### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = MKS1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "MKS1" "Meckel syndrome, type 1" "17" "q21-q24" "unknown" "NC_000017.10" "UD_130216937007" "{PMID:Kyttala 2006:16415886}" "https://www.LOVD.nl/MKS1" "Finnish Disease Database (FinDis) " "1" "7121" "54903" "609883" "1" "1" "1" "1" "The establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement nº 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/MKS1_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2011-04-05 00:00:00" "00006" "2023-11-30 08:48:46" "00006" "2025-11-24 12:14:12" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000034" "MKS1" "Meckel syndrome, type 1, transcript variant 2" "002" "NM_017777.3" "" "NP_001159399.1" "" "" "" "-75" "2323" "1680" "56296666" "56282797" "00002" "2012-05-11 13:11:53" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00002" "JBTS1" "Joubert syndrome, type 1 (JBTS1)" "AR" "213300" "" "" "" "00006" "2012-05-17 22:47:36" "00006" "2021-12-10 21:51:32" "00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59" "00078" "MKS1" "Meckel syndrome, type 1 (MKS-1, Meckel-Gruber syndrome)" "AR" "249000" "" "" "" "00015" "2012-11-09 15:11:48" "00006" "2021-12-10 21:51:32" "00089" "BBS1" "Bardet-Biedl syndrome, type 1 (BBS-1)" "AR;DR" "209900" "" "" "" "00015" "2012-11-26 09:02:23" "00006" "2021-12-10 21:51:32" "00114" "GA1" "glutaricaciduria, type 1 (GA-1)" "AR" "231670" "" "autosomal recessive" "" "00008" "2013-03-06 12:48:45" "00006" "2021-12-10 21:51:32" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04579" "BBS13" "Bardet-Biedl syndrome, type 13 (BBS-13)" "AR" "615990" "" "" "" "00000" "2015-09-23 10:25:23" "00006" "2021-12-10 21:51:32" "05109" "JBTS" "Joubert syndrome (JBTS)" "" "" "" "" "" "00006" "2016-01-09 00:37:44" "" "" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05578" "MKS" "Meckel syndrome (MKS, Meckel-Gruber syndrome)" "" "" "" "" "" "00006" "2019-02-22 22:26:27" "00006" "2021-12-10 21:51:32" "06335" "JBTS28" "Joubert syndrome 28" "AR" "617121" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 6 "{{geneid}}" "{{diseaseid}}" "MKS1" "00078" "MKS1" "00089" "MKS1" "00139" "MKS1" "04579" "MKS1" "05109" "MKS1" "06335" ## Individuals ## Do not remove or alter this header ## ## Count = 168 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000020" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000044" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "Coriell sample" "" "" "" "" "0" "" "" "" "" "00000210" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "(Saudi Arabia)" "" "" "" "" "" "" "00019400" "" "" "" "1" "" "00752" "" "" "" "" "" "" "0" "" "" "" "" "00019401" "" "" "" "1" "" "00752" "" "" "" "" "India" "" "0" "" "" "" "" "00019402" "" "" "" "1" "" "00752" "" "" "" "" "Pakistan" "" "0" "" "" "" "" "00019403" "" "" "" "1" "" "00752" "" "" "" "" "Greece" "" "0" "" "" "" "" "00019404" "" "" "" "1" "" "00752" "" "" "" "" "Serbia" "" "0" "" "" "" "" "00019405" "" "" "" "1" "" "00752" "" "" "" "" "Slovenia" "" "0" "" "" "" "" "00019406" "" "" "" "1" "" "00752" "" "mixed background (father Greek, mother Trinidad)" "" "" "Greece" "" "0" "" "" "Greek;Trinidad" "" "00019407" "" "" "" "1" "" "00752" "" "" "" "no" "Netherlands" "" "0" "" "" "" "" "00019408" "" "" "" "1" "" "00752" "" "" "" "" "Turkey" "" "0" "" "" "" "" "00056053" "" "" "" "1" "" "00552" "{PMID:Watson 2016:26729329}, {DOI:Watson 2016:10.1186/s12881-015-0265-z}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00056381" "" "" "" "1" "" "01240" "" "" "M" "yes" "Pakistan" "" "0" "" "" "Pashton" "IV-10" "00181104" "" "" "" "1" "" "02575" "" "" "M" "yes" "" "" "0" "" "" "" "" "00225723" "" "" "" "1" "" "00006" "{PMID:Shaheen 2013:23169490}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "23169490-FamMKS_F7" "00225724" "" "" "" "1" "" "00006" "{PMID:Shaheen 2013:23169490}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "23169490-FamMKS_F7" "00309223" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309224" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00331511" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "yes" "" "" "0" "" "" "Arab" "10DG0577" "00331512" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "family" "F" "yes" "" "" "0" "" "" "Arab" "12DG2087" "00331513" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "M" "yes" "" "" "0" "" "" "Arab" "16DG1064" "00332540" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "" "F" "" "United States" "" "0" "" "" "" "Pat25" "00333362" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat2" "00358970" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71161" "00358979" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71808" "00372288" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW010-3" "00372289" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW031-3" "00372290" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW090-3" "00372291" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW091-3" "00372292" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW092-3" "00372293" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW092-4" "00372294" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW093-3" "00372295" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW150-3" "00372296" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW153-3" "00372378" "" "" "" "1" "" "00000" "{PMID:Bachmann-Gagescu 2015:26092869}" "patient" "" "" "" "" "0" "" "" "" "UW318-3" "00372555" "" "" "" "1" "" "01848" "" "" "M" "" "" "" "0" "" "" "" "" "00375434" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#029" "00377666" "" "" "" "1" "" "00000" "{PMID:Brooks 2018:30055837}" "family 58" "M" "" "United States" "" "0" "" "" "" "397" "00377667" "" "" "" "1" "" "00000" "{PMID:Brooks 2018:30055837}" "family 57" "M" "" "United States" "" "0" "" "" "" "502" "00377668" "" "" "" "1" "" "00000" "{PMID:Brooks 2018:30055837}" "family 59" "M" "" "United States" "" "0" "" "" "" "537" "00377669" "" "" "" "1" "" "00000" "{PMID:Brooks 2018:30055837}" "family 60" "M" "" "United States" "" "0" "" "" "" "510" "00377670" "" "" "" "1" "" "00000" "{PMID:Brooks 2018:30055837}" "family 61" "M" "" "United States" "" "0" "" "" "" "573" "00377796" "" "" "" "1" "" "00000" "{PMID:Otto 2011:21068128}" "" "" "no" "United States" "" "0" "" "" "" "" "00380352" "" "" "" "1" "" "00000" "{PMID:M\'hamdi_2014:23432027}" "" "M" "yes" "Tunisia" "" "0" "" "" "Tunisian" "" "00382564" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "426" "00383199" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "F" "" "" "" "0" "" "" "" "" "00383200" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "M" "" "" "" "0" "" "" "Lebanese" "" "00383201" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "M" "" "" "" "0" "" "" "Saudi Arabian" "" "00383202" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "M" "" "" "" "0" "" "" "Turkish" "" "00383203" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "F" "" "" "" "0" "" "" "Northern European" "" "00383204" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "F" "" "" "" "0" "" "" "Middle Eastern" "" "00383205" "" "" "" "1" "" "00000" "{PMID:Leitch-2008:18327255}" "" "F" "" "" "" "0" "" "" "" "" "00384801" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "3 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00384826" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "3 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00384828" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "1 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00384839" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00384840" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00385282" "" "" "" "1" "" "00000" "{PMID:M\'hamdi-2014:23432027}" "" "M" "yes" "Tunisia" "" "0" "" "" "Tunisian" "" "00385621" "" "" "" "4" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "" "" "" "" "0" "" "" "" "6ORG" "00386784" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2937_004522" "00387555" "" "" "" "1" "" "00000" "{PMID:Knopp 2015:26003401}" "" "" "" "" "" "0" "" "" "" "" "00387556" "" "" "" "1" "" "00000" "{PMID:Knopp 2015:26003401}" "predicted as polymorphism, detected in heterozygous state in one patient with one heterozygous pathogenic MKS6 mutation but not in the as well severely affected sibling" "" "" "" "" "0" "" "" "" "" "00387604" "" "" "" "1" "" "00000" "{PMID:Watson 2016:26729329}" "" "" "" "" "" "0" "" "" "" "" "00388108" "" "" "" "1" "" "00000" "{PMID:Summers 2017:28497568}" "" "" "" "United States" "" "0" "" "" "" "502" "00388110" "" "" "" "1" "" "00000" "{PMID:Summers 2017:28497568}" "" "" "" "United States" "" "0" "" "" "" "510" "00388120" "" "" "" "1" "" "00000" "{PMID:Summers 2017:28497568}" "" "" "" "United States" "" "0" "" "" "" "537" "00388133" "" "" "" "1" "" "00000" "{PMID:Summers 2017:28497568}" "" "" "" "United States" "" "0" "" "" "" "573" "00408286" "" "" "" "1" "" "00000" "{PMID:Tallapaka 2019:31191208}" "aborted fetus with multiple malformations; parents second cousins with one Leber congenital amaurosis child" "F" "yes" "India" "" "0" "" "" "" "II: 1" "00414461" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP128" "00418727" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "F" "" "Germany" "" "0" "" "" "" "1" "00418728" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "2" "00418729" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "F" "" "Germany" "" "0" "" "" "" "3" "00418730" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "4" "00418731" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "5" "00418732" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "6" "00418733" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "7" "00418734" "" "" "" "1" "" "00000" "{PMID:Auber 2007:17935508}" "" "M" "" "Germany" "" "0" "" "" "" "8" "00418735" "" "" "" "4" "" "00000" "{PMID:Frank 2007:17437276}" "family, parents 1st cousins, 4 affected siblings" "" "yes" "Turkey" "" "0" "" "" "" "Fam850" "00418736" "" "" "" "1" "" "00000" "{PMID:Frank 2007:17437276}" "family 937, parents 1st cousins" "" "yes" "Turkey" "" "0" "" "" "" "Fam937" "00418737" "" "" "" "1" "" "00000" "{PMID:Frank 2007:17437276}" "family 951, parents 1st cousins" "" "yes" "Kuwait" "" "0" "" "" "" "Fam951" "00418738" "" "" "" "1" "" "00000" "{PMID:Frank 2007:17437276}" "family 943" "" "no" "Germany" "" "0" "" "" "" "Fam943" "00418739" "" "" "" "1" "" "00000" "{PMID:Romani 2014:24886560}" "" "M" "" "" "" "0" "" "" "" "COR340" "00418740" "" "" "" "1" "" "00000" "{PMID:Romani 2014:24886560}" "" "M" "" "" "" "0" "" "" "" "COR413" "00418743" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "JBTS-10" "00418744" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW031-3" "00418745" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW090-3" "00418746" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW091-3" "00418747" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW092-3" "00418748" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW093-3" "00418749" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "UW150-3" "00418750" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "JBTS-153" "00418751" "" "" "" "1" "" "00000" "{PMID:Slaats 2016:26490104}" "" "" "" "" "" "0" "" "" "" "JBTS-3504" "00418752" "" "" "" "1" "" "00000" "{PMID:Bader 2016:27377014}" "" "M" "no" "" "" "0" "" "" "Austrian" "?" "00418757" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "" "" "yes" "" "" "0" "" "" "Pakistani" "IV-2" "00418758" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "" "" "yes" "" "" "0" "" "" "Pakistani" "IV-3" "00418759" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "proband" "" "yes" "" "" "0" "" "" "Pakistani" "IV-8" "00418760" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "" "" "yes" "" "" "0" "" "" "Pakistani" "IV-9" "00418761" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "" "" "yes" "" "" "0" "" "" "Pakistani" "IV-10" "00418762" "" "" "" "1" "" "00000" "{PMID:Irfanullah 2016:27570071}" "" "" "yes" "" "" "0" "" "" "Pakistani" "IV-11" "00419636" "" "" "" "1" "" "02300" "{PMID:Marinakis 2021:34008892}" "" "M" "" "Greece" "" "0" "" "" "" "8125" "00422682" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33193692}" "" "F" "" "China" "" "0" "" "" "Chinese" "II:2" "00423226" "" "" "" "1" "" "00000" "{PMID:Brunetti-Pierri 2021:34359301}" "" "F" "" "Italy" "" "0" "" "" "white" "?" "00443497" "" "" "" "1" "" "00006" "{PMID:Tallila 2008:19466712}" "" "" "" "" "" "0" "" "" "Europe" "FIM48" "00443563" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443564" "" "" "" "2" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "Palestine" "" "0" "" "" "" "" "00443565" "" "" "" "79" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443566" "" "" "" "6" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443567" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "France" "" "0" "" "" "" "" "00443568" "" "" "" "2" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "Morocco;Pakistan" "" "0" "" "" "" "" "00443569" "" "" "" "10" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443570" "" "" "" "10" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443571" "" "" "" "5" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443572" "" "" "" "8" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443573" "" "" "" "13" "" "00006" "{PMID:Khaddour 2007:17397051}" "" "" "" "" "" "0" "" "" "" "" "00443574" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "affected fetus" "" "" "France" "<0d" "0" "" "" "" "Fam1Pat20" "00443575" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "affected fetus" "" "" "France" "<0d" "0" "" "" "" "Fam2Pat362" "00443576" "" "" "" "2" "" "00006" "{PMID:Khaddour 2007:17397051}" "family, 2 affected fetuses" "" "" "France" "<0d" "0" "" "" "" "Fam3Pat433/434" "00443577" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "family, 2 affected newborns" "" "" "Palestine" "" "0" "" "" "" "Fam4Pat522/523" "00443578" "" "" "" "2" "" "00006" "{PMID:Khaddour 2007:17397051}" "family, 3 affected newborns" "" "" "Palestine" "" "0" "" "" "" "Fam5Pat532/533/534" "00443579" "" "" "" "3" "" "00006" "{PMID:Khaddour 2007:17397051}" "affected fetus" "" "" "France" "<0d" "0" "" "" "" "Fam6Pat562" "00443580" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "affected fetus" "" "" "England" "<0d" "0" "" "" "" "Fam7Pat106" "00443581" "" "" "" "1" "" "00006" "{PMID:Khaddour 2007:17397051}" "affected fetus" "" "" "Pakistan" "<0d" "0" "" "" "" "Fam8Pat102" "00443582" "" "" "" "1" "" "00006" "{PMID:Consugar 2007:17377820}" "family, 1 affected fetus" "" "" "United States" "<0d" "0" "" "" "white;African-American" "M338" "00443583" "" "" "" "2" "" "00006" "{PMID:Consugar 2007:17377820}" "family, 2 affected fetuses" "" "" "United States" "<0d" "0" "" "" "Germany" "M340" "00443584" "" "" "" "1" "" "00006" "{PMID:Consugar 2007:17377820}" "family, 1 affected fetus" "" "" "United States" "<0d" "0" "" "" "Germany;Ireland;United Kingdom (Great Britain);America-N" "M380" "00443585" "" "" "" "1" "" "00006" "{PMID:Consugar 2007:17377820}" "family, 1 affected fetus" "" "" "United States" "<0d" "0" "" "" "Germany;Ireland;United Kingdom (Great Britain);Italy" "M383" "00443586" "" "" "" "1" "" "00006" "{PMID:Consugar 2007:17377820}" "family, 1 affected fetus" "" "" "United States" "<0d" "0" "" "" "Netherlands" "55875" "00443592" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "F" "" "Germany" "<0d" "0" "" "" "" "Case1" "00443593" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case2" "00443594" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "F" "" "Germany" "<0d" "0" "" "" "" "Case3" "00443595" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case4" "00443596" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case5" "00443597" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case6" "00443598" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case7" "00443599" "" "" "" "1" "" "00006" "{PMID:Auber 2007:17935508}" "affected fetus" "M" "" "Germany" "<0d" "0" "" "" "" "Case8" "00443600" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "" "" "" "Germany" "" "0" "" "" "" "Fam1" "00443601" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "" "" "" "Sweden;Portugal;Ireland" "" "0" "" "" "" "Fam2" "00443602" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "" "" "" "United States" "" "0" "" "" "" "Fam3" "00443603" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "" "" "" "Germany" "" "0" "" "" "" "Fam4" "00443604" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443605" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443606" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443607" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443608" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443609" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443610" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443611" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443612" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443613" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443614" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443615" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443616" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443617" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443618" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443619" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443620" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443621" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443622" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443623" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443624" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443625" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443626" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443627" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443628" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00443629" "" "" "" "1" "" "00006" "{PMID:Kyttala 2006:16415886}" "family" "" "" "Finland" "" "0" "" "" "" "" "00469978" "" "" "" "1" "" "04128" "{PMID:Serpieri 2023:36788019}" "" "" "" "" "" "0" "" "" "" "" "00469979" "" "" "" "1" "" "04128" "{PMID:Serpieri 2023:36788019}" "" "" "" "" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 167 "{{individualid}}" "{{diseaseid}}" "00000044" "00114" "00000210" "00058" "00019400" "00002" "00019401" "00002" "00019402" "00002" "00019403" "00002" "00019404" "00002" "00019405" "00002" "00019406" "00002" "00019407" "00002" "00019408" "00002" "00056053" "00078" "00056381" "05109" "00181104" "00078" "00225723" "05578" "00225724" "05578" "00309223" "04214" "00309224" "04214" "00331511" "05517" "00331512" "05517" "00331513" "05517" "00332540" "04214" "00333362" "04214" "00358970" "04214" "00358979" "04214" "00372288" "05109" "00372289" "05109" "00372290" "05109" "00372291" "05109" "00372292" "05109" "00372293" "05109" "00372294" "05109" "00372295" "05109" "00372296" "05109" "00372378" "05109" "00372555" "05109" "00375434" "04214" "00377666" "04214" "00377667" "04214" "00377668" "04214" "00377669" "04214" "00377670" "04214" "00377796" "04214" "00380352" "04214" "00382564" "04214" "00383199" "04214" "00383200" "04214" "00383201" "04214" "00383202" "04214" "00383203" "04214" "00383204" "04214" "00383205" "04214" "00384801" "04214" "00384826" "04214" "00384828" "04214" "00384839" "04214" "00384840" "04214" "00385282" "04214" "00385621" "04214" "00386784" "04214" "00387555" "04214" "00387556" "04214" "00387604" "04214" "00388108" "04214" "00388110" "04214" "00388120" "04214" "00388133" "04214" "00408286" "04214" "00414461" "00198" "00418727" "05578" "00418728" "05578" "00418729" "05578" "00418730" "05578" "00418731" "05578" "00418732" "05578" "00418733" "05578" "00418734" "05578" "00418735" "05578" "00418736" "05578" "00418737" "05578" "00418738" "05578" "00418739" "05109" "00418740" "05109" "00418743" "05109" "00418744" "05109" "00418745" "05109" "00418746" "05109" "00418747" "05109" "00418748" "05109" "00418749" "05109" "00418750" "05109" "00418751" "05109" "00418752" "05109" "00418757" "05109" "00418758" "05109" "00418759" "05109" "00418760" "05109" "00418761" "05109" "00418762" "05109" "00419636" "00198" "00422682" "05109" "00423226" "05109" "00443497" "05578" "00443563" "00000" "00443564" "00000" "00443565" "00000" "00443566" "00000" "00443567" "00000" "00443568" "00000" "00443569" "00000" "00443570" "00000" "00443571" "00000" "00443572" "00000" "00443573" "00000" "00443574" "05578" "00443575" "05578" "00443576" "05578" "00443577" "05578" "00443578" "05578" "00443579" "05578" "00443580" "05578" "00443581" "05578" "00443582" "05578" "00443583" "05578" "00443584" "05578" "00443585" "05578" "00443586" "05578" "00443592" "05578" "00443593" "05578" "00443594" "05578" "00443595" "05578" "00443596" "05578" "00443597" "05578" "00443598" "05578" "00443599" "05578" "00443600" "05578" "00443601" "05578" "00443602" "05578" "00443603" "05578" "00443604" "05578" "00443605" "05578" "00443606" "05578" "00443607" "05578" "00443608" "05578" "00443609" "05578" "00443610" "05578" "00443611" "05578" "00443612" "05578" "00443613" "05578" "00443614" "05578" "00443615" "05578" "00443616" "05578" "00443617" "05578" "00443618" "05578" "00443619" "05578" "00443620" "05578" "00443621" "05578" "00443622" "05578" "00443623" "05578" "00443624" "05578" "00443625" "05578" "00443626" "05578" "00443627" "05578" "00443628" "05578" "00443629" "05578" "00469978" "05109" "00469979" "05109" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00002, 00058, 00078, 00089, 00114, 00139, 00198, 04214, 04579, 05109, 05517, 05578, 06335 ## Count = 151 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Biochem_param}}" "{{Phenotype/enzyme_act}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000000026" "00058" "00000210" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043044" "00002" "00019401" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043045" "00002" "00019402" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043046" "00002" "00019403" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043047" "00002" "00019404" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043048" "00002" "00019405" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043049" "00002" "00019406" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043050" "00002" "00019400" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043051" "00002" "00019407" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043052" "00002" "00019408" "00752" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043063" "05109" "00056381" "01240" "Familial, autosomal recessive" "" "Joubert syndrome like phenotype" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000043077" "00078" "00056053" "00006" "Unknown" "" "Meckel-Gruber syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000143701" "00078" "00181104" "02575" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000170832" "05578" "00225723" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS-1" "Meckel-Gruber syndrome" "" "0000170835" "05578" "00225724" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS-1" "Meckel-Gruber syndrome" "" "0000234543" "04214" "00309223" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "BBS" "" "0000234544" "04214" "00309224" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "BBS" "" "0000249703" "05517" "00331511" "00000" "Familial, autosomal recessive" "" "Global developmental delay, Hydronephrosis, Obesity, Polydactyly, Cirrhosis, Allergy, AbnNo" "" "" "" "" "" "" "" "" "" "" "Polydactyly-Syndactyly-Triphalangism group" "skeletal dysplasia" "" "0000249704" "05517" "00331512" "00000" "Familial, autosomal recessive" "" "Occipital encephalocele, Polycystic kidney dysplasia, Polydactyly, Microcephaly, Neonatal Yes" "" "" "" "" "" "" "" "" "" "" "Polydactyly-Syndactyly-Triphalangism group" "skeletal dysplasia" "" "0000249705" "05517" "00331513" "00000" "Familial, autosomal recessive" "" "Occipital encephalocele, Hand polydactyly, Polycystic kidney dysplasia" "" "" "" "" "" "" "" "" "" "" "Polydactyly-Syndactyly-Triphalangism group" "skeletal dysplasia" "" "0000250728" "04214" "00332540" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000251549" "04214" "00333362" "00000" "Unknown" "47y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254268" "04214" "00358970" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000254277" "04214" "00358979" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267609" "05109" "00372288" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267610" "05109" "00372289" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267611" "05109" "00372290" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267612" "05109" "00372291" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267613" "05109" "00372292" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267614" "05109" "00372293" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267615" "05109" "00372294" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267616" "05109" "00372295" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267617" "05109" "00372296" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267699" "05109" "00372378" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000267869" "05109" "00372555" "01848" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000270648" "04214" "00375434" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272818" "04214" "00377666" "00000" "Familial, autosomal recessive" "" "polydactylyoculomotor apraxia, nystagmus, strabismus, ptosis, vessel attenuation, optic nerve atrophy" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000272819" "04214" "00377667" "00000" "Familial, autosomal recessive" "" "oculomotor apraxia, nystagmus, strabismus" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000272820" "04214" "00377668" "00000" "Familial, autosomal recessive" "" "liver disease, polydactylyoculomotor apraxia, nystagmus, ptosis" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000272821" "04214" "00377669" "00000" "Familial, autosomal recessive" "" "oculomotor apraxia, nystagmus, retinal degeneration, optic nerve atrophy" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000272822" "04214" "00377670" "00000" "Familial, autosomal recessive" "" "oculomotor apraxia, nystagmus, strabismus, vessel attenuation" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "0000272942" "04214" "00377796" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "Nephronophthisis" "" "0000274203" "04214" "00380352" "00000" "Familial, autosomal recessive" "6y" "Anemia, arterial hypertension. Retinitis pigmentaria" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl syndrome" "" "0000276413" "04214" "00382564" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Unspecified syndrome" "" "0000276986" "04214" "00383199" "00000" "Familial, autosomal recessive" "37y" "retinitis pigmentosa, obesity, polydactyly, renal disease, Sc,HT,SS,seizures" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276987" "04214" "00383200" "00000" "Familial, autosomal recessive" "9y" "retinitis pigmentosa, obesity, polydactyly, mental retardation, renal disease, developmental delaySeizures" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276988" "04214" "00383201" "00000" "Familial, autosomal recessive" "10y" "retinitis pigmentosa, obesity, polydactyly, mental retardation, developmental delayDF," "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276989" "04214" "00383202" "00000" "Familial, autosomal recessive" "2y" "obesity, polydactyly, Ns" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276990" "04214" "00383203" "00000" "Familial, autosomal recessive" "5y" "retinitis pigmentosa, obesity, polydactyly, severe mental retardation, renal disease, developmental delayAu," "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276991" "04214" "00383204" "00000" "Familial, autosomal recessive" "10y" "retinitis pigmentosa, obesity, polydactyly, mental retardation, developmental delayEP," "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000276992" "04214" "00383205" "00000" "Familial, autosomal recessive" "7y" "retinitis pigmentosa, severe obesity, polydactyly, mental retardation, developmental delaySeizures" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000278584" "04214" "00384801" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, brachydactyly, aopy, typical facies" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278609" "04214" "00384826" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, polydactyly, typical facies" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278611" "04214" "00384828" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, polydactyly, typical facies, hypogenitalism" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278622" "04214" "00384839" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, polydactyly, deafness," "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278623" "04214" "00384840" "00000" "Familial, autosomal recessive" "" "obesity, polydactyly, aosmia, aopy, typical facies, CHD, liver disease" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000279078" "04214" "00385282" "00000" "Familial, autosomal recessive" "6y" "obesity, retinitis pigmentosa, polydactyly, hypogenitalism,mental retardation, anemia HTA" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000279416" "04214" "00385621" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000280584" "04214" "00386784" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000281118" "04214" "00387555" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Meckel syndrome" "" "0000281119" "04214" "00387556" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Meckel syndrome" "" "0000281167" "04214" "00387604" "00000" "Familial" "" "" "" "" "6y" "" "" "" "" "" "" "" "" "Meckel-Gruber and Joubert syndrome" "" "0000281702" "04214" "00388108" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome (JBTS)" "" "0000281704" "04214" "00388110" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome (JBTS)" "" "0000281714" "04214" "00388120" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome (JBTS)" "" "0000281727" "04214" "00388133" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome (JBTS)" "" "0000300413" "04214" "00408286" "00000" "Familial, autosomal recessive" "0d" "fetus from terminated pregnancy: autopsy: externally, midline depression in the cranium extending onto the forehead, acircular defect in the occipital region of the cranium; significant hypertelorism; the nose well formed, both lateral maxillary processes not fused; nasal process not well developed, resulting in a large median upperlip cleft; cleft palate and micrognathia abdomen distended, anal opening could not be visualized; all limbs: postaxial polydactyly, both lower limbs were internally angulated in addition to bilateral congenital talipes equinovarus; enlarged and polycystic kidneys; friable liver; thin sigmoid colon" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome and Leber congenital amaurosis" "" "" "0000306296" "00198" "00414461" "00000" "Unknown" "2y" "Joubert Syndrome 28;Bardet-Biedl Syndrome 13" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000310022" "05578" "00418727" "00000" "Familial, autosomal recessive" "" "gestation weeks: 21+0; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: +/+; epididymal cystic dysplasia: F; ocular coloboma (left/right): +/+; dysmorphic facies with prominent/sloping forehead: +/-; other:" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310023" "05578" "00418728" "00000" "Familial, autosomal recessive" "" "gestation weeks: 31+6; campomelic variant: -; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: -/-; epididymal cystic dysplasia: +; ocular coloboma (left/right): +/+; dysmorphic facies with prominent/sloping forehead: -/+; other: polysplenia, hypoplastic left heart" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310024" "05578" "00418729" "00000" "Familial, autosomal recessive" "" "gestation weeks: 18+0; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: -/-; epididymal cystic dysplasia: F; ocular coloboma (left/right): +/-; dysmorphic facies with prominent/sloping forehead: -/+; other: -" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310025" "05578" "00418730" "00000" "Familial, autosomal recessive" "" "gestation weeks: 19th; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: -/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: -/+; epididymal cystic dysplasia: +; ocular coloboma (left/right): -/-; dysmorphic facies with prominent/sloping forehead: +/-; other: concordant twin, partial agenesis of corpus callosum" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310026" "05578" "00418731" "00000" "Familial, autosomal recessive" "" "gestation weeks: 19th; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: +*/+; epididymal cystic dysplasia: +; ocular coloboma (left/right): +/+; dysmorphic facies with prominent/sloping forehead: +/-; other: *Pierre Robin sequence, holoprosencephaly" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310027" "05578" "00418732" "00000" "Familial, autosomal recessive" "" "gestation weeks: 18th; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/-, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: -/+; epididymal cystic dysplasia: +; ocular coloboma (left/right): +/+; dysmorphic facies with prominent/sloping forehead: -/+; other: ambiguous genitalia" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310028" "05578" "00418733" "00000" "Familial, autosomal recessive" "" "gestation weeks: 22nd; campomelic variant: +; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: -/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: +/+; epididymal cystic dysplasia: +; ocular coloboma (left/right): not determined; dysmorphic facies with prominent/sloping forehead: -/+; other: -" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310029" "05578" "00418734" "00000" "Familial, autosomal recessive" "" "gestation weeks: 24th; campomelic variant: -; occipital cerebral encephalocele/lower occipital bone keyhole defect with occult cerebellar encephalocele: +/+; renal cystic dysplasia: +; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation anot determined periportal fibrosis): +; post-axial polydactyly of upper (left/right) limbs: +/+, lower (left/right) limbs: +/+; cleft palate/lobulated tongue: +/+; epididymal cystic dysplasia: +; ocular coloboma (left/right): not determined; dysmorphic facies with prominent/sloping forehead: -/+; other: horseshoe kidney" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310030" "05578" "00418735" "00000" "Familial, autosomal recessive" "" "central nervous system malformation: encephalocele; cystic kidney dysplasia; ductal plate malformation; postaxial polydactyly; additional features: Dandy-Walker malformation, hydrocephalus, cleft lip" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310031" "05578" "00418736" "00000" "Familial, autosomal recessive" "" "central nervous system malformation: encephalocele; cystic kidney dysplasia; ductal plate malformation; postaxial polydactyly" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310032" "05578" "00418737" "00000" "Familial, autosomal recessive" "" "central nervous system malformation: encephalocele; cystic kidney dysplasia; ductal plate malformation; postaxial polydactyly" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310033" "05578" "00418738" "00000" "Familial, autosomal recessive" "" "central nervous system malformation: encephalocele; cystic kidney dysplasia; ductal plate malformation; postaxial polydactyly" "" "" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome" "" "" "0000310034" "05109" "00418739" "00000" "Familial, autosomal recessive" "44y" "central nervous system: hypotonia/ataxia: +; breathing abnormalities: -; developmental. delay: +; intellectual disability (variable severity): +; oculomotor abnormalities: ocular: +; retinopathy: +; coloboma: -; renal: -; hepatic: -; other features: polydactyly: -; orofacial features: -; dysmorphisms: +; neuroimaging: molar tooth sign: +; other central nervous system defects: -" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310035" "05109" "00418740" "00000" "Familial, autosomal recessive" "2y" "central nervous system: hypotonia/ataxia: +; breathing abnormalities: -; developmental. delay: +; intellectual disability (variable severity): +; oculomotor abnormalities: ocular: +; retinopathy: -; coloboma: -; renal: -; hepatic: -; other features: polydactyly: -; orofacial features: -; dysmorphisms: -; neuroimaging: molar tooth sign: +; other central nervous system defects: -" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310038" "05109" "00418743" "00000" "Familial, autosomal recessive" "15y" "cell line: longer cilia than the controls; after 48 hours of serum starvation fibroblasts were only 52.7% ciliated; phenotype: molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: present; coloboma: absent, left optic pit; kidney disease: absent; liver fibrosis: absent; polydactyly: absent; other: bilateral ptosis, cryptorchidism, clinodactyly" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310039" "05109" "00418744" "00000" "Familial, autosomal recessive" "12y" "molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: absent; coloboma: absent; kidney disease: absent; liver fibrosis: absent; polydactyly: absentsleep apnea treated by tonsillectomy and adenoidectomy" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310040" "05109" "00418745" "00000" "Familial, autosomal recessive" "" "molar tooth sign: not documented; occipital encephalocele: not documented; retinal dystrophy: not documented; coloboma: not documented; kidney disease: not documented; liver fibrosis: not documented; polydactyly: not documented" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310041" "05109" "00418746" "00000" "Familial, autosomal recessive" "" "molar tooth sign: present; occipital encephalocele: not documented; retinal dystrophy: not documented; coloboma: not documented; kidney disease: not documented; liver fibrosis: not documented; polydactyly: not documented" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310042" "05109" "00418747" "00000" "Familial, autosomal recessive" "12y" "molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: absent; coloboma: absent; kidney disease: absent; liver fibrosis: absent; polydactyly: absent; other: ptosis, functions 1 grade behind in school" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310043" "05109" "00418748" "00000" "Familial, autosomal recessive" "6y" "molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: absent; coloboma: absent; kidney disease: absent; liver fibrosis: absent; polydactyly: absent; other: strabismus" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310044" "05109" "00418749" "00000" "Familial, autosomal recessive" "11y" "molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: absent; coloboma: present; kidney disease: absent; liver fibrosis: absent; polydactyly: absent; other: seizures, wheelchair-bound" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310045" "05109" "00418750" "00000" "Familial, autosomal recessive" "4y" "molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: present, abnormal electroretinogram; coloboma: absent, large left optic disc; kidney disease: echogenic kidneys on ultrasound; liver fibrosis: mildly increased liver echogenicity and mildly enlarged spleen on ultrasound, mildly elevated gamma-glutamyl transpeptidase; polydactyly: bilateral postaxial; other: critical aortic stenosis, bicuspid aortic valve, atrial septal defect, left 3rd nerve palsy, strabismus, left ptosis, vertical tali" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310046" "05109" "00418751" "00000" "Familial, autosomal recessive" "14y" "cell line: longer cilia than the controls, but ciliation of fibroblasts not statistically different from the controls; molar tooth sign: present; occipital encephalocele: absent; retinal dystrophy: absent; coloboma: absent; kidney disease: absent; liver fibrosis: absent; polydactyly: absent; other: oculomotor apraxia, tachypnea/apnea), autism, tumor cordis (oculomotor apraxia)" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310048" "05109" "00418752" "00000" "Familial, autosomal recessive" "6y2m" "family history: unremarkable; 27th week of gestation: prenatal ultrasound: enlarged ventricles; invasive prenatal diagnostics: normal male karyotype; birth normal in the 41st week of gestation; growth parameters: normal; episodes of apnea during the first 7 months of life; severe hypotonia, congenital rotatory nystagmus; delay of developmental milestones; 18m: brain magnetic resonance imaging: molar tooth sign and agenesis of corpus callosum; 21m: no evidence of retinal involvement; 3y5m sitting independently; 5y2m: height and weight between the 2nd and 9th percentile, the occipitofrontal head circumference at the 9th percentile; 6y2m months of age: could not stand or walk independently; dysmorphic features: slightly broad forehead, ptosis of the left eye, epicanthus inversus, smooth philtrum, enlarged nares, and thin vermilion of the upper lip; camptodactyly of digits III and V symmetrically in both hands; genitalia small; kidney and liver: normal shape, location and function; atactic movement disorder and trunk hypotonia, no dysphagia; ability to grasp for objects and obey simple commands but no active speech, communicating with simple gestures; ability to maintain good eye contact and has friendly and charming behavior; ability to move the wheelchair by his own manual propulsion to a limited extent; not diaper-free" "" "" "0m" "" "" "" "" "" "" "" "g.95693450T>G" "" "" "0000310053" "05109" "00418757" "00000" "Familial, autosomal recessive" "18y" "height (in cm)/mean average population height (respective age and sex)158/164; weight (in kg)/mean average population weight (respective age and sex): 42/52hypotonia: mild; ataxia: mild; polydactyly/camptodactyly : no; polydactyly (feet): no; speech impairment: yes; hearing impairment: moderate (41 to 55 dB); visual impairment: no; intellectual disability: none; molar tooth sign: not assessed; blood creatinine mg/dl: 0.7; blood urea nitrogen mg/dl: 13" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310054" "05109" "00418758" "00000" "Familial, autosomal recessive" "15y" "height (in cm)/mean average population height (respective age and sex)152/162; weight (in kg)/mean average population weight (respective age and sex): 38/47hypotonia: mild; ataxia: mild; polydactyly/camptodactyly : no; polydactyly (feet): no; speech impairment: yes; hearing impairment: moderate (41 to 55 dB); visual impairment: no; intellectual disability: none; molar tooth sign: not assessed; blood creatinine mg/dl: 1; blood urea nitrogen mg/dl: 16" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310055" "05109" "00418759" "00000" "Familial, autosomal recessive" "20y" "height (in cm)/mean average population height (respective age and sex)156/167; weight (in kg)/mean average population weight (respective age and sex): 35/53hypotonia: sever; ataxia: sever; polydactyly/camptodactyly : yes; polydactyly (feet): yes; speech impairment: mild; hearing impairment: mild (26 to 40 dB); visual impairment: no ; intellectual disability: apparent; molar tooth sign: yes; blood creatinine mg/dl: 0.93; blood urea nitrogen mg/dl: 13.6" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310056" "05109" "00418760" "00000" "Familial, autosomal recessive" "17y" "height (in cm)/mean average population height (respective age and sex)155/168; weight (in kg)/mean average population weight (respective age and sex): 46/50hypotonia: mild; ataxia: mild; polydactyly/camptodactyly : yes; polydactyly (feet): yes; speech impairment: none; hearing impairment: none; visual impairment: no; intellectual disability: none; molar tooth sign: not assessed; blood creatinine mg/dl: 1.12; blood urea nitrogen mg/dl: 12" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310057" "05109" "00418761" "00000" "Familial, autosomal recessive" "13y" "height (in cm)/mean average population height (respective age and sex)150/160; weight (in kg)/mean average population weight (respective age and sex): 40/42hypotonia: mild; ataxia: mild; polydactyly/camptodactyly : yes; polydactyly (feet): yes; speech impairment: none; hearing impairment: none; visual impairment: no; intellectual disability: none; molar tooth sign: not assessed; blood creatinine mg/dl: 0.85; blood urea nitrogen mg/dl: 12.8" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310058" "05109" "00418762" "00000" "Familial, autosomal recessive" "10y" "height (in cm)/mean average population height (respective age and sex)86/94; weight (in kg)/mean average population weight (respective age and sex): 28/29hypotonia: mild; ataxia: mild; polydactyly/camptodactyly : yes; polydactyly (feet): yes; speech impairment: none; hearing impairment: none; visual impairment: no; intellectual disability: none; molar tooth sign: not assessed; blood creatinine mg/dl: 0.8; blood urea nitrogen mg/dl: 13.9" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000310917" "00198" "00419636" "02300" "Familial, autosomal recessive" "1y" "" "" "" "" "" "" "" "" "" "" "" "" "congenital/syndromic abnormality" "" "0000313886" "05109" "00422682" "00000" "Familial, autosomal recessive" "" "born full-term by normal delivery, weighing 4,050 g and measuring 55 cm in height; hospitalized at the age of 5 months, diagnosed with hypotonia and developmental delay; brain magnetic resonance imaging: typical molar tooth sign, indicating severe cerebellar vermis hypoplasia; no renal/hepatic involvement, polydactyly, or agenesis of the corpus callosum" "" "" "" "" "" "" "" "" "" "" "Joubert syndrome" "" "" "0000314430" "05109" "00423226" "00000" "Familial, autosomal recessive" "39y" "born by caesarean section after 38 weeks of an uncomplicated pregnancy; birth weight of 3000 g (11th pc); walked independently and pronounced his first words at about 2 years of age; during infancy speech difficulties that required speech therapy; attended school with a mild learning difficulty, but he graduated from high school, he lives independently and is employed as an informatic technician; 39y years, weight: 81.9 kg (96th centile), height: 172.5 cm (45th centile), occipito-frontal circumference: 56.5 cm(48th centile); 25y: visual impairment; best corrected visual acuity right, left eye: 20/80, 20/40, refraction: sphere −5 = cylinder −2 alpha 180deg; Ishihara color vision test: inability to read any pseudoisochromatic plate except for the test plate; intraocular pressure: 16 mmHg both eyes; biomicroscopy: lenses: clear in both eyes; fundus examination: a waxy pallor of the optic disc with a circumpapillary atrophy, and widespread dystrophy of the retinal pigment epithelium with bone spicule-shaped pnt deposits in mid-periphery; optical coherence tomography: reduced macular thickness and retinal pigment epithelium dystrophy in both eyes, and vitreoretinal interface syndrome left eye; fundus autofluorescence: focal areas of hypoautofluorescence at the posterior pole, with foveal hyperautofluorescence in the right and foveal hypoautofluorescence in the left eye, Goldmann visual field: concentric constriction to central 10deg–20deg measured with a III4e and V4e target, respectively; scotopic and photopic; electroretinogram responses: below the noise lev" "" "" "25y" "" "night blindness and reduced visual acuity" "" "" "" "" "" "Joubert syndrome" "retinitis pigmentosa" "" "0000332831" "05578" "00443497" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332879" "05578" "00443574" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332880" "05578" "00443575" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332881" "05578" "00443576" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332882" "05578" "00443577" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332883" "05578" "00443578" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332884" "05578" "00443579" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332885" "05578" "00443580" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332886" "05578" "00443581" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332887" "05578" "00443582" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332888" "05578" "00443583" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332889" "05578" "00443584" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332890" "05578" "00443585" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332891" "05578" "00443586" "00006" "Familial, autosomal recessive" "<0d" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332897" "05578" "00443592" "00006" "Familial, autosomal recessive" "<0d" "gestation 21+0 weeks; campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); cleft palate, lobulated tongue; ocular coloboma (left/right); prominent forehead, no sloping forehead" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332898" "05578" "00443593" "00006" "Familial, autosomal recessive" "<0d" "gestation 31+6 weeks; no campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); no cleft palate, no lobulated tongue; epididymal cystic dysplasia; ocular coloboma (left/right); no prominent forehead, sloping forehead; polysplenia, hypoplastic left heart" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332899" "05578" "00443594" "00006" "Familial, autosomal recessive" "<0d" "gestation 18+0 weeks; campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); no cleft palate, no lobulated tongue; ocular coloboma (left); no prominent forehead, sloping forehead" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332900" "05578" "00443595" "00006" "Familial, autosomal recessive" "<0d" "gestation 19th week; campomelic variant; no occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); no cleft palate, lobulated tongue; epididymal cystic dysplasia; no ocular coloboma; prominent forehead, no sloping forehead; concordant twin, partial agenesis corpus callosum" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332901" "05578" "00443596" "00006" "Familial, autosomal recessive" "<0d" "gestation 19th week; campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); cleft palate, Pierre Robin sequence, lobulated tongue; epididymal cystic dysplasia; ocular coloboma (left/right); prominent forehead, no sloping forehead; holoprosencephaly" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332902" "05578" "00443597" "00006" "Familial, autosomal recessive" "<0d" "gestation 18th week; campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left); post-axial polydactyly lower limbs (left/right); no cleft palate, lobulated tongue; epididymal cystic dysplasia; ocular coloboma (left/right); no prominent forehead, sloping forehead; ambiguous genitalia" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332903" "05578" "00443598" "00006" "Familial, autosomal recessive" "<0d" "gestation 22nd week; campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (right); post-axial polydactyly lower limbs (left/right); cleft palate, lobulated tongue; epididymal cystic dysplasia; no prominent forehead, sloping forehead" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332904" "05578" "00443599" "00006" "Familial, autosomal recessive" "<0d" "gestation 24th week; no campomelic variant; occipital cerebral encephalocele, lower occipital bone keyhole defect with occult cerebellar encephalocele; renal cystic dysplasia; hepatic ductal plate malformation (intrahepatic partly cystic bile duct proliferation and periportal fibrosis); post-axial polydactyly upper limbs (left/right); post-axial polydactyly lower limbs (left/right); cleft palate, lobulated tongue; epididymal cystic dysplasia; no prominent forehead, sloping forehead; horseshoe kidney" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332905" "05578" "00443604" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332906" "05578" "00443605" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332907" "05578" "00443606" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332908" "05578" "00443607" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332909" "05578" "00443608" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332910" "05578" "00443609" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332911" "05578" "00443610" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332912" "05578" "00443611" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332913" "05578" "00443612" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332914" "05578" "00443613" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332915" "05578" "00443614" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332916" "05578" "00443615" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332917" "05578" "00443616" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332918" "05578" "00443617" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332919" "05578" "00443618" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332920" "05578" "00443619" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332921" "05578" "00443620" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332922" "05578" "00443621" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332923" "05578" "00443622" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332924" "05578" "00443623" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332925" "05578" "00443624" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332926" "05578" "00443625" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332927" "05578" "00443626" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332928" "05578" "00443627" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332929" "05578" "00443628" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000332930" "05578" "00443629" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "MKS1" "Meckel syndrome" "" "0000355123" "05109" "00469978" "04128" "Familial, autosomal recessive" "" "molar tooth sign" "" "" "" "" "" "" "" "" "" "" "JBTS" "" "" "0000355124" "05109" "00469979" "04128" "Familial, autosomal recessive" "" "molar tooth sign" "" "" "" "" "" "" "" "" "" "" "JBTS" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 168 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000020" "00000020" "1" "00004" "" "2012-05-11 13:18:40" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000044" "00000044" "1" "00004" "" "2012-05-11 13:18:47" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000211" "00000210" "1" "00039" "00006" "2012-09-22 11:36:24" "" "" "SEQ" "DNA" "" "" "0000019385" "00019400" "1" "00752" "00752" "2014-07-24 14:24:56" "00006" "2016-01-08 05:34:00" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000019386" "00019401" "1" "00752" "00752" "2014-07-24 15:08:16" "" "" "SEQ-NG-I" "DNA" "" "" "0000019387" "00019402" "1" "00752" "00752" "2014-07-24 15:26:52" "" "" "SEQ-NG-I" "DNA" "" "" "0000019388" "00019403" "1" "00752" "00752" "2014-07-24 15:32:00" "" "" "SEQ-NG-I" "DNA" "" "" "0000019389" "00019404" "1" "00752" "00752" "2014-07-24 15:43:19" "" "" "SEQ-NG-I" "DNA" "" "" "0000019390" "00019405" "1" "00752" "00752" "2014-07-24 15:46:48" "" "" "SEQ-NG-I" "DNA" "" "" "0000019391" "00019406" "1" "00752" "00752" "2014-07-24 15:51:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000019392" "00019407" "1" "00752" "00752" "2014-07-24 15:56:59" "00006" "2016-01-08 05:41:13" "SEQ-NG-S" "DNA" "" "" "0000019393" "00019408" "1" "00752" "00752" "2014-07-24 16:07:13" "" "" "SEQ-NG-I" "DNA" "" "" "0000056008" "00056053" "1" "00552" "00552" "2015-12-08 16:58:30" "" "" "SEQ-NG" "DNA" "" "" "0000056336" "00056381" "1" "01240" "01240" "2015-12-14 17:20:15" "" "" "SEQ-NG-IT" "DNA" "blood" "" "0000182061" "00181104" "1" "02575" "02575" "2018-09-28 11:55:34" "" "" "SEQ-NG-I" "DNA" "" "" "0000226790" "00225723" "1" "00006" "00006" "2019-02-22 23:57:10" "" "" "SEQ" "DNA" "" "" "0000226791" "00225724" "1" "00006" "00006" "2019-02-23 08:59:36" "" "" "SEQ" "DNA" "" "" "0000310368" "00309223" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310369" "00309224" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000332730" "00331511" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332731" "00331512" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332732" "00331513" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000333764" "00332540" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000334587" "00333362" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000360207" "00358970" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360216" "00358979" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000373517" "00372288" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373518" "00372289" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373519" "00372290" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373520" "00372291" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373521" "00372292" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373522" "00372293" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373523" "00372294" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373524" "00372295" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373525" "00372296" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373607" "00372378" "1" "00000" "00006" "2021-05-07 09:26:25" "" "" "SEQ" "DNA" "" "27-gene panel" "0000373788" "00372555" "1" "01848" "01848" "2021-05-10 08:12:01" "" "" "SEQ-NG" "DNA" "" "" "0000376631" "00375434" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000378870" "00377666" "1" "00000" "03840" "2021-08-02 11:30:27" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000378871" "00377667" "1" "00000" "03840" "2021-08-02 11:30:27" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000378872" "00377668" "1" "00000" "03840" "2021-08-02 11:30:27" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000378873" "00377669" "1" "00000" "03840" "2021-08-02 11:30:27" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000378874" "00377670" "1" "00000" "03840" "2021-08-02 11:30:27" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000379000" "00377796" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ; SEQ-NG-S" "DNA" "Blood" "" "0000381566" "00380352" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" "" "0000383778" "00382564" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000384423" "00383199" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384424" "00383200" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384425" "00383201" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384426" "00383202" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384427" "00383203" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384428" "00383204" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000384429" "00383205" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ" "DNA" "blood" "" "0000386027" "00384801" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" "" "0000386052" "00384826" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" "" "0000386054" "00384828" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" "" "0000386065" "00384839" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" "" "0000386066" "00384840" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" "" "0000386511" "00385282" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "targeted exon capture strategy" "0000386850" "00385621" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip" "0000388012" "00386784" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388781" "00387555" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "arraySNP;SEQ-NG;PCR" "DNA" "blood" "" "0000388782" "00387556" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "arraySNP;SEQ-NG;PCR" "DNA" "blood" "" "0000388830" "00387604" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "SEQ-NG;PCR" "DNA" "blood" "" "0000389347" "00388108" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ-NG" "DNA" "blood" "whole exome sequencing" "0000389349" "00388110" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ-NG" "DNA" "blood" "whole exome sequencing" "0000389359" "00388120" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ-NG" "DNA" "blood" "whole exome sequencing" "0000389372" "00388133" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ-NG" "DNA" "blood" "whole exome sequencing" "0000409542" "00408286" "1" "00000" "03840" "2022-04-19 20:05:20" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing" "0000415741" "00414461" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000420023" "00418727" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "frozen fetal tissue" "" "0000420024" "00418728" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "frozen fetal tissue" "" "0000420025" "00418729" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "frozen fetal tissue" "" "0000420026" "00418730" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "paraffin-embedded fetal tissue" "" "0000420027" "00418731" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "paraffin-embedded fetal tissue" "" "0000420028" "00418732" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "paraffin-embedded fetal tissue" "" "0000420029" "00418733" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "paraffin-embedded fetal tissue" "" "0000420030" "00418734" "1" "00000" "03840" "2022-10-04 23:24:52" "" "" "SEQ" "DNA" "paraffin-embedded fetal tissue" "" "0000420031" "00418735" "1" "00000" "03840" "2022-10-05 08:54:56" "" "" "SEQ" "DNA" "" "" "0000420032" "00418736" "1" "00000" "03840" "2022-10-05 08:54:56" "" "" "SEQ" "DNA" "" "" "0000420033" "00418737" "1" "00000" "03840" "2022-10-05 08:54:56" "" "" "SEQ" "DNA" "" "" "0000420034" "00418738" "1" "00000" "03840" "2022-10-05 08:54:56" "" "" "SEQ" "DNA" "" "" "0000420035" "00418739" "1" "00000" "03840" "2022-10-05 09:48:43" "03840" "2022-10-05 09:50:49" "SEQ-NG;SEQ" "DNA" "" "large screening of ciliopathy genes in 260 JS patients" "0000420036" "00418740" "1" "00000" "03840" "2022-10-05 09:48:43" "03840" "2022-10-05 09:50:49" "SEQ-NG;SEQ" "DNA" "" "large screening of ciliopathy genes in 260 JS patients" "0000420039" "00418743" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420040" "00418744" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420041" "00418745" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420042" "00418746" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420043" "00418747" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420044" "00418748" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420045" "00418749" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420046" "00418750" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420047" "00418751" "1" "00000" "03840" "2022-10-05 11:34:13" "" "" "?" "DNA" "" "" "0000420049" "00418752" "1" "00000" "03840" "2022-10-05 14:44:02" "" "" "?" "DNA" "" "" "0000420055" "00418757" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ-NG;SEQ" "DNA" "" "exome sequencing" "0000420056" "00418758" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ" "DNA" "" "" "0000420057" "00418759" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ" "DNA" "" "" "0000420058" "00418760" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ" "DNA" "" "" "0000420059" "00418761" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ" "DNA" "" "" "0000420060" "00418762" "1" "00000" "03840" "2022-10-05 22:31:33" "" "" "SEQ" "DNA" "" "" "0000420940" "00419636" "1" "02300" "00006" "2022-10-20 16:24:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000423993" "00422682" "1" "00000" "03840" "2022-11-10 20:54:11" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing" "0000424536" "00423226" "1" "00000" "03840" "2022-11-12 08:33:01" "" "" "SEQ-NG;SEQ" "DNA" "" "clinical exome sequencing" "0000444989" "00443497" "1" "00006" "00006" "2023-11-28 00:18:53" "" "" "SEQ" "DNA" "" "" "0000445056" "00443563" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445057" "00443564" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445058" "00443565" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445059" "00443566" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445060" "00443567" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445061" "00443568" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445062" "00443569" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445063" "00443570" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445064" "00443571" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445065" "00443572" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445066" "00443573" "1" "00006" "00006" "2023-11-29 09:57:46" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445067" "00443574" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445068" "00443575" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445069" "00443576" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445070" "00443577" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445071" "00443578" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445072" "00443579" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445073" "00443580" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445074" "00443581" "1" "00006" "00006" "2023-11-29 10:31:05" "" "" "DHPLC;SEQ" "DNA" "" "" "0000445075" "00443582" "1" "00006" "00006" "2023-11-29 13:14:48" "" "" "SEQ" "DNA" "" "" "0000445076" "00443583" "1" "00006" "00006" "2023-11-29 13:14:48" "" "" "SEQ" "DNA" "" "" "0000445077" "00443584" "1" "00006" "00006" "2023-11-29 13:14:48" "" "" "SEQ" "DNA" "" "" "0000445078" "00443585" "1" "00006" "00006" "2023-11-29 13:14:48" "" "" "SEQ" "DNA" "" "" "0000445079" "00443586" "1" "00006" "00006" "2023-11-29 13:14:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000445085" "00443592" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "deep-frozen tissue" "" "0000445086" "00443593" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "deep-frozen tissue" "" "0000445087" "00443594" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "deep-frozen tissue" "" "0000445088" "00443595" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "paraffin-embedded tissue" "" "0000445089" "00443596" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "paraffin-embedded tissue" "" "0000445090" "00443597" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "paraffin-embedded tissue" "" "0000445091" "00443598" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "paraffin-embedded tissue" "" "0000445092" "00443599" "1" "00006" "00006" "2023-11-29 14:23:35" "" "" "SEQ" "DNA" "paraffin-embedded tissue" "" "0000445093" "00443600" "1" "00006" "00006" "2023-11-29 15:10:46" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000445094" "00443601" "1" "00006" "00006" "2023-11-29 15:10:46" "" "" "SEQ" "DNA" "" "" "0000445095" "00443602" "1" "00006" "00006" "2023-11-29 15:10:46" "" "" "SEQ" "DNA" "" "" "0000445096" "00443603" "1" "00006" "00006" "2023-11-29 15:10:46" "" "" "SEQ" "DNA" "" "" "0000445097" "00443604" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445098" "00443605" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445099" "00443606" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445100" "00443607" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445101" "00443608" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445102" "00443609" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445103" "00443610" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445104" "00443611" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445105" "00443612" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445106" "00443613" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445107" "00443614" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445108" "00443615" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445109" "00443616" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445110" "00443617" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445111" "00443618" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445112" "00443619" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445113" "00443620" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445114" "00443621" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445115" "00443622" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445116" "00443623" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445117" "00443624" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445118" "00443625" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445119" "00443626" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445120" "00443627" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445121" "00443628" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000445122" "00443629" "1" "00006" "00006" "2023-11-29 16:33:40" "" "" "PCR;SEQ" "DNA" "" "" "0000471646" "00469978" "1" "04128" "04128" "2022-05-24 11:22:19" "" "" "SEQ-NG" "DNA" "" "" "0000471647" "00469979" "1" "04128" "04128" "2022-05-24 11:22:19" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 190 "{{screeningid}}" "{{geneid}}" "0000000020" "ALPL" "0000000020" "ATP7B" "0000000020" "ETFB" "0000000020" "GLB1" "0000000020" "IGHMBP2" "0000000020" "MKS1" "0000000020" "MYO5A" "0000000020" "NHLRC1" "0000000020" "NPHS1" "0000000020" "SERPINA1" "0000000020" "SLC26A2" "0000000020" "SMPD1" "0000000044" "ASS1" "0000000044" "ATP7B" "0000000044" "DPYD" "0000000044" "ETFB" "0000000044" "GCDH" "0000000044" "GLB1" "0000000044" "HADHA" "0000000044" "HGSNAT" "0000000044" "IGHMBP2" "0000000044" "KCNQ2" "0000000044" "MKS1" "0000000044" "MYO5A" "0000000211" "MKS1" "0000019385" "MKS1" "0000056336" "MKS1" "0000182061" "MKS1" "0000226790" "MKS1" "0000226791" "MKS1" "0000310368" "MKS1" "0000310369" "MKS1" "0000332730" "MKS1" "0000332731" "MKS1" "0000332732" "MKS1" "0000333764" "MKS1" "0000373517" "MKS1" "0000373518" "MKS1" "0000373519" "MKS1" "0000373520" "MKS1" "0000373521" "MKS1" "0000373522" "MKS1" "0000373523" "MKS1" "0000373524" "MKS1" "0000373525" "MKS1" "0000373607" "MKS1" "0000378870" "MKS1" "0000378871" "MKS1" "0000378872" "MKS1" "0000378873" "MKS1" "0000378874" "MKS1" "0000379000" "MKS1" "0000381566" "MKS1" "0000383778" "MKS1" "0000384423" "CEP290" "0000384423" "MKS1" "0000384423" "TMEM67" "0000384424" "CEP290" "0000384424" "MKS1" "0000384424" "TMEM67" "0000384425" "BBS10" "0000384425" "CEP290" "0000384425" "MKS1" "0000384425" "TMEM67" "0000384426" "CEP290" "0000384426" "MKS1" "0000384426" "TMEM67" "0000384427" "CEP290" "0000384427" "MKS1" "0000384427" "TMEM67" "0000384428" "BBS1" "0000384428" "CEP290" "0000384428" "MKS1" "0000384428" "TMEM67" "0000384429" "BBS1" "0000384429" "CEP290" "0000384429" "MKS1" "0000384429" "TMEM67" "0000386027" "BBS1" "0000386052" "BBS1" "0000386054" "BBS10" "0000386065" "BBS4" "0000386066" "MKS1" "0000386511" "BBS2" "0000386850" "SNRNP200" "0000388012" "MKS1" "0000388781" "MKS1" "0000388782" "MKS1" "0000388830" "MKS1" "0000389347" "MKS1" "0000389349" "MKS1" "0000389359" "MKS1" "0000389372" "MKS1" "0000409542" "RPGRIP1" "0000415741" "MKS1" "0000420023" "MKS1" "0000420024" "MKS1" "0000420025" "MKS1" "0000420026" "MKS1" "0000420027" "MKS1" "0000420028" "MKS1" "0000420029" "MKS1" "0000420030" "MKS1" "0000420031" "MKS1" "0000420032" "MKS1" "0000420033" "MKS1" "0000420034" "MKS1" "0000420035" "MKS1" "0000420036" "MKS1" "0000420039" "MKS1" "0000420040" "MKS1" "0000420041" "MKS1" "0000420042" "MKS1" "0000420043" "MKS1" "0000420044" "MKS1" "0000420045" "MKS1" "0000420046" "MKS1" "0000420047" "MKS1" "0000420049" "MKS1" "0000420055" "MKS1" "0000420056" "MKS1" "0000420057" "MKS1" "0000420058" "MKS1" "0000420059" "MKS1" "0000420060" "MKS1" "0000423993" "MKS1" "0000424536" "MKS1" "0000444989" "MKS1" "0000445056" "MKS1" "0000445057" "MKS1" "0000445058" "MKS1" "0000445059" "MKS1" "0000445060" "MKS1" "0000445061" "MKS1" "0000445062" "MKS1" "0000445063" "MKS1" "0000445064" "MKS1" "0000445065" "MKS1" "0000445066" "MKS1" "0000445067" "MKS1" "0000445068" "MKS1" "0000445069" "MKS1" "0000445070" "MKS1" "0000445071" "MKS1" "0000445072" "MKS1" "0000445073" "MKS1" "0000445074" "MKS1" "0000445075" "MKS1" "0000445076" "MKS1" "0000445077" "MKS1" "0000445078" "MKS1" "0000445079" "MKS1" "0000445085" "MKS1" "0000445086" "MKS1" "0000445087" "MKS1" "0000445088" "MKS1" "0000445089" "MKS1" "0000445090" "MKS1" "0000445091" "MKS1" "0000445092" "MKS1" "0000445093" "MKS1" "0000445094" "MKS1" "0000445095" "MKS1" "0000445096" "MKS1" "0000445097" "MKS1" "0000445098" "MKS1" "0000445099" "MKS1" "0000445100" "MKS1" "0000445101" "MKS1" "0000445102" "MKS1" "0000445103" "MKS1" "0000445104" "MKS1" "0000445105" "MKS1" "0000445106" "MKS1" "0000445107" "MKS1" "0000445108" "MKS1" "0000445109" "MKS1" "0000445110" "MKS1" "0000445111" "MKS1" "0000445112" "MKS1" "0000445113" "MKS1" "0000445114" "MKS1" "0000445115" "MKS1" "0000445116" "MKS1" "0000445117" "MKS1" "0000445118" "MKS1" "0000445119" "MKS1" "0000445120" "MKS1" "0000445121" "MKS1" "0000445122" "MKS1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 348 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000000665" "0" "90" "17" "56283865" "56283868" "dup" "0" "00002" "MKS1_000001" "g.56283865_56283868dup" "" "{PMID:Bell 2011:21228398}" "" "" "" "Unknown" "" "" "0" "" "" "g.58206504_58206507dup" "" "pathogenic" "" "0000000666" "0" "90" "17" "56290372" "56290372" "subst" "0" "00002" "MKS1_000002" "g.56290372C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58213011C>A" "" "pathogenic" "" "0000016102" "3" "95" "17" "56295987" "56295987" "subst" "4.46708E-5" "00039" "MKS1_000003" "g.56295987T>C" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "yes" "" "" "" "" "g.58218626T>C" "" "pathogenic" "" "0000016618" "0" "90" "17" "56283916" "56283944" "del" "0" "00015" "MKS1_000004" "g.56283916_56283944del" "" "" "" "Finmajor: IVS15-7_35 del: Exon 16 skipping: P470fsX562; c.1408-35_1408-7del29: p.G470GfsX93" "Finmajor, RNA exon 16 skipping; 70% of the Finnish MKS patients (most hom). Also common in non-Finnish MKS patients: observed in Afrikan-American, American, Dutch, English, French, German, Italian, Irish" "SUMMARY record" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000016619" "0" "90" "17" "56296537" "56296541" "dup" "0" "00015" "MKS1_000005" "g.56296537_56296541dup" "" "" "" "50insCCGGG" "" "SUMMARY record" "" "" "0" "" "" "g.58219176_58219180dup" "" "pathogenic (recessive)" "" "0000016620" "0" "70" "17" "56296510" "56296510" "subst" "0" "00015" "MKS1_000006" "g.56296510A>G" "" "" "" "IVS1+2T>C" "affects splicing" "SUMMARY record" "" "" "0" "" "" "g.58219149A>G" "" "likely pathogenic (recessive)" "" "0000016621" "0" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00015" "MKS1_000007" "g.56293449C>T" "" "" "" "E139E" "RNA exon 4 skipping" "SUMMARY record" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic (recessive)" "" "0000016622" "0" "70" "17" "56288019" "56288019" "subst" "6.09434E-5" "00015" "MKS1_000008" "g.56288019C>T" "" "" "" "IVS11+1G>A" "" "SUMMARY record" "" "" "0" "" "" "g.58210658C>T" "" "likely pathogenic (recessive)" "" "0000016624" "0" "90" "17" "56285921" "56285921" "subst" "0" "00015" "MKS1_000010" "g.56285921G>A" "" "" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.58208560G>A" "" "pathogenic (recessive)" "" "0000016625" "0" "90" "17" "56283865" "56283868" "dup" "0" "00015" "MKS1_000011" "g.56283865_56283868dup" "" "" "" "1448_1451dupCAGG" "" "SUMMARY record" "" "" "0" "" "" "g.58206504_58206507dup" "" "pathogenic (recessive)" "" "0000016626" "0" "70" "17" "56283826" "56283826" "subst" "0" "00015" "MKS1_000012" "g.56283826C>T" "" "" "" "" "variant last nucleotide exon 17, affects splicing" "SUMMARY record" "" "" "0" "" "" "g.58206465C>T" "" "likely pathogenic (recessive)" "" "0000016627" "0" "90" "17" "56295985" "56295991" "del" "0" "00015" "MKS1_000013" "g.56295985_56295991del" "" "" "" "c.184_190del7" "deletion last nucleotides exon 3" "SUMMARY record" "" "" "0" "" "" "g.58218624_58218630del" "" "pathogenic (recessive)" "" "0000016628" "0" "90" "17" "56292193" "56292193" "subst" "0" "00015" "MKS1_000014" "g.56292193G>A" "" "" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.58214832G>A" "" "pathogenic (recessive)" "" "0000016629" "0" "90" "17" "56292145" "56292145" "subst" "8.28796E-6" "00015" "MKS1_000015" "g.56292145G>A" "" "" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.58214784G>A" "" "pathogenic (recessive)" "" "0000016630" "0" "70" "17" "56288341" "56288341" "subst" "2.03161E-5" "00015" "MKS1_000016" "g.56288341C>T" "" "" "" "" "variant last nucleotide exon 11, affects splicing" "SUMMARY record" "" "" "0" "" "" "g.58210980C>T" "" "likely pathogenic (recessive)" "" "0000016631" "0" "70" "17" "56292101" "56292101" "subst" "8.35771E-6" "00015" "MKS1_000017" "g.56292101C>T" "" "" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.58214740C>T" "" "likely pathogenic (recessive)" "" "0000016632" "0" "70" "17" "56284444" "56284444" "del" "0" "00015" "MKS1_000018" "g.56284444del" "" "" "" "1407+2delT" "destroys donor splice site" "SUMMARY record" "" "" "0" "" "" "g.58207083del" "" "likely pathogenic (recessive)" "" "0000016633" "0" "90" "17" "56293641" "56293783" "del" "0" "00015" "MKS1_000019" "g.56293641_56293783del" "" "" "" "262-37_179del" "" "SUMMARY record" "" "" "0" "" "" "g.58216280_58216422del" "" "pathogenic (recessive)" "" "0000016634" "0" "90" "17" "56293475" "56293476" "del" "0" "00015" "MKS1_000020" "g.56293475_56293476del" "" "" "" "392_393delCT (Ser131X)" "" "SUMMARY record" "" "" "0" "" "" "g.58216114_58216115del" "" "pathogenic (recessive)" "" "0000016635" "0" "70" "17" "56292121" "56292121" "subst" "0.000190936" "00015" "MKS1_000021" "g.56292121G>A" "" "" "" "p.Arg166Trp" "" "SUMMARY record" "" "rs201845154" "0" "" "" "g.58214760G>A" "" "likely pathogenic (recessive)" "" "0000039599" "2" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00752" "MKS1_000024" "g.56293449C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic" "" "0000039600" "1" "90" "17" "56285320" "56285320" "subst" "8.12883E-6" "00752" "MKS1_000028" "g.56285320G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58207959G>A" "" "pathogenic" "" "0000039601" "3" "90" "17" "56283704" "56283704" "dup" "0" "00752" "MKS1_000029" "g.56283704dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58206343dup" "" "pathogenic" "" "0000039602" "3" "90" "17" "56296537" "56296537" "subst" "0" "00752" "MKS1_000027" "g.56296537C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58219176C>A" "" "pathogenic" "" "0000039603" "0" "90" "17" "56293486" "56293486" "del" "0" "00752" "MKS1_000025" "g.56293486del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.58216125del" "" "pathogenic" "" "0000039604" "1" "90" "17" "56285516" "56285518" "del" "0" "00752" "MKS1_000022" "g.56285516_56285518del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000039605" "3" "90" "17" "56285516" "56285518" "del" "0" "00752" "MKS1_000022" "g.56285516_56285518del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000039606" "3" "90" "17" "56283533" "56283533" "subst" "0" "00752" "MKS1_000030" "g.56283533T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58206172T>A" "" "pathogenic" "" "0000039607" "0" "90" "17" "56285516" "56285518" "del" "0" "00752" "MKS1_000022" "g.56285516_56285518del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000039608" "0" "90" "17" "56288349" "56288349" "subst" "0" "00752" "MKS1_000023" "g.56288349C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58210988C>T" "" "pathogenic" "" "0000039609" "0" "90" "17" "56296014" "56296014" "dup" "0" "00752" "MKS1_000026" "g.56296014dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58218653dup" "" "pathogenic" "" "0000039610" "3" "90" "17" "56293641" "56293783" "del" "0" "00752" "MKS1_000019" "g.56293641_56293783del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58216280_58216422del" "" "pathogenic" "" "0000086046" "1" "90" "17" "56293606" "56293606" "subst" "0" "00552" "MKS1_000031" "g.56293606T>C" "" "{PMID:Watson 2016:26729329}, {DOI:Watson 2016:10.1186/s12881-015-0265-z}" "" "" "" "Germline" "" "" "0" "" "" "g.58216245T>C" "" "pathogenic" "" "0000086576" "3" "70" "17" "56285516" "56285518" "del" "0" "01240" "MKS1_000022" "g.56285516_56285518del" "" "" "" "1115_1117delCCT" "" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000252300" "0" "30" "17" "56291758" "56291758" "subst" "0.000195038" "02326" "MKS1_000051" "g.56291758A>G" "" "" "" "MKS1(NM_017777.3):c.516-10T>C, MKS1(NM_017777.4):c.516-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58214397A>G" "" "likely benign" "" "0000255140" "0" "30" "17" "56296858" "56296858" "subst" "7.30151E-6" "01943" "MKS1_000060" "g.56296858A>T" "" "" "" "MKS1(NM_001165927.1):c.15T>A (p.V5=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58219497A>T" "" "likely benign" "" "0000256083" "0" "50" "17" "56284504" "56284504" "subst" "0.000430474" "01943" "MKS1_000040" "g.56284504A>G" "" "" "" "MKS1(NM_017777.3):c.1349T>C (p.I450T), MKS1(NM_017777.4):c.1349T>C (p.I450T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207143A>G" "" "VUS" "" "0000279794" "0" "10" "17" "56285503" "56285503" "subst" "5.68569E-5" "02330" "MKS1_000045" "g.56285503C>T" "" "" "" "MKS1(NM_017777.3):c.1128G>A (p.T376=), MKS1(NM_017777.4):c.1128G>A (p.T376=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58208142C>T" "" "benign" "" "0000279795" "0" "30" "17" "56296580" "56296580" "subst" "0.000417231" "02330" "MKS1_000057" "g.56296580G>A" "" "" "" "MKS1(NM_017777.3):c.12C>T (p.T4=), MKS1(NM_017777.4):c.12C>T (p.T4=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58219219G>A" "" "likely benign" "" "0000279796" "0" "10" "17" "56283880" "56283880" "subst" "0.00112346" "02330" "MKS1_000036" "g.56283880C>T" "" "" "" "MKS1(NM_017777.3):c.1436G>A (p.R479H), MKS1(NM_017777.4):c.1436G>A (p.R479H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206519C>T" "" "benign" "" "0000279797" "0" "30" "17" "56294075" "56294075" "subst" "0.0031397" "02330" "MKS1_000055" "g.56294075G>C" "" "" "" "MKS1(NM_001165927.1):c.183C>G (p.(Asp61Glu)), MKS1(NM_017777.3):c.213C>G (p.D71E), MKS1(NM_017777.4):c.213C>G (p.D71E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216714G>C" "" "likely benign" "" "0000279798" "0" "50" "17" "56289786" "56289786" "subst" "3.24873E-5" "02330" "MKS1_000049" "g.56289786G>A" "" "" "" "MKS1(NM_017777.3):c.868C>T (p.R290W), MKS1(NM_017777.4):c.868C>T (p.R290W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212425G>A" "" "VUS" "" "0000282509" "0" "10" "17" "56290334" "56290334" "subst" "0.43496" "02325" "MKS1_000050" "g.56290334T>C" "" "" "" "MKS1(NM_017777.3):c.858+9A>G, MKS1(NM_017777.4):c.858+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212973T>C" "" "benign" "" "0000283688" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "02329" "MKS1_000007" "g.56293449C>T" "" "" "" "MKS1(NM_017777.3):c.417G>A (p.E139=), MKS1(NM_017777.4):c.417G>A (p.E139=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic" "" "0000286597" "0" "10" "17" "56283089" "56283089" "del" "0.0365044" "02326" "MKS1_000032" "g.56283089del" "" "" "" "MKS1(NM_017777.3):c.*351delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58205728del" "" "benign" "" "0000286598" "0" "10" "17" "56296053" "56296053" "subst" "0.000389851" "02326" "MKS1_000056" "g.56296053G>A" "" "" "" "MKS1(NM_017777.3):c.118C>T (p.H40Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58218692G>A" "" "benign" "" "0000286599" "0" "10" "17" "56285244" "56285244" "subst" "0.00324329" "02326" "MKS1_000042" "g.56285244C>T" "" "" "" "MKS1(NM_017777.3):c.1273+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207883C>T" "" "benign" "" "0000286600" "0" "10" "17" "56285216" "56285216" "subst" "0.00139803" "02326" "MKS1_000041" "g.56285216G>A" "" "" "" "MKS1(NM_017777.3):c.1273+39C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207855G>A" "" "benign" "" "0000286601" "0" "10" "17" "56283901" "56283901" "subst" "1.63667E-5" "02326" "MKS1_000038" "g.56283901C>T" "" "" "" "MKS1(NM_017777.3):c.1415G>A (p.R472H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206540C>T" "" "benign" "" "0000286602" "0" "10" "17" "56283881" "56283881" "subst" "2.03558E-5" "02326" "MKS1_000037" "g.56283881G>A" "" "" "" "MKS1(NM_017777.3):c.1435C>T (p.R479C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206520G>A" "" "benign" "" "0000286603" "0" "10" "17" "56283880" "56283880" "subst" "0.00112346" "02326" "MKS1_000036" "g.56283880C>T" "" "" "" "MKS1(NM_017777.3):c.1436G>A (p.R479H), MKS1(NM_017777.4):c.1436G>A (p.R479H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206519C>T" "" "benign" "" "0000286604" "0" "10" "17" "56283734" "56283734" "subst" "0.00040205" "02326" "MKS1_000035" "g.56283734T>C" "" "" "" "MKS1(NM_017777.3):c.1498A>G (p.(Met500Val), p.M500V), MKS1(NM_017777.4):c.1498A>G (p.M500V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206373T>C" "" "benign" "" "0000286605" "0" "10" "17" "56294075" "56294075" "subst" "0.0031397" "02326" "MKS1_000055" "g.56294075G>C" "" "" "" "MKS1(NM_001165927.1):c.183C>G (p.(Asp61Glu)), MKS1(NM_017777.3):c.213C>G (p.D71E), MKS1(NM_017777.4):c.213C>G (p.D71E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216714G>C" "" "benign" "" "0000286606" "0" "90" "17" "56293449" "56293449" "subst" "0.000134019" "02326" "MKS1_000007" "g.56293449C>T" "" "" "" "MKS1(NM_017777.3):c.417G>A (p.E139=), MKS1(NM_017777.4):c.417G>A (p.E139=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic" "" "0000286607" "0" "10" "17" "56288502" "56288502" "subst" "0" "02326" "MKS1_000047" "g.56288502C>T" "" "" "" "MKS1(NM_017777.3):c.916-119G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58211141C>T" "" "benign" "" "0000291849" "0" "10" "17" "56296609" "56296609" "subst" "0.00243818" "01943" "MKS1_000059" "g.56296609G>C" "" "" "" "MKS1(NM_017777.3):c.-18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58219248G>C" "" "benign" "" "0000291850" "0" "30" "17" "56285483" "56285483" "subst" "8.12229E-6" "01943" "MKS1_000043" "g.56285483T>C" "" "" "" "MKS1(NM_017777.3):c.1148A>G (p.H383R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58208122T>C" "" "likely benign" "" "0000291851" "0" "10" "17" "56285244" "56285244" "subst" "0.00324329" "01943" "MKS1_000042" "g.56285244C>T" "" "" "" "MKS1(NM_017777.3):c.1273+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207883C>T" "" "benign" "" "0000291852" "0" "30" "17" "56296580" "56296580" "subst" "0.000417231" "01943" "MKS1_000057" "g.56296580G>A" "" "" "" "MKS1(NM_017777.3):c.12C>T (p.T4=), MKS1(NM_017777.4):c.12C>T (p.T4=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58219219G>A" "" "likely benign" "" "0000291853" "0" "90" "17" "56284445" "56284445" "subst" "0" "01943" "MKS1_000039" "g.56284445C>T" "" "" "" "MKS1(NM_017777.3):c.1407+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207084C>T" "" "pathogenic" "" "0000291854" "0" "10" "17" "56283449" "56283449" "subst" "0.0370875" "01943" "MKS1_000033" "g.56283449C>G" "" "" "" "MKS1(NM_017777.3):c.1671G>C (p.L557=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206088C>G" "" "benign" "" "0000291855" "0" "30" "17" "56294075" "56294075" "subst" "0.0031397" "01943" "MKS1_000055" "g.56294075G>C" "" "" "" "MKS1(NM_001165927.1):c.183C>G (p.(Asp61Glu)), MKS1(NM_017777.3):c.213C>G (p.D71E), MKS1(NM_017777.4):c.213C>G (p.D71E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216714G>C" "" "likely benign" "" "0000291856" "0" "30" "17" "56293498" "56293498" "subst" "0.000426545" "01943" "MKS1_000054" "g.56293498C>T" "" "" "" "MKS1(NM_017777.3):c.368G>A (p.R123Q), MKS1(NM_017777.4):c.368G>A (p.R123Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216137C>T" "" "likely benign" "" "0000291857" "0" "50" "17" "56292090" "56292090" "subst" "0.00062857" "01943" "MKS1_000052" "g.56292090G>A" "" "" "" "MKS1(NM_017777.3):c.515+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58214729G>A" "" "VUS" "" "0000291858" "0" "10" "17" "56290334" "56290334" "subst" "0.43496" "01943" "MKS1_000050" "g.56290334T>C" "" "" "" "MKS1(NM_017777.3):c.858+9A>G, MKS1(NM_017777.4):c.858+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212973T>C" "" "benign" "" "0000291859" "0" "10" "17" "56289719" "56289721" "del" "0" "01943" "MKS1_000048" "g.56289719_56289721del" "" "" "" "MKS1(NM_017777.3):c.915+19_915+21delTGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212358_58212360del" "" "benign" "" "0000325512" "0" "50" "17" "56280666" "56280666" "subst" "6.52539E-5" "01804" "EPX_000007" "g.56280666C>T" "" "" "" "EPX(NM_000502.4):c.1933C>T (p.(Arg645Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58203305C>T" "" "VUS" "" "0000325514" "0" "50" "17" "56283727" "56283727" "subst" "0.000166502" "01804" "MKS1_000034" "g.56283727G>C" "" "" "" "MKS1(NM_001165927.1):c.1475C>G (p.(Ser492Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206366G>C" "" "VUS" "" "0000325516" "0" "50" "17" "56288034" "56288034" "subst" "0" "01804" "MKS1_000046" "g.56288034T>C" "" "" "" "MKS1(NM_001165927.1):c.980A>G (p.(Glu327Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58210673T>C" "" "VUS" "" "0000325518" "0" "50" "17" "56296582" "56296582" "subst" "3.42082E-5" "01804" "MKS1_000058" "g.56296582T>A" "" "" "" "MKS1(NM_017777.3):c.10A>T (p.(Thr4Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58219221T>A" "" "VUS" "" "0000338400" "0" "10" "17" "56290334" "56290334" "subst" "0.43496" "02327" "MKS1_000050" "g.56290334T>C" "" "" "" "MKS1(NM_017777.3):c.858+9A>G, MKS1(NM_017777.4):c.858+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212973T>C" "" "benign" "" "0000344040" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "02327" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58212983T>C" "" "VUS" "" "0000344381" "0" "50" "17" "56285332" "56285332" "subst" "0.000113814" "02327" "MKS1_000062" "g.56285332C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58207971C>G" "" "VUS" "" "0000349569" "0" "50" "17" "56296004" "56296004" "subst" "0" "02327" "MKS1_000064" "g.56296004G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58218643G>C" "" "VUS" "" "0000350716" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "02327" "MKS1_000007" "g.56293449C>T" "" "" "" "MKS1(NM_017777.3):c.417G>A (p.E139=), MKS1(NM_017777.4):c.417G>A (p.E139=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic" "" "0000351285" "0" "90" "17" "56283916" "56283944" "del" "0" "02327" "MKS1_000004" "g.56283916_56283944del" "" "" "" "MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000405878" "3" "90" "17" "56293449" "56293449" "subst" "0.000134019" "02575" "MKS1_000007" "g.56293449C>T" "" "" "" "" "" "Germline" "yes" "rs386834048" "0" "" "" "g.58216088C>T" "" "pathogenic (recessive)" "" "0000459820" "3" "90" "17" "56285505" "56285505" "dup" "0" "00006" "MKS1_000065" "g.56285505dup" "" "{PMID:Shaheen 2013:23169490}" "" "1126duplA" "" "Germline" "" "" "0" "" "" "g.58208144dup" "" "pathogenic (recessive)" "" "0000459821" "3" "90" "17" "56285505" "56285505" "dup" "0" "00006" "MKS1_000065" "g.56285505dup" "" "{PMID:Shaheen 2013:23169490}" "" "1126dupA" "" "Germline" "" "" "0" "" "" "g.58208144dup" "" "pathogenic (recessive)" "" "0000562362" "0" "50" "17" "56283519" "56283519" "subst" "0.000215874" "01943" "MKS1_000069" "g.56283519C>T" "" "" "" "MKS1(NM_017777.3):c.1601G>A (p.R534Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206158C>T" "" "VUS" "" "0000562363" "0" "50" "17" "56283688" "56283688" "subst" "0.000125887" "02325" "MKS1_000070" "g.56283688C>A" "" "" "" "MKS1(NM_001165927.1):c.1514G>T (p.(Arg505Leu)), MKS1(NM_017777.3):c.1544G>T (p.R515L), MKS1(NM_017777.4):c.1544G>T (p.R515L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206327C>A" "" "VUS" "" "0000562364" "0" "50" "17" "56283734" "56283734" "subst" "0.00040205" "02330" "MKS1_000035" "g.56283734T>C" "" "" "" "MKS1(NM_017777.3):c.1498A>G (p.(Met500Val), p.M500V), MKS1(NM_017777.4):c.1498A>G (p.M500V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206373T>C" "" "VUS" "" "0000562365" "0" "30" "17" "56283881" "56283881" "subst" "2.03558E-5" "01943" "MKS1_000037" "g.56283881G>A" "" "" "" "MKS1(NM_017777.3):c.1435C>T (p.R479C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206520G>A" "" "likely benign" "" "0000562366" "0" "90" "17" "56283916" "56283944" "del" "0" "02325" "MKS1_000004" "g.56283916_56283944del" "" "" "" "MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000562367" "0" "30" "17" "56284465" "56284465" "subst" "0.00220513" "02330" "MKS1_000071" "g.56284465C>T" "" "" "" "MKS1(NM_001165927.1):c.1358G>A (p.(Arg453Gln)), MKS1(NM_017777.3):c.1388G>A (p.R463Q), MKS1(NM_017777.4):c.1388G>A (p.R463Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207104C>T" "" "likely benign" "" "0000562368" "0" "30" "17" "56284465" "56284465" "subst" "0.00220513" "01943" "MKS1_000071" "g.56284465C>T" "" "" "" "MKS1(NM_001165927.1):c.1358G>A (p.(Arg453Gln)), MKS1(NM_017777.3):c.1388G>A (p.R463Q), MKS1(NM_017777.4):c.1388G>A (p.R463Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207104C>T" "" "likely benign" "" "0000562369" "0" "30" "17" "56284465" "56284465" "subst" "0.00220513" "01804" "MKS1_000071" "g.56284465C>T" "" "" "" "MKS1(NM_001165927.1):c.1358G>A (p.(Arg453Gln)), MKS1(NM_017777.3):c.1388G>A (p.R463Q), MKS1(NM_017777.4):c.1388G>A (p.R463Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207104C>T" "" "likely benign" "" "0000562370" "0" "10" "17" "56284465" "56284465" "subst" "0.00220513" "02326" "MKS1_000071" "g.56284465C>T" "" "" "" "MKS1(NM_001165927.1):c.1358G>A (p.(Arg453Gln)), MKS1(NM_017777.3):c.1388G>A (p.R463Q), MKS1(NM_017777.4):c.1388G>A (p.R463Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207104C>T" "" "benign" "" "0000562371" "0" "50" "17" "56284504" "56284504" "subst" "0.000430474" "02330" "MKS1_000040" "g.56284504A>G" "" "" "" "MKS1(NM_017777.3):c.1349T>C (p.I450T), MKS1(NM_017777.4):c.1349T>C (p.I450T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207143A>G" "" "VUS" "" "0000562374" "0" "10" "17" "56285332" "56285332" "subst" "2.03239E-5" "02330" "MKS1_000072" "g.56285332C>A" "" "" "" "MKS1(NM_017777.4):c.1196G>T (p.C399F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207971C>A" "" "benign" "" "0000562375" "0" "90" "17" "56285347" "56285347" "subst" "0" "01943" "MKS1_000073" "g.56285347C>T" "" "" "" "MKS1(NM_017777.3):c.1181G>A (p.W394*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207986C>T" "" "pathogenic" "" "0000562377" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "02330" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58212983T>C" "" "VUS" "" "0000562378" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "02326" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58212983T>C" "" "VUS" "" "0000562380" "0" "30" "17" "56290379" "56290379" "subst" "2.43657E-5" "02330" "MKS1_000075" "g.56290379C>T" "" "" "" "MKS1(NM_017777.4):c.822G>A (p.P274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58213018C>T" "" "likely benign" "" "0000562382" "0" "30" "17" "56291113" "56291113" "subst" "0.00016245" "01943" "MKS1_000077" "g.56291113T>C" "" "" "" "MKS1(NM_017777.3):c.749+13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58213752T>C" "" "likely benign" "" "0000562383" "0" "50" "17" "56291720" "56291720" "subst" "0.00037364" "02330" "MKS1_000078" "g.56291720C>T" "" "" "" "MKS1(NM_017777.3):c.544G>A (p.V182I), MKS1(NM_017777.4):c.544G>A (p.V182I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58214359C>T" "" "VUS" "" "0000562384" "0" "10" "17" "56291720" "56291720" "subst" "0.00037364" "02326" "MKS1_000078" "g.56291720C>T" "" "" "" "MKS1(NM_017777.3):c.544G>A (p.V182I), MKS1(NM_017777.4):c.544G>A (p.V182I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58214359C>T" "" "benign" "" "0000562385" "0" "30" "17" "56291758" "56291758" "subst" "0.000195038" "01943" "MKS1_000051" "g.56291758A>G" "" "" "" "MKS1(NM_017777.3):c.516-10T>C, MKS1(NM_017777.4):c.516-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58214397A>G" "" "likely benign" "" "0000562386" "0" "50" "17" "56293469" "56293469" "subst" "0" "01943" "MKS1_000079" "g.56293469T>C" "" "" "" "MKS1(NM_017777.3):c.397A>G (p.R133G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216108T>C" "" "VUS" "" "0000562387" "0" "50" "17" "56293498" "56293498" "subst" "0.000426545" "02330" "MKS1_000054" "g.56293498C>T" "" "" "" "MKS1(NM_017777.3):c.368G>A (p.R123Q), MKS1(NM_017777.4):c.368G>A (p.R123Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216137C>T" "" "VUS" "" "0000562388" "0" "30" "17" "56293498" "56293498" "subst" "0.000426545" "02326" "MKS1_000054" "g.56293498C>T" "" "" "" "MKS1(NM_017777.3):c.368G>A (p.R123Q), MKS1(NM_017777.4):c.368G>A (p.R123Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216137C>T" "" "likely benign" "" "0000562389" "0" "50" "17" "56293585" "56293585" "subst" "0" "01804" "MKS1_000080" "g.56293585T>G" "" "" "" "MKS1(NM_017777.3):c.281A>C (p.(Gln94Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216224T>G" "" "VUS" "" "0000562390" "0" "30" "17" "56294020" "56294020" "subst" "0.00021126" "01943" "MKS1_000081" "g.56294020G>A" "" "" "" "MKS1(NM_017777.3):c.261+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216659G>A" "" "likely benign" "" "0000562391" "0" "30" "17" "56294075" "56294075" "subst" "0.0031397" "01804" "MKS1_000055" "g.56294075G>C" "" "" "" "MKS1(NM_001165927.1):c.183C>G (p.(Asp61Glu)), MKS1(NM_017777.3):c.213C>G (p.D71E), MKS1(NM_017777.4):c.213C>G (p.D71E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216714G>C" "" "likely benign" "" "0000562392" "0" "50" "17" "56294089" "56294089" "subst" "0.000121861" "02327" "MKS1_000082" "g.56294089G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216728G>A" "" "VUS" "" "0000616705" "0" "90" "17" "56283916" "56283944" "del" "0" "01804" "MKS1_000004" "g.56283916_56283944del" "" "" "" "MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000623721" "0" "50" "17" "56284567" "56284567" "subst" "0" "02325" "MKS1_000084" "g.56284567A>T" "" "" "" "MKS1(NM_017777.4):c.1286T>A (p.L429Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207206A>T" "" "VUS" "" "0000623722" "0" "30" "17" "56296565" "56296565" "subst" "0.000709578" "02330" "MKS1_000085" "g.56296565G>A" "" "" "" "MKS1(NM_017777.3):c.27C>T (p.D9=), MKS1(NM_017777.4):c.27C>T (p.D9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58219204G>A" "" "likely benign" "" "0000623723" "0" "30" "17" "56296565" "56296565" "subst" "0.000709578" "01943" "MKS1_000085" "g.56296565G>A" "" "" "" "MKS1(NM_017777.3):c.27C>T (p.D9=), MKS1(NM_017777.4):c.27C>T (p.D9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58219204G>A" "" "likely benign" "" "0000658201" "0" "30" "17" "56283688" "56283688" "subst" "0.000125887" "01943" "MKS1_000070" "g.56283688C>A" "" "" "" "MKS1(NM_001165927.1):c.1514G>T (p.(Arg505Leu)), MKS1(NM_017777.3):c.1544G>T (p.R515L), MKS1(NM_017777.4):c.1544G>T (p.R515L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206327C>A" "" "likely benign" "" "0000680932" "0" "50" "17" "56283508" "56283508" "subst" "3.26616E-5" "01943" "MKS1_000086" "g.56283508G>A" "" "" "" "MKS1(NM_017777.3):c.1612C>T (p.R538C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206147G>A" "" "VUS" "" "0000680933" "0" "50" "17" "56283847" "56283847" "subst" "0" "01943" "MKS1_000087" "g.56283847A>C" "" "" "" "MKS1(NM_017777.3):c.1469T>G (p.L490W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58206486A>C" "" "VUS" "" "0000680934" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "02325" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58212983T>C" "" "VUS" "" "0000685279" "0" "70" "17" "56284465" "56284465" "subst" "0.00220513" "00004" "MKS1_000071" "g.56284465C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001321269.1:c.1388G>A" "" "Germline" "" "" "0" "" "" "g.58207104C>T" "" "likely pathogenic" "ACMG" "0000685280" "0" "70" "17" "56284504" "56284504" "subst" "0.000430474" "00004" "MKS1_000040" "g.56284504A>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001321269.1:c.1349T>C" "" "Germline" "" "" "0" "" "" "g.58207143A>G" "" "likely pathogenic" "ACMG" "0000692405" "0" "30" "17" "56281676" "56281676" "subst" "0" "01943" "MKS1_000088" "g.56281676T>G" "" "" "" "EPX(NM_000502.5):c.2040T>G (p.G680=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58204315T>G" "" "likely benign" "" "0000692406" "0" "30" "17" "56291146" "56291146" "subst" "0.000129953" "01943" "MKS1_000089" "g.56291146C>T" "" "" "" "MKS1(NM_017777.3):c.729G>A (p.T243=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58213785C>T" "" "likely benign" "" "0000692407" "0" "30" "17" "56291612" "56291612" "subst" "0.000178712" "01943" "MKS1_000090" "g.56291612C>A" "" "" "" "MKS1(NM_017777.3):c.644+8G>T, MKS1(NM_017777.4):c.644+8G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58214251C>A" "" "likely benign" "" "0000726528" "0" "30" "17" "56284566" "56284566" "subst" "1.62467E-5" "01943" "MKS1_000092" "g.56284566C>T" "" "" "" "MKS1(NM_017777.3):c.1287G>A (p.L429=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58207205C>T" "" "likely benign" "" "0000726529" "0" "30" "17" "56285503" "56285503" "subst" "5.68569E-5" "01943" "MKS1_000045" "g.56285503C>T" "" "" "" "MKS1(NM_017777.3):c.1128G>A (p.T376=), MKS1(NM_017777.4):c.1128G>A (p.T376=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58208142C>T" "" "likely benign" "" "0000726530" "0" "90" "17" "56285505" "56285509" "dup" "0" "01943" "MKS1_000093" "g.56285505_56285509dup" "" "" "" "MKS1(NM_017777.3):c.1122_1126dupATTCA (p.T376Nfs*56)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58208144_58208148dup" "" "pathogenic" "" "0000726531" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "01943" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58212983T>C" "" "VUS" "" "0000726532" "0" "30" "17" "56292094" "56292094" "subst" "4.63298E-5" "01943" "MKS1_000094" "g.56292094G>A" "" "" "" "MKS1(NM_017777.3):c.515+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58214733G>A" "" "likely benign" "" "0000726533" "0" "50" "17" "56293498" "56293498" "subst" "0.000426545" "02329" "MKS1_000054" "g.56293498C>T" "" "" "" "MKS1(NM_017777.3):c.368G>A (p.R123Q), MKS1(NM_017777.4):c.368G>A (p.R123Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216137C>T" "" "VUS" "" "0000726534" "0" "50" "17" "56294088" "56294088" "subst" "4.06204E-5" "01943" "MKS1_000096" "g.56294088C>T" "" "" "" "MKS1(NM_017777.3):c.200G>A (p.R67H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58216727C>T" "" "VUS" "" "0000726535" "0" "50" "17" "56296032" "56296032" "subst" "0" "01943" "MKS1_000097" "g.56296032G>A" "" "" "" "MKS1(NM_017777.3):c.139C>T (p.L47F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58218671G>A" "" "VUS" "" "0000730012" "3" "90" "17" "56296511" "56296666" "del" "0" "00000" "MKS1_000091" "g.(56296091_56296511)_(56296666_?)del" "" "{PMID:Maddirevula 2018:29620724}" "" "deletion exon 1" "" "Germline" "" "" "0" "" "" "g.(58218730_58219150)_(58219305_?)del" "" "pathogenic (recessive)" "" "0000730013" "3" "90" "17" "56285505" "56285505" "dup" "0" "00000" "MKS1_000065" "g.56285505dup" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_017777.3:c.1126dupA:p.(Thr376Asnfs*3)" "" "Germline" "" "" "0" "" "" "g.58208144dup" "" "pathogenic (recessive)" "" "0000730014" "3" "90" "17" "56293499" "56293499" "subst" "1.62503E-5" "00000" "MKS1_000095" "g.56293499G>A" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_017777.3:c.367C>T:p.(Arg123*)" "" "Germline" "" "" "0" "" "" "g.58216138G>A" "" "likely pathogenic (recessive)" "" "0000731554" "3" "50" "17" "56285260" "56285260" "subst" "1.22141E-5" "00000" "MKS1_000098" "g.56285260G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.58207899G>A" "" "VUS" "" "0000732501" "0" "90" "17" "0" "0" "" "0" "00000" "MYH2_000008" "g.?" "" "{PMID:Costa 2017:28912962}" "" "496C>T (Arg166Cys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000760057" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "00000" "MKS1_000063" "g.56290344T>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.58212983T>C" "" "VUS" "" "0000760094" "0" "50" "17" "56284465" "56284465" "subst" "0.00220513" "00000" "MKS1_000071" "g.56284465C>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.58207104C>T" "" "VUS" "" "0000783497" "1" "90" "17" "56285320" "56285320" "subst" "8.12883E-6" "00000" "MKS1_000028" "g.56285320G>A" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1208C>T" "" "Germline" "" "" "0" "" "" "g.58207959G>A" "" "pathogenic" "" "0000783498" "3" "90" "17" "56283704" "56283704" "dup" "0" "00000" "MKS1_000029" "g.56283704dup" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1528dupC" "" "Germline" "" "" "0" "" "" "g.58206343dup" "" "pathogenic" "" "0000783499" "3" "90" "17" "56293641" "56293783" "del" "0" "00000" "MKS1_000019" "g.56293641_56293783del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.262-179_262-37del" "" "Germline" "" "" "0" "" "" "g.58216280_58216422del" "" "pathogenic" "" "0000783500" "3" "90" "17" "56296537" "56296537" "subst" "0" "00000" "MKS1_000027" "g.56296537C>A" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.55G>T" "" "Germline" "" "" "0" "" "" "g.58219176C>A" "" "pathogenic" "" "0000783501" "1" "90" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1115_1117delCCT" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000783502" "1" "90" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1115_1117delCCT" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000783503" "3" "90" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1115_1117delCCT" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000783504" "3" "90" "17" "56283533" "56283533" "subst" "0" "00000" "MKS1_000030" "g.56283533T>A" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1589-2A>T" "" "Germline" "" "" "0" "" "" "g.58206172T>A" "" "pathogenic" "" "0000783505" "1" "90" "17" "56288349" "56288349" "subst" "0" "00000" "MKS1_000023" "g.56288349C>T" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.950G>A" "" "Germline" "" "" "0" "" "" "g.58210988C>T" "" "pathogenic" "" "0000783587" "1" "70" "17" "56292124" "56292124" "subst" "3.7323E-5" "00000" "MKS1_000100" "g.56292124G>A" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.493C>T" "" "Germline" "" "" "0" "" "" "g.58214763G>A" "" "likely pathogenic" "" "0000783712" "2" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.417G>A" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic" "" "0000783713" "2" "90" "17" "56293486" "56293486" "del" "0" "00000" "MKS1_000025" "g.56293486del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.381delC" "" "Germline" "" "" "0" "" "" "g.58216125del" "" "pathogenic" "" "0000783714" "2" "90" "17" "56293486" "56293486" "del" "0" "00000" "MKS1_000025" "g.56293486del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.381delC" "" "Germline" "" "" "0" "" "" "g.58216125del" "" "pathogenic" "" "0000783715" "2" "90" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1115_1117delCCT" "" "Germline" "" "" "0" "" "" "g.58208155_58208157del" "" "pathogenic" "" "0000783759" "2" "70" "17" "56284464" "56284464" "subst" "4.06101E-6" "00000" "MKS1_000099" "g.56284464C>A" "" "{PMID:Bachmann-Gagescu 2015:26092869}" "" "NM_017777.3:c.1389G>T" "" "Germline" "" "" "0" "" "" "g.58207103C>A" "" "likely pathogenic" "" "0000784042" "0" "70" "17" "56283520" "56283520" "subst" "4.07156E-6" "01848" "MKS1_000101" "g.56283520G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.58206159G>A" "" "likely pathogenic" "" "0000784043" "0" "70" "17" "56292145" "56292145" "subst" "8.28796E-6" "01848" "MKS1_000015" "g.56292145G>A" "" "" "sbanfi" "" "" "Germline" "" "" "0" "" "" "g.58214784G>A" "" "pathogenic" "" "0000788513" "0" "50" "17" "56289785" "56289785" "subst" "4.06091E-5" "00000" "MKS1_000102" "g.56289785C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G869A" "" "Germline" "" "" "0" "" "" "g.58212424C>T" "" "VUS" "" "0000791776" "0" "70" "17" "56288349" "56288349" "subst" "0" "00000" "MKS1_000023" "g.56288349C>T" "" "{PMID:Brooks 2018:30055837}" "" "c.950G>A; p.G317Q" "" "Germline" "?" "" "0" "" "" "g.58210988C>T" "" "likely pathogenic" "" "0000791777" "0" "70" "17" "56292124" "56292124" "subst" "3.7323E-5" "00000" "MKS1_000100" "g.56292124G>A" "" "{PMID:Brooks 2018:30055837}" "" "c.493C>T; p.R165C" "" "Germline" "?" "" "0" "" "" "g.58214763G>A" "" "likely pathogenic" "" "0000791778" "0" "70" "17" "56283840" "56283840" "subst" "6.49926E-5" "00000" "MKS1_000103" "g.56283840A>C" "" "{PMID:Brooks 2018:30055837}" "" "c.1476T>G; p.C492W" "" "Germline" "?" "" "0" "" "" "g.58206479A>C" "" "likely pathogenic" "" "0000791779" "0" "70" "17" "56284466" "56284466" "subst" "0" "00000" "MKS1_000105" "g.56284466G>C" "" "{PMID:Brooks 2018:30055837}" "" "c.1387C>G; p.R463G" "" "Germline" "?" "" "0" "" "" "g.58207105G>C" "" "likely pathogenic" "" "0000791780" "0" "70" "17" "56285320" "56285320" "subst" "8.12883E-6" "00000" "MKS1_000028" "g.56285320G>A" "" "{PMID:Brooks 2018:30055837}" "" "c.1208C>T; p.S403L" "" "Germline" "?" "" "0" "" "" "g.58207959G>A" "" "likely pathogenic" "" "0000791863" "0" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Brooks 2018:30055837}" "" "c.1115_1117del; p.S372del" "" "Germline" "?" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000791864" "0" "70" "17" "56284464" "56284464" "subst" "4.06101E-6" "00000" "MKS1_000099" "g.56284464C>A" "" "{PMID:Brooks 2018:30055837}" "" "c.1389G>T; p.R463R (Splice)" "" "Germline" "?" "" "0" "" "" "g.58207103C>A" "" "likely pathogenic" "" "0000791865" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Brooks 2018:30055837}" "" "c.417G>A" "" "Germline" "?" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic" "" "0000791866" "0" "70" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Brooks 2018:30055837}" "" "c.1408-36_1408-6del" "" "Germline" "?" "" "0" "" "" "g.58206555_58206583del" "" "likely pathogenic" "" "0000791867" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Brooks 2018:30055837}" "" "c.417G>A" "" "Germline" "?" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic" "" "0000792020" "0" "90" "17" "0" "0" "subst" "0" "00000" "MYH2_000008" "g.?" "" "{PMID:Otto 2011:21068128}" "" "c.857T/C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000795028" "0" "90" "17" "56282436" "56282436" "del" "0" "00000" "MKS1_000106" "g.56282436delG" "" "{PMID:M\'hamdi 2014:23432027}" "" "c.*1004delC" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000798031" "0" "70" "17" "56290344" "56290344" "subst" "0.000507614" "00000" "MKS1_000063" "g.56290344T>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "MKS1 c.857A>G, p.(Asp286Gly)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.58212983T>C" "" "likely pathogenic" "ACMG" "0000808122" "0" "50" "17" "56284574" "56284574" "subst" "8.12381E-6" "01943" "MKS1_000107" "g.56284574G>A" "" "" "" "MKS1(NM_017777.3):c.1279C>T (p.H427Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808123" "0" "30" "17" "56290387" "56290387" "subst" "8.12209E-6" "01804" "MKS1_000108" "g.56290387C>T" "" "" "" "MKS1(NM_001165927.1):c.784G>A (p.(Ala262Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808124" "0" "30" "17" "56291612" "56291612" "subst" "0.000178712" "02330" "MKS1_000090" "g.56291612C>A" "" "" "" "MKS1(NM_017777.3):c.644+8G>T, MKS1(NM_017777.4):c.644+8G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808125" "0" "30" "17" "56293439" "56293439" "subst" "4.06128E-6" "01943" "MKS1_000109" "g.56293439A>G" "" "" "" "MKS1(NM_017777.3):c.417+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808126" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "02330" "MKS1_000007" "g.56293449C>T" "" "" "" "MKS1(NM_017777.3):c.417G>A (p.E139=), MKS1(NM_017777.4):c.417G>A (p.E139=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000808127" "0" "50" "17" "56296567" "56296567" "subst" "0" "01804" "MKS1_000110" "g.56296567C>G" "" "" "" "MKS1(NM_017777.3):c.25G>C (p.(Asp9His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000811062" "0" "70" "17" "56290344" "56290344" "subst" "0.000507614" "00000" "MKS1_000063" "g.56290344T>C" "" "{PMID:Leitch-2008:18327255}" "" "D286G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811063" "0" "70" "17" "56293498" "56293498" "subst" "0.000426545" "00000" "MKS1_000054" "g.56293498C>T" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "R123Q" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811066" "0" "70" "17" "56293498" "56293498" "subst" "0.000426545" "00000" "MKS1_000054" "g.56293498C>T" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "R123Q" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811067" "0" "70" "17" "56283840" "56283840" "subst" "6.49926E-5" "00000" "MKS1_000103" "g.56283840A>C" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "C492W" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811068" "0" "70" "17" "56285517" "56285519" "del" "0" "00000" "MKS1_000111" "g.56285517_56285519del" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "F371del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811069" "0" "70" "17" "56284504" "56284504" "subst" "0.000430474" "00000" "MKS1_000040" "g.56284504A>G" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "I450T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811071" "0" "70" "17" "0" "0" "" "0" "00000" "MYH2_000008" "g.?" "0/96 ethnically matched controls" "{PMID:Leitch-2008:18327255}" "" "V339M" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000811073" "0" "70" "17" "0" "0" "" "0" "00000" "MYH2_000008" "g.?" "" "{PMID:Leitch-2008:18327255}" "" "V339M" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813252" "0" "50" "17" "56292120" "56292120" "subst" "0" "00000" "MKS1_000112" "g.56292120G>A" "" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "c.485+12C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000813296" "0" "50" "17" "56292120" "56292120" "subst" "0" "00000" "MKS1_000112" "g.56292120G>A" "" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "c.485+12C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000813300" "0" "50" "17" "56296608" "56296608" "subst" "0" "00000" "MKS1_000115" "g.56296608G>C" "" "{PMID:Abu-Safieh-2012:22353939}" "" "c.-17C>G" "C not found at position 59, found G instead." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000813334" "0" "50" "17" "56293631" "56293631" "subst" "0.000471682" "00000" "MKS1_000113" "g.56293631T>C" "" "{PMID:Abu-Safieh-2012:22353939}" "" "232-27A>G" "" "Germline" "" "" "0" "" "" "g.58216270T>C" "" "VUS" "" "0000813336" "3" "70" "17" "56296511" "56296666" "del" "0" "00000" "MKS1_000091" "g.(56296091_56296511)_(56296666_?)del" "" "{PMID:Abu-Safieh-2012:22353939}" "" "del ex1" "0/96 ethnically matched controls" "Germline" "" "" "0" "" "" "g.(58218730_58219150)_(58219305_?)del" "" "likely pathogenic (recessive)" "" "0000814069" "0" "50" "17" "56282436" "56282436" "del" "0" "00000" "MKS1_000106" "g.56282436delG" "" "{PMID:M\'hamdi-2014:23432027}" "" "BBS13: c.*1004delC" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000814628" "0" "90" "17" "56284471" "56284471" "subst" "4.06118E-6" "00000" "MKS1_000116" "g.56284471T>C" "" "{PMID:Xing-2014:24608809}" "" "c.1382A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000814629" "0" "90" "17" "56283519" "56283519" "subst" "0.000215874" "00000" "MKS1_000069" "g.56283519C>T" "" "{PMID:Xing-2014:24608809}" "" "c.1601G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000816170" "0" "50" "17" "56284483" "56284483" "subst" "0" "00000" "MKS1_000117" "g.56284483T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "MKS1 c.1370A>G, p.Glu457Gly" "heterozygous" "Unknown" "?" "" "0" "" "" "g.58207122T>C" "" "VUS" "" "0000816474" "0" "50" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.417G>A, p.Glu139=" "heterozygous" "Unknown" "?" "" "0" "" "" "g.58216088C>T" "" "VUS" "" "0000817539" "3" "30" "17" "56290334" "56290334" "subst" "0.43496" "00000" "MKS1_000050" "g.56290334T>C" "" "{PMID:Knopp 2015:26003401}" "" "c.858+9A>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000817540" "3" "50" "17" "56292106" "56292106" "subst" "0" "00000" "MKS1_000118" "g.56292106C>T" "" "{PMID:Knopp 2015:26003401}" "" "c.511G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000817596" "0" "90" "17" "56293606" "56293606" "subst" "0" "00000" "MKS1_000031" "g.56293606T>C" "" "{PMID:Watson 2016:26729329}" "" "c.262-2A>G (p.?)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818327" "0" "90" "17" "56284464" "56284464" "subst" "4.06101E-6" "00000" "MKS1_000099" "g.56284464C>A" "" "{PMID:Summers 2017:28497568}" "" "c.1389G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818328" "0" "90" "17" "56292124" "56292124" "subst" "3.7323E-5" "00000" "MKS1_000100" "g.56292124G>A" "" "{PMID:Summers 2017:28497568}" "" "c.493C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818331" "0" "90" "17" "56284466" "56284466" "subst" "0" "00000" "MKS1_000105" "g.56284466G>C" "" "{PMID:Summers 2017:28497568}" "" "c.1387C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818332" "0" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Summers 2017:28497568}" "" "c.1408-36_1408-6del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818352" "0" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Summers 2017:28497568}" "" "c.417G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818353" "0" "90" "17" "56283840" "56283840" "subst" "6.49926E-5" "00000" "MKS1_000103" "g.56283840A>C" "" "{PMID:Summers 2017:28497568}" "" "c.1476T>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818378" "0" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Summers 2017:28497568}" "" "c.417G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000818379" "0" "90" "17" "56285320" "56285320" "subst" "8.12883E-6" "00000" "MKS1_000028" "g.56285320G>A" "" "{PMID:Summers 2017:28497568}" "" "c.1208C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000846723" "3" "90" "17" "56288341" "56288341" "subst" "2.03161E-5" "00000" "MKS1_000016" "g.56288341C>T" "" "{PMID:Tallapaka 2019:31191208}" "" "MKS1 c.958G>A (p.Val320Ile)" "double homozygous" "Germline" "yes" "" "0" "" "" "g.58210980C>T" "" "pathogenic" "" "0000855008" "0" "70" "17" "56283916" "56283944" "del" "0" "01943" "MKS1_000004" "g.56283916_56283944del" "" "" "" "MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000855009" "0" "30" "17" "56288030" "56288030" "subst" "0.00155999" "02330" "MKS1_000119" "g.56288030C>T" "" "" "" "MKS1(NM_017777.4):c.1014G>A (p.L338=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855010" "0" "30" "17" "56291612" "56291612" "subst" "0.000178712" "02326" "MKS1_000090" "g.56291612C>A" "" "" "" "MKS1(NM_017777.3):c.644+8G>T, MKS1(NM_017777.4):c.644+8G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855011" "0" "70" "17" "56293449" "56293449" "subst" "0.000134019" "01943" "MKS1_000007" "g.56293449C>T" "" "" "" "MKS1(NM_017777.3):c.417G>A (p.E139=), MKS1(NM_017777.4):c.417G>A (p.E139=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000855012" "0" "30" "17" "56296565" "56296565" "subst" "0.000709578" "02326" "MKS1_000085" "g.56296565G>A" "" "" "" "MKS1(NM_017777.3):c.27C>T (p.D9=), MKS1(NM_017777.4):c.27C>T (p.D9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865376" "0" "30" "17" "56283688" "56283688" "subst" "0.000125887" "01804" "MKS1_000070" "g.56283688C>A" "" "" "" "MKS1(NM_001165927.1):c.1514G>T (p.(Arg505Leu)), MKS1(NM_017777.3):c.1544G>T (p.R515L), MKS1(NM_017777.4):c.1544G>T (p.R515L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865377" "0" "50" "17" "56296842" "56296842" "subst" "0" "01804" "MKS1_000120" "g.56296842G>C" "" "" "" "MKS1(NM_001165927.1):c.31C>G (p.(Arg11Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000868772" "0" "70" "17" "56283840" "56283840" "subst" "6.49926E-5" "04128" "MKS1_000103" "g.56283840A>C" "" "{PMID:Serpieri 2023:36788019}" "" "" "combination of variants not reported" "Germline" "" "rs137853105" "0" "" "" "g.58206479A>C" "" "pathogenic" "" "0000873622" "0" "70" "17" "56283519" "56283519" "subst" "0.000215874" "00000" "MKS1_000069" "g.56283519C>T" "228" "{PMID:Sun 2018:30076350}" "" "MKS1(NM_017777.3): c.1601G>A(p.R534Q)/c.323G>A(p.R108H)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58206158C>T" "" "likely pathogenic" "" "0000873623" "0" "70" "17" "56293543" "56293543" "subst" "0.000146224" "00000" "MKS1_000121" "g.56293543C>T" "228" "{PMID:Sun 2018:30076350}" "" "MKS1(NM_017777.3): c.1601G>A(p.R534Q)/c.323G>A(p.R108H)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58216182C>T" "" "likely pathogenic" "" "0000880255" "1" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "heterozygous, no second allele found" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880256" "1" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "heterozygous, no second allele found" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880257" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880258" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880259" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880260" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880261" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880262" "3" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "MKS1 c.1408-7_35del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic" "" "0000880263" "3" "90" "17" "56293641" "56293783" "del" "0" "00000" "MKS1_000019" "g.56293641_56293783del" "" "{PMID:Frank 2007:17437276}" "" "262-37_179del" "" "Germline" "yes" "" "0" "" "" "g.58216280_58216422del" "" "pathogenic (recessive)" "" "0000880264" "3" "90" "17" "56284444" "56284444" "del" "0" "00000" "MKS1_000018" "g.56284444del" "" "{PMID:Frank 2007:17437276}" "" "1407+2delT" "" "Germline" "" "" "0" "" "" "g.58207083del" "" "pathogenic (recessive)" "" "0000880265" "3" "90" "17" "56292101" "56292101" "subst" "8.35771E-6" "00000" "MKS1_000017" "g.56292101C>T" "" "{PMID:Frank 2007:17437276}" "" "IVS5+1G>A" "" "Germline" "" "" "0" "" "" "g.58214740C>T" "" "pathogenic (recessive)" "" "0000880266" "21" "90" "17" "56283916" "56283944" "del" "0" "00000" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Frank 2007:17437276}" "" "1408-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000880267" "11" "70" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Frank 2007:17437276}" "" "" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic (recessive)" "" "0000880269" "3" "50" "17" "56283743" "56283743" "subst" "0" "00000" "MKS1_000123" "g.56283743T>C" "" "{PMID:Romani 2014:24886560}" "" "MKS1 c.1461-2A>G," "error in annotation, c.1461-2 does not have the sequence indicated in the publication; should be annotated c.1491-2A>G; homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58206382T>C" "" "VUS" "" "0000880270" "0" "70" "17" "56285881" "56285883" "del" "0" "00000" "MKS1_000125" "g.56285881_56285883del" "" "{PMID:Romani 2014:24886560}" "" "MKS1 c.1085_1088delCCT, p.S362del" "error in annotation, CCT deletion is not 4 but 3 nucleotides, so should be annotated c.1086_1088del; heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58208520_58208522del" "" "likely pathogenic" "" "0000880273" "0" "70" "17" "56283643" "56283643" "subst" "0" "00000" "MKS1_000122" "g.56283643C>A" "" "{PMID:Romani 2014:24886560}" "" "MKS1 c.1558+1G>T," "error in annotation, 1558 does not have the sequence indicated in the publication; should be annotated c.1588+1G>T; heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58206282C>A" "" "likely pathogenic" "" "0000880278" "2" "70" "17" "56293449" "56293449" "subst" "0.000134019" "00000" "MKS1_000007" "g.56293449C>T" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1208C>T, p.S403L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58216088C>T" "" "likely pathogenic" "" "0000880279" "3" "70" "17" "56283704" "56283704" "dup" "0" "00000" "MKS1_000029" "g.56283704dup" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1528dupC, p.R510Pfs*81" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206343dup" "" "likely pathogenic" "" "0000880280" "3" "70" "17" "56293641" "56293783" "del" "0" "00000" "MKS1_000019" "g.56293641_56293783del" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.262-37_179del, p.F88_E139del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58216280_58216422del" "" "likely pathogenic" "" "0000880281" "3" "70" "17" "56296537" "56296537" "subst" "0" "00000" "MKS1_000027" "g.56296537C>A" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.55G>T, p.D19Y" "homozygous" "Germline" "yes" "" "0" "" "" "g.58219176C>A" "" "likely pathogenic" "" "0000880282" "1" "70" "17" "56293486" "56293486" "del" "0" "00000" "MKS1_000025" "g.56293486del" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.381delC, p.Y128Tfs*17" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58216125del" "" "likely pathogenic" "" "0000880283" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1115_1117delCCT, p.S372del" "homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880284" "3" "70" "17" "56283533" "56283533" "subst" "0" "00000" "MKS1_000030" "g.56283533T>A" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1589-2A>T, splice" "homozygous" "Germline" "yes" "" "0" "" "" "g.58206172T>A" "" "likely pathogenic" "" "0000880285" "1" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1115_1117delCCT, p.S372del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880286" "1" "70" "17" "56296014" "56296014" "dup" "0" "00000" "MKS1_000026" "g.56296014dup" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.157dupG, p.D53Gfs*6" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58218653dup" "" "likely pathogenic" "" "0000880287" "2" "70" "17" "56285320" "56285320" "subst" "8.12883E-6" "00000" "MKS1_000028" "g.56285320G>A" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1208C>T, p.S403L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58207959G>A" "" "likely pathogenic" "" "0000880288" "2" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.1115_1117delCCT, p.S372del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880289" "2" "70" "17" "56288349" "56288349" "subst" "0" "00000" "MKS1_000023" "g.56288349C>T" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.950G>A, p.G317E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58210988C>T" "" "likely pathogenic" "" "0000880290" "2" "70" "17" "56285267" "56285267" "subst" "0" "00000" "MKS1_000124" "g.56285267G>A" "" "{PMID:Slaats 2016:26490104}" "" "MKS1 c.625C>T, p.P218S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58207906G>A" "" "likely pathogenic" "" "0000880300" "21" "70" "17" "56293641" "56293783" "del" "0" "00000" "MKS1_000019" "g.56293641_56293783del" "" "{PMID:Bader 2016:27377014}" "" "MKS1 c.262-179_262-37del, p.(Phe88_Glu139del)" "heterozygous" "Germline" "?" "" "0" "" "" "g.58216280_58216422del" "" "likely pathogenic" "" "0000880301" "10" "70" "17" "56294048" "56294048" "subst" "0" "00000" "MKS1_000126" "g.56294048C>A" "" "{PMID:Bader 2016:27377014}" "" "MKS1 c.240G>T, p.(Trp80Cys)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58216687C>A" "" "likely pathogenic" "" "0000880308" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880309" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880310" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880311" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880312" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000880313" "3" "70" "17" "56285516" "56285518" "del" "0" "00000" "MKS1_000022" "g.56285516_56285518del" "" "{PMID:Irfanullah 2016:27570071}" "" "MKS1 c.1115_1117delCCT, p.(Ser372del)" "hypomorphic allele with variable expressivity; homozygous" "Germline" "yes" "" "0" "" "" "g.58208155_58208157del" "" "likely pathogenic" "" "0000881299" "21" "90" "17" "56293496" "56293496" "subst" "8.12216E-6" "02300" "MKS1_000127" "g.56293496G>A" "" "{PMID:Marinakis 2021:34008892}" "" "" "ACMG PVS1, PM2, PM3, PP3" "Germline" "" "" "0" "" "" "g.58216135G>A" "" "pathogenic (recessive)" "ACMG" "0000881367" "11" "70" "17" "56283840" "56283840" "subst" "6.49926E-5" "02300" "MKS1_000103" "g.56283840A>C" "" "{PMID:Marinakis 2021:34008892}" "" "" "ACMG PM2, PP2, PP3, PP5" "Germline" "" "" "0" "" "" "g.58206479A>C" "" "likely pathogenic (recessive)" "ACMG" "0000894050" "0" "90" "17" "56283916" "56283944" "del" "0" "02326" "MKS1_000004" "g.56283916_56283944del" "" "" "" "MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894051" "0" "30" "17" "56284504" "56284504" "subst" "0.000430474" "02326" "MKS1_000040" "g.56284504A>G" "" "" "" "MKS1(NM_017777.3):c.1349T>C (p.I450T), MKS1(NM_017777.4):c.1349T>C (p.I450T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894052" "0" "50" "17" "56289786" "56289786" "subst" "3.24873E-5" "02326" "MKS1_000049" "g.56289786G>A" "" "" "" "MKS1(NM_017777.3):c.868C>T (p.R290W), MKS1(NM_017777.4):c.868C>T (p.R290W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000900033" "11" "90" "17" "56294098" "56294098" "subst" "1.21861E-5" "00000" "MKS1_000129" "g.56294098C>T" "" "{PMID:Luo 2020:33193692}" "" "MKS1 c.191-1G>A, p.(S64Mfs*12)" "heterozygous, confirmed on mRNA level" "Germline" "yes" "" "0" "" "" "g.58216737C>T" "" "pathogenic" "ACMG" "0000900034" "21" "90" "17" "56285912" "56285912" "del" "0" "00000" "MKS1_000128" "g.56285912del" "" "{PMID:Luo 2020:33193692}" "" "MKS1 c.1058delG , p.(Gly353GlufsTer2)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58208551del" "" "pathogenic" "ACMG" "0000900603" "11" "90" "17" "56292145" "56292145" "subst" "8.28796E-6" "00000" "MKS1_000015" "g.56292145G>A" "" "{PMID:Brunetti-Pierri 2021:34359301}" "" "MKS1 NM_017777: c.472C>T; p.(Arg158*)" "heterozygous, confirmed on mRNA level" "Germline" "yes" "" "0" "" "" "g.58214784G>A" "" "pathogenic" "ACMG" "0000900604" "21" "70" "17" "56283520" "56283520" "subst" "4.07156E-6" "00000" "MKS1_000101" "g.56283520G>A" "" "{PMID:Brunetti-Pierri 2021:34359301}" "" "MKS1 NM_017777: c.1600C>T; p.(Arg534*)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.58206159G>A" "" "likely pathogenic" "ACMG" "0000914902" "0" "30" "17" "56284566" "56284566" "subst" "1.62467E-5" "02326" "MKS1_000092" "g.56284566C>T" "" "" "" "MKS1(NM_017777.3):c.1287G>A (p.L429=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926565" "0" "30" "17" "56289780" "56289780" "subst" "0.00017868" "02326" "MKS1_000130" "g.56289780T>C" "" "" "" "MKS1(NM_017777.3):c.874A>G (p.K292E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926566" "0" "30" "17" "56294020" "56294020" "subst" "0.00021126" "02326" "MKS1_000081" "g.56294020G>A" "" "" "" "MKS1(NM_017777.3):c.261+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951840" "1" "90" "17" "56293475" "56293476" "del" "0" "00006" "MKS1_000020" "g.56293475_56293476del" "" "{PMID:Tallila 2008:19466712}" "" "392_393delCT" "" "Germline" "" "" "0" "" "" "g.58216114_58216115del" "" "pathogenic (recessive)" "" "0000951842" "2" "90" "17" "56292121" "56292121" "subst" "0.000190936" "00006" "MKS1_000021" "g.56292121G>A" "" "{PMID:Tallila 2008:19466712}" "" "" "" "Germline" "" "" "0" "" "" "g.58214760G>A" "" "pathogenic (recessive)" "" "0000951921" "0" "10" "17" "56296130" "56296130" "subst" "0.00479608" "00006" "MKS1_000135" "g.56296130A>C" "1/202" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58218769A>C" "" "benign" "" "0000951922" "0" "10" "17" "56292090" "56292090" "subst" "0.00062857" "00006" "MKS1_000052" "g.56292090G>A" "2/236" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58214729G>A" "" "benign" "" "0000951923" "0" "10" "17" "56290334" "56290334" "subst" "0.43496" "00006" "MKS1_000050" "g.56290334T>C" "79/232" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58212973T>C" "" "benign" "" "0000951924" "0" "10" "17" "56289719" "56289721" "del" "0" "00006" "MKS1_000048" "g.56289719_56289721del" "6/182" "{PMID:Khaddour 2007:17397051}" "" "915+19_915+21delTGC" "" "Germline" "" "" "0" "" "" "g.58212358_58212360del" "" "benign" "" "0000951925" "0" "10" "17" "56285567" "56285567" "subst" "0.0023363" "00006" "MKS1_000134" "g.56285567G>A" "1/164" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58208206G>A" "" "benign" "" "0000951926" "0" "10" "17" "56285244" "56285244" "subst" "0.00324329" "00006" "MKS1_000042" "g.56285244C>T" "2/196" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58207883C>T" "" "benign" "" "0000951927" "0" "10" "17" "56283449" "56283449" "subst" "0.0370875" "00006" "MKS1_000033" "g.56283449C>G" "10/230" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58206088C>G" "" "benign" "" "0000951928" "0" "10" "17" "56283365" "56283365" "subst" "0" "00006" "MKS1_000133" "g.56283365G>A" "10/230" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58206004G>A" "" "benign" "" "0000951929" "0" "10" "17" "56283089" "56283089" "del" "0.0365044" "00006" "MKS1_000032" "g.56283089del" "5/146" "{PMID:Khaddour 2007:17397051}" "" "*351delG" "" "Germline" "" "" "0" "" "" "g.58205728del" "" "benign" "" "0000951930" "0" "10" "17" "56283026" "56283026" "subst" "0.0917604" "00006" "MKS1_000132" "g.56283026G>A" "8/146" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58205665G>A" "" "benign" "" "0000951931" "0" "10" "17" "56282968" "56282968" "subst" "0.0430813" "00006" "MKS1_000131" "g.56282968G>C" "13/146" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58205607G>C" "" "benign" "" "0000951932" "11" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00006" "MKS1_000007" "g.56293449C>T" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic (recessive)" "" "0000951933" "21" "90" "17" "56288341" "56288341" "subst" "2.03161E-5" "00006" "MKS1_000016" "g.56288341C>T" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58210980C>T" "" "pathogenic (recessive)" "" "0000951934" "21" "90" "17" "56295985" "56295991" "del" "0" "00006" "MKS1_000013" "g.56295985_56295991del" "" "{PMID:Khaddour 2007:17397051}" "" "184_190del7" "" "Germline" "" "" "0" "" "" "g.58218624_58218630del" "" "pathogenic (recessive)" "" "0000951935" "3" "90" "17" "56285921" "56285921" "subst" "0" "00006" "MKS1_000010" "g.56285921G>A" "" "{PMID:Khaddour 2007:17397051}" "" "1048C>G (Q350X)" "" "Germline" "" "" "0" "" "" "g.58208560G>A" "" "pathogenic (recessive)" "" "0000951936" "3" "90" "17" "56285921" "56285921" "subst" "0" "00006" "MKS1_000010" "g.56285921G>A" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58208560G>A" "" "pathogenic (recessive)" "" "0000951937" "11" "90" "17" "56292145" "56292145" "subst" "8.28796E-6" "00006" "MKS1_000015" "g.56292145G>A" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58214784G>A" "" "pathogenic (recessive)" "" "0000951938" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Khaddour 2007:17397051}" "" "1408-35_1408-7del (G470GfsX93)" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951939" "3" "90" "17" "56283865" "56283868" "dup" "0" "00006" "MKS1_000001" "g.56283865_56283868dup" "" "{PMID:Khaddour 2007:17397051}" "" "1448_1451dup" "" "Germline" "" "" "0" "" "" "g.58206504_58206507dup" "" "pathogenic (recessive)" "" "0000951940" "21" "90" "17" "56292193" "56292193" "subst" "0" "00006" "MKS1_000014" "g.56292193G>A" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58214832G>A" "" "pathogenic (recessive)" "" "0000951941" "11" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Khaddour 2007:17397051}" "" "1408-35_1408-7del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951942" "11" "90" "17" "56283826" "56283826" "subst" "0" "00006" "MKS1_000012" "g.56283826C>T" "" "{PMID:Khaddour 2007:17397051}" "" "" "" "Germline" "" "" "0" "" "" "g.58206465C>T" "" "pathogenic (recessive)" "" "0000951943" "11" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Khaddour 2007:17397051}" "" "1408-35_1408-7del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951944" "21" "90" "17" "56288019" "56288019" "subst" "6.09434E-5" "00006" "MKS1_000008" "g.56288019C>T" "" "{PMID:Consugar 2007:17377820}" "" "IVS11+1G>A" "" "Germline" "" "" "0" "" "" "g.58210658C>T" "" "pathogenic (recessive)" "" "0000951945" "21" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Consugar 2007:17377820}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951946" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Consugar 2007:17377820}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951947" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Consugar 2007:17377820}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951948" "21" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00006" "MKS1_000007" "g.56293449C>T" "" "{PMID:Consugar 2007:17377820}" "" "417G>A" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic (recessive)" "" "0000951954" "11" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Consugar 2007:17377820}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951955" "11" "90" "17" "56293449" "56293449" "subst" "0.000134019" "00006" "MKS1_000007" "g.56293449C>T" "" "{PMID:Consugar 2007:17377820}" "" "417G>A" "" "Germline" "" "" "0" "" "" "g.58216088C>T" "" "pathogenic (recessive)" "" "0000951956" "11" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Consugar 2007:17377820}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951962" "1" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951963" "1" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951964" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951965" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951966" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951967" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951968" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951969" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Auber 2007:17935508}" "" "IVS15-7_35" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951970" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951971" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951972" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951973" "1" "90" "17" "56296537" "56296541" "dup" "0" "00006" "MKS1_000005" "g.56296537_56296541dup" "" "{PMID:Kyttala 2006:16415886}" "" "50insCCGGG" "" "Germline" "" "" "0" "" "" "g.58219176_58219180dup" "" "pathogenic (recessive)" "" "0000951974" "2" "90" "17" "56296510" "56296510" "subst" "0" "00006" "MKS1_000006" "g.56296510A>G" "" "{PMID:Kyttala 2006:16415886}" "" "IVS1+2T>C" "" "Germline" "" "" "0" "" "" "g.58219149A>G" "" "pathogenic (recessive)" "" "0000951976" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951977" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951978" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951979" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951980" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951981" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951982" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951983" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951984" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951985" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951986" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951987" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951988" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951989" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951990" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951991" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951992" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951993" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951994" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951995" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951996" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951997" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951998" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000951999" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000952000" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000952001" "3" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Kyttala 2006:16415886}" "" "IVS15-7_35del" "common founder haplotype; MKS1-Finmajor variant" "Germline" "" "" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" "0000969093" "0" "30" "17" "56296807" "56296807" "subst" "0" "02330" "MKS1_000136" "g.56296807T>C" "" "" "" "MKS1(NM_017777.4):c.-216A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982637" "0" "50" "17" "56283391" "56283391" "subst" "6.10446E-5" "01804" "MKS1_000137" "g.56283391G>T" "" "" "" "MKS1(NM_001321269.2):c.1646C>A (p.(Ser549Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982638" "0" "50" "17" "56283397" "56283397" "subst" "7.38623E-5" "01804" "MKS1_000138" "g.56283397C>T" "" "" "" "MKS1(NM_001321269.2):c.1640G>A (p.(Gly547Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982639" "0" "70" "17" "56289735" "56289735" "subst" "0" "02329" "MKS1_000139" "g.56289735T>A" "" "" "" "MKS1(NM_017777.4):c.915+4A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000982640" "0" "50" "17" "56289785" "56289785" "subst" "4.06091E-5" "01804" "MKS1_000102" "g.56289785C>T" "" "" "" "MKS1(NM_017777.4):c.869G>A (p.(Arg290Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982641" "0" "50" "17" "56290344" "56290344" "subst" "0.000507614" "01804" "MKS1_000063" "g.56290344T>C" "" "" "" "MKS1(NM_017777.3):c.857A>G (p.D286G), MKS1(NM_017777.4):c.857A>G (p.D286G, p.(Asp286Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982642" "0" "30" "17" "56291610" "56291610" "subst" "4.46784E-5" "01804" "MKS1_000140" "g.56291610C>T" "" "" "" "MKS1(NM_017777.4):c.644+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982643" "0" "30" "17" "56291758" "56291758" "subst" "0.000195038" "01804" "MKS1_000051" "g.56291758A>G" "" "" "" "MKS1(NM_017777.3):c.516-10T>C, MKS1(NM_017777.4):c.516-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982644" "0" "50" "17" "56296088" "56296088" "subst" "4.46722E-5" "01804" "MKS1_000141" "g.56296088A>G" "" "" "" "MKS1(NM_017777.4):c.83T>C (p.(Val28Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003441" "0" "50" "17" "56283734" "56283734" "subst" "0.00040205" "01804" "MKS1_000035" "g.56283734T>C" "" "" "" "MKS1(NM_017777.3):c.1498A>G (p.(Met500Val), p.M500V), MKS1(NM_017777.4):c.1498A>G (p.M500V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003442" "0" "70" "17" "56283825" "56283825" "subst" "0" "01804" "MKS1_000142" "g.56283825C>T" "" "" "" "MKS1(NM_017777.3):c.1490+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001041998" "0" "50" "17" "56284481" "56284481" "subst" "0" "01804" "MKS1_000143" "g.56284481C>A" "" "" "" "MKS1(NM_017777.4):c.1372G>T (p.(Asp458Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041999" "0" "50" "17" "56285296" "56285296" "subst" "3.25201E-5" "01804" "MKS1_000144" "g.56285296C>T" "" "" "" "MKS1(NM_017777.4):c.1232G>A (p.(Arg411His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042000" "0" "50" "17" "56292126" "56292126" "subst" "0.000223806" "01804" "MKS1_000145" "g.56292126C>T" "" "" "" "MKS1(NM_017777.4):c.491G>A (p.(Arg164His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056093" "0" "50" "17" "56285508" "56285508" "subst" "0" "01804" "MKS1_000146" "g.56285508A>G" "" "" "" "MKS1(NM_017777.4):c.1123T>C (p.(Phe375Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056094" "0" "50" "17" "56288067" "56288067" "subst" "4.06144E-6" "01804" "MKS1_000147" "g.56288067T>C" "" "" "" "MKS1(NM_017777.4):c.977A>G (p.(Glu326Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059865" "0" "90" "17" "56283916" "56283944" "del" "0" "00006" "MKS1_000004" "g.56283916_56283944del" "" "{PMID:Serpieri 2023:36788019}" "" "" "combination of variants not reported" "Germline" "" "rs386834043" "0" "" "" "g.58206555_58206583del" "" "pathogenic (recessive)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes MKS1 ## Count = 348 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000000665" "00000034" "90" "1450" "0" "1453" "0" "c.1450_1453dup" "r.(?)" "p.(Thr485Argfs*107)" "16" "0000000666" "00000034" "90" "829" "0" "829" "0" "c.829G>T" "r.(?)" "p.(Glu277*)" "8" "0000016102" "00000034" "95" "184" "0" "184" "0" "c.184A>G" "r.(?)" "p.(Thr62Ala)" "2" "0000016618" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "15i" "0000016619" "00000034" "90" "51" "0" "55" "0" "c.51_55dup" "r.(51_55dup)" "p.(Asp19Alafs*36)" "2" "0000016620" "00000034" "70" "80" "2" "80" "2" "c.80+2T>C" "r.spl" "p.?" "2" "0000016621" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.262_417del" "p.Phe88_Glu139del" "4" "0000016622" "00000034" "70" "1024" "1" "1024" "1" "c.1024+1G>A" "r.(959_1024del)" "p.(Val320_His342delinsAsp)" "11i" "0000016624" "00000034" "90" "1048" "0" "1048" "0" "c.1048C>T" "r.(1048c>u)" "p.(Gln350*)" "13" "0000016625" "00000034" "90" "1450" "0" "1453" "0" "c.1450_1453dup" "r.(1450_1453dup)" "p.(Thr485Argfs*107)" "" "0000016626" "00000034" "70" "1490" "0" "1490" "0" "c.1490G>A" "r.[(1490g>a, spl?)]" "p.[(Arg497Lys, ?)]" "17" "0000016627" "00000034" "90" "184" "0" "190" "0" "c.184_190del" "r.[(184_190del, spl?)]" "p.[(Thr62Valfs*14, spl?])" "3" "0000016628" "00000034" "90" "424" "0" "424" "0" "c.424C>T" "r.(424c>u)" "p.(Gln142*)" "" "0000016629" "00000034" "90" "472" "0" "472" "0" "c.472C>T" "r.472c>u)" "p.(Arg158*)" "6i" "0000016630" "00000034" "70" "958" "0" "958" "0" "c.958G>A" "r.[958g>a, spl?]" "p.[Val320Ile, ?]" "11" "0000016631" "00000034" "70" "515" "1" "515" "1" "c.515+1G>A" "r.spl" "p.?" "5i" "0000016632" "00000034" "70" "1407" "2" "1407" "2" "c.1407+2del" "r.spl" "p.?" "15i" "0000016633" "00000034" "90" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.[262_417del,262_417delins418-60_418-1]" "p.[Phe88_Glu139del,Phe88fs]" "3i" "0000016634" "00000034" "90" "392" "0" "393" "0" "c.392_393del" "r.(392_393del)" "p.(Ser131*)" "5" "0000016635" "00000034" "70" "496" "0" "496" "0" "c.496C>T" "r.(496c>u)" "p.(Arg166Trp)" "6" "0000039599" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.262_417del" "p.Phe88_Glu139del" "4" "0000039600" "00000034" "90" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Ser403Leu)" "14" "0000039601" "00000034" "90" "1528" "0" "1528" "0" "c.1528dup" "r.(?)" "p.(Arg510Profs*81)" "17" "0000039602" "00000034" "90" "55" "0" "55" "0" "c.55G>T" "r.(?)" "p.(Asp19Tyr)" "1" "0000039603" "00000034" "90" "381" "0" "381" "0" "c.381del" "r.(?)" "p.(Tyr128Thrfs*17)" "4" "0000039604" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "13" "0000039605" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "13" "0000039606" "00000034" "90" "1589" "-2" "1589" "-2" "c.1589-2A>T" "r.spl" "p.?" "17i" "0000039607" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "13" "0000039608" "00000034" "90" "950" "0" "950" "0" "c.950G>A" "r.(?)" "p.(Gly317Glu)" "10" "0000039609" "00000034" "90" "157" "0" "157" "0" "c.157dup" "r.(?)" "p.(Asp53Glyfs*6)" "2" "0000039610" "00000034" "90" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.(=)" "p.(=)" "3i" "0000086046" "00000034" "90" "262" "-2" "262" "-2" "c.262-2A>G" "r.spl?" "p.?" "3i" "0000086576" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "13" "0000252300" "00000034" "30" "516" "-10" "516" "-10" "c.516-10T>C" "r.(=)" "p.(=)" "" "0000255140" "00000034" "30" "-267" "0" "-267" "0" "c.-267T>A" "r.(?)" "p.(=)" "" "0000256083" "00000034" "50" "1349" "0" "1349" "0" "c.1349T>C" "r.(?)" "p.(Ile450Thr)" "" "0000279794" "00000034" "10" "1128" "0" "1128" "0" "c.1128G>A" "r.(?)" "p.(Thr376=)" "" "0000279795" "00000034" "30" "12" "0" "12" "0" "c.12C>T" "r.(?)" "p.(Thr4=)" "" "0000279796" "00000034" "10" "1436" "0" "1436" "0" "c.1436G>A" "r.(?)" "p.(Arg479His)" "" "0000279797" "00000034" "30" "213" "0" "213" "0" "c.213C>G" "r.(?)" "p.(Asp71Glu)" "" "0000279798" "00000034" "50" "868" "0" "868" "0" "c.868C>T" "r.(?)" "p.(Arg290Trp)" "" "0000282509" "00000034" "10" "858" "9" "858" "9" "c.858+9A>G" "r.(=)" "p.(=)" "" "0000283688" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000286597" "00000034" "10" "2031" "0" "2031" "0" "c.*351del" "r.(?)" "p.(=)" "" "0000286598" "00000034" "10" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(His40Tyr)" "" "0000286599" "00000034" "10" "1273" "11" "1273" "11" "c.1273+11G>A" "r.(=)" "p.(=)" "" "0000286600" "00000034" "10" "1273" "39" "1273" "39" "c.1273+39C>T" "r.(=)" "p.(=)" "" "0000286601" "00000034" "10" "1415" "0" "1415" "0" "c.1415G>A" "r.(?)" "p.(Arg472His)" "" "0000286602" "00000034" "10" "1435" "0" "1435" "0" "c.1435C>T" "r.(?)" "p.(Arg479Cys)" "" "0000286603" "00000034" "10" "1436" "0" "1436" "0" "c.1436G>A" "r.(?)" "p.(Arg479His)" "" "0000286604" "00000034" "10" "1498" "0" "1498" "0" "c.1498A>G" "r.(?)" "p.(Met500Val)" "" "0000286605" "00000034" "10" "213" "0" "213" "0" "c.213C>G" "r.(?)" "p.(Asp71Glu)" "" "0000286606" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000286607" "00000034" "10" "916" "-119" "916" "-119" "c.916-119G>A" "r.(=)" "p.(=)" "" "0000291849" "00000034" "10" "-18" "0" "-18" "0" "c.-18C>G" "r.(?)" "p.(=)" "" "0000291850" "00000034" "30" "1148" "0" "1148" "0" "c.1148A>G" "r.(?)" "p.(His383Arg)" "" "0000291851" "00000034" "10" "1273" "11" "1273" "11" "c.1273+11G>A" "r.(=)" "p.(=)" "" "0000291852" "00000034" "30" "12" "0" "12" "0" "c.12C>T" "r.(?)" "p.(Thr4=)" "" "0000291853" "00000034" "90" "1407" "1" "1407" "1" "c.1407+1G>A" "r.spl?" "p.?" "" "0000291854" "00000034" "10" "1671" "0" "1671" "0" "c.1671G>C" "r.(?)" "p.(Leu557=)" "" "0000291855" "00000034" "30" "213" "0" "213" "0" "c.213C>G" "r.(?)" "p.(Asp71Glu)" "" "0000291856" "00000034" "30" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "" "0000291857" "00000034" "50" "515" "12" "515" "12" "c.515+12C>T" "r.(=)" "p.(=)" "" "0000291858" "00000034" "10" "858" "9" "858" "9" "c.858+9A>G" "r.(=)" "p.(=)" "" "0000291859" "00000034" "10" "915" "19" "915" "21" "c.915+19_915+21del" "r.(=)" "p.(=)" "" "0000325512" "00000034" "50" "4454" "0" "4454" "0" "c.*2774G>A" "r.(=)" "p.(=)" "" "0000325514" "00000034" "50" "1505" "0" "1505" "0" "c.1505C>G" "r.(?)" "p.(Ser502Trp)" "" "0000325516" "00000034" "50" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(Glu337Gly)" "" "0000325518" "00000034" "50" "10" "0" "10" "0" "c.10A>T" "r.(?)" "p.(Thr4Ser)" "" "0000338400" "00000034" "10" "858" "9" "858" "9" "c.858+9A>G" "r.(=)" "p.(=)" "" "0000344040" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000344381" "00000034" "50" "1196" "0" "1196" "0" "c.1196G>C" "r.(?)" "p.(Cys399Ser)" "" "0000349569" "00000034" "50" "167" "0" "167" "0" "c.167C>G" "r.(?)" "p.(Thr56Ser)" "" "0000350716" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000351285" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(=)" "p.(=)" "" "0000405878" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.(=)" "p.(=)" "4" "0000459820" "00000034" "90" "1126" "0" "1126" "0" "c.1126dup" "r.(?)" "p.(Thr376Asnfs*3)" "" "0000459821" "00000034" "90" "1126" "0" "1126" "0" "c.1126dup" "r.(?)" "p.(Thr376Asnfs*3)" "" "0000562362" "00000034" "50" "1601" "0" "1601" "0" "c.1601G>A" "r.(?)" "p.(Arg534Gln)" "" "0000562363" "00000034" "50" "1544" "0" "1544" "0" "c.1544G>T" "r.(?)" "p.(Arg515Leu)" "" "0000562364" "00000034" "50" "1498" "0" "1498" "0" "c.1498A>G" "r.(?)" "p.(Met500Val)" "" "0000562365" "00000034" "30" "1435" "0" "1435" "0" "c.1435C>T" "r.(?)" "p.(Arg479Cys)" "" "0000562366" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(=)" "p.(=)" "" "0000562367" "00000034" "30" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000562368" "00000034" "30" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000562369" "00000034" "30" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000562370" "00000034" "10" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000562371" "00000034" "50" "1349" "0" "1349" "0" "c.1349T>C" "r.(?)" "p.(Ile450Thr)" "" "0000562374" "00000034" "10" "1196" "0" "1196" "0" "c.1196G>T" "r.(?)" "p.(Cys399Phe)" "" "0000562375" "00000034" "90" "1181" "0" "1181" "0" "c.1181G>A" "r.(?)" "p.(Trp394Ter)" "" "0000562377" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000562378" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000562380" "00000034" "30" "822" "0" "822" "0" "c.822G>A" "r.(?)" "p.(Pro274=)" "" "0000562382" "00000034" "30" "749" "13" "749" "13" "c.749+13A>G" "r.(=)" "p.(=)" "" "0000562383" "00000034" "50" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Val182Ile)" "" "0000562384" "00000034" "10" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Val182Ile)" "" "0000562385" "00000034" "30" "516" "-10" "516" "-10" "c.516-10T>C" "r.(=)" "p.(=)" "" "0000562386" "00000034" "50" "397" "0" "397" "0" "c.397A>G" "r.(?)" "p.(Arg133Gly)" "" "0000562387" "00000034" "50" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "" "0000562388" "00000034" "30" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "" "0000562389" "00000034" "50" "281" "0" "281" "0" "c.281A>C" "r.(?)" "p.(Gln94Pro)" "" "0000562390" "00000034" "30" "261" "7" "261" "7" "c.261+7C>T" "r.(=)" "p.(=)" "" "0000562391" "00000034" "30" "213" "0" "213" "0" "c.213C>G" "r.(?)" "p.(Asp71Glu)" "" "0000562392" "00000034" "50" "199" "0" "199" "0" "c.199C>T" "r.(?)" "p.(Arg67Cys)" "" "0000616705" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(=)" "p.(=)" "" "0000623721" "00000034" "50" "1286" "0" "1286" "0" "c.1286T>A" "r.(?)" "p.(Leu429Gln)" "" "0000623722" "00000034" "30" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(Asp9=)" "" "0000623723" "00000034" "30" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(Asp9=)" "" "0000658201" "00000034" "30" "1544" "0" "1544" "0" "c.1544G>T" "r.(?)" "p.(Arg515Leu)" "" "0000680932" "00000034" "50" "1612" "0" "1612" "0" "c.1612C>T" "r.(?)" "p.(Arg538Cys)" "" "0000680933" "00000034" "50" "1469" "0" "1469" "0" "c.1469T>G" "r.(?)" "p.(Leu490Trp)" "" "0000680934" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000685279" "00000034" "70" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000685280" "00000034" "70" "1349" "0" "1349" "0" "c.1349T>C" "r.(?)" "p.(Ile450Thr)" "" "0000692405" "00000034" "30" "3444" "0" "3444" "0" "c.*1764A>C" "r.(=)" "p.(=)" "" "0000692406" "00000034" "30" "729" "0" "729" "0" "c.729G>A" "r.(?)" "p.(Thr243=)" "" "0000692407" "00000034" "30" "644" "8" "644" "8" "c.644+8G>T" "r.(=)" "p.(=)" "" "0000726528" "00000034" "30" "1287" "0" "1287" "0" "c.1287G>A" "r.(?)" "p.(Leu429=)" "" "0000726529" "00000034" "30" "1128" "0" "1128" "0" "c.1128G>A" "r.(?)" "p.(Thr376=)" "" "0000726530" "00000034" "90" "1122" "0" "1126" "0" "c.1122_1126dup" "r.(?)" "p.(Thr376Asnfs*56)" "" "0000726531" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000726532" "00000034" "30" "515" "8" "515" "8" "c.515+8C>T" "r.(=)" "p.(=)" "" "0000726533" "00000034" "50" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "" "0000726534" "00000034" "50" "200" "0" "200" "0" "c.200G>A" "r.(?)" "p.(Arg67His)" "" "0000726535" "00000034" "50" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Leu47Phe)" "" "0000730012" "00000034" "90" "0" "0" "0" "0" "c.-75_(80+1_81-1){0}" "r.0?" "p.0?" "_1_1i" "0000730013" "00000034" "90" "1126" "0" "1126" "0" "c.1126dup" "r.(?)" "p.(Thr376Asnfs*3)" "" "0000730014" "00000034" "90" "367" "0" "367" "0" "c.367C>T" "r.(?)" "p.(Arg123*)" "" "0000731554" "00000034" "50" "1268" "0" "1268" "0" "c.1268C>T" "r.(?)" "p.(Thr423Ile)" "" "0000732501" "00000034" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000760057" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000760094" "00000034" "50" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Arg463Gln)" "" "0000783497" "00000034" "90" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Ser403Leu)" "" "0000783498" "00000034" "90" "1528" "0" "1528" "0" "c.1528dup" "r.(?)" "p.(Arg510Profs*81)" "" "0000783499" "00000034" "90" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.(=)" "p.(=)" "" "0000783500" "00000034" "90" "55" "0" "55" "0" "c.55G>T" "r.(?)" "p.(Asp19Tyr)" "" "0000783501" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000783502" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000783503" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000783504" "00000034" "90" "1589" "-2" "1589" "-2" "c.1589-2A>T" "r.spl?" "p.?" "" "0000783505" "00000034" "90" "950" "0" "950" "0" "c.950G>A" "r.(?)" "p.(Gly317Glu)" "" "0000783587" "00000034" "70" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Arg165Cys)" "" "0000783712" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.(=)" "p.(=)" "" "0000783713" "00000034" "90" "381" "0" "381" "0" "c.381del" "r.(?)" "p.(Tyr128Thrfs*17)" "" "0000783714" "00000034" "90" "381" "0" "381" "0" "c.381del" "r.(?)" "p.(Tyr128Thrfs*17)" "" "0000783715" "00000034" "90" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000783759" "00000034" "70" "1389" "0" "1389" "0" "c.1389G>T" "r.(=)" "p.(=)" "" "0000784042" "00000034" "70" "1600" "0" "1600" "0" "c.1600C>T" "r.(?)" "p.(Arg534*)" "" "0000784043" "00000034" "70" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158*)" "" "0000788513" "00000034" "50" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Arg290Gln)" "9" "0000791776" "00000034" "70" "950" "0" "950" "0" "c.950G>A" "r.(?)" "p.(Gly317Gln)" "" "0000791777" "00000034" "70" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Arg165Cys)" "" "0000791778" "00000034" "70" "1476" "0" "1476" "0" "c.1476T>G" "r.(?)" "p.(Cys492Trp)" "" "0000791779" "00000034" "70" "1387" "0" "1387" "0" "c.1387C>G" "r.(?)" "p.(Arg463Gly)" "" "0000791780" "00000034" "70" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Ser403Leu)" "" "0000791863" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000791864" "00000034" "70" "1389" "0" "1389" "0" "c.1389G>T" "r.spl?" "p.(Arg463=,?)" "" "0000791865" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.spl?" "p.(Glu139=,?)" "" "0000791866" "00000034" "70" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.?" "p.(?)" "" "0000791867" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.spl?" "p.(Glu139=,?)" "" "0000792020" "00000034" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "8" "0000795028" "00000034" "90" "2684" "0" "2684" "0" "c.*1004del" "r.spl?" "p.?" "18" "0000798031" "00000034" "70" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000808122" "00000034" "50" "1279" "0" "1279" "0" "c.1279C>T" "r.(?)" "p.(His427Tyr)" "" "0000808123" "00000034" "30" "814" "0" "814" "0" "c.814G>A" "r.(?)" "p.(Ala272Thr)" "" "0000808124" "00000034" "30" "644" "8" "644" "8" "c.644+8G>T" "r.(=)" "p.(=)" "" "0000808125" "00000034" "30" "417" "10" "417" "10" "c.417+10T>C" "r.(=)" "p.(=)" "" "0000808126" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000808127" "00000034" "50" "25" "0" "25" "0" "c.25G>C" "r.(?)" "p.(Asp9His)" "" "0000811062" "00000034" "70" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "8" "0000811063" "00000034" "70" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "4" "0000811066" "00000034" "70" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Arg123Gln)" "4" "0000811067" "00000034" "70" "1476" "0" "1476" "0" "c.1476T>G" "r.(?)" "p.(Cys492Trp)" "16" "0000811068" "00000034" "70" "1112" "0" "1114" "0" "c.1112_1114del" "r.(?)" "p.(Phe371del)" "13" "0000811069" "00000034" "70" "1349" "0" "1349" "0" "c.1349T>C" "r.(?)" "p.(Ile450Thr)" "15" "0000811071" "00000034" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000811073" "00000034" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000813252" "00000034" "50" "485" "12" "485" "12" "c.485+12C>T" "r.spl?" "p.?" "5" "0000813296" "00000034" "50" "485" "12" "485" "12" "c.485+12C>T" "r.spl?" "p.?" "5" "0000813300" "00000034" "50" "-17" "0" "-17" "0" "c.-17C>G" "r.(?)" "p.?" "1" "0000813334" "00000034" "50" "262" "-27" "262" "-27" "c.262-27A>G" "r.(?)" "p.(=)" "3" "0000813336" "00000034" "70" "0" "0" "0" "0" "c.-75_(80+1_81-1){0}" "r.0?" "p.0?" "_1_1i" "0000814069" "00000034" "50" "2684" "0" "2684" "0" "c.*1004del" "r.(?)" "p.?" "18" "0000814628" "00000034" "90" "1382" "0" "1382" "0" "c.1382A>G" "r.(?)" "p.(Tyr461Cys)" "15" "0000814629" "00000034" "90" "1601" "0" "1601" "0" "c.1601G>A" "r.(?)" "p.(Arg534Gln)" "18" "0000816170" "00000034" "50" "1370" "0" "1370" "0" "c.1370A>G" "r.(?)" "p.(Glu457Gly)" "" "0000816474" "00000034" "50" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000817539" "00000034" "30" "858" "9" "858" "9" "c.858+9A>G" "r.(=)" "p.(=)" "8i" "0000817540" "00000034" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "5" "0000817596" "00000034" "90" "262" "-2" "262" "-2" "c.262-2A>G" "r.spl?" "p.?" "3i" "0000818327" "00000034" "90" "1389" "0" "1389" "0" "c.1389G>T" "r.(=)" "p.(=)" "15" "0000818328" "00000034" "90" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Arg165Cys)" "5" "0000818331" "00000034" "90" "1387" "0" "1387" "0" "c.1387C>G" "r.(?)" "p.(Arg463Gly)" "15" "0000818332" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.?" "p.?" "15i" "0000818352" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.(=)" "p.(=)" "4" "0000818353" "00000034" "90" "1476" "0" "1476" "0" "c.1476T>G" "r.(?)" "p.(Cys492Trp)" "16" "0000818378" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.(=)" "p.(=)" "4" "0000818379" "00000034" "90" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Ser403Leu)" "14" "0000846723" "00000034" "90" "958" "0" "958" "0" "c.958G>A" "r.(?)" "p.Val320Ile" "11i" "0000855008" "00000034" "70" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(=)" "p.(=)" "" "0000855009" "00000034" "30" "1014" "0" "1014" "0" "c.1014G>A" "r.(?)" "p.(Leu338=)" "" "0000855010" "00000034" "30" "644" "8" "644" "8" "c.644+8G>T" "r.(=)" "p.(=)" "" "0000855011" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(Glu139=)" "" "0000855012" "00000034" "30" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(Asp9=)" "" "0000865376" "00000034" "30" "1544" "0" "1544" "0" "c.1544G>T" "r.(?)" "p.(Arg515Leu)" "" "0000865377" "00000034" "50" "-251" "0" "-251" "0" "c.-251C>G" "r.(?)" "p.(=)" "" "0000868772" "00000034" "70" "1476" "0" "1476" "0" "c.1476T>G" "r.(?)" "p.(Cys492Trp)" "" "0000873622" "00000034" "70" "1601" "0" "1601" "0" "c.1601G>A" "r.(?)" "p.(Arg534Gln)" "" "0000873623" "00000034" "70" "323" "0" "323" "0" "c.323G>A" "r.(?)" "p.(Arg108His)" "" "0000880255" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880256" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880257" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880258" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880259" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880260" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880261" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880262" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000880263" "00000034" "90" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.[262_417del,262_417delins418-60_418-1]" "p.[Phe88_Glu139del,Phe88fs]" "3i" "0000880264" "00000034" "90" "1407" "2" "1407" "2" "c.1407+2del" "r.spl" "p.?" "" "0000880265" "00000034" "90" "515" "1" "515" "1" "c.515+1G>A" "r.spl" "p.?" "" "0000880266" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.Glu471Leufs*92)(" "" "0000880267" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.spl?" "p.(Glu139=,?)" "" "0000880269" "00000034" "50" "1491" "-2" "1491" "-2" "c.1491-2A>G" "r.(?)" "p.?" "" "0000880270" "00000034" "70" "1086" "0" "1088" "0" "c.1086_1088del" "r.(?)" "p.(Leu363del)" "" "0000880273" "00000034" "70" "1588" "1" "1588" "1" "c.1588+1G>T" "r.spl" "p.?" "" "0000880278" "00000034" "70" "417" "0" "417" "0" "c.417G>A" "r.spl" "p.(Glu139=, Phe88_Glu139del)" "" "0000880279" "00000034" "70" "1528" "0" "1528" "0" "c.1528dup" "r.(?)" "p.(Arg510Profs*81)" "" "0000880280" "00000034" "70" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.262_417del" "p.(Phe88_Glu139del)" "" "0000880281" "00000034" "70" "55" "0" "55" "0" "c.55G>T" "r.(?)" "p.(Asp19Tyr)" "" "0000880282" "00000034" "70" "381" "0" "381" "0" "c.381del" "r.(?)" "p.(Tyr128Thrfs*17)" "" "0000880283" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880284" "00000034" "70" "1589" "-2" "1589" "-2" "c.1589-2A>T" "r.spl" "p.?" "" "0000880285" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880286" "00000034" "70" "157" "0" "157" "0" "c.157dupG" "r.(?)" "p.(Asp53Glyfs*6)" "" "0000880287" "00000034" "70" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Ser403Leu)" "" "0000880288" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880289" "00000034" "70" "950" "0" "950" "0" "c.950G>A" "r.(?)" "p.(Gly317Glu)" "" "0000880290" "00000034" "70" "1261" "0" "1261" "0" "c.1261C>T" "r.(?)" "p.(Pro421Ser)" "" "0000880300" "00000034" "70" "262" "-179" "262" "-37" "c.262-179_262-37del" "r.262_417del" "p.(Phe88_Glu139del)" "" "0000880301" "00000034" "70" "240" "0" "240" "0" "c.240G>T" "r.(?)" "p.(Trp80Cys)" "" "0000880308" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880309" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880310" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880311" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880312" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000880313" "00000034" "70" "1115" "0" "1117" "0" "c.1115_1117del" "r.(?)" "p.(Ser372del)" "" "0000881299" "00000034" "90" "370" "0" "370" "0" "c.370C>T" "r.(?)" "p.(Arg124Ter)" "" "0000881367" "00000034" "70" "1476" "0" "1476" "0" "c.1476T>G" "r.(?)" "p.(Cys492Trp)" "" "0000894050" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(=)" "p.(=)" "" "0000894051" "00000034" "30" "1349" "0" "1349" "0" "c.1349T>C" "r.(?)" "p.(Ile450Thr)" "" "0000894052" "00000034" "50" "868" "0" "868" "0" "c.868C>T" "r.(?)" "p.(Arg290Trp)" "" "0000900033" "00000034" "90" "191" "-1" "191" "-1" "c.191-1G>A" "r.191delG" "p.(Ser64Metfs*12)" "" "0000900034" "00000034" "90" "1058" "0" "1058" "0" "c.1058del" "r.(?)" "p.(Gly353GlufsTer2)" "" "0000900603" "00000034" "90" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158*)" "" "0000900604" "00000034" "70" "1600" "0" "1600" "0" "c.1600C>T" "r.(?)" "p.(Arg534*)" "" "0000914902" "00000034" "30" "1287" "0" "1287" "0" "c.1287G>A" "r.(?)" "p.(Leu429=)" "" "0000926565" "00000034" "30" "874" "0" "874" "0" "c.874A>G" "r.(?)" "p.(Lys292Glu)" "" "0000926566" "00000034" "30" "261" "7" "261" "7" "c.261+7C>T" "r.(=)" "p.(=)" "" "0000951840" "00000034" "90" "392" "0" "393" "0" "c.392_393del" "r.(?)" "p.(Ser131*)" "" "0000951842" "00000034" "90" "496" "0" "496" "0" "c.496C>T" "r.(?)" "p.(Arg166Trp)" "" "0000951921" "00000034" "10" "81" "-40" "81" "-40" "c.81-40T>G" "r.(?)" "p.(=)" "" "0000951922" "00000034" "10" "515" "12" "515" "12" "c.515+12C>T" "r.(?)" "p.(=)" "" "0000951923" "00000034" "10" "858" "9" "858" "9" "c.858+9A>G" "r.(?)" "p.(=)" "" "0000951924" "00000034" "10" "915" "19" "915" "21" "c.915+19_915+21del" "r.(?)" "p.(=)" "" "0000951925" "00000034" "10" "1096" "-32" "1096" "-32" "c.1096-32C>T" "r.(?)" "p.(=)" "" "0000951926" "00000034" "10" "1273" "11" "1273" "11" "c.1273+11G>A" "r.(?)" "p.(=)" "" "0000951927" "00000034" "10" "1671" "0" "1671" "0" "c.1671G>C" "r.(?)" "p.(Leu557=)" "" "0000951928" "00000034" "10" "1755" "0" "1755" "0" "c.*75C>T" "r.(?)" "p.(=)" "" "0000951929" "00000034" "10" "2031" "0" "2031" "0" "c.*351del" "r.(?)" "p.(=)" "" "0000951930" "00000034" "10" "2094" "0" "2094" "0" "c.*414C>T" "r.(?)" "p.(=)" "" "0000951931" "00000034" "10" "2152" "0" "2152" "0" "c.*472C>G" "r.(?)" "p.(=)" "" "0000951932" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.spl?" "p.?" "" "0000951933" "00000034" "90" "958" "0" "958" "0" "c.958G>A" "r.spl?" "p.?" "" "0000951934" "00000034" "90" "184" "0" "190" "0" "c.184_190del" "r.spl?" "p.(Thr62ValfsTer14)" "" "0000951935" "00000034" "90" "1048" "0" "1048" "0" "c.1048C>T" "r.(?)" "p.(Gln350Ter)" "" "0000951936" "00000034" "90" "1048" "0" "1048" "0" "c.1048C>T" "r.(?)" "p.(Gln350Ter)" "" "0000951937" "00000034" "90" "472" "0" "472" "0" "c.472C>T" "r.(472c>u)" "p.(Arg158Ter)" "" "0000951938" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951939" "00000034" "90" "1450" "0" "1453" "0" "c.1450_1453dup" "r.(1450_1453dup)" "p.(Thr485ArgfsTer107)" "" "0000951940" "00000034" "90" "424" "0" "424" "0" "c.424C>T" "r.(424c>u)" "p.(Gln142Ter)" "" "0000951941" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951942" "00000034" "90" "1490" "0" "1490" "0" "c.1490G>A" "r.spl?" "p.?" "" "0000951943" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951944" "00000034" "90" "1024" "1" "1024" "1" "c.1024+1G>A" "r.(959_1024del)" "p.(Val320_His342delinsAsp)" "" "0000951945" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951946" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951947" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951948" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.338_417del" "p.Lys113ThrfsTer59" "" "0000951954" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951955" "00000034" "90" "417" "0" "417" "0" "c.417G>A" "r.338_417del" "p.Lys113ThrfsTer59" "" "0000951956" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951962" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951963" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951964" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951965" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951966" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951967" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951968" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951969" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951970" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.1408_1490del" "p.Glu471Leufs*92" "" "0000951971" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951972" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951973" "00000034" "90" "51" "0" "55" "0" "c.51_55dup" "r.(51_55dup)" "p.(Asp19AlafsTer36)" "" "0000951974" "00000034" "90" "80" "2" "80" "2" "c.80+2T>C" "r.sp" "p.?" "" "0000951976" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951977" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951978" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951979" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951980" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951981" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951982" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951983" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951984" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951985" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951986" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951987" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951988" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951989" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951990" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951991" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951992" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951993" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951994" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951995" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951996" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951997" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951998" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000951999" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000952000" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000952001" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.(1408_1490del)" "p.(Glu471Leufs*92)" "" "0000969093" "00000034" "30" "-216" "0" "-216" "0" "c.-216A>G" "r.(?)" "p.(=)" "" "0000982637" "00000034" "50" "1729" "0" "1729" "0" "c.*49C>A" "r.(=)" "p.(=)" "" "0000982638" "00000034" "50" "1723" "0" "1723" "0" "c.*43G>A" "r.(=)" "p.(=)" "" "0000982639" "00000034" "70" "915" "4" "915" "4" "c.915+4A>T" "r.spl?" "p.?" "" "0000982640" "00000034" "50" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Arg290Gln)" "" "0000982641" "00000034" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Asp286Gly)" "" "0000982642" "00000034" "30" "644" "10" "644" "10" "c.644+10G>A" "r.(=)" "p.(=)" "" "0000982643" "00000034" "30" "516" "-10" "516" "-10" "c.516-10T>C" "r.(=)" "p.(=)" "" "0000982644" "00000034" "50" "83" "0" "83" "0" "c.83T>C" "r.(?)" "p.(Val28Ala)" "" "0001003441" "00000034" "50" "1498" "0" "1498" "0" "c.1498A>G" "r.(?)" "p.(Met500Val)" "" "0001003442" "00000034" "70" "1490" "1" "1490" "1" "c.1490+1G>A" "r.spl?" "p.?" "" "0001041998" "00000034" "50" "1372" "0" "1372" "0" "c.1372G>T" "r.(?)" "p.(Asp458Tyr)" "" "0001041999" "00000034" "50" "1232" "0" "1232" "0" "c.1232G>A" "r.(?)" "p.(Arg411His)" "" "0001042000" "00000034" "50" "491" "0" "491" "0" "c.491G>A" "r.(?)" "p.(Arg164His)" "" "0001056093" "00000034" "50" "1123" "0" "1123" "0" "c.1123T>C" "r.(?)" "p.(Phe375Leu)" "" "0001056094" "00000034" "50" "977" "0" "977" "0" "c.977A>G" "r.(?)" "p.(Glu326Gly)" "" "0001059865" "00000034" "90" "1408" "-34" "1408" "-6" "c.1408-34_1408-6del" "r.spl" "p.?" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 209 "{{screeningid}}" "{{variantid}}" "0000000020" "0000000665" "0000000044" "0000000666" "0000000211" "0000016102" "0000019385" "0000039599" "0000019385" "0000039600" "0000019386" "0000039601" "0000019387" "0000039602" "0000019388" "0000039603" "0000019388" "0000039604" "0000019389" "0000039605" "0000019390" "0000039606" "0000019391" "0000039607" "0000019391" "0000039608" "0000019392" "0000039609" "0000019393" "0000039610" "0000056008" "0000086046" "0000056336" "0000086576" "0000182061" "0000405878" "0000226790" "0000459820" "0000226791" "0000459821" "0000310368" "0000685279" "0000310369" "0000685280" "0000332730" "0000730012" "0000332731" "0000730013" "0000332732" "0000730014" "0000333764" "0000731554" "0000334587" "0000732501" "0000360207" "0000760057" "0000360216" "0000760094" "0000373517" "0000783497" "0000373517" "0000783712" "0000373518" "0000783498" "0000373519" "0000783499" "0000373520" "0000783500" "0000373521" "0000783501" "0000373521" "0000783713" "0000373522" "0000783502" "0000373522" "0000783714" "0000373523" "0000783503" "0000373524" "0000783504" "0000373525" "0000783505" "0000373525" "0000783715" "0000373607" "0000783587" "0000373607" "0000783759" "0000373788" "0000784042" "0000373788" "0000784043" "0000376631" "0000788513" "0000378870" "0000791776" "0000378870" "0000791863" "0000378871" "0000791777" "0000378871" "0000791864" "0000378872" "0000791778" "0000378872" "0000791865" "0000378873" "0000791779" "0000378873" "0000791866" "0000378874" "0000791780" "0000378874" "0000791867" "0000379000" "0000792020" "0000381566" "0000795028" "0000383778" "0000798031" "0000384423" "0000811062" "0000384424" "0000811063" "0000384425" "0000811066" "0000384426" "0000811067" "0000384426" "0000811068" "0000384427" "0000811069" "0000384428" "0000811071" "0000384429" "0000811073" "0000386027" "0000813252" "0000386052" "0000813296" "0000386054" "0000813300" "0000386065" "0000813334" "0000386066" "0000813336" "0000386511" "0000814069" "0000386850" "0000814628" "0000386850" "0000814629" "0000388012" "0000816170" "0000388012" "0000816474" "0000388781" "0000817539" "0000388782" "0000817540" "0000388830" "0000817596" "0000389347" "0000818327" "0000389347" "0000818328" "0000389349" "0000818331" "0000389349" "0000818332" "0000389359" "0000818352" "0000389359" "0000818353" "0000389372" "0000818378" "0000389372" "0000818379" "0000409542" "0000846723" "0000415741" "0000873622" "0000415741" "0000873623" "0000420023" "0000880255" "0000420024" "0000880256" "0000420025" "0000880257" "0000420026" "0000880258" "0000420027" "0000880259" "0000420028" "0000880260" "0000420029" "0000880261" "0000420030" "0000880262" "0000420031" "0000880263" "0000420032" "0000880264" "0000420033" "0000880265" "0000420034" "0000880266" "0000420034" "0000880267" "0000420035" "0000880269" "0000420036" "0000880270" "0000420036" "0000880273" "0000420039" "0000880278" "0000420039" "0000880287" "0000420040" "0000880279" "0000420041" "0000880280" "0000420042" "0000880281" "0000420043" "0000880282" "0000420043" "0000880288" "0000420044" "0000880283" "0000420045" "0000880284" "0000420046" "0000880285" "0000420046" "0000880289" "0000420047" "0000880286" "0000420047" "0000880290" "0000420049" "0000880300" "0000420049" "0000880301" "0000420055" "0000880308" "0000420056" "0000880309" "0000420057" "0000880310" "0000420058" "0000880311" "0000420059" "0000880312" "0000420060" "0000880313" "0000420940" "0000881299" "0000420940" "0000881367" "0000423993" "0000900033" "0000423993" "0000900034" "0000424536" "0000900603" "0000424536" "0000900604" "0000444989" "0000951840" "0000444989" "0000951842" "0000445056" "0000951921" "0000445057" "0000951922" "0000445058" "0000951923" "0000445059" "0000951924" "0000445060" "0000951925" "0000445061" "0000951926" "0000445062" "0000951927" "0000445063" "0000951928" "0000445064" "0000951929" "0000445065" "0000951930" "0000445066" "0000951931" "0000445067" "0000951932" "0000445067" "0000951940" "0000445068" "0000951933" "0000445068" "0000951941" "0000445069" "0000951934" "0000445069" "0000951942" "0000445070" "0000951935" "0000445071" "0000951936" "0000445072" "0000951937" "0000445072" "0000951943" "0000445073" "0000951938" "0000445074" "0000951939" "0000445075" "0000951944" "0000445075" "0000951954" "0000445076" "0000951945" "0000445076" "0000951955" "0000445077" "0000951946" "0000445078" "0000951947" "0000445079" "0000951948" "0000445079" "0000951956" "0000445085" "0000951962" "0000445086" "0000951963" "0000445087" "0000951964" "0000445088" "0000951965" "0000445089" "0000951966" "0000445090" "0000951967" "0000445091" "0000951968" "0000445092" "0000951969" "0000445093" "0000951970" "0000445094" "0000951971" "0000445095" "0000951972" "0000445096" "0000951973" "0000445096" "0000951974" "0000445097" "0000951976" "0000445098" "0000951977" "0000445099" "0000951978" "0000445100" "0000951979" "0000445101" "0000951980" "0000445102" "0000951981" "0000445103" "0000951982" "0000445104" "0000951983" "0000445105" "0000951984" "0000445106" "0000951985" "0000445107" "0000951986" "0000445108" "0000951987" "0000445109" "0000951988" "0000445110" "0000951989" "0000445111" "0000951990" "0000445112" "0000951991" "0000445113" "0000951992" "0000445114" "0000951993" "0000445115" "0000951994" "0000445116" "0000951995" "0000445117" "0000951996" "0000445118" "0000951997" "0000445119" "0000951998" "0000445120" "0000951999" "0000445121" "0000952000" "0000445122" "0000952001" "0000471646" "0001059865" "0000471647" "0000868772"