### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = MFSD2A)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"MFSD2A"	"major facilitator superfamily domain containing 2A"	"1"	"p34.2"	"unknown"	"NG_053084.1"	"UD_136021602049"	""	"https://www.LOVD.nl/MFSD2A"	""	"1"	"25897"	"84879"	"614397"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/MFSD2A_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2020-01-24 16:35:13"	"00000"	"2025-11-01 13:22:20"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00025669"	"MFSD2A"	"transcript variant 2"	"002"	"NM_032793.3"	""	"NP_116182.2"	""	""	""	"-181"	"1981"	"1593"	"40420784"	"40435628"	"00006"	"2021-12-17 17:37:24"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 5
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"03381"	"cancer, gastric"	"cancer, gastric (Neoplasm of stomach)"	""	"613659"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2017-07-14 15:28:09"
"04576"	"NEDMISBA;MCPH15"	"neurodevelopmental disorder with progressive microcephaly, spasticity, and brain abnormalitie (MCPH15)"	"AR"	"616486"	""	""	""	"00000"	"2015-09-23 10:25:23"	"00006"	"2021-12-17 19:31:53"
"05153"	"MCPH"	"microcephaly, primary, autosomal recessive (MCPH)"	""	""	""	""	""	"00006"	"2016-04-14 15:50:58"	"00006"	"2016-07-05 08:24:40"
"05421"	"microcephaly"	"microcephaly"	""	""	""	""	""	"00006"	"2018-04-15 11:41:15"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"MFSD2A"	"04576"
"MFSD2A"	"05153"


## Individuals ## Do not remove or alter this header ##
## Count = 16
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00104036"	""	""	""	"1"	""	"00587"	"{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}"	"54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer"	""	""	""	""	"0"	""	""	""	"Vogelaar-759A"
"00265259"	""	""	""	"1"	""	"03388"	""	""	""	"yes"	"Iran"	""	"0"	""	""	""	"MFSD2A"
"00276067"	""	""	""	"1"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 1 affected"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"FamAPat1"
"00276070"	""	""	""	"2"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 2 affected brothers"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"FamBPat2"
"00276071"	""	""	""	"4"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 4 affected sibs (2F, 2M)"	"F"	"yes"	"Pakistan"	""	"0"	""	""	""	"FamCPat3"
"00276074"	""	""	""	"1"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 1 affected"	"M"	"no"	"Russia"	""	"0"	""	""	""	"FamDPat5"
"00276075"	""	""	""	"1"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 2 affected sibs (F, M)"	"F"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"FamEPat6"
"00276076"	""	""	""	"1"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 1 affected"	"M"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"FamFPat7"
"00276077"	""	""	""	"1"	""	"03565"	"{PMID:Scala 2020:32572202}"	"2-generation family, 1 affected"	"F"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"FamGPat8"
"00317994"	""	""	""	"1"	""	"00006"	"{PMID:Riazuddin 2017:27457812}"	""	""	"yes"	"Pakistan"	""	"0"	""	""	""	"PKMR97"
"00387814"	""	""	""	"3"	""	"00006"	"{PMID:Hu 2019:29302074}"	"family, 3 affected individuals, first cousin parents"	""	"yes"	"Iran"	""	"0"	""	""	"Baloch"	"M8700073"
"00396960"	""	""	"00276071"	"1"	""	"00006"	"{PMID:Scala 2020:32572202}"	"FamCPat4"	"F"	"yes"	"Pakistan"	""	"0"	""	""	""	"FamCPat4"
"00396961"	""	""	""	"2"	""	"00006"	"{PMID:Harel 2018:30043326}"	"2-generation family, affected brother/sister, unaffected heterozygous carrier parents"	"F;M"	"yes"	"Morocco"	""	"0"	""	""	"Jewish"	"family"
"00396962"	""	""	""	"10"	""	"00006"	"{PMID:Abe 2015:}"	"3-generation family, 10 affected (3F, 7M)"	"F;M"	"yes"	"Pakistan"	""	"0"	""	""	""	"family"
"00396963"	""	""	""	"2"	""	"00006"	"{PMID:Guemez-Gamboa 2015:26005868}"	"4-generation family, 2 affected, sisters unaffected heterozygous carrier parents"	"F"	"yes"	"Libya"	""	"0"	""	""	""	"Fam1422"
"00396964"	""	""	""	"2"	""	"00006"	"{PMID:Guemez-Gamboa 2015:26005868}"	"4-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives"	"F;M"	"yes"	"Egypt"	""	"0"	""	""	""	"Fam1825"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 16
"{{individualid}}"	"{{diseaseid}}"
"00104036"	"03381"
"00265259"	"05421"
"00276067"	"04576"
"00276070"	"04576"
"00276071"	"04576"
"00276074"	"04576"
"00276075"	"04576"
"00276076"	"04576"
"00276077"	"04576"
"00317994"	"00139"
"00387814"	"00139"
"00396960"	"04576"
"00396961"	"04576"
"00396962"	"05153"
"00396963"	"04576"
"00396964"	"04576"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00139, 03381, 04576, 05153, 05421
## Count = 16
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000081970"	"03381"	"00104036"	"00587"	"Unknown"	""	"diffuse-type or intestinal-type gastric cancer"	""	""	""	""	""	""	""	""	""	""
"0000203078"	"05421"	"00265259"	"03388"	"Familial, autosomal recessive"	"?"	""	"?"	"11y?"	""	""	""	""	""	"autosomal recessive primary microcephaly-15"	"microcephaly"	""
"0000210667"	"04576"	"00276067"	"03565"	"Familial, autosomal recessive"	"04y"	"no premature death; OFC birth 28 cm (-4.6 SDS), OFC  41 cm (-5.6 SDS); global developmental delay; not sitting; not walking; no speech; no behavioral abnormalities; appendicular spasticity; axial hypotonia; seizures; dysphagia; talipes equinovarus; MRI severe WM thinning with ventricular dilatation, severe simplified gyral pattern, severe corpus callosum hypoplasia, inferior vermian hypoplasia, pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210668"	"04576"	"00276070"	"03565"	"Familial, autosomal recessive"	"04y"	"no premature death; OFC birth 27 cm (-3.9 SDS), OFC  37 cm (-8.8 SDS); global developmental delay; not sitting; not walking; severely delayed speech; no behavioral abnormalities; appendicular spasticity; no axial hypotonia; seizures; no dysphagia; talipes equinovarus; MRI severe WM thinning with ventricular dilatation, severe simplified gyral pattern, severe corpus callosum hypoplasia, inferior vermian hypoplasia, pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210669"	"04576"	"00276071"	"03565"	"Familial, autosomal recessive"	"17y"	"no premature death; OFC 49 cm (-5.0 SDS); global developmental delay; sit; walk; severely delayed speech; severe intellectual disability; aggressive behavior; appendicular spasticity; no axial hypotonia; no seizures; no dysphagia; no skeletal abnormalities; MRI moderate WM thinning with ventricular dilatation, mild simplified gyral pattern, mild corpus callosum hypoplasia, inferior vermian hypoplasia, no pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210670"	"04576"	"00276074"	"03565"	"Familial, autosomal recessive"	"05y"	"no premature death; OFC 46 cm (-3.6 SDS); global developmental delay; sit; not walking; no speech; severe intellectual disability; no behavioral abnormalities; no appendicular spasticity; axial hypotonia; seizures; dysphagia; no skeletal abnormalities; MRI mild WM thinning with ventricular dilatation, mild simplified gyral pattern, mild corpus callosum hypoplasia, inferior vermian hypoplasia, no pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210671"	"04576"	"00276075"	"03565"	"Familial, autosomal recessive"	"00y01m"	"no premature death; OFC birth 28.5 cm (-3.6 SDS); global developmental delay; not sitting; not walking; no speech; severe intellectual disability; no behavioral abnormalities; appendicular spasticity; no axial hypotonia; seizures; dysphagia; no skeletal abnormalities; MRI severe WM thinning with ventricular dilatation, severe simplified gyral pattern, severe corpus callosum hypoplasia, inferior vermian hypoplasia, pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210673"	"04576"	"00276076"	"03565"	"Familial, autosomal recessive"	"02y"	"no premature death; OFC birth 25.5 cm (-6 SDS), OFC  36 cm (-8.9 SDS); global developmental delay; not sitting; not walking; no speech; severe intellectual disability; no behavioral abnormalities; appendicular spasticity; no axial hypotonia; seizures; dysphagia; talipes equinovarus; MRI severe WM thinning with ventricular dilatation, severe simplified gyral pattern, severe corpus callosum hypoplasia, inferior vermian hypoplasia, pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000210674"	"04576"	"00276077"	"03565"	"Familial, autosomal recessive"	"00y04m"	"no premature death; OFC birth 30.5 cm (-2.4 SDS), OFC  36 cm (-3.9 SDS); global developmental delay; sit; not walking; no speech; severe intellectual disability; no behavioral abnormalities; appendicular spasticity; no axial hypotonia; seizures; dysphagia; talipes equinovarus, bilateral developmental dysplasia hip; MRI severe WM thinning with ventricular dilatation, severe simplified gyral pattern, severe corpus callosum hypoplasia, inferior vermian hypoplasia, pontine hypoplasia"	""	""	""	""	""	""	""	""	""	""
"0000241778"	"00139"	"00317994"	"00006"	"Familial, autosomal recessive"	""	"Moderate to severe ID, non-talkative"	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000281382"	"00139"	"00387814"	"00006"	"Familial, autosomal recessive"	""	"no premature death; OFC mean -4.3 SDS; global developmental delay (3/3); sit (3/3); walk (3/3); no speech (2/3); moderate-severe intellectual disability (3/3); no behavioral abnormalities; no appendicular spasticity, ataxia (3/3); no axial hypotonia; no seizures; no dysphagia; no skeletal abnormalities"	""	""	""	""	""	""	""	"NEDMISBA"	"intellectual disability"	""
"0000290115"	"04576"	"00396960"	"00006"	"Familial, autosomal recessive"	"27y"	"no premature death; OFC 47 cm (-6.9 SDS); global developmental delay; sit; walk; severely delayed speech; severe intellectual disability; aggressive behavior; appendicular spasticity; no axial hypotonia; no seizures; no dysphagia; no skeletal abnormalities; MRI moderate WM thinning with ventricular dilatation, mild simplified gyral pattern, mild corpus callosum hypoplasia, inferior vermian hypoplasia, no pontine hypoplasia"	""	""	""	""	""	""	""	"NEDMISBA"	""	""
"0000290116"	"04576"	"00396961"	"00006"	"Familial, autosomal recessive"	""	"no premature death; OFC birth mean -2.5 SDS, OFC  mean -3.25 SDS; global developmental delay (2/2); sit (2/2); not walking; severely delayed speech (2/2); intellectual disability (2/2); no behavioral abnormalities; appendicular spasticity, dystonia (2/2); axial hypotonia (2/2); no seizures; no dysphagia; no skeletal abnormalities; MRI WM thinning with ventricular dilatation (2/2)"	""	""	""	""	""	""	""	"NEDMISBA"	"microcephaly, hypomyelination"	""
"0000290117"	"05153"	"00396962"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., OFC </= -3 SDS; global developmental delay; no/limited (10/10); severe intellectual disability (10/10); autism spectrum disorder (10/10); appendicular spasticity (3/10); no seizures; MRI WM thinning with ventricular dilatation"	""	""	""	""	""	""	""	"NEDMISBA"	"microcephaly"	""
"0000290118"	"04576"	"00396963"	"00006"	"Familial, autosomal recessive"	""	"see peper; ..."	""	""	""	""	""	""	""	"NEDMISBA"	"lethal microcephaly syndrome"	""
"0000290119"	"04576"	"00396964"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	"NEDMISBA"	"lethal microcephaly syndrome"	""


## Screenings ## Do not remove or alter this header ##
## Count = 16
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000104507"	"00104036"	"1"	"00587"	"00006"	"2017-04-28 08:15:46"	""	""	"SEQ-NG"	"DNA"	""	""
"0000266378"	"00265259"	"1"	"03388"	"03388"	"2019-09-18 12:46:44"	""	""	"SEQ-NG"	"DNA"	"Blood"	"targeted WES for microcephaly"
"0000277213"	"00276067"	"1"	"03565"	"03565"	"2020-01-24 16:10:03"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277215"	"00276070"	"1"	"03565"	"03565"	"2020-01-24 16:27:49"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277216"	"00276071"	"1"	"03565"	"03565"	"2020-01-24 16:41:15"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277217"	"00276074"	"1"	"03565"	"03565"	"2020-01-24 17:00:30"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277218"	"00276075"	"1"	"03565"	"03565"	"2020-01-24 17:08:46"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277220"	"00276076"	"1"	"03565"	"03565"	"2020-01-24 17:13:27"	""	""	"SEQ-NG"	"DNA"	""	""
"0000277221"	"00276077"	"1"	"03565"	"03565"	"2020-01-24 17:18:56"	""	""	"SEQ-NG"	"DNA"	""	""
"0000319176"	"00317994"	"1"	"00006"	"00006"	"2020-11-05 17:52:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000389045"	"00387814"	"1"	"00006"	"00006"	"2021-10-31 12:02:46"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000398202"	"00396960"	"1"	"00006"	"00006"	"2021-12-17 19:49:27"	""	""	"SEQ"	"DNA"	""	""
"0000398203"	"00396961"	"1"	"00006"	"00006"	"2021-12-17 20:30:13"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000398204"	"00396962"	"1"	"00006"	"00006"	"2021-12-17 20:37:54"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000398205"	"00396963"	"1"	"00006"	"00006"	"2021-12-17 20:47:20"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000398206"	"00396964"	"1"	"00006"	"00006"	"2021-12-17 20:50:14"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 11
"{{screeningid}}"	"{{geneid}}"
"0000266378"	"MFSD2A"
"0000277213"	"MFSD2A"
"0000277215"	"MFSD2A"
"0000277216"	"MFSD2A"
"0000277217"	"MFSD2A"
"0000277218"	"MFSD2A"
"0000277220"	"MFSD2A"
"0000277221"	"MFSD2A"
"0000319176"	"MFSD2A"
"0000389045"	"MFSD2A"
"0000398202"	"MFSD2A"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 19
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000169428"	"0"	"70"	"1"	"40433552"	"40433552"	"subst"	"0.000101636"	"00587"	"MFSD2A_000001"	"g.40433552C>G"	""	"{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}"	""	"NM_001136493.2(MFSD2A):c.1211C>G p.(Ala404Gly)"	"variant could not be associated with disease phenotype"	"Germline"	""	""	"0"	""	""	"g.39967880C>G"	""	"likely pathogenic"	""
"0000597043"	"3"	"70"	"1"	"40424348"	"40424350"	"del"	"0"	"03388"	"MFSD2A_000002"	"g.40424348_40424350del"	""	""	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.39958676_39958678del"	"{CV:000965673}"	"likely pathogenic (recessive)"	""
"0000631958"	"3"	"90"	"1"	"40434366"	"40434366"	"subst"	"0"	"03565"	"MFSD2A_000003"	"g.40434366C>T"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4"	"Germline"	"yes"	""	"0"	""	""	"g.39968694C>T"	""	"likely pathogenic (recessive)"	""
"0000631959"	"3"	"90"	"1"	"40431222"	"40431222"	"subst"	"4.06253E-6"	"03565"	"MFSD2A_000004"	"g.40431222G>A"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	"yes"	"rs758953000"	"0"	""	""	"g.39965550G>A"	""	"pathogenic (recessive)"	""
"0000631960"	"3"	"90"	"1"	"40431565"	"40431565"	"subst"	"4.06141E-6"	"03565"	"MFSD2A_000006"	"g.40431565C>T"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4"	"Germline"	"yes"	"rs756467073"	"0"	""	""	"g.39965893C>T"	""	"likely pathogenic (recessive)"	""
"0000631961"	"1"	"90"	"1"	"40432306"	"40432306"	"subst"	"0"	"03565"	"MFSD2A_000008"	"g.40432306G>T"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4"	"Germline"	"yes"	""	"0"	""	""	"g.39966634G>T"	""	"likely pathogenic (recessive)"	""
"0000631962"	"2"	"90"	"1"	"40432807"	"40432807"	"subst"	"8.12427E-6"	"03565"	"MFSD2A_000009"	"g.40432807G>A"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4"	"Germline"	"yes"	""	"0"	""	""	"g.39967135G>A"	""	"likely pathogenic (recessive)"	""
"0000631963"	"3"	"90"	"1"	"40431005"	"40431005"	"subst"	"4.06177E-6"	"03565"	"MFSD2A_000005"	"g.40431005C>T"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4, PP5"	"Germline"	"yes"	""	"0"	""	""	"g.39965333C>T"	""	"likely pathogenic (recessive)"	""
"0000631965"	"3"	"90"	"1"	"40434274"	"40434323"	"del"	"0"	"03565"	"MFSD2A_000010"	"g.40434274_40434323del"	""	"{PMID:Scala 2020:32572202}"	""	"1423_1472deldelCAGCCGGAACGTGTCAAGTTTACACTGAACATGCTCGTGACCATGGCTCC"	"ACMG PVS1, PM2, PP4"	"Germline"	"yes"	""	"0"	""	""	"g.39968602_39968651del"	""	"pathogenic (recessive)"	""
"0000631966"	"3"	"90"	"1"	"40432308"	"40432311"	"del"	"0"	"03565"	"MFSD2A_000007"	"g.40432308_40432311del"	""	"{PMID:Scala 2020:32572202}"	""	"chr1:40432304 TTGTC>T"	"ACMG PVS1, PM2, PP4"	"Germline"	"yes"	""	"0"	""	""	"g.39966636_39966639del"	""	"pathogenic (recessive)"	""
"0000701840"	"3"	"70"	"1"	"40431565"	"40431565"	"subst"	"4.06141E-6"	"00006"	"MFSD2A_000006"	"g.40431565C>T"	""	"{PMID:Riazuddin 2017:27457812}"	""	"NM_001136493.2:c.632C>T"	""	"Germline"	""	""	"0"	""	""	"g.39965893C>T"	""	"VUS"	""
"0000817838"	"3"	"70"	"1"	"40431155"	"40431155"	"subst"	"0"	"00006"	"MFSD2A_000011"	"g.40431155C>A"	""	"{PMID:Hu 2019:29302074}"	""	""	"novel candidate disease gene"	"Germline"	""	""	"0"	""	""	"g.39965483C>A"	""	"likely pathogenic (recessive)"	""
"0000830412"	"3"	"90"	"1"	"40431565"	"40431565"	"subst"	"4.06141E-6"	"00006"	"MFSD2A_000006"	"g.40431565C>T"	""	"{PMID:Scala 2020:32572202}"	""	""	"ACMG PS3, PM2, PP3, PP4"	"Germline"	"yes"	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000830413"	"3"	"90"	"1"	"40433585"	"40433585"	"subst"	"4.10219E-6"	"00006"	"MFSD2A_000012"	"g.40433585C>A"	""	"{PMID:Harel 2018:30043326}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000830414"	"3"	"90"	"1"	"40433304"	"40433304"	"subst"	"0"	"00006"	"MFSD2A_000013"	"g.40433304C>T"	""	"{PMID:Abe 2015:26005865}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000830415"	"3"	"90"	"1"	"40431162"	"40431162"	"subst"	"4.06138E-6"	"00006"	"MFSD2A_000014"	"g.40431162C>T"	""	"{PMID:Guemez-Gamboa 2015:26005868}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000830416"	"3"	"90"	"1"	"40431005"	"40431005"	"subst"	"4.06177E-6"	"00006"	"MFSD2A_000005"	"g.40431005C>T"	""	"{PMID:Guemez-Gamboa 2015:26005868}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0001050068"	"0"	"30"	"1"	"40422751"	"40422751"	"subst"	"0"	"01804"	"MFSD2A_000015"	"g.40422751C>A"	""	""	""	"MFSD2A(NM_032793.5):c.94-8C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001050069"	"0"	"50"	"1"	"40432551"	"40432551"	"subst"	"3.2537E-5"	"01804"	"MFSD2A_000016"	"g.40432551G>A"	""	""	""	"MFSD2A(NM_032793.5):c.874G>A (p.(Gly292Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes MFSD2A
## Count = 19
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000169428"	"00025669"	"70"	"1172"	"0"	"1172"	"0"	"c.1172C>G"	"r.(?)"	"p.(Ala391Gly)"	""
"0000597043"	"00025669"	"70"	"229"	"-25"	"229"	"-23"	"c.229-25_229-23del"	"r.(?)"	"p.(=)"	""
"0000631958"	"00025669"	"90"	"1478"	"0"	"1478"	"0"	"c.1478C>T"	"r.(?)"	"p.(Pro493Leu)"	""
"0000631959"	"00025669"	"90"	"556"	"1"	"556"	"1"	"c.556+1G>A"	"r.spl"	"p.?"	""
"0000631960"	"00025669"	"90"	"593"	"0"	"593"	"0"	"c.593C>T"	"r.(?)"	"p.(Thr198Met)"	""
"0000631961"	"00025669"	"90"	"748"	"0"	"748"	"0"	"c.748G>T"	"r.(?)"	"p.(Val250Phe)"	""
"0000631962"	"00025669"	"90"	"977"	"0"	"977"	"0"	"c.977G>A"	"r.(?)"	"p.(Arg326His)"	""
"0000631963"	"00025669"	"90"	"476"	"0"	"476"	"0"	"c.476C>T"	"r.(?)"	"p.(Thr159Met)"	""
"0000631965"	"00025669"	"90"	"1386"	"0"	"1435"	"0"	"c.1386_1435del"	"r.(?)"	"p.(Gln462HisfsTer17)"	""
"0000631966"	"00025669"	"90"	"750"	"0"	"753"	"0"	"c.750_753del"	"r.(?)"	"p.(Cys251SerfsTer3)"	""
"0000701840"	"00025669"	"70"	"593"	"0"	"593"	"0"	"c.593C>T"	"r.(?)"	"p.(Thr198Met)"	""
"0000817838"	"00025669"	"70"	"490"	"0"	"490"	"0"	"c.490C>A"	"r.(?)"	"p.(Pro164Thr)"	""
"0000830412"	"00025669"	"90"	"593"	"0"	"593"	"0"	"c.593C>T"	"r.(?)"	"p.(Thr198Met)"	""
"0000830413"	"00025669"	"90"	"1205"	"0"	"1205"	"0"	"c.1205C>A"	"r.(?)"	"p.(Pro402His)"	""
"0000830414"	"00025669"	"90"	"1016"	"0"	"1016"	"0"	"c.1016C>T"	"r.(?)"	"p.(Ser339Leu)"	""
"0000830415"	"00025669"	"90"	"497"	"0"	"497"	"0"	"c.497C>T"	"r.(?)"	"p.(Ser166Leu)"	""
"0000830416"	"00025669"	"90"	"476"	"0"	"476"	"0"	"c.476C>T"	"r.(?)"	"p.(Thr159Met)"	""
"0001050068"	"00025669"	"30"	"94"	"-8"	"94"	"-8"	"c.94-8C>A"	"r.(=)"	"p.(=)"	""
"0001050069"	"00025669"	"50"	"874"	"0"	"874"	"0"	"c.874G>A"	"r.(?)"	"p.(Gly292Ser)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 17
"{{screeningid}}"	"{{variantid}}"
"0000104507"	"0000169428"
"0000266378"	"0000597043"
"0000277213"	"0000631958"
"0000277215"	"0000631959"
"0000277216"	"0000631960"
"0000277217"	"0000631961"
"0000277217"	"0000631962"
"0000277218"	"0000631963"
"0000277220"	"0000631965"
"0000277221"	"0000631966"
"0000319176"	"0000701840"
"0000389045"	"0000817838"
"0000398202"	"0000830412"
"0000398203"	"0000830413"
"0000398204"	"0000830414"
"0000398205"	"0000830415"
"0000398206"	"0000830416"