### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = NIPA1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "NIPA1" "non imprinted in Prader-Willi/Angelman syndrome 1" "15" "q11.2" "unknown" "NG_009056.1" "UD_132084532001" "" "https://www.LOVD.nl/NIPA1" "" "1" "17043" "123606" "608145" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/NIPA1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-03-02 21:25:34" "00000" "2025-02-07 18:57:27" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00014566" "NIPA1" "transcript variant 1" "002" "NM_144599.4" "" "NP_653200.2" "" "" "" "-25" "6540" "990" "23086436" "23043279" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "02300" "SPG6" "paraplegia, spastic, type 6 (SPG-6)" "AD" "600363" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "NIPA1" "02300" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00183455" "" "" "" "1" "" "02947" "{PMID:Giugliano 2018:30373198}" "" "M" "" "Italy" "" "0" "" "" "" "Patient XVII" "00210191" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00291161" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00300198" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00304458" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{individualid}}" "{{diseaseid}}" "00183455" "00244" "00291161" "00198" "00300198" "00198" "00304458" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00244, 02300 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000158758" "00198" "00210191" "01164" "Unknown" "" "HP:0002493 (Upper motor neuron dysfunction); HP:0001258 (Spastic paraplegia)" "" "" "" "" "" "" "" "" "" "" "" "0000171335" "00244" "00183455" "00006" "Unknown" "" "onset congenital, congenital arthrogryposis, no muscle weakness, normal elevated CPK (1x), biopsy fiber type dystroportion" "00y00m01d" "" "congenital arthrogryposis" "" "" "" "" "" "" "myopathy" "" "0000227527" "00198" "00300198" "01164" "Unknown" "" "Abnormality of the nervous system (HP:0000707)" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000184423" "00183455" "1" "02947" "02947" "2018-10-25 15:31:17" "" "" "arrayCGH" "DNA" "" "" "0000211267" "00210191" "1" "01164" "01164" "2018-12-27 15:49:43" "" "" "SEQ-NG" "DNA" "" "" "0000292329" "00291161" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000301313" "00300198" "1" "01164" "01164" "2020-04-23 14:22:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000305587" "00304458" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 42 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000293102" "0" "30" "15" "23060820" "23060820" "subst" "0.000637916" "02330" "NIPA1_000006" "g.23060820C>T" "" "" "" "NIPA1(NM_144599.4):c.312G>A (p.P104=), NIPA1(NM_144599.5):c.312G>A (p.P104=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22812248G>A" "" "likely benign" "" "0000293104" "0" "10" "15" "23052632" "23052632" "subst" "0.744867" "02330" "NIPA1_000004" "g.23052632T>C" "" "" "" "NIPA1(NM_144599.5):c.441A>G (p.T147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22820436A>G" "" "benign" "" "0000293105" "0" "10" "15" "23086388" "23086390" "del" "0" "02330" "NIPA1_000012" "g.23086388_23086390del" "" "" "" "NIPA1(NM_001142275.1):c.-48+453_-48+455del (p.(=)), NIPA1(NM_144599.5):c.45_47delGGC (p.A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786680del" "" "benign" "" "0000293106" "0" "50" "15" "23049335" "23049335" "subst" "0" "02330" "NIPA1_000003" "g.23049335C>T" "" "" "" "NIPA1(NM_144599.5):c.484G>A (p.V162M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22823733G>A" "" "VUS" "" "0000296482" "0" "30" "15" "23060841" "23060841" "subst" "0.000243758" "02325" "NIPA1_000007" "g.23060841G>C" "" "" "" "NIPA1(NM_144599.5):c.291C>G (p.P97=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22812227C>G" "" "likely benign" "" "0000296483" "0" "10" "15" "23059394" "23059394" "subst" "0" "02325" "NIPA1_000005" "g.23059394C>T" "" "" "" "NIPA1(NM_144599.5):c.317+1421G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22813674G>A" "" "benign" "" "0000296484" "0" "10" "15" "23052632" "23052632" "subst" "0.744867" "02325" "NIPA1_000004" "g.23052632T>C" "" "" "" "NIPA1(NM_144599.5):c.441A>G (p.T147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22820436A>G" "" "benign" "" "0000296485" "0" "10" "15" "23086388" "23086390" "del" "0" "02325" "NIPA1_000017" "g.23086388_23086390del" "" "" "" "NIPA1(NM_001142275.1):c.-48+453_-48+455del (p.(=)), NIPA1(NM_144599.5):c.45_47delGGC (p.A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786680del" "" "benign" "" "0000304168" "0" "30" "15" "23049066" "23049066" "subst" "4.06329E-6" "01943" "NIPA1_000002" "g.23049066C>G" "" "" "" "NIPA1(NM_144599.4):c.753G>C (p.A251=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22824002G>C" "" "likely benign" "" "0000304169" "0" "30" "15" "23049018" "23049018" "subst" "2.03151E-5" "01943" "NIPA1_000001" "g.23049018C>T" "" "" "" "NIPA1(NM_144599.4):c.801G>A (p.V267=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22824050G>A" "" "likely benign" "" "0000323891" "0" "50" "15" "23086385" "23086390" "dup" "0" "01804" "NIPA1_000011" "g.23086385_23086390dup" "" "" "" "NIPA1(NM_001142275.1):c.-48+455_-48+456insGGCGGC (p.(=)), NIPA1(NM_144599.4):c.36_41dupGGCGGC (p.A15_A16dup), NIPA1(NM_144599.5):c.36_41dupGGCGGC ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786683dup" "" "VUS" "" "0000323892" "0" "30" "15" "23086388" "23086390" "del" "0" "01804" "NIPA1_000012" "g.23086388_23086390del" "" "" "" "NIPA1(NM_001142275.1):c.-48+453_-48+455del (p.(=)), NIPA1(NM_144599.5):c.45_47delGGC (p.A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786680del" "" "likely benign" "" "0000323893" "0" "50" "15" "23086388" "23086390" "dup" "0" "01804" "NIPA1_000013" "g.23086388_23086390dup" "" "" "" "NIPA1(NM_144599.4):c.45_47dup (p.(Ala16dup)), NIPA1(NM_144599.4):c.45_47dupGGC (p.A16dup), NIPA1(NM_144599.5):c.45_47dupGGC (p.A16dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786680dup" "" "VUS" "" "0000323895" "0" "50" "15" "23086382" "23086390" "del" "0" "01804" "NIPA1_000014" "g.23086382_23086390del" "" "" "" "NIPA1(NM_144599.4):c.39_47del (p.(Ala14_Ala16del)), NIPA1(NM_144599.5):c.39_47delGGCGGCGGC (p.A14_A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22786678_22786686del" "" "VUS" "" "0000339702" "0" "10" "15" "23052632" "23052632" "subst" "0.744867" "02327" "NIPA1_000004" "g.23052632T>C" "" "" "" "NIPA1(NM_144599.5):c.441A>G (p.T147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22820436A>G" "" "benign" "" "0000344695" "0" "90" "15" "23049088" "23049088" "subst" "0" "02327" "NIPA1_000020" "g.23049088T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22823980A>G" "" "pathogenic" "" "0000346808" "0" "30" "15" "23060890" "23060890" "subst" "1.22984E-5" "02327" "NIPA1_000018" "g.23060890A>G" "" "" "" "NIPA1(NM_144599.4):c.242T>C (p.(Ile81Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22812178T>C" "" "likely benign" "" "0000408468" "0" "50" "15" "22756504" "23088787" "dup" "0" "02947" "CYFIP1_000005" "g.(22500000_22756504)_(23088787_23100000)dup" "" "{PMID:Giugliano 2018:30373198}" "" "g.22756504_23088787dup" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000442737" "0" "90" "15" "23060816" "23060816" "subst" "0" "01164" "NIPA1_000021" "g.23060816C>T" "" "" "" "" "ACMG grading: PP5,PS3,PS1,PM2,PP1,PP3; reported in Chen 2005. HumMutat 25: 135; Svenstrup 2011. EurJNeurol 18: 1197; Hedera 2013. JNeurolSci 335: 231 Martinez-Lage 2012. Acta Neuropathol 124: 285 Zhao 2008. JNeurosci 28: 13938" "Germline" "" "rs104894490" "0" "" "" "g.22812252G>A" "" "pathogenic" "ACMG" "0000553621" "0" "30" "15" "23049282" "23049282" "subst" "0.00128945" "01943" "NIPA1_000022" "g.23049282G>A" "" "" "" "NIPA1(NM_144599.4):c.537C>T (p.I179=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22823786C>T" "" "likely benign" "" "0000553623" "0" "50" "15" "23060875" "23060875" "subst" "0" "02327" "NIPA1_000023" "g.23060875G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22812193C>G" "" "VUS" "" "0000553624" "0" "50" "15" "23086305" "23086331" "dup" "0" "01943" "NIPA1_000024" "g.23086305_23086331dup" "" "" "" "NIPA1(NM_144599.4):c.88_114dupCTCGGCCTGGGCGTGGCCGTCGTGTCG (p.L30_S38dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786737_22786763dup" "" "VUS" "" "0000553625" "0" "30" "15" "23086337" "23086337" "subst" "0" "01943" "NIPA1_000025" "g.23086337G>A" "" "" "" "NIPA1(NM_144599.4):c.75C>T (p.P25=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786731C>T" "" "likely benign" "" "0000553628" "0" "30" "15" "23086385" "23086390" "dup" "0" "02330" "NIPA1_000011" "g.23086385_23086390dup" "" "" "" "NIPA1(NM_001142275.1):c.-48+455_-48+456insGGCGGC (p.(=)), NIPA1(NM_144599.4):c.36_41dupGGCGGC (p.A15_A16dup), NIPA1(NM_144599.5):c.36_41dupGGCGGC ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786683dup" "" "likely benign" "" "0000553629" "0" "30" "15" "23086385" "23086390" "dup" "0" "01943" "NIPA1_000011" "g.23086385_23086390dup" "" "" "" "NIPA1(NM_001142275.1):c.-48+455_-48+456insGGCGGC (p.(=)), NIPA1(NM_144599.4):c.36_41dupGGCGGC (p.A15_A16dup), NIPA1(NM_144599.5):c.36_41dupGGCGGC ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786683dup" "" "likely benign" "" "0000553630" "0" "30" "15" "23086385" "23086390" "dup" "0" "02325" "NIPA1_000011" "g.23086385_23086390dup" "" "" "" "NIPA1(NM_001142275.1):c.-48+455_-48+456insGGCGGC (p.(=)), NIPA1(NM_144599.4):c.36_41dupGGCGGC (p.A15_A16dup), NIPA1(NM_144599.5):c.36_41dupGGCGGC ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786683dup" "" "likely benign" "" "0000553631" "0" "50" "15" "23086388" "23086390" "dup" "0" "01943" "NIPA1_000013" "g.23086388_23086390dup" "" "" "" "NIPA1(NM_144599.4):c.45_47dup (p.(Ala16dup)), NIPA1(NM_144599.4):c.45_47dupGGC (p.A16dup), NIPA1(NM_144599.5):c.45_47dupGGC (p.A16dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786680dup" "" "VUS" "" "0000553632" "0" "30" "15" "23086388" "23086390" "dup" "0" "02326" "NIPA1_000013" "g.23086388_23086390dup" "" "" "" "NIPA1(NM_144599.4):c.45_47dup (p.(Ala16dup)), NIPA1(NM_144599.4):c.45_47dupGGC (p.A16dup), NIPA1(NM_144599.5):c.45_47dupGGC (p.A16dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786680dup" "" "likely benign" "" "0000615167" "0" "30" "15" "23086388" "23086390" "dup" "0" "02325" "NIPA1_000013" "g.23086388_23086390dup" "" "" "" "NIPA1(NM_144599.4):c.45_47dup (p.(Ala16dup)), NIPA1(NM_144599.4):c.45_47dupGGC (p.A16dup), NIPA1(NM_144599.5):c.45_47dupGGC (p.A16dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22786678_22786680dup" "" "likely benign" "" "0000649018" "1" "30" "15" "23043498" "23043498" "subst" "0" "03575" "NIPA1_000028" "g.23043498A>C" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous; {DB:CLININrs73412681}" "Germline" "" "rs73412681" "0" "" "" "g.22829570T>G" "" "likely benign" "" "0000657528" "0" "30" "15" "23060820" "23060820" "subst" "0.000637916" "01943" "NIPA1_000006" "g.23060820C>T" "" "" "" "NIPA1(NM_144599.4):c.312G>A (p.P104=), NIPA1(NM_144599.5):c.312G>A (p.P104=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22812248G>A" "" "likely benign" "" "0000664232" "0" "90" "15" "23086278" "23086278" "subst" "0" "01164" "NIPA1_000029" "g.23086278G>C" "" "" "" "" "ACMG grading: PS3,PS4,PM2,PP1,PP3; Zhao et al. 2008. J neuroscience 51: 13938; Botzolakis et al. 2011. Mol Cell Neurosci. 1: 122; Dz et al. 2011. Clin Neurol Neurosurg 6: 480; Rainier et al. 2003. Am J Hum Genet. 3: 967" "Germline" "" "rs104894496" "0" "" "" "g.22786790C>G" "" "pathogenic" "ACMG" "0000669275" "3" "30" "15" "23043498" "23043498" "subst" "0" "03575" "NIPA1_000028" "g.23043498A>C" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs73412681}" "Germline" "" "rs73412681" "0" "" "" "g.22829570T>G" "" "likely benign" "" "0000806570" "0" "50" "15" "23086273" "23086273" "subst" "0" "02327" "NIPA1_000030" "g.23086273C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806571" "0" "30" "15" "23086385" "23086390" "dup" "0" "02326" "NIPA1_000011" "g.23086385_23086390dup" "" "" "" "NIPA1(NM_001142275.1):c.-48+455_-48+456insGGCGGC (p.(=)), NIPA1(NM_144599.4):c.36_41dupGGCGGC (p.A15_A16dup), NIPA1(NM_144599.5):c.36_41dupGGCGGC ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891966" "0" "30" "15" "23086382" "23086390" "del" "0" "02326" "NIPA1_000014" "g.23086382_23086390del" "" "" "" "NIPA1(NM_144599.4):c.39_47del (p.(Ala14_Ala16del)), NIPA1(NM_144599.5):c.39_47delGGCGGCGGC (p.A14_A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891967" "0" "10" "15" "23086388" "23086390" "del" "0" "02326" "NIPA1_000012" "g.23086388_23086390del" "" "" "" "NIPA1(NM_001142275.1):c.-48+453_-48+455del (p.(=)), NIPA1(NM_144599.5):c.45_47delGGC (p.A16del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914264" "0" "50" "15" "23049212" "23049212" "subst" "0" "02327" "NIPA1_000031" "g.23049212C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925933" "0" "30" "15" "23060841" "23060841" "subst" "0.000243758" "02326" "NIPA1_000007" "g.23060841G>C" "" "" "" "NIPA1(NM_144599.5):c.291C>G (p.P97=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950312" "0" "30" "15" "23060820" "23060820" "subst" "0.000637916" "02326" "NIPA1_000006" "g.23060820C>T" "" "" "" "NIPA1(NM_144599.4):c.312G>A (p.P104=), NIPA1(NM_144599.5):c.312G>A (p.P104=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001247" "0" "50" "15" "23060890" "23060890" "subst" "1.22984E-5" "01804" "NIPA1_000018" "g.23060890A>G" "" "" "" "NIPA1(NM_144599.4):c.242T>C (p.(Ile81Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001248" "0" "30" "15" "23086303" "23086303" "subst" "0" "01804" "NIPA1_000032" "g.23086303C>T" "" "" "" "NIPA1(NM_144599.4):c.109G>A (p.(Val37Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes NIPA1 ## Count = 42 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000293102" "00014566" "30" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Pro104=)" "" "0000293104" "00014566" "10" "441" "0" "441" "0" "c.441A>G" "r.(?)" "p.(Thr147=)" "" "0000293105" "00014566" "10" "45" "0" "47" "0" "c.45_47del" "r.(?)" "p.(Ala16del)" "" "0000293106" "00014566" "50" "484" "0" "484" "0" "c.484G>A" "r.(?)" "p.(Val162Met)" "" "0000296482" "00014566" "30" "291" "0" "291" "0" "c.291C>G" "r.(?)" "p.(Pro97=)" "" "0000296483" "00014566" "10" "317" "1421" "317" "1421" "c.317+1421G>A" "r.(=)" "p.(=)" "" "0000296484" "00014566" "10" "441" "0" "441" "0" "c.441A>G" "r.(?)" "p.(Thr147=)" "" "0000296485" "00014566" "10" "45" "0" "47" "0" "c.45_47del" "r.(?)" "p.(Ala16del)" "" "0000304168" "00014566" "30" "753" "0" "753" "0" "c.753G>C" "r.(?)" "p.(Ala251=)" "" "0000304169" "00014566" "30" "801" "0" "801" "0" "c.801G>A" "r.(?)" "p.(Val267=)" "" "0000323891" "00014566" "50" "42" "0" "47" "0" "c.42_47dup" "r.(?)" "p.(Ala15_Ala16dup)" "" "0000323892" "00014566" "30" "45" "0" "47" "0" "c.45_47del" "r.(?)" "p.(Ala16del)" "" "0000323893" "00014566" "50" "45" "0" "47" "0" "c.45_47dup" "r.(?)" "p.(Ala16dup)" "" "0000323895" "00014566" "50" "39" "0" "47" "0" "c.39_47del" "r.(?)" "p.(Ala14_Ala16del)" "" "0000339702" "00014566" "10" "441" "0" "441" "0" "c.441A>G" "r.(?)" "p.(Thr147=)" "" "0000344695" "00014566" "90" "731" "0" "731" "0" "c.731A>G" "r.(?)" "p.(Gln244Arg)" "" "0000346808" "00014566" "30" "242" "0" "242" "0" "c.242T>C" "r.(?)" "p.(Ile81Thr)" "" "0000408468" "00014566" "50" "0" "0" "0" "0" "c.-25_*5550[2]" "r.=" "p.=" "" "0000442737" "00014566" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.Gly106Arg" "" "0000553621" "00014566" "30" "537" "0" "537" "0" "c.537C>T" "r.(?)" "p.(Ile179=)" "" "0000553623" "00014566" "50" "257" "0" "257" "0" "c.257C>G" "r.(?)" "p.(Ala86Gly)" "" "0000553624" "00014566" "50" "88" "0" "114" "0" "c.88_114dup" "r.(?)" "p.(Leu30_Ser38dup)" "" "0000553625" "00014566" "30" "75" "0" "75" "0" "c.75C>T" "r.(?)" "p.(Pro25=)" "" "0000553628" "00014566" "30" "42" "0" "47" "0" "c.42_47dup" "r.(?)" "p.(Ala15_Ala16dup)" "" "0000553629" "00014566" "30" "42" "0" "47" "0" "c.42_47dup" "r.(?)" "p.(Ala15_Ala16dup)" "" "0000553630" "00014566" "30" "42" "0" "47" "0" "c.42_47dup" "r.(?)" "p.(Ala15_Ala16dup)" "" "0000553631" "00014566" "50" "45" "0" "47" "0" "c.45_47dup" "r.(?)" "p.(Ala16dup)" "" "0000553632" "00014566" "30" "45" "0" "47" "0" "c.45_47dup" "r.(?)" "p.(Ala16dup)" "" "0000615167" "00014566" "30" "45" "0" "47" "0" "c.45_47dup" "r.(?)" "p.(Ala16dup)" "" "0000649018" "00014566" "30" "6321" "0" "6321" "0" "c.*5331T>G" "r.(=)" "p.(=)" "" "0000657528" "00014566" "30" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Pro104=)" "" "0000664232" "00014566" "90" "134" "0" "134" "0" "c.134C>G" "r.(?)" "p.(Thr45Arg)" "" "0000669275" "00014566" "30" "6321" "0" "6321" "0" "c.*5331T>G" "r.(=)" "p.(=)" "" "0000806570" "00014566" "50" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Val47Met)" "" "0000806571" "00014566" "30" "42" "0" "47" "0" "c.42_47dup" "r.(?)" "p.(Ala15_Ala16dup)" "" "0000891966" "00014566" "30" "39" "0" "47" "0" "c.39_47del" "r.(?)" "p.(Ala14_Ala16del)" "" "0000891967" "00014566" "10" "45" "0" "47" "0" "c.45_47del" "r.(?)" "p.(Ala16del)" "" "0000914264" "00014566" "50" "607" "0" "607" "0" "c.607G>A" "r.(?)" "p.(Val203Met)" "" "0000925933" "00014566" "30" "291" "0" "291" "0" "c.291C>G" "r.(?)" "p.(Pro97=)" "" "0000950312" "00014566" "30" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Pro104=)" "" "0001001247" "00014566" "50" "242" "0" "242" "0" "c.242T>C" "r.(?)" "p.(Ile81Thr)" "" "0001001248" "00014566" "30" "109" "0" "109" "0" "c.109G>A" "r.(?)" "p.(Val37Met)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{variantid}}" "0000184423" "0000408468" "0000211267" "0000442737" "0000292329" "0000649018" "0000301313" "0000664232" "0000305587" "0000669275"