### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NAGLU) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NAGLU" "N-acetylglucosaminidase, alpha" "17" "q21.2" "unknown" "NG_011552.1" "UD_132118853137" "" "https://www.LOVD.nl/NAGLU" "" "1" "7632" "4669" "609701" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/NAGLU_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-12-01 12:39:48" "00006" "2025-11-20 12:33:25" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00014259" "NAGLU" "N-acetylglucosaminidase, alpha" "001" "NM_000263.3" "" "NP_000254.2" "" "" "" "-340" "2443" "2232" "40687951" "40696467" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01934" "MPS3B" "mucopolysaccharidosis, type IIIB (MPS-3B)" "AR" "252920" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03814" "SPG54" "paraplegia, spastic, type 54, autosomal recessive (SPG-54)" "AR" "615033" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04588" "CMT2V" "Charcot-Marie-Tooth disease?, axonal, type 2V (CMT-2V)" "AD" "616491" "" "" "" "00000" "2015-09-23 10:25:23" "00006" "2021-12-10 21:51:32" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05580" "MPS" "mucopolysaccharidosis (MPS)" "" "" "" "" "" "00006" "2019-03-01 09:43:46" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "NAGLU" "00139" "NAGLU" "01934" "NAGLU" "04588" ## Individuals ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00143198" "" "" "" "1" "" "02335" "" "" "M" "?" "" "" "0" "" "" "" "" "00143764" "" "" "" "1" "" "02335" "" "" "M" "" "" "" "0" "" "" "" "" "00150135" "" "" "" "6" "" "00006" "{PMID:Karaca 2015:26539891}" "" "" "" "" "" "0" "family structure in paper" "" "" "26539891-FamBAB4129" "00150136" "" "" "" "1" "" "00006" "{PMID:Karaca 2015:26539891}" "" "" "" "" "" "0" "family structure in paper" "" "" "26539891-FamBAB4470" "00226371" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Sousse" "Pat1B" "00226372" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Sousse" "Pat2B" "00226373" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Mahdia" "Pat3B" "00269893" "" "" "" "1" "" "01807" "" "" "?" "" "" "" "0" "" "" "" "" "00276321" "" "" "" "2" "" "03568" "" "" "F" "yes" "Turkey" "" "0" "" "" "Turkish" "" "00291710" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291711" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295565" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00331515" "" "" "" "4" "" "00000" "{PMID:Maddirevula 2018:29620724}" "family, 4 affected (F, 3M)" "F;M" "yes" "" "" "0" "" "" "Arab" "08DG00334 , 09DG00558,09DG00559, 15DG0604" "00374561" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "R-0536" "00379502" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Sousse" "" "00379503" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Sousse" "" "00379504" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Mahdia" "" "00403868" "" "" "" "1" "" "00006" "{PMID:Froukh 2020:32056211}" "analysis 103 families with neurodevelopmental disorders" "" "" "Jordan" "" "0" "" "" "" "TF049" "00453026" "" "" "" "2" "" "03566" "{DOI:Paracha 2024:10.3389/fmed.2024.1424753}" "2-generation family, 2 affected sisters, heterozygous carrier parents/relatives" "F" "yes" "Pakistan" "" "0" "" "" "" "Fam3" "00455307" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-1" "00455308" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-2" "00455309" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-3" "00455310" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-4" "00455311" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-5" "00455312" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-6" "00455313" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-7" "00455314" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-8" "00455315" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-9" "00455316" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-10" "00455317" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "NAGLU-11" "00456545" "" "" "" "1" "" "00006" "{PMID:Fang 2022:34813777}" "" "M" "" "China" "" "0" "" "" "" "Pat35" "00456546" "" "" "" "1" "" "00006" "{PMID:Fang 2022:34813777}" "" "F" "" "China" "" "0" "" "" "" "Pat36" "00467632" "" "" "" "1" "" "00006" "{PMID:Elmas 2019:30426380}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Turkey" "" "0" "" "" "" "Pat12" "00469849" "" "" "" "1" "" "00006" "{PMID:Jacob 2025:39706863}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "India" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 35 "{{individualid}}" "{{diseaseid}}" "00143198" "01934" "00143764" "01934" "00150135" "00198" "00150136" "00198" "00226371" "00198" "00226372" "00198" "00226373" "00198" "00269893" "00198" "00276321" "01934" "00276321" "03814" "00291710" "00198" "00291711" "00198" "00295565" "00198" "00331515" "05517" "00374561" "00198" "00379502" "04214" "00379503" "04214" "00379504" "04214" "00403868" "05611" "00453026" "05611" "00455307" "05580" "00455308" "05580" "00455309" "05580" "00455310" "05580" "00455311" "05580" "00455312" "05580" "00455313" "05580" "00455314" "05580" "00455315" "05580" "00455316" "05580" "00455317" "05580" "00456545" "05580" "00456546" "05580" "00467632" "00198" "00469849" "05517" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 01934, 03814, 04214, 04588, 05517, 05580, 05611 ## Count = 33 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000115949" "01934" "00143198" "02335" "Familial, autosomal recessive" "01y11m" "" "" "" "" "" "" "" "" "" "" "" "" "0000116534" "01934" "00143764" "02335" "Familial, autosomal recessive" "04y04m" "diagnosis of MPS IIIB: clinically and biochemically" "" "" "" "" "" "" "" "" "" "" "" "0000122537" "00198" "00150135" "00006" "Familial, autosomal recessive" "" "intellectual diability, coarse face, hepatosplenomegaly" "" "" "" "" "" "" "" "" "" "" "" "0000122538" "00198" "00150136" "00006" "Familial, autosomal recessive" "" "intellectual diability, seizures, CCH(posterior part)" "" "" "" "" "" "" "" "" "" "" "" "0000171483" "00198" "00226371" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "MPC-3B" "intellectual disability" "" "0000171484" "00198" "00226372" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "MPC-3B" "intellectual disability" "" "0000171485" "00198" "00226373" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "MPC-3B" "intellectual disability" "" "0000207689" "00198" "00269893" "01807" "Unknown" "" "Severe global developmental delay (HP:0011344); Microcephaly (HP:0000252); Short stature (HP:0004322); Sleep disturbance (HP:0002360); Developmental regression (HP:0002376); Inability to walk (HP:0002540); Brain atrophy (HP:0012444); Impaired social interactions (HP:0000735)" "" "" "" "" "" "" "" "" "" "" "" "0000210911" "01934" "00276321" "03568" "Familial, autosomal recessive" "02y" "HP:0001250 \r\nHP:0006834 \r\nHP:0031358\r\nHP:0002240\r\nHP:0001263 \r\nHP:0001249 \r\nHP:0000007 \r\nHP:0003676" "00y06m" "" "" "" "" "" "" "" "MPS-3B" "MPS-3B" "" "0000210912" "03814" "00276321" "03568" "Familial, autosomal recessive" "02y" "HP:0001347\r\nHP:0001263\r\nHP:0001258\r\nHP:0001249\r\nHP:0000007\r\nHP:0007340\r\nHP:0003676" "" "" "" "" "" "" "" "" "" "" "" "0000223130" "00198" "00295565" "01164" "Unknown" "" "Epileptiform EEG discharges (HP:0011182); Intellectual disability (HP:0001249); Abnormal facial shape (HP:0001999); Progressive cerebellar ataxia (HP:0002073)" "" "" "" "" "" "" "" "" "" "" "" "0000249707" "05517" "00331515" "00000" "Familial, autosomal recessive" "" "Hepatosplenomegaly, Macroglossia, Gingival overgrowth, Depressed nasal bridge, Low-se Yes" "" "" "" "" "" "" "" "" "Lysosomal Storage Diseases with Skeletal Involvement (dysostosis multiplex group)" "skeletal dysplasia" "" "0000269771" "00198" "00374561" "00006" "Familial, autosomal recessive" "" "recurrent seizures, lethargy, choreic movements and regression in milestones" "" "" "" "" "" "" "" "" "" "leukodystrophy" "" "0000273375" "04214" "00379502" "00000" "Unknown" "1y6m" "Mitral insufficiency" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273376" "04214" "00379503" "00000" "Unknown" "1y" "Supra ventricular tachycardia" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273377" "04214" "00379504" "00000" "Unknown" "9y" "" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000296548" "05611" "00403868" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000341671" "05611" "00453026" "03566" "Familial, autosomal recessive" "" "severe phenotype, progressive neurological deterioration, developmental delays (speech delay > motor delay), mild hearing loss, severe intellectual disability, coarse facial features" "" "" "" "" "" "" "" "" "MPS3B" "neurodevelopmental disorder" "" "0000343887" "05580" "00455307" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343888" "05580" "00455308" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343889" "05580" "00455309" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343890" "05580" "00455310" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343891" "05580" "00455311" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343892" "05580" "00455312" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343893" "05580" "00455313" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343894" "05580" "00455314" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343895" "05580" "00455315" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343896" "05580" "00455316" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000343897" "05580" "00455317" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000345053" "05580" "00456545" "00006" "Familial, X-linked recessive" "" "attenuated" "4y" "6y" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000345054" "05580" "00456546" "00006" "Familial, X-linked recessive" "" "severe" "3y" "3y" "" "" "" "" "" "" "MPS3B" "mucopolysaccharidosis" "" "0000352844" "00198" "00467632" "00006" "Familial, autosomal recessive" "9y2m" "see paper; ..., storage diseases; speech disability, developmental delay, hepatomegaly, mild learning disability, ptosis left eye, otitis media with effusion; MRI thin corpus callosum, mucosal thickening at the paranasal sinuses, hyperintense cells in left mastoid cells; no cardiac anomalies" "2m" "" "" "" "" "" "" "" "MPS3B" "" "" "0000354994" "05517" "00469849" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3B" "skeletal dysplasia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000144055" "00143198" "1" "02335" "02335" "2017-11-30 11:52:00" "" "" "SEQ" "DNA" "blood" "" "0000144622" "00143764" "1" "02335" "02335" "2017-12-05 10:52:55" "" "" "SEQ" "DNA" "blood" "" "0000150990" "00150135" "1" "00006" "00006" "2018-01-13 12:41:38" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000150991" "00150136" "1" "00006" "00006" "2018-01-13 12:41:38" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000227459" "00226371" "1" "00006" "00006" "2019-03-08 21:24:18" "" "" "SEQ" "DNA" "" "" "0000227460" "00226372" "1" "00006" "00006" "2019-03-08 21:24:18" "" "" "SEQ" "DNA" "" "" "0000227461" "00226373" "1" "00006" "00006" "2019-03-08 21:24:18" "" "" "SEQ" "DNA" "" "" "0000271046" "00269893" "1" "01807" "01807" "2019-12-10 12:31:55" "" "" "SEQ" "DNA" "" "" "0000277468" "00276321" "1" "03568" "03568" "2020-01-30 14:18:48" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000292878" "00291710" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292879" "00291711" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296735" "00295565" "1" "01164" "01164" "2020-03-18 10:48:21" "" "" "SEQ-NG-S" "DNA" "" "" "0000332734" "00331515" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000375755" "00374561" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000380702" "00379502" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380703" "00379503" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380704" "00379504" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000405106" "00403868" "1" "00006" "00006" "2022-02-24 16:43:58" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000454637" "00453026" "1" "03566" "00006" "2024-08-15 18:41:07" "" "" "SEQ-NG;SEQ" "DNA" "" "WES" "0000456921" "00455307" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456922" "00455308" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456923" "00455309" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456924" "00455310" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456925" "00455311" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456926" "00455312" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456927" "00455313" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456928" "00455314" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456929" "00455315" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456930" "00455316" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456931" "00455317" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000458162" "00456545" "1" "00006" "00006" "2024-10-28 14:01:06" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000458163" "00456546" "1" "00006" "00006" "2024-10-28 14:01:06" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000469297" "00467632" "1" "00006" "00006" "2025-10-24 22:46:25" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000471517" "00469849" "1" "00006" "00006" "2025-11-20 12:33:13" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 25 "{{screeningid}}" "{{geneid}}" "0000144055" "NAGLU" "0000144622" "NAGLU" "0000150990" "NAGLU" "0000150991" "NAGLU" "0000227459" "NAGLU" "0000227460" "NAGLU" "0000227461" "NAGLU" "0000332734" "NAGLU" "0000375755" "ROGDI" "0000380702" "NAGLU" "0000380703" "NAGLU" "0000380704" "NAGLU" "0000456921" "NAGLU" "0000456922" "NAGLU" "0000456923" "NAGLU" "0000456924" "NAGLU" "0000456925" "NAGLU" "0000456926" "NAGLU" "0000456927" "NAGLU" "0000456928" "NAGLU" "0000456929" "NAGLU" "0000456930" "NAGLU" "0000456931" "NAGLU" "0000458162" "NAGLU" "0000458163" "NAGLU" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 202 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000234493" "3" "70" "17" "40688390" "40688390" "subst" "0" "02335" "NAGLU_000002" "g.40688390G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.42536372G>C" "" "likely pathogenic" "" "0000234494" "3" "50" "17" "40688304" "40688304" "subst" "0" "02335" "NAGLU_000001" "g.40688304C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.42536286C>T" "" "VUS" "" "0000235426" "3" "70" "17" "40690709" "40690709" "subst" "0" "02335" "NAGLU_000003" "g.40690709C>G" "" "" "" "" "another variant affecting amino acid R234 is already published as pathogenic: c.700C>T, p.(R234C)" "Germline" "" "" "0" "" "" "g.42538691C>G" "" "likely pathogenic" "" "0000244146" "3" "90" "17" "40690709" "40690709" "subst" "0" "00006" "NAGLU_000003" "g.40690709C>G" "" "{PMID:Karaca 2015:26539891}" "" "NM_000263: c.C700G; p.R234G" "" "Germline" "" "" "0" "" "" "g.42538691C>G" "" "pathogenic" "" "0000244147" "3" "90" "17" "40696045" "40696045" "subst" "1.66608E-5" "00006" "NAGLU_000004" "g.40696045G>A" "" "{PMID:Karaca 2015:26539891}" "" "NM_000263: c.G2021A; p.R674H" "" "Germline" "" "" "0" "" "" "g.42544027G>A" "" "pathogenic" "" "0000255352" "0" "70" "17" "40690752" "40690752" "subst" "4.08007E-6" "01943" "NAGLU_000022" "g.40690752A>G" "" "" "" "NAGLU(NM_000263.3):c.743A>G (p.H248R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42538734A>G" "" "likely pathogenic" "" "0000255647" "0" "90" "17" "40689451" "40689451" "subst" "3.24865E-5" "01943" "NAGLU_000016" "g.40689451A>G" "" "" "" "NAGLU(NM_000263.3):c.419A>G (p.Y140C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537433A>G" "" "pathogenic" "" "0000292978" "0" "10" "17" "40695470" "40695470" "subst" "0.000954987" "02330" "NAGLU_000028" "g.40695470G>A" "" "" "" "NAGLU(NM_000263.3):c.1446G>A (p.R482=), NAGLU(NM_000263.4):c.1446G>A (p.R482=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543452G>A" "" "benign" "" "0000292979" "0" "30" "17" "40695812" "40695812" "subst" "0.00557723" "02330" "NAGLU_000036" "g.40695812C>T" "" "" "" "NAGLU(NM_000263.4):c.1788C>T (p.G596=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543794C>T" "" "likely benign" "" "0000292980" "0" "10" "17" "40695884" "40695884" "subst" "0.00164843" "02330" "NAGLU_000037" "g.40695884C>T" "" "" "" "NAGLU(NM_000263.4):c.1860C>T (p.S620=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543866C>T" "" "benign" "" "0000292982" "0" "30" "17" "40696233" "40696233" "subst" "0.018537" "02330" "NAGLU_000041" "g.40696233C>A" "" "" "" "NAGLU(NM_000263.3):c.2209C>A (p.(Arg737Ser)), NAGLU(NM_000263.4):c.2209C>A (p.R737S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544215C>A" "" "likely benign" "" "0000292983" "0" "10" "17" "40696233" "40696233" "subst" "0.910882" "02330" "NAGLU_000042" "g.40696233C>G" "" "" "" "NAGLU(NM_000263.4):c.2209C>G (p.R737G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544215C>G" "" "benign" "" "0000292984" "0" "50" "17" "40688643" "40688643" "subst" "0" "02330" "NAGLU_000014" "g.40688643C>T" "" "" "" "NAGLU(NM_000263.4):c.353C>T (p.P118L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536625C>T" "" "VUS" "" "0000292985" "0" "10" "17" "40689455" "40689455" "subst" "0.994518" "02330" "NAGLU_000017" "g.40689455T>C" "" "" "" "NAGLU(NM_000263.3):c.423T>C (p.S141=), NAGLU(NM_000263.4):c.423T>C (p.S141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537437T>C" "" "benign" "" "0000296299" "0" "30" "17" "40695539" "40695539" "subst" "0.00212825" "02325" "NAGLU_000030" "g.40695539C>T" "" "" "" "NAGLU(NM_000263.3):c.1515C>T (p.S505=), NAGLU(NM_000263.4):c.1515C>T (p.S505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543521C>T" "" "likely benign" "" "0000296300" "0" "90" "17" "40695582" "40695582" "subst" "4.17167E-6" "02325" "NAGLU_000031" "g.40695582C>T" "" "" "" "NAGLU(NM_000263.4):c.1558C>T (p.R520W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543564C>T" "" "pathogenic" "" "0000296301" "0" "90" "17" "40696045" "40696045" "subst" "1.66608E-5" "02325" "NAGLU_000004" "g.40696045G>A" "" "" "" "NAGLU(NM_000263.3):c.2021G>A (p.R674H), NAGLU(NM_000263.4):c.2021G>A (p.R674H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544027G>A" "" "pathogenic" "" "0000296302" "0" "10" "17" "40696233" "40696233" "subst" "0.018537" "02325" "NAGLU_000041" "g.40696233C>A" "" "" "" "NAGLU(NM_000263.3):c.2209C>A (p.(Arg737Ser)), NAGLU(NM_000263.4):c.2209C>A (p.R737S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544215C>A" "" "benign" "" "0000296303" "0" "10" "17" "40696233" "40696233" "subst" "0.910882" "02325" "NAGLU_000042" "g.40696233C>G" "" "" "" "NAGLU(NM_000263.4):c.2209C>G (p.R737G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544215C>G" "" "benign" "" "0000296304" "0" "90" "17" "40688535" "40688535" "subst" "0" "02325" "NAGLU_000009" "g.40688535G>A" "" "" "" "NAGLU(NM_000263.4):c.245G>A (p.G82D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536517G>A" "" "pathogenic" "" "0000296305" "0" "10" "17" "40689455" "40689455" "subst" "0.994518" "02325" "NAGLU_000017" "g.40689455T>C" "" "" "" "NAGLU(NM_000263.3):c.423T>C (p.S141=), NAGLU(NM_000263.4):c.423T>C (p.S141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537437T>C" "" "benign" "" "0000296306" "0" "90" "17" "40689535" "40689535" "subst" "0" "02325" "NAGLU_000018" "g.40689535G>A" "" "" "" "NAGLU(NM_000263.4):c.503G>A (p.W168*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537517G>A" "" "pathogenic" "" "0000296307" "0" "90" "17" "40693092" "40693092" "subst" "5.27884E-5" "02325" "NAGLU_000024" "g.40693092C>T" "" "" "" "NAGLU(NM_000263.3):c.889C>T (p.R297*, p.(Arg297*)), NAGLU(NM_000263.4):c.889C>T (p.R297*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42541074C>T" "" "pathogenic" "" "0000302845" "0" "90" "17" "40695235" "40695235" "subst" "0" "01943" "NAGLU_000026" "g.40695235G>A" "" "" "" "NAGLU(NM_000263.3):c.1211G>A (p.W404*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543217G>A" "" "pathogenic" "" "0000302846" "0" "90" "17" "40695468" "40695468" "subst" "0" "01943" "NAGLU_000027" "g.40695468C>T" "" "" "" "NAGLU(NM_000263.3):c.1444C>T (p.R482W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543450C>T" "" "pathogenic" "" "0000302847" "0" "30" "17" "40695470" "40695470" "subst" "0.000954987" "01943" "NAGLU_000028" "g.40695470G>A" "" "" "" "NAGLU(NM_000263.3):c.1446G>A (p.R482=), NAGLU(NM_000263.4):c.1446G>A (p.R482=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543452G>A" "" "likely benign" "" "0000302848" "0" "30" "17" "40695476" "40695476" "subst" "0.000114368" "01943" "NAGLU_000029" "g.40695476G>A" "" "" "" "NAGLU(NM_000263.3):c.1452G>A (p.G484=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543458G>A" "" "likely benign" "" "0000302849" "0" "30" "17" "40695539" "40695539" "subst" "0.00212825" "01943" "NAGLU_000030" "g.40695539C>T" "" "" "" "NAGLU(NM_000263.3):c.1515C>T (p.S505=), NAGLU(NM_000263.4):c.1515C>T (p.S505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543521C>T" "" "likely benign" "" "0000302850" "0" "90" "17" "40695586" "40695586" "subst" "2.49211E-5" "01943" "NAGLU_000032" "g.40695586C>T" "" "" "" "NAGLU(NM_000263.3):c.1562C>T (p.P521L), NAGLU(NM_000263.4):c.1562C>T (p.P521L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543568C>T" "" "pathogenic" "" "0000302851" "0" "90" "17" "40695706" "40695706" "subst" "0" "01943" "NAGLU_000033" "g.40695706T>G" "" "" "" "NAGLU(NM_000263.3):c.1682T>G (p.L561R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543688T>G" "" "pathogenic" "" "0000302852" "0" "90" "17" "40695717" "40695717" "subst" "2.87043E-5" "01943" "NAGLU_000034" "g.40695717C>T" "" "" "" "NAGLU(NM_000263.3):c.1693C>T (p.R565W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543699C>T" "" "pathogenic" "" "0000302853" "0" "90" "17" "40695718" "40695718" "subst" "4.5109E-5" "01943" "NAGLU_000035" "g.40695718G>A" "" "" "" "NAGLU(NM_000263.3):c.1694G>A (p.R565Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543700G>A" "" "pathogenic" "" "0000302854" "0" "50" "17" "40688477" "40688477" "subst" "0" "01943" "NAGLU_000005" "g.40688477G>A" "" "" "" "NAGLU(NM_000263.3):c.187G>A (p.D63N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536459G>A" "" "VUS" "" "0000302855" "0" "90" "17" "40695924" "40695924" "subst" "0" "01943" "NAGLU_000038" "g.40695924G>A" "" "" "" "NAGLU(NM_000263.3):c.1900G>A (p.E634K, p.(Glu634Lys)), NAGLU(NM_000263.4):c.1900G>A (p.E634K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543906G>A" "" "pathogenic" "" "0000302856" "0" "90" "17" "40695951" "40695951" "subst" "0" "01943" "NAGLU_000039" "g.40695951C>T" "" "" "" "NAGLU(NM_000263.3):c.1927C>T (p.R643C), NAGLU(NM_000263.4):c.1927C>T (p.(Arg643Cys), p.R643C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543933C>T" "" "pathogenic" "" "0000302857" "0" "90" "17" "40696045" "40696045" "subst" "1.66608E-5" "01943" "NAGLU_000004" "g.40696045G>A" "" "" "" "NAGLU(NM_000263.3):c.2021G>A (p.R674H), NAGLU(NM_000263.4):c.2021G>A (p.R674H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544027G>A" "" "pathogenic" "" "0000302858" "0" "90" "17" "40696051" "40696051" "subst" "0" "01943" "NAGLU_000040" "g.40696051G>C" "" "" "" "NAGLU(NM_000263.3):c.2027G>C (p.R676P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42544033G>C" "" "pathogenic" "" "0000302862" "0" "70" "17" "40688571" "40688573" "delins" "0" "01943" "NAGLU_000011" "g.40688571_40688573delinsCCC" "" "" "" "NAGLU(NM_000263.3):c.281_283delGCGinsCCC (p.R94_D95delinsPH)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536553_42536555delinsCCC" "" "likely pathogenic" "" "0000302863" "0" "50" "17" "40688571" "40688571" "subst" "0" "01943" "NAGLU_000010" "g.40688571G>C" "" "" "" "NAGLU(NM_000263.3):c.281G>C (p.R94P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536553G>C" "" "VUS" "" "0000302864" "0" "50" "17" "40688573" "40688573" "subst" "0" "01943" "NAGLU_000012" "g.40688573G>C" "" "" "" "NAGLU(NM_000263.3):c.283G>C (p.D95H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536555G>C" "" "VUS" "" "0000302865" "0" "10" "17" "40689455" "40689455" "subst" "0.994518" "01943" "NAGLU_000017" "g.40689455T>C" "" "" "" "NAGLU(NM_000263.3):c.423T>C (p.S141=), NAGLU(NM_000263.4):c.423T>C (p.S141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537437T>C" "" "benign" "" "0000302866" "0" "50" "17" "40689541" "40689541" "subst" "0" "01943" "NAGLU_000019" "g.40689541G>A" "" "" "" "NAGLU(NM_000263.3):c.509G>A (p.G170D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42537523G>A" "" "VUS" "" "0000302867" "0" "90" "17" "40690432" "40690432" "subst" "4.06204E-6" "01943" "NAGLU_000020" "g.40690432C>T" "" "" "" "NAGLU(NM_000263.3):c.607C>T (p.R203*, p.(Arg203*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42538414C>T" "" "pathogenic" "" "0000302868" "0" "10" "17" "40690792" "40690792" "subst" "0.0150193" "01943" "NAGLU_000023" "g.40690792C>G" "" "" "" "NAGLU(NM_000263.3):c.764+19C>G, NAGLU(NM_000263.4):c.764+19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42538774C>G" "" "benign" "" "0000302869" "0" "90" "17" "40693092" "40693092" "subst" "5.27884E-5" "01943" "NAGLU_000024" "g.40693092C>T" "" "" "" "NAGLU(NM_000263.3):c.889C>T (p.R297*, p.(Arg297*)), NAGLU(NM_000263.4):c.889C>T (p.R297*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42541074C>T" "" "pathogenic" "" "0000325409" "0" "50" "17" "40688582" "40688582" "subst" "0" "01804" "NAGLU_000013" "g.40688582G>A" "" "" "" "NAGLU(NM_000263.3):c.292G>A (p.(Gly98Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536564G>A" "" "VUS" "" "0000325410" "0" "30" "17" "40688680" "40688680" "subst" "6.47473E-5" "01804" "NAGLU_000015" "g.40688680C>T" "" "" "" "NAGLU(NM_000263.3):c.383+7C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42536662C>T" "" "likely benign" "" "0000325411" "0" "50" "17" "40690506" "40690506" "subst" "0" "01804" "NAGLU_000021" "g.40690506A>G" "" "" "" "NAGLU(NM_000263.3):c.678+3A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42538488A>G" "" "VUS" "" "0000325413" "0" "50" "17" "40695924" "40695924" "subst" "0" "01804" "NAGLU_000038" "g.40695924G>A" "" "" "" "NAGLU(NM_000263.3):c.1900G>A (p.E634K, p.(Glu634Lys)), NAGLU(NM_000263.4):c.1900G>A (p.E634K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543906G>A" "" "VUS" "" "0000343114" "0" "50" "17" "40695717" "40695717" "subst" "2.87043E-5" "02327" "NAGLU_000034" "g.40695717C>T" "" "" "" "NAGLU(NM_000263.3):c.1693C>T (p.R565W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543699C>T" "" "VUS" "" "0000349119" "0" "70" "17" "40695858" "40695858" "subst" "5.57564E-5" "02327" "NAGLU_000044" "g.40695858A>G" "" "" "" "NAGLU(NM_000263.4):c.1834A>G (p.S612G, p.(Ser612Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.42543840A>G" "" "likely pathogenic" "" "0000467295" "3" "90" "17" "40695698" "40695698" "subst" "0" "00006" "NAGLU_000045" "g.40695698C>G" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.42543680C>G" "" "pathogenic (recessive)" "" "0000467296" "3" "90" "17" "40695835" "40695835" "subst" "0" "00006" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.42543817C>T" "" "pathogenic (recessive)" "" "0000467297" "3" "90" "17" "40695835" "40695835" "subst" "0" "00006" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.42543817C>T" "" "pathogenic (recessive)" "" "0000561490" "0" "30" "17" "40688460" "40688460" "subst" "0" "02330" "NAGLU_000047" "g.40688460C>G" "" "" "" "NAGLU(NM_000263.3):c.170C>G (p.(Ala57Gly)), NAGLU(NM_000263.4):c.170C>G (p.A57G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42536442C>G" "" "likely benign" "" "0000561491" "0" "90" "17" "40688504" "40688527" "dup" "0" "01943" "NAGLU_000048" "g.40688504_40688527dup" "" "" "" "NAGLU(NM_000263.3):c.214_237dupGCGGCGCGCGTGCGGGTGCGCGGC (p.A72_G79dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42536486_42536509dup" "" "pathogenic" "" "0000561493" "0" "90" "17" "40688507" "40688511" "dup" "0" "01943" "NAGLU_000049" "g.40688507_40688511dup" "" "" "" "NAGLU(NM_000263.3):c.217_221dupGCGCG (p.V75Rfs*49), NAGLU(NM_000263.4):c.217_221dupGCGCG (p.V75Rfs*49)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42536489_42536493dup" "" "pathogenic" "" "0000561494" "0" "10" "17" "40689453" "40689453" "subst" "0.00486896" "01804" "NAGLU_000050" "g.40689453T>A" "" "" "" "NAGLU(NM_000263.3):c.421T>A (p.(Ser141Thr)), NAGLU(NM_000263.4):c.421T>A (p.S141T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42537435T>A" "" "benign" "" "0000561495" "0" "70" "17" "40689564" "40689564" "subst" "4.07491E-6" "01943" "NAGLU_000051" "g.40689564G>C" "" "" "" "NAGLU(NM_000263.3):c.531+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42537546G>C" "" "likely pathogenic" "" "0000561497" "0" "50" "17" "40690424" "40690424" "subst" "0" "01804" "NAGLU_000053" "g.40690424C>T" "" "" "" "NAGLU(NM_000263.3):c.599C>T (p.(Ala200Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538406C>T" "" "VUS" "" "0000561498" "0" "10" "17" "40690431" "40690431" "subst" "8.12348E-6" "02330" "NAGLU_000054" "g.40690431G>A" "" "" "" "NAGLU(NM_000263.4):c.606G>A (p.G202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538413G>A" "" "benign" "" "0000561499" "0" "10" "17" "40690500" "40690500" "subst" "0.000958394" "02330" "NAGLU_000055" "g.40690500G>T" "" "" "" "NAGLU(NM_000263.4):c.675G>T (p.L225=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538482G>T" "" "benign" "" "0000561500" "0" "50" "17" "40690745" "40690745" "subst" "0" "02330" "NAGLU_000056" "g.40690745G>C" "" "" "" "NAGLU(NM_000263.3):c.736G>C (p.(Ala246Pro)), NAGLU(NM_000263.4):c.736G>C (p.A246P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538727G>C" "" "VUS" "" "0000561501" "0" "10" "17" "40690792" "40690792" "subst" "0.0150193" "02330" "NAGLU_000023" "g.40690792C>G" "" "" "" "NAGLU(NM_000263.3):c.764+19C>G, NAGLU(NM_000263.4):c.764+19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538774C>G" "" "benign" "" "0000561502" "0" "30" "17" "40693239" "40693239" "subst" "0.000533903" "02330" "NAGLU_000057" "g.40693239T>C" "" "" "" "NAGLU(NM_000263.4):c.1021+15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42541221T>C" "" "likely benign" "" "0000561503" "0" "10" "17" "40695296" "40695296" "subst" "0.000142457" "02330" "NAGLU_000058" "g.40695296C>T" "" "" "" "NAGLU(NM_000263.4):c.1272C>T (p.N424=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543278C>T" "" "benign" "" "0000561504" "0" "90" "17" "40695378" "40695378" "subst" "1.23822E-5" "01943" "NAGLU_000059" "g.40695378G>A" "" "" "" "NAGLU(NM_000263.3):c.1354G>A (p.E452K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543360G>A" "" "pathogenic" "" "0000561505" "0" "50" "17" "40695421" "40695421" "subst" "0" "01943" "NAGLU_000060" "g.40695421A>C" "" "" "" "NAGLU(NM_000263.3):c.1397A>C (p.D466A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543403A>C" "" "VUS" "" "0000561506" "0" "50" "17" "40695459" "40695459" "subst" "0.000111834" "02330" "NAGLU_000061" "g.40695459G>A" "" "" "" "NAGLU(NM_000263.4):c.1435G>A (p.A479T, p.(Ala479Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543441G>A" "" "VUS" "" "0000561507" "0" "30" "17" "40695462" "40695462" "subst" "0.000744456" "02330" "NAGLU_000062" "g.40695462G>A" "" "" "" "NAGLU(NM_000263.3):c.1438G>A (p.(Ala480Thr)), NAGLU(NM_000263.4):c.1438G>A (p.A480T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543444G>A" "" "likely benign" "" "0000561508" "0" "70" "17" "40695513" "40695513" "subst" "4.4276E-6" "01943" "NAGLU_000063" "g.40695513C>G" "" "" "" "NAGLU(NM_000263.3):c.1489C>G (p.L497V), NAGLU(NM_000263.4):c.1489C>G (p.L497V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543495C>G" "" "likely pathogenic" "" "0000561509" "0" "30" "17" "40695539" "40695539" "subst" "0.00212825" "02330" "NAGLU_000030" "g.40695539C>T" "" "" "" "NAGLU(NM_000263.3):c.1515C>T (p.S505=), NAGLU(NM_000263.4):c.1515C>T (p.S505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543521C>T" "" "likely benign" "" "0000561510" "0" "50" "17" "40695858" "40695858" "subst" "5.57564E-5" "02330" "NAGLU_000044" "g.40695858A>G" "" "" "" "NAGLU(NM_000263.4):c.1834A>G (p.S612G, p.(Ser612Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543840A>G" "" "VUS" "" "0000561511" "0" "30" "17" "40696007" "40696007" "subst" "0.000688757" "02330" "NAGLU_000064" "g.40696007G>A" "" "" "" "NAGLU(NM_000263.4):c.1983G>A (p.K661=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543989G>A" "" "likely benign" "" "0000561513" "0" "30" "17" "40696233" "40696233" "subst" "0.018537" "01804" "NAGLU_000041" "g.40696233C>A" "" "" "" "NAGLU(NM_000263.3):c.2209C>A (p.(Arg737Ser)), NAGLU(NM_000263.4):c.2209C>A (p.R737S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42544215C>A" "" "likely benign" "" "0000616551" "0" "50" "17" "40690745" "40690745" "subst" "0" "01804" "NAGLU_000056" "g.40690745G>C" "" "" "" "NAGLU(NM_000263.3):c.736G>C (p.(Ala246Pro)), NAGLU(NM_000263.4):c.736G>C (p.A246P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538727G>C" "" "VUS" "" "0000616552" "0" "30" "17" "40693076" "40693076" "subst" "4.06062E-6" "02330" "NAGLU_000067" "g.40693076C>T" "" "" "" "NAGLU(NM_000263.4):c.873C>T (p.I291=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42541058C>T" "" "likely benign" "" "0000616553" "0" "30" "17" "40693136" "40693136" "subst" "0.00107233" "02330" "NAGLU_000068" "g.40693136C>G" "" "" "" "NAGLU(NM_000263.3):c.933C>G (p.A311=), NAGLU(NM_000263.4):c.933C>G (p.A311=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42541118C>G" "" "likely benign" "" "0000616554" "0" "50" "17" "40695346" "40695346" "subst" "0.000204053" "01943" "NAGLU_000069" "g.40695346C>T" "" "" "" "NAGLU(NM_000263.3):c.1322C>T (p.T441M), NAGLU(NM_000263.4):c.1322C>T (p.T441M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543328C>T" "" "VUS" "" "0000623675" "0" "10" "17" "40689453" "40689453" "subst" "0.00486896" "02330" "NAGLU_000050" "g.40689453T>A" "" "" "" "NAGLU(NM_000263.3):c.421T>A (p.(Ser141Thr)), NAGLU(NM_000263.4):c.421T>A (p.S141T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42537435T>A" "" "benign" "" "0000623676" "0" "50" "17" "40690456" "40690456" "subst" "0.000146272" "02325" "NAGLU_000066" "g.40690456G>A" "" "" "" "NAGLU(NM_000263.4):c.631G>A (p.D211N, p.(Asp211Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42538438G>A" "" "VUS" "" "0000624894" "3" "90" "17" "40688402" "40688402" "subst" "0" "01807" "NAGLU_000070" "g.40688402C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.42536384C>T" "" "pathogenic" "" "0000632321" "3" "90" "17" "40689541" "40689541" "subst" "0" "03568" "NAGLU_000071" "g.40689541G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.42537523G>T" "" "likely pathogenic" "" "0000649567" "1" "50" "17" "40695586" "40695586" "subst" "2.49211E-5" "03575" "NAGLU_000032" "g.40695586C>T" "3/2763 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs104894595}" "Germline" "" "rs104894595" "0" "" "" "g.42543568C>T" "" "VUS" "" "0000649568" "1" "90" "17" "40695717" "40695717" "subst" "2.87043E-5" "03575" "NAGLU_000034" "g.40695717C>T" "1/2789 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs104894597}" "Germline" "" "rs104894597" "0" "" "" "g.42543699C>T" "" "pathogenic" "" "0000653433" "0" "90" "17" "40693092" "40693092" "subst" "5.27884E-5" "01164" "NAGLU_000024" "g.40693092C>T" "" "" "" "" "de Ruijter et al. 2012. Mol Genet Metab 107: 705; Meijer et al. 2017. Mol Genet Metab 122: 100; Pollard et al. 2013. J Inherit Metab Dis 36: 179" "Germline" "" "rs104894592" "0" "" "" "g.42541074C>T" "" "pathogenic" "ACMG" "0000653434" "0" "70" "17" "40695835" "40695835" "subst" "0" "01164" "NAGLU_000046" "g.40695835C>T" "" "" "" "" "ACMG: PM2,PM3,PP1,PP3; Ouesleti et al. 2011. Clin Chim Acta 412: 2326; Romdhane et al. 2012. Orphanet J Rare Dis 7: 52" "Germline" "" "rs751203469" "0" "" "" "g.42543817C>T" "" "likely pathogenic" "ACMG" "0000658115" "0" "50" "17" "40688460" "40688460" "subst" "0" "02325" "NAGLU_000047" "g.40688460C>G" "" "" "" "NAGLU(NM_000263.3):c.170C>G (p.(Ala57Gly)), NAGLU(NM_000263.4):c.170C>G (p.A57G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42536442C>G" "" "VUS" "" "0000658116" "0" "30" "17" "40695491" "40695491" "subst" "0.000176031" "02330" "NAGLU_000072" "g.40695491C>T" "" "" "" "NAGLU(NM_000263.4):c.1467C>T (p.D489=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543473C>T" "" "likely benign" "" "0000658117" "0" "70" "17" "40695513" "40695513" "subst" "4.4276E-6" "02327" "NAGLU_000063" "g.40695513C>G" "" "" "" "NAGLU(NM_000263.3):c.1489C>G (p.L497V), NAGLU(NM_000263.4):c.1489C>G (p.L497V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543495C>G" "" "likely pathogenic" "" "0000658118" "0" "90" "17" "40695951" "40695951" "subst" "0" "02329" "NAGLU_000039" "g.40695951C>T" "" "" "" "NAGLU(NM_000263.3):c.1927C>T (p.R643C), NAGLU(NM_000263.4):c.1927C>T (p.(Arg643Cys), p.R643C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543933C>T" "" "pathogenic" "" "0000658119" "0" "70" "17" "40695951" "40695951" "subst" "0" "02327" "NAGLU_000039" "g.40695951C>T" "" "" "" "NAGLU(NM_000263.3):c.1927C>T (p.R643C), NAGLU(NM_000263.4):c.1927C>T (p.(Arg643Cys), p.R643C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.42543933C>T" "" "likely pathogenic" "" "0000680860" "0" "30" "17" "40689542" "40689542" "subst" "0.000154505" "02327" "NAGLU_000073" "g.40689542C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680861" "0" "30" "17" "40693136" "40693136" "subst" "0.00107233" "01943" "NAGLU_000068" "g.40693136C>G" "" "" "" "NAGLU(NM_000263.3):c.933C>G (p.A311=), NAGLU(NM_000263.4):c.933C>G (p.A311=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680862" "0" "50" "17" "40695246" "40695246" "subst" "8.12434E-6" "02325" "NAGLU_000074" "g.40695246C>T" "" "" "" "NAGLU(NM_000263.4):c.1222C>T (p.H408Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000680863" "0" "50" "17" "40695253" "40695253" "subst" "2.03122E-5" "01943" "NAGLU_000075" "g.40695253T>C" "" "" "" "NAGLU(NM_000263.3):c.1229T>C (p.F410S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000680864" "0" "30" "17" "40695884" "40695884" "subst" "0.00164843" "02326" "NAGLU_000037" "g.40695884C>T" "" "" "" "NAGLU(NM_000263.4):c.1860C>T (p.S620=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726360" "0" "90" "17" "40688507" "40688511" "dup" "0" "02329" "NAGLU_000049" "g.40688507_40688511dup" "" "" "" "NAGLU(NM_000263.3):c.217_221dupGCGCG (p.V75Rfs*49), NAGLU(NM_000263.4):c.217_221dupGCGCG (p.V75Rfs*49)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726361" "0" "90" "17" "40689558" "40689558" "subst" "0" "01943" "NAGLU_000076" "g.40689558C>T" "" "" "" "NAGLU(NM_000263.3):c.526C>T (p.Q176*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726362" "0" "50" "17" "40693051" "40693051" "subst" "4.06072E-6" "01943" "NAGLU_000077" "g.40693051C>T" "" "" "" "NAGLU(NM_000263.3):c.848C>T (p.P283L, p.(Pro283Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726363" "0" "50" "17" "40695295" "40695295" "subst" "0" "01943" "NAGLU_000078" "g.40695295A>G" "" "" "" "NAGLU(NM_000263.3):c.1271A>G (p.N424S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726364" "0" "30" "17" "40695929" "40695929" "subst" "4.41275E-5" "02330" "NAGLU_000079" "g.40695929C>T" "" "" "" "NAGLU(NM_000263.3):c.1905C>T (p.A635=), NAGLU(NM_000263.4):c.1905C>T (p.A635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726365" "0" "50" "17" "40695952" "40695952" "subst" "0" "01943" "NAGLU_000080" "g.40695952G>A" "" "" "" "NAGLU(NM_000263.3):c.1928G>A (p.R643H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726366" "0" "30" "17" "40696181" "40696181" "subst" "0.000622655" "01943" "NAGLU_000081" "g.40696181G>A" "" "" "" "NAGLU(NM_000263.3):c.2157G>A (p.P719=), NAGLU(NM_000263.4):c.2157G>A (p.P719=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726367" "0" "30" "17" "40696244" "40696244" "subst" "1.24534E-5" "02330" "NAGLU_000082" "g.40696244C>T" "" "" "" "NAGLU(NM_000263.4):c.2220C>T (p.A740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000730016" "3" "90" "17" "40693092" "40693092" "subst" "5.27884E-5" "00000" "NAGLU_000024" "g.40693092C>T" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_000263.3:c.889C>T:p.(Arg297*)" "" "Germline" "" "" "0" "" "" "g.42541074C>T" "" "pathogenic (recessive)" "" "0000787537" "3" "50" "17" "40695148" "40695148" "subst" "2.44525E-5" "00000" "NAGLU_000083" "g.40695148G>A" "" "0" "" "" "" "Germline" "" "rs768600049" "0" "" "" "g.42543130G>A" "" "VUS" "" "0000793861" "3" "90" "17" "40695698" "40695698" "subst" "0" "00000" "NAGLU_000045" "g.40695698C>G" "" "{PMID:Ousleti-2011:21910976}" "" "c.1674C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793862" "3" "90" "17" "40695698" "40695698" "subst" "0" "00000" "NAGLU_000045" "g.40695698C>G" "" "{PMID:Ousleti-2011:21910976}" "" "c.1674C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793863" "3" "90" "17" "40695835" "40695835" "subst" "0" "00000" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ousleti-2011:21910976}" "" "c.1811C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793864" "3" "90" "17" "40695835" "40695835" "subst" "0" "00000" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ousleti-2011:21910976}" "" "c.1811C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793865" "3" "90" "17" "40695835" "40695835" "subst" "0" "00000" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ousleti-2011:21910976}" "" "c.1811C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793866" "3" "90" "17" "40695835" "40695835" "subst" "0" "00000" "NAGLU_000046" "g.40695835C>T" "" "{PMID:Ousleti-2011:21910976}" "" "c.1811C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000807963" "0" "30" "17" "40688384" "40688384" "subst" "0" "01804" "NAGLU_000084" "g.40688384G>T" "" "" "" "NAGLU(NM_000263.3):c.94G>T (p.(Val32Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807964" "0" "30" "17" "40695929" "40695929" "subst" "4.41275E-5" "01943" "NAGLU_000079" "g.40695929C>T" "" "" "" "NAGLU(NM_000263.3):c.1905C>T (p.A635=), NAGLU(NM_000263.4):c.1905C>T (p.A635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807965" "0" "50" "17" "40696171" "40696171" "subst" "0" "01943" "NAGLU_000085" "g.40696171C>T" "" "" "" "NAGLU(NM_000263.3):c.2147C>T (p.P716L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000841167" "3" "90" "17" "40688402" "40688402" "subst" "0" "00006" "NAGLU_000070" "g.40688402C>T" "" "{PMID:Froukh 2020:32056211}" "" "" "" "Germline" "" "" "0" "" "" "g.42536384C>T" "" "pathogenic (recessive)" "" "0000854888" "0" "10" "17" "40689455" "40689455" "subst" "0.994518" "02326" "NAGLU_000017" "g.40689455T>C" "" "" "" "NAGLU(NM_000263.3):c.423T>C (p.S141=), NAGLU(NM_000263.4):c.423T>C (p.S141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000854889" "0" "50" "17" "40695346" "40695346" "subst" "0.000204053" "02325" "NAGLU_000069" "g.40695346C>T" "" "" "" "NAGLU(NM_000263.3):c.1322C>T (p.T441M), NAGLU(NM_000263.4):c.1322C>T (p.T441M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854890" "0" "50" "17" "40695513" "40695513" "subst" "4.4276E-6" "02330" "NAGLU_000063" "g.40695513C>G" "" "" "" "NAGLU(NM_000263.3):c.1489C>G (p.L497V), NAGLU(NM_000263.4):c.1489C>G (p.L497V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854891" "0" "90" "17" "40695586" "40695586" "subst" "2.49211E-5" "02330" "NAGLU_000032" "g.40695586C>T" "" "" "" "NAGLU(NM_000263.3):c.1562C>T (p.P521L), NAGLU(NM_000263.4):c.1562C>T (p.P521L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000854892" "0" "30" "17" "40695845" "40695845" "subst" "2.27312E-5" "01943" "NAGLU_000089" "g.40695845C>T" "" "" "" "NAGLU(NM_000263.3):c.1821C>T (p.D607=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854893" "0" "50" "17" "40696182" "40696182" "subst" "0" "01804" "NAGLU_000090" "g.40696182C>T" "" "" "" "NAGLU(NM_000263.3):c.2158C>T (p.(Arg720*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865246" "0" "50" "17" "40688564" "40688564" "subst" "0" "01943" "NAGLU_000086" "g.40688564T>C" "" "" "" "NAGLU(NM_000263.3):c.274T>C (p.Y92H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865247" "0" "50" "17" "40690691" "40690691" "subst" "2.03399E-5" "01804" "NAGLU_000087" "g.40690691C>T" "" "" "" "NAGLU(NM_000263.3):c.682C>T (p.(Arg228Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865248" "0" "30" "17" "40695425" "40695425" "subst" "4.83985E-5" "02326" "NAGLU_000088" "g.40695425A>G" "" "" "" "NAGLU(NM_000263.4):c.1401A>G (p.P467=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893568" "0" "30" "17" "40690472" "40690472" "subst" "4.0659E-6" "01804" "NAGLU_000091" "g.40690472C>G" "" "" "" "NAGLU(NM_000263.3):c.647C>G (p.(Pro216Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893569" "0" "50" "17" "40693051" "40693051" "subst" "4.06072E-6" "01804" "NAGLU_000077" "g.40693051C>T" "" "" "" "NAGLU(NM_000263.3):c.848C>T (p.P283L, p.(Pro283Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893570" "0" "30" "17" "40695143" "40695143" "subst" "0.000440586" "02326" "NAGLU_000092" "g.40695143G>T" "" "" "" "NAGLU(NM_000263.4):c.1119G>T (p.V373=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893571" "0" "50" "17" "40695144" "40695144" "subst" "1.22376E-5" "01804" "NAGLU_000093" "g.40695144C>T" "" "" "" "NAGLU(NM_000263.3):c.1120C>T (p.(Pro374Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893572" "0" "30" "17" "40695462" "40695462" "subst" "0.000744456" "01804" "NAGLU_000062" "g.40695462G>A" "" "" "" "NAGLU(NM_000263.3):c.1438G>A (p.(Ala480Thr)), NAGLU(NM_000263.4):c.1438G>A (p.A480T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893573" "0" "50" "17" "40695711" "40695711" "subst" "0" "01804" "NAGLU_000094" "g.40695711C>T" "" "" "" "NAGLU(NM_000263.3):c.1687C>T (p.(Leu563Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914813" "0" "10" "17" "40689455" "40689455" "subst" "0.994518" "02329" "NAGLU_000017" "g.40689455T>C" "" "" "" "NAGLU(NM_000263.3):c.423T>C (p.S141=), NAGLU(NM_000263.4):c.423T>C (p.S141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914814" "0" "50" "17" "40690394" "40690394" "subst" "2.03041E-5" "02330" "NAGLU_000095" "g.40690394A>G" "" "" "" "NAGLU(NM_000263.4):c.569A>G (p.N190S, p.(Asn190Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914815" "0" "10" "17" "40695143" "40695143" "subst" "0.000440586" "02330" "NAGLU_000092" "g.40695143G>T" "" "" "" "NAGLU(NM_000263.4):c.1119G>T (p.V373=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914816" "0" "30" "17" "40695641" "40695641" "subst" "4.54515E-5" "02330" "NAGLU_000096" "g.40695641C>T" "" "" "" "NAGLU(NM_000263.4):c.1617C>T (p.A539=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914817" "0" "30" "17" "40696050" "40696050" "subst" "0" "01804" "NAGLU_000097" "g.40696050C>T" "" "" "" "NAGLU(NM_000263.3):c.2026C>T (p.(Arg676Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914818" "0" "10" "17" "40696233" "40696233" "subst" "0.910882" "02326" "NAGLU_000042" "g.40696233C>G" "" "" "" "NAGLU(NM_000263.4):c.2209C>G (p.R737G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914819" "0" "10" "17" "40696233" "40696233" "subst" "0.910882" "02329" "NAGLU_000042" "g.40696233C>G" "" "" "" "NAGLU(NM_000263.4):c.2209C>G (p.R737G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000926477" "0" "30" "17" "40693239" "40693239" "subst" "3.69625E-5" "02330" "NAGLU_000098" "g.40693239T>G" "" "" "" "NAGLU(NM_000263.4):c.1021+15T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926478" "0" "10" "17" "40696233" "40696233" "subst" "0.018537" "02326" "NAGLU_000041" "g.40696233C>A" "" "" "" "NAGLU(NM_000263.3):c.2209C>A (p.(Arg737Ser)), NAGLU(NM_000263.4):c.2209C>A (p.R737S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000930761" "0" "30" "17" "40695929" "40695929" "subst" "4.41275E-5" "02326" "NAGLU_000079" "g.40695929C>T" "" "" "" "NAGLU(NM_000263.3):c.1905C>T (p.A635=), NAGLU(NM_000263.4):c.1905C>T (p.A635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930762" "0" "30" "17" "40696067" "40696067" "subst" "0.000143487" "02330" "NAGLU_000099" "g.40696067G>A" "" "" "" "NAGLU(NM_000263.4):c.2043G>A (p.A681=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968878" "0" "50" "17" "40688520" "40688520" "subst" "0" "02325" "NAGLU_000100" "g.40688520T>G" "" "" "" "NAGLU(NM_000263.4):c.230T>G (p.V77G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968879" "0" "30" "17" "40688641" "40688641" "subst" "0" "02330" "NAGLU_000101" "g.40688641G>T" "" "" "" "NAGLU(NM_000263.4):c.351G>T (p.V117=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968881" "0" "70" "17" "40690433" "40690433" "subst" "4.06177E-6" "02329" "NAGLU_000102" "g.40690433G>A" "" "" "" "NAGLU(NM_000263.4):c.608G>A (p.R203Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000968882" "0" "30" "17" "40696181" "40696181" "subst" "0.000622655" "02330" "NAGLU_000081" "g.40696181G>A" "" "" "" "NAGLU(NM_000263.3):c.2157G>A (p.P719=), NAGLU(NM_000263.4):c.2157G>A (p.P719=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982496" "0" "50" "17" "40688460" "40688460" "subst" "0" "01804" "NAGLU_000047" "g.40688460C>G" "" "" "" "NAGLU(NM_000263.3):c.170C>G (p.(Ala57Gly)), NAGLU(NM_000263.4):c.170C>G (p.A57G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982497" "0" "50" "17" "40689442" "40689442" "subst" "1.21825E-5" "01804" "NAGLU_000103" "g.40689442C>T" "" "" "" "NAGLU(NM_000263.4):c.410C>T (p.(Thr137Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982498" "0" "50" "17" "40693048" "40693048" "subst" "4.87278E-5" "02325" "NAGLU_000104" "g.40693048C>T" "" "" "" "NAGLU(NM_000263.4):c.845C>T (p.A282V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982499" "0" "50" "17" "40695527" "40695528" "del" "0" "01804" "NAGLU_000105" "g.40695527_40695528del" "" "" "" "NAGLU(NM_000263.4):c.1503_1504del (p.(Tyr502Glnfs*13))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982500" "0" "90" "17" "40695951" "40695951" "subst" "0" "01804" "NAGLU_000039" "g.40695951C>T" "" "" "" "NAGLU(NM_000263.3):c.1927C>T (p.R643C), NAGLU(NM_000263.4):c.1927C>T (p.(Arg643Cys), p.R643C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000989526" "3" "90" "17" "40695718" "40695718" "subst" "4.5109E-5" "03566" "NAGLU_000035" "g.40695718G>A" "" "{DOI:Paracha 2024:10.3389/fmed.2024.1424753}" "" "" "" "Germline" "yes" "" "0" "" "" "g.42543700G>A" "" "pathogenic (recessive)" "" "0001003229" "0" "50" "17" "40690432" "40690432" "subst" "4.06204E-6" "01804" "NAGLU_000020" "g.40690432C>T" "" "" "" "NAGLU(NM_000263.3):c.607C>T (p.R203*, p.(Arg203*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003230" "0" "90" "17" "40693077" "40693077" "subst" "1.21819E-5" "01804" "NAGLU_000106" "g.40693077G>A" "" "" "" "NAGLU(NM_000263.3):c.874G>A (p.(Gly292Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001003231" "0" "70" "17" "40693092" "40693092" "subst" "5.27884E-5" "01804" "NAGLU_000024" "g.40693092C>T" "" "" "" "NAGLU(NM_000263.3):c.889C>T (p.R297*, p.(Arg297*)), NAGLU(NM_000263.4):c.889C>T (p.R297*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001003232" "0" "50" "17" "40693147" "40693147" "subst" "0" "01804" "NAGLU_000107" "g.40693147A>T" "" "" "" "NAGLU(NM_000263.3):c.944A>T (p.(Asn315Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003233" "0" "30" "17" "40693164" "40693164" "subst" "0" "01804" "NAGLU_000108" "g.40693164T>A" "" "" "" "NAGLU(NM_000263.3):c.961T>A (p.(Ser321Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003234" "0" "50" "17" "40695355" "40695355" "subst" "4.49971E-5" "01804" "NAGLU_000109" "g.40695355C>T" "" "" "" "NAGLU(NM_000263.3):c.1331C>T (p.(Ala444Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003235" "0" "90" "17" "40696015" "40696015" "subst" "0" "01804" "NAGLU_000110" "g.40696015C>T" "" "" "" "NAGLU(NM_000263.3):c.1991C>T (p.(Ala664Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001011306" "3" "70" "17" "40688482" "40688482" "del" "0" "00006" "NAGLU_000111" "g.40688482del" "" "{PMID:Pollard 2016:22976768}" "" "192delC" "" "Germline" "" "" "0" "" "" "g.42536464del" "" "likely pathogenic (recessive)" "" "0001011307" "3" "70" "17" "40688498" "40688498" "subst" "0" "00006" "NAGLU_000112" "g.40688498G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42536480G>C" "" "likely pathogenic (recessive)" "" "0001011308" "1" "70" "17" "40688512" "40688537" "del" "0" "00006" "NAGLU_000113" "g.40688512_40688537del" "" "{PMID:Pollard 2016:22976768}" "" "222_247del26" "" "Germline" "" "" "0" "" "" "g.42536494_42536519del" "" "likely pathogenic (recessive)" "" "0001011309" "1" "70" "17" "40688504" "40688527" "dup" "0" "00006" "NAGLU_000048" "g.40688504_40688527dup" "" "{PMID:Pollard 2016:22976768}" "" "214_237dup24" "" "Germline" "" "" "0" "" "" "g.42536486_42536509dup" "" "likely pathogenic (recessive)" "" "0001011310" "1" "70" "17" "40688549" "40688549" "subst" "0" "00006" "NAGLU_000114" "g.40688549G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42536531G>C" "" "likely pathogenic (recessive)" "" "0001011311" "3" "70" "17" "40689415" "40689415" "subst" "8.12196E-6" "00006" "NAGLU_000116" "g.40689415G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42537397G>A" "" "likely pathogenic (recessive)" "" "0001011312" "1" "70" "17" "40689454" "40689454" "subst" "0" "00006" "NAGLU_000117" "g.40689454C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42537436C>T" "" "likely pathogenic (recessive)" "" "0001011313" "1" "70" "17" "40689514" "40689514" "subst" "0" "00006" "NAGLU_000118" "g.40689514G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42537496G>A" "" "likely pathogenic (recessive)" "" "0001011314" "1" "70" "17" "40695346" "40695346" "subst" "0" "00006" "NAGLU_000120" "g.40695346C>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42543328C>A" "" "likely pathogenic (recessive)" "" "0001011315" "1" "70" "17" "40695715" "40695718" "dup" "0" "00006" "NAGLU_000121" "g.40695715_40695718dup" "" "{PMID:Pollard 2016:22976768}" "" "1691_1694dupCTCG" "" "Germline" "" "" "0" "" "" "g.42543697_42543700dup" "" "likely pathogenic (recessive)" "" "0001011316" "1" "70" "17" "40695855" "40695855" "subst" "0" "00006" "NAGLU_000123" "g.40695855G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42543837G>C" "" "likely pathogenic (recessive)" "" "0001011351" "2" "90" "17" "40688648" "40688648" "subst" "0" "00006" "NAGLU_000115" "g.40688648G>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42536630G>T" "" "pathogenic (recessive)" "" "0001011352" "2" "90" "17" "40693077" "40693077" "subst" "1.21819E-5" "00006" "NAGLU_000106" "g.40693077G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42541059G>A" "" "pathogenic (recessive)" "" "0001011353" "2" "90" "17" "40695973" "40695973" "subst" "0" "00006" "NAGLU_000124" "g.40695973G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42543955G>A" "" "pathogenic (recessive)" "" "0001011354" "2" "90" "17" "40695768" "40695768" "subst" "8.27479E-6" "00006" "NAGLU_000122" "g.40695768G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42543750G>C" "" "pathogenic (recessive)" "" "0001011355" "2" "90" "17" "40696044" "40696044" "subst" "2.08559E-5" "00006" "NAGLU_000125" "g.40696044C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42544026C>T" "" "pathogenic (recessive)" "" "0001011356" "2" "90" "17" "40693092" "40693092" "subst" "5.27884E-5" "00006" "NAGLU_000024" "g.40693092C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42541074C>T" "" "pathogenic (recessive)" "" "0001011357" "2" "90" "17" "40696210" "40696212" "del" "0" "00006" "NAGLU_000126" "g.40696210_40696212del" "" "{PMID:Pollard 2016:22976768}" "" "2186_2188delAGA" "" "Germline" "" "" "0" "" "" "g.42544192_42544194del" "" "pathogenic (recessive)" "" "0001011358" "2" "90" "17" "40695265" "40695265" "subst" "2.4378E-5" "00006" "NAGLU_000119" "g.40695265A>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.42543247A>G" "" "pathogenic (recessive)" "" "0001012771" "1" "90" "17" "40689424" "40689424" "subst" "0" "00006" "NAGLU_000127" "g.40689424A>G" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.42537406A>G" "" "pathogenic (recessive)" "" "0001012772" "1" "90" "17" "40690432" "40690432" "subst" "4.06204E-6" "00006" "NAGLU_000020" "g.40690432C>T" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.42538414C>T" "" "pathogenic (recessive)" "" "0001012791" "2" "90" "17" "40693202" "40693222" "dup" "0" "00006" "NAGLU_000129" "g.40693202_40693222dup" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.42541184_42541204dup" "" "pathogenic (recessive)" "" "0001012792" "2" "90" "17" "40690683" "40690687" "del" "4.06798E-6" "00006" "NAGLU_000128" "g.40690683_40690687del" "" "{PMID:Fang 2022:34813777}" "" "679-5_679-1delTCCAG" "" "Germline" "" "" "0" "" "" "g.42538665_42538669del" "" "pathogenic (recessive)" "" "0001015531" "0" "50" "17" "40695459" "40695459" "subst" "0.000111834" "02327" "NAGLU_000061" "g.40695459G>A" "" "" "" "NAGLU(NM_000263.4):c.1435G>A (p.A479T, p.(Ala479Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015532" "0" "50" "17" "40695924" "40695924" "subst" "0" "02330" "NAGLU_000038" "g.40695924G>A" "" "" "" "NAGLU(NM_000263.3):c.1900G>A (p.E634K, p.(Glu634Lys)), NAGLU(NM_000263.4):c.1900G>A (p.E634K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015533" "0" "10" "17" "40696233" "40696233" "subst" "0.018537" "02329" "NAGLU_000041" "g.40696233C>A" "" "" "" "NAGLU(NM_000263.3):c.2209C>A (p.(Arg737Ser)), NAGLU(NM_000263.4):c.2209C>A (p.R737S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001026893" "0" "30" "17" "40690456" "40690456" "subst" "0.000146272" "02330" "NAGLU_000066" "g.40690456G>A" "" "" "" "NAGLU(NM_000263.4):c.631G>A (p.D211N, p.(Asp211Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026894" "0" "30" "17" "40695200" "40695200" "subst" "5.68828E-5" "02326" "NAGLU_000130" "g.40695200C>T" "" "" "" "NAGLU(NM_000263.4):c.1176C>T (p.T392=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041845" "0" "50" "17" "40688628" "40688628" "subst" "0" "01804" "NAGLU_000131" "g.40688628C>T" "" "" "" "NAGLU(NM_000263.4):c.338C>T (p.(Pro113Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041846" "0" "50" "17" "40690394" "40690394" "subst" "2.03041E-5" "01804" "NAGLU_000095" "g.40690394A>G" "" "" "" "NAGLU(NM_000263.4):c.569A>G (p.N190S, p.(Asn190Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041847" "0" "50" "17" "40690418" "40690418" "subst" "6.904E-5" "01804" "NAGLU_000132" "g.40690418T>A" "" "" "" "NAGLU(NM_000263.4):c.593T>A (p.(Phe198Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041848" "0" "50" "17" "40690456" "40690456" "subst" "0.000146272" "01804" "NAGLU_000066" "g.40690456G>A" "" "" "" "NAGLU(NM_000263.4):c.631G>A (p.D211N, p.(Asp211Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041849" "0" "50" "17" "40692985" "40692985" "subst" "3.65559E-5" "01804" "NAGLU_000133" "g.40692985A>G" "" "" "" "NAGLU(NM_000263.4):c.782A>G (p.(Asn261Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041850" "0" "30" "17" "40695200" "40695200" "subst" "5.68828E-5" "02330" "NAGLU_000130" "g.40695200C>T" "" "" "" "NAGLU(NM_000263.4):c.1176C>T (p.T392=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041851" "0" "50" "17" "40695459" "40695459" "subst" "0.000111834" "01804" "NAGLU_000061" "g.40695459G>A" "" "" "" "NAGLU(NM_000263.4):c.1435G>A (p.A479T, p.(Ala479Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041852" "0" "90" "17" "40695858" "40695858" "subst" "5.57564E-5" "01804" "NAGLU_000044" "g.40695858A>G" "" "" "" "NAGLU(NM_000263.4):c.1834A>G (p.S612G, p.(Ser612Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001041853" "0" "50" "17" "40695913" "40695913" "subst" "7.07908E-5" "01804" "NAGLU_000134" "g.40695913T>G" "" "" "" "NAGLU(NM_000263.4):c.1889T>G (p.(Val630Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001049561" "3" "90" "17" "40695718" "40695718" "subst" "4.5109E-5" "00006" "NAGLU_000035" "g.40695718G>A" "" "{PMID:Elmas 2019:30426380}" "" "" "" "Germline" "" "" "0" "" "" "g.42543700G>A" "" "pathogenic (recessive)" "" "0001056007" "0" "70" "17" "40695829" "40695829" "del" "0" "01804" "NAGLU_000135" "g.40695829del" "" "" "" "NAGLU(NM_000263.4):c.1805del (p.(Leu602Argfs*21))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001056008" "0" "50" "17" "40696008" "40696008" "subst" "0" "01804" "NAGLU_000136" "g.40696008C>G" "" "" "" "NAGLU(NM_000263.4):c.1984C>G (p.(Gln662Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056009" "0" "50" "17" "40696203" "40696203" "subst" "0" "01804" "NAGLU_000137" "g.40696203G>A" "" "" "" "NAGLU(NM_000263.4):c.2179G>A (p.(Ala727Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059665" "3" "70" "17" "40695699" "40695699" "subst" "8.21436E-6" "00006" "NAGLU_000138" "g.40695699G>A" "" "{PMID:Jacob 2025:39706863}" "" "" "" "Germline" "" "" "0" "" "" "g.42543681G>A" "SCV002507182.1" "likely pathogenic (recessive)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NAGLU ## Count = 202 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000234493" "00014259" "70" "100" "0" "100" "0" "c.100G>C" "r.(?)" "p.(Ala34Pro)" "1" "0000234494" "00014259" "50" "14" "0" "14" "0" "c.14C>T" "r.(?)" "p.(Ala5Val)" "1" "0000235426" "00014259" "70" "700" "0" "700" "0" "c.700C>G" "r.(?)" "p.(Arg234Gly)" "4" "0000244146" "00014259" "90" "700" "0" "700" "0" "c.700C>G" "r.(?)" "p.(Arg234Gly)" "4" "0000244147" "00014259" "90" "2021" "0" "2021" "0" "c.2021G>A" "r.(?)" "p.(Arg674His)" "6" "0000255352" "00014259" "70" "743" "0" "743" "0" "c.743A>G" "r.(?)" "p.(His248Arg)" "" "0000255647" "00014259" "90" "419" "0" "419" "0" "c.419A>G" "r.(?)" "p.(Tyr140Cys)" "" "0000292978" "00014259" "10" "1446" "0" "1446" "0" "c.1446G>A" "r.(?)" "p.(Arg482=)" "" "0000292979" "00014259" "30" "1788" "0" "1788" "0" "c.1788C>T" "r.(?)" "p.(Gly596=)" "" "0000292980" "00014259" "10" "1860" "0" "1860" "0" "c.1860C>T" "r.(?)" "p.(Ser620=)" "" "0000292982" "00014259" "30" "2209" "0" "2209" "0" "c.2209C>A" "r.(?)" "p.(Arg737Ser)" "" "0000292983" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>G" "r.(?)" "p.(Arg737Gly)" "" "0000292984" "00014259" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Pro118Leu)" "" "0000292985" "00014259" "10" "423" "0" "423" "0" "c.423T>C" "r.(?)" "p.(Ser141=)" "" "0000296299" "00014259" "30" "1515" "0" "1515" "0" "c.1515C>T" "r.(?)" "p.(Ser505=)" "" "0000296300" "00014259" "90" "1558" "0" "1558" "0" "c.1558C>T" "r.(?)" "p.(Arg520Trp)" "" "0000296301" "00014259" "90" "2021" "0" "2021" "0" "c.2021G>A" "r.(?)" "p.(Arg674His)" "" "0000296302" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>A" "r.(?)" "p.(Arg737Ser)" "" "0000296303" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>G" "r.(?)" "p.(Arg737Gly)" "" "0000296304" "00014259" "90" "245" "0" "245" "0" "c.245G>A" "r.(?)" "p.(Gly82Asp)" "" "0000296305" "00014259" "10" "423" "0" "423" "0" "c.423T>C" "r.(?)" "p.(Ser141=)" "" "0000296306" "00014259" "90" "503" "0" "503" "0" "c.503G>A" "r.(?)" "p.(Trp168Ter)" "" "0000296307" "00014259" "90" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297Ter)" "" "0000302845" "00014259" "90" "1211" "0" "1211" "0" "c.1211G>A" "r.(?)" "p.(Trp404Ter)" "" "0000302846" "00014259" "90" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000302847" "00014259" "30" "1446" "0" "1446" "0" "c.1446G>A" "r.(?)" "p.(Arg482=)" "" "0000302848" "00014259" "30" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "" "0000302849" "00014259" "30" "1515" "0" "1515" "0" "c.1515C>T" "r.(?)" "p.(Ser505=)" "" "0000302850" "00014259" "90" "1562" "0" "1562" "0" "c.1562C>T" "r.(?)" "p.(Pro521Leu)" "" "0000302851" "00014259" "90" "1682" "0" "1682" "0" "c.1682T>G" "r.(?)" "p.(Leu561Arg)" "" "0000302852" "00014259" "90" "1693" "0" "1693" "0" "c.1693C>T" "r.(?)" "p.(Arg565Trp)" "" "0000302853" "00014259" "90" "1694" "0" "1694" "0" "c.1694G>A" "r.(?)" "p.(Arg565Gln)" "" "0000302854" "00014259" "50" "187" "0" "187" "0" "c.187G>A" "r.(?)" "p.(Asp63Asn)" "" "0000302855" "00014259" "90" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Glu634Lys)" "" "0000302856" "00014259" "90" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Cys)" "" "0000302857" "00014259" "90" "2021" "0" "2021" "0" "c.2021G>A" "r.(?)" "p.(Arg674His)" "" "0000302858" "00014259" "90" "2027" "0" "2027" "0" "c.2027G>C" "r.(?)" "p.(Arg676Pro)" "" "0000302862" "00014259" "70" "281" "0" "283" "0" "c.281_283delinsCCC" "r.(?)" "p.(Arg94_Asp95delinsProHis)" "" "0000302863" "00014259" "50" "281" "0" "281" "0" "c.281G>C" "r.(?)" "p.(Arg94Pro)" "" "0000302864" "00014259" "50" "283" "0" "283" "0" "c.283G>C" "r.(?)" "p.(Asp95His)" "" "0000302865" "00014259" "10" "423" "0" "423" "0" "c.423T>C" "r.(?)" "p.(Ser141=)" "" "0000302866" "00014259" "50" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Gly170Asp)" "" "0000302867" "00014259" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Ter)" "" "0000302868" "00014259" "10" "764" "19" "764" "19" "c.764+19C>G" "r.(=)" "p.(=)" "" "0000302869" "00014259" "90" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297Ter)" "" "0000325409" "00014259" "50" "292" "0" "292" "0" "c.292G>A" "r.(?)" "p.(Gly98Ser)" "" "0000325410" "00014259" "30" "383" "7" "383" "7" "c.383+7C>T" "r.(=)" "p.(=)" "" "0000325411" "00014259" "50" "678" "3" "678" "3" "c.678+3A>G" "r.spl?" "p.?" "" "0000325413" "00014259" "50" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Glu634Lys)" "" "0000343114" "00014259" "50" "1693" "0" "1693" "0" "c.1693C>T" "r.(?)" "p.(Arg565Trp)" "" "0000349119" "00014259" "70" "1834" "0" "1834" "0" "c.1834A>G" "r.(?)" "p.(Ser612Gly)" "" "0000467295" "00014259" "90" "1674" "0" "1674" "0" "c.1674C>G" "r.(?)" "p.(Tyr558*)" "" "0000467296" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "" "0000467297" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "" "0000561490" "00014259" "30" "170" "0" "170" "0" "c.170C>G" "r.(?)" "p.(Ala57Gly)" "" "0000561491" "00014259" "90" "214" "0" "237" "0" "c.214_237dup" "r.(?)" "p.(Ala72_Gly79dup)" "" "0000561493" "00014259" "90" "217" "0" "221" "0" "c.217_221dup" "r.(?)" "p.(Val75ArgfsTer49)" "" "0000561494" "00014259" "10" "421" "0" "421" "0" "c.421T>A" "r.(?)" "p.(Ser141Thr)" "" "0000561495" "00014259" "70" "531" "1" "531" "1" "c.531+1G>C" "r.spl?" "p.?" "" "0000561497" "00014259" "50" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Ala200Val)" "" "0000561498" "00014259" "10" "606" "0" "606" "0" "c.606G>A" "r.(?)" "p.(Gly202=)" "" "0000561499" "00014259" "10" "675" "0" "675" "0" "c.675G>T" "r.(?)" "p.(Leu225=)" "" "0000561500" "00014259" "50" "736" "0" "736" "0" "c.736G>C" "r.(?)" "p.(Ala246Pro)" "" "0000561501" "00014259" "10" "764" "19" "764" "19" "c.764+19C>G" "r.(=)" "p.(=)" "" "0000561502" "00014259" "30" "1021" "15" "1021" "15" "c.1021+15T>C" "r.(=)" "p.(=)" "" "0000561503" "00014259" "10" "1272" "0" "1272" "0" "c.1272C>T" "r.(?)" "p.(Asn424=)" "" "0000561504" "00014259" "90" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Glu452Lys)" "" "0000561505" "00014259" "50" "1397" "0" "1397" "0" "c.1397A>C" "r.(?)" "p.(Asp466Ala)" "" "0000561506" "00014259" "50" "1435" "0" "1435" "0" "c.1435G>A" "r.(?)" "p.(Ala479Thr)" "" "0000561507" "00014259" "30" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Ala480Thr)" "" "0000561508" "00014259" "70" "1489" "0" "1489" "0" "c.1489C>G" "r.(?)" "p.(Leu497Val)" "" "0000561509" "00014259" "30" "1515" "0" "1515" "0" "c.1515C>T" "r.(?)" "p.(Ser505=)" "" "0000561510" "00014259" "50" "1834" "0" "1834" "0" "c.1834A>G" "r.(?)" "p.(Ser612Gly)" "" "0000561511" "00014259" "30" "1983" "0" "1983" "0" "c.1983G>A" "r.(?)" "p.(Lys661=)" "" "0000561513" "00014259" "30" "2209" "0" "2209" "0" "c.2209C>A" "r.(?)" "p.(Arg737Ser)" "" "0000616551" "00014259" "50" "736" "0" "736" "0" "c.736G>C" "r.(?)" "p.(Ala246Pro)" "" "0000616552" "00014259" "30" "873" "0" "873" "0" "c.873C>T" "r.(?)" "p.(Ile291=)" "" "0000616553" "00014259" "30" "933" "0" "933" "0" "c.933C>G" "r.(?)" "p.(Ala311=)" "" "0000616554" "00014259" "50" "1322" "0" "1322" "0" "c.1322C>T" "r.(?)" "p.(Thr441Met)" "" "0000623675" "00014259" "10" "421" "0" "421" "0" "c.421T>A" "r.(?)" "p.(Ser141Thr)" "" "0000623676" "00014259" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Asp211Asn)" "" "0000624894" "00014259" "90" "112" "0" "112" "0" "c.112C>T" "r.(?)" "p.(Arg38Trp)" "" "0000632321" "00014259" "90" "509" "0" "509" "0" "c.509G>T" "r.(?)" "p.(Gly170Val)" "2" "0000649567" "00014259" "50" "1562" "0" "1562" "0" "c.1562C>T" "r.(?)" "p.(Pro521Leu)" "" "0000649568" "00014259" "90" "1693" "0" "1693" "0" "c.1693C>T" "r.(?)" "p.(Arg565Trp)" "" "0000653433" "00014259" "90" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297*)" "" "0000653434" "00014259" "70" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "" "0000658115" "00014259" "50" "170" "0" "170" "0" "c.170C>G" "r.(?)" "p.(Ala57Gly)" "" "0000658116" "00014259" "30" "1467" "0" "1467" "0" "c.1467C>T" "r.(?)" "p.(Asp489=)" "" "0000658117" "00014259" "70" "1489" "0" "1489" "0" "c.1489C>G" "r.(?)" "p.(Leu497Val)" "" "0000658118" "00014259" "90" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Cys)" "" "0000658119" "00014259" "70" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Cys)" "" "0000680860" "00014259" "30" "510" "0" "510" "0" "c.510C>T" "r.(?)" "p.(Gly170=)" "" "0000680861" "00014259" "30" "933" "0" "933" "0" "c.933C>G" "r.(?)" "p.(Ala311=)" "" "0000680862" "00014259" "50" "1222" "0" "1222" "0" "c.1222C>T" "r.(?)" "p.(His408Tyr)" "" "0000680863" "00014259" "50" "1229" "0" "1229" "0" "c.1229T>C" "r.(?)" "p.(Phe410Ser)" "" "0000680864" "00014259" "30" "1860" "0" "1860" "0" "c.1860C>T" "r.(?)" "p.(Ser620=)" "" "0000726360" "00014259" "90" "217" "0" "221" "0" "c.217_221dup" "r.(?)" "p.(Val75ArgfsTer49)" "" "0000726361" "00014259" "90" "526" "0" "526" "0" "c.526C>T" "r.(?)" "p.(Gln176*)" "" "0000726362" "00014259" "50" "848" "0" "848" "0" "c.848C>T" "r.(?)" "p.(Pro283Leu)" "" "0000726363" "00014259" "50" "1271" "0" "1271" "0" "c.1271A>G" "r.(?)" "p.(Asn424Ser)" "" "0000726364" "00014259" "30" "1905" "0" "1905" "0" "c.1905C>T" "r.(?)" "p.(Ala635=)" "" "0000726365" "00014259" "50" "1928" "0" "1928" "0" "c.1928G>A" "r.(?)" "p.(Arg643His)" "" "0000726366" "00014259" "30" "2157" "0" "2157" "0" "c.2157G>A" "r.(?)" "p.(Pro719=)" "" "0000726367" "00014259" "30" "2220" "0" "2220" "0" "c.2220C>T" "r.(?)" "p.(Ala740=)" "" "0000730016" "00014259" "90" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297*)" "" "0000787537" "00014259" "50" "1124" "0" "1124" "0" "c.1124G>A" "r.(?)" "p.(Arg375His)" "6" "0000793861" "00014259" "90" "1674" "0" "1674" "0" "c.1674C>G" "r.(?)" "p.(Tyr558*)" "6" "0000793862" "00014259" "90" "1674" "0" "1674" "0" "c.1674C>G" "r.(?)" "p.(Tyr558*)" "6" "0000793863" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "6" "0000793864" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "6" "0000793865" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "6" "0000793866" "00014259" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Pro604Leu)" "6" "0000807963" "00014259" "30" "94" "0" "94" "0" "c.94G>T" "r.(?)" "p.(Val32Leu)" "" "0000807964" "00014259" "30" "1905" "0" "1905" "0" "c.1905C>T" "r.(?)" "p.(Ala635=)" "" "0000807965" "00014259" "50" "2147" "0" "2147" "0" "c.2147C>T" "r.(?)" "p.(Pro716Leu)" "" "0000841167" "00014259" "90" "112" "0" "112" "0" "c.112C>T" "r.(?)" "p.(Arg38Trp)" "" "0000854888" "00014259" "10" "423" "0" "423" "0" "c.423T>C" "r.(?)" "p.(Ser141=)" "" "0000854889" "00014259" "50" "1322" "0" "1322" "0" "c.1322C>T" "r.(?)" "p.(Thr441Met)" "" "0000854890" "00014259" "50" "1489" "0" "1489" "0" "c.1489C>G" "r.(?)" "p.(Leu497Val)" "" "0000854891" "00014259" "90" "1562" "0" "1562" "0" "c.1562C>T" "r.(?)" "p.(Pro521Leu)" "" "0000854892" "00014259" "30" "1821" "0" "1821" "0" "c.1821C>T" "r.(?)" "p.(Asp607=)" "" "0000854893" "00014259" "50" "2158" "0" "2158" "0" "c.2158C>T" "r.(?)" "p.(Arg720*)" "" "0000865246" "00014259" "50" "274" "0" "274" "0" "c.274T>C" "r.(?)" "p.(Tyr92His)" "" "0000865247" "00014259" "50" "682" "0" "682" "0" "c.682C>T" "r.(?)" "p.(Arg228Trp)" "" "0000865248" "00014259" "30" "1401" "0" "1401" "0" "c.1401A>G" "r.(?)" "p.(Pro467=)" "" "0000893568" "00014259" "30" "647" "0" "647" "0" "c.647C>G" "r.(?)" "p.(Pro216Arg)" "" "0000893569" "00014259" "50" "848" "0" "848" "0" "c.848C>T" "r.(?)" "p.(Pro283Leu)" "" "0000893570" "00014259" "30" "1119" "0" "1119" "0" "c.1119G>T" "r.(?)" "p.(Val373=)" "" "0000893571" "00014259" "50" "1120" "0" "1120" "0" "c.1120C>T" "r.(?)" "p.(Pro374Ser)" "" "0000893572" "00014259" "30" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Ala480Thr)" "" "0000893573" "00014259" "50" "1687" "0" "1687" "0" "c.1687C>T" "r.(?)" "p.(Leu563Phe)" "" "0000914813" "00014259" "10" "423" "0" "423" "0" "c.423T>C" "r.(?)" "p.(Ser141=)" "" "0000914814" "00014259" "50" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asn190Ser)" "" "0000914815" "00014259" "10" "1119" "0" "1119" "0" "c.1119G>T" "r.(?)" "p.(Val373=)" "" "0000914816" "00014259" "30" "1617" "0" "1617" "0" "c.1617C>T" "r.(?)" "p.(Ala539=)" "" "0000914817" "00014259" "30" "2026" "0" "2026" "0" "c.2026C>T" "r.(?)" "p.(Arg676Trp)" "" "0000914818" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>G" "r.(?)" "p.(Arg737Gly)" "" "0000914819" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>G" "r.(?)" "p.(Arg737Gly)" "" "0000926477" "00014259" "30" "1021" "15" "1021" "15" "c.1021+15T>G" "r.(=)" "p.(=)" "" "0000926478" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>A" "r.(?)" "p.(Arg737Ser)" "" "0000930761" "00014259" "30" "1905" "0" "1905" "0" "c.1905C>T" "r.(?)" "p.(Ala635=)" "" "0000930762" "00014259" "30" "2043" "0" "2043" "0" "c.2043G>A" "r.(?)" "p.(=)" "" "0000968878" "00014259" "50" "230" "0" "230" "0" "c.230T>G" "r.(?)" "p.(Val77Gly)" "" "0000968879" "00014259" "30" "351" "0" "351" "0" "c.351G>T" "r.(?)" "p.(=)" "" "0000968881" "00014259" "70" "608" "0" "608" "0" "c.608G>A" "r.(?)" "p.(Arg203Gln)" "" "0000968882" "00014259" "30" "2157" "0" "2157" "0" "c.2157G>A" "r.(?)" "p.(Pro719=)" "" "0000982496" "00014259" "50" "170" "0" "170" "0" "c.170C>G" "r.(?)" "p.(Ala57Gly)" "" "0000982497" "00014259" "50" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Thr137Met)" "" "0000982498" "00014259" "50" "845" "0" "845" "0" "c.845C>T" "r.(?)" "p.(Ala282Val)" "" "0000982499" "00014259" "50" "1503" "0" "1504" "0" "c.1503_1504del" "r.(?)" "p.(Tyr502Glnfs*13)" "" "0000982500" "00014259" "90" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Cys)" "" "0000989526" "00014259" "90" "1694" "0" "1694" "0" "c.1694G>A" "r.(?)" "p.(Arg565Gln)" "" "0001003229" "00014259" "50" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Ter)" "" "0001003230" "00014259" "90" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Gly292Arg)" "" "0001003231" "00014259" "70" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297Ter)" "" "0001003232" "00014259" "50" "944" "0" "944" "0" "c.944A>T" "r.(?)" "p.(Asn315Ile)" "" "0001003233" "00014259" "30" "961" "0" "961" "0" "c.961T>A" "r.(?)" "p.(Ser321Thr)" "" "0001003234" "00014259" "50" "1331" "0" "1331" "0" "c.1331C>T" "r.(?)" "p.(Ala444Val)" "" "0001003235" "00014259" "90" "1991" "0" "1991" "0" "c.1991C>T" "r.(?)" "p.(Ala664Val)" "" "0001011306" "00014259" "70" "192" "0" "192" "0" "c.192del" "r.(?)" "p.(Tyr65ThrfsTer57)" "" "0001011307" "00014259" "70" "208" "0" "208" "0" "c.208G>C" "r.(?)" "p.(Gly70Arg)" "" "0001011308" "00014259" "70" "222" "0" "247" "0" "c.222_247del" "r.(?)" "p.(Val75GlyfsTer108)" "" "0001011309" "00014259" "70" "214" "0" "237" "0" "c.214_237dup" "r.(?)" "p.(Ala72_Gly79dup)" "" "0001011310" "00014259" "70" "259" "0" "259" "0" "c.259G>C" "r.(?)" "p.(Ala87Pro)" "" "0001011311" "00014259" "70" "384" "-1" "384" "-1" "c.384-1G>A" "r.spl" "p.?" "" "0001011312" "00014259" "70" "422" "0" "422" "0" "c.422C>T" "r.(?)" "p.(Ser141Phe)" "" "0001011313" "00014259" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Gly161Asp)" "" "0001011314" "00014259" "70" "1322" "0" "1322" "0" "c.1322C>A" "r.(?)" "p.(Thr441Lys)" "" "0001011315" "00014259" "70" "1691" "0" "1694" "0" "c.1691_1694dup" "r.(?)" "p.(Gln566SerfsTer13)" "" "0001011316" "00014259" "70" "1831" "0" "1831" "0" "c.1831G>C" "r.(?)" "p.(Ala611Pro)" "" "0001011351" "00014259" "90" "358" "0" "358" "0" "c.358G>T" "r.(?)" "p.(Glu120Ter)" "" "0001011352" "00014259" "90" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Gly292Arg)" "" "0001011353" "00014259" "90" "1949" "0" "1949" "0" "c.1949G>A" "r.(?)" "p.(Gly650Glu)" "" "0001011354" "00014259" "90" "1744" "0" "1744" "0" "c.1744G>C" "r.(?)" "p.(Ala582Pro)" "" "0001011355" "00014259" "90" "2020" "0" "2020" "0" "c.2020C>T" "r.(?)" "p.(Arg674Cys)" "" "0001011356" "00014259" "90" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297Ter)" "" "0001011357" "00014259" "90" "2186" "0" "2188" "0" "c.2186_2188del" "r.(?)" "p.(Lys729del)" "" "0001011358" "00014259" "90" "1241" "0" "1241" "0" "c.1241A>G" "r.(?)" "p.(His414Arg)" "" "0001012771" "00014259" "90" "392" "0" "392" "0" "c.392A>G" "r.(?)" "p.(Tyr131Cys)" "2" "0001012772" "00014259" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Ter)" "3" "0001012791" "00014259" "90" "999" "0" "1019" "0" "c.999_1019dup" "r.(?)" "p.(Tyr335_Val341dup)" "5" "0001012792" "00014259" "90" "679" "-5" "679" "-1" "c.679-5_679-1del" "r.spl" "p.?" "3i" "0001015531" "00014259" "50" "1435" "0" "1435" "0" "c.1435G>A" "r.(?)" "p.(Ala479Thr)" "" "0001015532" "00014259" "50" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Glu634Lys)" "" "0001015533" "00014259" "10" "2209" "0" "2209" "0" "c.2209C>A" "r.(?)" "p.(Arg737Ser)" "" "0001026893" "00014259" "30" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Asp211Asn)" "" "0001026894" "00014259" "30" "1176" "0" "1176" "0" "c.1176C>T" "r.(?)" "p.(=)" "" "0001041845" "00014259" "50" "338" "0" "338" "0" "c.338C>T" "r.(?)" "p.(Pro113Leu)" "" "0001041846" "00014259" "50" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asn190Ser)" "" "0001041847" "00014259" "50" "593" "0" "593" "0" "c.593T>A" "r.(?)" "p.(Phe198Tyr)" "" "0001041848" "00014259" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Asp211Asn)" "" "0001041849" "00014259" "50" "782" "0" "782" "0" "c.782A>G" "r.(?)" "p.(Asn261Ser)" "" "0001041850" "00014259" "30" "1176" "0" "1176" "0" "c.1176C>T" "r.(?)" "p.(=)" "" "0001041851" "00014259" "50" "1435" "0" "1435" "0" "c.1435G>A" "r.(?)" "p.(Ala479Thr)" "" "0001041852" "00014259" "90" "1834" "0" "1834" "0" "c.1834A>G" "r.(?)" "p.(Ser612Gly)" "" "0001041853" "00014259" "50" "1889" "0" "1889" "0" "c.1889T>G" "r.(?)" "p.(Val630Gly)" "" "0001049561" "00014259" "90" "1694" "0" "1694" "0" "c.1694G>A" "p.(Arg565Trp)" "p.(Arg565Gln)" "" "0001056007" "00014259" "70" "1805" "0" "1805" "0" "c.1805del" "r.(?)" "p.(Leu602Argfs*21)" "" "0001056008" "00014259" "50" "1984" "0" "1984" "0" "c.1984C>G" "r.(?)" "p.(Gln662Glu)" "" "0001056009" "00014259" "50" "2179" "0" "2179" "0" "c.2179G>A" "r.(?)" "p.(Ala727Thr)" "" "0001059665" "00014259" "70" "1675" "0" "1675" "0" "c.1675G>A" "r.(?)" "p.(Asp559Asn)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 49 "{{screeningid}}" "{{variantid}}" "0000144055" "0000234493" "0000144055" "0000234494" "0000144622" "0000235426" "0000150990" "0000244146" "0000150991" "0000244147" "0000227459" "0000467295" "0000227460" "0000467296" "0000227461" "0000467297" "0000271046" "0000624894" "0000277468" "0000632321" "0000292878" "0000649567" "0000292879" "0000649568" "0000296735" "0000653433" "0000296735" "0000653434" "0000332734" "0000730016" "0000375755" "0000787537" "0000380702" "0000793861" "0000380702" "0000793862" "0000380703" "0000793863" "0000380703" "0000793864" "0000380704" "0000793865" "0000380704" "0000793866" "0000405106" "0000841167" "0000454637" "0000989526" "0000456921" "0001011306" "0000456922" "0001011307" "0000456923" "0001011308" "0000456923" "0001011351" "0000456924" "0001011309" "0000456924" "0001011352" "0000456925" "0001011310" "0000456925" "0001011353" "0000456926" "0001011311" "0000456927" "0001011312" "0000456927" "0001011354" "0000456928" "0001011313" "0000456928" "0001011355" "0000456929" "0001011314" "0000456929" "0001011356" "0000456930" "0001011315" "0000456930" "0001011357" "0000456931" "0001011316" "0000456931" "0001011358" "0000458162" "0001012771" "0000458162" "0001012791" "0000458163" "0001012772" "0000458163" "0001012792" "0000469297" "0001049561" "0000471517" "0001059665"