### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = MAPK8IP3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "MAPK8IP3" "mitogen-activated protein kinase 8 interacting protein 3" "16" "p13.3" "unknown" "NC_000016.9" "UD_132438365459" "" "https://www.LOVD.nl/MAPK8IP3" "" "1" "6884" "23162" "605431" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/MAPK8IP3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2021-06-23 17:24:13" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025852" "MAPK8IP3" "transcript variant 3" "000" "NM_001318852.2" "" "NP_001305781.1" "" "" "" "-145" "5541" "4014" "1756196" "1820352" "00006" "2023-09-01 10:34:24" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05950" "NEDBA" "neurodevelopmental disorder with/without variable brain abnormalities (NEDBA)" "AD" "618443" "" "" "" "00006" "2021-06-23 17:23:30" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "MAPK8IP3" "05611" "MAPK8IP3" "05950" ## Individuals ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00213145" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat1" "00213146" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat2" "00213147" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat3" "00213148" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat4" "00213149" "" "" "" "3" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat5" "00213150" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat6" "00213151" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat7" "00213152" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat8" "00213153" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat9" "00213154" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "M" "" "" "" "0" "" "" "" "Pat10" "00213155" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat11" "00213156" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat12" "00213157" "" "" "" "1" "" "00006" "{PMID:Platzer 2019:30612693}" "" "F" "" "" "" "0" "" "" "" "Pat13" "00375618" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00376457" "" "" "" "2" "" "00006" "{PMID:Iwasawa 2019:30945334}" "2-generation family, 2 affected, unaffected heterozygous carrier parents" "M" "" "Japan" "" "0" "" "" "" "Fam1Pat1" "00376458" "" "" "00376457" "1" "" "00006" "{PMID:Iwasawa 2019:30945334}" "sister" "F" "" "Japan" "" "0" "" "" "" "Fam1Pat2" "00376459" "" "" "" "1" "" "00006" "{PMID:Iwasawa 2019:30945334}" "" "M" "" "Japan" "" "0" "" "" "" "Fam2Pat3" "00376460" "" "" "" "1" "" "00006" "{PMID:Iwasawa 2019:30945334}" "" "M" "" "Japan" "" "0" "" "" "" "Fam3Pat4" "00376461" "" "" "" "1" "" "00006" "{PMID:Iwasawa 2019:30945334}" "" "F" "" "Japan" "" "0" "" "" "" "Fam4Pat5" "00376462" "" "" "" "1" "" "00006" "contact me for details" "" "M" "" "Bulgaria" "" "0" "" "" "" "private email" "00391223" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "187184" "00436279" "" "" "" "1" "" "01164" "" "" "F" "no" "? (unknown)" "" "0" "" "" "" "269025" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 22 "{{individualid}}" "{{diseaseid}}" "00213145" "00139" "00213146" "00139" "00213147" "00139" "00213148" "00139" "00213149" "00139" "00213150" "00139" "00213151" "00139" "00213152" "00139" "00213153" "00139" "00213154" "00139" "00213155" "00139" "00213156" "00139" "00213157" "00139" "00375618" "00198" "00376457" "05611" "00376458" "05611" "00376459" "05611" "00376460" "05611" "00376461" "05611" "00376462" "05611" "00391223" "05950" "00436279" "05950" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 05611, 05950 ## Count = 22 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000161620" "00139" "00213145" "00006" "Isolated (sporadic)" "14y" "moderate intellectual disability (IQ48); autism spectrum disorder; no seizures; muscular hypotonia, ataxia; no microcephaly; cerebellar atrophy, white-matter hyperintensity in posterior limbs of internal capsules; scoliosis" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161621" "00139" "00213146" "00006" "Isolated (sporadic)" "4y" "severe intellectual disability; no autism spectrum disorder; no seizures; muscular hypotonia, ataxia; no microcephaly; no brain anomalies" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161622" "00139" "00213147" "00006" "Isolated (sporadic)" "4y" "moderate intellectual disability; no autism spectrum disorder; no seizures; muscular hypotonia; no microcephaly; no brain anomalies" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161623" "00139" "00213148" "00006" "Isolated (sporadic)" "7y" "mild intellectual disability; autism spectrum disorder; no seizures; no muscular hypotonia; no microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161624" "00139" "00213149" "00006" "Isolated (sporadic)" "10y" "moderate intellectual disability (IQ49); no autism spectrum disorder; generalized seizure (1x); muscular hypotonia; no microcephaly; perisylvian polymicrogyria" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161625" "00139" "00213150" "00006" "Isolated (sporadic)" "9y" "mild intellectual disability; no autism spectrum disorder; no seizures; muscular hypotonia; no microcephaly; perisylvian polymicrogyria; scoliosis" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161626" "00139" "00213151" "00006" "Isolated (sporadic)" "3y" "mild intellectual disability; no autism spectrum disorder; no seizures; no muscular hypotonia; microcephaly (-2.7SD); no brain anomalies" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161627" "00139" "00213152" "00006" "Isolated (sporadic)" "5y" "severe intellectual disability; no autism spectrum disorder; generalized seizure (1x); muscular hypotonia, spasticity; microcephaly (-2.5SD); cerebral atrophy, white-matter volume loss, thin CC with hypoplasia of rostrum and splenium, cerebellar atrophy; short stature" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161628" "00139" "00213153" "00006" "Isolated (sporadic)" "6y" "moderate intellectual disability; no autism spectrum disorder; generalized seizure (1x); muscular hypotonia, spasticity; microcephaly (-2.5SD); cerebral atrophy, white-matter volume loss, thin CC, cerebellar hypoplasia predominant in inferior vermis; short stature" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161629" "00139" "00213154" "00006" "Isolated (sporadic)" "4y" "moderate intellectual disability; no autism spectrum disorder; generalized seizures; muscular hypotonia; no microcephaly; no brain anomalies" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161630" "00139" "00213155" "00006" "Isolated (sporadic)" "11y" "mild intellectual disability; no autism spectrum disorder; no seizures; spasticity; no microcephaly; mild cerebral atrophy, white-matter volume loss, thin corpus callosum; cortical visual impairment" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161631" "00139" "00213156" "00006" "Isolated (sporadic)" "4y" "severe intellectual disability; no autism spectrum disorder; no seizures; spasticity; no microcephaly; short corpus callosum" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000161632" "00139" "00213157" "00006" "Isolated (sporadic)" "19y" "moderate intellectual disability (IQ49); no autism spectrum disorder; no seizures; muscular hypotonia, unstable gait; no microcephaly; white-matter volume loss, thin corpus callosum; cortical visual impairment; scoliosis" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000270831" "00198" "00375618" "01807" "Unknown" "" "Ureteral stenosis (HP:0000071); Global developmental delay (HP:0001263); Absent speech (HP:0001344); Abnormal heart morphology (HP:0001627); Abnormal renal morphology (HP:0012210)" "" "" "" "" "" "" "" "" "" "" "" "0000271664" "05611" "00376457" "00006" "Isolated (sporadic)" "29y" "birth-39w; delayed motor development; head control-2.5m;; sit-7m; never crawled; never walked; severe intellectual disability; no autistic behavior; language comprehension; speech simple two-word sentences; spastic diplegia; wheelchair bound; no infantile hypotonia; no history of regression; no epilepsy; EEG high-voltage slow waves with spikes; MRI brain cerebral atrophy; delayed myelination; corpus callosum hypoplasia; round face; no prominent nasal bridge; thin upper lip; short stature; obesity; precocious puberty" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000271665" "05611" "00376458" "00006" "Isolated (sporadic)" "27y" "birth-40w; delayed motor development; head control-3.5m; roll-11m; sit-6m; crawl-11m; never walked; severe intellectual disability; no autistic behavior; language comprehension; speech simple two-word sentences; spastic diplegia; wheelchair bound; no infantile hypotonia; no history of regression; epilepsy; EEG high-voltage slow waves with spikes; MRI brain cerebral atrophy; delayed myelination; corpus callosum hypoplasia; round face; no prominent nasal bridge; thin upper lip; short stature; obesity; precocious puberty" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000271666" "05611" "00376459" "00006" "Isolated (sporadic)" "16y" "birth-40w; delayed motor development; head control-4m; roll-6m; never sit; never walked; profound intellectual disability; no autistic behavior; language comprehension; speech simple words; spastic diplegia; wheelchair bound; no infantile hypotonia; no history of regression; epilepsy; EEG 3-Hz spike-wave discharges on the right frontal quadrant during sleep; MRI brain cerebral atrophy (mild, right hemisphere); no delayed myelination; corpus callosum hypoplasia; no round face; prominent nasal bridge; thin upper lip; short stature; obesity" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000271667" "05611" "00376460" "00006" "Isolated (sporadic)" "5y" "birth-36w; delayed motor development; head control-5m; roll-7m; sit-15m; crawl-18m; never walked; severe intellectual disability; autistic behavior; no language comprehension; no speech; no spastic diplegia; cruising; infantile hypotonia; no history of regression; no epilepsy; EEG nomal; MRI brain cerebral atrophy; no delayed myelination; corpus callosum hypoplasia; round face; prominent nasal bridge; thin upper lip; short stature; no obesity; no precocious puberty" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000271668" "05611" "00376461" "00006" "Isolated (sporadic)" "5y" "birth-41w; delayed motor development; head control-6m; roll-6m; sit-11m; crawl-18m; walk-48m; severe intellectual disability; autistic behavior; no language comprehension; no speech; spastic diplegia; able to walk; infantile hypotonia; no history of regression; no epilepsy; MRI brain cerebral atrophy; delayed myelination; corpus callosum hypoplasia; round face; prominent nasal bridge; thin upper lip; long and thick eyebrows, upper slanted palpebral fissures, anteverted nares, short philtrum; no short stature; no obesity; no precocious puberty" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000271670" "05611" "00376462" "00006" "Isolated (sporadic)" "03y" "4m-struggling to achieve developmental milestones, head control-4m, sit-10m, stand-12m, crawl-13, started walk-17m; hypotonia, sensory integration dysfunction, general coordination dysfunction; 3y-walks alone, but some poor balance and coordination; able to understand, limited speech, few words; some autistic spectrum disorders, incl. stimmings; delayed fine motor skills; smiley, social kid, good eye contact; short stature (92cm), weight 13kg" "00y04m" "" "delayed development" "" "" "" "" "" "NEDBA" "developmental dealy" "" "0000284664" "05950" "00391223" "01164" "Unknown" "11y" "Thick eyebrow, Autistic behavior, Autism with high cognitive abilities, Goiter, Long hallux, Sandal gap, Truncal obesity, Clumsiness, Highly arched eyebrow, Large earlobe" "" "" "" "" "" "" "" "" "" "" "" "0000326459" "05950" "00436279" "01164" "Isolated (sporadic)" "12y" "Intellectual disability, Increased body weight, EEG abnormality, EEG with spike-wave complexes, Abnormal repetitive mannerisms, Hyperactivity, Delayed speech and language development, Neurodevelopmental delay" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000214215" "00213145" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214216" "00213146" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214217" "00213147" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214218" "00213148" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214219" "00213149" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214220" "00213150" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214221" "00213151" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214222" "00213152" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214223" "00213153" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214224" "00213154" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214225" "00213155" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214226" "00213156" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000214227" "00213157" "1" "00006" "00006" "2019-01-11 21:59:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000376815" "00375618" "1" "01807" "01807" "2021-06-14 12:10:01" "" "" "SEQ" "DNA" "" "" "0000377662" "00376457" "1" "00006" "00006" "2021-06-24 16:01:16" "" "" "SEQ-NG" "DNA" "" "WES" "0000377663" "00376458" "1" "00006" "00006" "2021-06-24 16:01:16" "" "" "SEQ-NG" "DNA" "" "WES" "0000377664" "00376459" "1" "00006" "00006" "2021-06-24 16:01:16" "" "" "SEQ-NG" "DNA" "" "WES" "0000377665" "00376460" "1" "00006" "00006" "2021-06-24 16:01:16" "" "" "SEQ-NG" "DNA" "" "WES" "0000377666" "00376461" "1" "00006" "00006" "2021-06-24 16:01:16" "" "" "SEQ-NG" "DNA" "" "WES" "0000377668" "00376462" "1" "00006" "00006" "2021-06-24 16:12:12" "" "" "SEQ-NG" "DNA" "" "WES" "0000392465" "00391223" "1" "01164" "01164" "2021-11-15 11:48:20" "" "" "SEQ-NG-I" "DNA" "" "" "0000437762" "00436279" "1" "01164" "01164" "2023-08-31 14:25:38" "" "" "SEQ-NG-I" "DNA" "Blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 15 "{{screeningid}}" "{{geneid}}" "0000214215" "MAPK8IP3" "0000214216" "MAPK8IP3" "0000214217" "MAPK8IP3" "0000214218" "MAPK8IP3" "0000214219" "MAPK8IP3" "0000214220" "MAPK8IP3" "0000214221" "MAPK8IP3" "0000214222" "MAPK8IP3" "0000214223" "MAPK8IP3" "0000214224" "MAPK8IP3" "0000214225" "MAPK8IP3" "0000214226" "MAPK8IP3" "0000214227" "MAPK8IP3" "0000392465" "MAPK8IP3" "0000437762" "MAPK8IP3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 59 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000446156" "0" "90" "3" "1756405" "1756405" "del" "0" "00006" "MAPK8IP3_000005" "g.1756405del" "" "{PMID:Platzer 2019:30612693}" "" "65delG" "" "De novo" "" "" "0" "" "" "g.1714721del" "" "pathogenic (dominant)" "" "0000446157" "0" "90" "3" "1756419" "1756419" "subst" "0" "00006" "MAPK8IP3_000006" "g.1756419G>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1706418G>T" "" "pathogenic (dominant)" "" "0000446158" "0" "90" "3" "1756451" "1756451" "subst" "0" "00006" "MAPK8IP3_000007" "g.1756451C>G" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1714767C>G" "" "pathogenic (dominant)" "" "0000446159" "0" "90" "3" "1798706" "1798706" "subst" "0" "00006" "MAPK8IP3_000008" "g.1798706G>A" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1748705G>A" "" "pathogenic (dominant)" "" "0000446160" "0" "90" "3" "1810410" "1810410" "subst" "0" "00006" "MAPK8IP3_000010" "g.1810410T>C" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1760409T>C" "" "pathogenic (dominant)" "" "0000446161" "0" "90" "3" "1810410" "1810410" "subst" "0" "00006" "MAPK8IP3_000010" "g.1810410T>C" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1760409T>C" "" "pathogenic (dominant)" "" "0000446162" "0" "90" "3" "1812389" "1812389" "subst" "0" "00006" "MAPK8IP3_000009" "g.1812389G>A" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1762388G>A" "" "pathogenic (dominant)" "" "0000446163" "0" "90" "3" "1812844" "1812844" "subst" "0" "00006" "MAPK8IP3_000011" "g.1812844C>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1762843C>T" "" "pathogenic (dominant)" "" "0000446164" "0" "90" "3" "1812844" "1812844" "subst" "0" "00006" "MAPK8IP3_000011" "g.1812844C>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1762843C>T" "" "pathogenic (dominant)" "" "0000446165" "0" "90" "3" "1816769" "1816769" "subst" "0" "00006" "MAPK8IP3_000012" "g.1816769C>G" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1775085C>G" "" "pathogenic (dominant)" "" "0000446166" "0" "90" "3" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1776151C>T" "" "pathogenic (dominant)" "" "0000446167" "0" "90" "3" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1776151C>T" "" "pathogenic (dominant)" "" "0000446168" "0" "90" "3" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "{PMID:Platzer 2019:30612693}" "" "" "" "De novo" "" "" "0" "" "" "g.1776151C>T" "" "pathogenic (dominant)" "" "0000788868" "0" "70" "16" "1814212" "1814212" "dup" "0" "01807" "MAPK8IP3_000017" "g.1814212dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.1764211dup" "" "likely pathogenic" "" "0000790076" "0" "90" "3" "1812844" "1812844" "subst" "0" "00006" "MAPK8IP3_000011" "g.1812844C>T" "" "{PMID:Iwasawa 2019:30945334}" "" "" "" "De novo" "" "" "0" "" "" "g.1762843C>T" "" "pathogenic (dominant)" "" "0000790077" "0" "90" "3" "1812844" "1812844" "subst" "0" "00006" "MAPK8IP3_000011" "g.1812844C>T" "" "{PMID:Iwasawa 2019:30945334}" "" "" "" "De novo" "" "" "0" "" "" "g.1762843C>T" "" "pathogenic (dominant)" "" "0000790078" "0" "90" "3" "1812844" "1812844" "subst" "0" "00006" "MAPK8IP3_000011" "g.1812844C>T" "" "{PMID:Iwasawa 2019:30945334}" "" "" "" "De novo" "" "" "0" "" "" "g.1762843C>T" "" "pathogenic (dominant)" "" "0000790079" "0" "90" "3" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "{PMID:Iwasawa 2019:30945334}" "" "" "" "De novo" "" "" "0" "" "" "g.1767834C>T" "" "pathogenic (dominant)" "" "0000790080" "0" "90" "3" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "{PMID:Iwasawa 2019:30945334}" "" "" "" "De novo" "" "" "0" "" "" "g.1767834C>T" "" "pathogenic (dominant)" "" "0000790082" "0" "90" "16" "1817835" "1817835" "subst" "0" "00006" "MAPK8IP3_000013" "g.1817835C>T" "" "" "" "3439C>T (Arg1147Cys)" "" "Unknown" "" "" "0" "" "" "g.1767834C>T" "" "pathogenic (dominant)" "" "0000822765" "0" "50" "16" "1756384" "1756384" "subst" "0" "01164" "MAPK8IP3_000019" "g.1756384A>G" "" "" "" "" "ACMG: PM2_SUP, PP2" "Germline" "?" "" "" "" "" "" "" "VUS" "ACMG" "0000854311" "0" "30" "16" "1798690" "1798690" "subst" "4.06105E-5" "02325" "MAPK8IP3_000020" "g.1798690C>T" "" "" "" "MAPK8IP3(NM_001040439.2):c.1182C>T (p.I394=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000892593" "0" "50" "16" "1812379" "1812379" "subst" "0" "02329" "MAPK8IP3_000021" "g.1812379C>T" "" "" "" "MAPK8IP3(NM_001318852.1):c.1567C>T (p.R523C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892594" "0" "30" "16" "1818820" "1818820" "subst" "4.16729E-5" "02325" "MRPS34_000020" "g.1818820G>A" "" "" "" "MAPK8IP3(NM_001040439.2):c.3988G>A (p.E1330K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914496" "0" "30" "16" "1815106" "1815106" "subst" "0" "02325" "MAPK8IP3_000022" "g.1815106C>T" "" "" "" "MAPK8IP3(NM_001040439.2):c.2352C>T (p.A784=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914497" "0" "50" "16" "1817836" "1817836" "subst" "0" "02325" "MRPS34_000021" "g.1817836G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.3419G>A (p.(Arg1140His)), MAPK8IP3(NM_001040439.2):c.3419G>A (p.R1140H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000933153" "0" "50" "16" "1817836" "1817836" "subst" "0" "01164" "MRPS34_000021" "g.1817836G>A" "" "" "" "" "ACMG: PM5, PS2_SUP, PM2_SUP, PP2, confirmed de novo; p.Arg1147Cys known pathogenic variant" "De novo" "-" "" "0" "" "" "g.1767835G>A" "" "VUS (!)" "ACMG" "0000950531" "0" "50" "16" "1816575" "1816580" "del" "0" "02325" "NME3_000006" "g.1816575_1816580del" "" "" "" "MAPK8IP3(NM_001040439.2):c.2844_2849delAGAGCC (p.E949_P950del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968144" "0" "30" "16" "1779586" "1779635" "del" "0" "02325" "MAPK8IP3_000023" "g.1779586_1779635del" "" "" "" "MAPK8IP3(NM_001040439.2):c.593_602+40del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968147" "0" "30" "16" "1812867" "1812867" "subst" "0" "02325" "MAPK8IP3_000026" "g.1812867C>T" "" "" "" "MAPK8IP3(NM_001040439.2):c.1737C>T (p.S579=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968148" "0" "30" "16" "1818241" "1818241" "subst" "3.68014E-5" "02325" "MRPS34_000022" "g.1818241G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.3583G>A (p.(Gly1195Arg)), MAPK8IP3(NM_001040439.2):c.3583G>A (p.G1195R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001981" "0" "30" "16" "1793383" "1793383" "subst" "0.000251933" "01804" "MAPK8IP3_000027" "g.1793383C>G" "" "" "" "MAPK8IP3(NM_001040439.1):c.650C>G (p.(Thr217Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001982" "0" "50" "16" "1793389" "1793389" "subst" "4.20073E-6" "01804" "MAPK8IP3_000028" "g.1793389G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.656G>A (p.(Arg219His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001983" "0" "30" "16" "1810503" "1810503" "subst" "2.84509E-5" "01804" "MAPK8IP3_000029" "g.1810503G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.1406G>A (p.(Arg469His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001984" "0" "50" "16" "1813669" "1813669" "subst" "0" "01804" "MAPK8IP3_000030" "g.1813669C>T" "" "" "" "MAPK8IP3(NM_001040439.1):c.1889C>T (p.(Ser630Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001985" "0" "50" "16" "1813695" "1813695" "subst" "0" "01804" "MAPK8IP3_000031" "g.1813695G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.1915G>A (p.(Glu639Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001986" "0" "30" "16" "1814458" "1814460" "del" "0" "01804" "MAPK8IP3_000032" "g.1814458_1814460del" "" "" "" "MAPK8IP3(NM_001040439.1):c.2257_2259delAAG (p.(Lys753del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001987" "0" "50" "16" "1815149" "1815149" "subst" "1.63847E-5" "01804" "MAPK8IP3_000033" "g.1815149G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.2395G>A (p.(Ala799Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001988" "0" "50" "16" "1815987" "1815987" "subst" "2.05599E-5" "01804" "NME3_000007" "g.1815987G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.2452G>A (p.(Gly818Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001989" "0" "30" "16" "1816552" "1816552" "subst" "5.01488E-5" "01804" "NME3_000008" "g.1816552A>G" "" "" "" "MAPK8IP3(NM_001040439.1):c.2821A>G (p.(Ser941Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001990" "0" "30" "16" "1816578" "1816578" "subst" "0" "01804" "NME3_000009" "g.1816578G>C" "" "" "" "MAPK8IP3(NM_001040439.1):c.2847G>C (p.(Glu949Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001991" "0" "90" "16" "1817835" "1817835" "subst" "0" "02327" "MAPK8IP3_000013" "g.1817835C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001001992" "0" "70" "16" "1817836" "1817836" "subst" "0" "01804" "MRPS34_000021" "g.1817836G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.3419G>A (p.(Arg1140His)), MAPK8IP3(NM_001040439.2):c.3419G>A (p.R1140H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001001993" "0" "50" "16" "1818227" "1818227" "subst" "0" "01804" "MRPS34_000025" "g.1818227A>T" "" "" "" "MAPK8IP3(NM_001040439.1):c.3569A>T (p.(Glu1190Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001994" "0" "30" "16" "1818235" "1818235" "subst" "3.67951E-5" "01804" "MRPS34_000026" "g.1818235C>T" "" "" "" "MAPK8IP3(NM_001040439.1):c.3577C>T (p.(Arg1193Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001995" "0" "50" "16" "1818236" "1818236" "subst" "0.000114461" "01804" "MRPS34_000027" "g.1818236G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.3578G>A (p.(Arg1193His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001996" "0" "50" "16" "1818241" "1818241" "subst" "3.68014E-5" "01804" "MRPS34_000022" "g.1818241G>A" "" "" "" "MAPK8IP3(NM_001040439.1):c.3583G>A (p.(Gly1195Arg)), MAPK8IP3(NM_001040439.2):c.3583G>A (p.G1195R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001999" "0" "50" "16" "1818809" "1818809" "subst" "4.15821E-6" "01804" "MRPS34_000028" "g.1818809C>T" "" "" "" "MAPK8IP3(NM_001040439.1):c.3977C>T (p.(Ser1326Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002000" "0" "50" "16" "1818820" "1818820" "subst" "0" "01804" "MRPS34_000029" "g.1818820G>T" "" "" "" "MAPK8IP3(NM_001040439.1):c.3988G>T (p.(Glu1330*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015310" "0" "50" "16" "1797130" "1797130" "subst" "1.62625E-5" "02325" "MAPK8IP3_000034" "g.1797130C>T" "" "" "" "MAPK8IP3(NM_001040439.2):c.845C>T (p.S282L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026580" "0" "30" "16" "1779600" "1779624" "del" "0" "02325" "MAPK8IP3_000035" "g.1779600_1779624del" "" "" "" "MAPK8IP3(NM_001040439.2):c.599_602+21delGGAGGTACGCGGGGCGCGGCGGGGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040856" "0" "30" "16" "1799403" "1799403" "subst" "0" "01804" "MAPK8IP3_000036" "g.1799403G>A" "" "" "" "MAPK8IP3(NM_001318852.2):c.1216+682G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040857" "0" "30" "16" "1808144" "1808144" "subst" "8.13405E-6" "01804" "MAPK8IP3_000037" "g.1808144G>A" "" "" "" "MAPK8IP3(NM_001318852.2):c.1217-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040858" "0" "30" "16" "1815179" "1815179" "subst" "3.75081E-5" "01804" "MAPK8IP3_000038" "g.1815179G>C" "" "" "" "MAPK8IP3(NM_001318852.2):c.2446G>C (p.(Ala816Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040859" "0" "30" "16" "1818561" "1818561" "subst" "2.18704E-5" "01804" "MRPS34_000030" "g.1818561G>A" "" "" "" "MAPK8IP3(NM_001318852.2):c.3826G>A (p.(Glu1276Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055329" "0" "30" "16" "1811222" "1811223" "del" "0" "01804" "MAPK8IP3_000039" "g.1811222_1811223del" "" "" "" "MAPK8IP3(NM_001318852.2):c.1458-3_1458-2del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055331" "0" "30" "16" "1817733" "1817733" "subst" "1.22698E-5" "01804" "MRPS34_000032" "g.1817733C>T" "" "" "" "MAPK8IP3(NM_001318852.2):c.3406C>T (p.(Leu1136=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001066339" "0" "50" "16" "1779195" "1779195" "subst" "0" "02325" "MAPK8IP3_000040" "g.1779195C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066340" "0" "50" "16" "1814434" "1814434" "subst" "0" "01804" "MAPK8IP3_000041" "g.1814434G>A" "" "" "" "MAPK8IP3(NM_001318852.2):c.2254G>A (p.(Ala752Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes MAPK8IP3 ## Count = 59 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000446156" "00025852" "90" "65" "0" "65" "0" "c.65del" "r.(?)" "p.(Gly22AlafsTer3)" "" "0000446157" "00025852" "90" "79" "0" "79" "0" "c.79G>T" "r.(?)" "p.(Glu27Ter)" "" "0000446158" "00025852" "90" "111" "0" "111" "0" "c.111C>G" "r.(?)" "p.(Tyr37Ter)" "" "0000446159" "00025852" "90" "1201" "0" "1201" "0" "c.1201G>A" "r.(?)" "p.(Gly401Arg)" "" "0000446160" "00025852" "90" "1334" "0" "1334" "0" "c.1334T>C" "r.(?)" "p.(Leu445Pro)" "" "0000446161" "00025852" "90" "1334" "0" "1334" "0" "c.1334T>C" "r.(?)" "p.(Leu445Pro)" "" "0000446162" "00025852" "90" "1577" "0" "1577" "0" "c.1577G>A" "r.(?)" "p.(Arg526Gln)" "" "0000446163" "00025852" "90" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" "0000446164" "00025852" "90" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" "0000446165" "00025852" "90" "2985" "0" "2985" "0" "c.2985C>G" "r.(?)" "p.(His995Gln)" "" "0000446166" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000446167" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000446168" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000788868" "00025852" "70" "2121" "1" "2121" "1" "c.2121+1dup" "r.spl" "p.(Leu708Alafs*16)" "" "0000790076" "00025852" "90" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" "0000790077" "00025852" "90" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" "0000790078" "00025852" "90" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" "0000790079" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000790080" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000790082" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0000822765" "00025852" "50" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Tyr15Cys)" "" "0000854311" "00025852" "30" "1185" "0" "1185" "0" "c.1185C>T" "r.(?)" "p.(Ile395=)" "" "0000892593" "00025852" "50" "1567" "0" "1567" "0" "c.1567C>T" "r.(?)" "p.(Arg523Cys)" "" "0000892594" "00025852" "30" "4009" "0" "4009" "0" "c.4009G>A" "r.(?)" "p.(Glu1337Lys)" "" "0000914496" "00025852" "30" "2373" "0" "2373" "0" "c.2373C>T" "r.(?)" "p.(Ala791=)" "" "0000914497" "00025852" "50" "3440" "0" "3440" "0" "c.3440G>A" "r.(?)" "p.(Arg1147His)" "" "0000933153" "00025852" "50" "3440" "0" "3440" "0" "c.3440G>A" "r.(?)" "p.(Arg1147His)" "" "0000950531" "00025852" "50" "2865" "0" "2870" "0" "c.2865_2870del" "r.(?)" "p.(Glu956_Pro957del)" "" "0000968144" "00025852" "30" "602" "7" "602" "56" "c.602+7_602+56del" "r.(=)" "p.(=)" "" "0000968147" "00025852" "30" "1758" "0" "1758" "0" "c.1758C>T" "r.(?)" "p.(Ser586=)" "" "0000968148" "00025852" "30" "3604" "0" "3604" "0" "c.3604G>A" "r.(?)" "p.(Gly1202Arg)" "" "0001001981" "00025852" "30" "653" "0" "653" "0" "c.653C>G" "r.(?)" "p.(Thr218Arg)" "" "0001001982" "00025852" "50" "659" "0" "659" "0" "c.659G>A" "r.(?)" "p.(Arg220His)" "" "0001001983" "00025852" "30" "1427" "0" "1427" "0" "c.1427G>A" "r.(?)" "p.(Arg476His)" "" "0001001984" "00025852" "50" "1910" "0" "1910" "0" "c.1910C>T" "r.(?)" "p.(Ser637Phe)" "" "0001001985" "00025852" "50" "1936" "0" "1936" "0" "c.1936G>A" "r.(?)" "p.(Glu646Lys)" "" "0001001986" "00025852" "30" "2278" "0" "2280" "0" "c.2278_2280del" "r.(?)" "p.(Lys760del)" "" "0001001987" "00025852" "50" "2416" "0" "2416" "0" "c.2416G>A" "r.(?)" "p.(Ala806Thr)" "" "0001001988" "00025852" "50" "2473" "0" "2473" "0" "c.2473G>A" "r.(?)" "p.(Gly825Arg)" "" "0001001989" "00025852" "30" "2842" "0" "2842" "0" "c.2842A>G" "r.(?)" "p.(Ser948Gly)" "" "0001001990" "00025852" "30" "2868" "0" "2868" "0" "c.2868G>C" "r.(?)" "p.(Glu956Asp)" "" "0001001991" "00025852" "90" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Arg1147Cys)" "" "0001001992" "00025852" "70" "3440" "0" "3440" "0" "c.3440G>A" "r.(?)" "p.(Arg1147His)" "" "0001001993" "00025852" "50" "3590" "0" "3590" "0" "c.3590A>T" "r.(?)" "p.(Glu1197Val)" "" "0001001994" "00025852" "30" "3598" "0" "3598" "0" "c.3598C>T" "r.(?)" "p.(Arg1200Cys)" "" "0001001995" "00025852" "50" "3599" "0" "3599" "0" "c.3599G>A" "r.(?)" "p.(Arg1200His)" "" "0001001996" "00025852" "50" "3604" "0" "3604" "0" "c.3604G>A" "r.(?)" "p.(Gly1202Arg)" "" "0001001999" "00025852" "50" "3998" "0" "3998" "0" "c.3998C>T" "r.(?)" "p.(Ser1333Phe)" "" "0001002000" "00025852" "50" "4009" "0" "4009" "0" "c.4009G>T" "r.(?)" "p.(Glu1337*)" "" "0001015310" "00025852" "50" "848" "0" "848" "0" "c.848C>T" "r.(?)" "p.(Ser283Leu)" "" "0001026580" "00025852" "30" "602" "21" "602" "45" "c.602+21_602+45del" "r.(=)" "p.(=)" "" "0001040856" "00025852" "30" "1216" "682" "1216" "682" "c.1216+682G>A" "r.(=)" "p.(=)" "" "0001040857" "00025852" "30" "1217" "-5" "1217" "-5" "c.1217-5G>A" "r.spl?" "p.?" "" "0001040858" "00025852" "30" "2446" "0" "2446" "0" "c.2446G>C" "r.(?)" "p.(Ala816Pro)" "" "0001040859" "00025852" "30" "3826" "0" "3826" "0" "c.3826G>A" "r.(?)" "p.(Glu1276Lys)" "" "0001055329" "00025852" "30" "1458" "-3" "1458" "-2" "c.1458-3_1458-2del" "r.spl?" "p.?" "" "0001055331" "00025852" "30" "3406" "0" "3406" "0" "c.3406C>T" "r.(?)" "p.(Leu1136=)" "" "0001066339" "00025852" "50" "496" "0" "496" "0" "c.496C>T" "r.(?)" "p.(Gln166*)" "" "0001066340" "00025852" "50" "2254" "0" "2254" "0" "c.2254G>A" "r.(?)" "p.(Ala752Thr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 22 "{{screeningid}}" "{{variantid}}" "0000214215" "0000446156" "0000214216" "0000446157" "0000214217" "0000446158" "0000214218" "0000446159" "0000214219" "0000446160" "0000214220" "0000446161" "0000214221" "0000446162" "0000214222" "0000446163" "0000214223" "0000446164" "0000214224" "0000446165" "0000214225" "0000446166" "0000214226" "0000446167" "0000214227" "0000446168" "0000376815" "0000788868" "0000377662" "0000790076" "0000377663" "0000790077" "0000377664" "0000790078" "0000377665" "0000790079" "0000377666" "0000790080" "0000377668" "0000790082" "0000392465" "0000822765" "0000437762" "0000933153"