### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NEXN) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NEXN" "nexilin (F actin binding protein)" "1" "p31.1" "unknown" "LRG_442" "UD_132118967176" "" "https://www.LOVD.nl/SNEXN" "" "1" "29557" "91624" "613121" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/NEXN_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-09-19 10:44:18" "00006" "2026-05-04 13:34:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00014500" "NEXN" "transcript variant 1" "001" "NM_144573.3" "" "NP_653174.3" "" "" "" "-297" "3094" "2028" "78354200" "78409580" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00352" "CMD" "cardiomyopathy, dilated (CMD)" "" "" "" "" "" "00006" "2014-03-13 16:16:15" "00006" "2015-03-06 17:18:25" "03266" "CMD1CC" "cardiomyopathy, dilated, type 1CC (CMD-1CC)" "AD" "613122" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03479" "CMH20" "cardiomyopathy, hypertrophic, familial, type 20 (CMH-20)" "AD" "613876" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04172" "CM" "cardiomyopathy (CM)" "" "" "" "" "" "00006" "2015-01-20 15:34:26" "00006" "2016-03-20 12:15:43" "04173" "LVNC" "ventricular noncompaction, left (LVNC)" "" "" "" "" "" "00006" "2015-01-20 15:35:56" "00006" "2015-10-12 17:03:37" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "NEXN" "03266" "NEXN" "03479" ## Individuals ## Do not remove or alter this header ## ## Count = 29 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00128370" "" "" "" "1" "" "02244" "{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}" "stillbirth cohort (290 cases from Sweden)" "M" "" "Sweden" "0" "" "" "" "" "46" "00289921" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289922" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296724" "" "" "" "1" "" "00006" "{PMID:Haskell 2017:28611029}" "analysis 55 patients" "F" "" "United States" "" "0" "" "" "African American" "NCG_00805" "00317584" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317585" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317586" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317587" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317588" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317589" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317590" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317591" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317854" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317855" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317856" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317857" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317858" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00417652" "" "" "" "1" "" "04384" "" "" "" "" "" "" "" "" "" "" "" "00446760" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat33" "00446783" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat59" "00446789" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat69" "00446823" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat113" "00446859" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat166" "00449747" "" "" "" "1" "" "03544" "" "" "F" "" "- (not applicable)" "" "" "" "" "white" "" "00453234" "" "" "" "1" "" "02515" "Fusco 2042, submitted" "" "F" "" "Italy" "" "0" "" "" "white" "Fam193Pat208" "00453235" "" "" "" "1" "" "02515" "Fusco 2042, submitted" "" "F" "" "Italy" "" "0" "" "" "white" "Fam154Pat169" "00453236" "" "" "" "1" "" "02515" "Fusco 2042, submitted" "" "M" "" "Italy" "" "0" "" "" "white" "Fam19Pat27" "00474274" "" "" "" "1" "" "00006" "{PMID:Manzanilla Romero 2026:41746849}" "analysis 194 dilated cardiomyopathy patients" "" "" "Austria" "" "0" "" "" "" "" "00478186" "" "" "" "1" "" "00006" "{PMID:Sambuughin 2024:39457051}" "analysis 53 cases with exertional heat illness events" "" "" "United States" "" "0" "" "" "" "?" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 29 "{{individualid}}" "{{diseaseid}}" "00128370" "00198" "00289921" "00198" "00289922" "00198" "00296724" "00198" "00317584" "04172" "00317585" "04172" "00317586" "04172" "00317587" "04172" "00317588" "04172" "00317589" "04172" "00317590" "04172" "00317591" "04172" "00317854" "04172" "00317855" "04172" "00317856" "04172" "00317857" "04172" "00317858" "04172" "00417652" "00352" "00446760" "04173" "00446783" "04173" "00446789" "04173" "00446823" "04173" "00446859" "04173" "00449747" "00139" "00453234" "04172" "00453235" "04172" "00453236" "04172" "00474274" "00352" "00478186" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00352, 03266, 03479, 04172, 04173 ## Count = 25 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000100587" "00198" "00128370" "02244" "Unknown" "0d" "" "" "" "" "" "" "" "" "" "stillbirth (HP:0003826)" "" "0000224124" "00198" "00296724" "00006" "Unknown" "62y" "hypertrophic cardiomyopathy" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000241330" "04172" "00317584" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241331" "04172" "00317585" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241332" "04172" "00317586" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241333" "04172" "00317587" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241334" "04172" "00317588" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241335" "04172" "00317589" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241336" "04172" "00317590" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241337" "04172" "00317591" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241600" "04172" "00317854" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241601" "04172" "00317855" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241602" "04172" "00317856" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241603" "04172" "00317857" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241604" "04172" "00317858" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000335964" "04173" "00446760" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "left ventricular non-compaction" "" "0000335987" "04173" "00446783" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "left ventricular hypertrabeculation" "" "0000335993" "04173" "00446789" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "left ventricular non-compaction" "" "0000336027" "04173" "00446823" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "left ventricular hypertrabeculation" "" "0000336063" "04173" "00446859" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "left ventricular non-compaction" "" "0000338908" "00139" "00449747" "03544" "Isolated (sporadic)" "" "HP:0001263, HP:0000252, HP:0000271, HP:0000286, HP:0000316, HP:0001999, HP:0000463, HP:0000431" "" "" "" "" "" "" "" "WHSUS" "intellectual disability" "" "0000341880" "04172" "00453234" "02515" "Unknown" "" "" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000341881" "04172" "00453235" "02515" "Unknown" "" "" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000341882" "04172" "00453236" "02515" "Unknown" "" "" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000359074" "00352" "00474274" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 29 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000128837" "00128370" "1" "02244" "02244" "2017-09-15 14:33:33" "" "" "SEQ-NG" "DNA" "" "HaloPlex gene panel (70 heart genes)" "0000291089" "00289921" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291090" "00289922" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297834" "00296724" "1" "00006" "00006" "2020-04-11 10:26:30" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000318766" "00317584" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318767" "00317585" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318768" "00317586" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318769" "00317587" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318770" "00317588" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318771" "00317589" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318772" "00317590" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318773" "00317591" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319036" "00317854" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319037" "00317855" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319038" "00317856" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319039" "00317857" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319040" "00317858" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000418945" "00417652" "1" "04384" "04384" "2022-09-21 11:15:38" "" "" "SEQ-NG" "DNA" "" "" "0000448335" "00446760" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000448358" "00446783" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000448364" "00446789" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000448398" "00446823" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000448434" "00446859" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000451341" "00449747" "1" "03544" "03544" "2024-05-10 09:57:37" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000454845" "00453234" "1" "02515" "00006" "2024-08-16 15:35:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000454846" "00453235" "1" "02515" "00006" "2024-08-16 15:35:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000454847" "00453236" "1" "02515" "00006" "2024-08-16 15:35:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000475952" "00474274" "1" "00006" "00006" "2026-03-13 09:30:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000479833" "00478186" "1" "00006" "00006" "2026-05-04 13:34:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 15 "{{screeningid}}" "{{geneid}}" "0000297834" "NEXN" "0000318766" "NEXN" "0000318767" "NEXN" "0000318768" "NEXN" "0000318769" "NEXN" "0000318770" "NEXN" "0000318771" "NEXN" "0000318772" "NEXN" "0000318773" "NEXN" "0000319036" "NEXN" "0000319037" "NEXN" "0000319038" "NEXN" "0000319039" "NEXN" "0000319040" "NEXN" "0000418945" "NEXN" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 307 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000217969" "0" "50" "1" "78395131" "78395131" "subst" "0.00433821" "02244" "NEXN_000001" "g.78395131A>C" "" "{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}" "" "" "" "Germline" "?" "" "" "" "" "g.77929446A>C" "" "VUS" "" "0000245395" "0" "10" "1" "78395131" "78395131" "subst" "0.00433821" "02330" "NEXN_000001" "g.78395131A>C" "" "" "" "NEXN(NM_144573.3):c.995A>C (p.E332A), NEXN(NM_144573.4):c.995A>C (p.E332A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929446A>C" "" "benign" "" "0000245433" "0" "50" "1" "78408482" "78408482" "subst" "3.26373E-5" "02330" "NEXN_000055" "g.78408482A>G" "" "" "" "NEXN(NM_144573.4):c.1996A>G (p.T666A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942797A>G" "" "VUS" "" "0000245461" "0" "10" "1" "78392188" "78392188" "subst" "0" "02330" "NEXN_000013" "g.78392188A>G" "" "" "" "NEXN(NM_144573.4):c.579A>G (p.E193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926503A>G" "" "benign" "" "0000245462" "0" "10" "1" "78399092" "78399092" "subst" "0" "02330" "NEXN_000038" "g.78399092A>C" "" "" "" "NEXN(NM_144573.4):c.1179A>C (p.T393=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77933407A>C" "" "benign" "" "0000245523" "0" "10" "1" "78392588" "78392588" "subst" "0" "02330" "NEXN_000025" "g.78392588A>G" "" "" "" "NEXN(NM_144573.4):c.864+11A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926903A>G" "" "benign" "" "0000245553" "0" "50" "1" "78408441" "78408441" "subst" "7.34101E-5" "02330" "NEXN_000054" "g.78408441A>G" "" "" "" "NEXN(NM_144573.3):c.1955A>G (p.Y652C), NEXN(NM_144573.4):c.1955A>G (p.Y652C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942756A>G" "" "VUS" "" "0000245578" "0" "50" "1" "78392229" "78392229" "subst" "2.44027E-5" "02330" "NEXN_000016" "g.78392229A>G" "" "" "" "NEXN(NM_144573.3):c.620A>G (p.D207G), NEXN(NM_144573.4):c.620A>G (p.D207G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926544A>G" "" "VUS" "" "0000245580" "0" "50" "1" "78398989" "78398989" "subst" "0" "02330" "NEXN_000058" "g.78398989A>T" "" "" "" "NEXN(NM_144573.4):c.1076A>T (p.E359V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77933304A>T" "" "VUS" "" "0000245581" "0" "50" "1" "78401525" "78401525" "subst" "0" "02330" "NEXN_000039" "g.78401525A>T" "" "" "" "NEXN(NM_144573.4):c.1269A>T (p.E423D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77935840A>T" "" "VUS" "" "0000248070" "0" "30" "1" "78395131" "78395131" "subst" "0.00433821" "02325" "NEXN_000001" "g.78395131A>C" "" "" "" "NEXN(NM_144573.3):c.995A>C (p.E332A), NEXN(NM_144573.4):c.995A>C (p.E332A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929446A>C" "" "likely benign" "" "0000248086" "0" "30" "1" "78394984" "78394984" "subst" "0.000148452" "02325" "NEXN_000027" "g.78394984A>G" "" "" "" "NEXN(NM_144573.3):c.865-17A>G, NEXN(NM_144573.4):c.865-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929299A>G" "" "likely benign" "" "0000249709" "0" "50" "1" "78408482" "78408482" "subst" "3.26373E-5" "02325" "NEXN_000055" "g.78408482A>G" "" "" "" "NEXN(NM_144573.4):c.1996A>G (p.T666A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942797A>G" "" "VUS" "" "0000249836" "0" "50" "1" "78383405" "78383405" "subst" "0" "02325" "NEXN_000006" "g.78383405A>G" "" "" "" "NEXN(NM_144573.4):c.182A>G (p.Y61C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917720A>G" "" "VUS" "" "0000250741" "0" "10" "1" "78395131" "78395131" "subst" "0.00433821" "02326" "NEXN_000001" "g.78395131A>C" "" "" "" "NEXN(NM_144573.3):c.995A>C (p.E332A), NEXN(NM_144573.4):c.995A>C (p.E332A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929446A>C" "" "benign" "" "0000250777" "0" "30" "1" "78394984" "78394984" "subst" "0.000148452" "02326" "NEXN_000027" "g.78394984A>G" "" "" "" "NEXN(NM_144573.3):c.865-17A>G, NEXN(NM_144573.4):c.865-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929299A>G" "" "likely benign" "" "0000251922" "0" "30" "1" "78395085" "78395085" "subst" "0.000271522" "02326" "NEXN_000032" "g.78395085A>C" "" "" "" "NEXN(NM_144573.3):c.949A>C (p.M317L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929400A>C" "" "likely benign" "" "0000253744" "0" "10" "1" "78407923" "78407923" "subst" "8.18726E-6" "01943" "NEXN_000049" "g.78407923A>G" "" "" "" "NEXN(NM_144573.3):c.1659+30A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942238A>G" "" "benign" "" "0000253960" "0" "30" "1" "78395131" "78395131" "subst" "0.00433821" "01943" "NEXN_000001" "g.78395131A>C" "" "" "" "NEXN(NM_144573.3):c.995A>C (p.E332A), NEXN(NM_144573.4):c.995A>C (p.E332A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929446A>C" "" "likely benign" "" "0000253996" "0" "30" "1" "78394984" "78394984" "subst" "0.000148452" "01943" "NEXN_000027" "g.78394984A>G" "" "" "" "NEXN(NM_144573.3):c.865-17A>G, NEXN(NM_144573.4):c.865-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929299A>G" "" "likely benign" "" "0000256071" "0" "50" "1" "78399003" "78399003" "del" "0" "01943" "NEXN_000035" "g.78399003del" "" "" "" "NEXN(NM_144573.3):c.1090delA (p.I364Sfs*19)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77933318del" "" "VUS" "" "0000256140" "0" "50" "1" "78392139" "78392139" "subst" "4.09608E-6" "01943" "NEXN_000012" "g.78392139A>T" "" "" "" "NEXN(NM_144573.3):c.530A>T (p.K177I), NEXN(NM_144573.4):c.530A>T (p.K177I, p.(Lys177Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926454A>T" "" "VUS" "" "0000293064" "0" "10" "1" "78408520" "78408521" "del" "0" "02330" "NEXN_000057" "g.78408520_78408521del" "" "" "" "NEXN(NM_144573.4):c.*6_*7delCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942835_77942836del" "" "benign" "" "0000293065" "0" "50" "1" "78395146" "78395146" "subst" "8.21841E-6" "02330" "NEXN_000034" "g.78395146T>C" "" "" "" "NEXN(NM_144573.3):c.1010T>C (p.I337T), NEXN(NM_144573.4):c.1010T>C (p.I337T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929461T>C" "" "VUS" "" "0000293066" "0" "50" "1" "78399025" "78399025" "subst" "8.16473E-6" "02330" "NEXN_000036" "g.78399025C>A" "" "" "" "NEXN(NM_144573.4):c.1112C>A (p.P371Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77933340C>A" "" "VUS" "" "0000293067" "0" "10" "1" "78401664" "78401664" "subst" "0.000614521" "02330" "NEXN_000041" "g.78401664G>C" "" "" "" "NEXN(NM_144573.4):c.1408G>C (p.E470Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77935979G>C" "" "benign" "" "0000293068" "0" "50" "1" "78401675" "78401677" "del" "0" "02330" "NEXN_000042" "g.78401675_78401677del" "" "" "" "NEXN(NM_144573.3):c.1419_1421delAAG (p.R475del), NEXN(NM_144573.4):c.1419_1421del (p.(Arg475del)), NEXN(NM_144573.4):c.1419_1421delAAG (p.R475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77935990_77935992del" "" "VUS" "" "0000293069" "0" "50" "1" "78401709" "78401709" "subst" "6.10476E-5" "02330" "NEXN_000043" "g.78401709G>A" "" "" "" "NEXN(NM_144573.3):c.1453G>A (p.E485K), NEXN(NM_144573.4):c.1453G>A (p.E485K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77936024G>A" "" "VUS" "" "0000293070" "0" "10" "1" "78383379" "78383379" "subst" "0.000297753" "02330" "NEXN_000004" "g.78383379C>T" "" "" "" "NEXN(NM_144573.3):c.156C>T (p.D52=), NEXN(NM_144573.4):c.156C>T (p.D52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917694C>T" "" "benign" "" "0000293071" "0" "50" "1" "78407819" "78407819" "subst" "8.15062E-6" "02330" "NEXN_000045" "g.78407819C>A" "" "" "" "NEXN(NM_144573.4):c.1585C>A (p.Q529K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942134C>A" "" "VUS" "" "0000293072" "0" "10" "1" "78407911" "78407911" "subst" "0.00315246" "02330" "NEXN_000048" "g.78407911C>G" "" "" "" "NEXN(NM_144573.3):c.1659+18C>G, NEXN(NM_144573.4):c.1659+18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942226C>G" "" "benign" "" "0000293073" "0" "30" "1" "78408163" "78408168" "del" "0" "02330" "NEXN_000050" "g.78408163_78408168del" "" "" "" "NEXN(NM_144573.3):c.1677_1682delGGAGGA (p.E561_E562del), NEXN(NM_144573.4):c.1677_1682delGGAGGA (p.E561_E562del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942478_77942483del" "" "likely benign" "" "0000293074" "0" "50" "1" "78408498" "78408498" "subst" "2.04456E-5" "02330" "NEXN_000056" "g.78408498T>C" "" "" "" "NEXN(NM_144573.4):c.2012T>C (p.I671T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942813T>C" "" "VUS" "" "0000293075" "0" "10" "1" "78383874" "78383874" "subst" "0.00297486" "02330" "NEXN_000009" "g.78383874G>A" "" "" "" "NEXN(NM_144573.3):c.363G>A (p.T121=), NEXN(NM_144573.4):c.363G>A (p.T121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77918189G>A" "" "benign" "" "0000293076" "0" "10" "1" "78392121" "78392121" "subst" "0.00069192" "02330" "NEXN_000011" "g.78392121T>C" "" "" "" "NEXN(NM_144573.3):c.512T>C (p.I171T), NEXN(NM_144573.4):c.512T>C (p.I171T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926436T>C" "" "benign" "" "0000293077" "0" "50" "1" "78392256" "78392256" "subst" "1.62741E-5" "02330" "NEXN_000017" "g.78392256G>A" "" "" "" "NEXN(NM_144573.4):c.647G>A (p.R216Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926571G>A" "" "VUS" "" "0000293078" "0" "10" "1" "78383289" "78383289" "subst" "4.06312E-6" "02330" "NEXN_000002" "g.78383289T>C" "" "" "" "NEXN(NM_144573.3):c.66T>C (p.Y22=), NEXN(NM_144573.4):c.66T>C (p.Y22=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917604T>C" "" "benign" "" "0000293079" "0" "10" "1" "78392319" "78392319" "del" "0" "02330" "NEXN_000020" "g.78392319del" "" "" "" "NEXN(NM_144573.3):c.687+23delT, NEXN(NM_144573.4):c.687+23delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926634del" "" "benign" "" "0000293080" "0" "10" "1" "78392315" "78392318" "del" "0" "02330" "NEXN_000018" "g.78392315_78392318del" "" "" "" "NEXN(NM_144573.4):c.687+19_687+22delGTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926630_77926633del" "" "benign" "" "0000293081" "0" "10" "1" "78392390" "78392390" "subst" "4.06613E-6" "02330" "NEXN_000022" "g.78392390C>T" "" "" "" "NEXN(NM_144573.4):c.688-11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926705C>T" "" "benign" "" "0000293082" "0" "10" "1" "78392445" "78392445" "subst" "0.000602052" "02330" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926760C>A" "" "benign" "" "0000293083" "0" "10" "1" "78392446" "78392446" "subst" "0.181603" "02330" "NEXN_000024" "g.78392446G>A" "" "" "" "NEXN(NM_144573.3):c.733G>A (p.G245R), NEXN(NM_144573.4):c.733G>A (p.G245R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926761G>A" "" "benign" "" "0000293084" "0" "10" "1" "78392589" "78392589" "subst" "0.00134319" "02330" "NEXN_000026" "g.78392589T>A" "" "" "" "NEXN(NM_144573.3):c.864+12T>A, NEXN(NM_144573.4):c.864+12T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926904T>A" "" "benign" "" "0000293085" "0" "50" "1" "78394987" "78394990" "del" "0" "02330" "NEXN_000028" "g.78394987_78394990del" "" "" "" "NEXN(NM_144573.4):c.865-14_865-11delGTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929302_77929305del" "" "VUS" "" "0000293086" "0" "50" "1" "78395010" "78395010" "subst" "0" "02330" "NEXN_000029" "g.78395010G>A" "" "" "" "NEXN(NM_144573.3):c.874G>A (p.D292N), NEXN(NM_144573.4):c.874G>A (p.D292N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929325G>A" "" "VUS" "" "0000293087" "0" "30" "1" "78395029" "78395029" "subst" "0.000164425" "02330" "NEXN_000030" "g.78395029C>G" "" "" "" "NEXN(NM_144573.3):c.893C>G (p.T298R), NEXN(NM_144573.4):c.893C>G (p.T298R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929344C>G" "" "likely benign" "" "0000293088" "0" "50" "1" "78395071" "78395071" "subst" "0" "02330" "NEXN_000031" "g.78395071T>A" "" "" "" "NEXN(NM_144573.3):c.935T>A (p.L312H), NEXN(NM_144573.4):c.935T>A (p.L312H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929386T>A" "" "VUS" "" "0000293089" "0" "50" "1" "78395131" "78395133" "del" "0" "02330" "NEXN_000033" "g.78395131_78395133del" "" "" "" "NEXN(NM_144573.4):c.995_997delAAG (p.E332del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929446_77929448del" "" "VUS" "" "0000296423" "0" "50" "1" "78399025" "78399025" "subst" "6.94002E-5" "02325" "NEXN_000037" "g.78399025C>T" "" "" "" "NEXN(NM_144573.3):c.1112C>T (p.P371L), NEXN(NM_144573.4):c.1112C>T (p.P371L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77933340C>T" "" "VUS" "" "0000296424" "0" "50" "1" "78401620" "78401620" "subst" "4.07176E-6" "02325" "NEXN_000040" "g.78401620T>C" "" "" "" "NEXN(NM_144573.3):c.1364T>C (p.I455T), NEXN(NM_144573.4):c.1364T>C (p.I455T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77935935T>C" "" "VUS" "" "0000296425" "0" "10" "1" "78401664" "78401664" "subst" "0.000614521" "02325" "NEXN_000041" "g.78401664G>C" "" "" "" "NEXN(NM_144573.4):c.1408G>C (p.E470Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77935979G>C" "" "benign" "" "0000296426" "0" "50" "1" "78401709" "78401709" "subst" "6.10476E-5" "02325" "NEXN_000043" "g.78401709G>A" "" "" "" "NEXN(NM_144573.3):c.1453G>A (p.E485K), NEXN(NM_144573.4):c.1453G>A (p.E485K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77936024G>A" "" "VUS" "" "0000296427" "0" "50" "1" "78383380" "78383380" "subst" "4.07963E-5" "02325" "NEXN_000005" "g.78383380G>A" "" "" "" "NEXN(NM_144573.3):c.157G>A (p.E53K), NEXN(NM_144573.4):c.157G>A (p.E53K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917695G>A" "" "VUS" "" "0000296428" "0" "30" "1" "78407911" "78407911" "subst" "0.00315246" "02325" "NEXN_000048" "g.78407911C>G" "" "" "" "NEXN(NM_144573.3):c.1659+18C>G, NEXN(NM_144573.4):c.1659+18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942226C>G" "" "likely benign" "" "0000296429" "0" "30" "1" "78408163" "78408168" "del" "0" "02325" "NEXN_000051" "g.78408163_78408168del" "" "" "" "NEXN(NM_144573.3):c.1677_1682delGGAGGA (p.E561_E562del), NEXN(NM_144573.4):c.1677_1682delGGAGGA (p.E561_E562del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942478_77942483del" "" "likely benign" "" "0000296430" "0" "50" "1" "78383891" "78383891" "subst" "2.84393E-5" "02325" "NEXN_000010" "g.78383891G>A" "" "" "" "NEXN(NM_144573.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77918206G>A" "" "VUS" "" "0000296431" "0" "30" "1" "78383289" "78383289" "subst" "4.06312E-6" "02325" "NEXN_000002" "g.78383289T>C" "" "" "" "NEXN(NM_144573.3):c.66T>C (p.Y22=), NEXN(NM_144573.4):c.66T>C (p.Y22=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917604T>C" "" "likely benign" "" "0000296432" "0" "30" "1" "78392445" "78392445" "subst" "0.000602052" "02325" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926760C>A" "" "likely benign" "" "0000296433" "0" "10" "1" "78392446" "78392446" "subst" "0.181603" "02325" "NEXN_000024" "g.78392446G>A" "" "" "" "NEXN(NM_144573.3):c.733G>A (p.G245R), NEXN(NM_144573.4):c.733G>A (p.G245R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926761G>A" "" "benign" "" "0000296434" "0" "30" "1" "78392589" "78392589" "subst" "0.00134319" "02325" "NEXN_000026" "g.78392589T>A" "" "" "" "NEXN(NM_144573.3):c.864+12T>A, NEXN(NM_144573.4):c.864+12T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926904T>A" "" "likely benign" "" "0000300019" "0" "50" "1" "78401727" "78401727" "subst" "4.48018E-5" "02326" "NEXN_000044" "g.78401727G>C" "" "" "" "NEXN(NM_144573.3):c.1471G>C (p.E491Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77936042G>C" "" "VUS" "" "0000300020" "0" "10" "1" "78407911" "78407911" "subst" "0.00315246" "02326" "NEXN_000048" "g.78407911C>G" "" "" "" "NEXN(NM_144573.3):c.1659+18C>G, NEXN(NM_144573.4):c.1659+18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942226C>G" "" "benign" "" "0000300021" "0" "70" "1" "78408395" "78408398" "del" "0" "02326" "NEXN_000053" "g.78408395_78408398del" "" "" "" "NEXN(NM_144573.3):c.1909_1912delTACT (p.Y637Afs*48)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942710_77942713del" "" "likely pathogenic" "" "0000300022" "0" "30" "1" "78383289" "78383289" "subst" "4.06312E-6" "02326" "NEXN_000002" "g.78383289T>C" "" "" "" "NEXN(NM_144573.3):c.66T>C (p.Y22=), NEXN(NM_144573.4):c.66T>C (p.Y22=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917604T>C" "" "likely benign" "" "0000300023" "0" "30" "1" "78392307" "78392307" "subst" "0" "02326" "NEXN_000019" "g.78392307G>C" "" "" "" "NEXN(NM_144573.3):c.687+11G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926622G>C" "" "likely benign" "" "0000300024" "0" "30" "1" "78383301" "78383301" "subst" "0.000459088" "02326" "NEXN_000003" "g.78383301T>C" "" "" "" "NEXN(NM_144573.3):c.78T>C (p.L26=), NEXN(NM_144573.4):c.78T>C (p.L26=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917616T>C" "" "likely benign" "" "0000300025" "0" "10" "1" "78392589" "78392589" "subst" "0.00134319" "02326" "NEXN_000026" "g.78392589T>A" "" "" "" "NEXN(NM_144573.3):c.864+12T>A, NEXN(NM_144573.4):c.864+12T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926904T>A" "" "benign" "" "0000300026" "0" "30" "1" "78395029" "78395029" "subst" "0.000164425" "02326" "NEXN_000030" "g.78395029C>G" "" "" "" "NEXN(NM_144573.3):c.893C>G (p.T298R), NEXN(NM_144573.4):c.893C>G (p.T298R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929344C>G" "" "likely benign" "" "0000303017" "0" "50" "1" "78395146" "78395146" "subst" "8.21841E-6" "01943" "NEXN_000034" "g.78395146T>C" "" "" "" "NEXN(NM_144573.3):c.1010T>C (p.I337T), NEXN(NM_144573.4):c.1010T>C (p.I337T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929461T>C" "" "VUS" "" "0000303018" "0" "50" "1" "78407853" "78407853" "subst" "4.07169E-6" "01943" "NEXN_000046" "g.78407853T>C" "" "" "" "NEXN(NM_144573.3):c.1619T>C (p.M540T), NEXN(NM_144573.4):c.1619T>C (p.M540T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942168T>C" "" "VUS" "" "0000303019" "0" "30" "1" "78407868" "78407868" "subst" "1.22147E-5" "01943" "NEXN_000047" "g.78407868G>C" "" "" "" "NEXN(NM_144573.3):c.1634G>C (p.R545T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942183G>C" "" "likely benign" "" "0000303020" "0" "10" "1" "78407911" "78407911" "subst" "0.00315246" "01943" "NEXN_000048" "g.78407911C>G" "" "" "" "NEXN(NM_144573.3):c.1659+18C>G, NEXN(NM_144573.4):c.1659+18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942226C>G" "" "benign" "" "0000303021" "0" "50" "1" "78408364" "78408366" "del" "0" "01943" "NEXN_000052" "g.78408364_78408366del" "" "" "" "NEXN(NM_144573.3):c.1878_1880delAGA (p.E626del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77942679_77942681del" "" "VUS" "" "0000303022" "0" "10" "1" "78383453" "78383453" "subst" "4.12603E-6" "01943" "NEXN_000007" "g.78383453T>C" "" "" "" "NEXN(NM_144573.3):c.219+11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917768T>C" "" "benign" "" "0000303023" "0" "10" "1" "78383874" "78383874" "subst" "0.00297486" "01943" "NEXN_000009" "g.78383874G>A" "" "" "" "NEXN(NM_144573.3):c.363G>A (p.T121=), NEXN(NM_144573.4):c.363G>A (p.T121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77918189G>A" "" "benign" "" "0000303024" "0" "30" "1" "78392121" "78392121" "subst" "0.00069192" "01943" "NEXN_000011" "g.78392121T>C" "" "" "" "NEXN(NM_144573.3):c.512T>C (p.I171T), NEXN(NM_144573.4):c.512T>C (p.I171T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926436T>C" "" "likely benign" "" "0000303025" "0" "50" "1" "78392199" "78392200" "del" "0" "01943" "NEXN_000014" "g.78392199_78392200del" "" "" "" "NEXN(NM_144573.3):c.590_591delAA (p.E197Gfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926514_77926515del" "" "VUS" "" "0000303026" "0" "50" "1" "78392222" "78392222" "subst" "0.000219727" "01943" "NEXN_000015" "g.78392222G>A" "" "" "" "NEXN(NM_144573.3):c.613G>A (p.E205K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926537G>A" "" "VUS" "" "0000303027" "0" "30" "1" "78383289" "78383289" "subst" "4.06312E-6" "01943" "NEXN_000002" "g.78383289T>C" "" "" "" "NEXN(NM_144573.3):c.66T>C (p.Y22=), NEXN(NM_144573.4):c.66T>C (p.Y22=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917604T>C" "" "likely benign" "" "0000303028" "0" "10" "1" "78392319" "78392319" "del" "0" "01943" "NEXN_000021" "g.78392319del" "" "" "" "NEXN(NM_144573.3):c.687+23delT, NEXN(NM_144573.4):c.687+23delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926634del" "" "benign" "" "0000303029" "0" "30" "1" "78392445" "78392445" "subst" "0.000602052" "01943" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926760C>A" "" "likely benign" "" "0000303030" "0" "10" "1" "78392446" "78392446" "subst" "0.181603" "01943" "NEXN_000024" "g.78392446G>A" "" "" "" "NEXN(NM_144573.3):c.733G>A (p.G245R), NEXN(NM_144573.4):c.733G>A (p.G245R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926761G>A" "" "benign" "" "0000303031" "0" "30" "1" "78383301" "78383301" "subst" "0.000459088" "01943" "NEXN_000003" "g.78383301T>C" "" "" "" "NEXN(NM_144573.3):c.78T>C (p.L26=), NEXN(NM_144573.4):c.78T>C (p.L26=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77917616T>C" "" "likely benign" "" "0000303032" "0" "10" "1" "78392589" "78392589" "subst" "0.00134319" "01943" "NEXN_000026" "g.78392589T>A" "" "" "" "NEXN(NM_144573.3):c.864+12T>A, NEXN(NM_144573.4):c.864+12T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77926904T>A" "" "benign" "" "0000303033" "0" "50" "1" "78395071" "78395071" "subst" "0" "01943" "NEXN_000031" "g.78395071T>A" "" "" "" "NEXN(NM_144573.3):c.935T>A (p.L312H), NEXN(NM_144573.4):c.935T>A (p.L312H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77929386T>A" "" "VUS" "" "0000508402" "0" "50" "1" "78383290" "78383290" "subst" "4.06289E-6" "02330" "NEXN_000059" "g.78383290G>A" "" "" "" "NEXN(NM_144573.4):c.67G>A (p.V23I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917605G>A" "" "VUS" "" "0000508403" "0" "50" "1" "78383290" "78383290" "subst" "4.06289E-6" "02327" "NEXN_000059" "g.78383290G>A" "" "" "" "NEXN(NM_144573.4):c.67G>A (p.V23I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917605G>A" "" "VUS" "" "0000508404" "0" "10" "1" "78383301" "78383301" "subst" "0.000459088" "02330" "NEXN_000003" "g.78383301T>C" "" "" "" "NEXN(NM_144573.3):c.78T>C (p.L26=), NEXN(NM_144573.4):c.78T>C (p.L26=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917616T>C" "" "benign" "" "0000508405" "0" "30" "1" "78383674" "78383674" "subst" "6.50248E-5" "02326" "NEXN_000060" "g.78383674G>A" "" "" "" "NEXN(NM_144573.3):c.249G>A (p.E83=), NEXN(NM_144573.4):c.249G>A (p.E83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917989G>A" "" "likely benign" "" "0000508406" "0" "30" "1" "78383695" "78383695" "subst" "4.06388E-6" "01943" "NEXN_000061" "g.78383695A>G" "" "" "" "NEXN(NM_144573.3):c.270A>G (p.V90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918010A>G" "" "likely benign" "" "0000508407" "0" "10" "1" "78383874" "78383874" "subst" "0.00297486" "02327" "NEXN_000009" "g.78383874G>A" "" "" "" "NEXN(NM_144573.3):c.363G>A (p.T121=), NEXN(NM_144573.4):c.363G>A (p.T121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918189G>A" "" "benign" "" "0000508408" "0" "50" "1" "78383927" "78383927" "subst" "1.21862E-5" "01943" "NEXN_000062" "g.78383927T>C" "" "" "" "NEXN(NM_144573.3):c.416T>C (p.I139T), NEXN(NM_144573.4):c.416T>C (p.I139T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918242T>C" "" "VUS" "" "0000508409" "0" "50" "1" "78390870" "78390870" "subst" "0" "02327" "NEXN_000063" "g.78390870T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77925185T>G" "" "VUS" "" "0000508410" "0" "50" "1" "78392139" "78392139" "subst" "4.09608E-6" "02330" "NEXN_000012" "g.78392139A>T" "" "" "" "NEXN(NM_144573.3):c.530A>T (p.K177I), NEXN(NM_144573.4):c.530A>T (p.K177I, p.(Lys177Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926454A>T" "" "VUS" "" "0000508411" "0" "50" "1" "78392179" "78392179" "subst" "0" "02327" "NEXN_000064" "g.78392179G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926494G>A" "" "VUS" "" "0000508412" "0" "30" "1" "78392218" "78392218" "subst" "0" "01943" "NEXN_000065" "g.78392218G>C" "" "" "" "NEXN(NM_144573.3):c.609G>C (p.K203N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926533G>C" "" "likely benign" "" "0000508413" "0" "50" "1" "78392229" "78392229" "subst" "2.44027E-5" "02327" "NEXN_000016" "g.78392229A>G" "" "" "" "NEXN(NM_144573.3):c.620A>G (p.D207G), NEXN(NM_144573.4):c.620A>G (p.D207G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926544A>G" "" "VUS" "" "0000508414" "0" "50" "1" "78392255" "78392255" "subst" "4.06865E-6" "02325" "NEXN_000066" "g.78392255C>T" "" "" "" "NEXN(NM_144573.4):c.646C>T (p.R216*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926570C>T" "" "VUS" "" "0000508415" "0" "30" "1" "78392391" "78392391" "subst" "2.43936E-5" "01943" "NEXN_000067" "g.78392391G>A" "" "" "" "NEXN(NM_144573.3):c.688-10G>A, NEXN(NM_144573.4):c.688-10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926706G>A" "" "likely benign" "" "0000508416" "0" "30" "1" "78392391" "78392391" "subst" "2.43936E-5" "02325" "NEXN_000067" "g.78392391G>A" "" "" "" "NEXN(NM_144573.3):c.688-10G>A, NEXN(NM_144573.4):c.688-10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926706G>A" "" "likely benign" "" "0000508417" "0" "30" "1" "78392445" "78392445" "subst" "0.000602052" "02327" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926760C>A" "" "likely benign" "" "0000508418" "0" "10" "1" "78392490" "78392490" "subst" "0.000182997" "02330" "NEXN_000068" "g.78392490A>G" "" "" "" "NEXN(NM_144573.3):c.777A>G (p.Q259=), NEXN(NM_144573.4):c.777A>G (p.Q259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926805A>G" "" "benign" "" "0000508419" "0" "50" "1" "78392497" "78392497" "subst" "4.06759E-6" "02326" "NEXN_000069" "g.78392497C>T" "" "" "" "NEXN(NM_144573.3):c.784C>T (p.R262*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926812C>T" "" "VUS" "" "0000508420" "0" "10" "1" "78392548" "78392548" "subst" "0.000493688" "02330" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926863C>T" "" "benign" "" "0000508421" "0" "50" "1" "78392548" "78392548" "subst" "0.000493688" "01943" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926863C>T" "" "VUS" "" "0000508422" "0" "30" "1" "78392548" "78392548" "subst" "0.000493688" "02326" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926863C>T" "" "likely benign" "" "0000508423" "0" "10" "1" "78394984" "78394984" "subst" "0.000148452" "02330" "NEXN_000027" "g.78394984A>G" "" "" "" "NEXN(NM_144573.3):c.865-17A>G, NEXN(NM_144573.4):c.865-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929299A>G" "" "benign" "" "0000508425" "0" "30" "1" "78395053" "78395053" "subst" "7.39754E-5" "02326" "NEXN_000071" "g.78395053G>A" "" "" "" "NEXN(NM_144573.3):c.917G>A (p.R306H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929368G>A" "" "likely benign" "" "0000508426" "0" "50" "1" "78395131" "78395133" "del" "0" "02327" "NEXN_000033" "g.78395131_78395133del" "" "" "" "NEXN(NM_144573.4):c.995_997delAAG (p.E332del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929446_77929448del" "" "VUS" "" "0000508427" "0" "30" "1" "78395164" "78395164" "subst" "0.000176649" "02325" "NEXN_000072" "g.78395164C>T" "" "" "" "NEXN(NM_144573.4):c.1028C>T (p.A343V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929479C>T" "" "likely benign" "" "0000508428" "0" "50" "1" "78395190" "78395190" "subst" "3.69646E-5" "01943" "NEXN_000073" "g.78395190G>A" "" "" "" "NEXN(NM_144573.3):c.1053+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929505G>A" "" "VUS" "" "0000508429" "0" "50" "1" "78395190" "78395190" "subst" "3.69646E-5" "02326" "NEXN_000073" "g.78395190G>A" "" "" "" "NEXN(NM_144573.3):c.1053+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929505G>A" "" "VUS" "" "0000508430" "0" "50" "1" "78398991" "78398991" "subst" "0" "02330" "NEXN_000074" "g.78398991A>T" "" "" "" "NEXN(NM_144573.4):c.1078A>T (p.M360L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933306A>T" "" "VUS" "" "0000508431" "0" "50" "1" "78399009" "78399009" "subst" "0" "02325" "NEXN_000075" "g.78399009C>T" "" "" "" "NEXN(NM_144573.4):c.1096C>T (p.Q366*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933324C>T" "" "VUS" "" "0000508432" "0" "50" "1" "78399079" "78399079" "subst" "0" "02326" "NEXN_000076" "g.78399079A>G" "" "" "" "NEXN(NM_144573.3):c.1166A>G (p.E389G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933394A>G" "" "VUS" "" "0000508433" "0" "70" "1" "78399087" "78399087" "subst" "2.03747E-5" "02330" "NEXN_000077" "g.78399087C>T" "" "" "" "NEXN(NM_144573.3):c.1174C>T (p.R392*), NEXN(NM_144573.4):c.1174C>T (p.R392*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933402C>T" "" "likely pathogenic" "" "0000508434" "0" "50" "1" "78399087" "78399087" "subst" "2.03747E-5" "01943" "NEXN_000077" "g.78399087C>T" "" "" "" "NEXN(NM_144573.3):c.1174C>T (p.R392*), NEXN(NM_144573.4):c.1174C>T (p.R392*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933402C>T" "" "VUS" "" "0000508436" "0" "50" "1" "78399087" "78399087" "subst" "2.03747E-5" "02325" "NEXN_000077" "g.78399087C>T" "" "" "" "NEXN(NM_144573.3):c.1174C>T (p.R392*), NEXN(NM_144573.4):c.1174C>T (p.R392*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933402C>T" "" "VUS" "" "0000508437" "0" "70" "1" "78399087" "78399087" "subst" "2.03747E-5" "02326" "NEXN_000077" "g.78399087C>T" "" "" "" "NEXN(NM_144573.3):c.1174C>T (p.R392*), NEXN(NM_144573.4):c.1174C>T (p.R392*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933402C>T" "" "likely pathogenic" "" "0000508438" "0" "50" "1" "78399088" "78399088" "subst" "0" "02327" "NEXN_000078" "g.78399088G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933403G>A" "" "VUS" "" "0000508439" "0" "50" "1" "78399139" "78399139" "subst" "8.14637E-6" "02325" "NEXN_000079" "g.78399139A>T" "" "" "" "NEXN(NM_144573.4):c.1226A>T (p.E409V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933454A>T" "" "VUS" "" "0000508441" "0" "30" "1" "78401582" "78401582" "subst" "0" "02327" "NEXN_000081" "g.78401582T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935897T>C" "" "likely benign" "" "0000508442" "0" "50" "1" "78401620" "78401620" "subst" "4.07176E-6" "02326" "NEXN_000040" "g.78401620T>C" "" "" "" "NEXN(NM_144573.3):c.1364T>C (p.I455T), NEXN(NM_144573.4):c.1364T>C (p.I455T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935935T>C" "" "VUS" "" "0000508443" "0" "30" "1" "78401624" "78401624" "subst" "3.25629E-5" "01943" "NEXN_000082" "g.78401624A>C" "" "" "" "NEXN(NM_144573.3):c.1368A>C (p.G456=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935939A>C" "" "likely benign" "" "0000508444" "0" "50" "1" "78401675" "78401677" "del" "0" "02326" "NEXN_000042" "g.78401675_78401677del" "" "" "" "NEXN(NM_144573.3):c.1419_1421delAAG (p.R475del), NEXN(NM_144573.4):c.1419_1421del (p.(Arg475del)), NEXN(NM_144573.4):c.1419_1421delAAG (p.R475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935990_77935992del" "" "VUS" "" "0000508445" "0" "50" "1" "78401682" "78401682" "subst" "0" "01943" "NEXN_000083" "g.78401682G>C" "" "" "" "NEXN(NM_144573.3):c.1426G>C (p.A476P), NEXN(NM_144573.4):c.1426G>C (p.A476P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935997G>C" "" "VUS" "" "0000508447" "0" "30" "1" "78401691" "78401691" "subst" "0.000134286" "02326" "NEXN_000084" "g.78401691C>T" "" "" "" "NEXN(NM_144573.3):c.1435C>T (p.L479F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77936006C>T" "" "likely benign" "" "0000508448" "0" "50" "1" "78401722" "78401722" "subst" "0" "02327" "NEXN_000085" "g.78401722T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77936037T>G" "" "VUS" "" "0000508449" "0" "50" "1" "78401727" "78401727" "subst" "4.48018E-5" "01943" "NEXN_000044" "g.78401727G>C" "" "" "" "NEXN(NM_144573.3):c.1471G>C (p.E491Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77936042G>C" "" "VUS" "" "0000508450" "0" "50" "1" "78407715" "78407717" "del" "0" "02325" "FUBP1_000001" "g.78407715_78407717del" "" "" "" "NEXN(NM_144573.4):c.1481_1483delATG (p.D494del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942030_77942032del" "" "VUS" "" "0000508451" "0" "30" "1" "78407816" "78407816" "subst" "0.000220087" "02330" "FUBP1_000002" "g.78407816G>C" "" "" "" "NEXN(NM_001172309.1):c.1390G>C (p.(Glu464Gln)), NEXN(NM_144573.3):c.1582G>C (p.E528Q), NEXN(NM_144573.4):c.1582G>C (p.E528Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942131G>C" "" "likely benign" "" "0000508452" "0" "50" "1" "78407816" "78407816" "subst" "0.000220087" "01943" "FUBP1_000002" "g.78407816G>C" "" "" "" "NEXN(NM_001172309.1):c.1390G>C (p.(Glu464Gln)), NEXN(NM_144573.3):c.1582G>C (p.E528Q), NEXN(NM_144573.4):c.1582G>C (p.E528Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942131G>C" "" "VUS" "" "0000508453" "0" "30" "1" "78407816" "78407816" "subst" "0.000220087" "02326" "FUBP1_000002" "g.78407816G>C" "" "" "" "NEXN(NM_001172309.1):c.1390G>C (p.(Glu464Gln)), NEXN(NM_144573.3):c.1582G>C (p.E528Q), NEXN(NM_144573.4):c.1582G>C (p.E528Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942131G>C" "" "likely benign" "" "0000508454" "0" "10" "1" "78407816" "78407818" "del" "0" "02330" "FUBP1_000003" "g.78407816_78407818del" "" "" "" "NEXN(NM_144573.3):c.1582_1584delGAA (p.E528del), NEXN(NM_144573.4):c.1582_1584delGAA (p.E528del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942131_77942133del" "" "benign" "" "0000508455" "0" "30" "1" "78407816" "78407818" "del" "0" "02325" "FUBP1_000003" "g.78407816_78407818del" "" "" "" "NEXN(NM_144573.3):c.1582_1584delGAA (p.E528del), NEXN(NM_144573.4):c.1582_1584delGAA (p.E528del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942131_77942133del" "" "likely benign" "" "0000508456" "0" "30" "1" "78407911" "78407911" "subst" "0.00315246" "02327" "NEXN_000048" "g.78407911C>G" "" "" "" "NEXN(NM_144573.3):c.1659+18C>G, NEXN(NM_144573.4):c.1659+18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942226C>G" "" "likely benign" "" "0000508457" "0" "50" "1" "78408147" "78408151" "del" "0" "02325" "FUBP1_000004" "g.78408147_78408151del" "" "" "" "NEXN(NM_144573.4):c.1660-2_1662delAGAAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942462_77942466del" "" "VUS" "" "0000508458" "0" "50" "1" "78408235" "78408235" "subst" "0" "02330" "FUBP1_000005" "g.78408235G>A" "" "" "" "NEXN(NM_144573.4):c.1749G>A (p.W583*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942550G>A" "" "VUS" "" "0000508459" "0" "50" "1" "78408235" "78408235" "subst" "0" "02325" "FUBP1_000005" "g.78408235G>A" "" "" "" "NEXN(NM_144573.4):c.1749G>A (p.W583*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942550G>A" "" "VUS" "" "0000508460" "0" "30" "1" "78408274" "78408274" "subst" "0.000252264" "02330" "FUBP1_000006" "g.78408274T>G" "" "" "" "NEXN(NM_144573.3):c.1788T>G (p.S596R), NEXN(NM_144573.4):c.1788T>G (p.S596R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942589T>G" "" "likely benign" "" "0000508462" "0" "30" "1" "78408274" "78408274" "subst" "0.000252264" "02327" "FUBP1_000006" "g.78408274T>G" "" "" "" "NEXN(NM_144573.3):c.1788T>G (p.S596R), NEXN(NM_144573.4):c.1788T>G (p.S596R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942589T>G" "" "likely benign" "" "0000508463" "0" "30" "1" "78408274" "78408274" "subst" "0.000252264" "02325" "FUBP1_000006" "g.78408274T>G" "" "" "" "NEXN(NM_144573.3):c.1788T>G (p.S596R), NEXN(NM_144573.4):c.1788T>G (p.S596R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942589T>G" "" "likely benign" "" "0000508464" "0" "30" "1" "78408274" "78408274" "subst" "0.000252264" "02326" "FUBP1_000006" "g.78408274T>G" "" "" "" "NEXN(NM_144573.3):c.1788T>G (p.S596R), NEXN(NM_144573.4):c.1788T>G (p.S596R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942589T>G" "" "likely benign" "" "0000508465" "0" "50" "1" "78408285" "78408285" "subst" "0" "02326" "FUBP1_000007" "g.78408285G>A" "" "" "" "NEXN(NM_144573.3):c.1799G>A (p.R600K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942600G>A" "" "VUS" "" "0000508466" "0" "30" "1" "78408292" "78408292" "subst" "2.8491E-5" "02327" "FUBP1_000008" "g.78408292G>A" "" "" "" "NEXN(NM_144573.3):c.1806G>A (p.T602=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942607G>A" "" "likely benign" "" "0000508467" "0" "50" "1" "78408364" "78408366" "del" "0" "02327" "NEXN_000052" "g.78408364_78408366del" "" "" "" "NEXN(NM_144573.3):c.1878_1880delAGA (p.E626del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942679_77942681del" "" "VUS" "" "0000508469" "0" "50" "1" "78408512" "78408515" "del" "0" "02330" "FUBP1_000009" "g.78408512_78408515del" "" "" "" "NEXN(NM_144573.4):c.2025_2028delTTAA (p.*676Hfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942827_77942830del" "" "VUS" "" "0000605951" "0" "30" "1" "78383233" "78383233" "subst" "4.10102E-6" "02327" "NEXN_000086" "g.78383233T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917548T>A" "" "likely benign" "" "0000605952" "0" "50" "1" "78383290" "78383290" "subst" "4.06289E-6" "02325" "NEXN_000059" "g.78383290G>A" "" "" "" "NEXN(NM_144573.4):c.67G>A (p.V23I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917605G>A" "" "VUS" "" "0000605953" "0" "10" "1" "78383674" "78383674" "subst" "6.50248E-5" "02330" "NEXN_000060" "g.78383674G>A" "" "" "" "NEXN(NM_144573.3):c.249G>A (p.E83=), NEXN(NM_144573.4):c.249G>A (p.E83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917989G>A" "" "benign" "" "0000605954" "0" "30" "1" "78383807" "78383807" "subst" "1.21931E-5" "02327" "NEXN_000087" "g.78383807T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918122T>C" "" "likely benign" "" "0000605955" "0" "50" "1" "78383891" "78383891" "subst" "2.84393E-5" "02327" "NEXN_000010" "g.78383891G>A" "" "" "" "NEXN(NM_144573.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918206G>A" "" "VUS" "" "0000605956" "0" "50" "1" "78383903" "78383903" "subst" "3.24952E-5" "02325" "NEXN_000088" "g.78383903A>G" "" "" "" "NEXN(NM_144573.4):c.392A>G (p.Q131R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918218A>G" "" "VUS" "" "0000605957" "0" "10" "1" "78383976" "78383976" "subst" "8.12783E-6" "02330" "NEXN_000089" "g.78383976G>A" "" "" "" "NEXN(NM_144573.4):c.447+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918291G>A" "" "benign" "" "0000605958" "0" "30" "1" "78390892" "78390892" "subst" "2.44469E-5" "02327" "NEXN_000090" "g.78390892C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77925207C>T" "" "likely benign" "" "0000605959" "0" "30" "1" "78392548" "78392548" "subst" "0.000493688" "02327" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926863C>T" "" "likely benign" "" "0000605960" "0" "50" "1" "78392570" "78392570" "subst" "8.1815E-6" "02330" "NEXN_000091" "g.78392570G>A" "" "" "" "NEXN(NM_144573.4):c.857G>A (p.R286Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77926885G>A" "" "VUS" "" "0000605961" "0" "30" "1" "78394984" "78394984" "subst" "0.000148452" "02327" "NEXN_000027" "g.78394984A>G" "" "" "" "NEXN(NM_144573.3):c.865-17A>G, NEXN(NM_144573.4):c.865-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929299A>G" "" "likely benign" "" "0000605962" "0" "30" "1" "78395029" "78395029" "subst" "0.000164425" "01943" "NEXN_000030" "g.78395029C>G" "" "" "" "NEXN(NM_144573.3):c.893C>G (p.T298R), NEXN(NM_144573.4):c.893C>G (p.T298R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929344C>G" "" "likely benign" "" "0000605963" "0" "30" "1" "78395123" "78395123" "subst" "0" "02327" "NEXN_000092" "g.78395123A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929438A>C" "" "likely benign" "" "0000605964" "0" "10" "1" "78395131" "78395131" "subst" "0.00433821" "02327" "NEXN_000001" "g.78395131A>C" "" "" "" "NEXN(NM_144573.3):c.995A>C (p.E332A), NEXN(NM_144573.4):c.995A>C (p.E332A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929446A>C" "" "benign" "" "0000605965" "0" "30" "1" "78398979" "78398979" "subst" "4.10715E-6" "02327" "NEXN_000093" "g.78398979G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933294G>C" "" "likely benign" "" "0000605966" "0" "50" "1" "78399025" "78399025" "subst" "6.94002E-5" "02330" "NEXN_000037" "g.78399025C>T" "" "" "" "NEXN(NM_144573.3):c.1112C>T (p.P371L), NEXN(NM_144573.4):c.1112C>T (p.P371L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933340C>T" "" "VUS" "" "0000605967" "0" "70" "1" "78399087" "78399087" "subst" "2.03747E-5" "02327" "NEXN_000077" "g.78399087C>T" "" "" "" "NEXN(NM_144573.3):c.1174C>T (p.R392*), NEXN(NM_144573.4):c.1174C>T (p.R392*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933402C>T" "" "likely pathogenic" "" "0000605968" "0" "30" "1" "78401503" "78401503" "dup" "0" "02327" "NEXN_000094" "g.78401503dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935818dup" "" "likely benign" "" "0000605969" "0" "30" "1" "78401525" "78401525" "subst" "0" "02327" "NEXN_000039" "g.78401525A>T" "" "" "" "NEXN(NM_144573.4):c.1269A>T (p.E423D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935840A>T" "" "likely benign" "" "0000605970" "0" "30" "1" "78401675" "78401677" "del" "0" "02327" "NEXN_000042" "g.78401675_78401677del" "" "" "" "NEXN(NM_144573.3):c.1419_1421delAAG (p.R475del), NEXN(NM_144573.4):c.1419_1421del (p.(Arg475del)), NEXN(NM_144573.4):c.1419_1421delAAG (p.R475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77935990_77935992del" "" "likely benign" "" "0000605971" "0" "50" "1" "78401709" "78401709" "subst" "6.10476E-5" "02326" "NEXN_000043" "g.78401709G>A" "" "" "" "NEXN(NM_144573.3):c.1453G>A (p.E485K), NEXN(NM_144573.4):c.1453G>A (p.E485K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77936024G>A" "" "VUS" "" "0000605972" "0" "50" "1" "78407763" "78407763" "subst" "1.22316E-5" "02327" "FUBP1_000010" "g.78407763A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942078A>G" "" "VUS" "" "0000605974" "0" "10" "1" "78407852" "78407852" "subst" "0.000337986" "02330" "FUBP1_000011" "g.78407852A>G" "" "" "" "NEXN(NM_144573.3):c.1618A>G (p.M540V), NEXN(NM_144573.4):c.1618A>G (p.M540V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942167A>G" "" "benign" "" "0000605975" "0" "70" "1" "78408435" "78408437" "del" "0" "02330" "FUBP1_000012" "g.78408435_78408437del" "" "" "" "NEXN(NM_144573.4):c.1949_1951delGAG (p.G650del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942750_77942752del" "" "likely pathogenic" "" "0000620699" "0" "30" "1" "78383379" "78383379" "subst" "0.000297753" "01943" "NEXN_000004" "g.78383379C>T" "" "" "" "NEXN(NM_144573.3):c.156C>T (p.D52=), NEXN(NM_144573.4):c.156C>T (p.D52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917694C>T" "" "likely benign" "" "0000620700" "0" "50" "1" "78408441" "78408441" "subst" "7.34101E-5" "02326" "NEXN_000054" "g.78408441A>G" "" "" "" "NEXN(NM_144573.3):c.1955A>G (p.Y652C), NEXN(NM_144573.4):c.1955A>G (p.Y652C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942756A>G" "" "VUS" "" "0000647778" "1" "50" "1" "78399103" "78399103" "subst" "3.25685E-5" "03575" "NEXN_000095" "g.78399103G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs201806320}" "Germline" "" "rs201806320" "0" "" "" "g.77933418G>A" "" "VUS" "" "0000647779" "1" "50" "1" "78408441" "78408441" "subst" "7.34101E-5" "03575" "NEXN_000054" "g.78408441A>G" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs137853197}" "Germline" "" "rs137853197" "0" "" "" "g.77942756A>G" "" "VUS" "" "0000654109" "0" "50" "1" "78383398" "78383398" "subst" "3.67083E-5" "01943" "NEXN_000096" "g.78383398G>A" "" "" "" "NEXN(NM_144573.3):c.175G>A (p.E59K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77917713G>A" "" "VUS" "" "0000654110" "0" "50" "1" "78383891" "78383891" "subst" "2.84393E-5" "02330" "NEXN_000010" "g.78383891G>A" "" "" "" "NEXN(NM_144573.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77918206G>A" "" "VUS" "" "0000654111" "0" "10" "1" "78394996" "78394996" "subst" "0.000102966" "02330" "NEXN_000097" "g.78394996G>A" "" "" "" "NEXN(NM_144573.4):c.865-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77929311G>A" "" "benign" "" "0000654112" "0" "50" "1" "78399025" "78399025" "subst" "6.94002E-5" "02326" "NEXN_000037" "g.78399025C>T" "" "" "" "NEXN(NM_144573.3):c.1112C>T (p.P371L), NEXN(NM_144573.4):c.1112C>T (p.P371L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933340C>T" "" "VUS" "" "0000654113" "0" "50" "1" "78399084" "78399084" "subst" "1.63046E-5" "01943" "NEXN_000098" "g.78399084C>T" "" "" "" "NEXN(NM_144573.3):c.1171C>T (p.R391*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77933399C>T" "" "VUS" "" "0000654114" "0" "50" "1" "78407820" "78407820" "subst" "0" "02326" "FUBP1_000014" "g.78407820A>C" "" "" "" "NEXN(NM_144573.3):c.1586A>C (p.Q529P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942135A>C" "" "VUS" "" "0000654115" "0" "50" "1" "78408219" "78408219" "subst" "4.07166E-6" "02326" "FUBP1_000015" "g.78408219G>T" "" "" "" "NEXN(NM_144573.3):c.1733G>T (p.R578I), NEXN(NM_144573.4):c.1733G>T (p.R578I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942534G>T" "" "VUS" "" "0000654116" "0" "50" "1" "78408483" "78408483" "subst" "3.26307E-5" "01943" "FUBP1_000016" "g.78408483C>A" "" "" "" "NEXN(NM_144573.3):c.1997C>A (p.T666N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942798C>A" "" "VUS" "" "0000654117" "0" "10" "1" "78408518" "78408518" "subst" "4.21042E-6" "02330" "FUBP1_000017" "g.78408518C>T" "" "" "" "NEXN(NM_144573.4):c.*4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77942833C>T" "" "benign" "" "0000675935" "0" "50" "1" "78383903" "78383903" "subst" "3.24952E-5" "02327" "NEXN_000088" "g.78383903A>G" "" "" "" "NEXN(NM_144573.4):c.392A>G (p.Q131R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000675936" "0" "50" "1" "78392300" "78392300" "subst" "5.28546E-5" "02327" "NEXN_000099" "g.78392300A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000675937" "0" "50" "1" "78395010" "78395010" "subst" "0" "02326" "NEXN_000029" "g.78395010G>A" "" "" "" "NEXN(NM_144573.3):c.874G>A (p.D292N), NEXN(NM_144573.4):c.874G>A (p.D292N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000675938" "0" "30" "1" "78407816" "78407816" "subst" "0.000220087" "01804" "FUBP1_000002" "g.78407816G>C" "" "" "" "NEXN(NM_001172309.1):c.1390G>C (p.(Glu464Gln)), NEXN(NM_144573.3):c.1582G>C (p.E528Q), NEXN(NM_144573.4):c.1582G>C (p.E528Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000675939" "0" "50" "1" "78408237" "78408237" "subst" "4.07083E-6" "02326" "FUBP1_000018" "g.78408237T>A" "" "" "" "NEXN(NM_144573.3):c.1751T>A (p.F584Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688246" "0" "50" "1" "78383380" "78383380" "subst" "4.07963E-5" "01943" "NEXN_000005" "g.78383380G>A" "" "" "" "NEXN(NM_144573.3):c.157G>A (p.E53K), NEXN(NM_144573.4):c.157G>A (p.E53K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688247" "0" "30" "1" "78401494" "78401497" "del" "0" "02326" "NEXN_000100" "g.78401494_78401497del" "" "" "" "NEXN(NM_144573.3):c.1252-14_1252-11delAATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000688248" "0" "50" "1" "78408296" "78408296" "subst" "8.13795E-6" "02330" "FUBP1_000019" "g.78408296A>G" "" "" "" "NEXN(NM_144573.4):c.1810A>G (p.K604E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688249" "0" "50" "1" "78408435" "78408437" "del" "0" "02325" "FUBP1_000012" "g.78408435_78408437del" "" "" "" "NEXN(NM_144573.4):c.1949_1951delGAG (p.G650del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000701372" "0" "50" "1" "78383852" "78383853" "del" "8.12962E-6" "00006" "NEXN_000101" "g.78383852_78383853del" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "341_342delAA" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.77918167_77918168del" "" "VUS" "" "0000701373" "0" "50" "1" "78383903" "78383903" "subst" "3.24952E-5" "00006" "NEXN_000088" "g.78383903A>G" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77918218A>G" "" "VUS" "" "0000701374" "0" "50" "1" "78395029" "78395029" "subst" "0.000164425" "00006" "NEXN_000030" "g.78395029C>G" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour benign" "Germline" "" "" "0" "" "" "g.77929344C>G" "" "VUS" "" "0000701375" "0" "50" "1" "78399025" "78399025" "subst" "6.94002E-5" "00006" "NEXN_000037" "g.78399025C>T" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77933340C>T" "" "VUS" "" "0000701376" "0" "50" "1" "78401622" "78401622" "subst" "4.07156E-6" "00006" "NEXN_000102" "g.78401622G>A" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77935937G>A" "" "VUS" "" "0000701377" "0" "50" "1" "78401709" "78401709" "subst" "6.10476E-5" "00006" "NEXN_000043" "g.78401709G>A" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77936024G>A" "" "VUS" "" "0000701378" "0" "50" "1" "78401713" "78401713" "subst" "0" "00006" "NEXN_000104" "g.78401713C>G" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77936028C>G" "" "VUS" "" "0000701379" "0" "50" "1" "78408423" "78408423" "subst" "0" "00006" "NEXN_000106" "g.78408423C>A" "1/632 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77942738C>A" "" "VUS" "" "0000701642" "0" "50" "1" "78395190" "78395190" "subst" "3.69646E-5" "00006" "NEXN_000073" "g.78395190G>A" "1/156 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.77929505G>A" "" "VUS" "" "0000701643" "0" "50" "1" "78401663" "78401665" "del" "0" "00006" "NEXN_000103" "g.78401663_78401665del" "1/156 cases" "{PMID:Walsh 2017:27532257}" "" "1407_1409delAGA" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.77935978_77935980del" "" "VUS" "" "0000701644" "0" "50" "1" "78408163" "78408168" "del" "0" "00006" "NEXN_000050" "g.78408163_78408168del" "1/156 cases" "{PMID:Walsh 2017:27532257}" "" "1677_1682delGGAGGA" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.77942478_77942483del" "" "VUS" "" "0000701645" "0" "50" "1" "78408242" "78408244" "del" "0" "00006" "NEXN_000105" "g.78408242_78408244del" "1/156 cases" "{PMID:Walsh 2017:27532257}" "" "1756_1758delAAG" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.77942557_77942559del" "" "VUS" "" "0000701646" "0" "50" "1" "78408482" "78408482" "subst" "3.26373E-5" "00006" "NEXN_000055" "g.78408482A>G" "1/156 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.77942797A>G" "" "VUS" "" "0000701788" "0" "50" "1" "78395131" "78395133" "del" "0" "00006" "NEXN_000033" "g.78395131_78395133del" "" "{PMID:Haskell 2017:28611029}" "" "987_989delAGA" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000717703" "0" "50" "1" "78383380" "78383380" "subst" "4.07963E-5" "02330" "NEXN_000005" "g.78383380G>A" "" "" "" "NEXN(NM_144573.3):c.157G>A (p.E53K), NEXN(NM_144573.4):c.157G>A (p.E53K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000717704" "0" "30" "1" "78392490" "78392490" "subst" "0.000182997" "01943" "NEXN_000068" "g.78392490A>G" "" "" "" "NEXN(NM_144573.3):c.777A>G (p.Q259=), NEXN(NM_144573.4):c.777A>G (p.Q259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000717705" "0" "50" "1" "78401620" "78401620" "subst" "4.07176E-6" "02330" "NEXN_000040" "g.78401620T>C" "" "" "" "NEXN(NM_144573.3):c.1364T>C (p.I455T), NEXN(NM_144573.4):c.1364T>C (p.I455T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000717706" "0" "30" "1" "78401624" "78401624" "subst" "3.25629E-5" "02326" "NEXN_000082" "g.78401624A>C" "" "" "" "NEXN(NM_144573.3):c.1368A>C (p.G456=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000717707" "0" "50" "1" "78401706" "78401706" "subst" "4.0702E-6" "01943" "NEXN_000107" "g.78401706C>T" "" "" "" "NEXN(NM_144573.3):c.1450C>T (p.R484*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000799531" "0" "30" "1" "78392121" "78392121" "subst" "0.00069192" "02326" "NEXN_000011" "g.78392121T>C" "" "" "" "NEXN(NM_144573.3):c.512T>C (p.I171T), NEXN(NM_144573.4):c.512T>C (p.I171T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000799532" "0" "30" "1" "78407816" "78407818" "del" "0" "01943" "FUBP1_000003" "g.78407816_78407818del" "" "" "" "NEXN(NM_144573.3):c.1582_1584delGAA (p.E528del), NEXN(NM_144573.4):c.1582_1584delGAA (p.E528del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000799533" "0" "30" "1" "78407852" "78407852" "subst" "0.000337986" "01943" "FUBP1_000011" "g.78407852A>G" "" "" "" "NEXN(NM_144573.3):c.1618A>G (p.M540V), NEXN(NM_144573.4):c.1618A>G (p.M540V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000799534" "0" "50" "1" "78408329" "78408329" "subst" "0" "01943" "FUBP1_000021" "g.78408329T>C" "" "" "" "NEXN(NM_144573.3):c.1843T>C (p.W615R), NEXN(NM_144573.4):c.1843T>C (p.W615R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848850" "0" "30" "1" "78383289" "78383289" "subst" "4.06312E-6" "02327" "NEXN_000002" "g.78383289T>C" "" "" "" "NEXN(NM_144573.3):c.66T>C (p.Y22=), NEXN(NM_144573.4):c.66T>C (p.Y22=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848851" "0" "50" "1" "78383311" "78383311" "subst" "0" "02327" "NEXN_000108" "g.78383311G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848852" "0" "50" "1" "78383890" "78383890" "subst" "2.84393E-5" "02327" "NEXN_000109" "g.78383890C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848853" "0" "50" "1" "78383905" "78383905" "subst" "0" "02327" "NEXN_000110" "g.78383905G>C" "" "" "" "NEXN(NM_144573.4):c.394G>C (p.D132H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848854" "0" "50" "1" "78390900" "78390900" "subst" "0" "02327" "NEXN_000111" "g.78390900G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848855" "0" "50" "1" "78392075" "78392099" "del" "0" "02330" "NEXN_000112" "g.78392075_78392099del" "" "" "" "NEXN(NM_144573.4):c.490-25_490-1delGCTAATTATCTATTTTATAAAATAG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848856" "0" "30" "1" "78392425" "78392425" "subst" "0" "02327" "NEXN_000113" "g.78392425A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848858" "0" "30" "1" "78401691" "78401691" "subst" "0.000134286" "02327" "NEXN_000084" "g.78401691C>T" "" "" "" "NEXN(NM_144573.3):c.1435C>T (p.L479F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848859" "0" "50" "1" "78401709" "78401709" "subst" "6.10476E-5" "02327" "NEXN_000043" "g.78401709G>A" "" "" "" "NEXN(NM_144573.3):c.1453G>A (p.E485K), NEXN(NM_144573.4):c.1453G>A (p.E485K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848860" "0" "30" "1" "78407884" "78407884" "subst" "0" "02327" "FUBP1_000022" "g.78407884A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848861" "0" "30" "1" "78408163" "78408168" "del" "0" "02326" "NEXN_000050" "g.78408163_78408168del" "" "" "" "NEXN(NM_144573.3):c.1677_1682delGGAGGA (p.E561_E562del), NEXN(NM_144573.4):c.1677_1682delGGAGGA (p.E561_E562del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848862" "0" "50" "1" "78408219" "78408219" "subst" "4.07166E-6" "02325" "FUBP1_000015" "g.78408219G>T" "" "" "" "NEXN(NM_144573.3):c.1733G>T (p.R578I), NEXN(NM_144573.4):c.1733G>T (p.R578I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848863" "0" "50" "1" "78408296" "78408296" "subst" "8.13795E-6" "02327" "FUBP1_000019" "g.78408296A>G" "" "" "" "NEXN(NM_144573.4):c.1810A>G (p.K604E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000857610" "0" "10" "1" "78383874" "78383874" "subst" "0.00297486" "02326" "NEXN_000009" "g.78383874G>A" "" "" "" "NEXN(NM_144573.3):c.363G>A (p.T121=), NEXN(NM_144573.4):c.363G>A (p.T121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000878859" "0" "70" "1" "78407813" "78407818" "del" "0" "04384" "NEXN_000114" "g.78407813_78407818del" "" "" "beatrice.alessandrini" "" "" "Unknown" "" "" "0" "" "" "g.77942128_77942133del" "" "VUS" "" "0000883601" "0" "30" "1" "78381724" "78381724" "subst" "0" "02326" "NEXN_000115" "g.78381724T>C" "" "" "" "NEXN(NM_144573.3):c.-52-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000883602" "0" "50" "1" "78383885" "78383885" "subst" "4.06289E-6" "02330" "NEXN_000116" "g.78383885G>A" "" "" "" "NEXN(NM_144573.4):c.374G>A (p.R125Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883603" "0" "50" "1" "78383927" "78383927" "subst" "1.21862E-5" "02330" "NEXN_000062" "g.78383927T>C" "" "" "" "NEXN(NM_144573.3):c.416T>C (p.I139T), NEXN(NM_144573.4):c.416T>C (p.I139T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883604" "0" "10" "1" "78390875" "78390875" "subst" "0" "02330" "NEXN_000117" "g.78390875T>A" "" "" "" "NEXN(NM_144573.4):c.450T>A (p.I150=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000883605" "0" "30" "1" "78392195" "78392195" "subst" "0.000118296" "02327" "NEXN_000118" "g.78392195C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000883606" "0" "50" "1" "78395071" "78395071" "subst" "0" "02326" "NEXN_000031" "g.78395071T>A" "" "" "" "NEXN(NM_144573.3):c.935T>A (p.L312H), NEXN(NM_144573.4):c.935T>A (p.L312H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883607" "0" "50" "1" "78399001" "78399001" "subst" "3.67689E-5" "02330" "NEXN_000119" "g.78399001C>G" "" "" "" "NEXN(NM_144573.4):c.1088C>G (p.T363R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883608" "0" "10" "1" "78401675" "78401675" "subst" "3.25545E-5" "02330" "NEXN_000120" "g.78401675A>G" "" "" "" "NEXN(NM_144573.4):c.1419A>G (p.R473=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000883609" "0" "50" "1" "78407853" "78407853" "subst" "4.07169E-6" "02325" "NEXN_000046" "g.78407853T>C" "" "" "" "NEXN(NM_144573.3):c.1619T>C (p.M540T), NEXN(NM_144573.4):c.1619T>C (p.M540T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883610" "0" "50" "1" "78408237" "78408237" "subst" "4.07083E-6" "02327" "FUBP1_000018" "g.78408237T>A" "" "" "" "NEXN(NM_144573.3):c.1751T>A (p.F584Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883611" "0" "50" "1" "78408288" "78408288" "subst" "0" "02325" "FUBP1_000023" "g.78408288T>C" "" "" "" "NEXN(NM_144573.4):c.1802T>C (p.F601S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883612" "0" "50" "1" "78408348" "78408348" "subst" "0" "02325" "FUBP1_000024" "g.78408348T>C" "" "" "" "NEXN(NM_144573.4):c.1862T>C (p.I621T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883613" "0" "50" "1" "78408410" "78408410" "subst" "0" "02330" "FUBP1_000025" "g.78408410C>T" "" "" "" "NEXN(NM_144573.4):c.1924C>T (p.P642S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883614" "0" "50" "1" "78408441" "78408441" "subst" "7.34101E-5" "02327" "NEXN_000054" "g.78408441A>G" "" "" "" "NEXN(NM_144573.3):c.1955A>G (p.Y652C), NEXN(NM_144573.4):c.1955A>G (p.Y652C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911134" "0" "10" "1" "78383467" "78383467" "subst" "0.805968" "02325" "NEXN_000121" "g.78383467G>A" "" "" "" "NEXN(NM_144573.4):c.219+25G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000911135" "0" "30" "1" "78392196" "78392196" "subst" "4.07787E-6" "02326" "NEXN_000122" "g.78392196G>A" "" "" "" "NEXN(NM_144573.3):c.587G>A (p.R196H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000911136" "0" "30" "1" "78392569" "78392569" "subst" "0.000118615" "02325" "NEXN_000123" "g.78392569C>T" "" "" "" "NEXN(NM_144573.4):c.856C>T (p.R286W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000911137" "0" "10" "1" "78399207" "78399207" "subst" "0.755254" "02325" "NEXN_000124" "g.78399207C>G" "" "" "" "NEXN(NM_144573.4):c.1251+43C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000911138" "0" "50" "1" "78407853" "78407853" "subst" "4.07169E-6" "02326" "NEXN_000046" "g.78407853T>C" "" "" "" "NEXN(NM_144573.3):c.1619T>C (p.M540T), NEXN(NM_144573.4):c.1619T>C (p.M540T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911139" "0" "70" "1" "78407895" "78407895" "subst" "4.07378E-6" "02325" "FUBP1_000026" "g.78407895T>C" "" "" "" "NEXN(NM_144573.4):c.1659+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000911140" "0" "50" "1" "78408443" "78408443" "subst" "2.85481E-5" "02330" "FUBP1_000027" "g.78408443A>G" "" "" "" "NEXN(NM_144573.4):c.1957A>G (p.M653V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923243" "0" "50" "1" "78383314" "78383314" "subst" "0" "02330" "NEXN_000125" "g.78383314G>A" "" "" "" "NEXN(NM_144573.4):c.91G>A (p.V31I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923244" "0" "30" "1" "78392445" "78392445" "subst" "0.000602052" "02326" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000923245" "0" "50" "1" "78401663" "78401665" "del" "0" "02330" "NEXN_000103" "g.78401663_78401665del" "" "" "" "NEXN(NM_144573.4):c.1407_1409delAGA (p.E470del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923246" "0" "30" "1" "78407833" "78407833" "subst" "0" "02326" "FUBP1_000028" "g.78407833A>G" "" "" "" "NEXN(NM_144573.3):c.1599A>G (p.E533=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000923247" "0" "50" "1" "78408329" "78408329" "subst" "0" "02326" "FUBP1_000021" "g.78408329T>C" "" "" "" "NEXN(NM_144573.3):c.1843T>C (p.W615R), NEXN(NM_144573.4):c.1843T>C (p.W615R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923248" "0" "50" "1" "78408329" "78408329" "subst" "0" "02327" "FUBP1_000021" "g.78408329T>C" "" "" "" "NEXN(NM_144573.3):c.1843T>C (p.W615R), NEXN(NM_144573.4):c.1843T>C (p.W615R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000928216" "0" "50" "1" "78395038" "78395038" "subst" "1.64434E-5" "02330" "NEXN_000126" "g.78395038T>A" "" "" "" "NEXN(NM_144573.4):c.902T>A (p.I301N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931674" "0" "50" "1" "78408219" "78408219" "dup" "0" "03779" "NEXN_000127" "g.78408219dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000947299" "0" "50" "1" "78383903" "78383903" "subst" "3.24952E-5" "02330" "NEXN_000088" "g.78383903A>G" "" "" "" "NEXN(NM_144573.4):c.392A>G (p.Q131R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947300" "0" "50" "1" "78383927" "78383927" "subst" "1.21862E-5" "02327" "NEXN_000062" "g.78383927T>C" "" "" "" "NEXN(NM_144573.3):c.416T>C (p.I139T), NEXN(NM_144573.4):c.416T>C (p.I139T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947301" "0" "30" "1" "78392548" "78392548" "subst" "0.000493688" "02325" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947302" "0" "50" "1" "78395190" "78395190" "subst" "3.69646E-5" "02327" "NEXN_000073" "g.78395190G>A" "" "" "" "NEXN(NM_144573.3):c.1053+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947303" "0" "50" "1" "78401527" "78401527" "subst" "0" "02327" "NEXN_000128" "g.78401527C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947304" "0" "50" "1" "78401671" "78401671" "subst" "4.88333E-5" "02326" "NEXN_000129" "g.78401671C>G" "" "" "" "NEXN(NM_144573.3):c.1415C>G (p.A472G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947305" "0" "10" "1" "78408265" "78408265" "subst" "0" "02330" "FUBP1_000029" "g.78408265T>G" "" "" "" "NEXN(NM_144573.4):c.1779T>G (p.V593=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000947306" "0" "50" "1" "78408329" "78408329" "subst" "0" "02325" "FUBP1_000021" "g.78408329T>C" "" "" "" "NEXN(NM_144573.3):c.1843T>C (p.W615R), NEXN(NM_144573.4):c.1843T>C (p.W615R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000957742" "0" "70" "1" "78401671" "78401671" "subst" "4.88333E-5" "00006" "NEXN_000129" "g.78401671C>G" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77935986C>G" "" "likely pathogenic" "" "0000957765" "0" "70" "1" "78408504" "78408504" "subst" "4.10384E-6" "00006" "NEXN_000130" "g.78408504G>A" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77942819G>A" "" "likely pathogenic" "" "0000957805" "0" "50" "1" "78392569" "78392569" "subst" "0.000118615" "00006" "NEXN_000123" "g.78392569C>T" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77926884C>T" "" "VUS" "" "0000957841" "0" "70" "1" "78383380" "78383380" "subst" "4.07963E-5" "00006" "NEXN_000005" "g.78383380G>A" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77917695G>A" "" "VUS" "" "0000957906" "0" "50" "1" "78395131" "78395131" "subst" "0.00433821" "00006" "NEXN_000001" "g.78395131A>C" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77929446A>C" "" "VUS" "" "0000961156" "0" "50" "1" "78383675" "78383675" "subst" "8.12797E-6" "02330" "NEXN_000131" "g.78383675G>A" "" "" "" "NEXN(NM_144573.4):c.250G>A (p.E84K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000961157" "0" "50" "1" "78392229" "78392229" "subst" "2.44027E-5" "02326" "NEXN_000016" "g.78392229A>G" "" "" "" "NEXN(NM_144573.3):c.620A>G (p.D207G), NEXN(NM_144573.4):c.620A>G (p.D207G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000961158" "0" "70" "1" "78392255" "78392255" "subst" "4.06865E-6" "02327" "NEXN_000066" "g.78392255C>T" "" "" "" "NEXN(NM_144573.4):c.646C>T (p.R216*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000961159" "0" "50" "1" "78399136" "78399136" "subst" "8.14445E-6" "02329" "NEXN_000132" "g.78399136T>G" "" "" "" "NEXN(NM_144573.4):c.1223T>G (p.F408C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000974115" "0" "10" "1" "78383626" "78383629" "del" "0" "02330" "NEXN_000133" "g.78383626_78383629del" "" "" "" "NEXN(NM_144573.4):c.220-19_220-16delAATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000974116" "0" "30" "1" "78392548" "78392548" "subst" "0.000493688" "01804" "NEXN_000070" "g.78392548C>T" "" "" "" "NEXN(NM_144573.3):c.835C>T (p.R279C), NEXN(NM_144573.4):c.835C>T (p.R279C, p.(Arg279Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000974117" "0" "30" "1" "78395165" "78395165" "subst" "9.03684E-5" "01804" "NEXN_000134" "g.78395165G>A" "" "" "" "NEXN(NM_144573.4):c.1029G>A (p.(Ala343=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000974118" "0" "10" "1" "78407902" "78407902" "subst" "4.07777E-6" "02330" "FUBP1_000030" "g.78407902C>T" "" "" "" "NEXN(NM_144573.4):c.1659+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000985195" "21" "90" "1" "78392512" "78392512" "subst" "4.06855E-6" "03544" "NEXN_000135" "g.78392512G>T" "" "" "" "" "inherited from asymptomatic healthy mother; reported as a variant with incomplete penetrance" "Germline" "no" "rs771262904" "0" "" "" "g.77926827G>T" "{CV:599095}" "pathogenic (!)" "ACMG" "0000989637" "0" "50" "1" "78383858" "78383858" "subst" "0" "03779" "NEXN_000136" "g.78383858A>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000989746" "0" "50" "1" "78407717" "78407717" "subst" "1.64096E-5" "02515" "NEXN_000138" "g.78407717G>A" "" "Fusco 2042, submitted" "" "" "variant definitively linked to disease" "Germline" "" "rs755975282" "0" "" "" "g.77942032G>A" "" "VUS" "" "0000989747" "0" "50" "1" "78407830" "78407830" "subst" "0" "02515" "NEXN_000139" "g.78407830T>G" "" "Fusco 2042, submitted" "" "" "variant definitively linked to disease" "Germline" "" "" "0" "" "" "g.77942145T>G" "" "VUS" "" "0000989748" "0" "50" "1" "78392507" "78392509" "del" "0" "02515" "NEXN_000137" "g.78392507_78392509del" "" "Fusco 2042, submitted" "" "" "variant definitively linked to disease" "Germline" "" "" "0" "" "" "g.77926822_77926824del" "" "VUS" "" "0000991435" "0" "50" "1" "78383336" "78383336" "subst" "0" "01804" "NEXN_000140" "g.78383336T>C" "" "" "" "NEXN(NM_144573.3):c.113T>C (p.(Met38Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991436" "0" "50" "1" "78383927" "78383927" "subst" "1.21862E-5" "02325" "NEXN_000062" "g.78383927T>C" "" "" "" "NEXN(NM_144573.3):c.416T>C (p.I139T), NEXN(NM_144573.4):c.416T>C (p.I139T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991438" "0" "30" "1" "78394996" "78394996" "subst" "0.000102966" "02325" "NEXN_000097" "g.78394996G>A" "" "" "" "NEXN(NM_144573.4):c.865-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991439" "0" "50" "1" "78401682" "78401682" "subst" "0" "02329" "NEXN_000083" "g.78401682G>C" "" "" "" "NEXN(NM_144573.3):c.1426G>C (p.A476P), NEXN(NM_144573.4):c.1426G>C (p.A476P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991440" "0" "70" "1" "78408368" "78408369" "ins" "0" "01804" "FUBP1_000031" "g.78408368_78408369insTT" "" "" "" "NEXN(NM_144573.3):c.1882_1883insTT (p.(Tyr628fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001013347" "0" "10" "1" "78408271" "78408271" "subst" "0.000101733" "02330" "FUBP1_000032" "g.78408271C>T" "" "" "" "NEXN(NM_144573.4):c.1785C>T (p.D595=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001024204" "0" "50" "1" "78383905" "78383905" "subst" "0" "02325" "NEXN_000110" "g.78383905G>C" "" "" "" "NEXN(NM_144573.4):c.394G>C (p.D132H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001024205" "0" "50" "1" "78392157" "78392157" "subst" "0" "02330" "NEXN_000141" "g.78392157G>C" "" "" "" "NEXN(NM_144573.4):c.548G>C (p.G183A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001024206" "0" "50" "1" "78395050" "78395050" "subst" "8.21497E-6" "02330" "NEXN_000142" "g.78395050A>G" "" "" "" "NEXN(NM_144573.4):c.914A>G (p.Y305C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001032189" "0" "30" "1" "78392445" "78392445" "subst" "0.000602052" "01804" "NEXN_000023" "g.78392445C>A" "" "" "" "NEXN(NM_144573.3):c.732C>A (p.P244=), NEXN(NM_144573.4):c.732C>A (p.P244=, p.(Pro244=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001032190" "0" "50" "1" "78395131" "78395133" "del" "0" "02325" "NEXN_000033" "g.78395131_78395133del" "" "" "" "NEXN(NM_144573.4):c.995_997delAAG (p.E332del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045696" "0" "50" "1" "78392139" "78392139" "subst" "4.09608E-6" "02325" "NEXN_000012" "g.78392139A>T" "" "" "" "NEXN(NM_144573.3):c.530A>T (p.K177I), NEXN(NM_144573.4):c.530A>T (p.K177I, p.(Lys177Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045697" "0" "50" "1" "78401505" "78401510" "del" "0" "02325" "NEXN_000143" "g.78401505_78401510del" "" "" "" "NEXN(NM_144573.4):c.1252-3_1254delAAGGAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045698" "0" "50" "1" "78407727" "78407727" "subst" "0" "02326" "FUBP1_000033" "g.78407727G>C" "" "" "" "NEXN(NM_144573.3):c.1493G>C (p.R498T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045699" "0" "30" "1" "78408292" "78408292" "subst" "2.8491E-5" "02326" "FUBP1_000008" "g.78408292G>A" "" "" "" "NEXN(NM_144573.3):c.1806G>A (p.T602=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001047052" "0" "70" "1" "78399084" "78399084" "subst" "1.63046E-5" "03779" "NEXN_000098" "g.78399084C>T" "" "" "" "" "" "Unknown" "" "rs200106758" "0" "" "" "" "" "likely pathogenic" "" "0001050142" "0" "50" "1" "78392139" "78392139" "subst" "4.09608E-6" "01804" "NEXN_000012" "g.78392139A>T" "" "" "" "NEXN(NM_144573.3):c.530A>T (p.K177I), NEXN(NM_144573.4):c.530A>T (p.K177I, p.(Lys177Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063098" "0" "50" "1" "78401675" "78401677" "del" "0" "01804" "NEXN_000042" "g.78401675_78401677del" "" "" "" "NEXN(NM_144573.3):c.1419_1421delAAG (p.R475del), NEXN(NM_144573.4):c.1419_1421del (p.(Arg475del)), NEXN(NM_144573.4):c.1419_1421delAAG (p.R475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063099" "0" "30" "1" "78408380" "78408380" "subst" "3.68005E-5" "02325" "FUBP1_000034" "g.78408380G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001070672" "0" "50" "1" "78408275" "78408275" "subst" "4.06924E-6" "00006" "NEXN_000144" "g.78408275G>A" "" "{PMID:Manzanilla Romero 2026:41746849}" "" "" "possible combination of variants not reported" "Germline" "" "" "0" "" "" "g.77942590G>A" "" "VUS" "" "0001075824" "0" "50" "1" "78392295" "78392295" "subst" "0" "00006" "NEXN_000145" "g.78392295T>C" "" "{PMID:Sambuughin 2024:39457051}" "" "" "combination with other variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.77926610T>C" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NEXN ## Count = 307 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000217969" "00014500" "50" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000245395" "00014500" "10" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000245433" "00014500" "50" "1996" "0" "1996" "0" "c.1996A>G" "r.(?)" "p.(Thr666Ala)" "" "0000245461" "00014500" "10" "579" "0" "579" "0" "c.579A>G" "r.(?)" "p.(Glu193=)" "" "0000245462" "00014500" "10" "1179" "0" "1179" "0" "c.1179A>C" "r.(?)" "p.(Thr393=)" "" "0000245523" "00014500" "10" "864" "11" "864" "11" "c.864+11A>G" "r.(=)" "p.(=)" "" "0000245553" "00014500" "50" "1955" "0" "1955" "0" "c.1955A>G" "r.(?)" "p.(Tyr652Cys)" "" "0000245578" "00014500" "50" "620" "0" "620" "0" "c.620A>G" "r.(?)" "p.(Asp207Gly)" "" "0000245580" "00014500" "50" "1076" "0" "1076" "0" "c.1076A>T" "r.(?)" "p.(Glu359Val)" "" "0000245581" "00014500" "50" "1269" "0" "1269" "0" "c.1269A>T" "r.(?)" "p.(Glu423Asp)" "" "0000248070" "00014500" "30" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000248086" "00014500" "30" "865" "-17" "865" "-17" "c.865-17A>G" "r.(=)" "p.(=)" "" "0000249709" "00014500" "50" "1996" "0" "1996" "0" "c.1996A>G" "r.(?)" "p.(Thr666Ala)" "" "0000249836" "00014500" "50" "182" "0" "182" "0" "c.182A>G" "r.(?)" "p.(Tyr61Cys)" "" "0000250741" "00014500" "10" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000250777" "00014500" "30" "865" "-17" "865" "-17" "c.865-17A>G" "r.(=)" "p.(=)" "" "0000251922" "00014500" "30" "949" "0" "949" "0" "c.949A>C" "r.(?)" "p.(Met317Leu)" "" "0000253744" "00014500" "10" "1659" "30" "1659" "30" "c.1659+30A>G" "r.(=)" "p.(=)" "" "0000253960" "00014500" "30" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000253996" "00014500" "30" "865" "-17" "865" "-17" "c.865-17A>G" "r.(=)" "p.(=)" "" "0000256071" "00014500" "50" "1090" "0" "1090" "0" "c.1090del" "r.(?)" "p.(Ile364SerfsTer19)" "" "0000256140" "00014500" "50" "530" "0" "530" "0" "c.530A>T" "r.(?)" "p.(Lys177Ile)" "" "0000293064" "00014500" "10" "2034" "0" "2035" "0" "c.*6_*7del" "r.(=)" "p.(=)" "" "0000293065" "00014500" "50" "1010" "0" "1010" "0" "c.1010T>C" "r.(?)" "p.(Ile337Thr)" "" "0000293066" "00014500" "50" "1112" "0" "1112" "0" "c.1112C>A" "r.(?)" "p.(Pro371Gln)" "" "0000293067" "00014500" "10" "1408" "0" "1408" "0" "c.1408G>C" "r.(?)" "p.(Glu470Gln)" "" "0000293068" "00014500" "50" "1419" "0" "1421" "0" "c.1419_1421del" "r.(?)" "p.(Arg475del)" "" "0000293069" "00014500" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Glu485Lys)" "" "0000293070" "00014500" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Asp52=)" "" "0000293071" "00014500" "50" "1585" "0" "1585" "0" "c.1585C>A" "r.(?)" "p.(Gln529Lys)" "" "0000293072" "00014500" "10" "1659" "18" "1659" "18" "c.1659+18C>G" "r.(=)" "p.(=)" "" "0000293073" "00014500" "30" "1677" "0" "1682" "0" "c.1677_1682del" "r.(?)" "p.(Glu561_Glu562del)" "" "0000293074" "00014500" "50" "2012" "0" "2012" "0" "c.2012T>C" "r.(?)" "p.(Ile671Thr)" "" "0000293075" "00014500" "10" "363" "0" "363" "0" "c.363G>A" "r.(?)" "p.(Thr121=)" "" "0000293076" "00014500" "10" "512" "0" "512" "0" "c.512T>C" "r.(?)" "p.(Ile171Thr)" "" "0000293077" "00014500" "50" "647" "0" "647" "0" "c.647G>A" "r.(?)" "p.(Arg216Gln)" "" "0000293078" "00014500" "10" "66" "0" "66" "0" "c.66T>C" "r.(?)" "p.(Tyr22=)" "" "0000293079" "00014500" "10" "687" "23" "687" "23" "c.687+23del" "r.(=)" "p.(=)" "" "0000293080" "00014500" "10" "687" "19" "687" "22" "c.687+19_687+22del" "r.(=)" "p.(=)" "" "0000293081" "00014500" "10" "688" "-11" "688" "-11" "c.688-11C>T" "r.(=)" "p.(=)" "" "0000293082" "00014500" "10" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0000293083" "00014500" "10" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Arg)" "" "0000293084" "00014500" "10" "864" "12" "864" "12" "c.864+12T>A" "r.(=)" "p.(=)" "" "0000293085" "00014500" "50" "865" "-14" "865" "-11" "c.865-14_865-11del" "r.(=)" "p.(=)" "" "0000293086" "00014500" "50" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Asp292Asn)" "" "0000293087" "00014500" "30" "893" "0" "893" "0" "c.893C>G" "r.(?)" "p.(Thr298Arg)" "" "0000293088" "00014500" "50" "935" "0" "935" "0" "c.935T>A" "r.(?)" "p.(Leu312His)" "" "0000293089" "00014500" "50" "995" "0" "997" "0" "c.995_997del" "r.(?)" "p.(Glu332del)" "" "0000296423" "00014500" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Pro371Leu)" "" "0000296424" "00014500" "50" "1364" "0" "1364" "0" "c.1364T>C" "r.(?)" "p.(Ile455Thr)" "" "0000296425" "00014500" "10" "1408" "0" "1408" "0" "c.1408G>C" "r.(?)" "p.(Glu470Gln)" "" "0000296426" "00014500" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Glu485Lys)" "" "0000296427" "00014500" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Glu53Lys)" "" "0000296428" "00014500" "30" "1659" "18" "1659" "18" "c.1659+18C>G" "r.(=)" "p.(=)" "" "0000296429" "00014500" "30" "1677" "0" "1682" "0" "c.1677_1682del" "r.(?)" "p.(Glu561_Glu562del)" "" "0000296430" "00014500" "50" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000296431" "00014500" "30" "66" "0" "66" "0" "c.66T>C" "r.(?)" "p.(Tyr22=)" "" "0000296432" "00014500" "30" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0000296433" "00014500" "10" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Arg)" "" "0000296434" "00014500" "30" "864" "12" "864" "12" "c.864+12T>A" "r.(=)" "p.(=)" "" "0000300019" "00014500" "50" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Glu491Gln)" "" "0000300020" "00014500" "10" "1659" "18" "1659" "18" "c.1659+18C>G" "r.(=)" "p.(=)" "" "0000300021" "00014500" "70" "1909" "0" "1912" "0" "c.1909_1912del" "r.(?)" "p.(Tyr637AlafsTer48)" "" "0000300022" "00014500" "30" "66" "0" "66" "0" "c.66T>C" "r.(?)" "p.(Tyr22=)" "" "0000300023" "00014500" "30" "687" "11" "687" "11" "c.687+11G>C" "r.(=)" "p.(=)" "" "0000300024" "00014500" "30" "78" "0" "78" "0" "c.78T>C" "r.(?)" "p.(Leu26=)" "" "0000300025" "00014500" "10" "864" "12" "864" "12" "c.864+12T>A" "r.(=)" "p.(=)" "" "0000300026" "00014500" "30" "893" "0" "893" "0" "c.893C>G" "r.(?)" "p.(Thr298Arg)" "" "0000303017" "00014500" "50" "1010" "0" "1010" "0" "c.1010T>C" "r.(?)" "p.(Ile337Thr)" "" "0000303018" "00014500" "50" "1619" "0" "1619" "0" "c.1619T>C" "r.(?)" "p.(Met540Thr)" "" "0000303019" "00014500" "30" "1634" "0" "1634" "0" "c.1634G>C" "r.(?)" "p.(Arg545Thr)" "" "0000303020" "00014500" "10" "1659" "18" "1659" "18" "c.1659+18C>G" "r.(=)" "p.(=)" "" "0000303021" "00014500" "50" "1878" "0" "1880" "0" "c.1878_1880del" "r.(?)" "p.(Glu626del)" "" "0000303022" "00014500" "10" "219" "11" "219" "11" "c.219+11T>C" "r.(=)" "p.(=)" "" "0000303023" "00014500" "10" "363" "0" "363" "0" "c.363G>A" "r.(?)" "p.(Thr121=)" "" "0000303024" "00014500" "30" "512" "0" "512" "0" "c.512T>C" "r.(?)" "p.(Ile171Thr)" "" "0000303025" "00014500" "50" "590" "0" "591" "0" "c.590_591del" "r.(?)" "p.(Glu197GlyfsTer11)" "" "0000303026" "00014500" "50" "613" "0" "613" "0" "c.613G>A" "r.(?)" "p.(Glu205Lys)" "" "0000303027" "00014500" "30" "66" "0" "66" "0" "c.66T>C" "r.(?)" "p.(Tyr22=)" "" "0000303028" "00014500" "10" "687" "23" "687" "23" "c.687+23del" "r.(=)" "p.(=)" "" "0000303029" "00014500" "30" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0000303030" "00014500" "10" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Arg)" "" "0000303031" "00014500" "30" "78" "0" "78" "0" "c.78T>C" "r.(?)" "p.(Leu26=)" "" "0000303032" "00014500" "10" "864" "12" "864" "12" "c.864+12T>A" "r.(=)" "p.(=)" "" "0000303033" "00014500" "50" "935" "0" "935" "0" "c.935T>A" "r.(?)" "p.(Leu312His)" "" "0000508402" "00014500" "50" "67" "0" "67" "0" "c.67G>A" "r.(?)" "p.(Val23Ile)" "" "0000508403" "00014500" "50" "67" "0" "67" "0" "c.67G>A" "r.(?)" "p.(Val23Ile)" "" "0000508404" "00014500" "10" "78" "0" "78" "0" "c.78T>C" "r.(?)" "p.(Leu26=)" "" "0000508405" "00014500" "30" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(Glu83=)" "" "0000508406" "00014500" "30" "270" "0" "270" "0" "c.270A>G" "r.(?)" "p.(Val90=)" "" "0000508407" "00014500" "10" "363" "0" "363" "0" "c.363G>A" "r.(?)" "p.(Thr121=)" "" "0000508408" "00014500" "50" "416" "0" "416" "0" "c.416T>C" "r.(?)" "p.(Ile139Thr)" "" "0000508409" "00014500" "50" "448" "-3" "448" "-3" "c.448-3T>G" "r.spl?" "p.?" "" "0000508410" "00014500" "50" "530" "0" "530" "0" "c.530A>T" "r.(?)" "p.(Lys177Ile)" "" "0000508411" "00014500" "50" "570" "0" "570" "0" "c.570G>A" "r.(?)" "p.(Glu190=)" "" "0000508412" "00014500" "30" "609" "0" "609" "0" "c.609G>C" "r.(?)" "p.(Lys203Asn)" "" "0000508413" "00014500" "50" "620" "0" "620" "0" "c.620A>G" "r.(?)" "p.(Asp207Gly)" "" "0000508414" "00014500" "50" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216Ter)" "" "0000508415" "00014500" "30" "688" "-10" "688" "-10" "c.688-10G>A" "r.(=)" "p.(=)" "" "0000508416" "00014500" "30" "688" "-10" "688" "-10" "c.688-10G>A" "r.(=)" "p.(=)" "" "0000508417" "00014500" "30" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0000508418" "00014500" "10" "777" "0" "777" "0" "c.777A>G" "r.(?)" "p.(Gln259=)" "" "0000508419" "00014500" "50" "784" "0" "784" "0" "c.784C>T" "r.(?)" "p.(Arg262Ter)" "" "0000508420" "00014500" "10" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000508421" "00014500" "50" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000508422" "00014500" "30" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000508423" "00014500" "10" "865" "-17" "865" "-17" "c.865-17A>G" "r.(=)" "p.(=)" "" "0000508425" "00014500" "30" "917" "0" "917" "0" "c.917G>A" "r.(?)" "p.(Arg306His)" "" "0000508426" "00014500" "50" "995" "0" "997" "0" "c.995_997del" "r.(?)" "p.(Glu332del)" "" "0000508427" "00014500" "30" "1028" "0" "1028" "0" "c.1028C>T" "r.(?)" "p.(Ala343Val)" "" "0000508428" "00014500" "50" "1053" "1" "1053" "1" "c.1053+1G>A" "r.spl?" "p.?" "" "0000508429" "00014500" "50" "1053" "1" "1053" "1" "c.1053+1G>A" "r.spl?" "p.?" "" "0000508430" "00014500" "50" "1078" "0" "1078" "0" "c.1078A>T" "r.(?)" "p.(Met360Leu)" "" "0000508431" "00014500" "50" "1096" "0" "1096" "0" "c.1096C>T" "r.(?)" "p.(Gln366Ter)" "" "0000508432" "00014500" "50" "1166" "0" "1166" "0" "c.1166A>G" "r.(?)" "p.(Glu389Gly)" "" "0000508433" "00014500" "70" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Arg392Ter)" "" "0000508434" "00014500" "50" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Arg392Ter)" "" "0000508436" "00014500" "50" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Arg392Ter)" "" "0000508437" "00014500" "70" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Arg392Ter)" "" "0000508438" "00014500" "50" "1175" "0" "1175" "0" "c.1175G>A" "r.(?)" "p.(Arg392Gln)" "" "0000508439" "00014500" "50" "1226" "0" "1226" "0" "c.1226A>T" "r.(?)" "p.(Glu409Val)" "" "0000508441" "00014500" "30" "1326" "0" "1326" "0" "c.1326T>C" "r.(?)" "p.(Ser442=)" "" "0000508442" "00014500" "50" "1364" "0" "1364" "0" "c.1364T>C" "r.(?)" "p.(Ile455Thr)" "" "0000508443" "00014500" "30" "1368" "0" "1368" "0" "c.1368A>C" "r.(?)" "p.(Gly456=)" "" "0000508444" "00014500" "50" "1419" "0" "1421" "0" "c.1419_1421del" "r.(?)" "p.(Arg475del)" "" "0000508445" "00014500" "50" "1426" "0" "1426" "0" "c.1426G>C" "r.(?)" "p.(Ala476Pro)" "" "0000508447" "00014500" "30" "1435" "0" "1435" "0" "c.1435C>T" "r.(?)" "p.(Leu479Phe)" "" "0000508448" "00014500" "50" "1466" "0" "1466" "0" "c.1466T>G" "r.(?)" "p.(Phe489Cys)" "" "0000508449" "00014500" "50" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Glu491Gln)" "" "0000508450" "00014500" "50" "1481" "0" "1483" "0" "c.1481_1483del" "r.(?)" "p.(Asp494del)" "" "0000508451" "00014500" "30" "1582" "0" "1582" "0" "c.1582G>C" "r.(?)" "p.(Glu528Gln)" "" "0000508452" "00014500" "50" "1582" "0" "1582" "0" "c.1582G>C" "r.(?)" "p.(Glu528Gln)" "" "0000508453" "00014500" "30" "1582" "0" "1582" "0" "c.1582G>C" "r.(?)" "p.(Glu528Gln)" "" "0000508454" "00014500" "10" "1582" "0" "1584" "0" "c.1582_1584del" "r.(?)" "p.(Glu528del)" "" "0000508455" "00014500" "30" "1582" "0" "1584" "0" "c.1582_1584del" "r.(?)" "p.(Glu528del)" "" "0000508456" "00014500" "30" "1659" "18" "1659" "18" "c.1659+18C>G" "r.(=)" "p.(=)" "" "0000508457" "00014500" "50" "1661" "0" "1665" "0" "c.1661_1665del" "r.(?)" "p.(Lys554ArgfsTer9)" "" "0000508458" "00014500" "50" "1749" "0" "1749" "0" "c.1749G>A" "r.(?)" "p.(Trp583Ter)" "" "0000508459" "00014500" "50" "1749" "0" "1749" "0" "c.1749G>A" "r.(?)" "p.(Trp583Ter)" "" "0000508460" "00014500" "30" "1788" "0" "1788" "0" "c.1788T>G" "r.(?)" "p.(Ser596Arg)" "" "0000508462" "00014500" "30" "1788" "0" "1788" "0" "c.1788T>G" "r.(?)" "p.(Ser596Arg)" "" "0000508463" "00014500" "30" "1788" "0" "1788" "0" "c.1788T>G" "r.(?)" "p.(Ser596Arg)" "" "0000508464" "00014500" "30" "1788" "0" "1788" "0" "c.1788T>G" "r.(?)" "p.(Ser596Arg)" "" "0000508465" "00014500" "50" "1799" "0" "1799" "0" "c.1799G>A" "r.(?)" "p.(Arg600Lys)" "" "0000508466" "00014500" "30" "1806" "0" "1806" "0" "c.1806G>A" "r.(?)" "p.(Thr602=)" "" "0000508467" "00014500" "50" "1878" "0" "1880" "0" "c.1878_1880del" "r.(?)" "p.(Glu626del)" "" "0000508469" "00014500" "50" "2026" "0" "2029" "0" "c.2026_*1del" "r.(?)" "p.(Ter676HisextTer8)" "" "0000605951" "00014500" "30" "28" "-18" "28" "-18" "c.28-18T>A" "r.(=)" "p.(=)" "" "0000605952" "00014500" "50" "67" "0" "67" "0" "c.67G>A" "r.(?)" "p.(Val23Ile)" "" "0000605953" "00014500" "10" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(Glu83=)" "" "0000605954" "00014500" "30" "299" "-3" "299" "-3" "c.299-3T>C" "r.spl?" "p.?" "" "0000605955" "00014500" "50" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000605956" "00014500" "50" "392" "0" "392" "0" "c.392A>G" "r.(?)" "p.(Gln131Arg)" "" "0000605957" "00014500" "10" "447" "18" "447" "18" "c.447+18G>A" "r.(=)" "p.(=)" "" "0000605958" "00014500" "30" "467" "0" "467" "0" "c.467C>T" "r.(?)" "p.(Thr156Met)" "" "0000605959" "00014500" "30" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000605960" "00014500" "50" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Arg286Gln)" "" "0000605961" "00014500" "30" "865" "-17" "865" "-17" "c.865-17A>G" "r.(=)" "p.(=)" "" "0000605962" "00014500" "30" "893" "0" "893" "0" "c.893C>G" "r.(?)" "p.(Thr298Arg)" "" "0000605963" "00014500" "30" "987" "0" "987" "0" "c.987A>C" "r.(?)" "p.(Ala329=)" "" "0000605964" "00014500" "10" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000605965" "00014500" "30" "1066" "0" "1066" "0" "c.1066G>C" "r.(?)" "p.(Asp356His)" "" "0000605966" "00014500" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Pro371Leu)" "" "0000605967" "00014500" "70" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Arg392Ter)" "" "0000605968" "00014500" "30" "1252" "-5" "1252" "-5" "c.1252-5dup" "r.spl?" "p.?" "" "0000605969" "00014500" "30" "1269" "0" "1269" "0" "c.1269A>T" "r.(?)" "p.(Glu423Asp)" "" "0000605970" "00014500" "30" "1419" "0" "1421" "0" "c.1419_1421del" "r.(?)" "p.(Arg475del)" "" "0000605971" "00014500" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Glu485Lys)" "" "0000605972" "00014500" "50" "1529" "0" "1529" "0" "c.1529A>G" "r.(?)" "p.(Lys510Arg)" "" "0000605974" "00014500" "10" "1618" "0" "1618" "0" "c.1618A>G" "r.(?)" "p.(Met540Val)" "" "0000605975" "00014500" "70" "1949" "0" "1951" "0" "c.1949_1951del" "r.(?)" "p.(Gly650del)" "" "0000620699" "00014500" "30" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Asp52=)" "" "0000620700" "00014500" "50" "1955" "0" "1955" "0" "c.1955A>G" "r.(?)" "p.(Tyr652Cys)" "" "0000647778" "00014500" "50" "1190" "0" "1190" "0" "c.1190G>A" "r.(?)" "p.(Arg397Gln)" "" "0000647779" "00014500" "50" "1955" "0" "1955" "0" "c.1955A>G" "r.(?)" "p.(Tyr652Cys)" "" "0000654109" "00014500" "50" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Glu59Lys)" "" "0000654110" "00014500" "50" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000654111" "00014500" "10" "865" "-5" "865" "-5" "c.865-5G>A" "r.spl?" "p.?" "" "0000654112" "00014500" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Pro371Leu)" "" "0000654113" "00014500" "50" "1171" "0" "1171" "0" "c.1171C>T" "r.(?)" "p.(Arg391Ter)" "" "0000654114" "00014500" "50" "1586" "0" "1586" "0" "c.1586A>C" "r.(?)" "p.(Gln529Pro)" "" "0000654115" "00014500" "50" "1733" "0" "1733" "0" "c.1733G>T" "r.(?)" "p.(Arg578Ile)" "" "0000654116" "00014500" "50" "1997" "0" "1997" "0" "c.1997C>A" "r.(?)" "p.(Thr666Asn)" "" "0000654117" "00014500" "10" "2032" "0" "2032" "0" "c.*4C>T" "r.(=)" "p.(=)" "" "0000675935" "00014500" "50" "392" "0" "392" "0" "c.392A>G" "r.(?)" "p.(Gln131Arg)" "" "0000675936" "00014500" "50" "687" "4" "687" "4" "c.687+4A>T" "r.spl?" "p.?" "" "0000675937" "00014500" "50" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Asp292Asn)" "" "0000675938" "00014500" "30" "1582" "0" "1582" "0" "c.1582G>C" "r.(?)" "p.(Glu528Gln)" "" "0000675939" "00014500" "50" "1751" "0" "1751" "0" "c.1751T>A" "r.(?)" "p.(Phe584Tyr)" "" "0000688246" "00014500" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Glu53Lys)" "" "0000688247" "00014500" "30" "1252" "-14" "1252" "-11" "c.1252-14_1252-11del" "r.(=)" "p.(=)" "" "0000688248" "00014500" "50" "1810" "0" "1810" "0" "c.1810A>G" "r.(?)" "p.(Lys604Glu)" "" "0000688249" "00014500" "50" "1949" "0" "1951" "0" "c.1949_1951del" "r.(?)" "p.(Gly650del)" "" "0000701372" "00014500" "50" "341" "0" "342" "0" "c.341_342del" "r.(?)" "p.(Gln114Argfs*16)" "" "0000701373" "00014500" "50" "392" "0" "392" "0" "c.392A>G" "r.(?)" "p.(Gln131Arg)" "" "0000701374" "00014500" "50" "893" "0" "893" "0" "c.893C>G" "r.(?)" "p.(Thr298Arg)" "" "0000701375" "00014500" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Pro371Leu)" "" "0000701376" "00014500" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Gly456Arg)" "" "0000701377" "00014500" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Glu485Lys)" "" "0000701378" "00014500" "50" "1457" "0" "1457" "0" "c.1457C>G" "r.(?)" "p.(Ala486Gly)" "" "0000701379" "00014500" "50" "1937" "0" "1937" "0" "c.1937C>A" "r.(?)" "p.(Pro646Gln)" "" "0000701642" "00014500" "50" "1053" "1" "1053" "1" "c.1053+1G>A" "r.spl" "p.?" "" "0000701643" "00014500" "50" "1407" "0" "1409" "0" "c.1407_1409del" "r.(?)" "p.(Glu470del)" "" "0000701644" "00014500" "50" "1677" "0" "1682" "0" "c.1677_1682del" "r.(?)" "p.(Glu561_Glu562del)" "" "0000701645" "00014500" "50" "1756" "0" "1758" "0" "c.1756_1758del" "r.(?)" "p.(Lys586del)" "" "0000701646" "00014500" "50" "1996" "0" "1996" "0" "c.1996A>G" "r.(?)" "p.(Thr666Ala)" "" "0000701788" "00014500" "50" "995" "0" "997" "0" "c.995_997del" "r.(?)" "p.(Glu332del)" "" "0000717703" "00014500" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Glu53Lys)" "" "0000717704" "00014500" "30" "777" "0" "777" "0" "c.777A>G" "r.(?)" "p.(Gln259=)" "" "0000717705" "00014500" "50" "1364" "0" "1364" "0" "c.1364T>C" "r.(?)" "p.(Ile455Thr)" "" "0000717706" "00014500" "30" "1368" "0" "1368" "0" "c.1368A>C" "r.(?)" "p.(Gly456=)" "" "0000717707" "00014500" "50" "1450" "0" "1450" "0" "c.1450C>T" "r.(?)" "p.(Arg484*)" "" "0000799531" "00014500" "30" "512" "0" "512" "0" "c.512T>C" "r.(?)" "p.(Ile171Thr)" "" "0000799532" "00014500" "30" "1582" "0" "1584" "0" "c.1582_1584del" "r.(?)" "p.(Glu528del)" "" "0000799533" "00014500" "30" "1618" "0" "1618" "0" "c.1618A>G" "r.(?)" "p.(Met540Val)" "" "0000799534" "00014500" "50" "1843" "0" "1843" "0" "c.1843T>C" "r.(?)" "p.(Trp615Arg)" "" "0000848850" "00014500" "30" "66" "0" "66" "0" "c.66T>C" "r.(?)" "p.(Tyr22=)" "" "0000848851" "00014500" "50" "88" "0" "88" "0" "c.88G>C" "r.(?)" "p.(Asp30His)" "" "0000848852" "00014500" "50" "379" "0" "379" "0" "c.379C>T" "r.(?)" "p.(Arg127Cys)" "" "0000848853" "00014500" "50" "394" "0" "394" "0" "c.394G>C" "r.(?)" "p.(Asp132His)" "" "0000848854" "00014500" "50" "475" "0" "475" "0" "c.475G>A" "r.(?)" "p.(Glu159Lys)" "" "0000848855" "00014500" "50" "490" "-24" "490" "0" "c.490-24_490del" "r.spl?" "p.?" "" "0000848856" "00014500" "30" "712" "0" "712" "0" "c.712A>C" "r.(?)" "p.(Lys238Gln)" "" "0000848858" "00014500" "30" "1435" "0" "1435" "0" "c.1435C>T" "r.(?)" "p.(Leu479Phe)" "" "0000848859" "00014500" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Glu485Lys)" "" "0000848860" "00014500" "30" "1650" "0" "1650" "0" "c.1650A>C" "r.(?)" "p.(Ala550=)" "" "0000848861" "00014500" "30" "1677" "0" "1682" "0" "c.1677_1682del" "r.(?)" "p.(Glu561_Glu562del)" "" "0000848862" "00014500" "50" "1733" "0" "1733" "0" "c.1733G>T" "r.(?)" "p.(Arg578Ile)" "" "0000848863" "00014500" "50" "1810" "0" "1810" "0" "c.1810A>G" "r.(?)" "p.(Lys604Glu)" "" "0000857610" "00014500" "10" "363" "0" "363" "0" "c.363G>A" "r.(?)" "p.(Thr121=)" "" "0000878859" "00014500" "70" "1579" "0" "1584" "0" "c.1579_1584del" "r.(?)" "p.(Glu527_Glu528del)" "12" "0000883601" "00014500" "30" "-52" "-16" "-52" "-16" "c.-52-16T>C" "r.(=)" "p.(=)" "" "0000883602" "00014500" "50" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "" "0000883603" "00014500" "50" "416" "0" "416" "0" "c.416T>C" "r.(?)" "p.(Ile139Thr)" "" "0000883604" "00014500" "10" "450" "0" "450" "0" "c.450T>A" "r.(?)" "p.(Ile150=)" "" "0000883605" "00014500" "30" "586" "0" "586" "0" "c.586C>T" "r.(?)" "p.(Arg196Cys)" "" "0000883606" "00014500" "50" "935" "0" "935" "0" "c.935T>A" "r.(?)" "p.(Leu312His)" "" "0000883607" "00014500" "50" "1088" "0" "1088" "0" "c.1088C>G" "r.(?)" "p.(Thr363Arg)" "" "0000883608" "00014500" "10" "1419" "0" "1419" "0" "c.1419A>G" "r.(?)" "p.(Arg473=)" "" "0000883609" "00014500" "50" "1619" "0" "1619" "0" "c.1619T>C" "r.(?)" "p.(Met540Thr)" "" "0000883610" "00014500" "50" "1751" "0" "1751" "0" "c.1751T>A" "r.(?)" "p.(Phe584Tyr)" "" "0000883611" "00014500" "50" "1802" "0" "1802" "0" "c.1802T>C" "r.(?)" "p.(Phe601Ser)" "" "0000883612" "00014500" "50" "1862" "0" "1862" "0" "c.1862T>C" "r.(?)" "p.(Ile621Thr)" "" "0000883613" "00014500" "50" "1924" "0" "1924" "0" "c.1924C>T" "r.(?)" "p.(Pro642Ser)" "" "0000883614" "00014500" "50" "1955" "0" "1955" "0" "c.1955A>G" "r.(?)" "p.(Tyr652Cys)" "" "0000911134" "00014500" "10" "219" "25" "219" "25" "c.219+25G>A" "r.(=)" "p.(=)" "" "0000911135" "00014500" "30" "587" "0" "587" "0" "c.587G>A" "r.(?)" "p.(Arg196His)" "" "0000911136" "00014500" "30" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286Trp)" "" "0000911137" "00014500" "10" "1251" "43" "1251" "43" "c.1251+43C>G" "r.(=)" "p.(=)" "" "0000911138" "00014500" "50" "1619" "0" "1619" "0" "c.1619T>C" "r.(?)" "p.(Met540Thr)" "" "0000911139" "00014500" "70" "1659" "2" "1659" "2" "c.1659+2T>C" "r.spl?" "p.?" "" "0000911140" "00014500" "50" "1957" "0" "1957" "0" "c.1957A>G" "r.(?)" "p.(Met653Val)" "" "0000923243" "00014500" "50" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000923244" "00014500" "30" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0000923245" "00014500" "50" "1407" "0" "1409" "0" "c.1407_1409del" "r.(?)" "p.(Glu470del)" "" "0000923246" "00014500" "30" "1599" "0" "1599" "0" "c.1599A>G" "r.(?)" "p.(Glu533=)" "" "0000923247" "00014500" "50" "1843" "0" "1843" "0" "c.1843T>C" "r.(?)" "p.(Trp615Arg)" "" "0000923248" "00014500" "50" "1843" "0" "1843" "0" "c.1843T>C" "r.(?)" "p.(Trp615Arg)" "" "0000928216" "00014500" "50" "902" "0" "902" "0" "c.902T>A" "r.(?)" "p.(Ile301Asn)" "" "0000931674" "00014500" "50" "1733" "0" "1733" "0" "c.1733dup" "r.(?)" "p.(Ser579IlefsTer11)" "" "0000947299" "00014500" "50" "392" "0" "392" "0" "c.392A>G" "r.(?)" "p.(Gln131Arg)" "" "0000947300" "00014500" "50" "416" "0" "416" "0" "c.416T>C" "r.(?)" "p.(Ile139Thr)" "" "0000947301" "00014500" "30" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000947302" "00014500" "50" "1053" "1" "1053" "1" "c.1053+1G>A" "r.spl?" "p.?" "" "0000947303" "00014500" "50" "1271" "0" "1271" "0" "c.1271C>A" "r.(?)" "p.(Thr424Asn)" "" "0000947304" "00014500" "50" "1415" "0" "1415" "0" "c.1415C>G" "r.(?)" "p.(Ala472Gly)" "" "0000947305" "00014500" "10" "1779" "0" "1779" "0" "c.1779T>G" "r.(?)" "p.(=)" "" "0000947306" "00014500" "50" "1843" "0" "1843" "0" "c.1843T>C" "r.(?)" "p.(Trp615Arg)" "" "0000957742" "00014500" "70" "1415" "0" "1415" "0" "c.1415C>G" "r.(?)" "p.(Ala472Gly)" "" "0000957765" "00014500" "70" "2018" "0" "2018" "0" "c.2018G>A" "r.(?)" "p.(Ser673Asn)" "" "0000957805" "00014500" "50" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286Trp)" "" "0000957841" "00014500" "70" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Glu53Lys)" "" "0000957906" "00014500" "50" "995" "0" "995" "0" "c.995A>C" "r.(?)" "p.(Glu332Ala)" "" "0000961156" "00014500" "50" "250" "0" "250" "0" "c.250G>A" "r.(?)" "p.(Glu84Lys)" "" "0000961157" "00014500" "50" "620" "0" "620" "0" "c.620A>G" "r.(?)" "p.(Asp207Gly)" "" "0000961158" "00014500" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216Ter)" "" "0000961159" "00014500" "50" "1223" "0" "1223" "0" "c.1223T>G" "r.(?)" "p.(Phe408Cys)" "" "0000974115" "00014500" "10" "220" "-19" "220" "-16" "c.220-19_220-16del" "r.(=)" "p.(=)" "" "0000974116" "00014500" "30" "835" "0" "835" "0" "c.835C>T" "r.(?)" "p.(Arg279Cys)" "" "0000974117" "00014500" "30" "1029" "0" "1029" "0" "c.1029G>A" "r.(?)" "p.(=)" "" "0000974118" "00014500" "10" "1659" "9" "1659" "9" "c.1659+9C>T" "r.(=)" "p.(=)" "" "0000985195" "00014500" "90" "799" "0" "799" "0" "c.799G>T" "r.(?)" "p.(Glu267*)" "8" "0000989637" "00014500" "50" "347" "0" "347" "0" "c.347A>G" "r.(?)" "p.(Glu116Gly)" "" "0000989746" "00014500" "50" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "" "0000989747" "00014500" "50" "1596" "0" "1596" "0" "c.1596T>G" "r.(?)" "p.(Ile532Met)" "" "0000989748" "00014500" "50" "794" "0" "796" "0" "c.794_796del" "r.(?)" "p.(Gln265_Ala266delinsPro)" "" "0000991435" "00014500" "50" "113" "0" "113" "0" "c.113T>C" "r.(?)" "p.(Met38Thr)" "" "0000991436" "00014500" "50" "416" "0" "416" "0" "c.416T>C" "r.(?)" "p.(Ile139Thr)" "" "0000991438" "00014500" "30" "865" "-5" "865" "-5" "c.865-5G>A" "r.spl?" "p.?" "" "0000991439" "00014500" "50" "1426" "0" "1426" "0" "c.1426G>C" "r.(?)" "p.(Ala476Pro)" "" "0000991440" "00014500" "70" "1882" "0" "1883" "0" "c.1882_1883insTT" "r.(?)" "p.(Tyr628Phefs*59)" "" "0001013347" "00014500" "10" "1785" "0" "1785" "0" "c.1785C>T" "r.(?)" "p.(=)" "" "0001024204" "00014500" "50" "394" "0" "394" "0" "c.394G>C" "r.(?)" "p.(Asp132His)" "" "0001024205" "00014500" "50" "548" "0" "548" "0" "c.548G>C" "r.(?)" "p.(Gly183Ala)" "" "0001024206" "00014500" "50" "914" "0" "914" "0" "c.914A>G" "r.(?)" "p.(Tyr305Cys)" "" "0001032189" "00014500" "30" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Pro244=)" "" "0001032190" "00014500" "50" "995" "0" "997" "0" "c.995_997del" "r.(?)" "p.(Glu332del)" "" "0001045696" "00014500" "50" "530" "0" "530" "0" "c.530A>T" "r.(?)" "p.(Lys177Ile)" "" "0001045697" "00014500" "50" "1252" "-3" "1254" "0" "c.1252-3_1254del" "r.spl?" "p.?" "" "0001045698" "00014500" "50" "1493" "0" "1493" "0" "c.1493G>C" "r.(?)" "p.(Arg498Thr)" "" "0001045699" "00014500" "30" "1806" "0" "1806" "0" "c.1806G>A" "r.(?)" "p.(Thr602=)" "" "0001047052" "00014500" "70" "1171" "0" "1171" "0" "c.1171C>T" "r.(?)" "p.(Arg391Ter)" "" "0001050142" "00014500" "50" "530" "0" "530" "0" "c.530A>T" "r.(?)" "p.(Lys177Ile)" "" "0001063098" "00014500" "50" "1419" "0" "1421" "0" "c.1419_1421del" "r.(?)" "p.(Arg475del)" "" "0001063099" "00014500" "30" "1894" "0" "1894" "0" "c.1894G>C" "r.(?)" "p.(Glu632Gln)" "" "0001070672" "00014500" "50" "1789" "0" "1789" "0" "c.1789G>A" "r.(?)" "p.(Glu597Lys)" "" "0001075824" "00014500" "50" "686" "0" "686" "0" "c.686T>C" "r.(?)" "p.(Met229Thr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 29 "{{screeningid}}" "{{variantid}}" "0000128837" "0000217969" "0000291089" "0000647778" "0000291090" "0000647779" "0000297834" "0000701788" "0000318766" "0000701372" "0000318767" "0000701373" "0000318768" "0000701374" "0000318769" "0000701375" "0000318770" "0000701376" "0000318771" "0000701377" "0000318772" "0000701378" "0000318773" "0000701379" "0000319036" "0000701642" "0000319037" "0000701643" "0000319038" "0000701644" "0000319039" "0000701645" "0000319040" "0000701646" "0000418945" "0000878859" "0000448335" "0000957742" "0000448358" "0000957765" "0000448364" "0000957906" "0000448398" "0000957805" "0000448434" "0000957841" "0000451341" "0000985195" "0000454845" "0000989746" "0000454846" "0000989747" "0000454847" "0000989748" "0000475952" "0001070672" "0000479833" "0001075824"