### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = LZTR1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "LZTR1" "leucine-zipper-like transcription regulator 1" "22" "q11.21" "unknown" "NC_000022.10" "UD_132438659314" "" "https://www.LOVD.nl/LZTR1" "" "1" "6742" "8216" "600574" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/LZTR1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-01-20 11:01:26" "00000" "2026-03-24 15:25:07" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00011623" "LZTR1" "leucine-zipper-like transcription regulator 1" "001" "NM_006767.3" "" "NP_006758.2" "" "" "" "-103" "4212" "2523" "21336558" "21353326" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00383" "NS" "Noonan syndrome (NS)" "" "" "" "autosomal dominant" "" "00008" "2014-05-14 14:26:30" "00006" "2021-12-10 21:51:32" "00436" "SWNTS1" "Schwannomatosis, type 1 (SWNTS-1)" "" "162091" "" "" "" "00006" "2014-06-28 22:11:59" "00006" "2021-12-10 21:51:32" "00437" "SWNTS2" "Schwannomatosis, type 2 (SWNTS2)" "AD" "615670" "" "" "" "00006" "2014-06-28 22:13:09" "00006" "2020-10-16 09:48:45" "01159" "NF2" "neurofibromatosis, type 2 (NF-2)" "" "101000" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03028" "LGSS" "Legius syndrome (LGSS)" "AD" "611431" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05389" "SWNTS" "Schwannomatosis (SWNTS)" "" "" "" "" "" "00006" "2018-02-01 14:09:26" "" "" "05509" "-" "cafe-au-lait spots, multiple" "" "114030" "" "" "" "00008" "2018-11-10 16:28:16" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05854" "NS2" "Noonan syndrome, type 2 (NS2)" "AR" "605275" "" "" "" "00006" "2020-10-16 09:46:56" "00006" "2021-12-10 21:51:32" "05855" "NS10" "Noonan syndrome, type 10 (NS10)" "AD" "616564" "" "" "" "00006" "2020-10-16 09:47:45" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "LZTR1" "00383" "LZTR1" "00437" "LZTR1" "05389" "LZTR1" "05854" "LZTR1" "05855" ## Individuals ## Do not remove or alter this header ## ## Count = 182 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00017623" "" "" "" "2" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "2-generation family, 1 affected, unaffected carrier fatehr" "F" "no" "Italy" "" "0" "" "" "white" "" "00017624" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017625" "" "" "" "2" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "2-generation family, affected father/son" "M" "no" "Italy" "" "0" "" "" "white" "" "00017628" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017629" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017630" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017631" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017632" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017633" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017634" "" "" "" "2" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "2-generation family, 2 affected brothers (1 not carrier) and unaffected carrier father" "M" "no" "Italy" "" "0" "" "" "white" "" "00017635" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017636" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017637" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017638" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017639" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017640" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017641" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017642" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017643" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "M" "no" "Italy" "" "0" "" "" "white" "" "00017644" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "Italy" "" "0" "" "" "white" "" "00017645" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "no" "" "" "0" "" "" "" "" "00017646" "" "" "" "1" "" "00732" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "F" "" "" "" "0" "" "" "" "" "00050438" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected father/child" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050514" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050542" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050613" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00095759" "" "" "" "1" "" "00697" "{PMID:Ahronowitz 2007:16983642}" "CpG dinucleotide ; Mosaic" "" "" "" "" "0" "" "" "" "" "00095825" "" "" "" "1" "" "00697" "" "" "" "" "France" "" "0" "" "" "" "NF2 00522" "00095831" "" "" "" "1" "" "00697" "{PMID:Ahronowitz 2007:16983642}" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095836" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI00065" "00095837" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00218" "00095838" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00515" "00095839" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00150" "00095840" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00004" "00095841" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00106" "00095842" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI 00046" "00095843" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00157" "00095844" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00119" "00095845" "" "" "" "1" "" "00697" "" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095846" "" "" "" "1" "" "00697" "" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095847" "" "" "" "1" "" "00697" "" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095848" "" "" "" "1" "" "00697" "" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095849" "" "" "" "1" "" "00697" "" "CpG dinucleotide" "" "" "" "" "0" "" "" "" "" "00095850" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00117" "00095851" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00027" "00095852" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00030" "00095853" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00072" "00095854" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00188" "00095855" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00118" "00095856" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI 00067" "00095857" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00104" "00095858" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00040" "00095859" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00008" "00095860" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00330" "00095861" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00010" "00095862" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00357" "00095863" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00248" "00095864" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00032" "00095865" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00078" "00095866" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI 00017" "00095867" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "NF2 00364" "00095868" "" "" "" "1" "" "00697" "{PMID:Louvrier 2018:29409008}" "" "" "" "France" "" "0" "" "" "" "INI1 00105" "00206926" "" "" "" "1" "" "02255" "" "Schwannomatosis\r\nOMIM#162091" "F" "" "" "01y" "0" "" "" "" "" "00206927" "" "" "" "1" "" "02255" "" "" "F" "" "Italy" "12y" "0" "" "" "" "" "00206928" "" "" "" "1" "" "02255" "" "" "M" "" "" "06y" "0" "" "" "" "" "00206929" "" "" "" "1" "" "02255" "" "" "F" "" "Italy" "48y" "0" "" "" "" "" "00208788" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00231387" "" "" "" "1" "" "02551" "" "" "F" "" "" "" "0" "" "" "" "" "00269345" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295648" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295979" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00299689" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00314739" "" "" "" "1" "" "03821" "" "" "" "" "" "" "0" "" "" "" "" "00314740" "" "" "" "1" "" "03821" "" "" "" "" "" "" "0" "" "" "" "" "00314741" "" "" "" "1" "" "03821" "" "" "" "" "" "" "" "" "" "" "" "00324655" "" "" "" "1" "" "01602" "{PMID:Neubauer 2021:33895855}" "" "F" "" "Switzerland" "38y" "" "" "" "Europe" "SUDS028" "00324658" "" "" "" "1" "" "01602" "{PMID:Neubauer 2021:33895855}" "" "M" "" "Switzerland" "38y" "" "" "" "Europe" "SUDS075" "00335724" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00359458" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00373648" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00382166" "" "" "" "1" "" "01164" "" "" "M" "?" "Germany" "" "0" "" "" "" "182998" "00383050" "" "" "" "1" "" "04161" "" "" "" "" "Cyprus" "" "" "" "" "" "" "00385424" "" "" "" "1" "" "00006" "{PMID:Motta 2021:34626534}" "4-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "M" "yes" "Turkey" "" "0" "" "" "" "Fam2PatII1" "00414238" "" "" "" "1" "" "01164" "" "" "M" "?" "Germany" "" "0" "" "" "" "200506" "00428256" "" "" "" "1" "" "01164" "" "" "F" "yes" "" "" "0" "" "" "" "211995" "00435599" "" "" "" "1" "" "00006" "{PMID:Niggl 2023:37541189}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat5" "00443842" "" "" "" "1" "" "00006" "{PMID:Imafidon 2021:34136434}" "prenatal indication abnormal ultrasound" "M" "" "Netherlands" "" "0" "" "" "" "Pat655" "00444048" "" "" "" "1" "" "00006" "{PMID:Sarker 2023:38057384}" "family history" "M" "" "Bangladesh" "" "0" "" "" "" "PID_16" "00448270" "" "" "" "1" "" "00774" "" "" "M" "" "Italy" "" "" "" "" "" "" "00448271" "" "" "" "1" "" "00774" "" "" "F" "" "Italy" "" "" "" "" "" "" "00448272" "" "" "" "1" "" "00774" "" "" "F" "" "Italy" "" "" "" "" "" "" "00448273" "" "" "" "1" "" "00774" "" "" "F" "" "Italy" "" "" "" "" "" "" "00448274" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448275" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448276" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448277" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448278" "" "" "" "1" "" "00774" "" "" "" "" "" "" "" "" "" "" "" "00448279" "" "" "" "1" "" "00774" "" "" "" "" "" "" "" "" "" "" "" "00448280" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448282" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448285" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448286" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448287" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448288" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448290" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448291" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448292" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448293" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448294" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448295" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448296" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448297" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448298" "" "" "" "1" "" "00774" "" "" "" "" "" "" "" "" "" "" "" "00448299" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448300" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448301" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448302" "" "" "" "1" "" "00774" "" "" "" "" "" "" "" "" "" "" "" "00448303" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448304" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448306" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448308" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448310" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448315" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448317" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448318" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448321" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448322" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448323" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448324" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448325" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448326" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448327" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448328" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448329" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448330" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448331" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448332" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448333" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448334" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448335" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448336" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448337" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448338" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448339" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448340" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448341" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448342" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448343" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448344" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448345" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448346" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448347" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448348" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448349" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448350" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448351" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448352" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448353" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00448354" "" "" "" "1" "" "00774" "" "" "F" "" "" "" "" "" "" "" "" "00448361" "" "" "" "1" "" "00774" "" "" "M" "" "" "" "" "" "" "" "" "00460928" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00461057" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00461062" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00471386" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00471414" "" "" "" "3" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, 3 affected (father/daughter/son)" "M" "" "" "" "0" "" "" "" "NGS2" "00471415" "" "" "00471414" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "daughter" "M" "" "" "" "0" "" "" "" "NGS2C1" "00471416" "" "" "" "1" "" "00006" "{PMID:Smith 2015:25480913}" "patient" "" "" "" "" "0" "" "" "" "UVS+2" "00471417" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, 1 affected, unaffected carrier father" "F" "" "" "" "0" "" "" "" "S3" "00471503" "" "" "" "2" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, affected son/father" "M" "" "" "" "0" "" "" "" "NGS3" "00471504" "" "" "" "2" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, affected son/mother" "M" "" "" "" "0" "" "" "" "NGS5" "00471505" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, affected daughter, unaffected carrier father" "F" "" "" "" "0" "" "" "" "NGS7" "00471506" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, 1 affected, unaffected non-carrier mother" "F" "" "" "" "0" "" "" "" "S1" "00471507" "" "" "" "3" "" "00006" "{PMID:Piotrowski 2014:24362817}" "3-generation family, 3 affected, daughter/brother/father, unaffected carrier paternal grandfather" "F" "" "" "" "0" "" "" "" "S6" "00471508" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, affected daughter, unaffected carrier father" "F" "" "" "" "0" "" "" "" "S7" "00471509" "" "" "" "2" "" "00006" "{PMID:Piotrowski 2014:24362817}" "2-generation family, affected daughter/father" "M" "" "" "" "0" "" "" "" "S9C1" "00471510" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "M" "" "" "" "0" "" "" "" "S2" "00471511" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "F" "" "" "" "0" "" "" "" "S5" "00471512" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "F" "" "" "" "0" "" "" "" "NGS8" "00471513" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "F" "" "" "" "0" "" "" "" "NGS6" "00471514" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "M" "" "" "" "0" "" "" "" "S8" "00471515" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "F" "" "" "" "0" "" "" "" "S4" "00471516" "" "" "" "1" "" "00006" "{PMID:Piotrowski 2014:24362817}" "patient" "F" "" "" "" "0" "" "" "" "NGS1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 180 "{{individualid}}" "{{diseaseid}}" "00017623" "00436" "00017624" "00436" "00017625" "00436" "00017628" "00436" "00017629" "00436" "00017630" "00436" "00017631" "00436" "00017632" "00436" "00017633" "00436" "00017634" "00436" "00017635" "00436" "00017636" "00436" "00017637" "00436" "00017638" "00436" "00017639" "00436" "00017640" "00436" "00017641" "00436" "00017642" "00436" "00017643" "00436" "00017644" "00436" "00017645" "00436" "00017646" "00436" "00050438" "00198" "00050514" "00198" "00050542" "00198" "00050613" "00198" "00095759" "01159" "00095825" "01159" "00095831" "01159" "00095836" "05389" "00095837" "05389" "00095838" "05389" "00095839" "05389" "00095840" "05389" "00095841" "05389" "00095842" "05389" "00095843" "05389" "00095844" "05389" "00095845" "00436" "00095846" "00436" "00095847" "00436" "00095848" "00436" "00095849" "00436" "00095850" "05389" "00095851" "05389" "00095852" "05389" "00095853" "05389" "00095854" "05389" "00095855" "05389" "00095856" "05389" "00095857" "05389" "00095858" "05389" "00095859" "05389" "00095860" "05389" "00095861" "05389" "00095862" "05389" "00095863" "05389" "00095864" "05389" "00095865" "05389" "00095866" "05389" "00095867" "05389" "00095868" "05389" "00206926" "03028" "00206927" "05389" "00206928" "05389" "00206929" "05389" "00269345" "00198" "00295648" "00198" "00295979" "00198" "00299689" "00198" "00314739" "00383" "00314740" "00383" "00314741" "00383" "00324655" "05166" "00324658" "05166" "00335724" "00198" "00359458" "00198" "00373648" "00198" "00382166" "00437" "00383050" "00198" "00385424" "00383" "00414238" "00437" "00428256" "05854" "00435599" "05611" "00443842" "00198" "00444048" "05324" "00448270" "05509" "00448271" "05509" "00448272" "05509" "00448273" "05509" "00448274" "05509" "00448275" "05509" "00448276" "05509" "00448277" "05509" "00448278" "05509" "00448279" "05509" "00448280" "05509" "00448282" "05509" "00448285" "05509" "00448286" "05509" "00448287" "05509" "00448288" "05509" "00448290" "05509" "00448291" "05509" "00448292" "05509" "00448293" "05509" "00448294" "05509" "00448295" "05509" "00448296" "05509" "00448297" "05509" "00448298" "05509" "00448299" "05509" "00448300" "05509" "00448301" "05509" "00448302" "05509" "00448303" "05509" "00448304" "05509" "00448306" "05509" "00448308" "05509" "00448310" "05509" "00448315" "05509" "00448317" "05509" "00448318" "05509" "00448321" "05509" "00448322" "05509" "00448323" "05509" "00448324" "05509" "00448325" "05509" "00448326" "05509" "00448327" "05509" "00448328" "05509" "00448329" "05509" "00448330" "05509" "00448331" "05509" "00448332" "05509" "00448333" "05509" "00448334" "05509" "00448335" "05509" "00448336" "05509" "00448337" "05509" "00448338" "05509" "00448339" "05509" "00448340" "05509" "00448341" "05509" "00448342" "05509" "00448343" "05509" "00448344" "05509" "00448345" "05509" "00448346" "05509" "00448347" "05509" "00448348" "05509" "00448349" "05509" "00448350" "05509" "00448351" "05509" "00448352" "05509" "00448353" "05509" "00448354" "05509" "00448361" "05509" "00460928" "00198" "00461057" "00198" "00461062" "00198" "00471386" "00198" "00471414" "05389" "00471415" "05389" "00471416" "05389" "00471417" "05389" "00471503" "05389" "00471504" "05389" "00471505" "05389" "00471506" "05389" "00471507" "05389" "00471508" "05389" "00471509" "05389" "00471510" "05389" "00471511" "05389" "00471512" "05389" "00471513" "05389" "00471514" "05389" "00471515" "05389" "00471516" "05389" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00383, 00436, 00437, 01159, 03028, 05166, 05324, 05389, 05509, 05611, 05854, 05855 ## Count = 145 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000016122" "00436" "00017623" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016123" "00436" "00017624" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016124" "00436" "00017625" "00732" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016125" "00436" "00017628" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016126" "00436" "00017629" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016127" "00436" "00017630" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016128" "00436" "00017631" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016129" "00436" "00017632" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016130" "00436" "00017633" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016131" "00436" "00017634" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016147" "00436" "00017635" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016148" "00436" "00017636" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016149" "00436" "00017637" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016150" "00436" "00017638" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016151" "00436" "00017639" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016152" "00436" "00017640" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016153" "00436" "00017641" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016154" "00436" "00017642" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016155" "00436" "00017643" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016156" "00436" "00017644" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016157" "00436" "00017645" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016158" "00436" "00017646" "00732" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037050" "00198" "00050438" "00006" "Unknown" "" "sparse scalp hair, fragile nails, abnormality of limb bone morphology, alopecia of scalp, high palate, global developmental delay, global developmental delay, abnormality of the heart" "" "" "" "" "" "" "" "" "" "" "" "0000037126" "00198" "00050514" "00006" "Isolated (sporadic)" "" "agenesis of corpus callosum, periventricular gray matter heterotopia, seizures, frontal bossing, eczema" "" "" "" "" "" "" "" "" "" "" "" "0000037154" "00198" "00050542" "00006" "Isolated (sporadic)" "" "abnormality of the nervous system, dysphagia, abnormality of the palpebral fissures, inverted nipples, redundant skin, global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "0000037225" "00198" "00050613" "00006" "Isolated (sporadic)" "" "specific learning disability, congenital hypothyroidism, abnormality of metabolism/homeostasis, rhabdomyolysis, cardiomyopathy" "" "" "" "" "" "" "" "" "" "" "" "0000074164" "00436" "00095840" "00697" "Familial, autosomal dominant" "" "Unilateral vestibular schwannoma" "" "" "" "" "" "" "" "" "" "" "" "0000074165" "00436" "00095863" "00697" "Familial, autosomal dominant" "" "Unilateral vestibular schwannoma" "" "" "" "" "" "" "" "" "" "" "" "0000154719" "03028" "00206926" "02255" "-" "01y" "" "" "" "" "" "" "" "" "" "" "NF1" "" "0000154802" "05389" "00206927" "02255" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000154803" "05389" "00206928" "02255" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000154804" "05389" "00206929" "02255" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000157402" "00198" "00208788" "01164" "Unknown" "" "HP:0000256 (Macrocephaly); HP:0011342 (Mild global developmental delay); HP:0002121 (Absence seizures); HP:0002197 (Generalized seizures)" "" "" "" "" "" "" "" "" "" "" "" "0000173789" "00198" "00231387" "02551" "Unknown" "" "HP:0001067 (Neurofibromas)" "" "" "" "" "" "" "" "" "" "" "" "0000207177" "00198" "00269345" "01164" "Unknown" "" "Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "0000223212" "00198" "00295648" "01164" "Unknown" "" "Schwannoma (HP:0100008)" "" "" "" "" "" "" "" "" "" "" "" "0000223446" "00198" "00295979" "01164" "Unknown" "" "Multiple cafe-au-lait spots (HP:0007565)" "" "" "" "" "" "" "" "" "" "" "" "0000226994" "00198" "00299689" "01164" "Unknown" "" "Schwannoma (HP:0100008)" "" "" "" "" "" "" "" "" "" "" "" "0000253643" "00198" "00335724" "01807" "Unknown" "" "Muscular hypotonia (HP:0001252); Global developmental delay (HP:0001263); Hypertrophic cardiomyopathy (HP:0001639)" "" "" "" "" "" "" "" "" "" "" "" "0000254700" "00198" "00359458" "01807" "Unknown" "" "Microcephaly (HP:0000252); Autism (HP:0000717); Global developmental delay (HP:0001263); Dystonia (HP:0001332); Failure to thrive (HP:0001508); Ventricular septal defect (HP:0001629); Cardiomyopathy (HP:0001638); Hypertrophic cardiomyopathy (HP:0001639); Short stature (HP:0004322); Supravalvular aortic stenosis (HP:0004381); Attention deficit hyperactivity disorder (HP:0007018); Neurodevelopmental delay (HP:0012758)" "" "" "" "" "" "" "" "" "" "" "" "0000268922" "00198" "00373648" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Hypertrophic cardiomyopathy (HP:0001639); Short stature (HP:0004322); Ventricular tachycardia (HP:0004756)" "" "" "" "" "" "" "" "" "" "" "" "0000276001" "00437" "00382166" "01164" "Isolated (sporadic)" "" "Schwannoma" "" "" "" "" "" "" "" "" "" "" "" "0000279220" "00383" "00385424" "00006" "Familial, autosomal recessive" "08y" "height 122.2 cm (SD-1.00), weight 22 kg (SD-1.09), OFC 51 cm (SD+0.86); mild developmental delay; mild intellectual disability; language delay; learning disorder; hypotonia during infancy; congenital heart defect, pulmonary valve stenosis, pulmonary balloon valvuloplasty; small secundum ASD; hypertrophic cardiomyopathy, (asymmetrical hypertrophy interventricular septum; pectus carinatum superiorly and pectus excavatum inferiorly, wide and short shield chest; hyperlaxity; limited extension of elbows, cubitus valgus, winged shoulder blades, kyphosis, mild pes valgus and pes planus; bitemporal narrowing; hypertelorism; low-set and/or posteriorly rotated ears; prominent nasal bridge; low posterior hairline; short/webbed neck; triangular coarse face, sparse eyebrows, sparse eyelashes, downward slanted palpebral fissures, epicanthus, nasolacrimal duct stenosis, prominent nasolabial sulci, pointed receding chin; no café-au-lait spots; no freckling; sparse and curly hair, sparse and thin eyebrows and eyelashes, scaly and dry skin, eczematous skin, loose and thick skin, deep palmar creases; bilateral cryptorchidism; no lymphatic involvement; partial FXII deficiency (0.248 activity); no hematological abnormalities; atopic skin features, nasolacrimal duct stenosis, exotropia, bone pain and myalgia; trans-fontanelle USG left lateral ventriculomegaly; renal USG bilateral grade 2 medullary nephrocalcinosis" "" "" "" "" "" "" "" "" "NS14" "Noonan syndrome-like" "" "0000306093" "00437" "00414238" "01164" "Familial, autosomal dominant" "" "Peripheral Schwannoma, Cafe-au-lait spot" "" "" "" "" "" "" "" "" "Schwannomatosis" "Schwannomatosis" "" "0000319161" "05854" "00428256" "01164" "Unknown" "01y" "Hypertrophic cardiomyopathy, Feeding difficulties in infancy, Cardiomyopathy, sister died at 10 month of cardiomyopathy" "" "" "" "" "" "" "" "" "" "" "" "0000322113" "05166" "00324658" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "0000322116" "05166" "00324655" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "0000325784" "05611" "00435599" "00006" "Isolated (sporadic)" "9y-11y" "see paper; ..., normal pregnancy, birth 40w; 10m-first words; 1y3m-walk; only words, poor articulation, mixed receptive-expressive language disorder, dysarthria; mild intellectual disability; delayed gross motor skills; delayed fine motor skills; no seizures; hypotonia; no movement disorder; MRI normal; ADHD combined type, anxiety; difficulty falling asleep; long facial profile, deep-set eyes prominent nose, depressed nasal bridge, bilateral 5th finger clinodactyly, thin upper lip; myopia strabismus; normal hearing; no feeding problems; no recurrent infections" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000333119" "00198" "00443842" "00006" "Isolated (sporadic)" "" "cardiac malformation, dysmorphic features" "" "" "" "" "" "" "" "" "" "monogenic disease, syndromal disorder" "" "0000333305" "05324" "00444048" "00006" "Familial, X-linked recessive" "" "calf hypertrophy; no Gower sign positive; elevated CPK level (18160 U/L); feeding difficulties; no toe walking; no poor walking/running ability; no difficulty climbing stairs; waddling feet/gait; no seizure; no muscle weakness; no skinny legs/arms; delayed developmental milestones; intellectual disability; delayed speech; hyperactive" "" "" "" "" "" "" "" "" "DMD" "DMD" "" "0000337475" "05509" "00448271" "00774" "Familial" "00y04m" "" "" "00y04m" "" "" "" "" "" "" "" "" "" "0000337476" "05509" "00448270" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337477" "05509" "00448272" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337478" "05509" "00448273" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337479" "05509" "00448274" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337480" "05509" "00448275" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337481" "05509" "00448276" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337482" "05509" "00448277" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337483" "05509" "00448278" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337484" "05509" "00448279" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337485" "05509" "00448280" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337486" "05509" "00448282" "00774" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337487" "05509" "00448285" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337488" "05509" "00448286" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337489" "05509" "00448287" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337490" "05509" "00448288" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337491" "05509" "00448290" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337492" "05509" "00448291" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337493" "05509" "00448292" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337494" "05509" "00448293" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337495" "05509" "00448294" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337496" "05509" "00448295" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337497" "05509" "00448296" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337498" "05509" "00448298" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337499" "05509" "00448299" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337500" "05509" "00448301" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337501" "05509" "00448302" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337502" "05509" "00448303" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337503" "05509" "00448304" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337504" "05509" "00448306" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337505" "05509" "00448308" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337506" "05509" "00448310" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337507" "05509" "00448315" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337508" "05509" "00448317" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337509" "05509" "00448318" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337510" "05509" "00448318" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337511" "05509" "00448321" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337512" "05509" "00448322" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337513" "05509" "00448323" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337514" "05509" "00448324" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337515" "05509" "00448325" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337516" "05509" "00448326" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337517" "05509" "00448327" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337518" "05509" "00448328" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337519" "05509" "00448329" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337520" "05509" "00448330" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337521" "05509" "00448331" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337522" "05509" "00448332" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337523" "05509" "00448333" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337524" "05509" "00448334" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337525" "05509" "00448335" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337526" "05509" "00448336" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337527" "05509" "00448337" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337528" "05509" "00448338" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337529" "05509" "00448339" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337530" "05509" "00448340" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337531" "05509" "00448341" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337532" "05509" "00448341" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337533" "05509" "00448342" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337534" "05509" "00448343" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337535" "05509" "00448344" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337536" "05509" "00448345" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337537" "05509" "00448346" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337538" "05509" "00448347" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337539" "05509" "00448348" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337540" "05509" "00448349" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337541" "05509" "00448350" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337542" "05509" "00448351" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337543" "05509" "00448352" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337544" "05509" "00448353" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337545" "05509" "00448354" "00774" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337555" "05509" "00448361" "00774" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000356224" "00198" "00471386" "03544" "Isolated (sporadic)" "" "HP:0001256, HP:0001263, HP:0000729, HP:0003198, HP:0008962,\r\nHP:0006385, HP:0008110, HP:0000545, HP:0000271" "" "" "" "" "" "" "" "" "NS10;CSS2" "multiple congenital abnormalities" "" "0000356253" "05389" "00095836" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356254" "05389" "00095837" "00006" "Familial, autosomal dominant" "28y" "ambiguous schwannomatosis" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356255" "05389" "00095843" "00006" "Unknown" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356256" "05389" "00095844" "00006" "Unknown" "" "see paper; ..., schwannomatosis" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356257" "05389" "00471414" "00006" "Unknown" "59y" "see paper; ..., pinal schwannomas, schwannomas on forearm/abdomen" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356258" "05389" "00471415" "00006" "Familial, autosomal dominant" "42y" "see paper; ..., 28y-1 \"cyst\" removed from thigh (no histopathology)" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356259" "05389" "00471416" "00006" "Unknown" "48y" "see paper; ..., 32y-unilateral vestibular schwannoma, 48y-3 periveranl nerve schwannoma" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356260" "05389" "00471417" "00006" "Unknown" "42y" "see paper; ..., C5-C6 spinal schwannomas histologically confirmed, L parasternal schwannoma and L popliteal thigh schwannoma, posterior thigh schwannoma; 41y-no evidence of VS ; asymptomatic carrier father (67y)" "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356310" "05389" "00471503" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356311" "05389" "00471504" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356312" "05389" "00471505" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356313" "05389" "00471506" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356314" "05389" "00471507" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356315" "05389" "00471508" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356316" "05389" "00471509" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356317" "05389" "00471510" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356318" "05389" "00471511" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356319" "05389" "00471512" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356320" "05389" "00471513" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356321" "05389" "00471514" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356322" "05389" "00471515" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "SWNTS2" "schwannomatosis" "" "0000356323" "05389" "00471516" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "schwannomatosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 183 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000017606" "00017623" "1" "00732" "00732" "2014-06-26 11:52:43" "" "" "SEQ" "DNA" "Blood" "" "0000017607" "00017624" "1" "00732" "00732" "2014-06-26 12:16:31" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017608" "00017625" "1" "00732" "00732" "2014-06-26 12:30:55" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "" "0000017610" "00017628" "1" "00732" "00732" "2014-06-26 12:44:46" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017611" "00017629" "1" "00732" "00732" "2014-06-26 12:48:48" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017612" "00017630" "1" "00732" "00732" "2014-06-26 12:51:58" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017613" "00017631" "1" "00732" "00732" "2014-06-26 12:55:55" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017614" "00017632" "1" "00732" "00732" "2014-06-26 13:00:26" "" "" "MCA;SEQ" "DNA" "Bloodl" "" "0000017615" "00017633" "1" "00732" "00732" "2014-06-26 13:03:21" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017616" "00017634" "1" "00732" "00732" "2014-06-26 13:06:15" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "" "0000017617" "00017635" "1" "00732" "00732" "2014-06-26 13:10:28" "" "" "MCA;SEQ" "DNA" "Bloodl" "" "0000017618" "00017636" "1" "00732" "00732" "2014-06-26 13:17:31" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017619" "00017637" "1" "00732" "00732" "2014-06-26 13:19:37" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017620" "00017638" "1" "00732" "00732" "2014-06-26 13:21:36" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017621" "00017639" "1" "00732" "00732" "2014-06-26 13:23:39" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017622" "00017640" "1" "00732" "00732" "2014-06-26 13:27:38" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017623" "00017641" "1" "00732" "00732" "2014-06-26 13:31:07" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017624" "00017642" "1" "00732" "00732" "2014-06-26 13:32:51" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "" "0000017625" "00017643" "1" "00732" "00732" "2014-06-26 13:34:31" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017626" "00017644" "1" "00732" "00732" "2014-06-26 13:36:04" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000017627" "00017645" "1" "00732" "00732" "2014-06-26 13:38:36" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "" "0000017628" "00017646" "1" "00732" "00732" "2014-06-26 13:40:50" "" "" "MCA;SEQ" "DNA" "Blood" "" "0000050383" "00050438" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050459" "00050514" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050487" "00050542" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050558" "00050613" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000096159" "00095759" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA;RNA" "blood;tumour" "" "0000096225" "00095825" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ" "DNA;RNA" "blood;tumour" "" "0000096231" "00095831" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ" "DNA;RNA" "blood" "" "0000096236" "00095836" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096237" "00095837" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096238" "00095838" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096239" "00095839" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096240" "00095840" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096241" "00095841" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096242" "00095842" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096243" "00095843" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096244" "00095844" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096245" "00095845" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood;tumour" "" "0000096246" "00095846" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096247" "00095847" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096248" "00095848" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood;tumour" "" "0000096249" "00095849" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096250" "00095850" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096251" "00095851" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096252" "00095852" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096253" "00095853" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096254" "00095854" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096255" "00095855" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096256" "00095856" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096257" "00095857" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096258" "00095858" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096259" "00095859" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096260" "00095860" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096261" "00095861" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096262" "00095862" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096263" "00095863" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096264" "00095864" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096265" "00095865" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096266" "00095866" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096267" "00095867" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000096268" "00095868" "1" "00697" "00008" "2017-01-18 17:17:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000207961" "00206926" "1" "02255" "02255" "2018-11-17 11:46:06" "" "" "SEQ-NG-IT" "DNA" "Blood tissue" "" "0000207962" "00206927" "1" "02255" "02255" "2018-11-17 11:49:42" "" "" "SEQ-NG-IT" "DNA" "Blood tissue" "" "0000207963" "00206928" "1" "02255" "02255" "2018-11-17 11:52:48" "" "" "SEQ-NG-IT" "DNA" "Blood tissue" "" "0000207964" "00206929" "1" "02255" "02255" "2018-11-17 11:55:56" "" "" "SEQ-NG-IT" "DNA" "Blood tissue" "" "0000209837" "00208788" "1" "01164" "01164" "2018-12-17 10:13:26" "" "" "SEQ-NG" "DNA" "" "" "0000232485" "00231387" "1" "02551" "02551" "2019-04-30 20:12:12" "" "" "SEQ" "DNA" "" "" "0000270487" "00269345" "1" "01164" "01164" "2019-11-20 18:18:29" "" "" "SEQ-NG-S" "DNA" "" "" "0000296820" "00295648" "1" "01164" "01164" "2020-03-22 12:43:21" "" "" "SEQ-NG-S" "DNA" "" "" "0000297150" "00295979" "1" "01164" "01164" "2020-04-01 11:00:14" "" "" "SEQ-NG-S" "DNA" "" "" "0000300799" "00299689" "1" "01164" "01164" "2020-04-20 10:25:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000315912" "00314739" "1" "03821" "03821" "2020-10-16 00:51:35" "" "" "?" "DNA" "" "" "0000315913" "00314740" "1" "03821" "03821" "2020-10-16 01:01:17" "" "" "?" "DNA" "" "" "0000315914" "00314741" "1" "03821" "03821" "2020-10-16 01:30:00" "" "" "?" "DNA" "" "" "0000325863" "00324655" "1" "01602" "01602" "2020-12-21 14:16:18" "" "" "SEQ-NG-I" "DNA" "" "" "0000325866" "00324658" "1" "01602" "01602" "2020-12-21 14:24:07" "" "" "SEQ-NG-I" "DNA" "" "" "0000336953" "00335724" "1" "01807" "01807" "2021-03-08 13:23:01" "" "" "SEQ" "DNA" "" "" "0000360688" "00359458" "1" "01807" "01807" "2021-03-22 12:31:02" "" "" "SEQ" "DNA" "" "" "0000374881" "00373648" "1" "01807" "01807" "2021-05-17 15:48:38" "00001" "2021-05-17 15:50:45" "SEQ" "DNA" "" "" "0000383380" "00382166" "1" "01164" "01164" "2021-09-08 10:43:26" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000384274" "00383050" "1" "04161" "04161" "2021-09-20 13:20:35" "" "" "SEQ-NG" "DNA" "" "" "0000386653" "00385424" "1" "00006" "00006" "2021-10-11 08:59:10" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000415520" "00414238" "1" "01164" "01164" "2022-07-28 10:43:44" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000429667" "00428256" "1" "01164" "01164" "2022-12-27 16:29:34" "" "" "SEQ-NG-H" "DNA" "" "" "0000437080" "00435599" "1" "00006" "00006" "2023-08-05 19:25:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000445339" "00443842" "1" "00006" "00006" "2023-12-03 11:44:16" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000445545" "00444048" "1" "00006" "00006" "2023-12-11 17:21:28" "" "" "PCRm" "DNA" "" "" "0000449844" "00448271" "1" "00774" "00774" "2024-02-27 14:46:52" "" "" "SEQ-NG" "DNA" "" "" "0000449845" "00448270" "1" "00774" "00774" "2024-02-27 15:02:35" "" "" "SEQ-NG" "DNA" "" "" "0000449846" "00448272" "1" "00774" "00774" "2024-02-27 15:12:09" "" "" "SEQ-NG" "DNA" "" "" "0000449847" "00448273" "1" "00774" "00774" "2024-02-27 15:17:18" "" "" "SEQ-NG" "DNA" "" "" "0000449848" "00448274" "1" "00774" "00774" "2024-02-27 15:19:29" "" "" "SEQ-NG" "DNA" "" "" "0000449849" "00448275" "1" "00774" "00774" "2024-02-27 15:46:05" "" "" "SEQ-NG" "DNA" "" "" "0000449850" "00448276" "1" "00774" "00774" "2024-02-27 15:53:33" "" "" "SEQ-NG" "DNA" "" "" "0000449851" "00448277" "1" "00774" "00774" "2024-02-27 15:58:06" "" "" "SEQ-NG" "DNA" "" "" "0000449852" "00448278" "1" "00774" "00774" "2024-02-27 16:04:29" "" "" "SEQ-NG" "DNA" "" "" "0000449853" "00448279" "1" "00774" "00774" "2024-02-27 16:07:07" "" "" "SEQ-NG" "DNA" "" "" "0000449855" "00448280" "1" "00774" "00774" "2024-02-27 16:11:53" "" "" "SEQ-NG" "DNA" "" "" "0000449857" "00448282" "1" "00774" "00774" "2024-02-27 16:16:18" "" "" "SEQ-NG" "DNA" "" "" "0000449860" "00448285" "1" "00774" "00774" "2024-02-27 16:19:05" "" "" "SEQ-NG" "DNA" "" "" "0000449861" "00448286" "1" "00774" "00774" "2024-02-27 16:21:23" "" "" "SEQ-NG" "DNA" "" "" "0000449862" "00448287" "1" "00774" "00774" "2024-02-27 16:24:09" "" "" "SEQ-NG" "DNA" "" "" "0000449863" "00448288" "1" "00774" "00774" "2024-02-27 16:26:09" "" "" "SEQ-NG" "DNA" "" "" "0000449865" "00448290" "1" "00774" "00774" "2024-02-27 16:28:55" "" "" "SEQ-NG" "DNA" "" "" "0000449866" "00448291" "1" "00774" "00774" "2024-02-27 16:31:37" "" "" "SEQ-NG" "DNA" "" "" "0000449867" "00448292" "1" "00774" "00774" "2024-02-27 16:34:05" "" "" "SEQ-NG" "DNA" "" "" "0000449868" "00448293" "1" "00774" "00774" "2024-02-27 16:51:21" "" "" "SEQ-NG" "DNA" "" "" "0000449869" "00448294" "1" "00774" "00774" "2024-02-27 16:56:18" "" "" "SEQ-NG" "DNA" "" "" "0000449870" "00448295" "1" "00774" "00774" "2024-02-27 16:58:36" "" "" "SEQ-NG" "DNA" "" "" "0000449871" "00448296" "1" "00774" "00774" "2024-02-27 17:01:14" "" "" "SEQ-NG" "DNA" "" "" "0000449872" "00448297" "1" "00774" "00774" "2024-02-27 17:04:36" "" "" "SEQ-NG" "DNA" "" "" "0000449873" "00448298" "1" "00774" "00774" "2024-02-27 17:07:41" "" "" "SEQ-NG" "DNA" "" "" "0000449874" "00448299" "1" "00774" "00774" "2024-02-27 17:10:08" "" "" "SEQ-NG" "DNA" "" "" "0000449875" "00448300" "1" "00774" "00774" "2024-02-27 17:13:00" "" "" "SEQ-NG" "DNA" "" "" "0000449876" "00448301" "1" "00774" "00774" "2024-02-27 17:17:06" "" "" "SEQ-NG" "DNA" "" "" "0000449877" "00448302" "1" "00774" "00774" "2024-02-27 17:23:19" "" "" "SEQ-NG" "DNA" "" "" "0000449878" "00448303" "1" "00774" "00774" "2024-02-27 17:25:16" "" "" "SEQ-NG" "DNA" "" "" "0000449879" "00448304" "1" "00774" "00774" "2024-02-27 17:28:29" "" "" "SEQ-NG" "DNA" "" "" "0000449881" "00448306" "1" "00774" "00774" "2024-02-27 17:31:00" "" "" "SEQ-NG" "DNA" "" "" "0000449883" "00448308" "1" "00774" "00774" "2024-02-27 17:35:17" "" "" "SEQ-NG" "DNA" "" "" "0000449886" "00448310" "1" "00774" "00774" "2024-02-27 17:39:05" "" "" "SEQ-NG" "DNA" "" "" "0000449890" "00448315" "1" "00774" "00774" "2024-02-27 17:46:22" "" "" "SEQ-NG" "DNA" "" "" "0000449892" "00448317" "1" "00774" "00774" "2024-02-27 17:48:07" "" "" "SEQ-NG" "DNA" "" "" "0000449894" "00448318" "1" "00774" "00774" "2024-02-27 17:50:55" "" "" "SEQ-NG" "DNA" "" "" "0000449896" "00448321" "1" "00774" "00774" "2024-02-27 18:07:51" "" "" "SEQ-NG" "DNA" "" "" "0000449897" "00448322" "1" "00774" "00774" "2024-02-27 18:10:06" "" "" "SEQ-NG" "DNA" "" "" "0000449898" "00448323" "1" "00774" "00774" "2024-02-27 18:12:56" "" "" "SEQ-NG" "DNA" "" "" "0000449899" "00448324" "1" "00774" "00774" "2024-02-27 18:16:04" "" "" "SEQ-NG" "DNA" "" "" "0000449900" "00448325" "1" "00774" "00774" "2024-02-27 18:18:13" "" "" "SEQ-NG" "DNA" "" "" "0000449901" "00448326" "1" "00774" "00774" "2024-02-27 18:20:30" "" "" "SEQ-NG" "DNA" "" "" "0000449902" "00448327" "1" "00774" "00774" "2024-02-27 18:23:11" "" "" "SEQ-NG" "DNA" "" "" "0000449903" "00448328" "1" "00774" "00774" "2024-02-27 18:25:26" "" "" "SEQ-NG" "DNA" "" "" "0000449904" "00448329" "1" "00774" "00774" "2024-02-27 18:27:33" "" "" "SEQ-NG" "DNA" "" "" "0000449905" "00448330" "1" "00774" "00774" "2024-02-27 18:29:48" "" "" "SEQ-NG" "DNA" "" "" "0000449906" "00448331" "1" "00774" "00774" "2024-02-27 18:32:01" "" "" "SEQ-NG" "DNA" "" "" "0000449907" "00448332" "1" "00774" "00774" "2024-02-27 18:33:44" "" "" "SEQ-NG" "DNA" "" "" "0000449908" "00448333" "1" "00774" "00774" "2024-02-27 18:35:36" "" "" "SEQ-NG" "DNA" "" "" "0000449909" "00448334" "1" "00774" "00774" "2024-02-27 18:37:08" "" "" "SEQ-NG" "DNA" "" "" "0000449910" "00448335" "1" "00774" "00774" "2024-02-27 18:38:53" "" "" "SEQ-NG" "DNA" "" "" "0000449911" "00448336" "1" "00774" "00774" "2024-02-27 18:41:01" "" "" "SEQ-NG" "DNA" "" "" "0000449912" "00448337" "1" "00774" "00774" "2024-02-27 18:43:05" "" "" "SEQ-NG" "DNA" "" "" "0000449913" "00448338" "1" "00774" "00774" "2024-02-27 18:44:55" "" "" "SEQ-NG" "DNA" "" "" "0000449914" "00448339" "1" "00774" "00774" "2024-02-27 18:46:58" "" "" "SEQ-NG" "DNA" "" "" "0000449915" "00448340" "1" "00774" "00774" "2024-02-27 18:49:11" "" "" "SEQ-NG" "DNA" "" "" "0000449916" "00448341" "1" "00774" "00774" "2024-02-27 18:51:27" "" "" "SEQ-NG" "DNA" "" "" "0000449917" "00448342" "1" "00774" "00774" "2024-02-27 18:53:14" "" "" "SEQ-NG" "DNA" "" "" "0000449918" "00448343" "1" "00774" "00774" "2024-02-27 18:55:18" "" "" "SEQ-NG" "DNA" "" "" "0000449919" "00448344" "1" "00774" "00774" "2024-02-27 18:58:30" "" "" "SEQ-NG" "DNA" "" "" "0000449920" "00448344" "1" "00774" "00774" "2024-02-27 19:00:42" "" "" "SEQ-NG" "DNA" "" "" "0000449921" "00448345" "1" "00774" "00774" "2024-02-27 19:10:07" "" "" "SEQ-NG" "DNA" "" "" "0000449922" "00448346" "1" "00774" "00774" "2024-02-27 19:11:46" "" "" "SEQ-NG" "DNA" "" "" "0000449923" "00448347" "1" "00774" "00774" "2024-02-27 19:13:30" "" "" "SEQ-NG" "DNA" "" "" "0000449924" "00448348" "1" "00774" "00774" "2024-02-27 19:15:42" "" "" "SEQ-NG" "DNA" "" "" "0000449925" "00448349" "1" "00774" "00774" "2024-02-27 19:17:50" "" "" "SEQ-NG" "DNA" "" "" "0000449926" "00448350" "1" "00774" "00774" "2024-02-27 19:20:13" "" "" "SEQ-NG" "DNA" "" "" "0000449927" "00448351" "1" "00774" "00774" "2024-02-27 19:27:53" "" "" "SEQ-NG" "DNA" "" "" "0000449928" "00448352" "1" "00774" "00774" "2024-02-27 19:30:19" "" "" "SEQ-NG" "DNA" "" "" "0000449929" "00448353" "1" "00774" "00774" "2024-02-27 19:34:08" "" "" "SEQ-NG" "DNA" "" "" "0000449930" "00448354" "1" "00774" "00774" "2024-02-27 19:39:45" "" "" "SEQ-NG" "DNA" "" "" "0000449939" "00448361" "1" "00774" "00774" "2024-03-01 09:01:24" "" "" "SEQ-NG" "DNA" "" "" "0000462560" "00460928" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblasts" "mRNA splicing analysis on tissue" "0000462689" "00461057" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" "0000462694" "00461062" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" "0000473056" "00471386" "1" "03544" "03544" "2025-12-21 09:54:09" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000473084" "00471414" "1" "00006" "00006" "2025-12-22 11:54:58" "" "" "RT-PCR;SEQ" "DNA" "" "" "0000473085" "00471415" "1" "00006" "00006" "2025-12-22 12:04:06" "" "" "RT-PCR;SEQ" "DNA" "" "" "0000473086" "00471416" "1" "00006" "00006" "2025-12-22 17:11:24" "" "" "SEQ" "DNA" "" "" "0000473087" "00471417" "1" "00006" "00006" "2025-12-22 17:15:00" "" "" "SEQ" "DNA" "" "" "0000473173" "00471503" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000473174" "00471504" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000473175" "00471505" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000473176" "00471506" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000473177" "00471507" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473178" "00471508" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000473179" "00471509" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473180" "00471510" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473181" "00471511" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473182" "00471512" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000473183" "00471513" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "" "0000473184" "00471514" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473185" "00471515" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "SEQ" "DNA" "" "" "0000473186" "00471516" "1" "00006" "00006" "2025-12-27 13:28:02" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 164 "{{screeningid}}" "{{geneid}}" "0000017606" "LZTR1" "0000017607" "LZTR1" "0000017608" "LZTR1" "0000017610" "LZTR1" "0000017611" "LZTR1" "0000017612" "LZTR1" "0000017614" "LZTR1" "0000017615" "LZTR1" "0000017616" "LZTR1" "0000017617" "LZTR1" "0000017618" "LZTR1" "0000017619" "LZTR1" "0000017620" "LZTR1" "0000017621" "LZTR1" "0000017622" "LZTR1" "0000017623" "LZTR1" "0000017624" "LZTR1" "0000017625" "LZTR1" "0000017626" "LZTR1" "0000017627" "LZTR1" "0000017628" "LZTR1" "0000096159" "LZTR1" "0000096225" "LZTR1" "0000096231" "LZTR1" "0000096236" "LZTR1" "0000096237" "LZTR1" "0000096238" "LZTR1" "0000096239" "LZTR1" "0000096240" "LZTR1" "0000096241" "LZTR1" "0000096242" "LZTR1" "0000096243" "LZTR1" "0000096244" "LZTR1" "0000096245" "LZTR1" "0000096246" "LZTR1" "0000096247" "LZTR1" "0000096248" "LZTR1" "0000096249" "LZTR1" "0000096250" "LZTR1" "0000096251" "LZTR1" "0000096252" "LZTR1" "0000096253" "LZTR1" "0000096254" "LZTR1" "0000096255" "LZTR1" "0000096256" "LZTR1" "0000096257" "LZTR1" "0000096258" "LZTR1" "0000096259" "LZTR1" "0000096260" "LZTR1" "0000096261" "LZTR1" "0000096262" "LZTR1" "0000096263" "LZTR1" "0000096264" "LZTR1" "0000096265" "LZTR1" "0000096266" "LZTR1" "0000096267" "LZTR1" "0000096268" "LZTR1" "0000207961" "LZTR1" "0000207961" "NF1" "0000207961" "NF2" "0000207961" "SMARCB1" "0000207961" "SPRED1" "0000207962" "LZTR1" "0000207962" "NF1" "0000207962" "NF2" "0000207962" "SMARCB1" "0000207962" "SPRED1" "0000207963" "LZTR1" "0000207963" "NF1" "0000207963" "NF2" "0000207963" "SMARCB1" "0000207963" "SPRED1" "0000207964" "LZTR1" "0000207964" "NF1" "0000207964" "NF2" "0000207964" "SMARCB1" "0000207964" "SPRED1" "0000315912" "LZTR1" "0000315913" "LZTR1" "0000315914" "LZTR1" "0000383380" "LZTR1" "0000386653" "SPRED2" "0000415520" "LZTR1" "0000429667" "LZTR1" "0000445545" "DMD" "0000449844" "LZTR1" "0000449845" "LZTR1" "0000449846" "LZTR1" "0000449847" "LZTR1" "0000449848" "LZTR1" "0000449849" "LZTR1" "0000449850" "LZTR1" "0000449851" "LZTR1" "0000449852" "LZTR1" "0000449853" "LZTR1" "0000449855" "LZTR1" "0000449857" "LZTR1" "0000449860" "LZTR1" "0000449861" "LZTR1" "0000449862" "LZTR1" "0000449863" "LZTR1" "0000449865" "LZTR1" "0000449866" "LZTR1" "0000449867" "LZTR1" "0000449868" "LZTR1" "0000449869" "LZTR1" "0000449870" "LZTR1" "0000449871" "LZTR1" "0000449872" "LZTR1" "0000449873" "LZTR1" "0000449874" "LZTR1" "0000449875" "LZTR1" "0000449876" "LZTR1" "0000449877" "LZTR1" "0000449878" "LZTR1" "0000449879" "LZTR1" "0000449881" "LZTR1" "0000449883" "LZTR1" "0000449886" "LZTR1" "0000449890" "LZTR1" "0000449892" "LZTR1" "0000449894" "LZTR1" "0000449896" "LZTR1" "0000449898" "LZTR1" "0000449899" "LZTR1" "0000449900" "LZTR1" "0000449901" "LZTR1" "0000449902" "LZTR1" "0000449903" "LZTR1" "0000449904" "LZTR1" "0000449905" "LZTR1" "0000449906" "LZTR1" "0000449907" "LZTR1" "0000449908" "LZTR1" "0000449909" "LZTR1" "0000449910" "LZTR1" "0000449911" "LZTR1" "0000449912" "LZTR1" "0000449913" "LZTR1" "0000449914" "LZTR1" "0000449915" "LZTR1" "0000449916" "LZTR1" "0000449917" "LZTR1" "0000449918" "LZTR1" "0000449919" "LZTR1" "0000449920" "LZTR1" "0000449921" "LZTR1" "0000449922" "LZTR1" "0000449923" "LZTR1" "0000449924" "LZTR1" "0000449925" "LZTR1" "0000449926" "LZTR1" "0000449927" "LZTR1" "0000449928" "LZTR1" "0000449929" "LZTR1" "0000449930" "LZTR1" "0000449939" "LZTR1" "0000462560" "LZTR1" "0000462689" "LZTR1" "0000462694" "LZTR1" "0000473084" "LZTR1" "0000473085" "LZTR1" "0000473086" "LZTR1" "0000473087" "LZTR1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 467 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000037617" "11" "90" "22" "21349180" "21349180" "del" "0" "00732" "LZTR1_000001" "g.21349180del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "?" "" "0" "" "" "g.20994891del" "" "pathogenic" "" "0000037618" "0" "90" "22" "21349010" "21349010" "del" "0" "00732" "LZTR1_000002" "g.21349010del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "" "" "0" "" "" "g.20994721del" "" "pathogenic" "" "0000037619" "11" "90" "22" "21348232" "21348232" "dup" "0" "00732" "LZTR1_000003" "g.21348232dup" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "yes" "" "0" "" "" "g.20993943dup" "" "pathogenic" "" "0000037620" "0" "70" "22" "21348253" "21348253" "subst" "4.11984E-6" "00732" "LZTR1_000004" "g.21348253C>A" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "" "" "0" "" "" "g.20993964C>A" "" "likely pathogenic" "" "0000037621" "0" "70" "22" "21343128" "21343128" "subst" "0" "00732" "LZTR1_000005" "g.21343128T>G" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20988839T>G" "" "likely pathogenic" "" "0000037622" "0" "90" "22" "21351049" "21351049" "subst" "0" "00732" "LZTR1_000006" "g.21351049C>T" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20996760C>T" "" "pathogenic" "" "0000037623" "0" "90" "22" "21343123" "21343124" "dup" "0" "00732" "LZTR1_000007" "g.21343123_21343124dup" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20988834_20988835dup" "" "pathogenic" "" "0000037624" "0" "90" "22" "21343948" "21343948" "subst" "6.52353E-5" "00732" "LZTR1_000008" "g.21343948C>T" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20989659C>T" "" "pathogenic" "" "0000037625" "0" "90" "22" "21343081" "21343081" "del" "0" "00732" "LZTR1_000009" "g.21343081del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20988792del" "" "pathogenic" "" "0000037626" "11" "90" "22" "21348545" "21348545" "del" "0" "00732" "LZTR1_000010" "g.21348545del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "?" "" "0" "" "" "g.20994256del" "" "pathogenic" "" "0000037628" "0" "70" "22" "21341845" "21341847" "del" "0" "00732" "LZTR1_000011" "g.21341845_21341847del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "373_375delGTC" "" "Unknown" "?" "" "0" "" "" "g.20987556_20987558del" "" "likely pathogenic" "" "0000037629" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00732" "LZTR1_000012" "g.21346527C>T" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20992238C>T" "" "pathogenic" "" "0000037630" "0" "90" "22" "21351601" "21351601" "dup" "1.22089E-5" "00732" "LZTR1_000013" "g.21351601dup" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20997312dup" "" "pathogenic" "" "0000037631" "0" "70" "22" "21345975" "21345975" "subst" "0" "00732" "LZTR1_000014" "g.21345975C>T" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20991686C>T" "" "likely pathogenic" "" "0000037632" "0" "90" "22" "21348429" "21348429" "del" "0" "00732" "LZTR1_000015" "g.21348429del" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20994140del" "" "pathogenic" "" "0000037633" "11" "70" "22" "21351043" "21351043" "subst" "8.12592E-6" "00732" "LZTR1_000016" "g.21351043T>C" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "?" "" "0" "" "" "g.20996754T>C" "" "likely pathogenic" "" "0000037634" "21" "90" "22" "21337358" "21337358" "subst" "4.06065E-6" "00732" "LZTR1_000017" "g.21337358T>G" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "?" "" "0" "" "" "g.20983069T>G" "" "pathogenic" "" "0000037635" "11" "90" "22" "21341824" "21341824" "dup" "0" "00732" "LZTR1_000018" "g.21341824dup" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "?" "" "0" "" "" "g.20987535dup" "" "pathogenic" "" "0000037636" "0" "70" "22" "21347132" "21347132" "subst" "0" "00732" "LZTR1_000019" "g.21347132T>G" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20992843T>G" "" "likely pathogenic" "" "0000037637" "0" "70" "22" "21350271" "21350271" "subst" "2.43799E-5" "00732" "LZTR1_000020" "g.21350271C>T" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Unknown" "?" "" "0" "" "" "g.20995982C>T" "" "likely pathogenic" "" "0000037638" "0" "70" "22" "21344815" "21344815" "subst" "7.06074E-5" "00732" "LZTR1_000021" "g.21344815G>A" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "Germline" "yes" "" "0" "" "" "g.20990526G>A" "" "likely pathogenic" "" "0000037639" "0" "70" "22" "21337327" "21337327" "subst" "0" "00732" "LZTR1_000022" "g.21337327A>G" "" "{PMID:Paganini 2015:25335493}, {DOI:Paganini 2015:10.1038/ejhg.2014.220}" "" "" "" "De novo" "?" "" "0" "" "" "g.20983038A>G" "" "likely pathogenic" "" "0000079363" "0" "90" "22" "18889039" "21464119" "del" "0" "00006" "ARVCF_000002" "g.18889039_21464119del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000079439" "0" "90" "22" "18839287" "21830562" "dup" "0" "00006" "ARVCF_000005" "g.18839287_21830562dup" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "increased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000079467" "0" "90" "22" "19023163" "21464119" "del" "0" "00006" "ARVCF_000004" "g.19023163_21464119del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000079538" "0" "90" "22" "18893563" "21464119" "del" "0" "00006" "ARVCF_000003" "g.18893563_21464119del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000156614" "0" "90" "22" "21336829" "21336829" "subst" "0" "00697" "LZTR1_000055" "g.21336829C>T" "" "{PMID:Ahronowitz 2007:16983642}" "" "" "CpG dinucleotide ; Mosaic" "De novo" "" "" "0" "" "" "g.20982540C>T" "" "pathogenic" "" "0000156680" "0" "90" "22" "30051652" "30051652" "subst" "0" "00697" "NF2_000015" "g.30051652C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide ; Mosaic" "De novo" "" "" "0" "" "" "g.29655663C>T" "" "pathogenic" "" "0000156686" "0" "90" "22" "21336829" "21336829" "subst" "0" "00697" "LZTR1_000055" "g.21336829C>T" "" "{PMID:Ahronowitz 2007:16983642}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20982540C>T" "" "pathogenic" "" "0000156691" "0" "90" "22" "21340117" "21340117" "subst" "4.46933E-5" "00697" "LZTR1_000054" "g.21340117G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "creation of a new 3\'ss within intron 2, with insertion of 11 last nt of intron 2" "Unknown" "" "" "0" "" "" "g.20985828G>A" "" "pathogenic" "" "0000156692" "11" "90" "22" "21340117" "21340117" "subst" "4.46933E-5" "00697" "LZTR1_000054" "g.21340117G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "creation of a new 3\'ss within intron 2, with insertion of 11 last nt of intron 2" "Germline" "" "" "0" "" "" "g.20985828G>A" "" "pathogenic" "" "0000156693" "0" "50" "22" "21344641" "21344641" "subst" "5.70576E-5" "00697" "LZTR1_000027" "g.21344641G>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20990352G>T" "" "VUS" "" "0000156694" "0" "90" "22" "21346119" "21346119" "subst" "2.04963E-5" "00697" "LZTR1_000033" "g.21346119G>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20991830G>T" "" "pathogenic" "" "0000156695" "0" "90" "22" "21347195" "21347195" "subst" "0" "00697" "LZTR1_000039" "g.21347195T>C" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20992906T>C" "" "pathogenic" "" "0000156696" "0" "90" "22" "21351519" "21351519" "subst" "0" "00697" "LZTR1_000049" "g.21351519A>G" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20997230A>G" "" "pathogenic" "" "0000156697" "0" "90" "22" "0" "0" "" "" "00697" "LZTR1_000056" "g.(?_21336660)_(21351638_?)" "" "{PMID:Louvrier 2018:29409008}" "" "1-?_2523+?del" "" "Unknown" "" "" "0" "" "" "g.(?_20982371)_(20997349_?)del" "" "pathogenic" "" "0000156698" "0" "90" "22" "21336687" "21336687" "del" "0" "00697" "LZTR1_000058" "g.21336687del" "" "{PMID:Louvrier 2018:29409008}" "" "27delG" "G> tandem repeat" "Unknown" "" "" "0" "" "" "g.20982398del" "" "pathogenic" "" "0000156699" "0" "90" "22" "21336687" "21336687" "del" "0" "00697" "LZTR1_000058" "g.21336687del" "" "{PMID:Louvrier 2018:29409008}" "" "27delG" "G> tandem repeat" "Germline/De novo (untested)" "" "" "0" "" "" "g.20982398del" "" "pathogenic" "" "0000156700" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "00697" "LZTR1_000051" "g.21341825G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20987536G>A" "" "likely pathogenic" "" "0000156701" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "00697" "LZTR1_000051" "g.21341825G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20987536G>A" "" "likely pathogenic" "" "0000156702" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "00697" "LZTR1_000051" "g.21341825G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20987536G>A" "" "likely pathogenic" "" "0000156703" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "00697" "LZTR1_000051" "g.21341825G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20987536G>A" "" "likely pathogenic" "" "0000156704" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "00697" "LZTR1_000051" "g.21341825G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20987536G>A" "" "likely pathogenic" "" "0000156705" "0" "90" "22" "21342326" "21342326" "del" "0" "00697" "LZTR1_000023" "g.21342326del" "" "INI1 00117" "" "428delA" "" "Unknown" "" "" "0" "" "" "g.20988037del" "" "pathogenic" "" "0000156706" "0" "90" "22" "21344708" "21344715" "del" "0" "00697" "LZTR1_000028" "g.21344708_21344715del" "" "{PMID:Louvrier 2018:29409008}" "" "685_692delTGCAACTT" "" "Unknown" "" "" "0" "" "" "g.20990419_20990426del" "" "pathogenic" "" "0000156707" "0" "50" "22" "21344787" "21344787" "subst" "0" "00697" "LZTR1_000029" "g.21344787T>G" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20990498T>G" "" "VUS" "" "0000156708" "0" "50" "22" "21345967" "21345967" "subst" "0" "00697" "LZTR1_000030" "g.21345967C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20991678C>T" "" "VUS" "" "0000156709" "0" "90" "22" "21346016" "21346016" "subst" "0" "00697" "LZTR1_000031" "g.21346016T>G" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20991727T>G" "" "pathogenic" "" "0000156710" "0" "90" "22" "21346092" "21346105" "del" "0" "00697" "LZTR1_000032" "g.21346092_21346105del" "" "{PMID:Louvrier 2018:29409008}" "" "967_980delGTCGTCCAGCCCAG" "" "Unknown" "" "" "0" "" "" "g.20991803_20991816del" "" "pathogenic" "" "0000156711" "0" "90" "22" "21346524" "21346524" "subst" "4.06984E-6" "00697" "LZTR1_000035" "g.21346524G>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20992235G>T" "" "pathogenic" "" "0000156712" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "00697" "LZTR1_000037" "g.21346593C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20992304C>T" "" "pathogenic" "" "0000156713" "0" "90" "22" "21346635" "21346635" "subst" "4.08393E-6" "00697" "LZTR1_000038" "g.21346635C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20992346C>T" "" "pathogenic" "" "0000156714" "0" "90" "22" "21347989" "21347989" "subst" "0" "00697" "LZTR1_000040" "g.21347989C>G" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20993700C>G" "" "pathogenic" "" "0000156715" "0" "50" "22" "21348253" "21348253" "subst" "1.64794E-5" "00697" "LZTR1_000041" "g.21348253C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20993964C>T" "" "VUS" "" "0000156716" "0" "50" "22" "21348255" "21348255" "subst" "7.00246E-5" "00697" "LZTR1_000042" "g.21348255C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20993966C>T" "" "VUS" "" "0000156717" "0" "90" "22" "21348519" "21348519" "subst" "2.16056E-5" "00697" "LZTR1_000043" "g.21348519C>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20994230C>T" "" "pathogenic" "" "0000156718" "0" "50" "22" "21348928" "21348928" "subst" "0" "00697" "LZTR1_000044" "g.21348928G>T" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20994639G>T" "" "VUS" "" "0000156719" "0" "90" "22" "21350049" "21350049" "dup" "0" "00697" "LZTR1_000045" "g.21350049dup" "" "{PMID:Louvrier 2018:29409008}" "" "1957dupC" "" "Unknown" "" "" "0" "" "" "g.20995760dup" "" "pathogenic" "" "0000156720" "0" "50" "22" "21350056" "21350056" "subst" "4.06365E-6" "00697" "LZTR1_000046" "g.21350056T>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20995767T>A" "" "VUS" "" "0000156721" "0" "70" "22" "21350155" "21350155" "subst" "4.10065E-6" "00697" "LZTR1_000047" "g.21350155G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20995866G>A" "" "likely pathogenic" "" "0000156722" "0" "50" "22" "21351215" "21351215" "subst" "0" "00697" "LZTR1_000048" "g.21351215A>G" "" "{PMID:Louvrier 2018:29409008}" "" "" "" "Unknown" "" "" "0" "" "" "g.20996926A>G" "" "VUS" "" "0000156723" "0" "70" "22" "21351543" "21351543" "subst" "1.2234E-5" "00697" "LZTR1_000050" "g.21351543G>A" "" "{PMID:Louvrier 2018:29409008}" "" "" "CpG dinucleotide" "Unknown" "" "" "0" "" "" "g.20997254G>A" "" "likely pathogenic" "" "0000250331" "0" "30" "22" "21344808" "21344808" "subst" "4.1229E-6" "02329" "LZTR1_000101" "g.21344808A>G" "" "" "" "LZTR1(NM_006767.4):c.785A>G (p.D262G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20990519A>G" "" "likely benign" "" "0000253945" "0" "10" "22" "21349037" "21349037" "subst" "0.758863" "01943" "LZTR1_000098" "g.21349037A>G" "" "" "" "LZTR1(NM_006767.3):c.1785+21A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994748A>G" "" "benign" "" "0000283611" "0" "10" "22" "21347142" "21347142" "subst" "0.00671135" "02329" "LZTR1_000069" "g.21347142C>T" "" "" "" "LZTR1(NM_006767.3):c.1209C>T (p.F403=), LZTR1(NM_006767.4):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20992853C>T" "" "benign" "" "0000283612" "0" "30" "22" "21348473" "21348473" "subst" "0.00186642" "02329" "LZTR1_000073" "g.21348473C>T" "" "" "" "LZTR1(NM_006767.3):c.1530C>T (p.H510=), LZTR1(NM_006767.4):c.1530C>T (p.H510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994184C>T" "" "likely benign" "" "0000283613" "0" "30" "22" "21348506" "21348506" "subst" "0.000142814" "02329" "LZTR1_000075" "g.21348506C>T" "" "" "" "LZTR1(NM_006767.4):c.1563C>T (p.F521=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994217C>T" "" "likely benign" "" "0000283615" "0" "30" "22" "21350173" "21350173" "subst" "1.63873E-5" "02329" "LZTR1_000084" "g.21350173C>T" "" "" "" "LZTR1(NM_006767.4):c.2069+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20995884C>T" "" "likely benign" "" "0000283616" "0" "10" "22" "21350342" "21350342" "subst" "0.00492138" "02329" "LZTR1_000085" "g.21350342C>T" "" "" "" "LZTR1(NM_006767.4):c.2160C>T (p.F720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996053C>T" "" "benign" "" "0000283617" "0" "10" "22" "21341779" "21341790" "del" "0" "02329" "LZTR1_000062" "g.21341779_21341790del" "" "" "" "LZTR1(NM_006767.4):c.321-14_321-3delTGTGCCCACCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20987490_20987501del" "" "benign" "" "0000283618" "0" "30" "22" "21341882" "21341882" "subst" "1.6253E-5" "02329" "LZTR1_000063" "g.21341882C>T" "" "" "" "LZTR1(NM_006767.4):c.400+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20987593C>T" "" "likely benign" "" "0000291280" "0" "30" "22" "21347210" "21347210" "subst" "0" "01943" "LZTR1_000070" "g.21347210C>A" "" "" "" "LZTR1(NM_006767.3):c.1260+17C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20992921C>A" "" "likely benign" "" "0000291281" "0" "30" "22" "21348254" "21348254" "subst" "0.00100889" "01943" "LZTR1_000071" "g.21348254G>A" "" "" "" "LZTR1(NM_006767.3):c.1395G>A (p.A465=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20993965G>A" "" "likely benign" "" "0000291282" "0" "50" "22" "21348259" "21348285" "del" "0" "01943" "LZTR1_000072" "g.21348259_21348285del" "" "" "" "LZTR1(NM_006767.3):c.1400_1426delGCCGCTGGCTTCGCAGGAAGATCACGC (p.S467_Q476delinsK)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20993970_20993996del" "" "VUS" "" "0000291283" "0" "30" "22" "21348473" "21348473" "subst" "0.00186642" "01943" "LZTR1_000073" "g.21348473C>T" "" "" "" "LZTR1(NM_006767.3):c.1530C>T (p.H510=), LZTR1(NM_006767.4):c.1530C>T (p.H510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994184C>T" "" "likely benign" "" "0000291284" "0" "50" "22" "21348499" "21348499" "subst" "4.3416E-6" "01943" "LZTR1_000074" "g.21348499G>C" "" "" "" "LZTR1(NM_006767.3):c.1556G>C (p.R519P, p.(Arg519Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994210G>C" "" "VUS" "" "0000291285" "0" "90" "22" "21348560" "21348560" "subst" "0" "01943" "LZTR1_000077" "g.21348560T>G" "" "" "" "LZTR1(NM_006767.3):c.1615+2T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994271T>G" "" "pathogenic" "" "0000291286" "0" "30" "22" "21348854" "21348854" "subst" "1.23103E-5" "01943" "LZTR1_000079" "g.21348854G>A" "" "" "" "LZTR1(NM_006767.3):c.1623G>A (p.V541=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994565G>A" "" "likely benign" "" "0000291287" "0" "10" "22" "21348914" "21348914" "subst" "0.138205" "01943" "LZTR1_000080" "g.21348914C>T" "" "" "" "LZTR1(NM_006767.3):c.1683C>T (p.R561=), LZTR1(NM_006767.4):c.1683C>T (p.R561=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994625C>T" "" "benign" "" "0000291288" "0" "50" "22" "21348993" "21348993" "subst" "8.17695E-6" "01943" "LZTR1_000082" "g.21348993C>T" "" "" "" "LZTR1(NM_006767.3):c.1762C>T (p.R588W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994704C>T" "" "VUS" "" "0000291289" "0" "50" "22" "21349016" "21349016" "subst" "0" "01943" "LZTR1_000083" "g.21349016G>C" "" "" "" "LZTR1(NM_006767.3):c.1785G>C (p.K595N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994727G>C" "" "VUS" "" "0000291290" "0" "10" "22" "21337325" "21337325" "subst" "0.286655" "01943" "LZTR1_000060" "g.21337325G>A" "" "" "" "LZTR1(NM_006767.3):c.210G>A (p.K70=), LZTR1(NM_006767.4):c.210G>A (p.K70=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20983036G>A" "" "benign" "" "0000291291" "0" "10" "22" "21351018" "21351018" "subst" "0.015819" "01943" "LZTR1_000086" "g.21351018C>T" "" "" "" "LZTR1(NM_006767.3):c.2253C>T (p.F751=), LZTR1(NM_006767.4):c.2253C>T (p.F751=, p.(Phe751=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996729C>T" "" "benign" "" "0000291292" "0" "50" "22" "21351090" "21351090" "subst" "0" "01943" "LZTR1_000087" "g.21351090G>T" "" "" "" "LZTR1(NM_006767.3):c.2325G>T (p.Q775H), LZTR1(NM_006767.4):c.2325G>T (p.(Gln775His), p.Q775H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996801G>T" "" "VUS" "" "0000291293" "0" "50" "22" "21351542" "21351542" "subst" "4.0785E-5" "01943" "LZTR1_000088" "g.21351542C>T" "" "" "" "LZTR1(NM_006767.3):c.2428C>T (p.R810W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20997253C>T" "" "VUS" "" "0000291294" "0" "50" "22" "21340186" "21340186" "subst" "0" "01943" "LZTR1_000061" "g.21340186G>C" "" "" "" "LZTR1(NM_006767.3):c.320G>C (p.R107T, p.(Arg107Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20985897G>C" "" "VUS" "" "0000291295" "0" "50" "22" "21342407" "21342407" "subst" "2.44075E-5" "01943" "LZTR1_000064" "g.21342407G>A" "" "" "" "LZTR1(NM_006767.3):c.509G>A (p.R170Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20988118G>A" "" "VUS" "" "0000291296" "0" "30" "22" "21343111" "21343111" "subst" "0.000568662" "01943" "LZTR1_000065" "g.21343111G>A" "" "" "" "LZTR1(NM_006767.3):c.543G>A (p.T181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20988822G>A" "" "likely benign" "" "0000291297" "0" "10" "22" "21343995" "21343995" "subst" "0" "01943" "LZTR1_000066" "g.21343995C>T" "" "" "" "LZTR1(NM_006767.3):c.651+24C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20989706C>T" "" "benign" "" "0000291299" "0" "10" "22" "21346485" "21346485" "subst" "0.70502" "01943" "LZTR1_000068" "g.21346485T>C" "" "" "" "LZTR1(NM_006767.3):c.994-18T>C, LZTR1(NM_006767.4):c.994-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20992196T>C" "" "benign" "" "0000328910" "0" "50" "22" "21348522" "21348522" "subst" "3.45775E-5" "01804" "LZTR1_000076" "g.21348522T>C" "" "" "" "LZTR1(NM_006767.3):c.1579T>C (p.(Phe527Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994233T>C" "" "VUS" "" "0000328911" "0" "50" "22" "21348563" "21348563" "subst" "3.52609E-5" "01804" "LZTR1_000078" "g.21348563G>A" "" "" "" "LZTR1(NM_006767.3):c.1615+5G>A (p.?), LZTR1(NM_006767.4):c.1615+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994274G>A" "" "VUS" "" "0000337473" "0" "10" "22" "21346485" "21346485" "subst" "0.70502" "02327" "LZTR1_000068" "g.21346485T>C" "" "" "" "LZTR1(NM_006767.3):c.994-18T>C, LZTR1(NM_006767.4):c.994-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20992196T>C" "" "benign" "" "0000337474" "0" "30" "22" "21348562" "21348562" "subst" "0.000352252" "02327" "LZTR1_000096" "g.21348562C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994273C>T" "" "likely benign" "" "0000337475" "0" "10" "22" "21349037" "21349037" "subst" "0.758863" "02327" "LZTR1_000098" "g.21349037A>G" "" "" "" "LZTR1(NM_006767.3):c.1785+21A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994748A>G" "" "benign" "" "0000339634" "0" "10" "22" "21337325" "21337325" "subst" "0.286655" "02327" "LZTR1_000060" "g.21337325G>A" "" "" "" "LZTR1(NM_006767.3):c.210G>A (p.K70=), LZTR1(NM_006767.4):c.210G>A (p.K70=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20983036G>A" "" "benign" "" "0000340686" "0" "10" "22" "21348914" "21348914" "subst" "0.138205" "02327" "LZTR1_000080" "g.21348914C>T" "" "" "" "LZTR1(NM_006767.3):c.1683C>T (p.R561=), LZTR1(NM_006767.4):c.1683C>T (p.R561=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994625C>T" "" "benign" "" "0000340787" "0" "50" "22" "21347175" "21347175" "subst" "0" "02327" "LZTR1_000095" "g.21347175G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20992886G>T" "" "VUS" "" "0000340888" "0" "10" "22" "21351018" "21351018" "subst" "0.015819" "02327" "LZTR1_000086" "g.21351018C>T" "" "" "" "LZTR1(NM_006767.3):c.2253C>T (p.F751=), LZTR1(NM_006767.4):c.2253C>T (p.F751=, p.(Phe751=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996729C>T" "" "benign" "" "0000341044" "0" "30" "22" "21350369" "21350369" "subst" "0.00181275" "02327" "LZTR1_000099" "g.21350369C>T" "" "" "" "LZTR1(NM_006767.4):c.2187C>T (p.(Tyr729=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996080C>T" "" "likely benign" "" "0000341584" "0" "90" "22" "21337338" "21337338" "dup" "0" "02327" "LZTR1_000090" "g.21337338dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20983049dup" "" "pathogenic" "" "0000342233" "0" "90" "22" "21343948" "21343948" "subst" "6.52353E-5" "02327" "LZTR1_000008" "g.21343948C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20989659C>T" "" "pathogenic" "" "0000342528" "0" "90" "22" "21345973" "21345973" "subst" "0" "02327" "LZTR1_000093" "g.21345973G>A" "" "" "" "LZTR1(NM_006767.4):c.848G>A (p.R283Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20991684G>A" "" "pathogenic" "" "0000344141" "0" "30" "22" "21348954" "21348954" "subst" "0.000492908" "02327" "LZTR1_000097" "g.21348954G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20994665G>A" "" "likely benign" "" "0000344962" "0" "90" "22" "21351090" "21351090" "subst" "0" "02327" "LZTR1_000087" "g.21351090G>T" "" "" "" "LZTR1(NM_006767.3):c.2325G>T (p.Q775H), LZTR1(NM_006767.4):c.2325G>T (p.(Gln775His), p.Q775H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20996801G>T" "" "pathogenic" "" "0000345904" "0" "90" "22" "21344765" "21344765" "subst" "0" "02327" "LZTR1_000092" "g.21344765G>A" "" "" "" "LZTR1(NM_006767.4):c.742G>A (p.G248R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20990476G>A" "" "pathogenic" "" "0000349712" "0" "90" "22" "21342392" "21342392" "subst" "4.06656E-6" "02327" "LZTR1_000091" "g.21342392G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20988103G>A" "" "pathogenic" "" "0000350473" "0" "50" "22" "21346071" "21346071" "subst" "5.27684E-5" "02327" "LZTR1_000094" "g.21346071G>A" "" "" "" "LZTR1(NM_006767.4):c.946G>A (p.(Val316Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.20991782G>A" "" "VUS" "" "0000437682" "0" "90" "22" "21345969" "21345969" "subst" "0" "02255" "LZTR1_000102" "g.21345969C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20991680C>T" "" "pathogenic" "" "0000437683" "0" "90" "22" "21336814" "21336814" "del" "0" "02255" "LZTR1_000103" "g.21336814del" "" "" "" "154delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20982525del" "" "pathogenic" "" "0000437684" "0" "90" "22" "21348253" "21348253" "subst" "1.64794E-5" "02255" "LZTR1_000041" "g.21348253C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20993964C>T" "" "pathogenic" "" "0000437685" "0" "90" "22" "21336821" "21336821" "subst" "0" "02255" "LZTR1_000104" "g.21336821G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20982532G>A" "" "pathogenic" "" "0000440058" "0" "50" "22" "21336680" "21336680" "dup" "0" "01164" "LZTR1_000105" "g.21336680dup" "" "" "" "" "not regarded causative for phenotype in patient" "Germline" "" "" "0" "" "" "g.20982391dup" "" "VUS" "ACMG" "0000474894" "0" "70" "22" "21350390" "21350390" "del" "0" "02551" "LZTR1_000106" "g.21350390del" "" "" "" "2208delC" "" "Unknown" "" "" "0" "" "" "g.20996101del" "" "likely pathogenic" "" "0000571456" "0" "50" "22" "21336682" "21336682" "subst" "0.000159136" "01943" "AIFM3_000001" "g.21336682G>T" "" "" "" "LZTR1(NM_006767.3):c.22G>T (p.G8W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20982393G>T" "" "VUS" "" "0000571457" "0" "10" "22" "21337325" "21337325" "subst" "0.286655" "02330" "LZTR1_000060" "g.21337325G>A" "" "" "" "LZTR1(NM_006767.3):c.210G>A (p.K70=), LZTR1(NM_006767.4):c.210G>A (p.K70=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20983036G>A" "" "benign" "" "0000571458" "0" "50" "22" "21337360" "21337360" "subst" "0" "02329" "AIFM3_000002" "g.21337360T>A" "" "" "" "LZTR1(NM_006767.4):c.245T>A (p.V82E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20983071T>A" "" "VUS" "" "0000571459" "0" "10" "22" "21340198" "21340198" "subst" "0.00121529" "02327" "AIFM3_000003" "g.21340198C>T" "" "" "" "LZTR1(NM_006767.4):c.320+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985909C>T" "" "benign" "" "0000571460" "0" "50" "22" "21341825" "21341825" "subst" "2.0326E-5" "02325" "LZTR1_000051" "g.21341825G>A" "" "" "" "LZTR1(NM_006767.4):c.353G>A (p.(Arg118His), p.R118H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20987536G>A" "" "VUS" "" "0000571461" "0" "50" "22" "21341876" "21341876" "subst" "0" "01804" "LZTR1_000107" "g.21341876A>G" "" "" "" "LZTR1(NM_006767.3):c.400+4A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20987587A>G" "" "VUS" "" "0000571462" "0" "10" "22" "21343995" "21343995" "subst" "0" "02327" "LZTR1_000066" "g.21343995C>T" "" "" "" "LZTR1(NM_006767.3):c.651+24C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20989706C>T" "" "benign" "" "0000571463" "0" "10" "22" "21344002" "21344019" "delins" "0" "02325" "LZTR1_000108" "g.21344002_21344019delinsGGAGGAGGTGAGGGGCAT" "" "" "" "LZTR1(NM_006767.4):c.651+12_651+48delins37" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20989713_20989730delinsGGAGGAGGTGAGGGGCAT" "" "benign" "" "0000571464" "0" "10" "22" "21344002" "21344038" "del" "0" "02330" "LZTR1_000109" "g.21344002_21344038del" "" "" "" "LZTR1(NM_006767.4):c.651+31_651+67del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20989713_20989749del" "" "benign" "" "0000571465" "0" "90" "22" "21344694" "21344694" "dup" "0" "01943" "LZTR1_000110" "g.21344694dup" "" "" "" "LZTR1(NM_006767.3):c.671dup (p.(Ser227IlefsTer33)), LZTR1(NM_006767.3):c.671dupT (p.S227Ifs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990405dup" "" "pathogenic" "" "0000571466" "0" "70" "22" "21344694" "21344694" "dup" "0" "01804" "LZTR1_000110" "g.21344694dup" "" "" "" "LZTR1(NM_006767.3):c.671dup (p.(Ser227IlefsTer33)), LZTR1(NM_006767.3):c.671dupT (p.S227Ifs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990405dup" "" "likely pathogenic" "" "0000571467" "0" "50" "22" "21344700" "21344700" "subst" "0" "02327" "LZTR1_000111" "g.21344700C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990411C>A" "" "VUS" "" "0000571468" "0" "90" "22" "21344765" "21344765" "subst" "0" "02325" "LZTR1_000092" "g.21344765G>A" "" "" "" "LZTR1(NM_006767.4):c.742G>A (p.G248R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990476G>A" "" "pathogenic" "" "0000571469" "0" "50" "22" "21345972" "21345972" "subst" "0" "02327" "LZTR1_000112" "g.21345972C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991683C>T" "" "VUS" "" "0000571470" "0" "70" "22" "21345973" "21345973" "subst" "0" "02330" "LZTR1_000093" "g.21345973G>A" "" "" "" "LZTR1(NM_006767.4):c.848G>A (p.R283Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991684G>A" "" "likely pathogenic" "" "0000571471" "0" "90" "22" "21345989" "21345989" "del" "0" "01943" "LZTR1_000113" "g.21345989del" "" "" "" "LZTR1(NM_006767.3):c.864delC (p.M289Wfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991700del" "" "pathogenic" "" "0000571472" "0" "30" "22" "21346070" "21346070" "subst" "0.000112134" "01943" "LZTR1_000114" "g.21346070C>T" "" "" "" "LZTR1(NM_006767.3):c.945C>T (p.D315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991781C>T" "" "likely benign" "" "0000571473" "0" "50" "22" "21346114" "21346114" "subst" "0" "02325" "LZTR1_000115" "g.21346114G>T" "" "" "" "LZTR1(NM_006767.3):c.989G>T (p.(Ser330Ile)), LZTR1(NM_006767.4):c.989G>T (p.S330I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991825G>T" "" "VUS" "" "0000571474" "0" "10" "22" "21346485" "21346485" "subst" "0.70502" "02330" "LZTR1_000068" "g.21346485T>C" "" "" "" "LZTR1(NM_006767.3):c.994-18T>C, LZTR1(NM_006767.4):c.994-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20992196T>C" "" "benign" "" "0000571477" "0" "30" "22" "21347142" "21347142" "subst" "0.00671135" "01943" "LZTR1_000069" "g.21347142C>T" "" "" "" "LZTR1(NM_006767.3):c.1209C>T (p.F403=), LZTR1(NM_006767.4):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20992853C>T" "" "likely benign" "" "0000571478" "0" "70" "22" "21347167" "21347167" "subst" "0" "02327" "LZTR1_000117" "g.21347167C>T" "" "" "" "LZTR1(NM_006767.4):c.1234C>T (p.R412C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20992878C>T" "" "likely pathogenic" "" "0000571479" "0" "50" "22" "21347997" "21347997" "subst" "0" "01943" "LZTR1_000118" "g.21347997T>G" "" "" "" "LZTR1(NM_006767.3):c.1307T>G (p.L436R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20993708T>G" "" "VUS" "" "0000571480" "0" "30" "22" "21348254" "21348254" "subst" "0.00100889" "02327" "LZTR1_000071" "g.21348254G>A" "" "" "" "LZTR1(NM_006767.3):c.1395G>A (p.A465=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20993965G>A" "" "likely benign" "" "0000571481" "0" "50" "22" "21348474" "21348474" "subst" "0.000132655" "02327" "LZTR1_000119" "g.21348474G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994185G>A" "" "VUS" "" "0000571482" "0" "50" "22" "21348507" "21348507" "subst" "0.000125479" "02327" "LZTR1_000120" "g.21348507G>A" "" "" "" "LZTR1(NM_006767.4):c.1564G>A (p.E522K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994218G>A" "" "VUS" "" "0000571483" "0" "10" "22" "21348914" "21348914" "subst" "0.138205" "02330" "LZTR1_000080" "g.21348914C>T" "" "" "" "LZTR1(NM_006767.3):c.1683C>T (p.R561=), LZTR1(NM_006767.4):c.1683C>T (p.R561=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994625C>T" "" "benign" "" "0000571484" "0" "70" "22" "21348918" "21348918" "subst" "4.07674E-6" "02327" "LZTR1_000081" "g.21348918G>C" "" "" "" "LZTR1(NM_006767.4):c.1687G>C (p.(Glu563Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994629G>C" "" "likely pathogenic" "" "0000571485" "0" "50" "22" "21350074" "21350074" "subst" "0" "01943" "LZTR1_000121" "g.21350074G>A" "" "" "" "LZTR1(NM_006767.3):c.1982G>A (p.G661E), LZTR1(NM_006767.4):c.1982G>A (p.G661E, p.(Gly661Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995785G>A" "" "VUS" "" "0000571486" "0" "50" "22" "21350271" "21350271" "subst" "2.43799E-5" "02327" "LZTR1_000020" "g.21350271C>T" "" "" "" "LZTR1(NM_006767.4):c.2089C>T (p.(Arg697Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995982C>T" "" "VUS" "" "0000571487" "0" "70" "22" "21350272" "21350272" "subst" "2.84416E-5" "02327" "LZTR1_000122" "g.21350272G>A" "" "" "" "LZTR1(NM_006767.3):c.2090G>A (p.(Arg697Gln)), LZTR1(NM_006767.4):c.2090G>A (p.R697Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995983G>A" "" "likely pathogenic" "" "0000571488" "0" "10" "22" "21350342" "21350342" "subst" "0.00492138" "02330" "LZTR1_000085" "g.21350342C>T" "" "" "" "LZTR1(NM_006767.4):c.2160C>T (p.F720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996053C>T" "" "benign" "" "0000571489" "0" "10" "22" "21350342" "21350342" "subst" "0.00492138" "02327" "LZTR1_000085" "g.21350342C>T" "" "" "" "LZTR1(NM_006767.4):c.2160C>T (p.F720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996053C>T" "" "benign" "" "0000571490" "0" "50" "22" "21350350" "21350350" "subst" "0" "02327" "LZTR1_000123" "g.21350350T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996061T>C" "" "VUS" "" "0000571491" "0" "30" "22" "21350414" "21350414" "subst" "0.00998799" "01943" "LZTR1_000124" "g.21350414C>T" "" "" "" "LZTR1(NM_006767.3):c.2219+13C>T, LZTR1(NM_006767.4):c.2219+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996125C>T" "" "likely benign" "" "0000571492" "0" "10" "22" "21350414" "21350414" "subst" "0.00998799" "02329" "LZTR1_000124" "g.21350414C>T" "" "" "" "LZTR1(NM_006767.3):c.2219+13C>T, LZTR1(NM_006767.4):c.2219+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996125C>T" "" "benign" "" "0000571494" "0" "90" "22" "21351060" "21351061" "del" "0" "02325" "LZTR1_000126" "g.21351060_21351061del" "" "" "" "LZTR1(NM_006767.4):c.2295_2296delGA (p.E765Dfs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996771_20996772del" "" "pathogenic" "" "0000571495" "0" "90" "22" "21351090" "21351090" "subst" "0" "02325" "LZTR1_000087" "g.21351090G>T" "" "" "" "LZTR1(NM_006767.3):c.2325G>T (p.Q775H), LZTR1(NM_006767.4):c.2325G>T (p.(Gln775His), p.Q775H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996801G>T" "" "pathogenic" "" "0000571496" "0" "10" "22" "21351222" "21351222" "subst" "0.000614551" "02327" "LZTR1_000127" "g.21351222C>T" "" "" "" "LZTR1(NM_006767.4):c.2373C>T (p.H791=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996933C>T" "" "benign" "" "0000604249" "0" "90" "22" "21346015" "21346016" "del" "0" "01164" "LZTR1_000128" "g.21346015_21346016del" "" "" "" "" "ACMG: PVS1,PM1,PM2" "Germline" "" "rs767445373" "0" "" "" "g.20991726_20991727del" "" "pathogenic" "ACMG" "0000618477" "0" "30" "22" "21336686" "21336686" "subst" "3.79367E-5" "01804" "AIFM3_000004" "g.21336686G>A" "" "" "" "LZTR1(NM_006767.3):c.26G>A (p.(Gly9Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20982397G>A" "" "likely benign" "" "0000618478" "0" "70" "22" "21340117" "21340117" "subst" "4.46933E-5" "02327" "LZTR1_000054" "g.21340117G>A" "" "" "" "LZTR1(NM_006767.4):c.264-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985828G>A" "" "likely pathogenic" "" "0000618479" "0" "50" "22" "21340139" "21340139" "subst" "0" "02327" "AIFM3_000005" "g.21340139G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985850G>A" "" "VUS" "" "0000618480" "0" "70" "22" "21342301" "21342301" "subst" "4.07073E-6" "02327" "LZTR1_000129" "g.21342301G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20988012G>T" "" "likely pathogenic" "" "0000618481" "0" "50" "22" "21344713" "21344713" "subst" "0" "02327" "LZTR1_000130" "g.21344713C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990424C>A" "" "VUS" "" "0000618482" "0" "50" "22" "21344792" "21344792" "subst" "0" "02327" "LZTR1_000131" "g.21344792C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990503C>T" "" "VUS" "" "0000618483" "0" "50" "22" "21345967" "21345967" "subst" "0" "02327" "LZTR1_000030" "g.21345967C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991678C>T" "" "VUS" "" "0000618484" "0" "70" "22" "21347143" "21347143" "subst" "0" "02327" "LZTR1_000134" "g.21347143G>A" "" "" "" "LZTR1(NM_006767.3):c.1210G>A (p.(Gly404Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20992854G>A" "" "likely pathogenic" "" "0000618485" "0" "50" "22" "21348020" "21348020" "subst" "0" "02325" "LZTR1_000135" "g.21348020G>T" "" "" "" "LZTR1(NM_006767.4):c.1330G>T (p.D444Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20993731G>T" "" "VUS" "" "0000618486" "0" "30" "22" "21348032" "21348032" "subst" "2.04916E-5" "02327" "LZTR1_000136" "g.21348032G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20993743G>A" "" "likely benign" "" "0000618487" "0" "30" "22" "21348506" "21348506" "subst" "0.000142814" "02327" "LZTR1_000075" "g.21348506C>T" "" "" "" "LZTR1(NM_006767.4):c.1563C>T (p.F521=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994217C>T" "" "likely benign" "" "0000618488" "0" "50" "22" "21350272" "21350272" "subst" "2.84416E-5" "01804" "LZTR1_000122" "g.21350272G>A" "" "" "" "LZTR1(NM_006767.3):c.2090G>A (p.(Arg697Gln)), LZTR1(NM_006767.4):c.2090G>A (p.R697Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995983G>A" "" "VUS" "" "0000624263" "0" "10" "22" "21340198" "21340198" "subst" "0.00121529" "02329" "AIFM3_000003" "g.21340198C>T" "" "" "" "LZTR1(NM_006767.4):c.320+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985909C>T" "" "benign" "" "0000624264" "0" "50" "22" "21345922" "21345922" "subst" "0" "01943" "LZTR1_000132" "g.21345922C>G" "" "" "" "LZTR1(NM_006767.3):c.797C>G (p.T266R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991633C>G" "" "VUS" "" "0000624265" "0" "50" "22" "21347098" "21347098" "subst" "0" "02325" "LZTR1_000133" "g.21347098C>T" "" "" "" "LZTR1(NM_006767.4):c.1165C>T (p.L389F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20992809C>T" "" "VUS" "" "0000624266" "0" "30" "22" "21348842" "21348842" "subst" "2.48016E-5" "02330" "LZTR1_000137" "g.21348842C>T" "" "" "" "LZTR1(NM_006767.4):c.1616-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994553C>T" "" "likely benign" "" "0000624267" "0" "50" "22" "21350274" "21350274" "subst" "0" "02325" "LZTR1_000138" "g.21350274T>C" "" "" "" "LZTR1(NM_006767.4):c.2092T>C (p.S698P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995985T>C" "" "VUS" "" "0000624268" "0" "50" "22" "21351197" "21351197" "subst" "0" "02325" "LZTR1_000139" "g.21351197C>T" "" "" "" "LZTR1(NM_006767.4):c.2348C>T (p.T783M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996908C>T" "" "VUS" "" "0000653535" "0" "70" "22" "21348255" "21348255" "subst" "7.00246E-5" "01164" "LZTR1_000042" "g.21348255C>T" "" "" "" "" "ACMG: PM2,PM5,PP3,PP4; NF1, NF2 and SMARCB1 negative, brother also affected" "Germline" "" "rs550922200" "0" "" "" "g.20993966C>T" "" "likely pathogenic" "ACMG" "0000658887" "0" "10" "22" "21337303" "21337303" "subst" "0.00168133" "02330" "AIFM3_000006" "g.21337303C>T" "" "" "" "LZTR1(NM_006767.4):c.201-13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20983014C>T" "" "benign" "" "0000658888" "0" "10" "22" "21337308" "21337308" "subst" "0.00157171" "02330" "AIFM3_000007" "g.21337308C>T" "" "" "" "LZTR1(NM_006767.4):c.201-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20983019C>T" "" "benign" "" "0000658889" "0" "50" "22" "21340186" "21340186" "subst" "0" "02327" "LZTR1_000061" "g.21340186G>C" "" "" "" "LZTR1(NM_006767.3):c.320G>C (p.R107T, p.(Arg107Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985897G>C" "" "VUS" "" "0000658890" "0" "70" "22" "21340188" "21340188" "subst" "0" "02327" "AIFM3_000008" "g.21340188T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20985899T>G" "" "likely pathogenic" "" "0000658891" "0" "50" "22" "21344685" "21344685" "subst" "0" "02325" "LZTR1_000140" "g.21344685G>A" "" "" "" "LZTR1(NM_006767.4):c.662G>A (p.S221N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990396G>A" "" "VUS" "" "0000658892" "0" "10" "22" "21344764" "21344764" "subst" "0.000487876" "02330" "LZTR1_000141" "g.21344764C>T" "" "" "" "LZTR1(NM_006767.4):c.741C>T (p.S247=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20990475C>T" "" "benign" "" "0000658893" "0" "50" "22" "21346110" "21346110" "subst" "1.35899E-5" "02325" "LZTR1_000142" "g.21346110G>A" "" "" "" "LZTR1(NM_006767.4):c.985G>A (p.D329N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20991821G>A" "" "VUS" "" "0000658895" "0" "50" "22" "21348916" "21348933" "del" "0" "02325" "LZTR1_000143" "g.21348916_21348933del" "" "" "" "LZTR1(NM_006767.4):c.1685_1702delTGGAGCAGCTGTGCCGCC (p.L562_R567del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994627_20994644del" "" "VUS" "" "0000658896" "0" "90" "22" "21349283" "21349283" "del" "0" "02325" "LZTR1_000144" "g.21349283del" "" "" "" "LZTR1(NM_006767.4):c.1910delC (p.P637Lfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20994994del" "" "pathogenic" "" "0000658897" "0" "50" "22" "21350056" "21350056" "subst" "1.2191E-5" "01943" "LZTR1_000145" "g.21350056T>C" "" "" "" "LZTR1(NM_006767.3):c.1964T>C (p.M655T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995767T>C" "" "VUS" "" "0000658898" "0" "30" "22" "21350150" "21350150" "subst" "0.000110457" "01943" "LZTR1_000146" "g.21350150C>T" "" "" "" "LZTR1(NM_006767.3):c.2058C>T (p.A686=), LZTR1(NM_006767.4):c.2058C>T (p.A686=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20995861C>T" "" "likely benign" "" "0000658899" "0" "10" "22" "21351018" "21351018" "subst" "0.015819" "02330" "LZTR1_000086" "g.21351018C>T" "" "" "" "LZTR1(NM_006767.3):c.2253C>T (p.F751=), LZTR1(NM_006767.4):c.2253C>T (p.F751=, p.(Phe751=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996729C>T" "" "benign" "" "0000658900" "0" "10" "22" "21351222" "21351222" "subst" "0.000614551" "02330" "LZTR1_000127" "g.21351222C>T" "" "" "" "LZTR1(NM_006767.4):c.2373C>T (p.H791=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996933C>T" "" "benign" "" "0000658901" "0" "50" "22" "21351254" "21351254" "subst" "0" "02327" "LZTR1_000147" "g.21351254A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.20996965A>G" "" "VUS" "" "0000659775" "0" "70" "22" "21351042" "21351042" "subst" "0" "01164" "LZTR1_000148" "g.21351042C>G" "" "" "" "" "ACMG grading: PVS1,PM2\r\nmultiple cafe-au-lait spots at age 11y" "Germline" "" "" "0" "" "" "g.20996753C>G" "" "likely pathogenic" "ACMG" "0000663697" "0" "70" "22" "21341824" "21341824" "del" "0" "01164" "LZTR1_000149" "g.21341824del" "" "" "" "" "ACMG grading: PVS1,PM2\r\nschwannomatosis at age 66y" "Germline" "" "" "0" "" "" "g.20987535del" "" "likely pathogenic" "ACMG" "0000681800" "0" "70" "22" "21340117" "21340117" "subst" "4.46933E-5" "02325" "LZTR1_000054" "g.21340117G>A" "" "" "" "LZTR1(NM_006767.4):c.264-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000681801" "0" "90" "22" "21348002" "21348002" "subst" "0" "01943" "LZTR1_000150" "g.21348002G>T" "" "" "" "LZTR1(NM_006767.3):c.1312G>T (p.E438*), LZTR1(NM_006767.4):c.1312G>T (p.(Glu438Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681802" "0" "50" "22" "21348225" "21348225" "subst" "1.23728E-5" "01804" "LZTR1_000151" "g.21348225G>A" "" "" "" "LZTR1(NM_006767.3):c.1366G>A (p.(Val456Met)), LZTR1(NM_006767.4):c.1366G>A (p.V456M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681803" "0" "50" "22" "21349262" "21349262" "subst" "8.1414E-6" "02327" "LZTR1_000152" "g.21349262G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693116" "0" "50" "22" "21340191" "21340191" "subst" "0" "02325" "AIFM3_000009" "g.21340191G>T" "" "" "" "LZTR1(NM_006767.4):c.320+5G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693117" "0" "70" "22" "21341831" "21341831" "subst" "0" "02327" "LZTR1_000153" "g.21341831A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000693118" "0" "30" "22" "21343111" "21343111" "subst" "0.000568662" "02327" "LZTR1_000065" "g.21343111G>A" "" "" "" "LZTR1(NM_006767.3):c.543G>A (p.T181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693119" "0" "30" "22" "21346115" "21346115" "subst" "3.4118E-5" "02325" "LZTR1_000154" "g.21346115C>T" "" "" "" "LZTR1(NM_006767.4):c.990C>T (p.S330=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693120" "0" "90" "22" "21348224" "21348224" "subst" "0" "02325" "LZTR1_000155" "g.21348224C>A" "" "" "" "LZTR1(NM_006767.4):c.1365C>A (p.C455*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000698017" "0" "50" "22" "21340137" "21340137" "subst" "0" "03821" "LZTR1_000156" "g.21340137A>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000698018" "0" "50" "22" "21341844" "21341844" "subst" "4.06256E-5" "03821" "LZTR1_000157" "g.21341844C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000698019" "0" "50" "22" "21342407" "21342407" "subst" "2.44075E-5" "03821" "LZTR1_000064" "g.21342407G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000709017" "0" "90" "22" "21343924" "21343925" "del" "2.84842E-5" "01602" "LZTR1_000159" "g.21343924_21343925del" "" "{PMID:Neubauer 2021:33895855}" "" "" "" "Unknown" "" "" "" "" "" "" "" "pathogenic" "" "0000709020" "0" "90" "22" "21351554" "21351554" "subst" "0" "01602" "LZTR1_000158" "g.21351554C>T" "" "{PMID:Neubauer 2021:33895855}" "" "" "" "Unknown" "" "" "" "" "" "" "" "pathogenic" "" "0000728049" "0" "50" "22" "21336719" "21336719" "subst" "5.37733E-6" "02325" "AIFM3_000010" "g.21336719C>T" "" "" "" "LZTR1(NM_006767.4):c.59C>T (p.A20V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728050" "0" "90" "22" "21343969" "21343969" "subst" "0" "02327" "LZTR1_000160" "g.21343969G>T" "" "" "" "LZTR1(NM_006767.4):c.649G>T (p.E217*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728051" "0" "30" "22" "21346523" "21346523" "subst" "8.14412E-6" "02325" "LZTR1_000161" "g.21346523C>T" "" "" "" "LZTR1(NM_006767.4):c.1014C>T (p.P338=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728052" "0" "30" "22" "21347142" "21347142" "subst" "0.00671135" "02327" "LZTR1_000069" "g.21347142C>T" "" "" "" "LZTR1(NM_006767.3):c.1209C>T (p.F403=), LZTR1(NM_006767.4):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728053" "0" "70" "22" "21348879" "21348879" "subst" "0" "02327" "LZTR1_000162" "g.21348879G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000728054" "0" "90" "22" "21348895" "21348895" "del" "0" "01943" "LZTR1_000163" "g.21348895del" "" "" "" "LZTR1(NM_006767.3):c.1664delT (p.L555Rfs*37)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728055" "0" "90" "22" "21349317" "21349317" "subst" "4.17798E-6" "02327" "LZTR1_000164" "g.21349317T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728056" "0" "30" "22" "21350150" "21350150" "subst" "0.000110457" "02325" "LZTR1_000146" "g.21350150C>T" "" "" "" "LZTR1(NM_006767.3):c.2058C>T (p.A686=), LZTR1(NM_006767.4):c.2058C>T (p.A686=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000736493" "3" "70" "22" "21348918" "21348918" "subst" "4.07674E-6" "01807" "LZTR1_000081" "g.21348918G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000760761" "0" "70" "22" "21346659" "21346659" "subst" "4.13486E-6" "01807" "LZTR1_000165" "g.21346659G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000760762" "0" "70" "22" "21348927" "21348927" "subst" "4.07495E-6" "01807" "LZTR1_000166" "g.21348927T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000785729" "0" "70" "22" "21341824" "21341824" "dup" "0" "01807" "LZTR1_000018" "g.21341824dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.20987535dup" "" "likely pathogenic" "" "0000785730" "0" "50" "22" "21348994" "21348994" "subst" "4.08898E-6" "01807" "LZTR1_000167" "g.21348994G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000797466" "0" "70" "22" "21340117" "21340117" "subst" "4.46933E-5" "01164" "LZTR1_000054" "g.21340117G>A" "" "PMID: 24362817, 24362817, 31438995, 31128261 and 29409008" "" "" "ACMG: PS4, PM2_SUP, PP3" "Germline" "" "rs587777176" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000809497" "0" "70" "22" "21344807" "21344807" "del" "0" "02325" "LZTR1_000168" "g.21344807del" "" "" "" "LZTR1(NM_006767.4):c.784delG (p.D262Tfs*89)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809498" "0" "50" "22" "21345941" "21345941" "subst" "0" "02327" "LZTR1_000169" "g.21345941C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809499" "0" "50" "22" "21346654" "21346654" "subst" "8.21693E-6" "02325" "LZTR1_000170" "g.21346654C>T" "" "" "" "LZTR1(NM_006767.4):c.1145C>T (p.S382L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809500" "0" "50" "22" "21347167" "21347167" "subst" "0" "02325" "LZTR1_000117" "g.21347167C>T" "" "" "" "LZTR1(NM_006767.4):c.1234C>T (p.R412C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809501" "0" "30" "22" "21348209" "21348209" "subst" "1.65906E-5" "02325" "LZTR1_000171" "g.21348209G>A" "" "" "" "LZTR1(NM_006767.4):c.1354-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809502" "0" "50" "22" "21348563" "21348563" "subst" "3.52609E-5" "02325" "LZTR1_000078" "g.21348563G>A" "" "" "" "LZTR1(NM_006767.3):c.1615+5G>A (p.?), LZTR1(NM_006767.4):c.1615+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809503" "0" "10" "22" "21350054" "21350054" "subst" "0.00717293" "02330" "LZTR1_000172" "g.21350054C>T" "" "" "" "LZTR1(NM_006767.4):c.1962C>T (p.D654=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809504" "0" "30" "22" "21350312" "21350312" "subst" "7.31487E-5" "02325" "LZTR1_000173" "g.21350312C>T" "" "" "" "LZTR1(NM_006767.4):c.2130C>T (p.I710=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809505" "0" "10" "22" "21350414" "21350414" "subst" "0.00998799" "02327" "LZTR1_000124" "g.21350414C>T" "" "" "" "LZTR1(NM_006767.3):c.2219+13C>T, LZTR1(NM_006767.4):c.2219+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809506" "0" "50" "22" "21351074" "21351074" "subst" "4.87646E-5" "02325" "LZTR1_000174" "g.21351074T>C" "" "" "" "LZTR1(NM_006767.4):c.2309T>C (p.V770A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809507" "0" "50" "22" "21351082" "21351082" "subst" "2.8453E-5" "02330" "LZTR1_000175" "g.21351082G>A" "" "" "" "LZTR1(NM_006767.4):c.2317G>A (p.V773M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809508" "0" "30" "22" "21351170" "21351170" "subst" "0" "02327" "LZTR1_000176" "g.21351170T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810839" "0" "50" "22" "21344700" "21344700" "del" "0" "04161" "LZTR1_000177" "g.21344700del" "" "" "" "677delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20990411del" "" "pathogenic" "" "0000814308" "3" "30" "22" "21349229" "21349229" "subst" "5.28408E-5" "00006" "LZTR1_000178" "g.21349229G>A" "" "{PMID:Motta 2021:34626534}" "" "" "classification confirmed by in vitro functional analysis variant" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000856064" "0" "30" "22" "21342451" "21342451" "subst" "0.000351235" "02369" "LZTR1_000179" "g.21342451G>T" "" "" "" "LZTR1(NM_006767.4):c.509+44G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856065" "0" "30" "22" "21343718" "21343718" "subst" "0" "02369" "LZTR1_000180" "g.21343718C>T" "" "" "" "LZTR1(NM_006767.4):c.594-196C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856066" "0" "30" "22" "21344779" "21344779" "subst" "0" "01943" "LZTR1_000182" "g.21344779C>T" "" "" "" "LZTR1(NM_006767.3):c.756C>T (p.T252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856067" "0" "70" "22" "21344786" "21344786" "subst" "0" "02327" "LZTR1_000183" "g.21344786C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000856068" "0" "50" "22" "21347984" "21347984" "subst" "0" "02327" "LZTR1_000184" "g.21347984G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856069" "0" "50" "22" "21350382" "21350382" "subst" "0" "01943" "LZTR1_000188" "g.21350382A>G" "" "" "" "LZTR1(NM_006767.3):c.2200A>G (p.M734V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856070" "0" "50" "22" "21351013" "21351013" "subst" "0" "01943" "LZTR1_000189" "g.21351013G>T" "" "" "" "LZTR1(NM_006767.3):c.2248G>T (p.G750C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856071" "0" "30" "22" "21351072" "21351072" "subst" "3.2509E-5" "02325" "LZTR1_000190" "g.21351072G>A" "" "" "" "LZTR1(NM_006767.4):c.2307G>A (p.T769=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866732" "0" "10" "22" "21343995" "21344000" "del" "0" "01943" "LZTR1_000181" "g.21343995_21344000del" "" "" "" "LZTR1(NM_006767.3):c.651+24_651+36delCGCAGGTAGAGGAinsTAGAGGA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000866733" "0" "90" "22" "21344815" "21344815" "subst" "7.06074E-5" "02325" "LZTR1_000021" "g.21344815G>A" "" "" "" "LZTR1(NM_006767.4):c.791+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866734" "0" "50" "22" "21348462" "21348462" "subst" "0" "02326" "LZTR1_000185" "g.21348462C>T" "" "" "" "LZTR1(NM_006767.4):c.1519C>T (p.P507S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866735" "0" "10" "22" "21348473" "21348473" "subst" "0.00186642" "02326" "LZTR1_000073" "g.21348473C>T" "" "" "" "LZTR1(NM_006767.3):c.1530C>T (p.H510=), LZTR1(NM_006767.4):c.1530C>T (p.H510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000866736" "0" "50" "22" "21348498" "21348498" "subst" "8.23616E-5" "01943" "LZTR1_000186" "g.21348498C>T" "" "" "" "LZTR1(NM_006767.3):c.1555C>T (p.R519W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866737" "0" "50" "22" "21350372" "21350372" "subst" "0.000248517" "02327" "LZTR1_000187" "g.21350372C>T" "" "" "" "LZTR1(NM_006767.4):c.2190C>T (p.G730=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866738" "0" "30" "22" "21351669" "21351669" "subst" "0.00146686" "01943" "LZTR1_000191" "g.21351669C>T" "" "" "" "LZTR1(NM_006767.3):c.*32C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873318" "0" "70" "22" "21344731" "21344731" "subst" "0" "01164" "LZTR1_000192" "g.21344731C>A" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline" "" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000895593" "0" "70" "22" "21340138" "21340138" "subst" "0" "02327" "AIFM3_000011" "g.21340138T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000895594" "0" "50" "22" "21342316" "21342316" "subst" "0" "02327" "LZTR1_000193" "g.21342316A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895595" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "02327" "LZTR1_000037" "g.21346593C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895596" "0" "70" "22" "21348255" "21348255" "subst" "7.00246E-5" "02327" "LZTR1_000042" "g.21348255C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000895597" "0" "50" "22" "21349228" "21349228" "subst" "4.06441E-5" "02325" "LZTR1_000194" "g.21349228C>T" "" "" "" "LZTR1(NM_006767.4):c.1855C>T (p.(Arg619Cys), p.R619C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895598" "0" "70" "22" "21350154" "21350154" "subst" "4.50561E-5" "02327" "LZTR1_000195" "g.21350154C>T" "" "" "" "LZTR1(NM_006767.3):c.2062C>T (p.(Arg688Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000895599" "0" "10" "22" "21350285" "21350285" "subst" "0.000410362" "02326" "LZTR1_000196" "g.21350285C>G" "" "" "" "LZTR1(NM_006767.4):c.2103C>G (p.P701=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895600" "0" "50" "22" "21350343" "21350343" "subst" "1.22022E-5" "02325" "LZTR1_000197" "g.21350343G>A" "" "" "" "LZTR1(NM_006767.4):c.2161G>A (p.E721K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895601" "0" "50" "22" "21351040" "21351040" "subst" "0" "02327" "LZTR1_000198" "g.21351040T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895602" "0" "30" "22" "21351066" "21351066" "subst" "8.12625E-5" "02325" "LZTR1_000199" "g.21351066C>T" "" "" "" "LZTR1(NM_006767.4):c.2301C>T (p.N767=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895603" "0" "50" "22" "21351071" "21351071" "subst" "4.06362E-5" "02325" "LZTR1_000200" "g.21351071C>T" "" "" "" "LZTR1(NM_006767.3):c.2306C>T (p.(Thr769Met)), LZTR1(NM_006767.4):c.2306C>T (p.T769M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895604" "0" "50" "22" "21351236" "21351236" "subst" "6.50655E-5" "02325" "LZTR1_000201" "g.21351236T>C" "" "" "" "LZTR1(NM_006767.4):c.2387T>C (p.(Ile796Thr), p.I796T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895605" "0" "50" "22" "21351542" "21351542" "subst" "4.0785E-5" "02327" "LZTR1_000088" "g.21351542C>T" "" "" "" "LZTR1(NM_006767.3):c.2428C>T (p.R810W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000909263" "3" "50" "22" "21341842" "21341842" "subst" "0" "01164" "LZTR1_000202" "g.21341842G>C" "" "" "" "" "ACMG: PM2_Sup" "Germline" "?" "" "" "" "" "" "" "VUS" "ACMG" "0000915489" "0" "10" "22" "21347142" "21347142" "subst" "0.00671135" "02330" "LZTR1_000069" "g.21347142C>T" "" "" "" "LZTR1(NM_006767.3):c.1209C>T (p.F403=), LZTR1(NM_006767.4):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000915490" "0" "50" "22" "21347152" "21347152" "subst" "0" "02325" "LZTR1_000203" "g.21347152G>A" "" "" "" "LZTR1(NM_006767.4):c.1219G>A (p.V407M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927109" "0" "50" "22" "21341816" "21341816" "subst" "1.62747E-5" "02327" "LZTR1_000204" "g.21341816C>T" "" "" "" "LZTR1(NM_006767.4):c.344C>T (p.(Pro115Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927110" "0" "90" "22" "21342383" "21342383" "subst" "0" "02327" "LZTR1_000205" "g.21342383G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000927111" "0" "70" "22" "21343971" "21343971" "subst" "0" "02325" "LZTR1_000206" "g.21343971G>A" "" "" "" "LZTR1(NM_006767.4):c.651G>A (p.E217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000927112" "0" "50" "22" "21344718" "21344718" "subst" "0" "02327" "LZTR1_000207" "g.21344718C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927113" "0" "50" "22" "21351548" "21351548" "subst" "0" "02329" "LZTR1_000208" "g.21351548C>G" "" "" "" "LZTR1(NM_006767.4):c.2434C>G (p.L812V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931247" "0" "90" "22" "21336687" "21336687" "del" "0" "02325" "LZTR1_000058" "g.21336687del" "" "" "" "LZTR1(NM_006767.4):c.27delG (p.Q10Rfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931249" "0" "90" "22" "21345975" "21345975" "subst" "0" "02329" "LZTR1_000014" "g.21345975C>T" "" "" "" "LZTR1(NM_006767.4):c.850C>T (p.(Arg284Cys), p.R284C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931250" "0" "50" "22" "21346086" "21346086" "subst" "0" "02327" "LZTR1_000210" "g.21346086T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931251" "0" "70" "22" "21350272" "21350272" "subst" "2.84416E-5" "02325" "LZTR1_000122" "g.21350272G>A" "" "" "" "LZTR1(NM_006767.3):c.2090G>A (p.(Arg697Gln)), LZTR1(NM_006767.4):c.2090G>A (p.R697Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000931252" "0" "50" "22" "21351071" "21351071" "subst" "4.06362E-5" "01804" "LZTR1_000200" "g.21351071C>T" "" "" "" "LZTR1(NM_006767.3):c.2306C>T (p.(Thr769Met)), LZTR1(NM_006767.4):c.2306C>T (p.T769M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931850" "11" "70" "22" "21344762" "21344762" "del" "0" "00006" "LZTR1_000211" "g.21344762del" "" "{PMID:Niggl 2023:37541189}" "" "737delA" "" "Germline" "" "" "0" "" "" "g.20990473del" "" "likely pathogenic" "" "0000951538" "0" "90" "22" "21344765" "21344765" "subst" "0" "02329" "LZTR1_000092" "g.21344765G>A" "" "" "" "LZTR1(NM_006767.4):c.742G>A (p.G248R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951539" "0" "70" "22" "21346527" "21346527" "subst" "6.94286E-5" "02329" "LZTR1_000012" "g.21346527C>T" "" "" "" "LZTR1(NM_006767.3):c.1018C>T (p.(Arg340*)), LZTR1(NM_006767.4):c.1018C>T (p.R340*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951540" "0" "50" "22" "21348429" "21348429" "subst" "2.40493E-5" "01804" "LZTR1_000212" "g.21348429G>T" "" "" "" "LZTR1(NM_006767.3):c.1486G>T (p.(Ala496Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951541" "0" "30" "22" "21348430" "21348430" "subst" "2.39629E-5" "01804" "LZTR1_000213" "g.21348430C>A" "" "" "" "LZTR1(NM_006767.3):c.1487C>A (p.(Ala496Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951542" "0" "30" "22" "21348507" "21348507" "subst" "0.000125479" "02329" "LZTR1_000120" "g.21348507G>A" "" "" "" "LZTR1(NM_006767.4):c.1564G>A (p.E522K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951543" "0" "50" "22" "21349759" "21349759" "subst" "0" "02327" "LZTR1_000214" "g.21349759G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951544" "0" "50" "22" "21350074" "21350074" "subst" "0" "02325" "LZTR1_000121" "g.21350074G>A" "" "" "" "LZTR1(NM_006767.3):c.1982G>A (p.G661E), LZTR1(NM_006767.4):c.1982G>A (p.G661E, p.(Gly661Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951545" "0" "30" "22" "21350114" "21350114" "subst" "0.000825794" "02329" "LZTR1_000215" "g.21350114C>T" "" "" "" "LZTR1(NM_006767.4):c.2022C>T (p.D674=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951546" "0" "70" "22" "21351006" "21351006" "subst" "0" "02329" "LZTR1_000216" "g.21351006C>G" "" "" "" "LZTR1(NM_006767.4):c.2241C>G (p.Y747*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951547" "0" "70" "22" "21351236" "21351236" "subst" "6.50655E-5" "02327" "LZTR1_000201" "g.21351236T>C" "" "" "" "LZTR1(NM_006767.4):c.2387T>C (p.(Ile796Thr), p.I796T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951548" "0" "30" "22" "21355576" "21355576" "subst" "0.00411098" "01804" "LZTR1_000217" "g.21355576C>G" "" "" "" "THAP7(NM_001008695.1):c.205G>C (p.(Glu69Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000952253" "0" "70" "22" "21347098" "21347098" "subst" "0" "00006" "LZTR1_000133" "g.21347098C>T" "" "{PMID:Imafidon 2021:34136434}" "" "" "" "De novo" "" "" "0" "" "" "g.20992809C>T" "" "VUS" "" "0000952599" "1" "90" "22" "21344815" "21344815" "subst" "7.06074E-5" "00006" "LZTR1_000021" "g.21344815G>A" "" "{PMID:Sarker 2023:38057384}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20990526G>A" "" "pathogenic" "" "0000970387" "0" "50" "22" "21342308" "21342308" "subst" "0.000113877" "02325" "LZTR1_000227" "g.21342308C>A" "" "" "" "LZTR1(NM_006767.4):c.410C>A (p.T137N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970388" "0" "50" "22" "21344703" "21344703" "subst" "0" "02327" "LZTR1_000231" "g.21344703C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970389" "0" "50" "22" "21348958" "21348958" "subst" "0" "02330" "LZTR1_000247" "g.21348958T>G" "" "" "" "LZTR1(NM_006767.4):c.1727T>G (p.L576R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970390" "0" "50" "22" "21350074" "21350074" "subst" "0" "02330" "LZTR1_000121" "g.21350074G>A" "" "" "" "LZTR1(NM_006767.3):c.1982G>A (p.G661E), LZTR1(NM_006767.4):c.1982G>A (p.G661E, p.(Gly661Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970391" "0" "90" "22" "21350373" "21350373" "subst" "0" "02325" "LZTR1_000254" "g.21350373G>T" "" "" "" "LZTR1(NM_006767.4):c.2191G>T (p.E731*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000971428" "11" "70" "22" "21343084" "21343084" "del" "0" "00774" "LZTR1_000228" "g.21343084del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21343084del" "" "VUS" "" "0000971430" "11" "70" "22" "21341845" "21341847" "repeat" "0" "00774" "LZTR1_000011" "g.21341845_21341847del" "" "" "" "g.21341842GTC[1]" "" "Germline" "" "" "0" "" "" "g.21341845_21341847del" "" "VUS" "" "0000971431" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971432" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971433" "0" "70" "22" "21349286" "21349286" "del" "0" "00774" "LZTR1_000249" "g.21349286del" "" "" "" "g.21349285del" "" "Germline" "" "" "0" "" "" "g.21349286del" "" "VUS" "" "0000971434" "0" "70" "22" "21349286" "21349286" "del" "0" "00774" "LZTR1_000249" "g.21349286del" "" "" "" "g.21349285del" "" "Germline" "" "" "0" "" "" "g.21349286del" "" "VUS" "" "0000971435" "0" "70" "22" "21344815" "21344815" "subst" "7.06074E-5" "00774" "LZTR1_000021" "g.21344815G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344815G>A" "" "VUS" "" "0000971436" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971437" "0" "90" "22" "21348559" "21348559" "subst" "0" "00774" "LZTR1_000243" "g.21348559G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348559G>C" "" "VUS" "" "0000971438" "0" "70" "22" "21347985" "21347985" "subst" "0" "00774" "LZTR1_000238" "g.21347985A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21347985A>T" "" "VUS" "" "0000971439" "0" "90" "22" "21350103" "21350104" "del" "0" "00774" "LZTR1_000219" "g.21350103_21350104del" "" "" "" "g.21350101CT[1]" "" "Germline" "" "" "0" "" "" "g.21350103_21350104del" "" "VUS" "" "0000971441" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971443" "0" "70" "22" "21347150" "21347150" "subst" "0" "00774" "LZTR1_000237" "g.21347150C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21347150C>A" "" "VUS" "" "0000971445" "0" "90" "22" "21341873" "21341873" "subst" "0" "00774" "LZTR1_000224" "g.21341873G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21341873G>C" "" "VUS" "" "0000971447" "0" "90" "22" "21342298" "21342298" "subst" "0" "00774" "LZTR1_000226" "g.21342298G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21342298G>C" "" "VUS" "" "0000971448" "0" "70" "22" "21337340" "21337340" "del" "0" "00774" "LZTR1_000220" "g.21337340del" "" "" "" "g.21337338del" "" "Germline" "" "" "0" "" "" "g.21337340del" "" "VUS" "" "0000971449" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971451" "0" "70" "22" "21348520" "21348520" "subst" "0" "00774" "LZTR1_000242" "g.21348520A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348520A>C" "" "VUS" "" "0000971452" "0" "90" "22" "21346015" "21346016" "del" "0" "00774" "LZTR1_000128" "g.21346015_21346016del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346015_21346016del" "" "VUS" "" "0000971453" "0" "90" "22" "21351068" "21351068" "dup" "0" "00774" "LZTR1_000256" "g.21351068dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351068dup" "" "VUS" "" "0000971454" "0" "90" "22" "21344815" "21344815" "subst" "8.30675E-6" "00774" "LZTR1_000233" "g.21344815G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344815G>T" "" "VUS" "" "0000971455" "0" "70" "22" "21351082" "21351082" "subst" "2.8453E-5" "00774" "LZTR1_000175" "g.21351082G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351082G>A" "" "VUS" "" "0000971456" "0" "90" "22" "21348232" "21348232" "dup" "0" "00774" "LZTR1_000003" "g.21348232dup" "" "" "" "g.21348229dup" "" "Germline" "" "" "0" "" "" "g.21348232dup" "" "VUS" "" "0000971457" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971458" "0" "70" "22" "21348466" "21348466" "del" "0" "00774" "LZTR1_000241" "g.21348466del" "" "" "" "g.21348465del" "" "Germline" "" "" "0" "" "" "g.21348466del" "" "VUS" "" "0000971459" "0" "90" "22" "21351092" "21351092" "subst" "4.06524E-6" "00774" "LZTR1_000257" "g.21351092T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351092T>G" "" "VUS" "" "0000971460" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971461" "0" "70" "22" "21351174" "21351174" "subst" "4.07634E-6" "00774" "LZTR1_000258" "g.21351174G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351174G>A" "" "VUS" "" "0000971462" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "00774" "LZTR1_000037" "g.21346593C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346593C>T" "" "VUS" "" "0000971463" "0" "90" "22" "21344815" "21344815" "subst" "4.15338E-6" "00774" "LZTR1_000234" "g.21344815G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344815G>C" "" "VUS" "" "0000971464" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "00774" "LZTR1_000037" "g.21346593C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346593C>T" "" "VUS" "" "0000971465" "0" "90" "22" "21348921" "21348921" "subst" "0" "00774" "LZTR1_000245" "g.21348921C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348921C>T" "" "VUS" "" "0000971467" "0" "70" "22" "21341845" "21341847" "repeat" "0" "00774" "LZTR1_000011" "g.21341845_21341847del" "" "" "" "g.21341842GTC[1]" "" "Germline" "" "" "0" "" "" "g.21341845_21341847del" "" "VUS" "" "0000971469" "0" "70" "22" "21348923" "21348923" "subst" "0" "00774" "LZTR1_000246" "g.21348923G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348923G>T" "" "VUS" "" "0000971472" "0" "90" "22" "21351519" "21351519" "subst" "0" "00774" "LZTR1_000049" "g.21351519A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351519A>G" "" "VUS" "" "0000971476" "0" "70" "22" "21348277" "21348279" "del" "0" "00774" "LZTR1_000240" "g.21348277_21348279del" "" "" "" "g.21348274del" "" "Germline" "" "" "0" "" "" "g.21348277_21348279del" "" "VUS" "" "0000971477" "0" "70" "22" "21349149" "21349158" "dup" "0" "00774" "LZTR1_000248" "g.21349149_21349158dup" "" "" "" "g.21349147dup" "" "Germline" "" "" "0" "" "" "g.21349149_21349158dup" "" "VUS" "" "0000971481" "0" "70" "22" "21348872" "21348873" "ins" "0" "00774" "LZTR1_000244" "g.21348872_21348873insCTGG" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348872_21348873insCTGG" "" "VUS" "" "0000971482" "0" "70" "22" "21350133" "21350133" "subst" "0" "00774" "LZTR1_000251" "g.21350133C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21350133C>T" "" "VUS" "" "0000971483" "0" "90" "22" "21351092" "21351092" "subst" "4.06524E-6" "00774" "LZTR1_000257" "g.21351092T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351092T>G" "" "VUS" "" "0000971484" "0" "70" "22" "21351044" "21351069" "dup" "0" "00774" "LZTR1_000255" "g.21351044_21351069dup" "" "" "" "g.21351043dup" "" "Germline" "" "" "0" "" "" "g.21351044_21351069dup" "" "VUS" "" "0000971485" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "00774" "LZTR1_000037" "g.21346593C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346593C>T" "" "VUS" "" "0000971486" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971487" "0" "90" "22" "21348255" "21348255" "subst" "7.00246E-5" "00774" "LZTR1_000042" "g.21348255C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348255C>T" "" "VUS" "" "0000971488" "0" "90" "22" "21345919" "21345919" "subst" "0" "00774" "LZTR1_000235" "g.21345919G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21345919G>A" "" "VUS" "" "0000971489" "0" "70" "22" "21346071" "21346071" "subst" "5.27684E-5" "00774" "LZTR1_000094" "g.21346071G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346071G>A" "" "VUS" "" "0000971490" "0" "70" "22" "21350275" "21350275" "subst" "0" "00774" "LZTR1_000252" "g.21350275C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21350275C>T" "" "VUS" "" "0000971491" "0" "90" "22" "21342297" "21342297" "subst" "0" "00774" "LZTR1_000225" "g.21342297A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21342297A>G" "" "VUS" "" "0000971492" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971493" "0" "90" "22" "21344815" "21344815" "subst" "7.06074E-5" "00774" "LZTR1_000021" "g.21344815G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344815G>A" "" "VUS" "" "0000971494" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971495" "0" "90" "22" "21336687" "21336687" "del" "0" "00774" "LZTR1_000058" "g.21336687del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21336687del" "" "VUS" "" "0000971496" "0" "90" "22" "21344707" "21344707" "subst" "4.06161E-6" "00774" "LZTR1_000232" "g.21344707C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344707C>A" "" "VUS" "" "0000971497" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971498" "0" "90" "22" "21345919" "21345919" "subst" "0" "00774" "LZTR1_000235" "g.21345919G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21345919G>A" "" "VUS" "" "0000971499" "0" "90" "22" "21343097" "21343097" "del" "0" "00774" "LZTR1_000229" "g.21343097del" "" "" "" "g.21343096del" "" "Germline" "" "" "0" "" "" "g.21343097del" "" "VUS" "" "0000971500" "0" "90" "22" "21351006" "21351006" "subst" "0" "00774" "LZTR1_000216" "g.21351006C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351006C>G" "" "VUS" "" "0000971501" "0" "90" "22" "21346527" "21346527" "subst" "6.94286E-5" "00774" "LZTR1_000012" "g.21346527C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346527C>T" "" "VUS" "" "0000971502" "0" "90" "22" "21346593" "21346593" "subst" "5.69073E-5" "00774" "LZTR1_000037" "g.21346593C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21346593C>T" "" "VUS" "" "0000971503" "0" "70" "22" "21351188" "21351188" "subst" "0" "00774" "LZTR1_000259" "g.21351188C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351188C>A" "" "VUS" "" "0000971504" "0" "70" "22" "21341845" "21341845" "subst" "2.84382E-5" "00774" "LZTR1_000223" "g.21341845G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21341845G>A" "" "VUS" "" "0000971505" "0" "70" "22" "21347990" "21347990" "subst" "4.49754E-5" "00774" "LZTR1_000239" "g.21347990G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21347990G>A" "" "VUS" "" "0000971506" "0" "70" "22" "21351082" "21351082" "subst" "2.8453E-5" "00774" "LZTR1_000175" "g.21351082G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351082G>A" "" "VUS" "" "0000971507" "0" "70" "22" "21350286" "21350286" "del" "0" "00774" "LZTR1_000253" "g.21350286del" "" "" "" "g.21350285del" "" "Germline" "" "" "0" "" "" "g.21350286del" "" "VUS" "" "0000971508" "0" "90" "22" "21342407" "21342407" "subst" "2.44075E-5" "00774" "LZTR1_000064" "g.21342407G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21342407G>A" "" "VUS" "" "0000971509" "0" "70" "22" "21343132" "21343132" "subst" "0" "00774" "LZTR1_000230" "g.21343132G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21343132G>A" "" "VUS" "" "0000971510" "0" "70" "22" "21348224" "21348224" "subst" "0" "00774" "LZTR1_000155" "g.21348224C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21348224C>A" "" "VUS" "" "0000971511" "0" "70" "22" "21341829" "21341829" "subst" "0" "00774" "LZTR1_000222" "g.21341829C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21341829C>A" "" "VUS" "" "0000971512" "0" "90" "22" "21344815" "21344815" "subst" "4.15338E-6" "00774" "LZTR1_000234" "g.21344815G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21344815G>C" "" "VUS" "" "0000971513" "0" "70" "22" "21349312" "21349312" "del" "0" "00774" "LZTR1_000250" "g.21349312del" "" "" "" "g.21349311del" "" "Germline" "" "" "0" "" "" "g.21349312del" "" "VUS" "" "0000971514" "0" "70" "22" "21337364" "21337364" "dup" "0" "00774" "LZTR1_000221" "g.21337364dup" "" "" "" "g.21337361dup" "" "Germline" "" "" "0" "" "" "g.21337364dup" "" "VUS" "" "0000971515" "0" "70" "22" "21345920" "21345920" "subst" "0" "00774" "LZTR1_000236" "g.21345920G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21345920G>A" "" "VUS" "" "0000971516" "0" "70" "22" "21349286" "21349286" "del" "0" "00774" "LZTR1_000249" "g.21349286del" "" "" "" "g.21349285del" "" "Germline" "" "" "0" "" "" "g.21349286del" "" "VUS" "" "0000971521" "0" "50" "22" "21350980" "21350980" "subst" "8.13319E-6" "00774" "LZTR1_000218" "g.21350980C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21350980C>T" "" "VUS" "" "0000984120" "0" "30" "22" "21336650" "21336650" "subst" "0.000936422" "01804" "AIFM3_000012" "g.21336650G>A" "" "" "" "LZTR1(NM_006767.4):c.-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984121" "0" "50" "22" "21341816" "21341816" "subst" "1.62747E-5" "01804" "LZTR1_000204" "g.21341816C>T" "" "" "" "LZTR1(NM_006767.4):c.344C>T (p.(Pro115Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984122" "0" "50" "22" "21346031" "21346031" "subst" "0.000243255" "01804" "LZTR1_000260" "g.21346031G>A" "" "" "" "LZTR1(NM_006767.4):c.906G>A (p.(Ala302=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984123" "0" "90" "22" "21348002" "21348002" "subst" "0" "01804" "LZTR1_000150" "g.21348002G>T" "" "" "" "LZTR1(NM_006767.3):c.1312G>T (p.E438*), LZTR1(NM_006767.4):c.1312G>T (p.(Glu438Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000984124" "0" "30" "22" "21348460" "21348460" "subst" "4.15382E-5" "01804" "LZTR1_000261" "g.21348460C>T" "" "" "" "LZTR1(NM_006767.4):c.1517C>T (p.(Pro506Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984125" "0" "50" "22" "21350257" "21350257" "subst" "4.06345E-6" "01804" "LZTR1_000262" "g.21350257T>C" "" "" "" "LZTR1(NM_006767.4):c.2075T>C (p.(Phe692Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984126" "0" "30" "22" "21351018" "21351018" "subst" "0.015819" "01804" "LZTR1_000086" "g.21351018C>T" "" "" "" "LZTR1(NM_006767.3):c.2253C>T (p.F751=), LZTR1(NM_006767.4):c.2253C>T (p.F751=, p.(Phe751=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984127" "0" "70" "22" "21351090" "21351090" "subst" "0" "01804" "LZTR1_000087" "g.21351090G>T" "" "" "" "LZTR1(NM_006767.3):c.2325G>T (p.Q775H), LZTR1(NM_006767.4):c.2325G>T (p.(Gln775His), p.Q775H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000984128" "0" "70" "22" "21351236" "21351236" "subst" "6.50655E-5" "01804" "LZTR1_000201" "g.21351236T>C" "" "" "" "LZTR1(NM_006767.4):c.2387T>C (p.(Ile796Thr), p.I796T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005924" "0" "50" "22" "21340186" "21340186" "subst" "0" "01804" "LZTR1_000061" "g.21340186G>C" "" "" "" "LZTR1(NM_006767.3):c.320G>C (p.R107T, p.(Arg107Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005925" "0" "50" "22" "21341829" "21341829" "subst" "0" "01804" "LZTR1_000263" "g.21341829C>G" "" "" "" "LZTR1(NM_006767.3):c.357C>G (p.(Tyr119*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005926" "0" "70" "22" "21343969" "21343969" "subst" "0" "02329" "LZTR1_000160" "g.21343969G>T" "" "" "" "LZTR1(NM_006767.4):c.649G>T (p.E217*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005927" "0" "50" "22" "21346114" "21346114" "subst" "0" "01804" "LZTR1_000115" "g.21346114G>T" "" "" "" "LZTR1(NM_006767.3):c.989G>T (p.(Ser330Ile)), LZTR1(NM_006767.4):c.989G>T (p.S330I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005928" "0" "70" "22" "21346527" "21346527" "subst" "6.94286E-5" "01804" "LZTR1_000012" "g.21346527C>T" "" "" "" "LZTR1(NM_006767.3):c.1018C>T (p.(Arg340*)), LZTR1(NM_006767.4):c.1018C>T (p.R340*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005929" "0" "30" "22" "21346564" "21346564" "subst" "2.0315E-5" "01804" "LZTR1_000264" "g.21346564A>C" "" "" "" "LZTR1(NM_006767.3):c.1055A>C (p.(Tyr352Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005930" "0" "90" "22" "21347143" "21347143" "subst" "0" "01804" "LZTR1_000134" "g.21347143G>A" "" "" "" "LZTR1(NM_006767.3):c.1210G>A (p.(Gly404Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001005931" "0" "50" "22" "21347967" "21347967" "subst" "0" "01804" "LZTR1_000265" "g.21347967A>T" "" "" "" "LZTR1(NM_006767.3):c.1277A>T (p.(Lys426Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005932" "0" "30" "22" "21348243" "21348243" "subst" "2.87649E-5" "01804" "LZTR1_000266" "g.21348243A>G" "" "" "" "LZTR1(NM_006767.3):c.1384A>G (p.(Ile462Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005933" "0" "30" "22" "21348435" "21348435" "subst" "9.47176E-6" "01804" "LZTR1_000267" "g.21348435G>A" "" "" "" "LZTR1(NM_006767.3):c.1492G>A (p.(Gly498Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005934" "0" "50" "22" "21348499" "21348499" "subst" "4.3416E-6" "01804" "LZTR1_000074" "g.21348499G>C" "" "" "" "LZTR1(NM_006767.3):c.1556G>C (p.R519P, p.(Arg519Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005935" "0" "50" "22" "21348967" "21348967" "subst" "0" "01804" "LZTR1_000268" "g.21348967T>A" "" "" "" "LZTR1(NM_006767.3):c.1736T>A (p.(Val579Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005936" "0" "50" "22" "21349162" "21349162" "subst" "0" "01804" "LZTR1_000269" "g.21349162C>T" "" "" "" "LZTR1(NM_006767.3):c.1789C>T (p.(His597Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005937" "0" "50" "22" "21350154" "21350154" "subst" "4.50561E-5" "01804" "LZTR1_000195" "g.21350154C>T" "" "" "" "LZTR1(NM_006767.3):c.2062C>T (p.(Arg688Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005938" "0" "50" "22" "21351001" "21351001" "subst" "0" "02327" "LZTR1_000270" "g.21351001C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005939" "0" "50" "22" "21351042" "21351042" "subst" "0" "01804" "LZTR1_000148" "g.21351042C>G" "" "" "" "LZTR1(NM_006767.3):c.2277C>G (p.(Tyr759*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005940" "0" "70" "22" "21351220" "21351220" "del" "0" "02327" "LZTR1_000271" "g.21351220del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005941" "0" "50" "22" "21351551" "21351551" "subst" "4.07428E-6" "01804" "LZTR1_000272" "g.21351551A>G" "" "" "" "LZTR1(NM_006767.3):c.2437A>G (p.(Ser813Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005942" "0" "50" "22" "21351588" "21351588" "subst" "4.06848E-6" "01804" "LZTR1_000273" "g.21351588C>T" "" "" "" "LZTR1(NM_006767.3):c.2474C>T (p.(Ala825Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015909" "0" "50" "22" "21344732" "21344732" "subst" "2.84336E-5" "02325" "LZTR1_000274" "g.21344732C>T" "" "" "" "LZTR1(NM_006767.4):c.709C>T (p.R237W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015910" "0" "90" "22" "21344815" "21344815" "subst" "7.06074E-5" "02327" "LZTR1_000021" "g.21344815G>A" "" "" "" "LZTR1(NM_006767.4):c.791+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015911" "0" "30" "22" "21345980" "21345980" "subst" "0.000129185" "02325" "LZTR1_000275" "g.21345980C>T" "" "" "" "LZTR1(NM_006767.4):c.855C>T (p.Y285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015912" "0" "30" "22" "21346109" "21346109" "subst" "2.03727E-5" "02325" "LZTR1_000276" "g.21346109C>T" "" "" "" "LZTR1(NM_006767.4):c.984C>T (p.S328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015913" "0" "50" "22" "21348520" "21348520" "subst" "0" "02325" "LZTR1_000242" "g.21348520A>C" "" "" "" "LZTR1(NM_006767.4):c.1577A>C (p.Q526P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015914" "0" "90" "22" "21349239" "21349240" "del" "0" "02329" "LZTR1_000277" "g.21349239_21349240del" "" "" "" "LZTR1(NM_006767.4):c.1866_1867delTC (p.P623Tfs*45)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015915" "0" "50" "22" "21350372" "21350372" "subst" "0.000248517" "02325" "LZTR1_000187" "g.21350372C>T" "" "" "" "LZTR1(NM_006767.4):c.2190C>T (p.G730=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001022087" "0" "50" "22" "21351090" "21351090" "subst" "0" "04796" "LZTR1_000278" "g.21351090G>C" "" "" "" "" "effect on RNA inclusion of intron sequences" "Germline/De novo (untested)" "" "" "0" "" "" "g.20996801G>C" "" "VUS" "" "0001022216" "0" "70" "22" "21337383" "21337383" "subst" "4.06362E-6" "04796" "LZTR1_000279" "g.21337383G>T" "" "" "" "" "effect on RNA inclusion of intron sequences" "Germline/De novo (untested)" "" "" "0" "" "" "g.20983094G>T" "" "likely pathogenic" "" "0001022221" "0" "70" "22" "21340186" "21340186" "subst" "0" "04796" "LZTR1_000061" "g.21340186G>C" "" "" "" "" "multiple effects on RNA" "Germline/De novo (untested)" "" "" "0" "" "" "g.20985897G>C" "" "likely pathogenic" "" "0001022584" "0" "30" "22" "21351051" "21351051" "subst" "0" "03779" "LZTR1_000280" "g.21351051G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0001027369" "0" "10" "22" "21337308" "21337308" "subst" "0.00157171" "02329" "AIFM3_000007" "g.21337308C>T" "" "" "" "LZTR1(NM_006767.4):c.201-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027370" "0" "50" "22" "21341819" "21341819" "subst" "8.13948E-6" "02327" "LZTR1_000281" "g.21341819C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027371" "0" "30" "22" "21342351" "21342351" "subst" "0.000617294" "02329" "LZTR1_000282" "g.21342351C>T" "" "" "" "LZTR1(NM_006767.4):c.453C>T (p.D151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027372" "0" "10" "22" "21346485" "21346485" "subst" "0.70502" "02325" "LZTR1_000068" "g.21346485T>C" "" "" "" "LZTR1(NM_006767.3):c.994-18T>C, LZTR1(NM_006767.4):c.994-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027373" "0" "50" "22" "21347993" "21347993" "subst" "8.9945E-5" "02325" "LZTR1_000283" "g.21347993C>T" "" "" "" "LZTR1(NM_006767.4):c.1303C>T (p.R435W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027374" "0" "50" "22" "21348259" "21348285" "del" "0" "02327" "LZTR1_000072" "g.21348259_21348285del" "" "" "" "LZTR1(NM_006767.3):c.1400_1426delGCCGCTGGCTTCGCAGGAAGATCACGC (p.S467_Q476delinsK)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027796" "0" "90" "22" "21345973" "21345973" "subst" "0" "03779" "LZTR1_000093" "g.21345973G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1223430276" "0" "" "" "" "" "pathogenic" "" "0001043728" "0" "50" "22" "21341844" "21341844" "subst" "4.06256E-5" "01804" "LZTR1_000157" "g.21341844C>T" "" "" "" "LZTR1(NM_006767.4):c.372C>T (p.(Val124=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043729" "0" "30" "22" "21341882" "21341882" "subst" "1.6253E-5" "01804" "LZTR1_000063" "g.21341882C>T" "" "" "" "LZTR1(NM_006767.4):c.400+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043730" "0" "30" "22" "21342296" "21342296" "subst" "0" "01804" "LZTR1_000284" "g.21342296C>A" "" "" "" "LZTR1(NM_006767.4):c.401-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043731" "0" "50" "22" "21342386" "21342386" "subst" "9.75253E-5" "01804" "LZTR1_000285" "g.21342386C>T" "" "" "" "LZTR1(NM_006767.4):c.488C>T (p.(Thr163Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043732" "0" "90" "22" "21344694" "21344694" "dup" "0" "02327" "LZTR1_000110" "g.21344694dup" "" "" "" "LZTR1(NM_006767.3):c.671dup (p.(Ser227IlefsTer33)), LZTR1(NM_006767.3):c.671dupT (p.S227Ifs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043733" "0" "90" "22" "21344815" "21344815" "subst" "8.30675E-6" "01804" "LZTR1_000233" "g.21344815G>T" "" "" "" "LZTR1(NM_006767.4):c.791+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043734" "0" "90" "22" "21345975" "21345975" "subst" "0" "01804" "LZTR1_000014" "g.21345975C>T" "" "" "" "LZTR1(NM_006767.4):c.850C>T (p.(Arg284Cys), p.R284C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043735" "0" "70" "22" "21346027" "21346027" "subst" "0" "02325" "LZTR1_000286" "g.21346027G>T" "" "" "" "LZTR1(NM_006767.4):c.902G>T (p.G301V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001043736" "0" "50" "22" "21348225" "21348225" "subst" "1.23728E-5" "02325" "LZTR1_000151" "g.21348225G>A" "" "" "" "LZTR1(NM_006767.3):c.1366G>A (p.(Val456Met)), LZTR1(NM_006767.4):c.1366G>A (p.V456M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043737" "0" "30" "22" "21348565" "21348565" "subst" "1.7627E-5" "01804" "LZTR1_000287" "g.21348565C>G" "" "" "" "LZTR1(NM_006767.4):c.1615+7C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043738" "0" "70" "22" "21348918" "21348918" "subst" "4.07674E-6" "01804" "LZTR1_000081" "g.21348918G>C" "" "" "" "LZTR1(NM_006767.4):c.1687G>C (p.(Glu563Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001043739" "0" "50" "22" "21349228" "21349228" "subst" "4.06441E-5" "01804" "LZTR1_000194" "g.21349228C>T" "" "" "" "LZTR1(NM_006767.4):c.1855C>T (p.(Arg619Cys), p.R619C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043740" "0" "50" "22" "21350074" "21350074" "subst" "0" "01804" "LZTR1_000121" "g.21350074G>A" "" "" "" "LZTR1(NM_006767.3):c.1982G>A (p.G661E), LZTR1(NM_006767.4):c.1982G>A (p.G661E, p.(Gly661Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043741" "0" "90" "22" "21350360" "21350360" "subst" "4.06858E-6" "01804" "LZTR1_000288" "g.21350360C>A" "" "" "" "LZTR1(NM_006767.4):c.2178C>A (p.(Tyr726*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043742" "0" "30" "22" "21350369" "21350369" "subst" "0.00181275" "01804" "LZTR1_000099" "g.21350369C>T" "" "" "" "LZTR1(NM_006767.4):c.2187C>T (p.(Tyr729=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046804" "0" "50" "22" "21342388" "21342388" "subst" "0" "02325" "LZTR1_000289" "g.21342388G>A" "" "" "" "LZTR1(NM_006767.4):c.490G>A (p.E164K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046805" "0" "50" "22" "21346026" "21346026" "subst" "0" "02325" "LZTR1_000290" "g.21346026G>C" "" "" "" "LZTR1(NM_006767.4):c.901G>C (p.G301R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057079" "0" "90" "22" "21336687" "21336687" "dup" "0" "01804" "AIFM3_000013" "g.21336687dup" "" "" "" "LZTR1(NM_006767.4):c.27dup (p.(Gln10AlafsTer24))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001057080" "0" "50" "22" "21346071" "21346071" "subst" "5.27684E-5" "01804" "LZTR1_000094" "g.21346071G>A" "" "" "" "LZTR1(NM_006767.4):c.946G>A (p.(Val316Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057081" "0" "50" "22" "21347168" "21347168" "subst" "0" "01804" "LZTR1_000291" "g.21347168G>A" "" "" "" "LZTR1(NM_006767.4):c.1235G>A (p.(Arg412His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057082" "0" "50" "22" "21348250" "21348250" "subst" "0" "01804" "LZTR1_000292" "g.21348250C>T" "" "" "" "LZTR1(NM_006767.4):c.1391C>T (p.(Thr464Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057083" "0" "50" "22" "21348889" "21348889" "subst" "4.07877E-6" "01804" "LZTR1_000293" "g.21348889T>G" "" "" "" "LZTR1(NM_006767.4):c.1658T>G (p.(Leu553Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057084" "0" "50" "22" "21350271" "21350271" "subst" "2.43799E-5" "01804" "LZTR1_000020" "g.21350271C>T" "" "" "" "LZTR1(NM_006767.4):c.2089C>T (p.(Arg697Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057085" "0" "50" "22" "21350363" "21350363" "subst" "0" "01804" "LZTR1_000294" "g.21350363C>G" "" "" "" "LZTR1(NM_006767.4):c.2181C>G (p.(Ile727Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057086" "0" "50" "22" "21350984" "21350984" "subst" "0" "01804" "LZTR1_000295" "g.21350984G>A" "" "" "" "LZTR1(NM_006767.4):c.2220-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001061828" "0" "70" "22" "21341825" "21341825" "subst" "2.0326E-5" "03544" "LZTR1_000051" "g.21341825G>A" "" "" "" "" "" "De novo" "-" "rs769001939" "0" "" "" "g.20987536G>A" "{CV:1015410}" "likely pathogenic" "ACMG" "0001061857" "0" "90" "22" "21340117" "21340117" "subst" "4.46933E-5" "00006" "LZTR1_000054" "g.21340117G>A" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Unknown" "" "" "0" "" "" "g.20985828G>A" "" "pathogenic" "" "0001061858" "0" "90" "22" "21340117" "21340117" "subst" "4.46933E-5" "00006" "LZTR1_000054" "g.21340117G>A" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Unknown" "" "" "0" "" "" "g.20985828G>A" "" "pathogenic" "" "0001061860" "0" "90" "22" "21336687" "21336687" "del" "0" "00006" "LZTR1_000058" "g.21336687del" "" "{PMID:Smith 2015:25480913}" "" "27delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20982398del" "" "pathogenic" "" "0001061861" "11" "90" "22" "21336687" "21336687" "del" "0" "00006" "LZTR1_000058" "g.21336687del" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline" "" "" "0" "" "" "g.20982398del" "" "pathogenic" "" "0001061972" "11" "90" "22" "21341837" "21341837" "subst" "1.62534E-5" "00006" "LZTR1_000298" "g.21341837C>T" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline" "" "" "0" "" "" "g.20987548C>T" "" "pathogenic (dominant)" "" "0001061973" "21" "90" "22" "21348502" "21348502" "subst" "0" "00006" "LZTR1_000303" "g.21348502C>T" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline" "" "" "0" "" "" "g.20994213C>T" "" "pathogenic (dominant)" "" "0001061974" "11" "90" "22" "21350154" "21350154" "subst" "4.50561E-5" "00006" "LZTR1_000195" "g.21350154C>T" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20995865C>T" "" "pathogenic (dominant)" "" "0001061975" "0" "90" "22" "21351552" "21351552" "subst" "0" "00006" "LZTR1_000307" "g.21351552G>T" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20997263G>T" "" "pathogenic (dominant)" "" "0001061976" "11" "90" "22" "21351197" "21351200" "del" "0" "00006" "LZTR1_000306" "g.21351197_21351200del" "" "{PMID:Piotrowski 2014:24362817}" "" "2348_2351delCGCA" "" "Germline" "" "" "0" "" "" "g.20996908_20996911del" "" "pathogenic (dominant)" "" "0001061977" "11" "90" "22" "21343911" "21343911" "subst" "0" "00006" "LZTR1_000299" "g.21343911C>G" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20989622C>G" "" "pathogenic (dominant)" "" "0001061978" "11" "90" "22" "21348256" "21348256" "subst" "3.29731E-5" "00006" "LZTR1_000301" "g.21348256G>A" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline" "" "" "0" "" "" "g.20993967G>A" "" "pathogenic (dominant)" "" "0001061979" "0" "90" "22" "21337353" "21337353" "dup" "0" "00006" "LZTR1_000297" "g.21337353dup" "" "{PMID:Piotrowski 2014:24362817}" "" "238dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20983064dup" "" "pathogenic (dominant)" "" "0001061980" "0" "90" "22" "21347143" "21347143" "subst" "0" "00006" "LZTR1_000134" "g.21347143G>A" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20992854G>A" "" "pathogenic (dominant)" "" "0001061981" "0" "90" "22" "21348226" "21348226" "subst" "0" "00006" "LZTR1_000300" "g.21348226T>G" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20993937T>G" "" "pathogenic (dominant)" "" "0001061982" "0" "90" "22" "21348309" "21348309" "subst" "4.44227E-6" "00006" "LZTR1_000302" "g.21348309G>A" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20994020G>A" "" "pathogenic (dominant)" "" "0001061983" "0" "90" "22" "21348982" "21348982" "dup" "0" "00006" "LZTR1_000304" "g.21348982dup" "" "{PMID:Piotrowski 2014:24362817}" "" "1751dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20994693dup" "" "pathogenic (dominant)" "" "0001061984" "0" "90" "22" "21350154" "21350154" "subst" "4.50561E-5" "00006" "LZTR1_000195" "g.21350154C>T" "" "{PMID:Piotrowski 2014:24362817}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20995865C>T" "" "pathogenic (dominant)" "" "0001061985" "0" "30" "22" "21350969" "21350971" "del" "4.07425E-6" "00006" "LZTR1_000305" "g.21350969_21350971del" "" "{PMID:Piotrowski 2014:24362817}" "" "2220-16_2220-14delCTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.20996680_20996682del" "" "likely benign" "" "0001067461" "0" "50" "22" "21337317" "21337317" "subst" "0" "02325" "AIFM3_000014" "g.21337317C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067462" "0" "90" "22" "21341825" "21341825" "subst" "2.0326E-5" "01804" "LZTR1_000051" "g.21341825G>A" "" "" "" "LZTR1(NM_006767.4):c.353G>A (p.(Arg118His), p.R118H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001067463" "0" "90" "22" "21342363" "21342363" "subst" "8.12334E-6" "02325" "LZTR1_000308" "g.21342363C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001067464" "0" "50" "22" "21346042" "21346042" "subst" "0" "02325" "LZTR1_000309" "g.21346042C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067465" "0" "90" "22" "21348002" "21348002" "subst" "0" "02325" "LZTR1_000150" "g.21348002G>T" "" "" "" "LZTR1(NM_006767.3):c.1312G>T (p.E438*), LZTR1(NM_006767.4):c.1312G>T (p.(Glu438Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001067466" "0" "50" "22" "21349796" "21349796" "subst" "7.24638E-5" "02325" "LZTR1_000310" "g.21349796C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067467" "0" "50" "22" "21350271" "21350271" "subst" "2.43799E-5" "02325" "LZTR1_000020" "g.21350271C>T" "" "" "" "LZTR1(NM_006767.4):c.2089C>T (p.(Arg697Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001068266" "0" "70" "22" "21341834" "21341834" "subst" "0" "03779" "LZTR1_000311" "g.21341834A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001068267" "0" "50" "22" "21341834" "21341834" "subst" "0" "03779" "LZTR1_000311" "g.21341834A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001068316" "0" "50" "22" "21351543" "21351543" "subst" "1.2234E-5" "03779" "LZTR1_000050" "g.21351543G>A" "" "" "" "" "" "Unknown" "" "rs200195452" "0" "" "" "" "" "VUS" "" "0001068430" "0" "70" "22" "21341834" "21341834" "subst" "0" "03779" "LZTR1_000311" "g.21341834A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001071210" "0" "50" "22" "21351215" "21351215" "subst" "0" "03779" "LZTR1_000048" "g.21351215A>G" "" "" "" "" "" "Unknown" "" "rs1370157440" "0" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes LZTR1 ## Count = 467 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000037617" "00011623" "90" "1807" "0" "1807" "0" "c.1807del" "r.(?)" "p.(Val603*)" "16" "0000037618" "00011623" "90" "1779" "0" "1779" "0" "c.1779del" "r.(?)" "p.(Gln593Hisfs*7)" "15" "0000037619" "00011623" "90" "1373" "0" "1373" "0" "c.1373dup" "r.(?)" "p.(His459Profs*210)" "13" "0000037620" "00011623" "70" "1394" "0" "1394" "0" "c.1394C>A" "r.(?)" "p.(Ala465Glu)" "13" "0000037621" "00011623" "70" "560" "0" "560" "0" "c.560T>G" "r.(?)" "p.(Leu187Arg)" "6" "0000037622" "00011623" "90" "2284" "0" "2284" "0" "c.2284C>T" "r.(?)" "p.(Gln762*)" "19" "0000037623" "00011623" "90" "555" "0" "556" "0" "c.555_556dup" "r.(?)" "p.(Lys186Thrfs*15)" "6" "0000037624" "00011623" "90" "628" "0" "628" "0" "c.628C>T" "r.(?)" "p.(Arg210*)" "7" "0000037625" "00011623" "90" "513" "0" "513" "0" "c.513del" "r.(?)" "p.(Leu171Phefs*29)" "6" "0000037626" "00011623" "90" "1602" "0" "1602" "0" "c.1602del" "r.(?)" "p.(Lys534Asnfs*22)" "14" "0000037628" "00011623" "70" "373" "0" "375" "0" "c.373_375del" "r.(?)" "p.(Val125del)" "4" "0000037629" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340*)" "10" "0000037630" "00011623" "90" "2487" "0" "2487" "0" "c.2487dup" "r.(?)" "p.(Asp830Argfs*21)" "21" "0000037631" "00011623" "70" "850" "0" "850" "0" "c.850C>T" "r.(?)" "p.(Arg284Cys)" "9" "0000037632" "00011623" "90" "1486" "0" "1486" "0" "c.1486del" "r.(?)" "p.(Ala496Profs*60)" "14" "0000037633" "00011623" "70" "2278" "0" "2278" "0" "c.2278T>C" "r.(?)" "p.(Cys760Arg)" "19" "0000037634" "00011623" "90" "243" "0" "243" "0" "c.243T>G" "r.(?)" "p.(Tyr81*)" "2" "0000037635" "00011623" "90" "352" "0" "352" "0" "c.352dup" "r.(?)" "p.(Arg118Profs*28)" "4" "0000037636" "00011623" "70" "1199" "0" "1199" "0" "c.1199T>G" "r.(?)" "p.(Met400Arg)" "11" "0000037637" "00011623" "70" "2089" "0" "2089" "0" "c.2089C>T" "r.(?)" "p.(Arg697Trp)" "18" "0000037638" "00011623" "70" "791" "1" "791" "1" "c.791+1G>A" "r.spl?" "p.?" "8" "0000037639" "00011623" "70" "212" "0" "212" "0" "c.212A>G" "r.(?)" "p.(His71Arg)" "2" "0000079363" "00011623" "00" "-2447622" "0" "115005" "0" "c.-2447622_*112482del" "r.0?" "p.0?" "_1_21_" "0000079439" "00011623" "00" "-2497374" "0" "481448" "0" "c.-2497374_*478925dup" "r.?" "p.?" "_1_21_" "0000079467" "00011623" "00" "-2313498" "0" "115005" "0" "c.-2313498_*112482del" "r.0?" "p.0?" "_1_21_" "0000079538" "00011623" "00" "-2443098" "0" "115005" "0" "c.-2443098_*112482del" "r.0?" "p.0?" "_1_21_" "0000156614" "00011623" "90" "169" "0" "169" "0" "c.169C>T" "r.169c>u" "p.Arg57*" "1" "0000156680" "00011623" "90" "8388607" "0" "8388607" "0" "c.*8700015C>T" "r.(=)" "p.(=)" "6" "0000156686" "00011623" "90" "169" "0" "169" "0" "c.169C>T" "r.169c>u" "p.Arg57*" "1" "0000156691" "00011623" "90" "264" "-13" "264" "-13" "c.264-13G>A" "r.(263_264ins264-11_264-1)" "p.(Lys86CysfsTer16)" "2i" "0000156692" "00011623" "90" "264" "-13" "264" "-13" "c.264-13G>A" "r.(263_264ins264-11_264-1)" "p.(Lys86CysfsTer16)" "2i" "0000156693" "00011623" "50" "652" "-34" "652" "-34" "c.652-34G>T" "r.spl?" "p.(=)" "7i" "0000156694" "00011623" "90" "993" "1" "993" "1" "c.993+1G>T" "r.spl" "p.?" "9i" "0000156695" "00011623" "90" "1260" "2" "1260" "2" "c.1260+2T>C" "r.spl?" "p.?" "11i" "0000156696" "00011623" "90" "2407" "-2" "2407" "-2" "c.2407-2A>G" "r.spl" "p.?" "20i" "0000156697" "00011623" "90" "-1" "0" "2524" "0" "c.(?_-1)_(*1_?)del" "r.0" "p.0" "_1_21_" "0000156698" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10Argfs*15)" "1" "0000156699" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10Argfs*15)" "1" "0000156700" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0000156701" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0000156702" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0000156703" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0000156704" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0000156705" "00011623" "90" "428" "0" "428" "0" "c.428del" "r.(?)" "p.(Asn143Ilefs*4)" "5" "0000156706" "00011623" "90" "685" "0" "692" "0" "c.685_692del" "r.(?)" "p.(Cys229Profs*28)" "8" "0000156707" "00011623" "50" "764" "0" "764" "0" "c.764T>G" "r.(?)" "p.(Leu255Arg)" "8" "0000156708" "00011623" "50" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "9" "0000156709" "00011623" "90" "891" "0" "891" "0" "c.891T>G" "r.(?)" "p.(Tyr297*)" "9" "0000156710" "00011623" "90" "967" "0" "980" "0" "c.967_980del" "r.(?)" "p.(Val323Leufs*9)" "9" "0000156711" "00011623" "90" "1015" "0" "1015" "0" "c.1015G>T" "r.(?)" "p.(Glu339Ter)" "10" "0000156712" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362*)" "10" "0000156713" "00011623" "90" "1126" "0" "1126" "0" "c.1126C>T" "r.(?)" "p.(Gln376*)" "10" "0000156714" "00011623" "90" "1299" "0" "1299" "0" "c.1299C>G" "r.(?)" "p.(Tyr433*)" "12" "0000156715" "00011623" "50" "1394" "0" "1394" "0" "c.1394C>T" "r.(?)" "p.(Ala465Val)" "13" "0000156716" "00011623" "50" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Trp)" "13" "0000156717" "00011623" "90" "1576" "0" "1576" "0" "c.1576C>T" "r.(?)" "p.(Gln526*)" "14" "0000156718" "00011623" "50" "1697" "0" "1697" "0" "c.1697G>T" "r.(?)" "p.(Cys566Phe)" "15" "0000156719" "00011623" "90" "1957" "0" "1957" "0" "c.1957dup" "r.(?)" "p.(Gln653Profs*16)" "17" "0000156720" "00011623" "50" "1964" "0" "1964" "0" "c.1964T>A" "r.(?)" "p.(Met655Lys)" "17" "0000156721" "00011623" "70" "2063" "0" "2063" "0" "c.2063G>A" "r.(?)" "p.(Arg688His)" "17" "0000156722" "00011623" "50" "2366" "0" "2366" "0" "c.2366A>G" "r.(?)" "p.(Lys789Arg)" "20" "0000156723" "00011623" "70" "2429" "0" "2429" "0" "c.2429G>A" "r.(?)" "p.(Arg810Gln)" "21" "0000250331" "00011623" "30" "785" "0" "785" "0" "c.785A>G" "r.(?)" "p.(Asp262Gly)" "" "0000253945" "00011623" "10" "1785" "21" "1785" "21" "c.1785+21A>G" "r.(=)" "p.(=)" "" "0000283611" "00011623" "10" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Phe403=)" "" "0000283612" "00011623" "30" "1530" "0" "1530" "0" "c.1530C>T" "r.(?)" "p.(His510=)" "" "0000283613" "00011623" "30" "1563" "0" "1563" "0" "c.1563C>T" "r.(?)" "p.(Phe521=)" "" "0000283615" "00011623" "30" "2069" "12" "2069" "12" "c.2069+12C>T" "r.(=)" "p.(=)" "" "0000283616" "00011623" "10" "2160" "0" "2160" "0" "c.2160C>T" "r.(?)" "p.(Phe720=)" "" "0000283617" "00011623" "10" "321" "-14" "321" "-3" "c.321-14_321-3del" "r.spl?" "p.?" "" "0000283618" "00011623" "30" "400" "10" "400" "10" "c.400+10C>T" "r.(=)" "p.(=)" "" "0000291280" "00011623" "30" "1260" "17" "1260" "17" "c.1260+17C>A" "r.(=)" "p.(=)" "" "0000291281" "00011623" "30" "1395" "0" "1395" "0" "c.1395G>A" "r.(?)" "p.(Ala465=)" "" "0000291282" "00011623" "50" "1400" "0" "1426" "0" "c.1400_1426del" "r.(?)" "p.(Ser467_Gln476delinsLys)" "" "0000291283" "00011623" "30" "1530" "0" "1530" "0" "c.1530C>T" "r.(?)" "p.(His510=)" "" "0000291284" "00011623" "50" "1556" "0" "1556" "0" "c.1556G>C" "r.(?)" "p.(Arg519Pro)" "" "0000291285" "00011623" "90" "1615" "2" "1615" "2" "c.1615+2T>G" "r.spl?" "p.?" "" "0000291286" "00011623" "30" "1623" "0" "1623" "0" "c.1623G>A" "r.(?)" "p.(Val541=)" "" "0000291287" "00011623" "10" "1683" "0" "1683" "0" "c.1683C>T" "r.(?)" "p.(Arg561=)" "" "0000291288" "00011623" "50" "1762" "0" "1762" "0" "c.1762C>T" "r.(?)" "p.(Arg588Trp)" "" "0000291289" "00011623" "50" "1785" "0" "1785" "0" "c.1785G>C" "r.(?)" "p.(Lys595Asn)" "" "0000291290" "00011623" "10" "210" "0" "210" "0" "c.210G>A" "r.(?)" "p.(Lys70=)" "" "0000291291" "00011623" "10" "2253" "0" "2253" "0" "c.2253C>T" "r.(?)" "p.(Phe751=)" "" "0000291292" "00011623" "50" "2325" "0" "2325" "0" "c.2325G>T" "r.(?)" "p.(Gln775His)" "" "0000291293" "00011623" "50" "2428" "0" "2428" "0" "c.2428C>T" "r.(?)" "p.(Arg810Trp)" "" "0000291294" "00011623" "50" "320" "0" "320" "0" "c.320G>C" "r.(?)" "p.(Arg107Thr)" "" "0000291295" "00011623" "50" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Arg170Gln)" "" "0000291296" "00011623" "30" "543" "0" "543" "0" "c.543G>A" "r.(?)" "p.(Thr181=)" "" "0000291297" "00011623" "10" "651" "24" "651" "24" "c.651+24C>T" "r.(=)" "p.(=)" "" "0000291299" "00011623" "10" "994" "-18" "994" "-18" "c.994-18T>C" "r.(=)" "p.(=)" "" "0000328910" "00011623" "50" "1579" "0" "1579" "0" "c.1579T>C" "r.(?)" "p.(Phe527Leu)" "" "0000328911" "00011623" "50" "1615" "5" "1615" "5" "c.1615+5G>A" "r.spl?" "p.?" "" "0000337473" "00011623" "10" "994" "-18" "994" "-18" "c.994-18T>C" "r.(=)" "p.(=)" "" "0000337474" "00011623" "30" "1615" "4" "1615" "4" "c.1615+4C>T" "r.spl?" "p.?" "" "0000337475" "00011623" "10" "1785" "21" "1785" "21" "c.1785+21A>G" "r.(=)" "p.(=)" "" "0000339634" "00011623" "10" "210" "0" "210" "0" "c.210G>A" "r.(?)" "p.(Lys70=)" "" "0000340686" "00011623" "10" "1683" "0" "1683" "0" "c.1683C>T" "r.(?)" "p.(Arg561=)" "" "0000340787" "00011623" "50" "1242" "0" "1242" "0" "c.1242G>T" "r.(?)" "p.(Gly414=)" "" "0000340888" "00011623" "10" "2253" "0" "2253" "0" "c.2253C>T" "r.(?)" "p.(Phe751=)" "" "0000341044" "00011623" "30" "2187" "0" "2187" "0" "c.2187C>T" "r.(?)" "p.(Tyr729=)" "" "0000341584" "00011623" "90" "223" "0" "223" "0" "c.223dup" "r.(?)" "p.(Ala75GlyfsTer3)" "" "0000342233" "00011623" "90" "628" "0" "628" "0" "c.628C>T" "r.(?)" "p.(Arg210Ter)" "" "0000342528" "00011623" "90" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283Gln)" "" "0000344141" "00011623" "30" "1723" "0" "1723" "0" "c.1723G>A" "r.(?)" "p.(Asp575Asn)" "" "0000344962" "00011623" "90" "2325" "0" "2325" "0" "c.2325G>T" "r.(?)" "p.(Gln775His)" "" "0000345904" "00011623" "90" "742" "0" "742" "0" "c.742G>A" "r.(?)" "p.(Gly248Arg)" "" "0000349712" "00011623" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Trp165Ter)" "" "0000350473" "00011623" "50" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Val316Met)" "" "0000437682" "00011623" "90" "844" "0" "844" "0" "c.844C>T" "r.(844c>u)" "p.(Gln282*)" "9" "0000437683" "00011623" "90" "154" "0" "154" "0" "c.154del" "r.(154del)" "p.(His52Ilefs*49)" "1" "0000437684" "00011623" "90" "1394" "0" "1394" "0" "c.1394C>T" "r.(1394c>u)" "p.(Ala465Val)" "13" "0000437685" "00011623" "90" "161" "0" "161" "0" "c.161G>A" "r.(161g>a)" "p.(Trp54*)" "1" "0000440058" "00011623" "50" "20" "0" "20" "0" "c.20dup" "r.(?)" "p.Gln10Alafs*24" "" "0000474894" "00011623" "70" "2208" "0" "2208" "0" "c.2208del" "r.(?)" "p.(Glu737Argfs*30)" "" "0000571456" "00011623" "50" "22" "0" "22" "0" "c.22G>T" "r.(?)" "p.(Gly8Trp)" "" "0000571457" "00011623" "10" "210" "0" "210" "0" "c.210G>A" "r.(?)" "p.(Lys70=)" "" "0000571458" "00011623" "50" "245" "0" "245" "0" "c.245T>A" "r.(?)" "p.(Val82Glu)" "" "0000571459" "00011623" "10" "320" "12" "320" "12" "c.320+12C>T" "r.(=)" "p.(=)" "" "0000571460" "00011623" "50" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "" "0000571461" "00011623" "50" "400" "4" "400" "4" "c.400+4A>G" "r.spl?" "p.?" "" "0000571462" "00011623" "10" "651" "24" "651" "24" "c.651+24C>T" "r.(=)" "p.(=)" "" "0000571463" "00011623" "10" "651" "31" "651" "48" "c.651+31_651+48delinsGGAGGAGGTGAGGGGCAT" "r.(=)" "p.(=)" "" "0000571464" "00011623" "10" "651" "31" "651" "67" "c.651+31_651+67del" "r.(=)" "p.(=)" "" "0000571465" "00011623" "90" "671" "0" "671" "0" "c.671dup" "r.(?)" "p.(Ser227IlefsTer33)" "" "0000571466" "00011623" "70" "671" "0" "671" "0" "c.671dup" "r.(?)" "p.(Ser227IlefsTer33)" "" "0000571467" "00011623" "50" "677" "0" "677" "0" "c.677C>A" "r.(?)" "p.(Pro226Gln)" "" "0000571468" "00011623" "90" "742" "0" "742" "0" "c.742G>A" "r.(?)" "p.(Gly248Arg)" "" "0000571469" "00011623" "50" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Trp)" "" "0000571470" "00011623" "70" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283Gln)" "" "0000571471" "00011623" "90" "864" "0" "864" "0" "c.864del" "r.(?)" "p.(Met289TrpfsTer62)" "" "0000571472" "00011623" "30" "945" "0" "945" "0" "c.945C>T" "r.(?)" "p.(Asp315=)" "" "0000571473" "00011623" "50" "989" "0" "989" "0" "c.989G>T" "r.(?)" "p.(Ser330Ile)" "" "0000571474" "00011623" "10" "994" "-18" "994" "-18" "c.994-18T>C" "r.(=)" "p.(=)" "" "0000571477" "00011623" "30" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Phe403=)" "" "0000571478" "00011623" "70" "1234" "0" "1234" "0" "c.1234C>T" "r.(?)" "p.(Arg412Cys)" "" "0000571479" "00011623" "50" "1307" "0" "1307" "0" "c.1307T>G" "r.(?)" "p.(Leu436Arg)" "" "0000571480" "00011623" "30" "1395" "0" "1395" "0" "c.1395G>A" "r.(?)" "p.(Ala465=)" "" "0000571481" "00011623" "50" "1531" "0" "1531" "0" "c.1531G>A" "r.(?)" "p.(Val511Met)" "" "0000571482" "00011623" "50" "1564" "0" "1564" "0" "c.1564G>A" "r.(?)" "p.(Glu522Lys)" "" "0000571483" "00011623" "10" "1683" "0" "1683" "0" "c.1683C>T" "r.(?)" "p.(Arg561=)" "" "0000571484" "00011623" "70" "1687" "0" "1687" "0" "c.1687G>C" "r.(?)" "p.(Glu563Gln)" "" "0000571485" "00011623" "50" "1982" "0" "1982" "0" "c.1982G>A" "r.(?)" "p.(Gly661Glu)" "" "0000571486" "00011623" "50" "2089" "0" "2089" "0" "c.2089C>T" "r.(?)" "p.(Arg697Trp)" "" "0000571487" "00011623" "70" "2090" "0" "2090" "0" "c.2090G>A" "r.(?)" "p.(Arg697Gln)" "" "0000571488" "00011623" "10" "2160" "0" "2160" "0" "c.2160C>T" "r.(?)" "p.(Phe720=)" "" "0000571489" "00011623" "10" "2160" "0" "2160" "0" "c.2160C>T" "r.(?)" "p.(Phe720=)" "" "0000571490" "00011623" "50" "2168" "0" "2168" "0" "c.2168T>C" "r.(?)" "p.(Met723Thr)" "" "0000571491" "00011623" "30" "2219" "13" "2219" "13" "c.2219+13C>T" "r.(=)" "p.(=)" "" "0000571492" "00011623" "10" "2219" "13" "2219" "13" "c.2219+13C>T" "r.(=)" "p.(=)" "" "0000571494" "00011623" "90" "2295" "0" "2296" "0" "c.2295_2296del" "r.(?)" "p.(Glu765AspfsTer16)" "" "0000571495" "00011623" "90" "2325" "0" "2325" "0" "c.2325G>T" "r.(?)" "p.(Gln775His)" "" "0000571496" "00011623" "10" "2373" "0" "2373" "0" "c.2373C>T" "r.(?)" "p.(His791=)" "" "0000604249" "00011623" "90" "890" "0" "891" "0" "c.890_891del" "r.(?)" "p.(Tyr297Cysfs*18)" "" "0000618477" "00011623" "30" "26" "0" "26" "0" "c.26G>A" "r.(?)" "p.(Gly9Glu)" "" "0000618478" "00011623" "70" "264" "-13" "264" "-13" "c.264-13G>A" "r.(=)" "p.(=)" "" "0000618479" "00011623" "50" "273" "0" "273" "0" "c.273G>A" "r.(?)" "p.(Met91Ile)" "" "0000618480" "00011623" "70" "403" "0" "403" "0" "c.403G>T" "r.(?)" "p.(Gly135Cys)" "" "0000618481" "00011623" "50" "690" "0" "690" "0" "c.690C>A" "r.(?)" "p.(Asn230Lys)" "" "0000618482" "00011623" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Gln257Ter)" "" "0000618483" "00011623" "50" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000618484" "00011623" "70" "1210" "0" "1210" "0" "c.1210G>A" "r.(?)" "p.(Gly404Arg)" "" "0000618485" "00011623" "50" "1330" "0" "1330" "0" "c.1330G>T" "r.(?)" "p.(Asp444Tyr)" "" "0000618486" "00011623" "30" "1342" "0" "1342" "0" "c.1342G>A" "r.(?)" "p.(Val448Met)" "" "0000618487" "00011623" "30" "1563" "0" "1563" "0" "c.1563C>T" "r.(?)" "p.(Phe521=)" "" "0000618488" "00011623" "50" "2090" "0" "2090" "0" "c.2090G>A" "r.(?)" "p.(Arg697Gln)" "" "0000624263" "00011623" "10" "320" "12" "320" "12" "c.320+12C>T" "r.(=)" "p.(=)" "" "0000624264" "00011623" "50" "797" "0" "797" "0" "c.797C>G" "r.(?)" "p.(Thr266Arg)" "" "0000624265" "00011623" "50" "1165" "0" "1165" "0" "c.1165C>T" "r.(?)" "p.(Leu389Phe)" "" "0000624266" "00011623" "30" "1616" "-5" "1616" "-5" "c.1616-5C>T" "r.spl?" "p.?" "" "0000624267" "00011623" "50" "2092" "0" "2092" "0" "c.2092T>C" "r.(?)" "p.(Ser698Pro)" "" "0000624268" "00011623" "50" "2348" "0" "2348" "0" "c.2348C>T" "r.(?)" "p.(Thr783Met)" "" "0000653535" "00011623" "70" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Trp)" "" "0000658887" "00011623" "10" "201" "-13" "201" "-13" "c.201-13C>T" "r.(=)" "p.(=)" "" "0000658888" "00011623" "10" "201" "-8" "201" "-8" "c.201-8C>T" "r.(=)" "p.(=)" "" "0000658889" "00011623" "50" "320" "0" "320" "0" "c.320G>C" "r.(?)" "p.(Arg107Thr)" "" "0000658890" "00011623" "70" "320" "2" "320" "2" "c.320+2T>G" "r.spl?" "p.?" "" "0000658891" "00011623" "50" "662" "0" "662" "0" "c.662G>A" "r.(?)" "p.(Ser221Asn)" "" "0000658892" "00011623" "10" "741" "0" "741" "0" "c.741C>T" "r.(?)" "p.(Ser247=)" "" "0000658893" "00011623" "50" "985" "0" "985" "0" "c.985G>A" "r.(?)" "p.(Asp329Asn)" "" "0000658895" "00011623" "50" "1685" "0" "1702" "0" "c.1685_1702del" "r.(?)" "p.(Leu562_Arg567del)" "" "0000658896" "00011623" "90" "1910" "0" "1910" "0" "c.1910del" "r.(?)" "p.(Pro637LeufsTer15)" "" "0000658897" "00011623" "50" "1964" "0" "1964" "0" "c.1964T>C" "r.(?)" "p.(Met655Thr)" "" "0000658898" "00011623" "30" "2058" "0" "2058" "0" "c.2058C>T" "r.(?)" "p.(Ala686=)" "" "0000658899" "00011623" "10" "2253" "0" "2253" "0" "c.2253C>T" "r.(?)" "p.(Phe751=)" "" "0000658900" "00011623" "10" "2373" "0" "2373" "0" "c.2373C>T" "r.(?)" "p.(His791=)" "" "0000658901" "00011623" "50" "2405" "0" "2405" "0" "c.2405A>G" "r.(?)" "p.(Lys802Arg)" "" "0000659775" "00011623" "70" "2277" "0" "2277" "0" "c.2277C>G" "r.(?)" "p.(Tyr759*)" "" "0000663697" "00011623" "70" "352" "0" "352" "0" "c.352del" "r.(?)" "p.(Arg118Valfs*29)" "" "0000681800" "00011623" "70" "264" "-13" "264" "-13" "c.264-13G>A" "r.(=)" "p.(=)" "" "0000681801" "00011623" "90" "1312" "0" "1312" "0" "c.1312G>T" "r.(?)" "p.(Glu438Ter)" "" "0000681802" "00011623" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Val456Met)" "" "0000681803" "00011623" "50" "1889" "0" "1889" "0" "c.1889G>A" "r.(?)" "p.(Arg630Gln)" "" "0000693116" "00011623" "50" "320" "5" "320" "5" "c.320+5G>T" "r.spl?" "p.?" "" "0000693117" "00011623" "70" "359" "0" "359" "0" "c.359A>T" "r.(?)" "p.(His120Leu)" "" "0000693118" "00011623" "30" "543" "0" "543" "0" "c.543G>A" "r.(?)" "p.(Thr181=)" "" "0000693119" "00011623" "30" "990" "0" "990" "0" "c.990C>T" "r.(?)" "p.(Ser330=)" "" "0000693120" "00011623" "90" "1365" "0" "1365" "0" "c.1365C>A" "r.(?)" "p.(Cys455Ter)" "" "0000698017" "00011623" "50" "271" "0" "271" "0" "c.271A>G" "r.(?)" "p.(Met91Val)" "" "0000698018" "00011623" "50" "372" "0" "372" "0" "c.372C>T" "r.(?)" "p.(=)" "" "0000698019" "00011623" "50" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Arg170Gln)" "" "0000709017" "00011623" "90" "604" "0" "605" "0" "c.604_605del" "r.(?)" "p.(Met202Valfs*57)" "" "0000709020" "00011623" "90" "2440" "0" "2440" "0" "c.2440C>T" "r.(?)" "p.(Gln814*)" "" "0000728049" "00011623" "50" "59" "0" "59" "0" "c.59C>T" "r.(?)" "p.(Ala20Val)" "" "0000728050" "00011623" "90" "649" "0" "649" "0" "c.649G>T" "r.(?)" "p.(Glu217*)" "" "0000728051" "00011623" "30" "1014" "0" "1014" "0" "c.1014C>T" "r.(?)" "p.(Pro338=)" "" "0000728052" "00011623" "30" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Phe403=)" "" "0000728053" "00011623" "70" "1648" "0" "1648" "0" "c.1648G>A" "r.(?)" "p.(Val550Met)" "" "0000728054" "00011623" "90" "1664" "0" "1664" "0" "c.1664del" "r.(?)" "p.(Leu555Argfs*37)" "" "0000728055" "00011623" "90" "1942" "2" "1942" "2" "c.1942+2T>G" "r.spl?" "p.?" "" "0000728056" "00011623" "30" "2058" "0" "2058" "0" "c.2058C>T" "r.(?)" "p.(Ala686=)" "" "0000736493" "00011623" "70" "1687" "0" "1687" "0" "c.1687G>C" "r.(?)" "p.(Glu563Gln)" "" "0000760761" "00011623" "70" "1149" "1" "1149" "1" "c.1149+1G>A" "r.(?)" "p.(?)" "" "0000760762" "00011623" "70" "1696" "0" "1696" "0" "c.1696T>C" "r.(?)" "p.(Cys566Arg)" "" "0000785729" "00011623" "70" "352" "0" "352" "0" "c.352dup" "r.(?)" "p.(Arg118ProfsTer28)" "" "0000785730" "00011623" "50" "1763" "0" "1763" "0" "c.1763G>C" "r.(?)" "p.(Arg588Pro)" "" "0000797466" "00011623" "70" "264" "-13" "264" "-13" "c.264-13G>A" "r.(=)" "p.(=)" "" "0000809497" "00011623" "70" "784" "0" "784" "0" "c.784del" "r.(?)" "p.(Asp262Thrfs*89)" "" "0000809498" "00011623" "50" "816" "0" "816" "0" "c.816C>A" "r.(?)" "p.(His272Gln)" "" "0000809499" "00011623" "50" "1145" "0" "1145" "0" "c.1145C>T" "r.(?)" "p.(Ser382Leu)" "" "0000809500" "00011623" "50" "1234" "0" "1234" "0" "c.1234C>T" "r.(?)" "p.(Arg412Cys)" "" "0000809501" "00011623" "30" "1354" "-4" "1354" "-4" "c.1354-4G>A" "r.spl?" "p.?" "" "0000809502" "00011623" "50" "1615" "5" "1615" "5" "c.1615+5G>A" "r.spl?" "p.?" "" "0000809503" "00011623" "10" "1962" "0" "1962" "0" "c.1962C>T" "r.(?)" "p.(Asp654=)" "" "0000809504" "00011623" "30" "2130" "0" "2130" "0" "c.2130C>T" "r.(?)" "p.(Ile710=)" "" "0000809505" "00011623" "10" "2219" "13" "2219" "13" "c.2219+13C>T" "r.(=)" "p.(=)" "" "0000809506" "00011623" "50" "2309" "0" "2309" "0" "c.2309T>C" "r.(?)" "p.(Val770Ala)" "" "0000809507" "00011623" "50" "2317" "0" "2317" "0" "c.2317G>A" "r.(?)" "p.(Val773Met)" "" "0000809508" "00011623" "30" "2326" "-5" "2326" "-5" "c.2326-5T>C" "r.spl?" "p.?" "" "0000810839" "00011623" "50" "677" "0" "677" "0" "c.677del" "r.(?)" "p.(Pro226Hisfs*26)" "" "0000814308" "00011623" "30" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "" "0000856064" "00011623" "30" "509" "44" "509" "44" "c.509+44G>T" "r.(=)" "p.(=)" "" "0000856065" "00011623" "30" "594" "-196" "594" "-196" "c.594-196C>T" "r.(=)" "p.(=)" "" "0000856066" "00011623" "30" "756" "0" "756" "0" "c.756C>T" "r.(?)" "p.(Thr252=)" "" "0000856067" "00011623" "70" "763" "0" "763" "0" "c.763C>T" "r.(?)" "p.(Leu255Phe)" "" "0000856068" "00011623" "50" "1294" "0" "1294" "0" "c.1294G>T" "r.(?)" "p.(Asp432Tyr)" "" "0000856069" "00011623" "50" "2200" "0" "2200" "0" "c.2200A>G" "r.(?)" "p.(Met734Val)" "" "0000856070" "00011623" "50" "2248" "0" "2248" "0" "c.2248G>T" "r.(?)" "p.(Gly750Cys)" "" "0000856071" "00011623" "30" "2307" "0" "2307" "0" "c.2307G>A" "r.(?)" "p.(Thr769=)" "" "0000866732" "00011623" "10" "651" "24" "651" "29" "c.651+24_651+29del" "r.(=)" "p.(=)" "" "0000866733" "00011623" "90" "791" "1" "791" "1" "c.791+1G>A" "r.spl?" "p.?" "" "0000866734" "00011623" "50" "1519" "0" "1519" "0" "c.1519C>T" "r.(?)" "p.(Pro507Ser)" "" "0000866735" "00011623" "10" "1530" "0" "1530" "0" "c.1530C>T" "r.(?)" "p.(His510=)" "" "0000866736" "00011623" "50" "1555" "0" "1555" "0" "c.1555C>T" "r.(?)" "p.(Arg519Trp)" "" "0000866737" "00011623" "50" "2190" "0" "2190" "0" "c.2190C>T" "r.(?)" "p.(Gly730=)" "" "0000866738" "00011623" "30" "2555" "0" "2555" "0" "c.*32C>T" "r.(=)" "p.(=)" "" "0000873318" "00011623" "70" "708" "0" "708" "0" "c.708C>A" "r.(?)" "p.(Cys236*)" "" "0000895593" "00011623" "70" "272" "0" "272" "0" "c.272T>C" "r.(?)" "p.(Met91Thr)" "" "0000895594" "00011623" "50" "418" "0" "418" "0" "c.418A>G" "r.(?)" "p.(Ile140Val)" "" "0000895595" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362*)" "" "0000895596" "00011623" "70" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Trp)" "" "0000895597" "00011623" "50" "1855" "0" "1855" "0" "c.1855C>T" "r.(?)" "p.(Arg619Cys)" "" "0000895598" "00011623" "70" "2062" "0" "2062" "0" "c.2062C>T" "r.(?)" "p.(Arg688Cys)" "" "0000895599" "00011623" "10" "2103" "0" "2103" "0" "c.2103C>G" "r.(?)" "p.(Pro701=)" "" "0000895600" "00011623" "50" "2161" "0" "2161" "0" "c.2161G>A" "r.(?)" "p.(Glu721Lys)" "" "0000895601" "00011623" "50" "2275" "0" "2275" "0" "c.2275T>C" "r.(?)" "p.(Tyr759His)" "" "0000895602" "00011623" "30" "2301" "0" "2301" "0" "c.2301C>T" "r.(?)" "p.(Asn767=)" "" "0000895603" "00011623" "50" "2306" "0" "2306" "0" "c.2306C>T" "r.(?)" "p.(Thr769Met)" "" "0000895604" "00011623" "50" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Ile796Thr)" "" "0000895605" "00011623" "50" "2428" "0" "2428" "0" "c.2428C>T" "r.(?)" "p.(Arg810Trp)" "" "0000909263" "00011623" "50" "370" "0" "370" "0" "c.370G>C" "r.(?)" "p.(Val124Leu)" "" "0000915489" "00011623" "10" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Phe403=)" "" "0000915490" "00011623" "50" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Val407Met)" "" "0000927109" "00011623" "50" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Pro115Leu)" "" "0000927110" "00011623" "90" "485" "0" "485" "0" "c.485G>A" "r.(?)" "p.(Trp162*)" "" "0000927111" "00011623" "70" "651" "0" "651" "0" "c.651G>A" "r.(?)" "p.(Glu217=)" "" "0000927112" "00011623" "50" "695" "0" "695" "0" "c.695C>T" "r.(?)" "p.(Pro232Leu)" "" "0000927113" "00011623" "50" "2434" "0" "2434" "0" "c.2434C>G" "r.(?)" "p.(Leu812Val)" "" "0000931247" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10Argfs*15)" "" "0000931249" "00011623" "90" "850" "0" "850" "0" "c.850C>T" "r.(?)" "p.(Arg284Cys)" "" "0000931250" "00011623" "50" "961" "0" "961" "0" "c.961T>G" "r.(?)" "p.(Trp321Gly)" "" "0000931251" "00011623" "70" "2090" "0" "2090" "0" "c.2090G>A" "r.(?)" "p.(Arg697Gln)" "" "0000931252" "00011623" "50" "2306" "0" "2306" "0" "c.2306C>T" "r.(?)" "p.(Thr769Met)" "" "0000931850" "00011623" "70" "739" "0" "739" "0" "c.739del" "r.(?)" "p.(Ser247Alafs*5)" "" "0000951538" "00011623" "90" "742" "0" "742" "0" "c.742G>A" "r.(?)" "p.(Gly248Arg)" "" "0000951539" "00011623" "70" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000951540" "00011623" "50" "1486" "0" "1486" "0" "c.1486G>T" "r.(?)" "p.(Ala496Ser)" "" "0000951541" "00011623" "30" "1487" "0" "1487" "0" "c.1487C>A" "r.(?)" "p.(Ala496Asp)" "" "0000951542" "00011623" "30" "1564" "0" "1564" "0" "c.1564G>A" "r.(?)" "p.(Glu522Lys)" "" "0000951543" "00011623" "50" "1943" "-276" "1943" "-276" "c.1943-276G>A" "r.(=)" "p.(=)" "" "0000951544" "00011623" "50" "1982" "0" "1982" "0" "c.1982G>A" "r.(?)" "p.(Gly661Glu)" "" "0000951545" "00011623" "30" "2022" "0" "2022" "0" "c.2022C>T" "r.(?)" "p.(=)" "" "0000951546" "00011623" "70" "2241" "0" "2241" "0" "c.2241C>G" "r.(?)" "p.(Tyr747*)" "" "0000951547" "00011623" "70" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Ile796Thr)" "" "0000951548" "00011623" "30" "6462" "0" "6462" "0" "c.*3939C>G" "r.(=)" "p.(=)" "" "0000952253" "00011623" "70" "1165" "0" "1165" "0" "c.1165C>T" "r.(?)" "p.(Leu389Phe)" "" "0000952599" "00011623" "90" "791" "1" "791" "1" "c.791+1G>A" "r.spl" "p.?" "8" "0000970387" "00011623" "50" "410" "0" "410" "0" "c.410C>A" "r.(?)" "p.(Thr137Asn)" "" "0000970388" "00011623" "50" "680" "0" "680" "0" "c.680C>G" "r.(?)" "p.(Ser227Cys)" "" "0000970389" "00011623" "50" "1727" "0" "1727" "0" "c.1727T>G" "r.(?)" "p.(Leu576Arg)" "" "0000970390" "00011623" "50" "1982" "0" "1982" "0" "c.1982G>A" "r.(?)" "p.(Gly661Glu)" "" "0000970391" "00011623" "90" "2191" "0" "2191" "0" "c.2191G>T" "r.(?)" "p.(Glu731*)" "" "0000971428" "00011623" "70" "516" "0" "516" "0" "c.516del" "r.(?)" "p.(Val173SerfsTer27)" "" "0000971430" "00011623" "70" "373" "0" "375" "0" "c.373_375del" "r.(?)" "p.(Val125del)" "" "0000971431" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971432" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971433" "00011623" "70" "1913" "0" "1913" "0" "c.1913del" "r.(?)" "p.(Arg638ProfsTer14)" "" "0000971434" "00011623" "70" "1913" "0" "1913" "0" "c.1913del" "r.(?)" "p.(Arg638ProfsTer14)" "" "0000971435" "00011623" "70" "791" "1" "791" "1" "c.791+1G>A" "r.spl" "p.?" "" "0000971436" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971437" "00011623" "90" "1615" "1" "1615" "1" "c.1615+1G>C" "r.spl" "p.?" "" "0000971438" "00011623" "70" "1295" "0" "1295" "0" "c.1295A>T" "r.(?)" "p.(Asp432Val)" "" "0000971439" "00011623" "90" "2011" "0" "2012" "0" "c.2011_2012del" "r.(?)" "p.(Leu671ValfsTer3)" "" "0000971441" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971443" "00011623" "70" "1217" "0" "1217" "0" "c.1217C>A" "r.(?)" "p.(Thr406Lys)" "" "0000971445" "00011623" "90" "400" "1" "400" "1" "c.400+1G>C" "r.spl" "p.?" "" "0000971447" "00011623" "90" "401" "-1" "401" "-1" "c.401-1G>C" "r.spl" "p.?" "" "0000971448" "00011623" "70" "225" "0" "225" "0" "c.225del" "r.(?)" "p.(Tyr76IlefsTer25)" "" "0000971449" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971451" "00011623" "70" "1577" "0" "1577" "0" "c.1577A>C" "r.(?)" "p.(Gln526Pro)" "" "0000971452" "00011623" "90" "890" "0" "891" "0" "c.890_891del" "r.(?)" "p.(Tyr297CysfsTer18)" "" "0000971453" "00011623" "90" "2303" "0" "2303" "0" "c.2303dup" "r.(?)" "p.(Thr769AspfsTer13)" "" "0000971454" "00011623" "90" "791" "1" "791" "1" "c.791+1G>T" "r.spl" "p.?" "" "0000971455" "00011623" "70" "2317" "0" "2317" "0" "c.2317G>A" "r.(?)" "p.(Val773Met)" "" "0000971456" "00011623" "90" "1373" "0" "1373" "0" "c.1373dup" "r.(?)" "p.(His459ProfsTer210)" "" "0000971457" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971458" "00011623" "70" "1523" "0" "1523" "0" "c.1523del" "r.(?)" "p.(Leu508ArgfsTer48)" "" "0000971459" "00011623" "90" "2325" "2" "2325" "2" "c.2325+2T>G" "r.spl" "p.?" "" "0000971460" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971461" "00011623" "70" "2326" "-1" "2326" "-1" "c.2326-1G>A" "r.spl" "p.?" "" "0000971462" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362Ter)" "" "0000971463" "00011623" "90" "791" "1" "791" "1" "c.791+1G>C" "r.spl" "p.?" "" "0000971464" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362Ter)" "" "0000971465" "00011623" "90" "1690" "0" "1690" "0" "c.1690C>T" "r.(?)" "p.(Gln564Ter)" "" "0000971467" "00011623" "70" "373" "0" "375" "0" "c.373_375del" "r.(?)" "p.(Val125del)" "" "0000971469" "00011623" "70" "1692" "0" "1692" "0" "c.1692G>T" "r.(?)" "p.(Gln564His)" "" "0000971472" "00011623" "90" "2407" "-2" "2407" "-2" "c.2407-2A>G" "r.spl" "p.?" "" "0000971476" "00011623" "70" "1418" "0" "1420" "0" "c.1418_1420del" "r.(?)" "p.(Lys473del)" "" "0000971477" "00011623" "70" "1786" "-10" "1786" "-1" "c.1786-10_1786-1dup" "r.spl?" "p.?" "" "0000971481" "00011623" "70" "1641" "0" "1642" "0" "c.1641_1642insCTGG" "r.(?)" "p.(Met548LeufsTer122)" "" "0000971482" "00011623" "70" "2041" "0" "2041" "0" "c.2041C>T" "r.(?)" "p.(His681Tyr)" "" "0000971483" "00011623" "90" "2325" "2" "2325" "2" "c.2325+2T>G" "r.spl" "p.?" "" "0000971484" "00011623" "70" "2279" "0" "2304" "0" "c.2279_2304dup" "r.(?)" "p.(Thr769AlafsTer7)" "" "0000971485" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362Ter)" "" "0000971486" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971487" "00011623" "90" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Trp)" "" "0000971488" "00011623" "90" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Trp265Ter)" "" "0000971489" "00011623" "70" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Val316Met)" "" "0000971490" "00011623" "70" "2093" "0" "2093" "0" "c.2093C>T" "r.(?)" "p.(Ser698Phe)" "" "0000971491" "00011623" "90" "401" "-2" "401" "-2" "c.401-2A>G" "r.spl" "p.?" "" "0000971492" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971493" "00011623" "90" "791" "1" "791" "1" "c.791+1G>A" "r.spl" "p.?" "" "0000971494" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971495" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10ArgfsTer15)" "" "0000971496" "00011623" "90" "684" "0" "684" "0" "c.684C>A" "r.(?)" "p.(Cys228Ter)" "" "0000971497" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971498" "00011623" "90" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Trp265Ter)" "" "0000971499" "00011623" "90" "529" "0" "529" "0" "c.529del" "r.(?)" "p.(Ala177ProfsTer23)" "" "0000971500" "00011623" "90" "2241" "0" "2241" "0" "c.2241C>G" "r.(?)" "p.(Tyr747Ter)" "" "0000971501" "00011623" "90" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0000971502" "00011623" "90" "1084" "0" "1084" "0" "c.1084C>T" "r.(?)" "p.(Arg362Ter)" "" "0000971503" "00011623" "70" "2339" "0" "2339" "0" "c.2339C>A" "r.(?)" "p.(Ala780Asp)" "" "0000971504" "00011623" "70" "373" "0" "373" "0" "c.373G>A" "r.(?)" "p.(Val125Ile)" "" "0000971505" "00011623" "70" "1300" "0" "1300" "0" "c.1300G>A" "r.(?)" "p.(Gly434Arg)" "" "0000971506" "00011623" "70" "2317" "0" "2317" "0" "c.2317G>A" "r.(?)" "p.(Val773Met)" "" "0000971507" "00011623" "70" "2104" "0" "2104" "0" "c.2104del" "r.(?)" "p.(Glu702LysfsTer5)" "" "0000971508" "00011623" "90" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Arg170Gln)" "" "0000971509" "00011623" "70" "564" "0" "564" "0" "c.564G>A" "r.(?)" "p.(Trp188Ter)" "" "0000971510" "00011623" "70" "1365" "0" "1365" "0" "c.1365C>A" "r.(?)" "p.(Cys455Ter)" "" "0000971511" "00011623" "70" "357" "0" "357" "0" "c.357C>A" "r.(?)" "p.(Tyr119Ter)" "" "0000971512" "00011623" "90" "791" "1" "791" "1" "c.791+1G>C" "r.spl" "p.?" "" "0000971513" "00011623" "70" "1939" "0" "1939" "0" "c.1939del" "r.(?)" "p.(Ile647LeufsTer5)" "" "0000971514" "00011623" "70" "249" "0" "249" "0" "c.249dup" "r.(?)" "p.(Gly84TrpfsTer11)" "" "0000971515" "00011623" "70" "795" "0" "795" "0" "c.795G>A" "r.(?)" "p.(Trp265Ter)" "" "0000971516" "00011623" "70" "1913" "0" "1913" "0" "c.1913del" "r.(?)" "p.(Arg638ProfsTer14)" "" "0000971521" "00011623" "50" "2220" "-5" "2220" "-5" "c.2220-5C>T" "r.spl?" "p.?" "" "0000984120" "00011623" "30" "-11" "0" "-11" "0" "c.-11G>A" "r.(?)" "p.(=)" "" "0000984121" "00011623" "50" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Pro115Leu)" "" "0000984122" "00011623" "50" "906" "0" "906" "0" "c.906G>A" "r.(?)" "p.(=)" "" "0000984123" "00011623" "90" "1312" "0" "1312" "0" "c.1312G>T" "r.(?)" "p.(Glu438Ter)" "" "0000984124" "00011623" "30" "1517" "0" "1517" "0" "c.1517C>T" "r.(?)" "p.(Pro506Leu)" "" "0000984125" "00011623" "50" "2075" "0" "2075" "0" "c.2075T>C" "r.(?)" "p.(Phe692Ser)" "" "0000984126" "00011623" "30" "2253" "0" "2253" "0" "c.2253C>T" "r.(?)" "p.(Phe751=)" "" "0000984127" "00011623" "70" "2325" "0" "2325" "0" "c.2325G>T" "r.(?)" "p.(Gln775His)" "" "0000984128" "00011623" "70" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Ile796Thr)" "" "0001005924" "00011623" "50" "320" "0" "320" "0" "c.320G>C" "r.(?)" "p.(Arg107Thr)" "" "0001005925" "00011623" "50" "357" "0" "357" "0" "c.357C>G" "r.(?)" "p.(Tyr119*)" "" "0001005926" "00011623" "70" "649" "0" "649" "0" "c.649G>T" "r.(?)" "p.(Glu217*)" "" "0001005927" "00011623" "50" "989" "0" "989" "0" "c.989G>T" "r.(?)" "p.(Ser330Ile)" "" "0001005928" "00011623" "70" "1018" "0" "1018" "0" "c.1018C>T" "r.(?)" "p.(Arg340Ter)" "" "0001005929" "00011623" "30" "1055" "0" "1055" "0" "c.1055A>C" "r.(?)" "p.(Tyr352Ser)" "" "0001005930" "00011623" "90" "1210" "0" "1210" "0" "c.1210G>A" "r.(?)" "p.(Gly404Arg)" "" "0001005931" "00011623" "50" "1277" "0" "1277" "0" "c.1277A>T" "r.(?)" "p.(Lys426Ile)" "" "0001005932" "00011623" "30" "1384" "0" "1384" "0" "c.1384A>G" "r.(?)" "p.(Ile462Val)" "" "0001005933" "00011623" "30" "1492" "0" "1492" "0" "c.1492G>A" "r.(?)" "p.(Gly498Ser)" "" "0001005934" "00011623" "50" "1556" "0" "1556" "0" "c.1556G>C" "r.(?)" "p.(Arg519Pro)" "" "0001005935" "00011623" "50" "1736" "0" "1736" "0" "c.1736T>A" "r.(?)" "p.(Val579Glu)" "" "0001005936" "00011623" "50" "1789" "0" "1789" "0" "c.1789C>T" "r.(?)" "p.(His597Tyr)" "" "0001005937" "00011623" "50" "2062" "0" "2062" "0" "c.2062C>T" "r.(?)" "p.(Arg688Cys)" "" "0001005938" "00011623" "50" "2236" "0" "2236" "0" "c.2236C>T" "r.(?)" "p.(Pro746Ser)" "" "0001005939" "00011623" "50" "2277" "0" "2277" "0" "c.2277C>G" "r.(?)" "p.(Tyr759*)" "" "0001005940" "00011623" "70" "2371" "0" "2371" "0" "c.2371del" "r.(?)" "p.(His791Thrfs*22)" "" "0001005941" "00011623" "50" "2437" "0" "2437" "0" "c.2437A>G" "r.(?)" "p.(Ser813Gly)" "" "0001005942" "00011623" "50" "2474" "0" "2474" "0" "c.2474C>T" "r.(?)" "p.(Ala825Val)" "" "0001015909" "00011623" "50" "709" "0" "709" "0" "c.709C>T" "r.(?)" "p.(Arg237Trp)" "" "0001015910" "00011623" "90" "791" "1" "791" "1" "c.791+1G>A" "r.spl?" "p.?" "" "0001015911" "00011623" "30" "855" "0" "855" "0" "c.855C>T" "r.(?)" "p.(=)" "" "0001015912" "00011623" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(=)" "" "0001015913" "00011623" "50" "1577" "0" "1577" "0" "c.1577A>C" "r.(?)" "p.(Gln526Pro)" "" "0001015914" "00011623" "90" "1866" "0" "1867" "0" "c.1866_1867del" "r.(?)" "p.(Pro623Thrfs*45)" "" "0001015915" "00011623" "50" "2190" "0" "2190" "0" "c.2190C>T" "r.(?)" "p.(Gly730=)" "" "0001022087" "00011623" "50" "2325" "0" "2325" "0" "c.2325G>C" "r.[2325_2326ins2325+1_2325+20,=]" "p.[?,Gln775His]" "19" "0001022216" "00011623" "70" "263" "5" "263" "5" "c.263+5G>T" "r.[263_264ins[GTGAT;263+6_263+33],=]" "p.[Lys89Ter,=]" "3i" "0001022221" "00011623" "70" "320" "0" "320" "0" "c.320G>C" "r.[264_320del,264_400del,=]" "p.[Lys89_Arg107del,Lys89GlyfsTer11,Arg107Thr]" "3" "0001022584" "00011623" "30" "2286" "0" "2286" "0" "c.2286G>A" "r.(?)" "p.(Gln762=)" "" "0001027369" "00011623" "10" "201" "-8" "201" "-8" "c.201-8C>T" "r.(=)" "p.(=)" "" "0001027370" "00011623" "50" "347" "0" "347" "0" "c.347C>G" "r.(?)" "p.(Ala116Gly)" "" "0001027371" "00011623" "30" "453" "0" "453" "0" "c.453C>T" "r.(?)" "p.(=)" "" "0001027372" "00011623" "10" "994" "-18" "994" "-18" "c.994-18T>C" "r.(=)" "p.(=)" "" "0001027373" "00011623" "50" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Trp)" "" "0001027374" "00011623" "50" "1400" "0" "1426" "0" "c.1400_1426del" "r.(?)" "p.(Ser467_Gln476delinsLys)" "" "0001027796" "00011623" "90" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283Gln)" "" "0001043728" "00011623" "50" "372" "0" "372" "0" "c.372C>T" "r.(?)" "p.(=)" "" "0001043729" "00011623" "30" "400" "10" "400" "10" "c.400+10C>T" "r.(=)" "p.(=)" "" "0001043730" "00011623" "30" "401" "-3" "401" "-3" "c.401-3C>A" "r.spl?" "p.?" "" "0001043731" "00011623" "50" "488" "0" "488" "0" "c.488C>T" "r.(?)" "p.(Thr163Met)" "" "0001043732" "00011623" "90" "671" "0" "671" "0" "c.671dup" "r.(?)" "p.(Ser227IlefsTer33)" "" "0001043733" "00011623" "90" "791" "1" "791" "1" "c.791+1G>T" "r.spl?" "p.?" "" "0001043734" "00011623" "90" "850" "0" "850" "0" "c.850C>T" "r.(?)" "p.(Arg284Cys)" "" "0001043735" "00011623" "70" "902" "0" "902" "0" "c.902G>T" "r.(?)" "p.(Gly301Val)" "" "0001043736" "00011623" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Val456Met)" "" "0001043737" "00011623" "30" "1615" "7" "1615" "7" "c.1615+7C>G" "r.(=)" "p.(=)" "" "0001043738" "00011623" "70" "1687" "0" "1687" "0" "c.1687G>C" "r.(?)" "p.(Glu563Gln)" "" "0001043739" "00011623" "50" "1855" "0" "1855" "0" "c.1855C>T" "r.(?)" "p.(Arg619Cys)" "" "0001043740" "00011623" "50" "1982" "0" "1982" "0" "c.1982G>A" "r.(?)" "p.(Gly661Glu)" "" "0001043741" "00011623" "90" "2178" "0" "2178" "0" "c.2178C>A" "r.(?)" "p.(Tyr726*)" "" "0001043742" "00011623" "30" "2187" "0" "2187" "0" "c.2187C>T" "r.(?)" "p.(Tyr729=)" "" "0001046804" "00011623" "50" "490" "0" "490" "0" "c.490G>A" "r.(?)" "p.(Glu164Lys)" "" "0001046805" "00011623" "50" "901" "0" "901" "0" "c.901G>C" "r.(?)" "p.(Gly301Arg)" "" "0001057079" "00011623" "90" "27" "0" "27" "0" "c.27dup" "r.(?)" "p.(Gln10Alafs*24)" "" "0001057080" "00011623" "50" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Val316Met)" "" "0001057081" "00011623" "50" "1235" "0" "1235" "0" "c.1235G>A" "r.(?)" "p.(Arg412His)" "" "0001057082" "00011623" "50" "1391" "0" "1391" "0" "c.1391C>T" "r.(?)" "p.(Thr464Ile)" "" "0001057083" "00011623" "50" "1658" "0" "1658" "0" "c.1658T>G" "r.(?)" "p.(Leu553Arg)" "" "0001057084" "00011623" "50" "2089" "0" "2089" "0" "c.2089C>T" "r.(?)" "p.(Arg697Trp)" "" "0001057085" "00011623" "50" "2181" "0" "2181" "0" "c.2181C>G" "r.(?)" "p.(Ile727Met)" "" "0001057086" "00011623" "50" "2220" "-1" "2220" "-1" "c.2220-1G>A" "r.spl?" "p.?" "" "0001061828" "00011623" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "4" "0001061857" "00011623" "90" "264" "-13" "264" "-13" "c.264-13G>A" "r.263_264ins264-11_264-1" "p.Lys86CysfsTer16" "2i" "0001061858" "00011623" "90" "264" "-13" "264" "-13" "c.264-13G>A" "r.263_264ins264-11_264-1" "p.Lys86CysfsTer16" "2i" "0001061860" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10Argfs*15)" "1" "0001061861" "00011623" "90" "27" "0" "27" "0" "c.27del" "r.(?)" "p.(Gln10Argfs*15)" "1" "0001061972" "00011623" "90" "365" "0" "365" "0" "c.365C>T" "r.(?)" "p.(Ser122Leu)" "" "0001061973" "00011623" "90" "1559" "0" "1559" "0" "c.1559C>T" "r.(?)" "p.(Pro520Leu)" "" "0001061974" "00011623" "90" "2062" "0" "2062" "0" "c.2062C>T" "r.2062C>T" "p.Arg688Cys" "" "0001061975" "00011623" "90" "2438" "0" "2438" "0" "c.2438G>T" "r.2438G>T" "p.Ser813Ile" "" "0001061976" "00011623" "90" "2348" "0" "2351" "0" "c.2348_2351del" "r.(?)" "p.(Thr783ArgfsTer5)" "" "0001061977" "00011623" "90" "594" "-3" "594" "-3" "c.594-3C>G" "r.594_651del" "p.Leu199TrpfsTer34" "" "0001061978" "00011623" "90" "1397" "0" "1397" "0" "c.1397G>A" "r.(?)" "p.(Arg466Gln)" "" "0001061979" "00011623" "90" "238" "0" "238" "0" "c.238dup" "r.(?)" "p.(Ile80AsnfsTer15)" "" "0001061980" "00011623" "90" "1210" "0" "1210" "0" "c.1210G>A" "r.(?)" "p.(Gly404Arg)" "" "0001061981" "00011623" "90" "1367" "0" "1367" "0" "c.1367T>G" "r.1367T>G" "p.Val456Gly" "" "0001061982" "00011623" "90" "1449" "1" "1449" "1" "c.1449+1G>A" "r.1354_1449del" "p.Glu453_Lys484del" "" "0001061983" "00011623" "90" "1751" "0" "1751" "0" "c.1751dup" "r.(?)" "p.(Ser585GlufsTer84)" "" "0001061984" "00011623" "90" "2062" "0" "2062" "0" "c.2062C>T" "r.(2062C>T)" "p.(Arg688Cys)" "" "0001061985" "00011623" "30" "2220" "-16" "2220" "-14" "c.2220-16_2220-14del" "r.2219_2220=" "p.=" "" "0001067461" "00011623" "50" "202" "0" "202" "0" "c.202C>A" "r.(?)" "p.(Arg68Ser)" "" "0001067462" "00011623" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "" "0001067463" "00011623" "90" "465" "0" "465" "0" "c.465C>G" "r.(?)" "p.(Tyr155*)" "" "0001067464" "00011623" "50" "917" "0" "917" "0" "c.917C>T" "r.(?)" "p.(Thr306Met)" "" "0001067465" "00011623" "90" "1312" "0" "1312" "0" "c.1312G>T" "r.(?)" "p.(Glu438Ter)" "" "0001067466" "00011623" "50" "1943" "-239" "1943" "-239" "c.1943-239C>G" "r.(=)" "p.(=)" "" "0001067467" "00011623" "50" "2089" "0" "2089" "0" "c.2089C>T" "r.(?)" "p.(Arg697Trp)" "" "0001068266" "00011623" "70" "362" "0" "362" "0" "c.362A>G" "r.(?)" "p.(His121Arg)" "" "0001068267" "00011623" "50" "362" "0" "362" "0" "c.362A>G" "r.(?)" "p.(His121Arg)" "" "0001068316" "00011623" "50" "2429" "0" "2429" "0" "c.2429G>A" "r.(?)" "p.(Arg810Gln)" "" "0001068430" "00011623" "70" "362" "0" "362" "0" "c.362A>G" "r.(?)" "p.(His121Arg)" "" "0001071210" "00011623" "50" "2366" "0" "2366" "0" "c.2366A>G" "r.(?)" "p.(Lys789Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 186 "{{screeningid}}" "{{variantid}}" "0000017606" "0000037617" "0000017607" "0000037618" "0000017608" "0000037619" "0000017610" "0000037620" "0000017611" "0000037621" "0000017612" "0000037622" "0000017613" "0000037623" "0000017614" "0000037624" "0000017615" "0000037625" "0000017616" "0000037626" "0000017617" "0000037628" "0000017618" "0000037629" "0000017619" "0000037630" "0000017620" "0000037631" "0000017621" "0000037632" "0000017622" "0000037633" "0000017623" "0000037634" "0000017624" "0000037635" "0000017625" "0000037636" "0000017626" "0000037637" "0000017627" "0000037638" "0000017628" "0000037639" "0000050383" "0000079363" "0000050459" "0000079439" "0000050487" "0000079467" "0000050558" "0000079538" "0000096159" "0000156614" "0000096225" "0000156680" "0000096231" "0000156686" "0000096236" "0000156691" "0000096237" "0000156692" "0000096238" "0000156693" "0000096239" "0000156694" "0000096240" "0000156695" "0000096241" "0000156696" "0000096242" "0000156697" "0000096243" "0000156698" "0000096244" "0000156699" "0000096245" "0000156700" "0000096246" "0000156701" "0000096247" "0000156702" "0000096248" "0000156703" "0000096249" "0000156704" "0000096250" "0000156705" "0000096251" "0000156706" "0000096252" "0000156707" "0000096253" "0000156708" "0000096254" "0000156709" "0000096255" "0000156710" "0000096256" "0000156711" "0000096257" "0000156712" "0000096258" "0000156713" "0000096259" "0000156714" "0000096260" "0000156715" "0000096261" "0000156716" "0000096262" "0000156717" "0000096263" "0000156718" "0000096264" "0000156719" "0000096265" "0000156720" "0000096266" "0000156721" "0000096267" "0000156722" "0000096268" "0000156723" "0000207961" "0000437682" "0000207962" "0000437683" "0000207963" "0000437684" "0000207964" "0000437685" "0000209837" "0000440058" "0000232485" "0000474894" "0000270487" "0000604249" "0000296820" "0000653535" "0000297150" "0000659775" "0000300799" "0000663697" "0000315912" "0000698017" "0000315913" "0000698018" "0000315914" "0000698019" "0000325863" "0000709017" "0000325866" "0000709020" "0000336953" "0000736493" "0000360688" "0000760761" "0000360688" "0000760762" "0000374881" "0000785729" "0000374881" "0000785730" "0000383380" "0000797466" "0000384274" "0000810839" "0000386653" "0000814308" "0000415520" "0000873318" "0000429667" "0000909263" "0000437080" "0000931850" "0000445339" "0000952253" "0000445545" "0000952599" "0000449844" "0000971428" "0000449845" "0000971430" "0000449846" "0000971431" "0000449847" "0000971432" "0000449848" "0000971433" "0000449848" "0000971434" "0000449849" "0000971435" "0000449850" "0000971436" "0000449851" "0000971437" "0000449852" "0000971438" "0000449853" "0000971439" "0000449855" "0000971441" "0000449857" "0000971443" "0000449860" "0000971445" "0000449861" "0000971447" "0000449862" "0000971448" "0000449863" "0000971449" "0000449865" "0000971451" "0000449866" "0000971452" "0000449867" "0000971453" "0000449868" "0000971454" "0000449869" "0000971455" "0000449870" "0000971456" "0000449871" "0000971457" "0000449872" "0000971458" "0000449873" "0000971459" "0000449874" "0000971460" "0000449875" "0000971461" "0000449876" "0000971462" "0000449877" "0000971463" "0000449878" "0000971464" "0000449879" "0000971465" "0000449881" "0000971467" "0000449883" "0000971469" "0000449886" "0000971472" "0000449890" "0000971476" "0000449892" "0000971477" "0000449894" "0000971481" "0000449896" "0000971482" "0000449897" "0000971483" "0000449898" "0000971484" "0000449899" "0000971485" "0000449900" "0000971486" "0000449901" "0000971487" "0000449902" "0000971488" "0000449903" "0000971489" "0000449904" "0000971490" "0000449905" "0000971491" "0000449906" "0000971492" "0000449907" "0000971493" "0000449908" "0000971494" "0000449909" "0000971495" "0000449910" "0000971496" "0000449911" "0000971497" "0000449912" "0000971498" "0000449913" "0000971499" "0000449914" "0000971500" "0000449915" "0000971501" "0000449916" "0000971502" "0000449917" "0000971503" "0000449918" "0000971504" "0000449919" "0000971505" "0000449920" "0000971506" "0000449921" "0000971507" "0000449922" "0000971508" "0000449923" "0000971509" "0000449924" "0000971510" "0000449925" "0000971511" "0000449926" "0000971512" "0000449927" "0000971513" "0000449928" "0000971514" "0000449929" "0000971515" "0000449930" "0000971516" "0000449939" "0000971521" "0000462560" "0001022087" "0000462689" "0001022216" "0000462694" "0001022221" "0000473056" "0001061828" "0000473084" "0001061857" "0000473085" "0001061858" "0000473086" "0001061860" "0000473087" "0001061861" "0000473173" "0001061972" "0000473174" "0001061973" "0000473175" "0001061974" "0000473176" "0001061975" "0000473177" "0001061976" "0000473178" "0001061977" "0000473179" "0001061978" "0000473180" "0001061979" "0000473181" "0001061980" "0000473182" "0001061981" "0000473183" "0001061982" "0000473184" "0001061983" "0000473185" "0001061984" "0000473186" "0001061985"