### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NFIA) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NFIA" "nuclear factor I/A" "1" "p31.3-p31.2" "unknown" "NC_000001.10" "UD_132119078728" "" "https://www.LOVD.nl/NFIA" "" "1" "7784" "4774" "600727" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/NFIA_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2023-09-25 12:05:47" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025855" "NFIA" "transcript variant 1" "003" "NM_001134673.3" "" "NP_001128145.1" "" "" "" "-484" "8998" "1530" "61547980" "61928460" "00006" "2023-09-25 12:06:13" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04327" "CRS" "craniosynostosis (CRS)" "" "" "" "" "" "00006" "2015-09-12 20:59:03" "" "" "05998" "BRMUTD" "Brain malformations with or without urinary tract defects" "AD" "613735" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "NFIA" "05998" ## Individuals ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00269492" "" "" "" "1" "" "00006" "{PMID:Mikhail 2011:22031302}, {DOI:Mikhail 2011:10.1002/ajmg.a.34177}" "" "F" "" "" "" "0" "" "" "" "Pat1" "00436596" "" "" "" "1" "" "04567" "" "" "M" "no" "" "" "" "" "" "" "" "00436597" "" "" "" "1" "" "04567" "" "" "F" "no" "" "" "" "" "" "" "" "00436598" "" "" "" "1" "" "04567" "" "" "M" "no" "" "" "" "" "" "" "" "00436623" "" "" "" "1" "" "04567" "" "" "M" "no" "" "" "" "" "" "" "" "00436628" "" "" "" "1" "" "00006" "{PMID:Negishi 2015:27081522}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Japan" "" "0" "" "" "" "patient" "00436629" "" "" "" "1" "" "00006" "{PMID:Rao 2014:24462883}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "no" "Australia" "" "0" "" "" "" "patient" "00436630" "" "" "" "4" "" "00006" "{PMID:Nyboe 2015:25714559}" "2-generation family, 4 affected (F, 3M) father/daughter, 2 sons)" "F" "" "Denmark" "" "0" "" "" "" "FamPatII1" "00436631" "" "" "00436630" "1" "" "00006" "{PMID:Nyboe 2015:25714559}" "brother" "M" "" "Denmark" "" "0" "" "" "" "FamPatII2" "00436632" "" "" "00436630" "1" "" "00006" "{PMID:Nyboe 2015:25714559}" "brother" "M" "" "Denmark" "" "0" "" "" "" "FamPatII3" "00436633" "" "" "00436630" "1" "" "00006" "{PMID:Nyboe 2015:25714559}" "father" "M" "" "Denmark" "" "0" "" "" "" "FamPatI1" "00457834" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "311330" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 12 "{{individualid}}" "{{diseaseid}}" "00269492" "00198" "00436596" "05998" "00436597" "05998" "00436598" "05998" "00436623" "05998" "00436628" "00198" "00436629" "00198" "00436630" "04327" "00436631" "04327" "00436632" "04327" "00436633" "04327" "00457834" "05998" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 04327, 05998 ## Count = 11 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000207323" "00198" "00269492" "00006" "Unknown" "25y" "see paper; ..., intellectual disability, bipolar disorder, depression, incapable of making own decisions, no seizures, macrocephaly, high-forehead, hypotelorism, high palate, pointed chin, webbed neck, scoliosis, hydrocephalus, hypoplasia corpus callosum" "" "" "" "" "" "" "" "" "" "" "" "0000326745" "05998" "00436597" "04567" "-" "07y" "" "" "" "07y" "" "" "" "" "" "" "Developmental delay" "" "0000326746" "05998" "00436598" "04567" "-" "13y" "" "" "" "" "" "" "" "" "" "" "Macrocephaly" "" "0000326763" "05998" "00436596" "04567" "Isolated (sporadic)" "03y" "Frontal bossing" "" "" "" "" "" "" "" "" "" "Macrocephaly" "" "0000326764" "00198" "00436628" "00006" "Isolated (sporadic)" "05y" "see paper; ..., 28w-callosal agenesis; 41w-born by cesarean section due to enlargement head circumference, post-term pregnancy" "" "" "" "" "" "" "" "" "BRMUTD" "brain malformation, urinary tract defects" "" "0000326765" "00198" "00436629" "00006" "Isolated (sporadic)" "08y" "see paper; ..., hypoplastic corpus callosum, craniofacial abnormalities, urinary tract defects, developmental delay, metopic synostosis, macroscopic haemoglobinuria; hypoplasia corpus callosum, ventriculomegaly, metopic craniosynostoses, macrocephaly, developmental delay, dysmorphic features, no seizures, no Chiari I malformation, no tethered spinal cord, cutis marmorata, muscular hypotonia (improving); ultra sound pelvi-ureteric kinking; macroscopic haematuria" "" "" "" "" "" "" "" "" "BRMUTD" "hypoplastic corpus callosum, craniofacial abnormalities, urinary tract defects" "" "0000326766" "04327" "00436630" "00006" "Familial, autosomal dominant" "13y" "see paper; ..., hypoplasia or abscent corpus callosum, ventriculomegaly, lambdoid craniosynostosis, macrocephaly, develomental delay, dysmorphic features, no urinary tract defects" "" "" "" "" "" "" "" "" "BRMUTD" "craniosynostosis" "" "0000326767" "04327" "00436631" "00006" "Familial, autosomal dominant" "10y" "see paper; ..., hypoplasia or abscent corpus callosum, ventriculomegaly, no craniosynostosis, macrocephaly, develomental delay, dysmorphic features, urinary tract defects" "" "" "" "" "" "" "" "" "BRMUTD" "craniosynostosis" "" "0000326768" "04327" "00436632" "00006" "Familial, autosomal dominant" "6y" "see paper; ..., hypoplasia or abscent corpus callosum, ventriculomegaly, lambdoid craniosynostosis, macrocephaly, develomental delay, dysmorphic features, no urinary tract defects" "" "" "" "" "" "" "" "" "BRMUTD" "craniosynostosis" "" "0000326769" "04327" "00436633" "00006" "Familial, autosomal dominant" "42y" "see paper; ..., hypoplasia or abscent corpus callosum, no ventriculomegaly, sagittal craniosynostosis, macrocephaly, no develomental delay, no dysmorphic features, urinary tract defects" "" "" "" "" "" "" "" "" "BRMUTD" "craniosynostosis" "" "0000346282" "05998" "00457834" "01164" "Isolated (sporadic)" "06y" "Myotonia, Macrocephaly, Axial hypotonia, Gait disturbance, Frontal bossing, Low-set ears, Wide intermamillary distance, Hydrocephalus, Motor delay, Short attention span" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000270646" "00269492" "1" "00006" "00006" "2019-11-28 19:57:10" "00006" "2019-11-28 19:59:35" "arrayCGH;FISH" "DNA" "" "" "0000438080" "00436596" "1" "04567" "04567" "2023-09-22 19:31:39" "04567" "2023-09-22 22:41:51" "SEQ-NG" "DNA" "Blood" "" "0000438081" "00436597" "1" "04567" "04567" "2023-09-22 20:45:44" "04567" "2023-09-22 22:42:13" "SEQ-NG" "DNA" "Blood" "" "0000438083" "00436598" "1" "04567" "04567" "2023-09-22 21:07:09" "04567" "2023-09-22 22:42:31" "SEQ-NG" "DNA" "Blood" "" "0000438106" "00436623" "1" "04567" "04567" "2023-09-23 15:52:08" "" "" "SEQ-NG" "DNA" "Blood" "" "0000438111" "00436628" "1" "00006" "00006" "2023-09-25 18:57:13" "" "" "SEQ-NG" "DNA" "" "trio WES" "0000438112" "00436629" "1" "00006" "00006" "2023-09-25 19:04:48" "" "" "arrayCGH" "DNA" "" "" "0000438113" "00436630" "1" "00006" "00006" "2023-09-25 19:28:10" "" "" "arrayCGH" "DNA" "" "" "0000438114" "00436631" "1" "00006" "00006" "2023-09-25 19:42:54" "" "" "arrayCGH" "DNA" "" "" "0000438115" "00436632" "1" "00006" "00006" "2023-09-25 19:44:47" "" "" "arrayCGH" "DNA" "" "" "0000438116" "00436633" "1" "00006" "00006" "2023-09-25 19:47:12" "" "" "arrayCGH" "DNA" "" "" "0000459454" "00457834" "1" "01164" "01164" "2024-11-20 12:39:25" "" "" "SEQ-NG-I" "DNA" "Blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 6 "{{screeningid}}" "{{geneid}}" "0000270646" "NFIA" "0000438080" "NFIA" "0000438081" "NFIA" "0000438083" "NFIA" "0000438106" "NFIA" "0000459454" "NFIA" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 53 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000298573" "0" "70" "1" "61818161" "61818161" "subst" "0" "02329" "NFIA_000001" "g.61818161C>G" "" "" "" "NFIA(NM_001134673.4):c.740C>G (p.S247*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.61352489C>G" "" "likely pathogenic" "" "0000304106" "0" "10" "1" "61872225" "61872225" "subst" "0" "01943" "NFIA_000002" "g.61872225C>G" "" "" "" "NFIA(NM_001134673.4):c.1255-9C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.61406553C>G" "" "benign" "" "0000342804" "0" "50" "1" "61849013" "61849013" "subst" "0" "02327" "NFIA_000003" "g.61849013C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.61383341C>T" "" "VUS" "" "0000348993" "0" "30" "1" "61869779" "61869779" "subst" "0" "02327" "NFIA_000004" "g.61869779G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.61404107G>A" "" "likely benign" "" "0000508086" "0" "30" "1" "61553815" "61553815" "subst" "0" "01804" "NFIA_000005" "g.61553815T>G" "" "" "" "NFIA(NM_001134673.4):c.28-6T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61088143T>G" "" "likely benign" "" "0000508089" "0" "30" "1" "61824926" "61824926" "subst" "0" "01804" "NFIA_000006" "g.61824926G>C" "" "" "" "NFIA(NM_001134673.3):c.926G>C (p.(Gly309Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61359254G>C" "" "likely benign" "" "0000508091" "0" "90" "1" "61869901" "61869901" "subst" "0" "01943" "NFIA_000008" "g.61869901C>T" "" "" "" "NFIA(NM_001134673.4):c.1201C>T (p.Q401*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61404229C>T" "" "pathogenic" "" "0000508093" "0" "10" "1" "61872228" "61872229" "ins" "0" "01943" "NFIA_000009" "g.61872228_61872229insT" "" "" "" "NFIA(NM_001145512.1):c.1390-6_1390-5insT, NFIA(NM_005595.5):c.1255-6_1255-5insT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406556_61406557insT" "" "benign" "" "0000508095" "0" "30" "1" "61872230" "61872230" "subst" "0" "01804" "NFIA_000011" "g.61872230A>C" "" "" "" "NFIA(NM_001134673.3):c.1255-4A>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406558A>C" "" "likely benign" "" "0000508096" "0" "30" "1" "61872232" "61872232" "subst" "0" "01804" "NFIA_000012" "g.61872232A>C" "" "" "" "NFIA(NM_001134673.3):c.1255-2A>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406560A>C" "" "likely benign" "" "0000508097" "0" "30" "1" "61872232" "61872233" "del" "0.00313151" "01804" "NFIA_000013" "g.61872232_61872233del" "" "" "" "NFIA(NM_001134673.3):c.1255-2_1255-1del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406560_61406561del" "" "likely benign" "" "0000508098" "0" "30" "1" "61872233" "61872233" "subst" "0" "01804" "NFIA_000014" "g.61872233G>C" "" "" "" "NFIA(NM_001134673.3):c.1255-1G>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406561G>C" "" "likely benign" "" "0000508100" "0" "30" "1" "61872392" "61872392" "subst" "0.00018856" "01943" "NFIA_000016" "g.61872392G>A" "" "" "" "NFIA(NM_001134673.4):c.1413G>A (p.T471=), NFIA(NM_001145512.1):c.1548G>A (p.T516=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406720G>A" "" "likely benign" "" "0000508101" "0" "30" "1" "61872392" "61872392" "subst" "0.00018856" "02326" "NFIA_000016" "g.61872392G>A" "" "" "" "NFIA(NM_001134673.4):c.1413G>A (p.T471=), NFIA(NM_001145512.1):c.1548G>A (p.T516=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406720G>A" "" "likely benign" "" "0000508102" "0" "30" "1" "61921034" "61921034" "subst" "0.00133655" "01943" "NFIA_000017" "g.61921034C>T" "" "" "" "NFIA(NM_005595.4):c.1480C>T (p.P494S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61455362C>T" "" "likely benign" "" "0000604431" "0" "90" "1" "61886758" "61886758" "del" "0" "00006" "NFIA_000018" "g.(61632666_61886758)_(61886758_61920974)del" "" "{PMID:Mikhail 2011:22031302}, {DOI:Mikhail 2011:10.1002/ajmg.a.34177}" "" "hg18 g.61405254_61659346del" "254 kb intragenic deletion; father not available" "Germline/De novo (untested)" "" "" "0" "" "" "g.(61166994_61421086)_(61421086_61455302)del" "" "likely pathogenic (dominant)" "" "0000605878" "0" "50" "1" "61872397" "61872397" "subst" "0" "02327" "NFIA_000019" "g.61872397C>G" "" "" "" "NFIA(NM_001145512.1):c.1553C>G (p.(Pro518Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61406725C>G" "" "VUS" "" "0000654085" "0" "50" "1" "61554090" "61554090" "subst" "0" "01943" "NFIA_000020" "g.61554090A>C" "" "" "" "NFIA(NM_005595.4):c.297A>C (p.K99N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.61088418A>C" "" "VUS" "" "0000717579" "0" "70" "1" "61554055" "61554055" "subst" "0" "02329" "NFIA_000021" "g.61554055C>T" "" "" "" "NFIA(NM_001145512.2):c.397C>T (p.R133*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000799467" "0" "50" "1" "61553979" "61553979" "subst" "1.62583E-5" "01943" "NFIA_000022" "g.61553979T>G" "" "" "" "NFIA(NM_005595.4):c.186T>G (p.S62R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000799469" "0" "30" "1" "61798203" "61798203" "subst" "1.6251E-5" "01943" "NFIA_000023" "g.61798203C>T" "" "" "" "NFIA(NM_005595.4):c.645C>T (p.D215=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000799470" "0" "30" "1" "61872229" "61872230" "ins" "0" "01943" "NFIA_000024" "g.61872229_61872230insTC" "" "" "" "NFIA(NM_005595.4):c.1255-5_1255-4insTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000799471" "0" "50" "1" "61872231" "61872231" "subst" "6.43862E-5" "01943" "NFIA_000025" "g.61872231C>A" "" "" "" "NFIA(NM_005595.4):c.1255-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848801" "0" "50" "1" "61872229" "61872229" "subst" "0.000191675" "01943" "NFIA_000026" "g.61872229C>A" "" "" "" "NFIA(NM_001134673.4):c.1255-5C>A, NFIA(NM_005595.4):c.1255-5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000883535" "0" "70" "1" "61824947" "61824947" "subst" "0" "02327" "NFIA_000027" "g.61824947G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000933608" "0" "90" "1" "61554054" "61554054" "subst" "0" "04567" "NFIA_000029" "g.61554054T>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.61088382T>G" "" "pathogenic" "ACMG" "0000933609" "0" "50" "1" "61554137" "61554137" "subst" "0" "04567" "NFIA_000028" "g.61554137G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.61088465G>A" "" "VUS" "ACMG" "0000933610" "0" "70" "1" "61824887" "61824888" "del" "0" "04567" "NFIA_000030" "g.61824887_61824888del" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.61359215_61359216del" "" "likely pathogenic" "ACMG" "0000933641" "0" "70" "1" "61554054" "61554054" "subst" "0" "04567" "NFIA_000029" "g.61554054T>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.61088382T>G" "" "pathogenic" "ACMG" "0000933647" "0" "90" "1" "61869794" "61869794" "del" "0" "00006" "NFIA_000031" "g.61869794del" "" "{PMID:Negishi 2015:27081522}" "" "1094delC" "" "De novo" "" "" "0" "" "" "g.61404122del" "" "pathogenic (dominant)" "" "0000933648" "0" "90" "1" "61798183" "61872400" "del" "0" "00006" "NFIA_000032" "g.(61743258_61798183)_(61872400_61892136)del" "" "{PMID:Rao 2014:24462883}" "" "del ex4-9" "120 Kb deletion" "De novo" "" "" "0" "" "" "g.(61277586_61332511)_(61406728_61426464)del" "" "pathogenic (dominant)" "" "0000933649" "11" "90" "1" "61497698" "61607171" "del" "0" "00006" "NFIA_000033" "g.(61490000_61497698)_(61607171_61743191)del" "" "{PMID:Nyboe 2015:25714559}" "" "hg19 61,497,698–61,607,171del" "" "Germline" "yes" "" "0" "" "arr[hg19] 1p31.3(61,497,698–61,607,171)×1" "g.(?_61032026)_(61141499_61277519)del" "" "pathogenic (dominant)" "" "0000933650" "11" "90" "1" "61497698" "61607171" "del" "0" "00006" "NFIA_000033" "g.(61490000_61497698)_(61607171_61743191)del" "" "{PMID:Nyboe 2015:25714559}" "" "hg19 61,497,698–61,607,171del" "" "Germline" "yes" "" "0" "" "arr[hg19] 1p31.3(61,497,698–61,607,171)×1" "g.(?_61032026)_(61141499_61277519)del" "" "pathogenic (dominant)" "" "0000933651" "11" "90" "1" "61497698" "61607171" "del" "0" "00006" "NFIA_000033" "g.(61490000_61497698)_(61607171_61743191)del" "" "{PMID:Nyboe 2015:25714559}" "" "hg19 61,497,698–61,607,171del" "" "Germline" "yes" "" "0" "" "arr[hg19] 1p31.3(61,497,698–61,607,171)×1" "g.(?_61032026)_(61141499_61277519)del" "" "pathogenic (dominant)" "" "0000933652" "0" "90" "1" "61497698" "61607171" "del" "0" "00006" "NFIA_000033" "g.(61490000_61497698)_(61607171_61743191)del" "" "{PMID:Nyboe 2015:25714559}" "" "hg19 61,497,698–61,607,171del" "" "Germline/De novo (untested)" "yes" "" "0" "" "arr[hg19] 1p31.3(61,497,698–61,607,171)×1" "g.(?_61032026)_(61141499_61277519)del" "" "pathogenic (dominant)" "" "0000974058" "0" "30" "1" "61872224" "61872224" "subst" "0" "01804" "NFIA_000034" "g.61872224C>G" "" "" "" "NFIA(NM_001134673.4):c.1255-10C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000974059" "0" "30" "1" "61872229" "61872229" "subst" "0.000191675" "01804" "NFIA_000026" "g.61872229C>A" "" "" "" "NFIA(NM_001134673.4):c.1255-5C>A, NFIA(NM_005595.4):c.1255-5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991368" "0" "50" "1" "61547629" "61547629" "subst" "0" "01804" "NFIA_000035" "g.61547629G>A" "" "" "" "NFIA(NM_001145512.1):c.14G>A (p.(Arg5His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991369" "0" "50" "1" "61554116" "61554138" "dup" "0" "01804" "NFIA_000036" "g.61554116_61554138dup" "" "" "" "NFIA(NM_001145512.1):c.458_480dupCAGACCAGAAAGGCAAGATGCGA (p.(Arg161fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991372" "0" "50" "1" "61743198" "61743198" "subst" "4.47256E-5" "01804" "NFIA_000037" "g.61743198G>A" "" "" "" "NFIA(NM_001134673.3):c.566G>A (p.(Ser189Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991373" "0" "30" "1" "61798187" "61798187" "subst" "0" "01804" "NFIA_000038" "g.61798187A>G" "" "" "" "NFIA(NM_001145512.1):c.764A>G (p.(His255Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991376" "0" "30" "1" "61872238" "61872238" "subst" "0" "01804" "NFIA_000039" "g.61872238A>G" "" "" "" "NFIA(NM_001134673.3):c.1259A>G (p.(Asn420Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991377" "0" "30" "1" "61872397" "61872397" "subst" "0" "01804" "NFIA_000019" "g.61872397C>G" "" "" "" "NFIA(NM_001145512.1):c.1553C>G (p.(Pro518Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991378" "0" "50" "1" "61892155" "61892155" "subst" "0" "01804" "NFIA_000040" "g.61892155C>T" "" "" "" "NFIA(NM_001145512.1):c.1574C>T (p.(Thr525Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013337" "0" "10" "1" "61872228" "61872229" "ins" "0" "02326" "NFIA_000009" "g.61872228_61872229insT" "" "" "" "NFIA(NM_001145512.1):c.1390-6_1390-5insT, NFIA(NM_005595.5):c.1255-6_1255-5insT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001017481" "0" "90" "1" "61553899" "61553899" "subst" "0" "01164" "NFIA_000041" "g.61553899C>T" "" "" "" "" "ACMG: PVS1, PS2_SUP, PS4_SUP, PM2_SUP; confirmed de novo in trio exome" "De novo" "-" "" "0" "" "" "g.61088227C>T" "VCV001285510.1" "pathogenic (dominant)" "ACMG" "0001024195" "0" "90" "1" "61554013" "61554013" "subst" "0" "02329" "NFIA_000042" "g.61554013C>T" "" "" "" "NFIA(NM_005595.5):c.220C>T (p.R74*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001032139" "0" "30" "1" "61872229" "61872229" "dup" "0" "01804" "NFIA_000043" "g.61872229dup" "" "" "" "NFIA(NM_001134673.4):c.1255-5dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001050122" "0" "50" "1" "61547626" "61547626" "subst" "6.83761E-6" "01804" "NFIA_000044" "g.61547626G>A" "" "" "" "NFIA(NM_001145512.2):c.11G>A (p.(Cys4Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050123" "0" "50" "1" "61818185" "61818185" "subst" "0" "01804" "NFIA_000045" "g.61818185A>G" "" "" "" "NFIA(NM_001134673.4):c.764A>G (p.(Tyr255Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050124" "0" "30" "1" "61872228" "61872228" "subst" "0" "01804" "NFIA_000046" "g.61872228C>A" "" "" "" "NFIA(NM_001134673.4):c.1255-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001063073" "0" "50" "1" "61824948" "61824948" "subst" "0" "02325" "NFIA_000047" "g.61824948T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063074" "0" "50" "1" "61869949" "61869949" "subst" "0" "02325" "NFIA_000048" "g.61869949C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NFIA ## Count = 53 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000298573" "00025855" "70" "740" "0" "740" "0" "c.740C>G" "r.(?)" "p.(Ser247Ter)" "" "0000304106" "00025855" "10" "1255" "-9" "1255" "-9" "c.1255-9C>G" "r.(=)" "p.(=)" "" "0000342804" "00025855" "50" "1051" "0" "1051" "0" "c.1051C>T" "r.(?)" "p.(Arg351Ter)" "" "0000348993" "00025855" "30" "1079" "0" "1079" "0" "c.1079G>A" "r.(?)" "p.(Ser360Asn)" "" "0000508086" "00025855" "30" "28" "-6" "28" "-6" "c.28-6T>G" "r.(=)" "p.(=)" "" "0000508089" "00025855" "30" "926" "0" "926" "0" "c.926G>C" "r.(?)" "p.(Gly309Ala)" "" "0000508091" "00025855" "90" "1201" "0" "1201" "0" "c.1201C>T" "r.(?)" "p.(Gln401Ter)" "" "0000508093" "00025855" "10" "1255" "-6" "1255" "-5" "c.1255-6_1255-5insT" "r.spl?" "p.?" "" "0000508095" "00025855" "30" "1255" "-4" "1255" "-4" "c.1255-4A>C" "r.spl?" "p.?" "" "0000508096" "00025855" "30" "1255" "-2" "1255" "-2" "c.1255-2A>C" "r.spl?" "p.?" "" "0000508097" "00025855" "30" "1255" "-2" "1255" "-1" "c.1255-2_1255-1del" "r.spl?" "p.?" "" "0000508098" "00025855" "30" "1255" "-1" "1255" "-1" "c.1255-1G>C" "r.spl?" "p.?" "" "0000508100" "00025855" "30" "1413" "0" "1413" "0" "c.1413G>A" "r.(?)" "p.(Thr471=)" "" "0000508101" "00025855" "30" "1413" "0" "1413" "0" "c.1413G>A" "r.(?)" "p.(Thr471=)" "" "0000508102" "00025855" "30" "1572" "0" "1572" "0" "c.*42C>T" "r.(=)" "p.(=)" "" "0000604431" "00025855" "90" "559" "78314" "1420" "14359" "c.(559+1_559+78314)_(1420+14359_1421-1)del" "r.?" "p.?" "4i_11i" "0000605878" "00025855" "50" "1418" "0" "1418" "0" "c.1418C>G" "r.(?)" "p.(Pro473Arg)" "" "0000654085" "00025855" "50" "297" "0" "297" "0" "c.297A>C" "r.(?)" "p.(Lys99Asn)" "" "0000717579" "00025855" "70" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Arg88*)" "" "0000799467" "00025855" "50" "186" "0" "186" "0" "c.186T>G" "r.(?)" "p.(Ser62Arg)" "" "0000799469" "00025855" "30" "645" "0" "645" "0" "c.645C>T" "r.(?)" "p.(Asp215=)" "" "0000799470" "00025855" "30" "1255" "-5" "1255" "-4" "c.1255-5_1255-4insTC" "r.spl?" "p.?" "" "0000799471" "00025855" "50" "1255" "-3" "1255" "-3" "c.1255-3C>A" "r.spl?" "p.?" "" "0000848801" "00025855" "50" "1255" "-5" "1255" "-5" "c.1255-5C>A" "r.spl?" "p.?" "" "0000883535" "00025855" "70" "946" "1" "946" "1" "c.946+1G>C" "r.spl?" "p.?" "" "0000933608" "00025855" "90" "261" "0" "261" "0" "c.261T>G" "r.(?)" "p.(Tyr87*)" "" "0000933609" "00025855" "50" "344" "0" "344" "0" "c.344G>A" "r.(?)" "p.(Arg115Gln)" "" "0000933610" "00025855" "70" "887" "0" "888" "0" "c.887_888del" "r.(?)" "p.(Gly296Alafs*16)" "" "0000933641" "00025855" "70" "261" "0" "261" "0" "c.261T>G" "r.(?)" "p.(Tyr87*)" "" "0000933647" "00025855" "90" "1094" "0" "1094" "0" "c.1094del" "r.(?)" "p.(Pro365Hisfs*32)" "" "0000933648" "00025855" "90" "626" "-1" "1420" "1" "c.(625+1_626-1)_(1420+1_1421-1)del" "r.?" "p.?" "3i_9i" "0000933649" "00025855" "90" "0" "0" "0" "0" "c.-484_(559+52819_560-1){0}" "r.0?" "p.0?" "_1_2i" "0000933650" "00025855" "90" "0" "0" "0" "0" "c.-484_(559+52819_560-1){0}" "r.0?" "p.0?" "_1_2i" "0000933651" "00025855" "90" "0" "0" "0" "0" "c.-484_(559+52819_560-1){0}" "r.0?" "p.0?" "_1_2i" "0000933652" "00025855" "90" "0" "0" "0" "0" "c.-484_(559+52819_560-1){0}" "r.0?" "p.0?" "_1_2i" "0000974058" "00025855" "30" "1255" "-10" "1255" "-10" "c.1255-10C>G" "r.(=)" "p.(=)" "" "0000974059" "00025855" "30" "1255" "-5" "1255" "-5" "c.1255-5C>A" "r.spl?" "p.?" "" "0000991368" "00025855" "50" "-835" "0" "-835" "0" "c.-835G>A" "r.(?)" "p.(=)" "" "0000991369" "00025855" "50" "323" "0" "345" "0" "c.323_345dup" "r.(?)" "p.(Arg116Glnfs*27)" "" "0000991372" "00025855" "50" "566" "0" "566" "0" "c.566G>A" "r.(?)" "p.(Ser189Asn)" "" "0000991373" "00025855" "30" "629" "0" "629" "0" "c.629A>G" "r.(?)" "p.(His210Arg)" "" "0000991376" "00025855" "30" "1259" "0" "1259" "0" "c.1259A>G" "r.(?)" "p.(Asn420Ser)" "" "0000991377" "00025855" "30" "1418" "0" "1418" "0" "c.1418C>G" "r.(?)" "p.(Pro473Arg)" "" "0000991378" "00025855" "50" "1439" "0" "1439" "0" "c.1439C>T" "r.(?)" "p.(Thr480Ile)" "" "0001013337" "00025855" "10" "1255" "-6" "1255" "-5" "c.1255-6_1255-5insT" "r.spl?" "p.?" "" "0001017481" "00025855" "90" "106" "0" "106" "0" "c.106C>T" "r.(?)" "p.(Arg36*)" "2" "0001024195" "00025855" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74*)" "" "0001032139" "00025855" "30" "1255" "-5" "1255" "-5" "c.1255-5dup" "r.spl?" "p.?" "" "0001050122" "00025855" "50" "-838" "0" "-838" "0" "c.-838G>A" "r.(?)" "p.(=)" "" "0001050123" "00025855" "50" "764" "0" "764" "0" "c.764A>G" "r.(?)" "p.(Tyr255Cys)" "" "0001050124" "00025855" "30" "1255" "-6" "1255" "-6" "c.1255-6C>A" "r.(=)" "p.(=)" "" "0001063073" "00025855" "50" "946" "2" "946" "2" "c.946+2T>G" "r.spl?" "p.?" "" "0001063074" "00025855" "50" "1249" "0" "1249" "0" "c.1249C>T" "r.(?)" "p.(Leu417Phe)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 12 "{{screeningid}}" "{{variantid}}" "0000270646" "0000604431" "0000438080" "0000933608" "0000438081" "0000933609" "0000438083" "0000933610" "0000438106" "0000933641" "0000438111" "0000933647" "0000438112" "0000933648" "0000438113" "0000933649" "0000438114" "0000933650" "0000438115" "0000933651" "0000438116" "0000933652" "0000459454" "0001017481"