### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NHS) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NHS" "Nance-Horan syndrome (congenital cataracts and dental anomalies)" "X" "p22.3-p21.1" "unknown" "NG_011553.2" "UD_145626742787" "" "https://www.LOVD.nl/NHS" "" "1" "7820" "4810" "300457" "1" "1" "1" "1" "This gene sequence variant database has been initiated based on the data reported by Tarpey et al. (2009) A systematic, large-scale resequencing screen of the X-chromosome coding exons in mental retardation. Nat.Genet. 41: 535-543. Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/NHS_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2017-06-30 10:08:58" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000295" "NHS" "transcript variant 1" "001" "NM_198270.2" "" "NP_938011.1" "" "" "" "-338" "8423" "4893" "17393543" "17754114" "00000" "2012-09-13 12:04:48" "" "" "00026036" "NHS" "transcript variant 3 (removed from reference sequence) (removed from reference sequence) (removed from reference sequence)" "000" "NM_001291867.2" "" "NP_001278796.1" "" "" "MANE select" "-558" "8486" "4956" "1" "1" "00006" "2025-11-25 18:21:44" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00296" "CTRCT" "cataract (CTRCT)" "" "" "" "" "" "00006" "2014-01-16 08:42:13" "00006" "2015-03-07 14:30:33" "00325" "SPG" "paraplegia, spastic (SPG)" "" "" "" "" "" "00006" "2014-02-15 22:29:17" "00006" "2016-11-28 13:01:43" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02217" "CTRCT40" "cataract, type 40 (CTRCT-40)" "XL" "302200" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02218" "NHS" "Nance-Horan syndrome (NHS)" "XLD" "302350" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05165" "CCTRCT" "cataract, congenital (CCTRCT)" "" "" "" "" "" "00006" "2016-05-15 20:37:47" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "NHS" "00139" "NHS" "02217" "NHS" "02218" ## Individuals ## Do not remove or alter this header ## ## Count = 82 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00065055" "" "" "" "3" "" "00006" "{PMID:Gillespie 2014:25148791}, {DOI:Gillespie 2014:10.1016/j.ophtha.2014.06.006}" "has affected maternal great grandmother, maternal cousins" "M" "no" "" "" "0" "" "" "" "" "00106135" "" "" "" "1" "" "02128" "" "" "M" "no" "(Belgium)" "" "0" "" "" "" "" "00173116" "" "" "" "3" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173117" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173118" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173119" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173120" "" "" "" "2" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173121" "" "" "" "2" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173122" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173123" "" "" "" "9" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173124" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00183167" "" "" "" "2" "" "00006" "{PMID:Hu 2016:25644381}" "family, 2 affected, 1 unaffected heterozygous carrier female" "M" "" "" "" "0" "" "" "" "25644381-FamT149" "00294999" "" "" "" "13" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00302949" "" "" "" "1" "" "00006" "{PMID:Fieremans 2016:27159028}" "" "F" "" "" "" "0" "" "" "" "Pat5" "00305287" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00324493" "" "" "" "1" "" "01164" "" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" "173214" "00336008" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 181 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00374788" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1100" "00384308" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13587" "00385465" "" "" "" "1" "" "00000" "{PMID:Lenassi 2020:31848469}" "retrospective analysis" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "14022259" "00392274" "" "" "" "1" "" "00000" "{PMID:Bell 2021:33494148}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "27" "00392277" "" "" "" "1" "" "00000" "{PMID:Bell 2021:33494148}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "37" "00412197" "" "" "" "1" "" "01164" "" "" "M" "no" "" "" "0" "" "" "" "199898" "00414419" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "F" "" "China" "" "0" "" "" "" "WHP86" "00434076" "" "" "" "1" "" "00006" "{PMID:Li 2016:27307692}" "" "" "" "China" "" "0" "" "" "" "Pat32" "00434083" "" "" "" "1" "" "00006" "{PMID:Li 2016:27307692}" "" "" "" "China" "" "0" "" "" "" "Pat59" "00434129" "" "" "" "2" "" "00006" "{PMID:Li 2019:31842807}" "2-generation family, affected mother/son" "M" "" "China" "" "0" "" "" "" "Fam1PatII1" "00434130" "" "" "" "3" "" "00006" "{PMID:Li 2019:31842807}" "2-generation family, affected mother/2 daughters" "F" "" "China" "" "0" "" "" "" "Fam2PatII1" "00434251" "" "" "" "1" "" "00006" "{PMID:Jackson 2020:32830442}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" "Fam24533" "00440468" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3300.1" "00444293" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat55" "00444342" "" "" "" "1" "" "00006" "{PMID:Li 2018:29914532}" "2-generation family, 1 affected, unaffected carrier mother" "M" "" "China" "" "0" "" "" "" "FamPat7" "00444343" "" "" "" "1" "" "00006" "{PMID:Li 2018:29914532}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "China" "" "0" "" "" "" "FamPat8" "00444880" "" "" "" "1" "" "00006" "{PMID:Fan 2020:32883240}" "2-generation family, 1 affected" "" "" "China" "" "0" "" "" "" "Pat6" "00444881" "" "" "" "1" "" "00006" "{PMID:Fan 2020:32883240}" "2-generation family, 1 affected" "" "" "China" "" "0" "" "" "" "Pat7" "00444890" "" "" "" "3" "" "00006" "{PMID:Ma 2016:26694549}" "2-generation family, 3 affected father/2 sons" "M" "" "Australia" "" "0" "" "" "" "Fam6PatII1" "00444923" "" "" "" "4" "" "00006" "{PMID:Ma 2016:26694549}" "3-generation family, 4 affected (3F, M)" "M" "" "Australia" "" "0" "" "" "" "Fam40PatIII3" "00444948" "" "" "" "6" "" "00006" "{PMID:Patel 2017:27878435}" "family" "" "" "" "" "0" "" "" "" "10DG2001" "00445048" "" "" "" "1" "" "00006" "{PMID:Kessel 2021:34169787}" "patient" "" "" "Denmark" "" "0" "" "" "" "CC0000578" "00445049" "" "" "" "1" "" "00006" "{PMID:Kessel 2021:34169787}" "patient" "" "" "Denmark" "" "0" "" "" "" "CCMC00110" "00445101" "" "" "" "2" "" "00006" "{PMID:Reichsteiner 2021:34014271}" "2-generation family, affected mother/son" "M" "" "Switzerland" "" "0" "" "" "" "Fam19PatII1" "00445102" "" "" "" "5" "" "00006" "{PMID:Reichsteiner 2021:34014271}" "2-generation family, 5 affected (5M), unaffected carrier femal" "M" "" "Switzerland" "" "0" "" "" "" "Fam20PatI6" "00445103" "" "" "" "1" "" "00006" "{PMID:Reichsteiner 2021:34014271}" "nephew" "M" "" "Switzerland" "" "0" "" "" "" "Fam20PatII1" "00445104" "" "" "" "1" "" "00006" "{PMID:Reichsteiner 2021:34014271}" "nephew" "M" "" "Switzerland" "" "0" "" "" "" "Fam20PatII2" "00445105" "" "" "" "1" "" "00006" "{PMID:Reichsteiner 2021:34014271}" "nephew" "M" "" "Switzerland" "" "0" "" "" "" "Fam20PatII3" "00446429" "" "" "" "2" "" "00006" "{PMID:Liu 2023:37337769}" "2-generation family, affected mother/son" "F" "" "China" "" "0" "" "" "" "Fam11Pat39" "00446447" "" "" "" "1" "" "00006" "{PMID:Liu 2023:37337769}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Fam30Pat80" "00446480" "" "" "" "1" "" "00006" "{PMID:Liu 2023:37337769}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "China" "" "0" "" "" "" "Fam80Pat218" "00446530" "" "" "" "2" "" "00006" "{PMID:Liu 2023:37337769}" "family, 1 affected" "M" "" "China" "" "0" "" "" "" "Fam132Pat352" "00446531" "" "" "00446530" "1" "" "00006" "{PMID:Liu 2023:37337769}" "relative" "F" "" "China" "" "0" "" "" "" "Fam132Pat353" "00446543" "" "" "" "1" "" "00006" "{PMID:Liu 2023:37337769}" "" "M" "" "China" "" "0" "" "" "" "Fam156Pat417" "00446544" "" "" "" "2" "" "00006" "{PMID:Liu 2023:37337769}" "family, 1 affected" "F" "" "China" "" "0" "" "" "" "Fam158Pat420" "00446545" "" "" "" "1" "" "00006" "{PMID:Liu 2023:37337769}" "relative" "M" "" "China" "" "0" "" "" "" "Fam158Pat421" "00450481" "" "" "" "1" "" "00006" "{DOI:Steyaert 2024:10.1101/2024.05.03.24305331}, {PMID:Steyaert 2025:40138663}" "patient" "M" "" "" "" "0" "" "" "" "F034.1" "00468332" "" "" "" "1" "" "00006" "{PMID:Guo 2025:40449652}" "patient, no family history" "M" "" "China" "" "0" "" "" "" "Fam40Pat10780" "00468333" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam41Pat18629" "00468334" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam42Pat21105" "00468335" "" "" "" "1" "" "00006" "{PMID:Guo 2025:40449652}" "patient, no family history" "F" "" "China" "" "0" "" "" "" "Fam43Pat25146" "00468336" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam44Pat23806" "00468337" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "F" "" "China" "" "0" "" "" "" "Fam45Pat41088" "00468338" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam46Pat5351" "00468339" "" "" "00468338" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "F" "" "China" "" "0" "" "" "" "Fam46Pat5352" "00468340" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam47Pat5587" "00468341" "" "" "00468340" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "F" "" "China" "" "0" "" "" "" "Fam47Pat5588" "00468342" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam48Pat5950" "00468343" "" "" "" "1" "" "00006" "{PMID:Guo 2025:40449652}" "patient, no family history" "F" "" "China" "" "0" "" "" "" "Fam49Pat11752" "00468344" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "F" "" "China" "" "0" "" "" "" "Fam50Pat15415" "00468345" "" "" "00468344" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "F" "" "China" "" "0" "" "" "" "Fam50Pat15416" "00468368" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "M" "" "China" "" "0" "" "" "" "Fam63Pat5201" "00468369" "" "" "00468368" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "F" "" "China" "" "0" "" "" "" "Fam63Pat5201" "00468374" "" "" "00468373" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "F" "" "China" "" "0" "" "" "" "Fam66Pat24540" "00468396" "" "" "" "2" "" "00006" "{PMID:Guo 2025:40449652}" "family, several affected" "F" "" "China" "" "0" "" "" "" "Fam81Pat15532" "00468397" "" "" "00468396" "1" "" "00006" "{PMID:Guo 2025:40449652}" "relative" "M" "" "China" "" "0" "" "" "" "Fam81Pat16525" "00468501" "" "" "" "2" "" "00006" "{PMID:Wang 2024:38184101}" "family" "M" "" "China" "" "0" "" "" "" "Pat60" "00468502" "" "" "" "1" "" "00006" "{PMID:Wang 2024:38184101}" "patient, no family history" "M" "" "China" "" "0" "" "" "" "Pat61" "00469157" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470012" "" "" "" "5" "" "00006" "{PMID:Lecca 2024:38840272}" "5-generation family, 5 affected (2F, 3M)" "M" "" "Italy" "" "0" "" "" "" "FamLPat21" "00470013" "" "" "00470012" "1" "" "00006" "{PMID:Lecca 2024:38840272}" "mother" "F" "" "Italy" "" "0" "" "" "" "FamLPat67" "00470020" "" "" "" "1" "" "00006" "{PMID:Lecca 2024:38840272}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "FamAAPat36" "00472118" "" "" "" "1" "" "00006" "{PMID:Ibarluzea 2020:31906484}" "" "M" "" "Spain" "" "0" "" "" "" "ID1011" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 82 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00065055" "05165" "00106135" "02218" "00173116" "00187" "00173117" "00187" "00173118" "00187" "00173119" "00187" "00173120" "00187" "00173121" "00187" "00173122" "00187" "00173123" "00187" "00173124" "00187" "00183167" "00187" "00294999" "00198" "00302949" "00139" "00305287" "00198" "00324493" "02218" "00336008" "00296" "00374788" "00198" "00384308" "04214" "00385465" "04214" "00392274" "04214" "00392277" "04214" "00412197" "02218" "00414419" "00198" "00434076" "00296" "00434083" "00296" "00434129" "00296" "00434130" "00296" "00434251" "00198" "00440468" "00198" "00444293" "04214" "00444342" "00296" "00444343" "00296" "00444880" "00296" "00444881" "00296" "00444890" "00296" "00444923" "00296" "00444948" "00296" "00445048" "00296" "00445049" "00296" "00445101" "00296" "00445102" "00296" "00445103" "00296" "00445104" "00296" "00445105" "00296" "00446429" "00296" "00446447" "00296" "00446480" "00296" "00446530" "00296" "00446531" "00000" "00446543" "00296" "00446544" "00296" "00446545" "00000" "00450481" "05121" "00468332" "00296" "00468333" "00296" "00468334" "00296" "00468335" "00296" "00468336" "00296" "00468337" "00296" "00468338" "00296" "00468339" "00296" "00468340" "00296" "00468341" "00296" "00468342" "00296" "00468343" "00296" "00468344" "00296" "00468345" "00296" "00468368" "00296" "00468369" "00296" "00468374" "00296" "00468396" "00296" "00468397" "00296" "00468501" "00296" "00468502" "00296" "00469157" "00198" "00470012" "00325" "00470013" "00325" "00470020" "00325" "00472118" "00139" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00139, 00187, 00198, 00296, 00325, 01157, 02217, 02218, 04214, 05121, 05165 ## Count = 78 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000051192" "05165" "00065055" "00006" "Familial, autosomal recessive" "" "L: dense nuclear cataract; R: nuclear cataract, lamellar, posterior polar; L: hypoplastic iris, nystagmus; severe mental retardation" "" "" "" "" "" "" "" "" "" "" "" "" "0000083941" "02218" "00106135" "02128" "Familial, X-linked" "" "congenital diaphragmatic hernia (HP:0000776 ), congenital cataract (HP:0000519)" "" "" "" "" "" "" "" "" "" "" "" "" "0000137980" "00187" "00173116" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137981" "00187" "00173117" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137982" "00187" "00173118" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137983" "00187" "00173119" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137984" "00187" "00173120" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137985" "00187" "00173121" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137986" "00187" "00173122" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137987" "00187" "00173123" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000137988" "00187" "00173124" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "MRX" "" "0000143921" "00187" "00183167" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "mental retardation" "" "0000230033" "00139" "00302949" "00006" "Isolated (sporadic)" "" "see paper; ..., mild intellectual disability, autism spectrum disorder, congenital cataract microphthalmia, abnormal teeth" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000243036" "02218" "00324493" "01164" "Unknown" "" "(+) Abnormality of the lens,(+) Cataract / Cataracta congenita, no family history of cataract" "" "" "" "" "" "" "" "" "" "" "" "" "0000253923" "00296" "00336008" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "childhood cataract" "" "0000269998" "00198" "00374788" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy, ataxia, autism spectrum disorder" "" "0000278093" "04214" "00384308" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" "" "0000279260" "04214" "00385465" "00000" "Isolated (sporadic)" "" "" "<1y" "" "" "" "" "" "" "" "" "bilateral paediatric cataract" "congenital cataracts" "" "0000285552" "04214" "00392274" "00000" "Familial, X-linked recessive" "68y" "aphakia nystagmus, marfan syndrome" "" "" "2y" "" "" "" "" "" "" "Cataract 40, X-linked" "" "" "0000285555" "04214" "00392277" "00000" "Familial, X-linked recessive" "1y" "nuclear" "" "" "2m" "" "" "" "" "" "" "Cataract 40, X-linked" "" "" "0000304211" "02218" "00412197" "01164" "Familial, X-linked dominant" "" "Developmental cataract, Abnormality of eye movement, Nystagmus, Hypospadias, Motor delay, Amblyopia, Global developmental delay" "" "" "" "" "" "" "" "" "" "" "0y" "" "0000306254" "00198" "00414419" "00000" "Familial, autosomal dominant" "3y" "" "" "" "" "" "" "" "" "" "" "Cataract 40" "" "" "0000324452" "00296" "00434076" "00006" "Familial, autosomal dominant" "" "bilateral cortical cataract" "" "" "" "" "" "" "" "" "" "" "cataract" "" "0000324459" "00296" "00434083" "00006" "Familial, autosomal recessive" "" "bilateral nuclear cataract" "" "" "" "" "" "" "" "" "" "" "cataract" "" "0000324483" "00296" "00434129" "00006" "Familial, autosomal dominant" "" "see paper; ..., nuclear cataract, white opacities" "" "" "" "" "" "" "" "" "" "CTRCT1" "cataract" "" "0000324484" "00296" "00434130" "00006" "Familial, autosomal dominant" "" "see paper; ..., nuclear/lamellar cataract, blue punctate opacities" "" "" "" "" "" "" "" "" "" "CTRCT14" "cataract" "" "0000324609" "00198" "00434251" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "NHS" "cataract" "" "0000330378" "00198" "00440468" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "Nance-Horan syndrome (MIM #302350)" "" "" "0000333546" "04214" "00444293" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "congenital cataract" "" "0000333595" "00296" "00444342" "00006" "Familial, X-linked recessive" "" "cataract, microphthalmia, microcornea, nystagmus; long narrow face, small nose, mild anteverted pinnae, dental anomalies" "0d" "" "" "" "" "" "" "" "" "" "cataract" "" "0000333596" "00296" "00444343" "00006" "Isolated (sporadic)" "" "total cataract, microphthalmia, microcornea, nystagmus; large anteverted pinnae, mental retardation" "0d" "" "" "" "" "" "" "" "" "" "cataract" "" "0000334130" "00296" "00444880" "00006" "Unknown" "" "binocular, nuclear cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334131" "00296" "00444881" "00006" "Unknown" "" "binocular, OD-dot-like, OS-anterior polar dot-like" "" "" "" "" "" "" "" "" "" "" "cataract" "" "0000334140" "00296" "00444890" "00006" "Familial, X-linked" "" "see paper; ..., bilateral dense central nuclear, intellectual disability, large teeth, dysmorphic facies; brother HCD 11.25 AXL 20.88, aphakic glaucoma, 3y-Baerveldt tube; father cerulean cataracts HCD 12 AXL 24.5" "" "" "" "" "" "" "" "" "" "CTCRT40" "cataract" "" "0000334173" "00296" "00444923" "00006" "Familial, X-linked" "" "see paper; ..., bilateral cataract, left foot insertional polydactyly, ADHD, mild intellectual delay; face small narrow teeth with serrated edge, simple ears; visual acuity R unobtainable L 6/36; mother 32y-bilateral subcapsular cataracts diagnosed; sister 5y-bilateral cataracts diagnosed, oligodontia; grandmother cataracts diagnosed in 50s" "" "" "" "" "" "" "" "" "" "CTCRT40" "cataract" "" "0000334198" "00296" "00444948" "00006" "Familial, X-linked" "" "cataract, long face, bulbous nose, abnormal dentition; syndromic" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334300" "00296" "00445048" "00006" "Familial, X-linked recessive" "" "bilateral cataract, Nance Horan syndrome" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334301" "00296" "00445049" "00006" "Familial, X-linked recessive" "" "bilateral cataract, Nance Horan syndrome" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334354" "00296" "00445101" "00006" "Familial, X-linked recessive" "" "total cataract; microcornea; microphthalmos; broad forehead, sparse eyebrows, short and flat nose bridge, broad tip of the nose, anteverted nares, broad philtrum, thin upper lip, diastema, deeply rooted and slightly protruding ears, rather small fingers, deep palmar creases, hockey stick on both sides; aphakic glaucoma" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334355" "00296" "00445102" "00006" "Familial, X-linked recessive" "" "cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334356" "00296" "00445103" "00006" "Familial, X-linked recessive" "" "total cataract; microcornea; teeth malformations; aphakic glaucoma" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334357" "00296" "00445104" "00006" "Familial, X-linked recessive" "" "total cataract; microcornea; non-syndromic; no aphakic glaucoma" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000334358" "00296" "00445105" "00006" "Familial, X-linked recessive" "" "total cataract; non-syndromic; no aphakic glaucoma" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000335651" "00296" "00446429" "00006" "Familial, autosomal dominant" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "congenital catarct" "" "0000335668" "00296" "00446447" "00006" "Isolated (sporadic)" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "congenital catarct" "" "0000335700" "00296" "00446480" "00006" "Isolated (sporadic)" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "congenital catarct" "" "0000335740" "00296" "00446530" "00006" "Unknown" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "CTRCT40" "congenital catarct" "" "0000335750" "00296" "00446543" "00006" "Unknown" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "" "congenital catarct" "" "0000335751" "00296" "00446544" "00006" "Unknown" "" "bilateral congenital cataract" "" "" "" "" "" "" "" "" "" "" "congenital catarct" "" "0000339544" "05121" "00450481" "00006" "Unknown" "" "muscular dystrophy, cataract" "" "" "" "" "" "" "" "" "" "DMD" "muscular dystrophy" "" "0000353484" "00296" "00468332" "00006" "Familial, X-linked" "26.0y" "see paper; ..., cataract; postoperative retinal detachment; /; nystagmus; high myopia; 4y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353485" "00296" "00468333" "00006" "Familial, X-linked" "29.6y" "see paper; ..., cataract; microcornea; nystagmus;" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353486" "00296" "00468334" "00006" "Familial, X-linked" "4.8y" "see paper; ..., cataract; microcornea; nystagmus; 0.8y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353487" "00296" "00468335" "00006" "Familial, X-linked" "3.8y" "see paper; ..., posterior cataract; microcornea; nystagmus; 5.8y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353488" "00296" "00468336" "00006" "Familial, X-linked" "35.6y" "see paper; ..., cataract; 1.0y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353489" "00296" "00468337" "00006" "Familial, X-linked" "5.0y" "see paper; ..., punctate cataract; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353490" "00296" "00468338" "00006" "Familial, X-linked" "3.6y" "see paper; ..., nuclear cataract; nystagmus; 0.8y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353491" "00296" "00468339" "00006" "Familial, X-linked" "23.0y" "see paper; ..., sutural cataract; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353492" "00296" "00468340" "00006" "Familial, X-linked" "16.4y" "see paper; ..., cataract; microcornea; nystagmus; high myopia; 6.5y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353493" "00296" "00468341" "00006" "Familial, X-linked" "41.5y" "see paper; ..., sutural cataract; postoperative iris, posterior capsule opacification; microcornea; nystagmus; 12.0y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353494" "00296" "00468342" "00006" "Familial, X-linked" "19.0y" "see paper; ..., nuclear cataract; microcornea; microphthalmia; nystagmus; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353495" "00296" "00468343" "00006" "Familial, X-linked" "20.5y" "see paper; ..., cataract; postoperative posterior capsule opacification; /; nystagmus; high myopia; 1.0y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353496" "00296" "00468344" "00006" "Familial, X-linked" "0.4y" "see paper; ..., nuclear cataract; nystagmus; 0.5y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353497" "00296" "00468345" "00006" "Familial, X-linked" "25.3y" "see paper; ..., sutural cataract; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353520" "00296" "00468368" "00006" "Familial, X-linked" "0.5y" "see paper; ..., nuclear cataract; microcornea; microphthalmia; nystagmus; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353521" "00296" "00468369" "00006" "Familial, X-linked" "35.0y" "see paper; ..., sutural cataract; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353526" "00296" "00468374" "00006" "Familial, X-linked" "23.5y" "see paper; ..., lamellar cataract; high myopia; no surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353548" "00296" "00468396" "00006" "Familial, X-linked" "27.7y" "see paper; ..., cataract; postoperative posterior capsule opacification; microcornea; high myopia; 12.0y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353549" "00296" "00468397" "00006" "Familial, X-linked" "26.0y" "see paper; ..., cataract; postoperative retinal detachment; microcornea; nystagmus; high myopia; 5.0y-surgery" "" "" "" "" "" "" "" "" "" "CTRCT40" "cataract" "" "0000353653" "00296" "00468501" "00006" "Familial, X-linked dominant" "" "nuclear cataract; no symmetrical opacities; tooth defects, cognitive impairment" "2y" "" "" "" "" "" "" "" "" "NHS" "bilateral cataract" "" "0000353654" "00296" "00468502" "00006" "Familial, X-linked dominant" "" "zonular cataract, pulverulent cataract; symmetrical opacities; tooth defects, cognitive impairment" "2y" "" "" "" "" "" "" "" "" "NHS" "bilateral cataract" "" "0000354310" "00198" "00469157" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "multiple congenital anomalies" "" "0000355157" "00325" "00470012" "00006" "Familial, X-linked dominant" "7y7m" "see paper; ..., syndromic; bilateral zonular cataract; microcornea, esotropia; microdontia, oligodontia, abnormal auricular pavilion" "1d" "" "" "" "" "" "" "" "" "CTRCT40" "bilateral zonular cataract" "" "0000355158" "00325" "00470013" "00006" "Familial, X-linked dominant" "39y5m" "see paper; ..., syndromic; unilateral (right) cataract; myopia" "39y" "" "" "" "" "" "" "" "" "CTRCT40" "unilateral (right) cataract" "" "0000355165" "00325" "00470020" "00006" "Familial, X-linked dominant" "2y4m" "see paper; ..., syndromic; bilateral total cataract; horizontal nystagmus; benign external hydrocephalus, premature thelarche, atrial septal defect, intellectual disability/developmental delay (mild)" "1d" "" "" "" "" "" "" "" "" "CTRCT40" "bilateral total cataract" "" "0000356927" "00139" "00472118" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" ## Screenings ## Do not remove or alter this header ## ## Count = 82 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000065197" "00065055" "1" "00006" "00006" "2016-05-15 22:17:13" "00006" "2016-05-15 23:03:33" "SEQ;SEQ-NG" "DNA" "" "" "0000106606" "00106135" "1" "02128" "02128" "2017-06-29 10:26:06" "" "" "SEQ-NG" "DNA" "" "" "0000173999" "00173116" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:34:20" "SEQ" "DNA" "" "" "0000174000" "00173117" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174001" "00173118" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174002" "00173119" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174003" "00173120" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:34:20" "SEQ" "DNA" "" "" "0000174004" "00173121" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:34:20" "SEQ" "DNA" "" "" "0000174005" "00173122" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174006" "00173123" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:34:20" "SEQ" "DNA" "" "" "0000174007" "00173124" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000184125" "00183167" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000296167" "00294999" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000304074" "00302949" "1" "00006" "00006" "2020-06-05 09:01:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000306416" "00305287" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000325684" "00324493" "1" "01164" "01164" "2020-12-15 10:09:58" "" "" "SEQ-NG-I" "DNA" "" "" "0000337238" "00336008" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000375982" "00374788" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000385533" "00384308" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000386694" "00385465" "1" "00000" "03840" "2021-10-12 17:40:23" "" "" "SEQ-NG" "DNA" "blood" "114 genes panel tested" "0000393516" "00392274" "1" "00000" "03840" "2021-11-22 09:44:22" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing" "0000393519" "00392277" "1" "00000" "03840" "2021-11-22 09:44:22" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing" "0000413470" "00412197" "1" "01164" "01164" "2022-06-23 17:05:28" "" "" "SEQ-NG-I" "DNA" "" "" "0000415699" "00414419" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000435543" "00434076" "1" "00006" "00006" "2023-03-19 16:52:56" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000435550" "00434083" "1" "00006" "00006" "2023-03-19 16:52:56" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000435596" "00434129" "1" "00006" "00006" "2023-03-20 14:55:46" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000435597" "00434130" "1" "00006" "00006" "2023-03-20 14:55:46" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000435719" "00434251" "1" "00006" "00006" "2023-03-22 17:30:10" "" "" "SEQ-NG" "DNA" "" "WGS" "0000441953" "00440468" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000445867" "00444293" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000445910" "00444342" "1" "00006" "00006" "2023-12-21 22:12:43" "" "" "SEQ;SEQ-NG" "DNA" "" "80 gene panel" "0000445911" "00444343" "1" "00006" "00006" "2023-12-21 22:12:43" "" "" "SEQ;SEQ-NG" "DNA" "" "80 gene panel" "0000446449" "00444880" "1" "00006" "00006" "2023-12-28 14:50:54" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000446450" "00444881" "1" "00006" "00006" "2023-12-28 14:50:54" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000446459" "00444890" "1" "00006" "00006" "2023-12-28 19:27:56" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000446492" "00444923" "1" "00006" "00006" "2023-12-28 19:27:56" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000446517" "00444948" "1" "00006" "00006" "2023-12-29 13:59:22" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000446618" "00445048" "1" "00006" "00006" "2024-01-02 15:26:57" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000446619" "00445049" "1" "00006" "00006" "2024-01-02 15:26:57" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000446671" "00445101" "1" "00006" "00006" "2024-01-02 18:58:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000446672" "00445102" "1" "00006" "00006" "2024-01-02 18:58:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000446673" "00445103" "1" "00006" "00006" "2024-01-02 18:58:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000446674" "00445104" "1" "00006" "00006" "2024-01-02 18:58:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000446675" "00445105" "1" "00006" "00006" "2024-01-02 18:58:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000448002" "00446429" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448020" "00446447" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448053" "00446480" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448103" "00446530" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448104" "00446531" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448116" "00446543" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448117" "00446544" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000448118" "00446545" "1" "00006" "00006" "2024-01-17 16:49:48" "" "" "SEQ;SEQ-NG" "DNA" "" "792 gene panel" "0000452079" "00450481" "1" "00006" "00006" "2024-05-28 17:07:34" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000469998" "00468332" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000469999" "00468333" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470000" "00468334" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470001" "00468335" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470002" "00468336" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470003" "00468337" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470004" "00468338" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470005" "00468339" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470006" "00468340" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470007" "00468341" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470008" "00468342" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470009" "00468343" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470010" "00468344" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470011" "00468345" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470034" "00468368" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470035" "00468369" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470040" "00468374" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470062" "00468396" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470063" "00468397" "1" "00006" "00006" "2025-11-08 17:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470168" "00468501" "1" "00006" "00006" "2025-11-09 20:53:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470169" "00468502" "1" "00006" "00006" "2025-11-09 20:53:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470825" "00469157" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000471680" "00470012" "1" "00006" "00006" "2025-11-25 19:19:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000471681" "00470013" "1" "00006" "00006" "2025-11-25 19:19:02" "" "" "SEQ" "DNA" "" "" "0000471688" "00470020" "1" "00006" "00006" "2025-11-25 19:19:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000473788" "00472118" "1" "00006" "00006" "2026-01-08 11:09:10" "" "" "SEQ;SEQ-NG" "DNA" "" "82-gene panel ID" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 23 "{{screeningid}}" "{{geneid}}" "0000065197" "NHS" "0000106606" "NHS" "0000173999" "NHS" "0000174000" "NHS" "0000174001" "NHS" "0000174002" "NHS" "0000174003" "NRK" "0000174004" "NRK" "0000174005" "NRK" "0000174006" "NRK" "0000174007" "NRK" "0000184125" "NHS" "0000304074" "NHS" "0000325684" "NHS" "0000337238" "NHS" "0000375982" "NHS" "0000385533" "NHS" "0000386694" "NHS" "0000393516" "NHS" "0000393519" "NHS" "0000413470" "NHS" "0000415699" "NHS" "0000452079" "DMD" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 237 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000001813" "20" "50" "X" "17705852" "17705852" "dup" "0" "00037" "NHS_000013" "g.17705852dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17687732dup" "" "VUS" "" "0000002819" "20" "50" "X" "17705852" "17705852" "dup" "0" "00037" "NHS_000011" "g.17705852dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17687732dup" "" "VUS" "" "0000002820" "0" "50" "X" "17710353" "17710353" "del" "0" "00037" "NHS_000010" "g.17710353del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17692233del" "" "VUS" "" "0000006439" "20" "50" "X" "17612497" "17612497" "subst" "0" "00037" "NHS_000015" "g.17612497G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17594376G>A" "" "VUS" "" "0000006440" "20" "50" "X" "17753436" "17753436" "subst" "0" "00037" "NHS_000014" "g.17753436A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17735316=" "" "VUS" "" "0000008493" "20" "50" "X" "17612497" "17612497" "subst" "0" "00037" "NHS_000015" "g.17612497G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17594376G>A" "" "VUS" "" "0000008494" "20" "50" "X" "17705852" "17705852" "dup" "0" "00037" "NHS_000013" "g.17705852dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17687732dup" "" "VUS" "" "0000008495" "20" "50" "X" "17753436" "17753436" "subst" "0" "00037" "NHS_000014" "g.17753436A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17735316=" "" "VUS" "" "0000010824" "20" "50" "X" "17705852" "17705852" "dup" "0" "00037" "NHS_000011" "g.17705852dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.17687732dup" "" "VUS" "" "0000096853" "3" "90" "X" "17745308" "17745308" "subst" "0" "00006" "NHS_000012" "g.17745308C>T" "" "{PMID:Gillespie 2014:25148791}, {DOI:Gillespie 2014:10.1016/j.ophtha.2014.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.17727188C>T" "" "pathogenic" "" "0000172293" "21" "70" "X" "17746172" "17746172" "subst" "0" "02128" "NHS_000016" "g.17746172C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.17728052C>T" "" "likely pathogenic" "" "0000253672" "0" "10" "X" "17743944" "17743944" "subst" "0" "01943" "NHS_000036" "g.17743944A>C" "" "" "" "NHS(NM_001291867.1):c.1718A>C (p.Q573P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17725824A>C" "" "benign" "" "0000296473" "0" "30" "X" "17743697" "17743697" "subst" "3.35942E-5" "02325" "NHS_000032" "g.17743697G>A" "" "" "" "NHS(NM_001291867.2):c.1471G>A (p.(Asp491Asn), p.D491N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17725577G>A" "" "likely benign" "" "0000296474" "0" "10" "X" "17705852" "17705852" "dup" "0" "02325" "NHS_000013" "g.17705852dup" "" "" "" "NHS(NM_198270.4):c.566-10dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17687732dup" "" "benign" "" "0000296475" "0" "50" "X" "17710475" "17710475" "subst" "8.39175E-5" "02325" "NHS_000030" "g.17710475C>T" "" "" "" "NHS(NM_001291867.1):c.739C>T (p.R247C), NHS(NM_001291867.2):c.739C>T (p.R247C), NHS(NM_198270.4):c.739C>T (p.R247C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17692355C>T" "" "VUS" "" "0000300043" "0" "10" "X" "17743940" "17743940" "subst" "0.0248186" "02326" "NHS_000035" "g.17743940C>T" "" "" "" "NHS(NM_001136024.2):c.1183C>T (p.(Pro395Ser)), NHS(NM_198270.4):c.1651C>T (p.P551S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17725820C>T" "" "benign" "" "0000300044" "0" "30" "X" "17750565" "17750565" "subst" "0.000145516" "02326" "NHS_000056" "g.17750565C>T" "" "" "" "NHS(NM_001291867.1):c.4937C>T (p.S1646F), NHS(NM_001291867.2):c.4937C>T (p.S1646F), NHS(NM_198270.4):c.4874C>T (p.S1625F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17732445C>T" "" "likely benign" "" "0000300045" "0" "30" "X" "17705857" "17705857" "subst" "0.000117534" "02326" "NHS_000027" "g.17705857T>C" "" "" "" "NHS(NM_001136024.2):c.35-5T>C (p.?), NHS(NM_001291867.2):c.566-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17687737T>C" "" "likely benign" "" "0000304117" "0" "30" "X" "17742485" "17742485" "subst" "5.03511E-5" "01943" "NHS_000031" "g.17742485G>A" "" "" "" "NHS(NM_001291867.1):c.1175G>A (p.R392Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17724365G>A" "" "likely benign" "" "0000304118" "0" "30" "X" "17653697" "17653697" "subst" "0.00445821" "01943" "NHS_000025" "g.17653697C>T" "" "" "" "NHS(NM_001136024.2):c.11C>T (p.(Ala4Val)), NHS(NM_001136024.3):c.11C>T (p.A4V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17635577C>T" "" "likely benign" "" "0000304119" "0" "30" "X" "17743792" "17743792" "subst" "4.47831E-5" "01943" "NHS_000033" "g.17743792C>T" "" "" "" "NHS(NM_001291867.1):c.1566C>T (p.G522=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17725672C>T" "" "likely benign" "" "0000304120" "0" "50" "X" "17394056" "17394056" "subst" "0" "01943" "NHS_000017" "g.17394056G>A" "" "" "" "NHS(NM_001291867.1):c.176G>A (p.R59H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17375933G>A" "" "VUS" "" "0000304121" "0" "30" "X" "17394057" "17394057" "subst" "0" "01943" "NHS_000018" "g.17394057C>A" "" "" "" "NHS(NM_001291867.1):c.177C>A (p.R59=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17375934C>A" "" "likely benign" "" "0000304122" "0" "50" "X" "17744151" "17744151" "subst" "5.60601E-6" "01943" "NHS_000037" "g.17744151C>A" "" "" "" "NHS(NM_001291867.1):c.1925C>A (p.P642H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726031C>A" "" "VUS" "" "0000304123" "0" "50" "X" "17744294" "17744294" "subst" "2.23903E-5" "01943" "NHS_000038" "g.17744294C>T" "" "" "" "NHS(NM_001291867.1):c.2068C>T (p.H690Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726174C>T" "" "VUS" "" "0000304124" "0" "30" "X" "17394091" "17394091" "subst" "0.00285811" "01943" "NHS_000019" "g.17394091C>T" "" "" "" "NHS(NM_001291867.1):c.211C>T (p.P71S, p.(Pro71Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17375968C>T" "" "likely benign" "" "0000304125" "0" "30" "X" "17744819" "17744819" "subst" "0.00115314" "01943" "NHS_000041" "g.17744819G>A" "" "" "" "NHS(NM_001136024.2):c.2062G>A (p.(Ala688Thr)), NHS(NM_001291867.1):c.2593G>A (p.A865T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726699G>A" "" "likely benign" "" "0000304126" "0" "30" "X" "17744988" "17744988" "subst" "0.000123123" "01943" "NHS_000042" "g.17744988G>A" "" "" "" "NHS(NM_001291867.1):c.2762G>A (p.G921D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726868G>A" "" "likely benign" "" "0000304127" "0" "30" "X" "17745367" "17745367" "subst" "3.3592E-5" "01943" "NHS_000044" "g.17745367C>T" "" "" "" "NHS(NM_001291867.1):c.3141C>T (p.P1047=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17727247C>T" "" "likely benign" "" "0000304128" "0" "10" "X" "17745441" "17745441" "subst" "0.000784468" "01943" "NHS_000045" "g.17745441C>T" "" "" "" "NHS(NM_001291867.1):c.3215C>T (p.T1072I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17727321C>T" "" "benign" "" "0000304129" "0" "30" "X" "17745634" "17745634" "subst" "4.47996E-5" "01943" "NHS_000046" "g.17745634G>A" "" "" "" "NHS(NM_001291867.1):c.3408G>A (p.T1136=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17727514G>A" "" "likely benign" "" "0000304130" "0" "10" "X" "17746155" "17746155" "subst" "0.000661213" "01943" "NHS_000048" "g.17746155G>T" "" "" "" "NHS(NM_001136024.2):c.3398G>T (p.(Gly1133Val)), NHS(NM_001291867.1):c.3929G>T (p.G1310V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17728035G>T" "" "benign" "" "0000304131" "0" "10" "X" "17750294" "17750294" "subst" "0.00180785" "01943" "NHS_000053" "g.17750294T>A" "" "" "" "NHS(NM_001291867.1):c.4666T>A (p.S1556T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17732174T>A" "" "benign" "" "0000304132" "0" "30" "X" "17394393" "17394393" "subst" "0.000548315" "01943" "NHS_000023" "g.17394393C>T" "" "" "" "NHS(NM_001291867.1):c.513C>T (p.L171=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17376270C>T" "" "likely benign" "" "0000304133" "0" "50" "X" "17394426" "17394426" "subst" "1.09978E-5" "01943" "NHS_000024" "g.17394426C>G" "" "" "" "NHS(NM_001291867.1):c.546C>G (p.D182E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17376303C>G" "" "VUS" "" "0000304134" "0" "30" "X" "17705984" "17705984" "subst" "0.000224762" "01943" "NHS_000029" "g.17705984G>A" "" "" "" "NHS(NM_001291867.1):c.688G>A (p.A230T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17687864G>A" "" "likely benign" "" "0000333286" "0" "30" "X" "17394091" "17394091" "subst" "0.00285811" "01804" "NHS_000019" "g.17394091C>T" "" "" "" "NHS(NM_001291867.1):c.211C>T (p.P71S, p.(Pro71Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17375968C>T" "" "likely benign" "" "0000333287" "0" "30" "X" "17394182" "17394217" "dup" "0" "01804" "NHS_000020" "g.17394182_17394217dup" "" "" "" "NHS(NM_198270.2):c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG (p.(Glu101_Ala112dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17376059_17376094dup" "" "likely benign" "" "0000333288" "0" "50" "X" "17394190" "17394225" "del" "0" "01804" "NHS_000021" "g.17394190_17394225del" "" "" "" "NHS(NM_001291867.1):c.310_345del (p.P104_A115del), NHS(NM_001291867.2):c.310_345del (p.P104_A115del), NHS(NM_198270.2):c.303_338del (p.(Ala103_Al...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17376067_17376102del" "" "VUS" "" "0000333291" "0" "30" "X" "17653697" "17653697" "subst" "0.00445821" "01804" "NHS_000025" "g.17653697C>T" "" "" "" "NHS(NM_001136024.2):c.11C>T (p.(Ala4Val)), NHS(NM_001136024.3):c.11C>T (p.A4V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17635577C>T" "" "likely benign" "" "0000333292" "0" "50" "X" "17653705" "17653705" "subst" "0" "01804" "NHS_000026" "g.17653705A>T" "" "" "" "NHS(NM_001136024.2):c.19A>T (p.(Met7Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17635585A>T" "" "VUS" "" "0000333293" "0" "50" "X" "17705864" "17705864" "subst" "1.11913E-5" "01804" "NHS_000028" "g.17705864G>A" "" "" "" "NHS(NM_001136024.2):c.37G>A (p.(Val13Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17687744G>A" "" "VUS" "" "0000333297" "0" "50" "X" "17744523" "17744523" "subst" "2.2456E-5" "01804" "NHS_000040" "g.17744523C>T" "" "" "" "NHS(NM_001136024.2):c.1766C>T (p.(Ser589Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726403C>T" "" "VUS" "" "0000333299" "0" "50" "X" "17744819" "17744819" "subst" "0.00115314" "01804" "NHS_000041" "g.17744819G>A" "" "" "" "NHS(NM_001136024.2):c.2062G>A (p.(Ala688Thr)), NHS(NM_001291867.1):c.2593G>A (p.A865T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726699G>A" "" "VUS" "" "0000333300" "0" "50" "X" "17745057" "17745057" "subst" "0.00907666" "01804" "NHS_000043" "g.17745057A>T" "" "" "" "NHS(NM_001136024.2):c.2300A>T (p.(His767Leu)), NHS(NM_001291867.1):c.2831A>T (p.H944L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726937A>T" "" "VUS" "" "0000333301" "0" "50" "X" "17746011" "17746011" "subst" "0.000151097" "01804" "NHS_000047" "g.17746011C>T" "" "" "" "NHS(NM_001136024.2):c.3254C>T (p.(Thr1085Met)), NHS(NM_001291867.1):c.3785C>T (p.T1262M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17727891C>T" "" "VUS" "" "0000333302" "0" "30" "X" "17746155" "17746155" "subst" "0.000661213" "01804" "NHS_000048" "g.17746155G>T" "" "" "" "NHS(NM_001136024.2):c.3398G>T (p.(Gly1133Val)), NHS(NM_001291867.1):c.3929G>T (p.G1310V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17728035G>T" "" "likely benign" "" "0000333304" "0" "50" "X" "17746313" "17746313" "subst" "0" "01804" "NHS_000051" "g.17746313A>G" "" "" "" "NHS(NM_001136024.2):c.3556A>G (p.(Ile1186Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17728193A>G" "" "VUS" "" "0000333305" "0" "50" "X" "17750274" "17750274" "subst" "0" "01804" "NHS_000052" "g.17750274C>A" "" "" "" "NHS(NM_001136024.2):c.4115C>A (p.(Pro1372His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17732154C>A" "" "VUS" "" "0000333307" "0" "50" "X" "17750367" "17750367" "subst" "5.59309E-6" "01804" "NHS_000054" "g.17750367C>A" "" "" "" "NHS(NM_001136024.2):c.4208C>A (p.(Ser1403Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17732247C>A" "" "VUS" "" "0000333308" "0" "50" "X" "17750499" "17750499" "subst" "2.23811E-5" "01804" "NHS_000055" "g.17750499C>T" "" "" "" "NHS(NM_001136024.2):c.4340C>T (p.(Thr1447Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17732379C>T" "" "VUS" "" "0000342762" "0" "90" "X" "17742490" "17742490" "subst" "0" "02327" "NHS_000061" "g.17742490C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17724370C>T" "" "pathogenic" "" "0000343448" "0" "90" "X" "17744924" "17744924" "subst" "0" "02327" "NHS_000062" "g.17744924C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726804C>T" "" "pathogenic" "" "0000345015" "0" "90" "X" "17745185" "17745185" "subst" "0" "02327" "NHS_000064" "g.17745185C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17727065C>T" "" "pathogenic" "" "0000346018" "0" "90" "X" "17739752" "17739752" "del" "0" "02327" "NHS_000060" "g.17739752del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17721632del" "" "pathogenic" "" "0000347346" "0" "50" "X" "17745078" "17745078" "subst" "0" "02327" "NHS_000063" "g.17745078T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17726958T>G" "" "VUS" "" "0000348410" "0" "50" "X" "17393986" "17393986" "subst" "0" "02327" "NHS_000057" "g.17393986C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17375863C>T" "" "VUS" "" "0000350739" "0" "90" "X" "17739559" "17739559" "subst" "0" "02327" "NHS_000059" "g.17739559A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.17721439A>G" "" "pathogenic" "" "0000394316" "1" "50" "X" "17743940" "17743940" "subst" "0.0248186" "00124" "NHS_000035" "g.17743940C>T" "3/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "recurrent, found 3 times" "Germline" "" "" "0" "" "" "g.17725820C>T" "" "VUS" "" "0000394317" "1" "50" "X" "17744556" "17744556" "subst" "0.000768665" "00124" "NHS_000067" "g.17744556T>C" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.17726436T>C" "" "VUS" "" "0000394318" "1" "30" "X" "17744707" "17744707" "subst" "0.00012314" "00124" "NHS_000068" "g.17744707G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "Q806Q" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.17726587G>A" "" "likely benign" "" "0000394319" "1" "50" "X" "17744819" "17744819" "subst" "0.00115314" "00124" "NHS_000041" "g.17744819G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.17726699G>A" "" "VUS" "" "0000394320" "1" "30" "X" "17745427" "17745427" "subst" "0.00833506" "00124" "NHS_000069" "g.17745427T>C" "2/208 cases" "{PMID:Tarpey 2009:19377476}" "" "S1046S" "recurrent, found 2 times" "Germline" "" "" "0" "" "" "g.17727307T>C" "" "likely benign" "" "0000394321" "1" "30" "X" "17745430" "17745430" "subst" "0.00834141" "00124" "NHS_000070" "g.17745430A>G" "2/208 cases" "{PMID:Tarpey 2009:19377476}" "" "L1047L" "recurrent, found 2 times" "Germline" "" "" "0" "" "" "g.17727310A>G" "" "likely benign" "" "0000394322" "1" "50" "X" "17746155" "17746155" "subst" "0.000661213" "00124" "NHS_000048" "g.17746155G>T" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.17728035G>T" "" "VUS" "" "0000394323" "1" "50" "X" "17746244" "17746244" "subst" "0.165271" "00124" "NHS_000071" "g.17746244T>C" "9/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "recurrent, found 9 times" "Germline" "" "" "0" "" "" "g.17728124T>C" "" "VUS" "" "0000394324" "1" "30" "X" "17710501" "17710501" "subst" "0.000788688" "00124" "NHS_000066" "g.17710501C>G" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "P255P" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.17692381C>G" "" "likely benign" "" "0000408094" "21" "70" "X" "17743739" "17743739" "subst" "5.59873E-6" "00006" "NHS_000072" "g.17743739C>T" "" "{PMID:Hu 2016:25644381}" "" "NHS R484W" "" "Germline" "yes" "" "0" "" "" "g.17725619C>T" "" "likely pathogenic" "" "0000575092" "0" "10" "X" "17394190" "17394225" "del" "0" "01943" "NHS_000021" "g.17394190_17394225del" "" "" "" "NHS(NM_001291867.1):c.310_345del (p.P104_A115del), NHS(NM_001291867.2):c.310_345del (p.P104_A115del), NHS(NM_198270.2):c.303_338del (p.(Ala103_Al...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17376067_17376102del" "" "benign" "" "0000575095" "0" "30" "X" "17394452" "17394452" "subst" "0" "02325" "NHS_000076" "g.17394452A>C" "" "" "" "NHS(NM_198270.4):c.565+7A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17376329A>C" "" "likely benign" "" "0000575096" "0" "30" "X" "17705857" "17705857" "subst" "0.000117534" "01804" "NHS_000027" "g.17705857T>C" "" "" "" "NHS(NM_001136024.2):c.35-5T>C (p.?), NHS(NM_001291867.2):c.566-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17687737T>C" "" "likely benign" "" "0000575097" "0" "90" "X" "17705905" "17705905" "subst" "0" "02327" "NHS_000077" "g.17705905C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17687785C>A" "" "pathogenic" "" "0000575098" "0" "30" "X" "17705979" "17705979" "subst" "0" "01804" "NHS_000078" "g.17705979G>A" "" "" "" "NHS(NM_001136024.2):c.152G>A (p.(Arg51His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17687859G>A" "" "likely benign" "" "0000575099" "0" "50" "X" "17710578" "17710578" "subst" "2.23849E-5" "01943" "NHS_000079" "g.17710578A>G" "" "" "" "NHS(NM_001291867.1):c.842A>G (p.H281R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17692458A>G" "" "VUS" "" "0000575100" "0" "30" "X" "17743544" "17743544" "subst" "1.11993E-5" "01943" "NHS_000080" "g.17743544A>G" "" "" "" "NHS(NM_001291867.1):c.1318A>G (p.R440G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725424A>G" "" "likely benign" "" "0000575101" "0" "50" "X" "17743544" "17743544" "subst" "1.11993E-5" "02327" "NHS_000080" "g.17743544A>G" "" "" "" "NHS(NM_001291867.1):c.1318A>G (p.R440G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725424A>G" "" "VUS" "" "0000575102" "0" "30" "X" "17743697" "17743697" "subst" "3.35942E-5" "01804" "NHS_000032" "g.17743697G>A" "" "" "" "NHS(NM_001291867.2):c.1471G>A (p.(Asp491Asn), p.D491N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725577G>A" "" "likely benign" "" "0000575103" "0" "30" "X" "17743940" "17743940" "subst" "0.0248186" "01804" "NHS_000035" "g.17743940C>T" "" "" "" "NHS(NM_001136024.2):c.1183C>T (p.(Pro395Ser)), NHS(NM_198270.4):c.1651C>T (p.P551S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725820C>T" "" "likely benign" "" "0000575105" "0" "30" "X" "17744556" "17744556" "subst" "0.000768665" "01943" "NHS_000067" "g.17744556T>C" "" "" "" "NHS(NM_001136024.2):c.1799T>C (p.(Phe600Ser)), NHS(NM_001291867.1):c.2330T>C (p.F777S), NHS(NM_001291867.2):c.2330T>C (p.F777S), NHS(NM_198270.4):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726436T>C" "" "likely benign" "" "0000575106" "0" "30" "X" "17744556" "17744556" "subst" "0.000768665" "01804" "NHS_000067" "g.17744556T>C" "" "" "" "NHS(NM_001136024.2):c.1799T>C (p.(Phe600Ser)), NHS(NM_001291867.1):c.2330T>C (p.F777S), NHS(NM_001291867.2):c.2330T>C (p.F777S), NHS(NM_198270.4):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726436T>C" "" "likely benign" "" "0000575107" "0" "30" "X" "17744556" "17744556" "subst" "0.000768665" "02325" "NHS_000067" "g.17744556T>C" "" "" "" "NHS(NM_001136024.2):c.1799T>C (p.(Phe600Ser)), NHS(NM_001291867.1):c.2330T>C (p.F777S), NHS(NM_001291867.2):c.2330T>C (p.F777S), NHS(NM_198270.4):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726436T>C" "" "likely benign" "" "0000575108" "0" "50" "X" "17744889" "17744889" "subst" "3.35879E-5" "02325" "NHS_000081" "g.17744889T>C" "" "" "" "NHS(NM_001291867.1):c.2663T>C (p.M888T), NHS(NM_001291867.2):c.2663T>C (p.M888T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726769T>C" "" "VUS" "" "0000575109" "0" "50" "X" "17744946" "17744946" "subst" "2.2393E-5" "01943" "NHS_000082" "g.17744946C>T" "" "" "" "NHS(NM_001291867.1):c.2720C>T (p.P907L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726826C>T" "" "VUS" "" "0000575110" "0" "30" "X" "17745017" "17745017" "subst" "0.000117531" "01943" "NHS_000083" "g.17745017G>T" "" "" "" "NHS(NM_001291867.1):c.2791G>T (p.D931Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726897G>T" "" "likely benign" "" "0000575111" "0" "10" "X" "17745057" "17745057" "subst" "0.00907666" "01943" "NHS_000043" "g.17745057A>T" "" "" "" "NHS(NM_001136024.2):c.2300A>T (p.(His767Leu)), NHS(NM_001291867.1):c.2831A>T (p.H944L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726937A>T" "" "benign" "" "0000575112" "0" "50" "X" "17745542" "17745542" "subst" "0" "01943" "NHS_000084" "g.17745542C>T" "" "" "" "NHS(NM_001291867.1):c.3316C>T (p.H1106Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727422C>T" "" "VUS" "" "0000575113" "0" "30" "X" "17745600" "17745600" "subst" "0.000313627" "01943" "NHS_000085" "g.17745600C>T" "" "" "" "NHS(NM_001291867.1):c.3374C>T (p.S1125L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727480C>T" "" "likely benign" "" "0000575114" "0" "50" "X" "17745624" "17745624" "subst" "5.59845E-6" "01804" "NHS_000086" "g.17745624T>C" "" "" "" "NHS(NM_001136024.2):c.2867T>C (p.(Ile956Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727504T>C" "" "VUS" "" "0000575115" "0" "50" "X" "17745741" "17745741" "subst" "3.9388E-5" "01943" "NHS_000087" "g.17745741C>T" "" "" "" "NHS(NM_001291867.1):c.3515C>T (p.T1172M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727621C>T" "" "VUS" "" "0000575116" "0" "30" "X" "17746011" "17746011" "subst" "0.000151097" "01943" "NHS_000047" "g.17746011C>T" "" "" "" "NHS(NM_001136024.2):c.3254C>T (p.(Thr1085Met)), NHS(NM_001291867.1):c.3785C>T (p.T1262M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727891C>T" "" "likely benign" "" "0000575117" "0" "30" "X" "17746067" "17746067" "subst" "2.79792E-5" "01804" "NHS_000088" "g.17746067C>T" "" "" "" "NHS(NM_001136024.2):c.3310C>T (p.(Arg1104Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727947C>T" "" "likely benign" "" "0000575119" "0" "90" "X" "17746102" "17746102" "subst" "0" "02327" "NHS_000090" "g.17746102T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727982T>G" "" "pathogenic" "" "0000575120" "0" "30" "X" "17746277" "17746277" "subst" "0.000442307" "01943" "NHS_000050" "g.17746277G>A" "" "" "" "NHS(NM_001291867.1):c.4051G>A (p.D1351N), NHS(NM_001291867.2):c.4051G>A (p.D1351N), NHS(NM_198270.4):c.3988G>A (p.D1330N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17728157G>A" "" "likely benign" "" "0000575121" "0" "50" "X" "17746347" "17746347" "subst" "0" "02325" "NHS_000091" "g.17746347C>G" "" "" "" "NHS(NM_001291867.2):c.4121C>G (p.S1374C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17728227C>G" "" "VUS" "" "0000575122" "0" "30" "X" "17750294" "17750294" "subst" "0.00180785" "02327" "NHS_000053" "g.17750294T>A" "" "" "" "NHS(NM_001291867.1):c.4666T>A (p.S1556T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17732174T>A" "" "likely benign" "" "0000575123" "0" "30" "X" "17750565" "17750565" "subst" "0.000145516" "01943" "NHS_000056" "g.17750565C>T" "" "" "" "NHS(NM_001291867.1):c.4937C>T (p.S1646F), NHS(NM_001291867.2):c.4937C>T (p.S1646F), NHS(NM_198270.4):c.4874C>T (p.S1625F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17732445C>T" "" "likely benign" "" "0000619362" "0" "30" "X" "17394096" "17394098" "del" "0" "01804" "NHS_000092" "g.17394096_17394098del" "" "" "" "NHS(NM_001291867.1):c.216_218del (p.(Pro73del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17375973_17375975del" "" "likely benign" "" "0000619363" "0" "10" "X" "17394190" "17394225" "del" "0" "02325" "NHS_000021" "g.17394190_17394225del" "" "" "" "NHS(NM_001291867.1):c.310_345del (p.P104_A115del), NHS(NM_001291867.2):c.310_345del (p.P104_A115del), NHS(NM_198270.2):c.303_338del (p.(Ala103_Al...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17376067_17376102del" "" "benign" "" "0000619364" "0" "50" "X" "17394228" "17394230" "del" "0" "01943" "NHS_000093" "g.17394228_17394230del" "" "" "" "NHS(NM_001291867.1):c.348_350delGGC (p.A117del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17376105_17376107del" "" "VUS" "" "0000619365" "0" "30" "X" "17710475" "17710475" "subst" "8.39175E-5" "01943" "NHS_000030" "g.17710475C>T" "" "" "" "NHS(NM_001291867.1):c.739C>T (p.R247C), NHS(NM_001291867.2):c.739C>T (p.R247C), NHS(NM_198270.4):c.739C>T (p.R247C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17692355C>T" "" "likely benign" "" "0000619366" "0" "30" "X" "17743597" "17743597" "subst" "1.67819E-5" "01943" "NHS_000094" "g.17743597T>C" "" "" "" "NHS(NM_001291867.1):c.1371T>C (p.A457=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725477T>C" "" "likely benign" "" "0000619367" "0" "30" "X" "17743822" "17743822" "subst" "0.000459304" "01943" "NHS_000095" "g.17743822G>A" "" "" "" "NHS(NM_001291867.1):c.1596G>A (p.E532=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17725702G>A" "" "likely benign" "" "0000619368" "0" "30" "X" "17745613" "17745613" "subst" "0" "01943" "NHS_000098" "g.17745613G>A" "" "" "" "NHS(NM_001291867.1):c.3387G>A (p.P1129=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17727493G>A" "" "likely benign" "" "0000619369" "0" "50" "X" "17750027" "17750027" "subst" "0" "02327" "NHS_000099" "g.17750027C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17731907C>T" "" "VUS" "" "0000619370" "0" "50" "X" "17750061" "17750062" "del" "0" "01943" "NHS_000100" "g.17750061_17750062del" "" "" "" "NHS(NM_001291867.1):c.4433_4434delGC (p.S1478Kfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17731941_17731942del" "" "VUS" "" "0000624536" "0" "30" "X" "17744398" "17744398" "subst" "1.68086E-5" "01943" "NHS_000096" "g.17744398T>A" "" "" "" "NHS(NM_001291867.1):c.2172T>A (p.N724K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726278T>A" "" "likely benign" "" "0000624537" "0" "30" "X" "17744503" "17744503" "subst" "5.61649E-6" "01943" "NHS_000097" "g.17744503T>C" "" "" "" "NHS(NM_001291867.1):c.2277T>C (p.Y759=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17726383T>C" "" "likely benign" "" "0000624538" "0" "50" "X" "17750064" "17750064" "del" "0" "01943" "NHS_000101" "g.17750064del" "" "" "" "NHS(NM_001291867.1):c.4436delG (p.S1479Tfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17731944del" "" "VUS" "" "0000652856" "1" "10" "X" "17743940" "17743940" "subst" "0.0248186" "03575" "NHS_000035" "g.17743940C>T" "13/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "13 heterozygous; {DB:CLININrs150688899}" "Germline" "" "rs150688899" "0" "" "" "g.17725820C>T" "" "benign" "" "0000659230" "0" "30" "X" "17710588" "17710588" "subst" "1.11961E-5" "01804" "NHS_000102" "g.17710588G>A" "" "" "" "NHS(NM_001136024.2):c.321G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.17692468G>A" "" "likely benign" "" "0000667472" "0" "90" "X" "17705990" "17705990" "subst" "0" "00006" "NHS_000103" "g.17705990C>T" "" "{PMID:Fieremans 2016:27159028}" "" "NM_001136024.3:c.163C>T" "" "De novo" "" "" "0" "skewed X-inactivation (5:95 pat:mat)" "" "g.17687870C>T" "" "pathogenic" "" "0000670104" "0" "10" "X" "17743940" "17743940" "subst" "0.0248186" "03575" "NHS_000035" "g.17743940C>T" "8/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "8 homozygous; {DB:CLININrs150688899}" "Germline" "" "rs150688899" "0" "" "" "g.17725820C>T" "" "benign" "" "0000682311" "0" "30" "X" "17710564" "17710564" "subst" "0.000414035" "01943" "NHS_000104" "g.17710564G>A" "" "" "" "NHS(NM_001291867.1):c.828G>A (p.E276=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682312" "0" "30" "X" "17743973" "17743973" "subst" "8.97716E-5" "01943" "NHS_000105" "g.17743973C>T" "" "" "" "NHS(NM_001291867.1):c.1747C>T (p.R583C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682313" "0" "30" "X" "17744935" "17744935" "subst" "3.91931E-5" "01943" "NHS_000106" "g.17744935C>T" "" "" "" "NHS(NM_001291867.1):c.2709C>T (p.N903=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682314" "0" "30" "X" "17745758" "17745758" "subst" "1.12461E-5" "01943" "NHS_000107" "g.17745758A>G" "" "" "" "NHS(NM_001291867.1):c.3532A>G (p.S1178G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682315" "0" "50" "X" "17746221" "17746221" "subst" "5.60252E-6" "01943" "NHS_000049" "g.17746221G>A" "" "" "" "NHS(NM_001291867.1):c.3995G>A (p.R1332K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682316" "0" "50" "X" "17750056" "17750058" "dup" "0" "01943" "NHS_000108" "g.17750056_17750058dup" "" "" "" "NHS(NM_001291867.1):c.4428_4430dupTAG (p.S1480dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682317" "0" "50" "X" "17750088" "17750088" "subst" "0" "01943" "NHS_000109" "g.17750088C>T" "" "" "" "NHS(NM_001291867.1):c.4460C>T (p.P1487L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693503" "0" "50" "X" "17744889" "17744889" "subst" "3.35879E-5" "01943" "NHS_000081" "g.17744889T>C" "" "" "" "NHS(NM_001291867.1):c.2663T>C (p.M888T), NHS(NM_001291867.2):c.2663T>C (p.M888T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693504" "0" "30" "X" "17745406" "17745406" "subst" "2.23914E-5" "01943" "NHS_000110" "g.17745406A>G" "" "" "" "NHS(NM_001291867.1):c.3180A>G (p.K1060=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693505" "0" "30" "X" "17750064" "17750064" "subst" "0.000106395" "01943" "NHS_000111" "g.17750064G>A" "" "" "" "NHS(NM_001291867.1):c.4436G>A (p.S1479N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000708820" "20" "90" "X" "17710502" "17710502" "dup" "0" "01164" "NHS_000112" "g.17710502dup" "" "" "" "" "ACMG: PVS1, PM2: class 4" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000728720" "0" "50" "X" "17394032" "17394032" "subst" "0.000156901" "01943" "NHS_000113" "g.17394032C>T" "" "" "" "NHS(NM_001291867.1):c.152C>T (p.A51V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728721" "0" "50" "X" "17394070" "17394070" "subst" "2.0014E-5" "01943" "NHS_000114" "g.17394070C>T" "" "" "" "NHS(NM_001291867.1):c.190C>T (p.P64S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728722" "0" "50" "X" "17653720" "17653720" "subst" "0" "01943" "NHS_000115" "g.17653720G>A" "" "" "" "NHS(NM_001136024.3):c.34G>A (p.A12T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728723" "0" "90" "X" "17705959" "17705959" "del" "0" "02329" "NHS_000116" "g.17705959del" "" "" "" "NHS(NM_001291867.2):c.663delC (p.C222Afs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728724" "0" "30" "X" "17710501" "17710501" "subst" "0.000788688" "01943" "NHS_000066" "g.17710501C>G" "" "" "" "NHS(NM_001291867.1):c.765C>G (p.P255=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728725" "0" "30" "X" "17739759" "17739759" "subst" "5.77427E-6" "01943" "NHS_000117" "g.17739759G>A" "" "" "" "NHS(NM_001291867.1):c.1108+6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728726" "0" "50" "X" "17744061" "17744061" "subst" "3.36231E-5" "01943" "NHS_000118" "g.17744061C>T" "" "" "" "NHS(NM_001291867.1):c.1835C>T (p.T612M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728727" "0" "30" "X" "17744914" "17744914" "subst" "3.9194E-5" "01943" "NHS_000119" "g.17744914C>T" "" "" "" "NHS(NM_001291867.1):c.2688C>T (p.N896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728728" "0" "50" "X" "17746277" "17746277" "subst" "0.000442307" "02329" "NHS_000050" "g.17746277G>A" "" "" "" "NHS(NM_001291867.1):c.4051G>A (p.D1351N), NHS(NM_001291867.2):c.4051G>A (p.D1351N), NHS(NM_198270.4):c.3988G>A (p.D1330N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000736868" "1" "50" "X" "17394096" "17394098" "del" "0" "00000" "NHS_000092" "g.17394096_17394098del" "1/181 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs10590816" "0" "" "" "g.17375973_17375975del" "" "VUS" "" "0000787333" "0" "50" "X" "17743727" "17743727" "subst" "0.000190378" "00006" "NHS_000120" "g.17743727C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs770144581" "0" "" "" "g.17725607C>T" "" "VUS" "" "0000810197" "0" "30" "X" "17394233" "17394233" "subst" "0" "01943" "NHS_000122" "g.17394233T>C" "" "" "" "NHS(NM_001291867.1):c.353T>C (p.V118A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810199" "0" "50" "X" "17742519" "17742519" "subst" "1.67853E-5" "01943" "NHS_000123" "g.17742519G>A" "" "" "" "NHS(NM_001291867.1):c.1209G>A (p.S403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810200" "0" "50" "X" "17743697" "17743697" "subst" "3.35942E-5" "02327" "NHS_000032" "g.17743697G>A" "" "" "" "NHS(NM_001291867.2):c.1471G>A (p.(Asp491Asn), p.D491N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810201" "0" "30" "X" "17743849" "17743849" "subst" "0" "01943" "NHS_000124" "g.17743849C>T" "" "" "" "NHS(NM_001291867.1):c.1623C>T (p.T541=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810202" "0" "50" "X" "17744345" "17744345" "subst" "0.000335728" "01943" "NHS_000125" "g.17744345G>T" "" "" "" "NHS(NM_001291867.1):c.2119G>T (p.A707S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000812611" "21" "70" "X" "17744345" "17744345" "subst" "0.000335728" "00000" "NHS_000125" "g.17744345G>T" "" "{PMID:Wang 2019:31106028}" "" "c.2056G>T, p.(Ala686Ser)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.17726225G>T" "" "likely pathogenic" "" "0000814374" "20" "90" "X" "17745416" "17745416" "subst" "0" "00000" "NHS_000126" "g.17745416C>T" "" "{PMID:Lenassi 2020:31848469}" "" "NHS c.3127C>T p.(Gln1043Ter) hemi [de novo]" "hemizygous" "De novo" "?" "" "0" "" "" "g.17727296C>T" "" "pathogenic" "ACMG" "0000824278" "0" "90" "X" "17394125" "17394125" "dup" "0" "00000" "NHS_000127" "g.17394125dup" "" "{PMID:Bell 2021:33494148}" "" "NHS c.245dup, p.(Arg3659Ter)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.17376002dup" "" "pathogenic" "" "0000824281" "21" "70" "X" "17743851" "17743851" "del" "0" "00000" "NHS_000128" "g.17743851del" "" "{PMID:Bell 2021:33494148}" "" "NHS c.1625del, p.(Trp45Leu)" "different transcript, NM_001291867.2 c.1625del, p.Pro542LeufsTer35, hemizygous, unaffected mother is carrier" "Germline" "yes" "" "0" "" "" "g.17725731del" "" "likely pathogenic" "" "0000856493" "0" "30" "X" "17739686" "17739686" "subst" "5.60325E-6" "01943" "NHS_000131" "g.17739686G>A" "" "" "" "NHS(NM_001291867.1):c.1041G>A (p.T347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856494" "0" "50" "X" "17743754" "17743754" "subst" "0" "01943" "NHS_000132" "g.17743754G>C" "" "" "" "NHS(NM_001291867.1):c.1528G>C (p.E510Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856495" "0" "30" "X" "17745046" "17745046" "subst" "5.59973E-6" "01943" "NHS_000134" "g.17745046C>T" "" "" "" "NHS(NM_001291867.1):c.2820C>T (p.A940=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856496" "0" "50" "X" "17745540" "17745540" "subst" "2.24633E-5" "02327" "NHS_000135" "g.17745540G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856497" "0" "30" "X" "17746012" "17746012" "subst" "7.83423E-5" "01943" "NHS_000136" "g.17746012G>A" "" "" "" "NHS(NM_001291867.1):c.3786G>A (p.T1262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856498" "0" "90" "X" "17746097" "17746097" "subst" "0" "02327" "NHS_000137" "g.17746097C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000856499" "0" "30" "X" "17746118" "17746118" "subst" "1.12021E-5" "01943" "NHS_000138" "g.17746118G>A" "" "" "" "NHS(NM_001291867.1):c.3892G>A (p.E1298K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867246" "0" "50" "X" "17710533" "17710533" "subst" "5.59394E-6" "01943" "NHS_000129" "g.17710533A>C" "" "" "" "NHS(NM_001291867.1):c.797A>C (p.Y266S), NHS(NM_198270.2):c.797A>C (p.(Tyr266Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867247" "0" "30" "X" "17739606" "17739606" "subst" "1.11944E-5" "01943" "NHS_000130" "g.17739606A>C" "" "" "" "NHS(NM_001291867.1):c.961A>C (p.R321=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867248" "0" "30" "X" "17743936" "17743936" "subst" "2.2449E-5" "01943" "NHS_000133" "g.17743936C>T" "" "" "" "NHS(NM_001291867.1):c.1710C>T (p.H570=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867249" "0" "50" "X" "17750339" "17750339" "subst" "0.000117481" "01943" "NHS_000139" "g.17750339G>A" "" "" "" "NHS(NM_001291867.1):c.4711G>A (p.E1571K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000870967" "21" "70" "X" "17746226" "17746226" "del" "0" "01164" "NHS_000140" "g.17746226del" "" "" "" "" "ACMG: PVS1, PM2_SUP (Mother also affected, she is carrier of the variant)" "Germline" "yes" "" "0" "" "" "g.17728106del" "" "likely pathogenic (dominant)" "ACMG" "0000873560" "0" "70" "X" "17739693" "17739693" "subst" "0" "00000" "NHS_000141" "g.17739693G>T" "186" "{PMID:Sun 2018:30076350}" "" "NHS(NM_198270.2):c.985G>T(p.E329*)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.17721573G>T" "" "likely pathogenic" "" "0000915659" "0" "50" "X" "17394202" "17394202" "subst" "0.000501954" "02325" "NHS_000074" "g.17394202G>A" "" "" "" "NHS(NM_198270.4):c.322G>A (p.E108K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915660" "0" "30" "X" "17744556" "17744556" "subst" "0.000768665" "02326" "NHS_000067" "g.17744556T>C" "" "" "" "NHS(NM_001136024.2):c.1799T>C (p.(Phe600Ser)), NHS(NM_001291867.1):c.2330T>C (p.F777S), NHS(NM_001291867.2):c.2330T>C (p.F777S), NHS(NM_198270.4):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915661" "0" "30" "X" "17750565" "17750565" "subst" "0.000145516" "02327" "NHS_000056" "g.17750565C>T" "" "" "" "NHS(NM_001291867.1):c.4937C>T (p.S1646F), NHS(NM_001291867.2):c.4937C>T (p.S1646F), NHS(NM_198270.4):c.4874C>T (p.S1625F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915662" "0" "50" "X" "17750565" "17750565" "subst" "0.000145516" "02325" "NHS_000056" "g.17750565C>T" "" "" "" "NHS(NM_001291867.1):c.4937C>T (p.S1646F), NHS(NM_001291867.2):c.4937C>T (p.S1646F), NHS(NM_198270.4):c.4874C>T (p.S1625F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000921543" "1" "90" "X" "17710478" "17710478" "subst" "0" "00006" "NHS_000142" "g.17710478C>T" "" "{PMID:Li 2016:27307692}" "" "" "" "Germline" "" "" "0" "" "" "g.17692358C>T" "" "pathogenic" "" "0000921550" "3" "90" "X" "17743982" "17743982" "subst" "0" "00006" "NHS_000143" "g.17743982C>T" "" "{PMID:Li 2016:27307692}" "" "" "" "Germline" "" "" "0" "" "" "g.17725862C>T" "" "pathogenic" "" "0000921641" "3" "30" "X" "17746244" "17746244" "subst" "0.165271" "00006" "NHS_000071" "g.17746244T>C" "" "{PMID:Li 2019:31842807}" "" "" "" "Germline" "" "rs3747295" "0" "" "" "g.17728124T>C" "" "likely benign" "" "0000921671" "0" "30" "X" "17746244" "17746244" "subst" "0.165271" "00006" "NHS_000071" "g.17746244T>C" "" "{PMID:Li 2019:31842807}" "" "" "" "Germline" "" "rs3747295" "0" "" "" "g.17728124T>C" "" "likely benign" "" "0000921892" "20" "90" "X" "17394125" "17394125" "dup" "0" "00006" "NHS_000127" "g.17394125dup" "" "{PMID:Jackson 2020:32830442}" "" "" "" "Germline" "" "" "0" "" "" "g.17376002_17376003insAA" "" "pathogenic (recessive)" "" "0000939895" "0" "90" "X" "17742490" "17742490" "subst" "0" "00006" "NHS_000061" "g.17742490C>T" "" "{PMID:Nambot 2018:29095811}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.17724370C>T" "" "pathogenic (dominant)" "" "0000951726" "0" "50" "X" "17394096" "17394098" "dup" "0" "02325" "NHS_000144" "g.17394096_17394098dup" "" "" "" "NHS(NM_198270.4):c.216_218dupGCC (p.P73dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000954052" "0" "90" "X" "17742490" "17742490" "subst" "0" "00006" "NHS_000061" "g.17742490C>T" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.17724370C>T" "" "pathogenic" "" "0000954107" "21" "90" "X" "17745559" "17745559" "del" "0" "00006" "NHS_000145" "g.17745559del" "" "{PMID:Li 2018:29914532}" "" "NM_001291868.1:c.2739del" "" "Germline" "" "" "0" "" "" "g.17727439del" "" "pathogenic (recessive)" "" "0000954108" "0" "90" "X" "17746027" "17746028" "del" "0" "00006" "NHS_000146" "g.17746027_17746028del" "" "{PMID:Li 2018:29914532}" "" "NM_001291868.1:c.3207_3208del" "" "De novo" "" "" "0" "" "" "g.17727907_17727908del" "" "pathogenic" "" "0000954792" "21" "70" "X" "17745001" "17745002" "dup" "0" "00006" "NHS_000149" "g.17745001_17745002dup" "" "{PMID:Fan 2020:32883240}" "" "NM_001291867.1:c.2774_2775dup" "variant in unaffected mother" "Germline" "" "" "0" "" "" "g.17726881_17726882dup" "" "likely pathogenic" "" "0000954793" "11" "50" "X" "17745159" "17745159" "subst" "1.11961E-5" "00006" "NHS_000150" "g.17745159T>C" "" "{PMID:Fan 2020:32883240}" "" "NM_001291867.1:c.2933T>C" "variant in unaffected father" "Germline" "" "" "0" "" "" "g.17727039T>C" "" "VUS" "" "0000954804" "21" "90" "X" "17744996" "17744996" "del" "0" "00006" "NHS_000148" "g.17744996del" "" "{PMID:Ma 2016:26694549}" "" "2707delG" "" "Germline" "" "" "0" "" "" "g.17726876del" "" "pathogenic" "" "0000954832" "21" "90" "X" "17745913" "17745913" "subst" "0" "00006" "NHS_000151" "g.17745913C>A" "" "{PMID:Ma 2016:26694549}" "" "" "" "Germline" "" "" "0" "" "" "g.17727793C>A" "" "pathogenic (dominant)" "" "0000954861" "21" "90" "X" "17744521" "17744521" "del" "0" "00006" "NHS_000147" "g.17744521del" "" "{PMID:Patel 2017:27878435}" "" "" "" "Germline" "yes" "" "0" "" "" "g.17726401del" "" "pathogenic" "" "0000954971" "1" "70" "X" "17745885" "17745885" "del" "0" "00006" "NHS_000155" "g.17745885del" "" "{PMID:Kessel 2021:34169787}" "" "3596delA" "ACMG PSV1, PM2" "Germline" "" "" "0" "" "" "g.17727765del" "" "likely pathogenic (recessive)" "" "0000954972" "21" "70" "X" "17431368" "17724919" "dup" "0" "00006" "NHS_000152" "g.(?_17431368)_(17724919_?)dup" "" "{PMID:Kessel 2021:34169787}" "" "arr[hg19]Xp22.13(17,431,368-17,724,919)x2mat" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000955030" "21" "90" "X" "17739754" "17739754" "del" "0" "00006" "NHS_000154" "g.17739754del" "" "{PMID:Reichsteiner 2021:34014271}" "" "NM_001291867.1:c.1108+1del" "" "Germline" "" "" "0" "" "" "g.17721634del" "" "pathogenic (dominant)" "" "0000955031" "20" "90" "X" "17710453" "17710453" "subst" "0" "00006" "NHS_000153" "g.17710453A>G" "" "{PMID:Reichsteiner 2021:34014271}" "" "" "" "Germline" "" "" "0" "" "" "g.17692333A>G" "" "pathogenic (dominant)" "" "0000955032" "21" "90" "X" "17710453" "17710453" "subst" "0" "00006" "NHS_000153" "g.17710453A>G" "" "{PMID:Reichsteiner 2021:34014271}" "" "" "" "Germline" "" "" "0" "" "" "g.17692333A>G" "" "pathogenic" "" "0000955033" "21" "90" "X" "17710453" "17710453" "subst" "0" "00006" "NHS_000153" "g.17710453A>G" "" "{PMID:Reichsteiner 2021:34014271}" "" "" "" "Germline" "" "" "0" "" "" "g.17692333A>G" "" "pathogenic" "" "0000955034" "21" "90" "X" "17710453" "17710453" "subst" "0" "00006" "NHS_000153" "g.17710453A>G" "" "{PMID:Reichsteiner 2021:34014271}" "" "" "" "Germline" "" "" "0" "" "" "g.17692333A>G" "" "pathogenic" "" "0000957382" "0" "70" "X" "17394028" "17394028" "subst" "0" "00006" "NHS_000156" "g.17394028G>T" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.148G>T (Glu50*)" "" "Germline" "yes" "" "0" "" "" "g.17375905G>T" "" "likely pathogenic (dominant)" "" "0000957400" "0" "70" "X" "17739721" "17739721" "subst" "0" "00006" "NHS_000157" "g.17739721T>G" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.1076T>G (Ile359Ser)" "" "De novo" "" "" "0" "" "" "g.17721601T>G" "" "likely pathogenic (dominant)" "" "0000957433" "0" "70" "X" "17394228" "17394230" "del" "0" "00006" "NHS_000093" "g.17394228_17394230del" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.348_350del (Ala117del)" "" "De novo" "" "rs587780401" "0" "" "" "g.17376105_17376107del" "rs587780401" "likely pathogenic (dominant)" "" "0000957483" "0" "70" "X" "17745001" "17745002" "dup" "0" "00006" "NHS_000149" "g.17745001_17745002dup" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.2774_2775dup (Gln926Leufs*3)" "" "Germline" "" "" "0" "" "" "g.17726881_17726882dup" "" "likely pathogenic" "" "0000957484" "0" "70" "X" "17745001" "17745002" "dup" "0" "00006" "NHS_000149" "g.17745001_17745002dup" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.2774_2775dup (Gln926Leufs*3)" "" "Germline" "" "" "0" "" "" "g.17726881_17726882dup" "" "likely pathogenic" "" "0000957497" "0" "50" "X" "17745159" "17745159" "subst" "1.11961E-5" "00006" "NHS_000150" "g.17745159T>C" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.2933T>C (Ile978Thr)" "" "Germline" "no" "rs774677458" "0" "" "" "g.17727039T>C" "rs774677458" "VUS" "" "0000957498" "0" "50" "X" "17745159" "17745159" "subst" "1.11961E-5" "00006" "NHS_000150" "g.17745159T>C" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.2933T>C (Ile978Thr)" "" "Germline" "no" "rs774677458" "0" "" "" "g.17727039T>C" "rs774677458" "VUS" "" "0000957520" "0" "70" "X" "17746308" "17746308" "subst" "0" "00006" "NHS_000158" "g.17746308C>A" "" "{PMID:Liu 2023:37337769}" "" "NM_001291867.1:c.4082C>A (Ser1361*)" "" "Germline" "" "" "0" "" "" "g.17728188C>A" "" "likely pathogenic" "" "0000984585" "0" "30" "X" "17394228" "17394230" "dup" "0" "01804" "NHS_000159" "g.17394228_17394230dup" "" "" "" "NHS(NM_001291867.2):c.348_350dup (p.(Ala117dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984586" "0" "10" "X" "17746155" "17746155" "subst" "0.000661213" "02327" "NHS_000048" "g.17746155G>T" "" "" "" "NHS(NM_001136024.2):c.3398G>T (p.(Gly1133Val)), NHS(NM_001291867.1):c.3929G>T (p.G1310V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000984587" "0" "30" "X" "17746277" "17746277" "subst" "0.000442307" "02325" "NHS_000050" "g.17746277G>A" "" "" "" "NHS(NM_001291867.1):c.4051G>A (p.D1351N), NHS(NM_001291867.2):c.4051G>A (p.D1351N), NHS(NM_198270.4):c.3988G>A (p.D1330N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000986031" "0" "90" "X" "17416436" "17416437" ";" "0" "00006" "DMD_068917" "g.[17416436_17416437insATAAT;17416437_32148962inv;32148962_32148963insN[38]]" "" "{DOI:Steyaert 2024:10.1101/2024.05.03.24305331}, {PMID:Steyaert 2025:40138663}" "" "hg38 17398320-32130845inv" "two fusion transcripts predicted" "Germline/De novo (untested)" "" "" "0" "" "" "g.[17398319_17398320insATAAT;17398320_32130845inv;32130845_32130846insN[38]]" "" "pathogenic (recessive)" "" "0001006617" "0" "50" "X" "17394049" "17394049" "subst" "0" "01804" "NHS_000160" "g.17394049C>T" "" "" "" "NHS(NM_198270.2):c.169C>T (p.(Pro57Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006618" "0" "30" "X" "17394445" "17394445" "subst" "0" "01804" "NHS_000161" "g.17394445C>T" "" "" "" "NHS(NM_198270.2):c.565C>T (p.(Pro189Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006619" "0" "50" "X" "17710533" "17710533" "subst" "5.59394E-6" "01804" "NHS_000129" "g.17710533A>C" "" "" "" "NHS(NM_001291867.1):c.797A>C (p.Y266S), NHS(NM_198270.2):c.797A>C (p.(Tyr266Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006620" "0" "50" "X" "17737463" "17737465" "dup" "0" "01804" "NHS_000162" "g.17737463_17737465dup" "" "" "" "NHS(NM_001136024.2):c.322-1_323dupGTT (p.(Thr107_Phe108insLeu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006621" "0" "50" "X" "17743839" "17743839" "subst" "0" "01804" "NHS_000163" "g.17743839A>C" "" "" "" "NHS(NM_198270.2):c.1550A>C (p.(His517Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006622" "0" "50" "X" "17744472" "17744472" "subst" "0" "01804" "NHS_000164" "g.17744472G>T" "" "" "" "NHS(NM_198270.2):c.2183G>T (p.(Gly728Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006623" "0" "50" "X" "17745182" "17745182" "subst" "0" "01804" "NHS_000165" "g.17745182T>C" "" "" "" "NHS(NM_198270.2):c.2893T>C (p.(Ser965Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006624" "0" "50" "X" "17745479" "17745479" "subst" "0" "01804" "NHS_000166" "g.17745479C>A" "" "" "" "NHS(NM_001291867.2):c.3253C>A (p.(Pro1064Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006625" "0" "50" "X" "17745507" "17745507" "subst" "0" "01804" "NHS_000167" "g.17745507T>C" "" "" "" "NHS(NM_198270.2):c.3218T>C (p.(Leu1073Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006626" "0" "30" "X" "17750304" "17750304" "subst" "5.59726E-6" "01804" "NHS_000168" "g.17750304G>C" "" "" "" "NHS(NM_198270.2):c.4613G>C (p.(Ser1538Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044235" "0" "50" "X" "17743660" "17743660" "subst" "0" "01804" "NHS_000169" "g.17743660T>A" "" "" "" "NHS(NM_001291867.2):c.1434T>A (p.(His478Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044236" "0" "30" "X" "17745771" "17745771" "subst" "0.000573146" "01804" "NHS_000170" "g.17745771C>T" "" "" "" "NHS(NM_001291867.2):c.3545C>T (p.(Pro1182Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044237" "0" "50" "X" "17750157" "17750157" "subst" "1.11852E-5" "01804" "NHS_000171" "g.17750157C>A" "" "" "" "NHS(NM_001291867.2):c.4529C>A (p.(Ser1510Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001058079" "0" "90" "X" "17394227" "17394227" "del" "0" "00006" "NHS_000172" "g.17394227del" "" "{PMID:Guo 2025:40449652}" "" "c.348delC" "" "Germline" "" "" "0" "" "" "g.17376104del" "" "pathogenic" "" "0001058080" "0" "90" "X" "17710478" "17710478" "subst" "0" "00006" "NHS_000142" "g.17710478C>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17692358C>T" "" "pathogenic" "" "0001058081" "0" "90" "X" "17744584" "17744584" "del" "0" "00006" "NHS_000177" "g.17744584del" "" "{PMID:Guo 2025:40449652}" "" "2294delC" "" "Germline" "" "" "0" "" "" "g.17726464del" "" "pathogenic" "" "0001058082" "0" "90" "X" "17745354" "17745354" "del" "0" "00006" "NHS_000180" "g.17745354del" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17727234del" "" "pathogenic" "" "0001058083" "0" "90" "X" "17394255" "17394255" "subst" "0" "00006" "NHS_000173" "g.17394255C>A" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17376132C>A" "" "pathogenic" "" "0001058084" "0" "90" "X" "17394436" "17394436" "subst" "0" "00006" "NHS_000174" "g.17394436G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17376313G>T" "" "pathogenic" "" "0001058085" "0" "90" "X" "17705900" "17705900" "del" "0" "00006" "NHS_000175" "g.17705900del" "" "{PMID:Guo 2025:40449652}" "" "604delT" "" "Germline" "" "" "0" "" "" "g.17687780del" "" "pathogenic" "" "0001058086" "0" "90" "X" "17705900" "17705900" "del" "0" "00006" "NHS_000175" "g.17705900del" "" "{PMID:Guo 2025:40449652}" "" "604delT" "" "Germline" "" "" "0" "" "" "g.17687780del" "" "pathogenic" "" "0001058087" "0" "90" "X" "17739560" "17739560" "subst" "0" "00006" "NHS_000176" "g.17739560G>A" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17721440G>A" "" "pathogenic" "" "0001058088" "0" "90" "X" "17739560" "17739560" "subst" "0" "00006" "NHS_000176" "g.17739560G>A" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17721440G>A" "" "pathogenic" "" "0001058089" "0" "90" "X" "17742490" "17742490" "subst" "0" "00006" "NHS_000061" "g.17742490C>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17724370C>T" "" "pathogenic" "" "0001058090" "0" "90" "X" "17746150" "17746150" "del" "0" "00006" "NHS_000182" "g.17746150del" "" "{PMID:Guo 2025:40449652}" "" "3861delT" "" "Germline" "" "" "0" "" "" "g.17728030del" "" "pathogenic" "" "0001058091" "0" "90" "X" "17739693" "17739693" "subst" "0" "00006" "NHS_000141" "g.17739693G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17721573G>T" "" "pathogenic" "" "0001058092" "0" "90" "X" "17739693" "17739693" "subst" "0" "00006" "NHS_000141" "g.17739693G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17721573G>T" "" "pathogenic" "" "0001058115" "0" "90" "X" "17745005" "17745008" "del" "0" "00006" "NHS_000179" "g.17745005_17745008del" "" "{PMID:Guo 2025:40449652}" "" "2716_2719delTTAG" "" "Germline" "" "" "0" "" "" "g.17726885_17726888del" "" "pathogenic" "" "0001058116" "0" "90" "X" "17745005" "17745008" "del" "0" "00006" "NHS_000179" "g.17745005_17745008del" "" "{PMID:Guo 2025:40449652}" "" "2716_2719delTTAG" "" "Germline" "" "" "0" "" "" "g.17726885_17726888del" "" "pathogenic" "" "0001058121" "0" "90" "X" "17394436" "17394436" "subst" "0" "00006" "NHS_000174" "g.17394436G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17376313G>T" "" "pathogenic" "" "0001058143" "0" "90" "X" "17394436" "17394436" "subst" "0" "00006" "NHS_000174" "g.17394436G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17376313G>T" "" "pathogenic" "" "0001058144" "0" "90" "X" "17394436" "17394436" "subst" "0" "00006" "NHS_000174" "g.17394436G>T" "" "{PMID:Guo 2025:40449652}" "" "" "" "Germline" "" "" "0" "" "" "g.17376313G>T" "" "pathogenic" "" "0001058255" "0" "70" "X" "17744737" "17744737" "del" "0" "00006" "NHS_000178" "g.17744737del" "" "{PMID:Wang 2024:38184101}" "" "NM_001291867.1:c.2511del" "ACMG PVS1, PM2_sup" "Germline" "" "" "0" "" "" "g.17726617del" "" "likely pathogenic (dominant)" "ACMG" "0001058256" "0" "70" "X" "17745611" "17745611" "subst" "1.67968E-5" "00006" "NHS_000181" "g.17745611C>G" "" "{PMID:Wang 2024:38184101}" "" "NM_001291867.1:c.3385C>G" "ACMG PS2_mod, PS4_sup, PM2_sup, PP1_sup, PP4" "Germline" "" "" "0" "" "" "g.17727491C>G" "" "likely pathogenic (dominant)" "ACMG" "0001058947" "0" "70" "X" "17705909" "17705909" "subst" "1.67821E-5" "00006" "NHS_000183" "g.17705909G>A" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.17687789G>A" "" "likely pathogenic" "" "0001059904" "21" "90" "X" "17746027" "17746028" "del" "0" "00006" "NHS_000146" "g.17746027_17746028del" "" "{PMID:Lecca 2024:38840272}" "" "" "ACMG PVS1, PM2_P, PP5_P" "Germline" "" "" "0" "" "" "g.17727907_17727908del" "" "pathogenic (dominant)" "ACMG" "0001059905" "0" "90" "X" "17746027" "17746028" "del" "0" "00006" "NHS_000146" "g.17746027_17746028del" "" "{PMID:Lecca 2024:38840272}" "" "" "ACMG PVS1, PM2_P, PP5_P" "Germline/De novo (untested)" "" "" "0" "" "" "g.17727907_17727908del" "" "pathogenic (dominant)" "ACMG" "0001059912" "0" "90" "X" "17737462" "17737462" "subst" "0" "00006" "NHS_000184" "g.17737462A>C" "" "{PMID:Lecca 2024:38840272}" "" "" "ACMG PVS1, PM2_P, PM6_M" "De novo" "" "" "0" "" "" "g.17719342A>C" "" "pathogenic (dominant)" "ACMG" "0001062672" "21" "50" "X" "17743559" "17743559" "subst" "0" "00006" "NHS_000185" "g.17743559A>G" "" "{PMID:Ibarluzea 2020:31906484}" "" "NM_198270.3:c.1270A>G" "ACMG PM2, BP1" "Germline" "" "" "0" "maternal X-inactivation uninformative" "" "g.17725439A>G" "" "VUS" "ACMG" "0001067595" "0" "50" "X" "17394337" "17394337" "subst" "5.29225E-5" "02325" "NHS_000186" "g.17394337C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067596" "0" "30" "X" "17710268" "17710268" "subst" "0" "01804" "NHS_000187" "g.17710268A>T" "" "" "" "NHS(NM_001291867.2):c.719-187A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001067597" "0" "50" "X" "17744418" "17744420" "del" "0" "02325" "NHS_000188" "g.17744418_17744420del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067598" "0" "50" "X" "17750076" "17750076" "subst" "0" "02325" "NHS_000189" "g.17750076C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NHS ## Count = 267 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000001813" "00000295" "50" "566" "-10" "566" "-10" "c.566-10dup" "r.(=)" "p.(=)" "1i" "0000002819" "00000295" "50" "566" "-10" "566" "-10" "c.566-10dup" "r.(=)" "p.(=)" "1i" "0000002820" "00000295" "50" "719" "-102" "719" "-102" "c.719-102del" "r.(=)" "p.(=)" "2i" "0000006439" "00000295" "50" "566" "-93365" "566" "-93365" "c.566-93365G>A" "r.(=)" "p.(=)" "1i" "0000006440" "00000295" "50" "7745" "0" "7745" "0" "c.*2852A>T" "r.(=)" "p.(=)" "8" "0000008493" "00000295" "50" "566" "-93365" "566" "-93365" "c.566-93365G>A" "r.(=)" "p.(=)" "1i" "0000008494" "00000295" "50" "566" "-10" "566" "-10" "c.566-10dup" "r.(=)" "p.(=)" "1i" "0000008495" "00000295" "50" "7745" "0" "7745" "0" "c.*2852A>T" "r.(=)" "p.(=)" "8" "0000010824" "00000295" "50" "566" "-10" "566" "-10" "c.566-10dup" "r.(=)" "p.(=)" "1i" "0000096853" "00000295" "90" "3019" "0" "3019" "0" "c.3019C>T" "r.(?)" "p.(Gln1007*)" "" "0000172293" "00000295" "70" "3883" "0" "3883" "0" "c.3883C>T" "r.(?)" "p.(Gln1295*)" "6" "0000253672" "00000295" "10" "1655" "0" "1655" "0" "c.1655A>C" "r.(?)" "p.(Gln552Pro)" "" "0000296473" "00000295" "30" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Asp470Asn)" "" "0000296474" "00000295" "10" "566" "-10" "566" "-10" "c.566-10dup" "r.(=)" "p.(=)" "" "0000296475" "00000295" "50" "739" "0" "739" "0" "c.739C>T" "r.(?)" "p.(Arg247Cys)" "" "0000300043" "00000295" "10" "1651" "0" "1651" "0" "c.1651C>T" "r.(?)" "p.(Pro551Ser)" "" "0000300044" "00000295" "30" "4874" "0" "4874" "0" "c.4874C>T" "r.(?)" "p.(Ser1625Phe)" "" "0000300045" "00000295" "30" "566" "-5" "566" "-5" "c.566-5T>C" "r.spl?" "p.?" "" "0000304117" "00000295" "30" "1112" "0" "1112" "0" "c.1112G>A" "r.(?)" "p.(Arg371Gln)" "" "0000304118" "00000295" "30" "566" "-52165" "566" "-52165" "c.566-52165C>T" "r.(=)" "p.(=)" "" "0000304119" "00000295" "30" "1503" "0" "1503" "0" "c.1503C>T" "r.(?)" "p.(Gly501=)" "" "0000304120" "00000295" "50" "176" "0" "176" "0" "c.176G>A" "r.(?)" "p.(Arg59His)" "" "0000304121" "00000295" "30" "177" "0" "177" "0" "c.177C>A" "r.(?)" "p.(Arg59=)" "" "0000304122" "00000295" "50" "1862" "0" "1862" "0" "c.1862C>A" "r.(?)" "p.(Pro621His)" "" "0000304123" "00000295" "50" "2005" "0" "2005" "0" "c.2005C>T" "r.(?)" "p.(His669Tyr)" "" "0000304124" "00000295" "30" "211" "0" "211" "0" "c.211C>T" "r.(?)" "p.(Pro71Ser)" "" "0000304125" "00000295" "30" "2530" "0" "2530" "0" "c.2530G>A" "r.(?)" "p.(Ala844Thr)" "" "0000304126" "00000295" "30" "2699" "0" "2699" "0" "c.2699G>A" "r.(?)" "p.(Gly900Asp)" "" "0000304127" "00000295" "30" "3078" "0" "3078" "0" "c.3078C>T" "r.(?)" "p.(Pro1026=)" "" "0000304128" "00000295" "10" "3152" "0" "3152" "0" "c.3152C>T" "r.(?)" "p.(Thr1051Ile)" "" "0000304129" "00000295" "30" "3345" "0" "3345" "0" "c.3345G>A" "r.(?)" "p.(Thr1115=)" "" "0000304130" "00000295" "10" "3866" "0" "3866" "0" "c.3866G>T" "r.(?)" "p.(Gly1289Val)" "" "0000304131" "00000295" "10" "4603" "0" "4603" "0" "c.4603T>A" "r.(?)" "p.(Ser1535Thr)" "" "0000304132" "00000295" "30" "513" "0" "513" "0" "c.513C>T" "r.(?)" "p.(Leu171=)" "" "0000304133" "00000295" "50" "546" "0" "546" "0" "c.546C>G" "r.(?)" "p.(Asp182Glu)" "" "0000304134" "00000295" "30" "688" "0" "688" "0" "c.688G>A" "r.(?)" "p.(Ala230Thr)" "" "0000333286" "00000295" "30" "211" "0" "211" "0" "c.211C>T" "r.(?)" "p.(Pro71Ser)" "" "0000333287" "00000295" "30" "302" "0" "337" "0" "c.302_337dup" "r.(?)" "p.(Glu101_Ala112dup)" "" "0000333288" "00000295" "50" "310" "0" "345" "0" "c.310_345del" "r.(?)" "p.(Pro104_Ala115del)" "" "0000333291" "00000295" "30" "566" "-52165" "566" "-52165" "c.566-52165C>T" "r.(=)" "p.(=)" "" "0000333292" "00000295" "50" "566" "-52157" "566" "-52157" "c.566-52157A>T" "r.(=)" "p.(=)" "" "0000333293" "00000295" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Val190Ile)" "" "0000333297" "00000295" "50" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Ser745Phe)" "" "0000333299" "00000295" "50" "2530" "0" "2530" "0" "c.2530G>A" "r.(?)" "p.(Ala844Thr)" "" "0000333300" "00000295" "50" "2768" "0" "2768" "0" "c.2768A>T" "r.(?)" "p.(His923Leu)" "" "0000333301" "00000295" "50" "3722" "0" "3722" "0" "c.3722C>T" "r.(?)" "p.(Thr1241Met)" "" "0000333302" "00000295" "30" "3866" "0" "3866" "0" "c.3866G>T" "r.(?)" "p.(Gly1289Val)" "" "0000333304" "00000295" "50" "4024" "0" "4024" "0" "c.4024A>G" "r.(?)" "p.(Ile1342Val)" "" "0000333305" "00000295" "50" "4583" "0" "4583" "0" "c.4583C>A" "r.(?)" "p.(Pro1528His)" "" "0000333307" "00000295" "50" "4676" "0" "4676" "0" "c.4676C>A" "r.(?)" "p.(Ser1559Tyr)" "" "0000333308" "00000295" "50" "4808" "0" "4808" "0" "c.4808C>T" "r.(?)" "p.(Thr1603Met)" "" "0000342762" "00000295" "90" "1117" "0" "1117" "0" "c.1117C>T" "r.(?)" "p.(Arg373Ter)" "" "0000343448" "00000295" "90" "2635" "0" "2635" "0" "c.2635C>T" "r.(?)" "p.(Arg879Ter)" "" "0000345015" "00000295" "90" "2896" "0" "2896" "0" "c.2896C>T" "r.(?)" "p.(Gln966Ter)" "" "0000346018" "00000295" "90" "1044" "0" "1044" "0" "c.1044del" "r.(?)" "p.(Gly349GlufsTer27)" "" "0000347346" "00000295" "50" "2789" "0" "2789" "0" "c.2789T>G" "r.(?)" "p.(Leu930Arg)" "" "0000348410" "00000295" "50" "106" "0" "106" "0" "c.106C>T" "r.(?)" "p.(Pro36Ser)" "" "0000350739" "00000295" "90" "853" "-2" "853" "-2" "c.853-2A>G" "r.spl?" "p.?" "" "0000394316" "00000295" "50" "1651" "0" "1651" "0" "c.1651C>T" "r.(?)" "p.(Pro551Ser)" "" "0000394317" "00000295" "50" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Phe756Ser)" "" "0000394318" "00000295" "30" "2418" "0" "2418" "0" "c.2418G>A" "r.(=)" "p.(=)" "" "0000394319" "00000295" "50" "2530" "0" "2530" "0" "c.2530G>A" "r.(?)" "p.(Ala844Thr)" "" "0000394320" "00000295" "30" "3138" "0" "3138" "0" "c.3138T>C" "r.(=)" "p.(=)" "" "0000394321" "00000295" "30" "3141" "0" "3141" "0" "c.3141A>G" "r.(=)" "p.(=)" "" "0000394322" "00000295" "50" "3866" "0" "3866" "0" "c.3866G>T" "r.(?)" "p.(Gly1289Val)" "" "0000394323" "00000295" "50" "3955" "0" "3955" "0" "c.3955T>C" "r.(?)" "p.(Phe1319Leu)" "" "0000394324" "00000295" "30" "765" "0" "765" "0" "c.765C>G" "r.(=)" "p.(=)" "" "0000408094" "00000295" "00" "1450" "0" "1450" "0" "c.1450C>T" "r.(?)" "p.(Arg484Trp)" "" "0000575092" "00000295" "10" "310" "0" "345" "0" "c.310_345del" "r.(?)" "p.(Pro104_Ala115del)" "" "0000575095" "00000295" "30" "565" "7" "565" "7" "c.565+7A>C" "r.(=)" "p.(=)" "" "0000575096" "00000295" "30" "566" "-5" "566" "-5" "c.566-5T>C" "r.spl?" "p.?" "" "0000575097" "00000295" "90" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Tyr203Ter)" "" "0000575098" "00000295" "30" "683" "0" "683" "0" "c.683G>A" "r.(?)" "p.(Arg228His)" "" "0000575099" "00000295" "50" "842" "0" "842" "0" "c.842A>G" "r.(?)" "p.(His281Arg)" "" "0000575100" "00000295" "30" "1255" "0" "1255" "0" "c.1255A>G" "r.(?)" "p.(Arg419Gly)" "" "0000575101" "00000295" "50" "1255" "0" "1255" "0" "c.1255A>G" "r.(?)" "p.(Arg419Gly)" "" "0000575102" "00000295" "30" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Asp470Asn)" "" "0000575103" "00000295" "30" "1651" "0" "1651" "0" "c.1651C>T" "r.(?)" "p.(Pro551Ser)" "" "0000575105" "00000295" "30" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Phe756Ser)" "" "0000575106" "00000295" "30" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Phe756Ser)" "" "0000575107" "00000295" "30" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Phe756Ser)" "" "0000575108" "00000295" "50" "2600" "0" "2600" "0" "c.2600T>C" "r.(?)" "p.(Met867Thr)" "" "0000575109" "00000295" "50" "2657" "0" "2657" "0" "c.2657C>T" "r.(?)" "p.(Pro886Leu)" "" "0000575110" "00000295" "30" "2728" "0" "2728" "0" "c.2728G>T" "r.(?)" "p.(Asp910Tyr)" "" "0000575111" "00000295" "10" "2768" "0" "2768" "0" "c.2768A>T" "r.(?)" "p.(His923Leu)" "" "0000575112" "00000295" "50" "3253" "0" "3253" "0" "c.3253C>T" "r.(?)" "p.(His1085Tyr)" "" "0000575113" "00000295" "30" "3311" "0" "3311" "0" "c.3311C>T" "r.(?)" "p.(Ser1104Leu)" "" "0000575114" "00000295" "50" "3335" "0" "3335" "0" "c.3335T>C" "r.(?)" "p.(Ile1112Thr)" "" "0000575115" "00000295" "50" "3452" "0" "3452" "0" "c.3452C>T" "r.(?)" "p.(Thr1151Met)" "" "0000575116" "00000295" "30" "3722" "0" "3722" "0" "c.3722C>T" "r.(?)" "p.(Thr1241Met)" "" "0000575117" "00000295" "30" "3778" "0" "3778" "0" "c.3778C>T" "r.(?)" "p.(Arg1260Cys)" "" "0000575119" "00000295" "90" "3813" "0" "3813" "0" "c.3813T>G" "r.(?)" "p.(Tyr1271Ter)" "" "0000575120" "00000295" "30" "3988" "0" "3988" "0" "c.3988G>A" "r.(?)" "p.(Asp1330Asn)" "" "0000575121" "00000295" "50" "4058" "0" "4058" "0" "c.4058C>G" "r.(?)" "p.(Ser1353Cys)" "" "0000575122" "00000295" "30" "4603" "0" "4603" "0" "c.4603T>A" "r.(?)" "p.(Ser1535Thr)" "" "0000575123" "00000295" "30" "4874" "0" "4874" "0" "c.4874C>T" "r.(?)" "p.(Ser1625Phe)" "" "0000619362" "00000295" "30" "216" "0" "218" "0" "c.216_218del" "r.(?)" "p.(Pro73del)" "" "0000619363" "00000295" "10" "310" "0" "345" "0" "c.310_345del" "r.(?)" "p.(Pro104_Ala115del)" "" "0000619364" "00000295" "50" "348" "0" "350" "0" "c.348_350del" "r.(?)" "p.(Ala117del)" "" "0000619365" "00000295" "30" "739" "0" "739" "0" "c.739C>T" "r.(?)" "p.(Arg247Cys)" "" "0000619366" "00000295" "30" "1308" "0" "1308" "0" "c.1308T>C" "r.(?)" "p.(Ala436=)" "" "0000619367" "00000295" "30" "1533" "0" "1533" "0" "c.1533G>A" "r.(?)" "p.(Glu511=)" "" "0000619368" "00000295" "30" "3324" "0" "3324" "0" "c.3324G>A" "r.(?)" "p.(Pro1108=)" "" "0000619369" "00000295" "50" "4336" "0" "4336" "0" "c.4336C>T" "r.(?)" "p.(Arg1446Ter)" "" "0000619370" "00000295" "50" "4370" "0" "4371" "0" "c.4370_4371del" "r.(?)" "p.(Ser1457LysfsTer12)" "" "0000624536" "00000295" "30" "2109" "0" "2109" "0" "c.2109T>A" "r.(?)" "p.(Asn703Lys)" "" "0000624537" "00000295" "30" "2214" "0" "2214" "0" "c.2214T>C" "r.(?)" "p.(Tyr738=)" "" "0000624538" "00000295" "50" "4373" "0" "4373" "0" "c.4373del" "r.(?)" "p.(Ser1458ThrfsTer13)" "" "0000652856" "00000295" "10" "1651" "0" "1651" "0" "c.1651C>T" "r.(?)" "p.(Pro551Ser)" "" "0000659230" "00000295" "30" "852" "0" "852" "0" "c.852G>A" "r.(?)" "p.(Thr284=)" "" "0000667472" "00000295" "90" "694" "0" "694" "0" "c.694C>T" "r.(?)" "p.(Gln232*)" "" "0000670104" "00000295" "10" "1651" "0" "1651" "0" "c.1651C>T" "r.(?)" "p.(Pro551Ser)" "" "0000682311" "00000295" "30" "828" "0" "828" "0" "c.828G>A" "r.(?)" "p.(Glu276=)" "" "0000682312" "00000295" "30" "1684" "0" "1684" "0" "c.1684C>T" "r.(?)" "p.(Arg562Cys)" "" "0000682313" "00000295" "30" "2646" "0" "2646" "0" "c.2646C>T" "r.(?)" "p.(Asn882=)" "" "0000682314" "00000295" "30" "3469" "0" "3469" "0" "c.3469A>G" "r.(?)" "p.(Ser1157Gly)" "" "0000682315" "00000295" "50" "3932" "0" "3932" "0" "c.3932G>A" "r.(?)" "p.(Arg1311Lys)" "" "0000682316" "00000295" "50" "4365" "0" "4367" "0" "c.4365_4367dup" "r.(?)" "p.(Ser1459dup)" "" "0000682317" "00000295" "50" "4397" "0" "4397" "0" "c.4397C>T" "r.(?)" "p.(Pro1466Leu)" "" "0000693503" "00000295" "50" "2600" "0" "2600" "0" "c.2600T>C" "r.(?)" "p.(Met867Thr)" "" "0000693504" "00000295" "30" "3117" "0" "3117" "0" "c.3117A>G" "r.(?)" "p.(Lys1039=)" "" "0000693505" "00000295" "30" "4373" "0" "4373" "0" "c.4373G>A" "r.(?)" "p.(Ser1458Asn)" "" "0000708820" "00000295" "90" "766" "0" "766" "0" "c.766dup" "r.(?)" "p.(Leu256Profs*21)" "3" "0000728720" "00000295" "50" "152" "0" "152" "0" "c.152C>T" "r.(?)" "p.(Ala51Val)" "" "0000728721" "00000295" "50" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Pro64Ser)" "" "0000728722" "00000295" "50" "566" "-52142" "566" "-52142" "c.566-52142G>A" "r.(=)" "p.(=)" "" "0000728723" "00000295" "90" "663" "0" "663" "0" "c.663del" "r.(?)" "p.(Cys222Alafs*62)" "" "0000728724" "00000295" "30" "765" "0" "765" "0" "c.765C>G" "r.(?)" "p.(Pro255=)" "" "0000728725" "00000295" "30" "1045" "6" "1045" "6" "c.1045+6G>A" "r.(=)" "p.(=)" "" "0000728726" "00000295" "50" "1772" "0" "1772" "0" "c.1772C>T" "r.(?)" "p.(Thr591Met)" "" "0000728727" "00000295" "30" "2625" "0" "2625" "0" "c.2625C>T" "r.(?)" "p.(Asn875=)" "" "0000728728" "00000295" "50" "3988" "0" "3988" "0" "c.3988G>A" "r.(?)" "p.(Asp1330Asn)" "" "0000736868" "00000295" "50" "216" "0" "218" "0" "c.216_218del" "r.(?)" "p.(Pro73del)" "" "0000787333" "00000295" "50" "1438" "0" "1438" "0" "c.1438C>T" "r.(?)" "p.(Arg480Cys)" "6" "0000810197" "00000295" "30" "353" "0" "353" "0" "c.353T>C" "r.(?)" "p.(Val118Ala)" "" "0000810199" "00000295" "50" "1146" "0" "1146" "0" "c.1146G>A" "r.(?)" "p.(Ser382=)" "" "0000810200" "00000295" "50" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Asp470Asn)" "" "0000810201" "00000295" "30" "1560" "0" "1560" "0" "c.1560C>T" "r.(?)" "p.(Thr520=)" "" "0000810202" "00000295" "50" "2056" "0" "2056" "0" "c.2056G>T" "r.(?)" "p.(Ala686Ser)" "" "0000812611" "00000295" "70" "2056" "0" "2056" "0" "c.2056G>T" "r.(?)" "p.(Ala686Ser)" "" "0000814374" "00000295" "90" "3127" "0" "3127" "0" "c.3127C>T" "r.(?)" "p.(Gln1043Ter)" "" "0000824278" "00000295" "90" "245" "0" "245" "0" "c.245dup" "r.(?)" "p.(Pro83Alafs*100)" "" "0000824281" "00000295" "70" "1562" "0" "1562" "0" "c.1562del" "r.(?)" "p.(Pro521Leufs*35)" "" "0000856493" "00000295" "30" "978" "0" "978" "0" "c.978G>A" "r.(?)" "p.(Thr326=)" "" "0000856493" "00026036" "30" "1041" "0" "1041" "0" "c.1041G>A" "r.(?)" "p.(Thr347=)" "" "0000856494" "00000295" "50" "1465" "0" "1465" "0" "c.1465G>C" "r.(?)" "p.(Glu489Gln)" "" "0000856494" "00026036" "50" "1528" "0" "1528" "0" "c.1528G>C" "r.(?)" "p.(Glu510Gln)" "" "0000856495" "00000295" "30" "2757" "0" "2757" "0" "c.2757C>T" "r.(?)" "p.(Ala919=)" "" "0000856495" "00026036" "30" "2820" "0" "2820" "0" "c.2820C>T" "r.(?)" "p.(Ala940=)" "" "0000856496" "00000295" "50" "3251" "0" "3251" "0" "c.3251G>A" "r.(?)" "p.(Arg1084His)" "" "0000856496" "00026036" "50" "3314" "0" "3314" "0" "c.3314G>A" "r.(?)" "p.(Arg1105His)" "" "0000856497" "00000295" "30" "3723" "0" "3723" "0" "c.3723G>A" "r.(?)" "p.(Thr1241=)" "" "0000856497" "00026036" "30" "3786" "0" "3786" "0" "c.3786G>A" "r.(?)" "p.(Thr1262=)" "" "0000856498" "00000295" "90" "3808" "0" "3808" "0" "c.3808C>T" "r.(?)" "p.(Gln1270*)" "" "0000856498" "00026036" "90" "3871" "0" "3871" "0" "c.3871C>T" "r.(?)" "p.(Gln1291*)" "" "0000856499" "00000295" "30" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Glu1277Lys)" "" "0000856499" "00026036" "30" "3892" "0" "3892" "0" "c.3892G>A" "r.(?)" "p.(Glu1298Lys)" "" "0000867246" "00000295" "50" "797" "0" "797" "0" "c.797A>C" "r.(?)" "p.(Tyr266Ser)" "" "0000867246" "00026036" "50" "797" "0" "797" "0" "c.797A>C" "r.(?)" "p.(Tyr266Ser)" "" "0000867247" "00000295" "30" "898" "0" "898" "0" "c.898A>C" "r.(?)" "p.(Arg300=)" "" "0000867247" "00026036" "30" "961" "0" "961" "0" "c.961A>C" "r.(?)" "p.(Arg321=)" "" "0000867248" "00000295" "30" "1647" "0" "1647" "0" "c.1647C>T" "r.(?)" "p.(His549=)" "" "0000867248" "00026036" "30" "1710" "0" "1710" "0" "c.1710C>T" "r.(?)" "p.(His570=)" "" "0000867249" "00000295" "50" "4648" "0" "4648" "0" "c.4648G>A" "r.(?)" "p.(Glu1550Lys)" "" "0000867249" "00026036" "50" "4711" "0" "4711" "0" "c.4711G>A" "r.(?)" "p.(Glu1571Lys)" "" "0000870967" "00000295" "70" "3937" "0" "3937" "0" "c.3937del" "r.(?)" "p.(Thr1313Glnfs*3)" "7" "0000873560" "00000295" "70" "985" "0" "985" "0" "c.985G>T" "r.(?)" "p.(Glu329*)" "" "0000915659" "00000295" "50" "322" "0" "322" "0" "c.322G>A" "r.(?)" "p.(Glu108Lys)" "" "0000915660" "00000295" "30" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Phe756Ser)" "" "0000915661" "00000295" "30" "4874" "0" "4874" "0" "c.4874C>T" "r.(?)" "p.(Ser1625Phe)" "" "0000915662" "00000295" "50" "4874" "0" "4874" "0" "c.4874C>T" "r.(?)" "p.(Ser1625Phe)" "" "0000921543" "00000295" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Ter)" "" "0000921550" "00000295" "90" "1693" "0" "1693" "0" "c.1693C>T" "r.(?)" "p.(Arg565Ter)" "" "0000921641" "00000295" "30" "3955" "0" "3955" "0" "c.3955T>C" "r.(?)" "p.(Phe1319Leu)" "" "0000921671" "00000295" "30" "3955" "0" "3955" "0" "c.3955T>C" "r.(?)" "p.(Phe1319Leu)" "" "0000921892" "00000295" "90" "245" "0" "245" "0" "c.245dup" "r.(?)" "p.(Pro83AlafsTer100)" "" "0000939895" "00000295" "90" "1117" "0" "1117" "0" "c.1117C>T" "r.(?)" "p.(Arg373Ter)" "5" "0000951726" "00000295" "50" "216" "0" "218" "0" "c.216_218dup" "r.(?)" "p.(Pro73dup)" "" "0000951726" "00026036" "50" "216" "0" "218" "0" "c.216_218dup" "r.(?)" "p.(Pro73dup)" "" "0000954052" "00000295" "90" "1117" "0" "1117" "0" "c.1117C>T" "r.(?)" "p.(Arg373Ter)" "" "0000954107" "00000295" "90" "3270" "0" "3270" "0" "c.3270del" "r.(?)" "p.(Phe1090LeufsTer9)" "" "0000954108" "00000295" "90" "3738" "0" "3739" "0" "c.3738_3739del" "r.(?)" "p.(Ala1247PhefsTer16)" "" "0000954792" "00000295" "70" "2712" "0" "2713" "0" "c.2712_2713dup" "r.(?)" "p.(Gln905LeufsTer3)" "" "0000954793" "00000295" "50" "2870" "0" "2870" "0" "c.2870T>C" "r.(?)" "p.(Ile957Thr)" "" "0000954804" "00000295" "90" "2707" "0" "2707" "0" "c.2707del" "r.(?)" "p.(Glu903AsnfsTer4)" "" "0000954832" "00000295" "90" "3624" "0" "3624" "0" "c.3624C>A" "r.(?)" "p.(Cys1208Ter)" "" "0000954861" "00000295" "90" "2232" "0" "2232" "0" "c.2232del" "r.(?)" "p.(Lys744AsnfsTer15)" "" "0000954971" "00000295" "70" "3596" "0" "3596" "0" "c.3596del" "r.(?)" "p.(Asn1199ThrfsTer6)" "" "0000954972" "00000295" "90" "565" "36923" "852" "14331" "c.(?_565+36923)_(852+14331_?)dup" "r.?" "p.?" "" "0000955030" "00000295" "90" "1045" "1" "1045" "1" "c.1045+1del" "r.spl" "p.?" "" "0000955031" "00000295" "90" "719" "-2" "719" "-2" "c.719-2A>G" "r.spl" "p.?" "" "0000955032" "00000295" "90" "719" "-2" "719" "-2" "c.719-2A>G" "r.spl" "p.?" "" "0000955033" "00000295" "90" "719" "-2" "719" "-2" "c.719-2A>G" "r.spl" "p.?" "" "0000955034" "00000295" "90" "719" "-2" "719" "-2" "c.719-2A>G" "r.spl" "p.?" "" "0000957382" "00000295" "70" "148" "0" "148" "0" "c.148G>T" "r.(?)" "p.(Glu50*)" "" "0000957400" "00000295" "70" "1013" "0" "1013" "0" "c.1013T>G" "r.(?)" "p.(Ile338Ser)" "" "0000957433" "00000295" "70" "348" "0" "350" "0" "c.348_350del" "r.(?)" "p.(Ala117del)" "" "0000957483" "00000295" "70" "2712" "0" "2713" "0" "c.2712_2713dup" "r.(?)" "p.(Gln905Leufs*3)" "" "0000957484" "00000295" "70" "2712" "0" "2713" "0" "c.2712_2713dup" "r.(?)" "p.(Gln905Leufs*3)" "" "0000957497" "00000295" "50" "2870" "0" "2870" "0" "c.2870T>C" "r.(?)" "p.(Ile957Thr)" "" "0000957498" "00000295" "50" "2870" "0" "2870" "0" "c.2870T>C" "r.(?)" "p.(Ile957Thr)" "" "0000957520" "00000295" "70" "4019" "0" "4019" "0" "c.4019C>A" "r.(?)" "p.(Ser1340*)" "" "0000984585" "00000295" "30" "348" "0" "350" "0" "c.348_350dup" "r.(?)" "p.(Ala117dup)" "" "0000984585" "00026036" "30" "348" "0" "350" "0" "c.348_350dup" "r.(?)" "p.(Ala117dup)" "" "0000984586" "00000295" "10" "3866" "0" "3866" "0" "c.3866G>T" "r.(?)" "p.(Gly1289Val)" "" "0000984587" "00000295" "30" "3988" "0" "3988" "0" "c.3988G>A" "r.(?)" "p.(Asp1330Asn)" "" "0000986031" "00000295" "90" "565" "21992" "8423" "0" "c.565+21992_*3530inv{1}" "r.?" "p.?" "1i_8_" "0001006617" "00000295" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Pro57Ser)" "" "0001006617" "00026036" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Pro57Ser)" "" "0001006618" "00000295" "30" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Pro189Ser)" "" "0001006618" "00026036" "30" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Pro189Ser)" "" "0001006619" "00000295" "50" "797" "0" "797" "0" "c.797A>C" "r.(?)" "p.(Tyr266Ser)" "" "0001006619" "00026036" "50" "797" "0" "797" "0" "c.797A>C" "r.(?)" "p.(Tyr266Ser)" "" "0001006620" "00000295" "50" "853" "-2098" "853" "-2096" "c.853-2098_853-2096dup" "r.(=)" "p.(=)" "" "0001006620" "00026036" "50" "853" "-1" "854" "0" "c.853-1_854dup" "r.spl?" "p.?" "" "0001006621" "00000295" "50" "1550" "0" "1550" "0" "c.1550A>C" "r.(?)" "p.(His517Pro)" "" "0001006621" "00026036" "50" "1613" "0" "1613" "0" "c.1613A>C" "r.(?)" "p.(His538Pro)" "" "0001006622" "00000295" "50" "2183" "0" "2183" "0" "c.2183G>T" "r.(?)" "p.(Gly728Val)" "" "0001006622" "00026036" "50" "2246" "0" "2246" "0" "c.2246G>T" "r.(?)" "p.(Gly749Val)" "" "0001006623" "00000295" "50" "2893" "0" "2893" "0" "c.2893T>C" "r.(?)" "p.(Ser965Pro)" "" "0001006623" "00026036" "50" "2956" "0" "2956" "0" "c.2956T>C" "r.(?)" "p.(Ser986Pro)" "" "0001006624" "00000295" "50" "3190" "0" "3190" "0" "c.3190C>A" "r.(?)" "p.(Pro1064Thr)" "" "0001006624" "00026036" "50" "3253" "0" "3253" "0" "c.3253C>A" "r.(?)" "p.(Pro1085Thr)" "" "0001006625" "00000295" "50" "3218" "0" "3218" "0" "c.3218T>C" "r.(?)" "p.(Leu1073Pro)" "" "0001006625" "00026036" "50" "3281" "0" "3281" "0" "c.3281T>C" "r.(?)" "p.(Leu1094Pro)" "" "0001006626" "00000295" "30" "4613" "0" "4613" "0" "c.4613G>C" "r.(?)" "p.(Ser1538Thr)" "" "0001006626" "00026036" "30" "4676" "0" "4676" "0" "c.4676G>C" "r.(?)" "p.(Ser1559Thr)" "" "0001044235" "00000295" "50" "1371" "0" "1371" "0" "c.1371T>A" "r.(?)" "p.(His457Gln)" "" "0001044235" "00026036" "50" "1434" "0" "1434" "0" "c.1434T>A" "r.(?)" "p.(His478Gln)" "" "0001044236" "00000295" "30" "3482" "0" "3482" "0" "c.3482C>T" "r.(?)" "p.(Pro1161Leu)" "" "0001044236" "00026036" "30" "3545" "0" "3545" "0" "c.3545C>T" "r.(?)" "p.(Pro1182Leu)" "" "0001044237" "00000295" "50" "4466" "0" "4466" "0" "c.4466C>A" "r.(?)" "p.(Ser1489Tyr)" "" "0001044237" "00026036" "50" "4529" "0" "4529" "0" "c.4529C>A" "r.(?)" "p.(Ser1510Tyr)" "" "0001058079" "00000295" "90" "347" "0" "347" "0" "c.347del" "r.(?)" "p.(Ala116GlyfsTer80)" "" "0001058080" "00000295" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Ter)" "" "0001058081" "00000295" "90" "2295" "0" "2295" "0" "c.2295del" "r.(?)" "p.(Ser766ProfsTer29)" "" "0001058082" "00000295" "90" "3065" "0" "3065" "0" "c.3065del" "r.(?)" "p.(Gly1022ValfsTer26)" "" "0001058083" "00000295" "90" "375" "0" "375" "0" "c.375C>A" "r.(?)" "p.(Cys125Ter)" "" "0001058084" "00000295" "90" "556" "0" "556" "0" "c.556G>T" "r.(?)" "p.(Glu186Ter)" "" "0001058085" "00000295" "90" "604" "0" "604" "0" "c.604del" "r.(?)" "p.(Tyr202ThrfsTer82)" "" "0001058086" "00000295" "90" "604" "0" "604" "0" "c.604del" "r.(?)" "p.(Tyr202ThrfsTer82)" "" "0001058087" "00000295" "90" "853" "-1" "853" "-1" "c.853-1G>A" "r.spl" "p.?" "" "0001058088" "00000295" "90" "853" "-1" "853" "-1" "c.853-1G>A" "r.spl" "p.?" "" "0001058089" "00000295" "90" "1117" "0" "1117" "0" "c.1117C>T" "r.(?)" "p.(Arg373Ter)" "" "0001058090" "00000295" "90" "3861" "0" "3861" "0" "c.3861del" "r.(?)" "p.(Ala1288GlnfsTer14)" "" "0001058091" "00000295" "90" "985" "0" "985" "0" "c.985G>T" "r.(?)" "p.(Glu329Ter)" "" "0001058092" "00000295" "90" "985" "0" "985" "0" "c.985G>T" "r.(?)" "p.(Glu329Ter)" "" "0001058115" "00000295" "90" "2716" "0" "2719" "0" "c.2716_2719del" "r.(?)" "p.(Leu906MetfsTer24)" "" "0001058116" "00000295" "90" "2716" "0" "2719" "0" "c.2716_2719del" "r.(?)" "p.(Leu906MetfsTer24)" "" "0001058121" "00000295" "90" "556" "0" "556" "0" "c.556G>T" "r.(?)" "p.(Glu186Ter)" "" "0001058143" "00000295" "90" "556" "0" "556" "0" "c.556G>T" "r.(?)" "p.(Glu186Ter)" "" "0001058144" "00000295" "90" "556" "0" "556" "0" "c.556G>T" "r.(?)" "p.(Glu186Ter)" "" "0001058255" "00000295" "70" "2448" "0" "2448" "0" "c.2448del" "r.(?)" "p.(Arg816SerfsTer22)" "" "0001058256" "00000295" "70" "3322" "0" "3322" "0" "c.3322C>G" "r.(?)" "p.(Pro1108Ala)" "" "0001058947" "00000295" "70" "613" "0" "613" "0" "c.613G>A" "r.(?)" "p.(Ala205Thr)" "" "0001059904" "00026036" "90" "3801" "0" "3802" "0" "c.3801_3802del" "r.(?)" "p.(Ala1268PhefsTer16)" "" "0001059905" "00026036" "90" "3801" "0" "3802" "0" "c.3801_3802del" "r.(?)" "p.(Ala1268PhefsTer16)" "" "0001059912" "00026036" "90" "853" "-2" "853" "-2" "c.853-2A>C" "r.spl" "p.?" "" "0001062672" "00026036" "50" "1333" "0" "1333" "0" "c.1333A>G" "r.(?)" "p.(Arg445Gly)" "" "0001067595" "00000295" "50" "457" "0" "457" "0" "c.457C>T" "r.(?)" "p.(Leu153Phe)" "" "0001067595" "00026036" "50" "457" "0" "457" "0" "c.457C>T" "r.(?)" "p.(Leu153Phe)" "" "0001067596" "00000295" "30" "719" "-187" "719" "-187" "c.719-187A>T" "r.(=)" "p.(=)" "" "0001067596" "00026036" "30" "719" "-187" "719" "-187" "c.719-187A>T" "r.(=)" "p.(=)" "" "0001067597" "00000295" "50" "2129" "0" "2131" "0" "c.2129_2131del" "r.(?)" "p.(Asp710del)" "" "0001067597" "00026036" "50" "2192" "0" "2194" "0" "c.2192_2194del" "r.(?)" "p.(Asp731del)" "" "0001067598" "00000295" "50" "4385" "0" "4385" "0" "c.4385C>G" "r.(?)" "p.(Ser1462Cys)" "" "0001067598" "00026036" "50" "4448" "0" "4448" "0" "c.4448C>G" "r.(?)" "p.(Ser1483Cys)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 89 "{{screeningid}}" "{{variantid}}" "0000000209" "0000001813" "0000000209" "0000002819" "0000000209" "0000002820" "0000000209" "0000006439" "0000000209" "0000006440" "0000000210" "0000008493" "0000000210" "0000008494" "0000000210" "0000008495" "0000000210" "0000010824" "0000065197" "0000096853" "0000106606" "0000172293" "0000173999" "0000394316" "0000174000" "0000394317" "0000174001" "0000394318" "0000174002" "0000394319" "0000174003" "0000394320" "0000174004" "0000394321" "0000174005" "0000394322" "0000174006" "0000394323" "0000174007" "0000394324" "0000184125" "0000408094" "0000296167" "0000652856" "0000304074" "0000667472" "0000306416" "0000670104" "0000325684" "0000708820" "0000337238" "0000736868" "0000375982" "0000787333" "0000385533" "0000812611" "0000386694" "0000814374" "0000393516" "0000824278" "0000393519" "0000824281" "0000413470" "0000870967" "0000415699" "0000873560" "0000435543" "0000921543" "0000435550" "0000921550" "0000435596" "0000921641" "0000435597" "0000921671" "0000435719" "0000921892" "0000441953" "0000939895" "0000445867" "0000954052" "0000445910" "0000954107" "0000445911" "0000954108" "0000446449" "0000954792" "0000446450" "0000954793" "0000446459" "0000954804" "0000446492" "0000954832" "0000446517" "0000954861" "0000446618" "0000954971" "0000446619" "0000954972" "0000446671" "0000955030" "0000446672" "0000955031" "0000446673" "0000955032" "0000446674" "0000955033" "0000446675" "0000955034" "0000448002" "0000957382" "0000448020" "0000957400" "0000448053" "0000957433" "0000448103" "0000957483" "0000448104" "0000957484" "0000448116" "0000957520" "0000448117" "0000957497" "0000448118" "0000957498" "0000452079" "0000986031" "0000469998" "0001058079" "0000469999" "0001058080" "0000470000" "0001058081" "0000470001" "0001058082" "0000470002" "0001058083" "0000470003" "0001058084" "0000470004" "0001058085" "0000470005" "0001058086" "0000470006" "0001058087" "0000470007" "0001058088" "0000470008" "0001058089" "0000470009" "0001058090" "0000470010" "0001058091" "0000470011" "0001058092" "0000470034" "0001058115" "0000470035" "0001058116" "0000470040" "0001058121" "0000470062" "0001058143" "0000470063" "0001058144" "0000470168" "0001058255" "0000470169" "0001058256" "0000470825" "0001058947" "0000471680" "0001059904" "0000471681" "0001059905" "0000471688" "0001059912" "0000473788" "0001062672"