### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NDUFA10) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NDUFA10" "NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa" "2" "q37.3" "unknown" "NC_000002.11" "UD_134408579728" "" "http://www.LOVD.nl/NDUFA10" "" "1" "7684" "4705" "603835" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/NDUFA10_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2025-01-31 09:46:53" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001049" "NDUFA10" "NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa" "001" "NM_004544.3" "" "NP_004535.1" "" "" "" "-101" "4814" "1068" "240896789" "240964819" "00000" "2012-09-13 13:09:50" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04293" "OPA" "atrophy, optic (OPA)" "" "" "" "" "" "00006" "2015-06-21 20:48:01" "00006" "2018-11-16 15:59:50" "06478" "MC1DN22" "Mi complex I deficiency, nuclear type 22" "AR" "618243" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "NDUFA10" "00139" "NDUFA10" "06478" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00292659" "" "" "" "34" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292660" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304805" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00461178" "" "" "" "1" "" "00006" "{PMID:Zheng 2024:39423307}" "" "M" "" "China" "" "0" "" "" "" "F036P038II-1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00292659" "00198" "00292660" "00198" "00304805" "00198" "00461178" "04293" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 01157, 04293, 06478 ## Count = 2 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Hearing/Problems}}" "{{Phenotype/Vision/Problems}}" "{{Phenotype/Development/Motor_skills}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/MRI/brain}}" "{{Phenotype/Eye/OCT}}" "{{Phenotype/Vision/Field}}" "{{Phenotype/Vision/Acuity}}" "{{Phenotype/Vision/Optic_nerve/Hypoplasia}}" "{{Phenotype/Vision/Colour}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Habits}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "" "" "" "3w" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000348678" "04293" "00461178" "00006" "Familial, autosomal recessive" "6y" "see paper; ..., subcute onset; best corrected visual acuity (first visit) OD normal light perception/OS 0.2; fundus oculi (first visit) OD diffuse pale optic disc/OS temporal pallor, SP, IP; OCT OD diffuse thinning/OS temporal thinning;" "5y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "optic atrophy" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000293827" "00292659" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293828" "00292660" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305934" "00304805" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000462810" "00461178" "1" "00006" "00006" "2025-01-31 10:20:27" "" "" "SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 31 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000003788" "3" "50" "2" "240937636" "240937636" "subst" "0" "00037" "NDUFA10_000001" "g.240937636T>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.239998219T>G" "" "VUS" "" "0000296345" "0" "10" "2" "240900612" "240900612" "del" "0" "02325" "NDUFA10_000002" "g.240900612del" "" "" "" "NDUFA10(NM_004544.4):c.1000-5delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.239961195del" "" "benign" "" "0000296346" "0" "10" "2" "240961728" "240961728" "subst" "0.664678" "02325" "NDUFA10_000007" "g.240961728T>C" "" "" "" "NDUFA10(NM_004544.4):c.105A>G (p.K35=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.240022311T>C" "" "benign" "" "0000296347" "0" "50" "2" "240964648" "240964648" "subst" "3.23422E-5" "02325" "NDUFA10_000008" "g.240964648C>A" "" "" "" "NDUFA10(NM_004544.4):c.71G>T (p.R24L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.240025231C>A" "" "VUS" "" "0000296348" "0" "10" "2" "240946766" "240946766" "subst" "0.400206" "02325" "NDUFA10_000006" "g.240946766T>C" "" "" "" "NDUFA10(NM_004544.4):c.771A>G (p.Q257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.240007349T>C" "" "benign" "" "0000296349" "0" "10" "2" "240923147" "240923147" "subst" "0" "02325" "NDUFA10_000005" "g.240923147C>T" "" "" "" "NDUFA10(NM_004544.4):c.999+6344G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.239983730C>T" "" "benign" "" "0000296350" "0" "10" "2" "240923146" "240923146" "subst" "0" "02325" "NDUFA10_000004" "g.240923146T>C" "" "" "" "NDUFA10(NM_004544.4):c.999+6345A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.239983729T>C" "" "benign" "" "0000296351" "0" "10" "2" "240923050" "240923050" "subst" "0" "02325" "NDUFA10_000003" "g.240923050C>T" "" "" "" "NDUFA10(NM_004544.4):c.999+6441G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.239983633C>T" "" "benign" "" "0000328239" "0" "50" "2" "240969540" "240969540" "subst" "8.20156E-6" "01804" "OR6B2_000003" "g.240969540A>G" "" "" "" "OR6B2(NM_001005853.1):c.307T>C (p.(Phe103Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.240030123A>G" "" "VUS" "" "0000348345" "0" "50" "2" "240944673" "240944673" "subst" "0" "02327" "NDUFA10_000009" "g.240944673G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.240005256G>A" "" "VUS" "" "0000515287" "0" "30" "2" "240900566" "240900566" "subst" "0" "01804" "NDUFA10_000010" "g.240900566T>G" "" "" "" "NDUFA10(NM_004544.3):c.1037A>C (p.(Glu346Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.239961149T>G" "" "likely benign" "" "0000515288" "0" "30" "2" "240951038" "240951038" "subst" "2.03039E-5" "01804" "NDUFA10_000011" "g.240951038T>C" "" "" "" "NDUFA10(NM_004544.3):c.745A>G (p.(Met249Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.240011621T>C" "" "likely benign" "" "0000621001" "0" "30" "2" "240913010" "240913030" "del" "0" "02325" "NDUFA10_000014" "g.240913010_240913030del" "" "" "" "NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.239973593_239973613del" "" "likely benign" "" "0000650516" "1" "30" "2" "240900128" "240900128" "subst" "0" "03575" "NDUFA10_000015" "g.240900128G>A" "34/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "34 heterozygous; {DB:CLININrs74614612}" "Germline" "" "rs74614612" "0" "" "" "g.239960711G>A" "" "likely benign" "" "0000650517" "1" "50" "2" "240960670" "240960670" "subst" "0.000491383" "03575" "NDUFA10_000016" "g.240960670A>G" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs140776586}" "Germline" "" "rs140776586" "0" "" "" "g.240021253A>G" "" "VUS" "" "0000669622" "3" "30" "2" "240900128" "240900128" "subst" "0" "03575" "NDUFA10_000015" "g.240900128G>A" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs74614612}" "Germline" "" "rs74614612" "0" "" "" "g.239960711G>A" "" "likely benign" "" "0000688714" "0" "50" "2" "240944702" "240944702" "subst" "0" "02325" "NDUFA10_000017" "g.240944702T>C" "" "" "" "NDUFA10(NM_004544.4):c.815A>G (p.D272G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800516" "0" "30" "2" "240913010" "240913030" "del" "0" "01943" "NDUFA10_000014" "g.240913010_240913030del" "" "" "" "NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800517" "0" "50" "2" "240913012" "240913012" "subst" "0" "01943" "NDUFA10_000018" "g.240913012G>C" "" "" "" "NDUFA10(NM_001322019.1):c.1066C>G (p.R356G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800518" "0" "30" "2" "240954286" "240954286" "subst" "0.00172297" "01943" "NDUFA10_000019" "g.240954286T>C" "" "" "" "NDUFA10(NM_004544.3):c.548-9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800519" "0" "50" "2" "240960670" "240960670" "subst" "0.000491383" "01943" "NDUFA10_000016" "g.240960670A>G" "" "" "" "NDUFA10(NM_004544.3):c.404T>C (p.L135S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000849813" "0" "50" "2" "240961724" "240961724" "subst" "3.24886E-5" "01943" "NDUFA10_000020" "g.240961724G>A" "" "" "" "NDUFA10(NM_004544.3):c.109C>T (p.R37C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858452" "0" "50" "2" "240951071" "240951071" "subst" "0.0057258" "01943" "NDUFA10_000012" "g.240951071C>T" "" "" "" "NDUFA10(NM_004544.3):c.712G>A (p.E238K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911646" "0" "10" "2" "240960848" "240960848" "subst" "0.00295104" "02325" "NDUFA10_000021" "g.240960848G>A" "" "" "" "NDUFA10(NM_004544.4):c.245-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000992721" "0" "50" "2" "240969461" "240969461" "subst" "0.00052592" "01804" "NDUFA10_000022" "g.240969461G>A" "" "" "" "OR6B2(NM_001005853.1):c.386C>T (p.(Pro129Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001022397" "1" "50" "2" "240960670" "240960670" "subst" "0.000491383" "00006" "NDUFA10_000016" "g.240960670A>G" "" "{PMID:Zheng 2024:39423307}" "" "" "ACMG PM3, PP1, PP3, PP4," "Germline" "" "" "0" "" "" "g.240021253A>G" "" "VUS" "" "0001022553" "2" "90" "2" "240912967" "240912988" "del" "0" "00006" "NDUFA10_000023" "g.240912967_240912988del" "" "{PMID:Zheng 2024:39423307}" "" "1090_1110del CACGATCAGCTTCAAGGAGGGA (Ser364_Arg370del)" "ACMG PS4, PM2, PM3, PM4PP1, PP4," "Germline" "" "" "0" "" "" "g.239973550_239973571del" "" "pathogenic" "" "0001033171" "0" "50" "2" "240946774" "240946774" "subst" "8.1708E-6" "01804" "NDUFA10_000024" "g.240946774C>A" "" "" "" "NDUFA10(NM_004544.4):c.763G>T (p.(Val255Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033172" "0" "50" "2" "240954226" "240954226" "subst" "7.31048E-5" "01804" "NDUFA10_000025" "g.240954226G>A" "" "" "" "NDUFA10(NM_004544.4):c.599C>T (p.(Pro200Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051163" "0" "50" "2" "240951085" "240951085" "subst" "0" "01804" "NDUFA10_000026" "g.240951085T>C" "" "" "" "NDUFA10(NM_004544.4):c.698A>G (p.(Tyr233Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051164" "0" "50" "2" "240954175" "240954175" "subst" "0.000109649" "01804" "NDUFA10_000027" "g.240954175C>T" "" "" "" "NDUFA10(NM_004544.4):c.650G>A (p.(Arg217Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NDUFA10 ## Count = 31 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000003788" "00001049" "50" "890" "6991" "890" "6991" "c.890+6991A>C" "r.(=)" "p.(=)" "" "0000296345" "00001049" "10" "1000" "-5" "1000" "-5" "c.1000-5del" "r.spl?" "p.?" "" "0000296346" "00001049" "10" "105" "0" "105" "0" "c.105A>G" "r.(?)" "p.(Lys35=)" "" "0000296347" "00001049" "50" "71" "0" "71" "0" "c.71G>T" "r.(?)" "p.(Arg24Leu)" "" "0000296348" "00001049" "10" "771" "0" "771" "0" "c.771A>G" "r.(?)" "p.(Gln257=)" "" "0000296349" "00001049" "10" "999" "6344" "999" "6344" "c.999+6344G>A" "r.(=)" "p.(=)" "" "0000296350" "00001049" "10" "999" "6345" "999" "6345" "c.999+6345A>G" "r.(=)" "p.(=)" "" "0000296351" "00001049" "10" "999" "6441" "999" "6441" "c.999+6441G>A" "r.(=)" "p.(=)" "" "0000328239" "00001049" "50" "-4822" "0" "-4822" "0" "c.-4822T>C" "r.(?)" "p.(=)" "" "0000348345" "00001049" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Pro282Ser)" "" "0000515287" "00001049" "30" "1037" "0" "1037" "0" "c.1037A>C" "r.(?)" "p.(Glu346Ala)" "" "0000515288" "00001049" "30" "745" "0" "745" "0" "c.745A>G" "r.(?)" "p.(Met249Val)" "" "0000621001" "00001049" "30" "1000" "-12385" "1000" "-12365" "c.1000-12385_1000-12365del" "r.(=)" "p.(=)" "" "0000650516" "00001049" "30" "1475" "0" "1475" "0" "c.*407C>T" "r.(=)" "p.(=)" "" "0000650517" "00001049" "50" "404" "0" "404" "0" "c.404T>C" "r.(?)" "p.(Leu135Ser)" "" "0000669622" "00001049" "30" "1475" "0" "1475" "0" "c.*407C>T" "r.(=)" "p.(=)" "" "0000688714" "00001049" "50" "815" "0" "815" "0" "c.815A>G" "r.(?)" "p.(Asp272Gly)" "" "0000800516" "00001049" "30" "1000" "-12385" "1000" "-12365" "c.1000-12385_1000-12365del" "r.(=)" "p.(=)" "" "0000800517" "00001049" "50" "1000" "-12409" "1000" "-12409" "c.1000-12409C>G" "r.(=)" "p.(=)" "" "0000800518" "00001049" "30" "548" "-9" "548" "-9" "c.548-9A>G" "r.(=)" "p.(=)" "" "0000800519" "00001049" "50" "404" "0" "404" "0" "c.404T>C" "r.(?)" "p.(Leu135Ser)" "" "0000849813" "00001049" "50" "109" "0" "109" "0" "c.109C>T" "r.(?)" "p.(Arg37Cys)" "" "0000858452" "00001049" "50" "712" "0" "712" "0" "c.712G>A" "r.(?)" "p.(Glu238Lys)" "" "0000911646" "00001049" "10" "245" "-19" "245" "-19" "c.245-19C>T" "r.(=)" "p.(=)" "" "0000992721" "00001049" "50" "-4743" "0" "-4743" "0" "c.-4743C>T" "r.(?)" "p.(=)" "" "0001022397" "00001049" "50" "404" "0" "404" "0" "c.404T>C" "r.(?)" "p.(Leu135Ser)" "" "0001022553" "00001049" "90" "1000" "-12385" "1000" "-12364" "c.1000-12385_1000-12364del" "r.?" "p.?" "" "0001033171" "00001049" "50" "763" "0" "763" "0" "c.763G>T" "r.(?)" "p.(Val255Phe)" "" "0001033172" "00001049" "50" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "" "0001051163" "00001049" "50" "698" "0" "698" "0" "c.698A>G" "r.(?)" "p.(Tyr233Cys)" "" "0001051164" "00001049" "50" "650" "0" "650" "0" "c.650G>A" "r.(?)" "p.(Arg217Gln)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 6 "{{screeningid}}" "{{variantid}}" "0000000209" "0000003788" "0000293827" "0000650516" "0000293828" "0000650517" "0000305934" "0000669622" "0000462810" "0001022397" "0000462810" "0001022553"