### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = MBOAT7) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "MBOAT7" "membrane bound O-acyltransferase domain containing 7" "19" "q13.4" "unknown" "NG_033045.2" "UD_132465815840" "" "https://www.LOVD.nl/MBOAT7" "" "1" "15505" "79143" "606048" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/MBOAT7_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-12-29 13:08:36" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00011880" "MBOAT7" "transcript variant 1" "003" "NM_024298.3" "" "NP_077274.3" "" "" "" "-548" "2051" "1419" "54693733" "54677106" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04147" "MRT" "mental retardation, autosomal recessive (MRT, intellectual disability (IDT))" "" "" "" "autosomal recessive" "" "00006" "2014-10-11 12:21:35" "00006" "2018-12-18 09:25:11" "05679" "MRT57" "mental retardation, autosomal recessive, type 57 (MRT57)" "AR" "617188" "" "" "" "00006" "2019-12-29 13:08:00" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "MBOAT7" "04147" "MBOAT7" "05679" ## Individuals ## Do not remove or alter this header ## ## Count = 18 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00274323" "" "" "" "2" "" "03545" "" "" "M" "yes" "Iran" "18y" "0" "" "" "" "G6233" "00274324" "" "" "" "1" "" "03545" "" "" "M" "yes" "" "" "0" "" "" "" "" "00274338" "" "" "" "3" "" "00006" "{PMID:Johansen 2016:27616480}" "3-generation family, 3 affected (3M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Egypt" "" "0" "" "" "" "Fam1PatIII2" "00274339" "" "" "00274338" "1" "" "00006" "{PMID:Johansen 2016:27616480}" "" "M" "yes" "Egypt" "" "0" "" "" "" "Fam1PatIII3" "00274340" "" "" "00274338" "1" "" "00006" "{PMID:Johansen 2016:27616480}" "" "M" "yes" "Egypt" "" "0" "" "" "" "Fam1PatIII4" "00274341" "" "" "" "2" "" "00006" "{PMID:Johansen 2016:27616480}" "3-generation family, 2 affected (F, M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "" "Fam2PatIII2" "00274342" "" "" "00274341" "1" "" "00006" "{PMID:Johansen 2016:27616480}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "Fam2PatIII3" "00274343" "" "" "" "3" "" "00006" "{PMID:Johansen 2016:27616480}" "3-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "" "Fam3PatIII3" "00274344" "" "" "00274343" "1" "" "00006" "{PMID:Johansen 2016:27616480}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "Fam3PatIII4" "00274345" "" "" "00274343" "1" "" "00006" "{PMID:Johansen 2016:27616480}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "Fam3PatIII5" "00275630" "" "" "" "4" "" "00006" "{PMID:Santos-Cortez 2018:30167849}" "5-generation family, 4 affected (2F, 2M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "" "FamMR77Pat4" "00275631" "" "" "00275630" "1" "" "00006" "{PMID:Santos-Cortez 2018:30167849}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "FamMR77Pat5" "00275632" "" "" "00275630" "1" "" "00006" "{PMID:Santos-Cortez 2018:30167849}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "FamMR77Pat6" "00275633" "" "" "00275630" "1" "" "00006" "{PMID:Santos-Cortez 2018:30167849}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "FamMR77Pat7" "00292196" "" "" "" "23" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00387885" "" "" "" "3" "" "00006" "{PMID:Hu 2019:29302074}" "family, 3 affected individuals, first cousin parents once removed" "" "yes" "" "" "0" "" "" "Azeri" "M9000101" "00426134" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, other affecteds in family" "M" "" "Oman" "" "0" "" "" "" "61BS3700" "00460893" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 18 "{{individualid}}" "{{diseaseid}}" "00274323" "04147" "00274324" "04147" "00274338" "00198" "00274339" "00198" "00274340" "00198" "00274341" "00198" "00274342" "00198" "00274343" "00198" "00274344" "00198" "00274345" "00198" "00275630" "00139" "00275631" "00139" "00275632" "00139" "00275633" "00139" "00292196" "00198" "00387885" "00139" "00426134" "00139" "00460893" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 04147, 05679 ## Count = 15 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000209281" "00198" "00274338" "00006" "Familial, autosomal recessive" "" "head control-7m, sit-2y, walk-4y6m; no speech; onset seizures-7m, myoclonic seizures; child autism rating scale 28; head circumference -1SD; hypotonia infancy; hypertonia; intellectual disability; MRI brain normal" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209282" "00198" "00274339" "00006" "Familial, autosomal recessive" "" "head control-8m, sit-2y6m, walk-4y; no speech; onset seizures-6m, focal seizures; child autism rating scale 30; head circumference -1SD; hypotonia infancy; hypertonia; intellectual disability;" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209283" "00198" "00274340" "00006" "Familial, autosomal recessive" "" "head control-6m, sit-2y, walk-3y; no speech; onset seizures-7m, myoclonic seizures; child autism rating scale 30; head circumference -1SD; hypotonia infancy; hypertonia; intellectual disability; MRI brain normal" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209284" "00198" "00274341" "00006" "Familial, autosomal recessive" "" "head control-2y6m, sit-3y6m; no speech; onset seizures-2y6m, generalized tonic-clonic seizures; child autism rating scale 44; head circumference -3SD; hypotonia infancy; hypertonia; intellectual disability; MRI brain polymicrogyria, cortical atrophy" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209285" "00198" "00274342" "00006" "Familial, autosomal recessive" "" "head control-2y, sit-3y; no speech; no seizures; child autism rating scale 42; head circumference -2SD; hypotonia infancy; hypertonia; intellectual disability;" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209286" "00198" "00274343" "00006" "Familial, autosomal recessive" "" "head control-8m, sit-1y6m, walk-3y6m; first words-7y, two word sentence-7y ; onset seizures-18m, myoclonic seizures; child autism rating scale 41; head circumference -1.1SD; hypotonia infancy; hypertonia; intellectual disability; MRI brain polymicrogyria, cortical atrophy" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209287" "00198" "00274344" "00006" "Familial, autosomal recessive" "" "head control-8m, sit-1y6m, walk-2y; first words-4y, two word sentence-5y ; onset seizures-4m, focal seizures; child autism rating scale 42; head circumference -2.5SD; hypotonia infancy; hypertonia; intellectual disability; MRI brain normal" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209288" "00198" "00274345" "00006" "Familial, autosomal recessive" "" "head control-1y, sit-1y6m; no speech; onset seizures-6m, myoclonic seizures; child autism rating scale 42; head circumference -2.8SD; hypotonia infancy; hypertonia; intellectual disability" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000209297" "04147" "00274323" "03545" "Familial, autosomal recessive" "" "intellectual disability, developmental delay,muscular hypotonia" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" "0000210241" "00139" "00275630" "00006" "Familial, autosomal recessive" "32y" "OFC 55cm; IQ 30, severe intellectual disability (HP:0010864); speech disability" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000210242" "00139" "00275631" "00006" "Familial, autosomal recessive" "29y" "OFC 53.8cm; IQ 30, severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000210243" "00139" "00275632" "00006" "Familial, autosomal recessive" "28y" "OFC 52.5cm; IQ 25, severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000210244" "00139" "00275633" "00006" "Familial, autosomal recessive" "19y" "OFC 51.2cm; IQ 25, severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000281453" "00139" "00387885" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, no microcephaly, epilepsy, leukoencephalopathy" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000317284" "00139" "00426134" "00006" "Familial, autosomal recessive" "2y" "" "" "" "" "" "" "" "" "" "MRT57" "intellectual disability" "" ## Screenings ## Do not remove or alter this header ## ## Count = 18 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000275482" "00274323" "1" "03545" "03545" "2019-12-29 08:17:22" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000275483" "00274324" "1" "03545" "03545" "2019-12-29 08:28:25" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000275498" "00274338" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275499" "00274339" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275500" "00274340" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275501" "00274341" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275502" "00274342" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275503" "00274343" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275504" "00274344" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275505" "00274345" "1" "00006" "00006" "2019-12-29 15:57:46" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000276788" "00275630" "1" "00006" "00006" "2020-01-11 17:34:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000276789" "00275631" "1" "00006" "00006" "2020-01-11 17:34:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000276790" "00275632" "1" "00006" "00006" "2020-01-11 17:34:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000276791" "00275633" "1" "00006" "00006" "2020-01-11 17:34:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000293364" "00292196" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000389116" "00387885" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000427454" "00426134" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000462525" "00460893" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 16 "{{screeningid}}" "{{geneid}}" "0000275482" "MBOAT7" "0000275483" "MBOAT7" "0000275498" "MBOAT7" "0000275499" "MBOAT7" "0000275500" "MBOAT7" "0000275501" "MBOAT7" "0000275502" "MBOAT7" "0000275503" "MBOAT7" "0000275504" "MBOAT7" "0000275505" "MBOAT7" "0000276788" "MBOAT7" "0000276789" "MBOAT7" "0000276790" "MBOAT7" "0000276791" "MBOAT7" "0000389116" "MBOAT7" "0000462525" "MBOAT7" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 39 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000291581" "0" "50" "19" "54687439" "54687440" "del" "0" "01943" "MBOAT7_000001" "g.54687439_54687440del" "" "" "" "MBOAT7(NM_024298.4):c.458_459delTC (p.L153Qfs*142)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54183556_54183557del" "" "VUS" "" "0000309689" "0" "30" "19" "54695254" "54695254" "subst" "0.00101963" "02330" "TSEN34_000001" "g.54695254G>A" "" "" "" "TSEN34(NM_001282332.2):c.39G>A (p.V13=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54191403G>A" "" "likely benign" "" "0000309690" "0" "10" "19" "54697079" "54697079" "subst" "0.762808" "02330" "TSEN34_000002" "g.54697079C>T" "" "" "" "TSEN34(NM_001282332.2):c.795C>T (p.P265=), TSEN34(NM_024075.5):c.795C>T (p.P265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54193224=" "" "benign" "" "0000309691" "0" "50" "19" "54697134" "54697134" "subst" "7.71599E-5" "02330" "TSEN34_000003" "g.54697134G>A" "" "" "" "TSEN34(NM_001282332.2):c.850G>A (p.V284I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54193279G>A" "" "VUS" "" "0000312094" "0" "10" "19" "54697079" "54697079" "subst" "0.762808" "02325" "TSEN34_000002" "g.54697079C>T" "" "" "" "TSEN34(NM_001282332.2):c.795C>T (p.P265=), TSEN34(NM_024075.5):c.795C>T (p.P265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54193224=" "" "benign" "" "0000316654" "0" "10" "19" "54672410" "54672410" "subst" "0.00539805" "01943" "TMC4_000001" "g.54672410C>T" "" "" "" "TMC4(NM_001145303.2):c.460-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54168684C>T" "" "benign" "" "0000344332" "0" "50" "19" "54684584" "54684584" "subst" "0" "02327" "MBOAT7_000002" "g.54684584A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54180867A>G" "" "VUS" "" "0000568381" "0" "30" "19" "54675795" "54675795" "subst" "4.07797E-6" "01804" "MBOAT7_000004" "g.54675795C>T" "" "" "" "TMC4(NM_001145303.1):c.155G>A (p.(Arg52Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54172026C>T" "" "likely benign" "" "0000568382" "0" "50" "19" "54677907" "54677907" "subst" "0" "02327" "MBOAT7_000005" "g.54677907A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54174213A>G" "" "VUS" "" "0000568383" "0" "50" "19" "54682480" "54682480" "subst" "0" "01943" "MBOAT7_000006" "g.54682480A>C" "" "" "" "MBOAT7(NM_001146082.2):c.1033T>G (p.*345Gext*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54178763A>C" "" "VUS" "" "0000568384" "0" "50" "19" "54684748" "54684748" "subst" "0" "02327" "MBOAT7_000007" "g.54684748G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54181031G>C" "" "VUS" "" "0000568385" "0" "30" "19" "54692208" "54692208" "subst" "0" "01804" "MBOAT7_000008" "g.54692208G>C" "" "" "" "MBOAT7(NM_001146056.1):c.-16-8C>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54188354G>C" "" "likely benign" "" "0000568387" "0" "30" "19" "54696013" "54696013" "subst" "4.07857E-6" "01943" "MBOAT7_000010" "g.54696013G>T" "" "" "" "TSEN34(NM_001282332.1):c.534G>T (p.L178F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54192162G>T" "" "likely benign" "" "0000617858" "0" "30" "19" "54684748" "54684748" "subst" "0" "01804" "MBOAT7_000011" "g.54684748G>A" "" "" "" "MBOAT7(NM_001146056.1):c.377C>T (p.(Pro126Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54181031G>A" "" "likely benign" "" "0000629504" "3" "90" "19" "54678095" "54678095" "subst" "0" "03545" "MBOAT7_000012" "g.54678095G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.54174401G>T" "" "likely pathogenic (recessive)" "" "0000629505" "3" "90" "19" "54678022" "54678022" "del" "0" "03545" "MBOAT7_000013" "g.54678022del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.54174328del" "" "likely pathogenic (recessive)" "" "0000629529" "3" "90" "19" "54692133" "54692152" "del" "0" "00006" "MBOAT7_000015" "g.54692133_54692152del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54188279_54188298del" "" "pathogenic (recessive)" "" "0000629530" "3" "90" "19" "54692133" "54692152" "del" "0" "00006" "MBOAT7_000015" "g.54692133_54692152del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54188279_54188298del" "" "pathogenic (recessive)" "" "0000629531" "3" "90" "19" "54692133" "54692152" "del" "0" "00006" "MBOAT7_000015" "g.54692133_54692152del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54188279_54188298del" "" "pathogenic (recessive)" "" "0000629532" "3" "90" "19" "54684576" "54684596" "del" "0" "00006" "MBOAT7_000014" "g.54684576_54684596del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54180859_54180879del" "" "pathogenic (recessive)" "" "0000629533" "3" "90" "19" "54684576" "54684596" "del" "0" "00006" "MBOAT7_000014" "g.54684576_54684596del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54180859_54180879del" "" "pathogenic (recessive)" "" "0000629534" "3" "90" "19" "54684576" "54684596" "del" "0" "00006" "MBOAT7_000014" "g.54684576_54684596del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54180859_54180879del" "" "pathogenic (recessive)" "" "0000629535" "3" "90" "19" "54684576" "54684596" "del" "0" "00006" "MBOAT7_000014" "g.54684576_54684596del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54180859_54180879del" "" "pathogenic (recessive)" "" "0000629536" "3" "90" "19" "54684576" "54684596" "del" "0" "00006" "MBOAT7_000014" "g.54684576_54684596del" "" "{PMID:Johansen 2016:27616480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54180859_54180879del" "" "pathogenic (recessive)" "" "0000630927" "3" "90" "19" "54691125" "54691125" "del" "0" "00006" "MBOAT7_000016" "g.54691125del" "" "{PMID:Santos-Cortez 2018:30167849}" "" "251delT" "" "Germline" "" "" "0" "" "" "g.54187243del" "" "pathogenic (recessive)" "" "0000630928" "3" "90" "19" "54691125" "54691125" "del" "0" "00006" "MBOAT7_000016" "g.54691125del" "" "{PMID:Santos-Cortez 2018:30167849}" "" "251delT" "" "Germline" "" "" "0" "" "" "g.54187243del" "" "pathogenic (recessive)" "" "0000630929" "3" "90" "19" "54691125" "54691125" "del" "0" "00006" "MBOAT7_000016" "g.54691125del" "" "{PMID:Santos-Cortez 2018:30167849}" "" "251delT" "" "Germline" "" "" "0" "" "" "g.54187243del" "" "pathogenic (recessive)" "" "0000630930" "3" "90" "19" "54691125" "54691125" "del" "0" "00006" "MBOAT7_000016" "g.54691125del" "" "{PMID:Santos-Cortez 2018:30167849}" "" "251delT" "" "Germline" "" "" "0" "" "" "g.54187243del" "" "pathogenic (recessive)" "" "0000650053" "1" "30" "19" "54677793" "54677793" "subst" "0.00853471" "03575" "MBOAT7_000017" "g.54677793C>T" "23/2789 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "23 heterozygous, no homozygous; {DB:CLININrs79199039}" "Germline" "" "rs79199039" "0" "" "" "g.54174099C>T" "" "likely benign" "" "0000727522" "0" "70" "19" "54687564" "54687564" "subst" "0" "01943" "MBOAT7_000018" "g.54687564C>A" "" "" "" "MBOAT7(NM_024298.4):c.334-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809046" "0" "70" "19" "54678080" "54678080" "del" "0" "01943" "MBOAT7_000019" "g.54678080del" "" "" "" "MBOAT7(NM_024298.4):c.1079delC (p.P360Rfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000817909" "3" "70" "19" "54678088" "54678088" "subst" "0" "00006" "MBOAT7_000020" "g.54678088C>T" "" "{PMID:Hu 2019:29302074}" "" "" "novel candidate disease gene" "Germline" "" "" "0" "" "" "g.54174394C>T" "" "likely pathogenic (recessive)" "" "0000904814" "3" "70" "19" "54684740" "54684740" "subst" "0" "00006" "MBOAT7_000021" "g.54684740C>G" "" "{PMID:Al-Kasbi 2022:36344539}" "" "" "" "Germline" "" "" "0" "" "" "g.54181023C>G" "" "likely pathogenic (recessive)" "" "0000983644" "0" "30" "19" "54694230" "54694230" "subst" "1.88993E-5" "01804" "MBOAT7_000022" "g.54694230G>T" "" "" "" "TSEN34(NM_001282333.2):c.-5+8G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005120" "0" "90" "19" "54677782" "54677803" "del" "0" "01804" "MBOAT7_000023" "g.54677782_54677803del" "" "" "" "MBOAT7(NM_024298.3):c.1361_1382delGGCGGAAGGCAGCATCCCAGCC (p.(Arg454fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001005121" "0" "30" "19" "54677872" "54677872" "subst" "8.49178E-6" "01804" "MBOAT7_000024" "g.54677872T>C" "" "" "" "MBOAT7(NM_024298.3):c.1285A>G (p.(Ile429Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005122" "0" "50" "19" "54691063" "54691063" "subst" "0" "01804" "MBOAT7_000025" "g.54691063G>T" "" "" "" "MBOAT7(NM_024298.3):c.313C>A (p.(Gln105Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001022052" "0" "70" "19" "54687439" "54687440" "del" "0" "04796" "MBOAT7_000001" "g.54687439_54687440del" "" "" "" "458_459delTC" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.54183556_54183557del" "" "likely pathogenic" "" "0001056791" "0" "50" "19" "54673250" "54673250" "subst" "0" "01804" "MBOAT7_000026" "g.54673250C>T" "" "" "" "TMC4(NM_144686.4):c.442G>A (p.(Gly148Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes MBOAT7 ## Count = 39 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000291581" "00011880" "50" "458" "0" "459" "0" "c.458_459del" "r.(?)" "p.(Leu153GlnfsTer142)" "" "0000309689" "00011880" "30" "-2069" "0" "-2069" "0" "c.-2069C>T" "r.(?)" "p.(=)" "" "0000309690" "00011880" "10" "-3894" "0" "-3894" "0" "c.-3894G>A" "r.(?)" "p.(=)" "" "0000309691" "00011880" "50" "-3949" "0" "-3949" "0" "c.-3949C>T" "r.(?)" "p.(=)" "" "0000312094" "00011880" "10" "-3894" "0" "-3894" "0" "c.-3894G>A" "r.(?)" "p.(=)" "" "0000316654" "00011880" "10" "6747" "0" "6747" "0" "c.*5328G>A" "r.(=)" "p.(=)" "" "0000344332" "00011880" "50" "760" "0" "760" "0" "c.760T>C" "r.(?)" "p.(Cys254Arg)" "" "0000568381" "00011880" "30" "3362" "0" "3362" "0" "c.*1943G>A" "r.(=)" "p.(=)" "" "0000568382" "00011880" "50" "1250" "0" "1250" "0" "c.1250T>C" "r.(?)" "p.(Leu417Pro)" "" "0000568383" "00011880" "50" "1031" "2" "1031" "2" "c.1031+2T>G" "r.spl?" "p.?" "" "0000568384" "00011880" "50" "596" "0" "596" "0" "c.596C>G" "r.(?)" "p.(Pro199Arg)" "" "0000568385" "00011880" "30" "77" "-8" "77" "-8" "c.77-8C>G" "r.(=)" "p.(=)" "" "0000568387" "00011880" "30" "-2828" "0" "-2828" "0" "c.-2828C>A" "r.(?)" "p.(=)" "" "0000617858" "00011880" "30" "596" "0" "596" "0" "c.596C>T" "r.(?)" "p.(Pro199Leu)" "" "0000629504" "00011880" "90" "1062" "0" "1062" "0" "c.1062C>A" "r.(?)" "p.(Tyr354*)" "8" "0000629505" "00011880" "90" "1135" "0" "1135" "0" "c.1135del" "r.(?)" "p.(Leu379Trpfs*9)" "8" "0000629529" "00011880" "90" "126" "0" "145" "0" "c.126_145del" "r.(?)" "p.(Leu43Hisfs*69)" "" "0000629530" "00011880" "90" "126" "0" "145" "0" "c.126_145del" "r.(?)" "p.(Leu43Hisfs*69)" "" "0000629531" "00011880" "90" "126" "0" "145" "0" "c.126_145del" "r.(?)" "p.(Leu43Hisfs*69)" "" "0000629532" "00011880" "90" "758" "0" "778" "0" "c.758_778del" "r.(?)" "p.(Glu253_Ala259del)" "" "0000629533" "00011880" "90" "758" "0" "778" "0" "c.758_778del" "r.(?)" "p.(Glu253_Ala259del)" "" "0000629534" "00011880" "90" "758" "0" "778" "0" "c.758_778del" "r.(?)" "p.(Glu253_Ala259del)" "" "0000629535" "00011880" "90" "758" "0" "778" "0" "c.758_778del" "r.(?)" "p.(Glu253_Ala259del)" "" "0000629536" "00011880" "90" "758" "0" "778" "0" "c.758_778del" "r.(?)" "p.(Glu253_Ala259del)" "" "0000630927" "00011880" "90" "251" "0" "251" "0" "c.251del" "r.[(251del),spl]" "p.[(Leu84Argfs*25),?]" "" "0000630928" "00011880" "90" "251" "0" "251" "0" "c.251del" "r.[(251del),spl]" "p.[(Leu84Argfs*25),?]" "" "0000630929" "00011880" "90" "251" "0" "251" "0" "c.251del" "r.[(251del),spl]" "p.[(Leu84Argfs*25),?]" "" "0000630930" "00011880" "90" "251" "0" "251" "0" "c.251del" "r.[(251del),spl]" "p.[(Leu84Argfs*25),?]" "" "0000650053" "00011880" "30" "1364" "0" "1364" "0" "c.1364G>A" "r.(?)" "p.(Arg455Gln)" "" "0000727522" "00011880" "70" "334" "-1" "334" "-1" "c.334-1G>T" "r.spl?" "p.?" "" "0000809046" "00011880" "70" "1079" "0" "1079" "0" "c.1079del" "r.(?)" "p.(Pro360Argfs*5)" "" "0000817909" "00011880" "70" "1069" "0" "1069" "0" "c.1069G>A" "r.(?)" "p.(Gly357Ser)" "" "0000904814" "00011880" "70" "604" "0" "604" "0" "c.604G>C" "r.(?)" "p.(Gly202Arg)" "" "0000983644" "00011880" "30" "-1045" "0" "-1045" "0" "c.-1045C>A" "r.(?)" "p.(=)" "" "0001005120" "00011880" "90" "1361" "0" "1382" "0" "c.1361_1382del" "r.(?)" "p.(Arg454Profs*28)" "" "0001005121" "00011880" "30" "1285" "0" "1285" "0" "c.1285A>G" "r.(?)" "p.(Ile429Val)" "" "0001005122" "00011880" "50" "313" "0" "313" "0" "c.313C>A" "r.(?)" "p.(Gln105Lys)" "" "0001022052" "00011880" "70" "458" "0" "459" "0" "c.458_459del" "r.495_854del" "p.Phe167_Pro286del" "5" "0001056791" "00011880" "50" "5907" "0" "5907" "0" "c.*4488G>A" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 18 "{{screeningid}}" "{{variantid}}" "0000275482" "0000629504" "0000275483" "0000629505" "0000275498" "0000629529" "0000275499" "0000629530" "0000275500" "0000629531" "0000275501" "0000629532" "0000275502" "0000629533" "0000275503" "0000629534" "0000275504" "0000629535" "0000275505" "0000629536" "0000276788" "0000630927" "0000276789" "0000630928" "0000276790" "0000630929" "0000276791" "0000630930" "0000293364" "0000650053" "0000389116" "0000817909" "0000427454" "0000904814" "0000462525" "0001022052"