### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = NRL)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"NRL"	"neural retina leucine zipper"	"14"	"q11.1-q11.2"	"unknown"	"NG_011697.1"	"UD_132118491372"	""	"https://www.LOVD.nl/NRL"	"Mutations of the Neuroretina-linked Leucine Zipper Gene <http://www.retina-international.org/files/sci-news/nrlmut.htm>"	"1"	"8002"	"4901"	"162080"	"1"	"1"	"1"	"1"	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font><br>Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project."	""	"g"	"https://databases.lovd.nl/shared/refseq/NRL_codingDNA.html"	"1"	""	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>"	"-1"	""	"-1"	"00001"	"2010-04-29 00:00:00"	"00006"	"2017-06-16 15:11:29"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00014819"	"NRL"	"neural retina leucine zipper"	"001"	"NM_006177.3"	""	"NP_006168.1"	""	""	""	"-131"	"1843"	"714"	"24553832"	"24549316"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 6
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00112"	"RP"	"retinitis pigmentosa (RP)"	""	"268000"	""	""	""	"00001"	"2013-02-21 17:12:36"	"00006"	"2021-01-18 09:53:26"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00387"	"ESCS"	"S-cone syndrome, enhanced (ESCS, Goldmann-Favre syndrome)"	"AR"	"268100"	""	""	""	"00006"	"2014-05-28 08:42:36"	"00006"	"2021-12-10 21:51:32"
"01473"	"OPMD"	"dystrophy, muscular, oculopharyngeal (OPMD)"	"AD"	"164300"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"03415"	"RP27"	"retinitis pigmentosa, type 27 (RP27)"	"AD"	"613750"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}"	"{{diseaseid}}"
"NRL"	"03415"


## Individuals ## Do not remove or alter this header ##
## Count = 150
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00033161"	""	""	""	"1"	""	"00229"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00105017"	""	""	""	"1"	""	"01244"	"{PMID:de Castro-Miró 2016:28005958}"	""	"M"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"69ORG1"
"00155514"	""	""	""	"2"	""	"01243"	"Sharon, submitted"	""	"F"	"yes"	"Israel"	""	"0"	""	""	"Jewish-Oriental"	""
"00155515"	""	""	""	"1"	""	"01243"	"Sharon, submitted"	""	"F"	"no"	"Israel"	""	"0"	""	""	"Jewish-Oriental"	""
"00233238"	""	""	""	"1"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00233239"	""	""	""	"1"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00233240"	""	""	""	"1"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00233241"	""	""	""	"1"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00233242"	""	""	""	"6"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00233775"	""	""	""	"1"	""	"02591"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	"analysis 1204  retinitis pigmentosa cases"	""	""	"Japan"	""	"0"	""	""	""	""
"00291016"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00308525"	""	""	""	"3"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"3 patients with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00309258"	""	""	""	"1"	""	"00004"	"{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}"	"family"	""	""	"Israel"	""	"0"	""	""	"Iraq;Jewish"	"MOL1109"
"00309259"	""	""	""	"3"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"3 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309260"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00319836"	""	""	""	"2"	""	"00008"	"{PMID:Milla 2002:12221539}"	""	""	""	"Spain"	""	"0"	""	""	""	""
"00325419"	""	""	""	"1"	""	"00006"	"{PMID:Zenteno 2020:31736247}"	"family"	""	""	"Mexico"	""	"0"	""	""	""	"1031"
"00326682"	""	""	""	"1"	""	"00008"	"{PMID:Ziviello 2005:15994872}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00326686"	""	""	""	"1"	""	"00008"	"{PMID:Ziviello 2005:15994872}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00328492"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"15004850"
"00332286"	""	""	""	"1"	""	"00000"	"{PMID:Porto 2017:29186038}"	"proband"	""	""	"Brazil"	""	"0"	""	""	""	"Fam31PatFBP_169"
"00335130"	""	""	""	"1"	""	"00000"	"{PMID:Haer-Wigman 2017:28224992}"	"patient"	""	"yes"	"Netherlands"	""	"0"	""	""	""	"1893"
"00335644"	""	""	""	"1"	""	"00008"	"{PMID:Sullivan 2006:16799052}"	"2 families"	""	""	"United States"	""	"0"	""	""	""	""
"00335645"	""	""	""	"1"	""	"00008"	"{PMID:Sullivan 2006:16799052}"	"1 family"	""	""	"United States"	""	"0"	""	""	""	""
"00335981"	""	""	""	"1"	""	"00000"	"{PMID:Sergouniotis 2016:27628848}"	"analysis 486 cases"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00358730"	""	""	""	"1"	""	"00000"	"{PMID:Carrigan 2016:27624628}"	""	""	""	"Ireland"	""	"0"	""	""	""	""
"00358731"	""	""	""	"1"	""	"00000"	"{PMID:Carrigan 2016:27624628}"	""	""	""	"Ireland"	""	"0"	""	""	""	""
"00359139"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"13010253"
"00373875"	""	""	""	"1"	""	"00000"	"{PMID:Consugar 2015:25412400}"	""	""	""	"United States"	""	"0"	""	""	""	"OGI-019-047"
"00375300"	""	""	""	"1"	""	"00000"	"{PMID:Oishi 2014:25324289}"	"family"	""	""	"Japan"	""	"0"	""	""	""	"K2291"
"00376823"	""	""	""	"1"	""	"00000"	"{PMID:Daiger 2014:24664689}"	""	""	""	"United States"	""	"0"	""	""	""	"UTAD198"
"00377208"	""	""	""	"3"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"M"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"303"
"00377209"	""	""	"00377208"	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"father"	"M"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"304"
"00377210"	""	""	"00377208"	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"paternal grandmother"	"F"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"825"
"00377268"	""	""	""	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"F"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"406"
"00377389"	""	""	""	"1"	""	"00000"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Spain"	""	"0"	""	""	""	"?"
"00377390"	""	""	""	"1"	""	"00000"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Spain"	""	"0"	""	""	""	"?"
"00377391"	""	""	""	"1"	""	"00000"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Spain"	""	"0"	""	""	""	"?"
"00379385"	""	""	""	"1"	""	"00000"	"{PMID:Collin-2011:21217109}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	""
"00383450"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00383451"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"F"	""	""	""	"0"	""	""	""	""
"00384636"	""	""	""	"1"	""	"00000"	"{PMID:Ehrenberg 2019:31814694}"	""	"?"	"no"	"Israel"	""	"0"	""	""	""	"Family 14 patient 1"
"00384637"	""	""	""	"1"	""	"00000"	"{PMID:Ehrenberg 2019:31814694}"	""	"?"	"no"	"Israel"	""	"0"	""	""	""	"Family 15 patient 1"
"00385040"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2020:31630094}"	""	"?"	"no"	"China"	""	"0"	""	""	""	"19653"
"00386979"	""	""	""	"1"	""	"00000"	"{PMID:Jauregui 2020:32098976}"	""	"M"	""	"(United States)"	""	"0"	""	""	"white"	"5"
"00389860"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 797, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1144"
"00389954"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 998, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1238"
"00390771"	""	""	""	"1"	""	"00000"	"{PMID:Booij-2011:20801516}"	""	""	""	""	""	"0"	""	""	""	""
"00391581"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	"?"	""	"New Zealand"	""	"0"	""	""	"Maori"	"80"
"00392636"	""	""	""	"1"	""	"00000"	"{PMID:Ma 2021:33691693}"	""	"?"	""	"Korea"	""	"0"	""	""	""	"117"
"00407357"	""	""	""	"1"	""	"00000"	"{PMID:Borràs 2013:23534816}"	""	""	""	"Spain"	""	"0"	""	""	"Spanish"	"RP-645"
"00407359"	""	""	""	"1"	""	"00000"	"{PMID:Borràs 2013:23534816}"	""	""	""	"Spain"	""	"0"	""	""	"Spanish"	"RP-65"
"00409947"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"F"	""	""	""	"0"	""	""	""	"famRP251pat_III:1"
"00409948"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"F"	""	""	""	"0"	""	""	""	"famRP251pat_III:3"
"00409949"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"F"	""	""	""	"0"	""	""	""	"famRP251pat_III:5"
"00409950"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"F"	""	""	""	"0"	""	""	""	"famRP251pat_III:6"
"00409951"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"M"	""	""	""	"0"	""	""	""	"famRP251pat_III:7"
"00409952"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"M"	""	""	""	"0"	""	""	""	"famRP251pat_III:9"
"00409953"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 1999:10192380}"	"Family RP251"	"M"	""	""	""	"0"	""	""	""	"famRP251pat_III:11"
"00409954"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 2000:11039579}"	"Family RP357"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"south-east England"	"famRP357pat_III:3"
"00409955"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 2000:11039579}"	"Family RP357"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"south-east England"	"famRP357pat_IV:4"
"00409956"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 2000:11039579}"	"Family RP57"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"south-east England"	"famRP57pat_IV:3"
"00409957"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 2000:11039579}"	"Family RP57"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"south-east England"	"famRP57pat_V:1"
"00409958"	""	""	""	"1"	""	"00000"	"{PMID:Bessant 2000:11039579}"	"Family RP3097"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"south-east England"	"famRP3097pat_II:4"
"00409959"	""	""	""	"1"	""	"00000"	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"F"	""	"Spain"	""	"0"	""	""	"10"	"fam1pat_III:2"
"00409960"	""	""	""	"1"	""	"00000"	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"M"	""	"Spain"	""	"0"	""	""	"10"	"fam1pat_III:3"
"00409961"	""	""	""	"1"	""	"00000"	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"F"	""	"Spain"	""	"0"	""	""	"11"	"fam1pat_IV:5"
"00409962"	""	""	""	"1"	""	"00000"	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"M"	""	"Spain"	""	"0"	""	""	"11"	"fam1pat_IV:7"
"00409963"	""	""	""	"1"	""	"00000"	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"M"	""	"Spain"	""	"0"	""	""	"0"	"fam2pat1"
"00409965"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient"	"F"	""	""	""	"0"	""	""	""	"fam5715(001-083)pat_II:2"
"00409966"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s daughter 1"	"F"	""	""	""	"0"	""	""	""	"fam5715(001-083)pat_III:2"
"00409967"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s daughter 2"	"F"	""	""	""	"0"	""	""	""	"fam5715(001-083)pat_III:3"
"00409968"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s paternal grandmother"	"F"	""	""	""	"0"	""	""	""	"famE481 (001-338)pat_I:2"
"00409969"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s father"	"M"	""	""	""	"0"	""	""	""	"famE481 (001-338)pat_II:2"
"00409970"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s paternal aunt"	"F"	""	""	""	"0"	""	""	""	"famE481 (001-338)pat_II:4"
"00409971"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient"	"M"	""	""	""	"0"	""	""	""	"famE481 (001-338)pat_III:1"
"00409972"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s brother"	"M"	""	""	""	"0"	""	""	""	"famE481 (001-338)pat_III:2"
"00409973"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s father"	"M"	""	""	""	"0"	""	""	""	"fam5763 (001-122)pat_I:1"
"00409974"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient"	"M"	""	""	""	"0"	""	""	""	"fam5763 (001-122)pat_II:3"
"00409975"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s mother"	"F"	""	""	""	"0"	""	""	""	"fam5677 (001-172)pat_I:2"
"00409976"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient"	"F"	""	""	""	"0"	""	""	""	"fam5677 (001-172)pat_II:2"
"00409977"	""	""	""	"1"	""	"00000"	"{PMID:DeAngelis 2002:11879142}"	"index patient\'s son"	"M"	""	""	""	"0"	""	""	""	"fam5677 (001-172)pat_III:2"
"00409981"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	"Family 1160"	"F"	""	""	""	"0"	""	""	""	"048-096"
"00409982"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	"Family 7080, proband"	"F"	""	""	""	"0"	""	""	""	"003-001"
"00409983"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	""	"?"	""	""	""	"0"	""	""	""	"078-059"
"00409984"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	""	"?"	""	""	""	"0"	""	""	""	"003-252"
"00409985"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	"Family J408"	"M"	""	""	""	"0"	""	""	""	"115-031"
"00409986"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	"Family 1508"	"F"	""	""	""	"0"	""	""	""	"048-019"
"00409987"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	""	"?"	""	""	""	"0"	""	""	""	"115-039"
"00409988"	""	""	""	"1"	""	"00000"	"{PMID:Nishiguchi 2004:12552256}"	"Family 7080, brother of 003-001"	"M"	""	""	""	"0"	""	""	""	"003-001"
"00409990"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409991"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409992"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409993"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409994"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409995"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409996"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409997"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409998"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00409999"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410000"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410001"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410002"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410003"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410004"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410005"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410006"	""	""	""	"1"	""	"00000"	"{PMID:Kanda 2007:17335001}"	"cell line (HEK) NRL protein investigation"	""	""	""	""	"0"	""	""	""	"?"
"00410009"	""	""	""	"1"	""	"00000"	"{PMID:Hernan 2011:21981118}"	""	""	""	"Spain"	""	"0"	""	""	""	"II.1"
"00410010"	""	""	""	"1"	""	"00000"	"{PMID:Hernan 2011:21981118}"	""	""	""	"Spain"	""	"0"	""	""	""	"II.2"
"00410011"	""	""	""	"1"	""	"00000"	"{PMID:Hernan 2011:21981118}"	""	""	""	"Spain"	""	"0"	""	""	""	"III.4"
"00410012"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"M"	""	"China"	""	"0"	""	""	""	"II:2"
"00410013"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"M"	""	"China"	""	"0"	""	""	""	"II:3"
"00410014"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"F"	""	"China"	""	"0"	""	""	""	"III:2"
"00410015"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"M"	""	"China"	""	"0"	""	""	""	"III:4"
"00410016"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"M"	""	"China"	""	"0"	""	""	""	"III:7"
"00410017"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"F"	""	"China"	""	"0"	""	""	""	"III:11"
"00410018"	""	""	""	"1"	""	"00000"	"{PMID:Gao 2016:27081294}"	""	"F"	""	"China"	""	"0"	""	""	""	"III:15"
"00410020"	""	""	""	"1"	""	"00000"	"{PMID:Qin 2017:28106895}"	""	"F"	""	"China"	""	"0"	""	""	""	"III:1"
"00410021"	""	""	""	"1"	""	"00000"	"{PMID:Qin 2017:28106895}"	""	"F"	""	"China"	""	"0"	""	""	""	"II:2"
"00410026"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) brother of 4 and 5"	"M"	"yes"	""	"56y"	"0"	""	""	""	"D3"
"00410027"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) sister of 5 and 3"	"F"	"yes"	""	"51y"	"0"	""	""	""	"D4"
"00410028"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) brother of 4 and 3"	"M"	"yes"	""	"50y"	"0"	""	""	""	"D5"
"00410029"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) father of 3, 4, 5"	"M"	"yes"	""	"72y"	"0"	""	""	""	"D1"
"00410030"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) mother  of 3, 4, 5"	"F"	"yes"	""	"89y"	"0"	""	""	""	"D2"
"00410031"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family D (BJ) son of 5"	"M"	""	""	""	"0"	""	""	""	"A2"
"00410032"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family A, mother of 2 and 3"	"F"	""	""	""	"0"	""	""	""	"A1"
"00410033"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family A, daughter1 of 1"	"F"	""	""	""	"0"	""	""	""	"A2"
"00410034"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family A, daughter2 of 1"	"F"	""	""	""	"0"	""	""	""	"A3"
"00410035"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family B"	"F"	""	""	""	"0"	""	""	""	"B"
"00410036"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family C"	"M"	""	""	""	"0"	""	""	""	"C"
"00410037"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family E"	"F"	""	""	""	"0"	""	""	""	"E"
"00410038"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family F"	"F"	""	""	""	"0"	""	""	""	"F"
"00410039"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family G"	"M"	""	""	""	"0"	""	""	""	"G"
"00410040"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family H"	"M"	""	""	""	"0"	""	""	""	"H"
"00410041"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family I"	"F"	""	""	""	"0"	""	""	""	"I"
"00410042"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family J"	"F"	""	""	""	"0"	""	""	""	"J"
"00410043"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family K"	"F"	""	""	""	"0"	""	""	""	"K"
"00410044"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family L"	"F"	""	""	""	"0"	""	""	""	"L"
"00410045"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family M"	"F"	""	""	""	"0"	""	""	""	"M"
"00410046"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family N"	"F"	""	""	""	"0"	""	""	""	"N"
"00410047"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family O"	"F"	""	""	""	"0"	""	""	""	"O"
"00410048"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family P"	"F"	""	""	""	"0"	""	""	""	"P"
"00410049"	""	""	""	"1"	""	"00000"	"{PMID:Braverman 2017:28590779}"	"family Q"	"F"	""	""	""	"0"	""	""	""	"Q"
"00410055"	""	""	""	"1"	""	"00000"	"{PMID:Littink 2018:29385733}"	""	"M"	""	""	""	"0"	""	""	""	""
"00410056"	""	""	""	"1"	""	"00000"	"{PMID:Littink 2018:29385733}"	""	"M"	""	""	""	"0"	""	""	""	""
"00410057"	""	""	""	"1"	""	"00000"	"{PMID:Littink 2018:29385733}"	""	"M"	""	""	""	"0"	""	""	""	""
"00429835"	""	""	""	"1"	""	"04436"	"{PMID:Panneman 2023:36819107}"	""	"F"	""	""	""	"0"	""	""	""	""
"00429912"	""	""	""	"1"	""	"04436"	"{PMID:Panneman 2023:36819107}"	""	"F"	""	""	""	"0"	""	""	""	""
"00430049"	""	""	""	"1"	""	"04436"	"{PMID:Panneman 2023:36819107}"	""	"F"	""	""	""	"0"	""	""	""	""
"00447608"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"SRP-1158"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 150
"{{individualid}}"	"{{diseaseid}}"
"00033161"	"04214"
"00105017"	"00387"
"00155514"	"04214"
"00155515"	"04214"
"00233238"	"04214"
"00233239"	"04214"
"00233240"	"04214"
"00233241"	"04214"
"00233242"	"04214"
"00233775"	"04214"
"00291016"	"00198"
"00308525"	"04214"
"00309258"	"04214"
"00309259"	"04214"
"00309260"	"04214"
"00319836"	"04214"
"00325419"	"04214"
"00326682"	"04214"
"00326686"	"04214"
"00328492"	"04214"
"00332286"	"04214"
"00335130"	"00198"
"00335644"	"04214"
"00335645"	"04214"
"00335981"	"04214"
"00358730"	"04214"
"00358731"	"04214"
"00359139"	"04214"
"00373875"	"04214"
"00375300"	"04214"
"00376823"	"04214"
"00377208"	"04214"
"00377209"	"04214"
"00377210"	"04214"
"00377268"	"04214"
"00377389"	"04214"
"00377390"	"04214"
"00377391"	"04214"
"00379385"	"04214"
"00383450"	"04214"
"00383451"	"04214"
"00384636"	"00198"
"00384637"	"00198"
"00385040"	"04214"
"00386979"	"04214"
"00389860"	"04214"
"00389954"	"04214"
"00390771"	"04214"
"00391581"	"04214"
"00392636"	"04214"
"00407357"	"04214"
"00407359"	"04214"
"00409947"	"04214"
"00409948"	"04214"
"00409949"	"04214"
"00409950"	"04214"
"00409951"	"04214"
"00409952"	"04214"
"00409953"	"04214"
"00409954"	"04214"
"00409955"	"04214"
"00409956"	"04214"
"00409957"	"04214"
"00409958"	"04214"
"00409959"	"04214"
"00409960"	"04214"
"00409961"	"04214"
"00409962"	"04214"
"00409963"	"04214"
"00409965"	"04214"
"00409966"	"04214"
"00409967"	"04214"
"00409968"	"04214"
"00409969"	"04214"
"00409970"	"04214"
"00409971"	"04214"
"00409972"	"04214"
"00409973"	"04214"
"00409974"	"04214"
"00409975"	"04214"
"00409976"	"04214"
"00409977"	"04214"
"00409981"	"04214"
"00409982"	"04214"
"00409983"	"04214"
"00409984"	"04214"
"00409985"	"04214"
"00409986"	"04214"
"00409987"	"04214"
"00409988"	"04214"
"00409990"	"04214"
"00409991"	"04214"
"00409992"	"04214"
"00409993"	"04214"
"00409994"	"04214"
"00409995"	"04214"
"00409996"	"04214"
"00409997"	"04214"
"00409998"	"04214"
"00409999"	"04214"
"00410000"	"04214"
"00410001"	"04214"
"00410002"	"04214"
"00410003"	"04214"
"00410004"	"04214"
"00410005"	"04214"
"00410006"	"04214"
"00410009"	"04214"
"00410010"	"04214"
"00410011"	"04214"
"00410012"	"04214"
"00410013"	"04214"
"00410014"	"04214"
"00410015"	"04214"
"00410016"	"04214"
"00410017"	"04214"
"00410018"	"04214"
"00410020"	"04214"
"00410021"	"04214"
"00410026"	"04214"
"00410027"	"04214"
"00410028"	"04214"
"00410029"	"01473"
"00410030"	"01473"
"00410031"	"01473"
"00410032"	"04214"
"00410033"	"01473"
"00410034"	"01473"
"00410035"	"04214"
"00410036"	"01473"
"00410037"	"01473"
"00410038"	"01473"
"00410039"	"01473"
"00410040"	"01473"
"00410041"	"01473"
"00410042"	"01473"
"00410043"	"01473"
"00410044"	"01473"
"00410045"	"01473"
"00410046"	"01473"
"00410047"	"01473"
"00410048"	"01473"
"00410049"	"01473"
"00410055"	"04214"
"00410056"	"04214"
"00410057"	"04214"
"00429835"	"04214"
"00429912"	"00112"
"00430049"	"00112"
"00447608"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00112, 00198, 00387, 01473, 03415, 04214
## Count = 143
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000026590"	"04214"	"00033161"	"00229"	"Unknown"	"1y"	"lumped pigmentary retinal degeneration, early onset; ferriprive anemia"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000082909"	"00387"	"00105017"	"01244"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000128014"	"04214"	"00155514"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000128015"	"04214"	"00155515"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000233953"	"04214"	"00308525"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000234578"	"04214"	"00309258"	"00004"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000234579"	"04214"	"00309259"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"ESCS"	""
"0000234580"	"04214"	"00309260"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000241940"	"04214"	"00319836"	"00008"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa (RPAD)"	""
"0000243906"	"04214"	"00325419"	"00006"	"Familial, autosomal dominant"	""	"retinitis pigmentosa"	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000245148"	"04214"	"00326682"	"00008"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"autosomal dominant retinitis pigmentosa (ADRP)"	""
"0000245152"	"04214"	"00326686"	"00008"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"autosomal dominant retinitis pigmentosa (ADRP)"	""
"0000246718"	"04214"	"00328492"	"00000"	"Familial, autosomal recessive"	"5y"	"retinal dystrophy (HP:0000556)"	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000250473"	"04214"	"00332286"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis, early-onset retinal dystrophy"	""
"0000252845"	"00198"	"00335130"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000253564"	"04214"	"00335644"	"00008"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"autosomal dominant retinitis pigmentosa (adRP)"	""
"0000253565"	"04214"	"00335645"	"00008"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"autosomal dominant retinitis pigmentosa (adRP)"	""
"0000253896"	"04214"	"00335981"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000253945"	"04214"	"00358730"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis, atypical"	""
"0000253946"	"04214"	"00358731"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis, atypical"	""
"0000254436"	"04214"	"00359139"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa or rod-cone dystrophy"	""
"0000269084"	"04214"	"00373875"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"chorioretinal dystrophy"	""
"0000270514"	"04214"	"00375300"	"00000"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000272033"	"04214"	"00376823"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000272366"	"04214"	"00377208"	"00000"	"Familial, autosomal dominant"	"10y"	"see paper"	"5y"	"8y"	""	""	""	""	""	""	"retinitis pigmentosa, type 27 (RP27)"	"retinal disease"	""
"0000272367"	"04214"	"00377209"	"00000"	"Familial, autosomal dominant"	""	"see paper"	""	""	""	""	""	""	""	""	"retinitis pigmentosa, type 27 (RP27)"	"retinal disease"	""
"0000272368"	"04214"	"00377210"	"00000"	"Familial, autosomal dominant"	""	"see paper"	""	""	""	""	""	""	""	""	"retinitis pigmentosa, type 27 (RP27)"	"retinal disease"	""
"0000272426"	"04214"	"00377268"	"00000"	"Familial, autosomal dominant"	"47y"	"see paper"	"19y"	"27y"	""	""	""	""	""	""	""	"retinal disease"	""
"0000272539"	"04214"	"00377389"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"RP27"	"retinitis pigmentosa"	""
"0000272540"	"04214"	"00377390"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"RP27"	"retinitis pigmentosa"	""
"0000272541"	"04214"	"00377391"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"RP27"	"retinitis pigmentosa"	""
"0000273258"	"04214"	"00379385"	"00000"	"Unknown"	"30y"	""	"10y"	""	""	""	""	""	""	""	""	"clumped pigmentary retinal degeneration (CPRD)"	""
"0000277235"	"04214"	"00383450"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Enhanced S-cone"	""
"0000277236"	"04214"	"00383451"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Enhanced S-cone"	""
"0000278426"	"00198"	"00384636"	"00000"	"Unknown"	""	"enhanced S-cone syndrome (AR) and Early onset oculopharyngeal muscular dystrophy (AD)"	""	""	""	""	""	""	""	""	"Mixed"	"Enhanced S-cone syndrome and early onset oculopharyngeal muscular dystrophy"	""
"0000278427"	"00198"	"00384637"	"00000"	"Familial, autosomal recessive"	""	"enhanced S-cone syndrome (AR) and Early onset oculopharyngeal muscular dystrophy (AD)"	""	""	""	""	""	""	""	""	"Mixed"	"Enhanced S-cone syndrome and early onset oculopharyngeal muscular dystrophy"	""
"0000278824"	"04214"	"00385040"	"00000"	"Isolated (sporadic)"	"4y"	"nyctalopia, no nystagmus, best corrected visual acuity right/left eye: NA"	"6m"	""	""	""	""	""	""	""	"Leber congenital amaurosis"	"Leber congenital amaurosis"	""
"0000280757"	"04214"	"00386979"	"00000"	"Familial, autosomal dominant"	"20y"	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa, autosomal dominant"	""	""
"0000283401"	"04214"	"00389860"	"00000"	"Isolated (sporadic)"	"31y"	"age at genetic diagnosis mentioned"	""	"25y"	""	""	""	""	""	""	"sporadic retinitis pigmentosa"	""	""
"0000283495"	"04214"	"00389954"	"00000"	"Isolated (sporadic)"	"15y"	"age at genetic diagnosis mentioned"	""	"10y"	""	""	""	""	""	""	"sporadic retinitis pigmentosa"	""	""
"0000284259"	"04214"	"00390771"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa (RP)"	""
"0000284917"	"04214"	"00391581"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"rod-cone dystrophy"	""
"0000285883"	"04214"	"00392636"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	"retinitis pigmentosa"	""
"0000299711"	"04214"	"00407357"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"severe autosomal dominant retinitis pigmentosa (adRP)"	""
"0000299713"	"04214"	"00407359"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	"severe autosomal dominant retinitis pigmentosa (adRP)"	""
"0000302061"	"04214"	"00409947"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302062"	"04214"	"00409948"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302063"	"04214"	"00409949"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302064"	"04214"	"00409950"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302065"	"04214"	"00409951"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302066"	"04214"	"00409952"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302067"	"04214"	"00409953"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302068"	"04214"	"00409954"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302069"	"04214"	"00409955"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302070"	"04214"	"00409956"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302071"	"04214"	"00409957"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302072"	"04214"	"00409958"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302073"	"04214"	"00409959"	"00000"	"Familial, autosomal recessive"	""	"cataracts at the beginning of the fourth decade; peripheral visual field constriction and pigmentary deposits first occurred at the beginning of the third decade; electroretinography: abolished rod and cone responses"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302074"	"04214"	"00409960"	"00000"	"Familial, autosomal recessive"	""	"cataracts at the beginning of the fourth decade; peripheral visual field constriction and pigmentary deposits first occurred at the beginning of the third decade; electroretinography: abolished rod and cone responses"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302075"	"04214"	"00409961"	"00000"	"Familial, autosomal recessive"	""	"electroretinography: abolished rod and cone responses"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302076"	"04214"	"00409962"	"00000"	"Familial, autosomal recessive"	""	"electroretinography: abolished rod and cone responses"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302077"	"04214"	"00409963"	"00000"	"Familial, autosomal recessive"	""	"clinical symptoms of retinitis pigmentosa without electroretinographic responses"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302079"	"04214"	"00409965"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302080"	"04214"	"00409966"	"00000"	"Familial, autosomal dominant"	"34y"	"age at onset of night blindness (years): 4, age at onset of visual field loss (years): 28; lens opacities (cataract) right/left eye: +/+; bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	"4y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302081"	"04214"	"00409967"	"00000"	"Familial, autosomal dominant"	"25y"	"no night blindness, age at onset of visual field loss (years): 13; lens opacities (cataract) right/left eye: -/-; bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	"13y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302082"	"04214"	"00409968"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302083"	"04214"	"00409969"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302084"	"04214"	"00409970"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302085"	"04214"	"00409971"	"00000"	"Familial, autosomal dominant"	"21y"	"age at onset of night blindness (years): 5, age at onset of visual field loss (years): 16; lens opacities (cataract) right/left eye: -/-; bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	"5y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302086"	"04214"	"00409972"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302087"	"04214"	"00409973"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302088"	"04214"	"00409974"	"00000"	"Familial, autosomal dominant"	"21y"	"age at onset of night blindness (years): 1, age at onset of visual field loss (years): 12; lens opacities (cataract) right/left eye: +/-; bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	"1y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302089"	"04214"	"00409975"	"00000"	"Familial, autosomal dominant"	"73y"	"age at onset of night blindness (years): 1, age at onset of visual field loss (years): 13; lens opacities (cataract) right/left eye: +/+ (removed  right eye at age 45 years and in the left eye at age 65 years); bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	"1y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302090"	"04214"	"00409976"	"00000"	"Familial, autosomal dominant"	"26y"	"no night blindness, no visual field loss; lens opacities (cataract) right/left eye: -/-; bone-spicule pigment in at least 1 quadrant right/left eye: +/+"	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302091"	"04214"	"00409977"	"00000"	"Familial, autosomal dominant"	"9y"	"age at onset of night blindness (years): 2, no visual field loss; lens opacities (cataract) right/left eye: -/-; bone-spicule pigment in at least 1 quadrant right/left eye: +/-"	"2y"	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302093"	"04214"	"00409981"	"00000"	"Unknown"	"6y"	"best corrected visual acuity right, left eye: 20/200, 20/70; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: nondetectable; 30-Hz white right, left eye: nondetectable"	""	""	""	""	""	""	""	""	"retinitis pigmentosa, AD"	""	""
"0000302094"	"04214"	"00409982"	"00000"	"Familial, autosomal recessive"	"43y"	"clumped pigmentary retinal dystrophy; best corrected visual acuity right, left eye: 20/40, 20/40; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: 8, 6; 30-Hz white right, left eye: 0.9, 0.6"	""	""	""	""	""	""	""	""	"retinitis pigmentosa, AR"	""	""
"0000302095"	"04214"	"00409983"	"00000"	"Unknown"	"19y"	"best corrected visual acuity right, left eye: 20/100, 20/200; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: 458, 396; 30-Hz white right, left eye: 37, 51"	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302096"	"04214"	"00409984"	"00000"	"Familial, autosomal recessive"	"50y"	"best corrected visual acuity right, left eye: 20/30, 20/30; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: 4, 4; 30-Hz white right, left eye: 0.8, 0.9"	""	""	""	""	""	""	""	""	"retinitis pigmentosa, AR"	""	""
"0000302097"	"04214"	"00409985"	"00000"	"Familial, autosomal dominant"	"24y"	"father deceased, segregation impossible; best corrected visual acuity right, left eye: 20/100, 20/200; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: 308, 264; 30-Hz white right, left eye: 4, 5"	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302098"	"04214"	"00409986"	"00000"	"Unknown"	"23y"	"best corrected visual acuity right, left eye: hand motions/hand motions; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: nondetectable; 30-Hz white right, left eye: 0.4, 0.5"	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""	""
"0000302099"	"04214"	"00409987"	"00000"	"Unknown"	"44y"	"best corrected visual acuity right, left eye: 20/200, 20/200; electroretinography amplitude, uV, 0.5-Hz white, right, left eye: 309, 212; 30-Hz white right, left eye: 39, 33"	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302100"	"04214"	"00409988"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa, AR"	""	""
"0000302101"	"04214"	"00409990"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302102"	"04214"	"00409991"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302103"	"04214"	"00409992"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302104"	"04214"	"00409993"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302105"	"04214"	"00409994"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302106"	"04214"	"00409995"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302107"	"04214"	"00409996"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302108"	"04214"	"00409997"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302109"	"04214"	"00409998"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302110"	"04214"	"00409999"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302111"	"04214"	"00410000"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302112"	"04214"	"00410001"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome/atypical retinitis pigmentosa"	""	""
"0000302113"	"04214"	"00410002"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302114"	"04214"	"00410003"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302115"	"04214"	"00410004"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""	""
"0000302116"	"04214"	"00410005"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""	""
"0000302117"	"04214"	"00410006"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302118"	"04214"	"00410009"	"00000"	"Familial, autosomal dominant"	"71y"	"onset of night blindness (years): 48, onset of visual field loss (years): 44; visual field: concentric loss both eyes (55); best corrected visual acuity right/left eye: < 0.1 / 0.3 (55); electroretinogram: no register (60); fundus: typical of RP with macular affectation (68)"	""	""	""	"upregulation of RHO promoter by p.M96T protein similar to that shown by other missense NRL mutations that cause adRP"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302119"	"04214"	"00410010"	"00000"	"Familial, autosomal dominant"	"63y"	"onset of night blindness (years): none, onset of visual field loss (years): 56; visual field: marked concentric loss (56); best corrected visual acuity right/left eye: 1 both eyes (52); electroretinogram: not available; fundus: right eye: slight colour alteration of the retinal pigment epithelium; left eye: few bone spicules (56)"	""	""	""	"upregulation of RHO promoter by p.M96T protein similar to that shown by other missense NRL mutations that cause adRP"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302120"	"04214"	"00410011"	"00000"	"Familial, autosomal dominant"	"36y"	"onset of night blindness (years): 23, onset of visual field loss (years): 23; visual field: inferior hemifield both eyes (25; best corrected visual acuity right/left eye: 0.5 both eyes (25); electroretinogram: cones and flicker: no response; rod and mixed: amplitude reduction (25); fundus: bone spicules and attenuation of vessels"	"23y"	""	""	"upregulation of RHO promoter by p.M96T protein similar to that shown by other missense NRL mutations that cause adRP"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302122"	"04214"	"00410012"	"00000"	"Familial, autosomal dominant"	"68y"	"age at onset (years): 30s; visual acuity: <0.1/0.2; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: diminished; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: visual field loss"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302123"	"04214"	"00410013"	"00000"	"Familial, autosomal dominant"	"63y"	"age at onset (years): 30s; visual acuity: <0.1/0.1; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: diminished; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: visual field loss"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302124"	"04214"	"00410014"	"00000"	"Familial, autosomal dominant"	"48y"	"age at onset (years): 20s; visual acuity: <0.1/0.1; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: not examined; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: not examined"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302125"	"04214"	"00410015"	"00000"	"Familial, autosomal dominant"	"40y"	"age at onset (years): 20s; visual acuity: <0.1/0.1; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: not examined; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: visual field loss"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302126"	"04214"	"00410016"	"00000"	"Familial, autosomal dominant"	"34y"	"age at onset (years): 10s; visual acuity: light perception; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: diminished; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: visual field loss"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302127"	"04214"	"00410017"	"00000"	"Familial, autosomal dominant"	"21y"	"age at onset (years): 20s; visual acuity: not examined; fundus appearance: No obvious RP symptoms; color vision: normal;  electroretinography: diminished rod response, normal cone response; optical coherence tomography: normal; visual field: normal"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302128"	"04214"	"00410018"	"00000"	"Familial, autosomal dominant"	"31y"	"age at onset (years): 20s; visual acuity: <0.2/0.2; fundus appearance: pigment deposits, attenuated retinal arterioles, macular degeneration, pale optic discs; color vision: blue color blindness;  electroretinography: not examined; optical coherence tomography: thinning photoreceptor layer and retinal pigment epithelium, disrupted choroid; visual field: not examined"	""	""	""	"p.P49L mutant showed a statistically significant increase in transactivating the rhodopsin expression"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302129"	"04214"	"00410020"	"00000"	"Familial, autosomal dominant"	"14y"	"no apparent pigmentation at the time of the last ophthalmologic examination"	"<10y"	""	"night blindness"	"S50del mutation accelerates the transcriptional activation ability of NRL and decreases its phosphorylation level"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302130"	"04214"	"00410021"	"00000"	"Familial, autosomal dominant"	""	"night blindness since childhood, visual field loss and reduction of visual acuity, fundus: bone-spicules pigmentation in the mid-peripheral retina"	""	""	"night blindness"	"S50del mutation accelerates the transcriptional activation ability of NRL and decreases its phosphorylation level"	""	""	""	""	"retinitis pigmentosa"	""	""
"0000302135"	"04214"	"00410026"	"00000"	"Unknown"	""	"retinal dystrophy and clinically definite oculopharyngeal muscular dystrophy, early onset"	""	""	""	""	""	""	""	""	"retinal dystrophy and oculopharyngeal muscular dystrophy"	""	""
"0000302136"	"04214"	"00410027"	"00000"	"Unknown"	""	"retinal dystrophy and clinically definite oculopharyngeal muscular dystrophy, early onset"	""	""	""	""	""	""	""	""	"retinal dystrophy and oculopharyngeal muscular dystrophy"	""	""
"0000302137"	"04214"	"00410028"	"00000"	"Unknown"	""	"retinal dystrophy and clinically definite oculopharyngeal muscular dystrophy, early onset"	""	""	""	""	""	""	""	""	"retinal dystrophy and oculopharyngeal muscular dystrophy"	""	""
"0000302138"	"01473"	"00410029"	"00000"	"Familial, autosomal dominant"	""	"clinically definite oculopharyngeal muscular dystrophy, late onset"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302139"	"01473"	"00410030"	"00000"	"Familial, autosomal dominant"	""	"oculopharyngeal muscular dystrophy, late onset"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302140"	"01473"	"00410031"	"00000"	"Familial, autosomal dominant"	"39y"	"no retinal dystrophy, OPMD - currently asymptomatic"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302141"	"04214"	"00410032"	"00000"	"Unknown"	"51y"	"retinal dystrophy and clinically definite oculopharyngeal muscular dystrophy, early onset"	""	""	""	""	""	""	""	""	"retinal dystrophy and oculopharyngeal muscular dystrophy"	""	""
"0000302142"	"01473"	"00410033"	"00000"	"Familial, autosomal dominant"	"27y"	"no retinal dystrophy, OPMD - currently asymptomatic"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302143"	"01473"	"00410034"	"00000"	"Familial, autosomal dominant"	"18y"	"no retinal dystrophy, OPMD - currently asymptomatic"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302144"	"04214"	"00410035"	"00000"	"Unknown"	"35y"	"oculopharyngeal muscular dystrophy, early onset"	""	""	""	""	""	""	""	""	"retinal dystrophy and oculopharyngeal muscular dystrophy"	""	""
"0000302145"	"01473"	"00410036"	"00000"	"Familial, autosomal dominant"	"66y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302146"	"01473"	"00410037"	"00000"	"Familial, autosomal dominant"	"54y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302147"	"01473"	"00410038"	"00000"	"Familial, autosomal dominant"	"66y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302148"	"01473"	"00410039"	"00000"	"Familial, autosomal dominant"	"72y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302149"	"01473"	"00410040"	"00000"	"Familial, autosomal dominant"	"74y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302150"	"01473"	"00410041"	"00000"	"Familial, autosomal dominant"	"62y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302151"	"01473"	"00410042"	"00000"	"Familial, autosomal dominant"	"52y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302152"	"01473"	"00410043"	"00000"	"Familial, autosomal dominant"	"66y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302153"	"01473"	"00410044"	"00000"	"Familial, autosomal dominant"	"80y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302154"	"01473"	"00410045"	"00000"	"Familial, autosomal dominant"	"62y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302155"	"01473"	"00410046"	"00000"	"Familial, autosomal dominant"	"64y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302156"	"01473"	"00410047"	"00000"	"Familial, autosomal dominant"	"47y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302157"	"01473"	"00410048"	"00000"	"Familial, autosomal dominant"	"57y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302158"	"01473"	"00410049"	"00000"	"Familial, autosomal dominant"	"47y"	"clinically definite oculopharyngeal muscular dystrophy, late onset; no retinal dystrophy"	""	""	""	""	""	""	""	""	"oculopharyngeal muscular dystrophy"	""	""
"0000302164"	"04214"	"00410055"	"00000"	"Familial, autosomal recessive"	"29y"	"best corrected visual acuity right, left eye: 20/125, 20/125, refraction right/left eye: +4.75/+6.50; Goldmann perimetry: moderately constricted, midperipheral and central sensitivity loss; ocular features: divergent strabismus"	"10y"	""	""	""	""	""	""	""	"S-cone syndrome, enhanced (ESCS, Goldmann-Favre syndrome)"	""	""
"0000302165"	"04214"	"00410056"	"00000"	"Familial, autosomal recessive"	"13y"	"best corrected visual acuity right, left eye: 20/40, 20/40, refraction right/left eye: +3.0/+3.0; Goldmann perimetry: midperipheral and central sensitivity loss; ocular features: convergent strabismus, nystagmus"	"2y"	""	""	""	""	""	""	""	"S-cone syndrome, enhanced (ESCS, Goldmann-Favre syndrome)"	""	""
"0000302166"	"04214"	"00410057"	"00000"	"Familial, autosomal recessive"	"11y"	"best corrected visual acuity right, left eye: 20/32, 20/63, refraction right/left eye: +1.5/+3.25; Goldmann perimetry: moderately constricted, midperipheral; ocular features: and central sensitivity loss"	"2y"	""	""	""	""	""	""	""	"S-cone syndrome, enhanced (ESCS, Goldmann-Favre syndrome)"	""	""
"0000320707"	"04214"	"00429835"	"04436"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000320784"	"00112"	"00429912"	"04436"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000320921"	"00112"	"00430049"	"04436"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000336807"	"00198"	"00447608"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa, simplex"	""


## Screenings ## Do not remove or alter this header ##
## Count = 150
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000033229"	"00033161"	"1"	"00229"	"00229"	"2012-02-04 15:13:24"	"00006"	"2012-05-18 13:59:33"	"SEQ;SEQ-NG-S"	"DNA"	""	""
"0000105491"	"00105017"	"1"	"01244"	"01244"	"2017-06-15 11:27:14"	""	""	"SEQ-NG-I"	"DNA"	"Whole blood"	""
"0000156379"	"00155514"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156380"	"00155515"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000234337"	"00233238"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000234338"	"00233239"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000234339"	"00233240"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000234340"	"00233241"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000234341"	"00233242"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000234874"	"00233775"	"1"	"02591"	"02591"	"2019-05-03 15:11:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000292184"	"00291016"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000309670"	"00308525"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000310403"	"00309258"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310404"	"00309259"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310405"	"00309260"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000321017"	"00319836"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"DGGE; SSCA"	"DNA"	""	""
"0000326630"	"00325419"	"1"	"00006"	"00006"	"2021-01-03 11:36:11"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"199 gene panel"
"0000327895"	"00326682"	"1"	"00008"	"00008"	"2021-01-14 12:28:06"	""	""	"DHPLC"	"DNA"	"blood"	""
"0000327899"	"00326686"	"1"	"00008"	"00008"	"2021-01-14 12:28:06"	""	""	"DHPLC"	"DNA"	"blood"	""
"0000329707"	"00328492"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000333506"	"00332286"	"1"	"00000"	"00006"	"2021-02-16 17:14:33"	""	""	"SEQ-NG"	"DNA"	""	"300-gene panel"
"0000336359"	"00335130"	"1"	"00000"	"00006"	"2021-03-04 11:06:46"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000336872"	"00335644"	"1"	"00008"	"00008"	"2021-03-07 20:43:50"	""	""	"SEQ"	"DNA"	""	""
"0000336873"	"00335645"	"1"	"00008"	"00008"	"2021-03-07 20:43:50"	""	""	"SEQ"	"DNA"	""	""
"0000337211"	"00335981"	"1"	"00000"	"00006"	"2021-03-10 17:05:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000359960"	"00358730"	"1"	"00000"	"00006"	"2021-03-11 13:59:15"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000359961"	"00358731"	"1"	"00000"	"00006"	"2021-03-11 13:59:15"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000360377"	"00359139"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000375107"	"00373875"	"1"	"00000"	"00006"	"2021-05-21 15:01:30"	""	""	"SEQ-NG"	"DNA"	""	"238-gene panel"
"0000376497"	"00375300"	"1"	"00000"	"00006"	"2021-06-03 08:39:58"	""	""	"SEQ-NG"	"DNA"	""	"193-gene panel"
"0000378028"	"00376823"	"1"	"00000"	"00006"	"2021-06-25 15:49:34"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000378413"	"00377208"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378414"	"00377209"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	""	""	"SEQ"	"DNA"	"buccal cells"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378415"	"00377210"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	""	""	"SEQ"	"DNA"	"buccal cells"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378473"	"00377268"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378592"	"00377389"	"1"	"00000"	"03840"	"2021-07-22 14:34:00"	""	""	"?"	"DNA"	""	"various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES"
"0000378593"	"00377390"	"1"	"00000"	"03840"	"2021-07-22 14:34:00"	""	""	"?"	"DNA"	""	"various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES"
"0000378594"	"00377391"	"1"	"00000"	"03840"	"2021-07-22 14:34:00"	""	""	"?"	"DNA"	""	"various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES"
"0000380585"	"00379385"	"1"	"00000"	"00008"	"2021-08-05 00:17:46"	""	""	"PCR;SEQ; arraySNP"	"DNA"	"blood"	""
"0000384675"	"00383450"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000384676"	"00383451"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000385864"	"00384636"	"1"	"00000"	"03840"	"2021-10-04 12:47:36"	""	""	"arraySNP;SEQ"	"DNA"	"blood"	""
"0000385865"	"00384637"	"1"	"00000"	"03840"	"2021-10-04 12:47:36"	""	""	"arraySNP;SEQ"	"DNA"	"blood"	""
"0000386269"	"00385040"	"1"	"00000"	"03840"	"2021-10-06 17:52:46"	""	""	"SEQ-NG"	"DNA"	""	"targeted next-generation sequencing"
"0000388205"	"00386979"	"1"	"00000"	"03840"	"2021-10-28 13:59:26"	""	""	"SEQ-NG"	"DNA"	"blood"	"targeted sequencing"
"0000391103"	"00389860"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET4 targeted sequencing panel - see paper"
"0000391197"	"00389954"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET6 targeted sequencing panel - see paper"
"0000392012"	"00390771"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"arraySEQ"	"DNA"	"Blood"	""
"0000392823"	"00391581"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000393883"	"00392636"	"1"	"00000"	"03840"	"2021-11-23 15:06:01"	""	""	"SEQ-NG-I;SEQ"	"DNA"	""	"whole exome sequencing"
"0000408605"	"00407357"	"1"	"00000"	"00008"	"2022-04-06 13:32:24"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000408607"	"00407359"	"1"	"00000"	"00008"	"2022-04-06 13:32:24"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000411210"	"00409947"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411211"	"00409948"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411212"	"00409949"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411213"	"00409950"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411214"	"00409951"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411215"	"00409952"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411216"	"00409953"	"1"	"00000"	"03840"	"2022-05-15 10:55:53"	""	""	"SEQ;RFLP"	"DNA"	""	""
"0000411217"	"00409954"	"1"	"00000"	"03840"	"2022-05-15 11:30:28"	""	""	"HD"	"DNA"	"blood"	""
"0000411218"	"00409955"	"1"	"00000"	"03840"	"2022-05-15 11:30:28"	""	""	"HD"	"DNA"	"blood"	""
"0000411219"	"00409956"	"1"	"00000"	"03840"	"2022-05-15 11:30:28"	""	""	"HD"	"DNA"	"blood"	""
"0000411220"	"00409957"	"1"	"00000"	"03840"	"2022-05-15 11:30:28"	""	""	"HD"	"DNA"	"blood"	""
"0000411221"	"00409958"	"1"	"00000"	"03840"	"2022-05-15 11:30:28"	""	""	"HD"	"DNA"	"blood"	""
"0000411222"	"00409959"	"1"	"00000"	"03840"	"2022-05-15 13:39:24"	""	""	"DGGE;SSCA;SEQ"	"DNA"	"blood"	""
"0000411223"	"00409960"	"1"	"00000"	"03840"	"2022-05-15 13:39:24"	""	""	"DGGE;SSCA;SEQ"	"DNA"	"blood"	""
"0000411224"	"00409961"	"1"	"00000"	"03840"	"2022-05-15 13:39:24"	""	""	"DGGE;SSCA;SEQ"	"DNA"	"blood"	""
"0000411225"	"00409962"	"1"	"00000"	"03840"	"2022-05-15 13:39:24"	""	""	"DGGE;SSCA;SEQ"	"DNA"	"blood"	""
"0000411226"	"00409963"	"1"	"00000"	"03840"	"2022-05-15 13:39:24"	""	""	"DGGE;SSCA;SEQ"	"DNA"	"blood"	""
"0000411228"	"00409965"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411229"	"00409966"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411230"	"00409967"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411231"	"00409968"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411232"	"00409969"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411233"	"00409970"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411234"	"00409971"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411235"	"00409972"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411236"	"00409973"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411237"	"00409974"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411238"	"00409975"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411239"	"00409976"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411240"	"00409977"	"1"	"00000"	"03840"	"2022-05-16 11:05:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411243"	"00409981"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411244"	"00409982"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411245"	"00409983"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411246"	"00409984"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411247"	"00409985"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411248"	"00409986"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411249"	"00409987"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411250"	"00409988"	"1"	"00000"	"03840"	"2022-05-16 15:56:24"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411252"	"00409990"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411253"	"00409991"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411254"	"00409992"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411255"	"00409993"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411256"	"00409994"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411257"	"00409995"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411258"	"00409996"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411259"	"00409997"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411260"	"00409998"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411261"	"00409999"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411262"	"00410000"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411263"	"00410001"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411264"	"00410002"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411265"	"00410003"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411266"	"00410004"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411267"	"00410005"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411268"	"00410006"	"1"	"00000"	"03840"	"2022-05-17 13:47:35"	""	""	"?"	"DNA"	""	""
"0000411270"	"00410009"	"1"	"00000"	"03840"	"2022-05-17 15:02:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411271"	"00410010"	"1"	"00000"	"03840"	"2022-05-17 15:02:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411272"	"00410011"	"1"	"00000"	"03840"	"2022-05-17 15:02:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000411274"	"00410012"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411275"	"00410013"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411276"	"00410014"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411277"	"00410015"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411278"	"00410016"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411279"	"00410017"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411280"	"00410018"	"1"	"00000"	"03840"	"2022-05-17 20:30:44"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411282"	"00410020"	"1"	"00000"	"03840"	"2022-05-17 20:49:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411283"	"00410021"	"1"	"00000"	"03840"	"2022-05-17 20:49:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411288"	"00410026"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411289"	"00410027"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411290"	"00410028"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411291"	"00410029"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411292"	"00410030"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411293"	"00410031"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411294"	"00410032"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411295"	"00410033"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411296"	"00410034"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411297"	"00410035"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411298"	"00410036"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411299"	"00410037"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411300"	"00410038"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411301"	"00410039"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411302"	"00410040"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411303"	"00410041"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411304"	"00410042"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411305"	"00410043"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411306"	"00410044"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411307"	"00410045"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411308"	"00410046"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411309"	"00410047"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411310"	"00410048"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411311"	"00410049"	"1"	"00000"	"03840"	"2022-05-18 12:34:52"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411317"	"00410055"	"1"	"00000"	"03840"	"2022-05-18 12:58:53"	""	""	"arraySNP;SEQ"	"DNA"	"blood"	"homozygosity mapping"
"0000411318"	"00410056"	"1"	"00000"	"03840"	"2022-05-18 12:58:53"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000411319"	"00410057"	"1"	"00000"	"03840"	"2022-05-18 12:58:53"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000431248"	"00429835"	"1"	"04436"	"00008"	"2023-01-11 18:53:49"	""	""	"SEQ"	"DNA"	""	"RP-LCA smMIPs sequencing"
"0000431325"	"00429912"	"1"	"04436"	"00008"	"2023-01-11 18:53:49"	""	""	"SEQ"	"DNA"	""	"RP-LCA smMIPs sequencing"
"0000431462"	"00430049"	"1"	"04436"	"00008"	"2023-01-11 18:53:49"	""	""	"SEQ"	"DNA"	""	"RP-LCA smMIPs sequencing"
"0000449185"	"00447608"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 152
"{{screeningid}}"	"{{geneid}}"
"0000033229"	"AIPL1"
"0000033229"	"C2orf71"
"0000033229"	"CFH"
"0000033229"	"NRL"
"0000156379"	"NRL"
"0000156380"	"NRL"
"0000234337"	"NRL"
"0000234338"	"NRL"
"0000234339"	"NRL"
"0000234340"	"NRL"
"0000234341"	"NRL"
"0000234874"	"NRL"
"0000309670"	"NRL"
"0000310403"	"NRL"
"0000310404"	"NRL"
"0000310405"	"NRL"
"0000321017"	"CRX"
"0000321017"	"NRL"
"0000321017"	"PRPH2"
"0000321017"	"RHO"
"0000321017"	"ROM1"
"0000321017"	"RP1"
"0000326630"	"NRL"
"0000327895"	"NRL"
"0000327899"	"NRL"
"0000329707"	"NRL"
"0000333506"	"NRL"
"0000336359"	"NRL"
"0000336872"	"NRL"
"0000336873"	"NRL"
"0000337211"	"NRL"
"0000359960"	"NRL"
"0000359961"	"NRL"
"0000375107"	"NRL"
"0000376497"	"NRL"
"0000378413"	"NRL"
"0000378414"	"NRL"
"0000378415"	"NRL"
"0000378473"	"NRL"
"0000378592"	"NRL"
"0000378593"	"NRL"
"0000378594"	"NRL"
"0000380585"	"NRL"
"0000384675"	"NRL"
"0000384676"	"NRL"
"0000385864"	"NRL"
"0000385865"	"NRL"
"0000386269"	"NRL"
"0000388205"	"NRL"
"0000391103"	"NRL"
"0000391197"	"NRL"
"0000392012"	"NRL"
"0000392823"	"NRL"
"0000393883"	"NRL"
"0000408605"	"SPTBN5"
"0000408607"	"FRMPD1"
"0000411210"	"NRL"
"0000411211"	"NRL"
"0000411212"	"NRL"
"0000411213"	"NRL"
"0000411214"	"NRL"
"0000411215"	"NRL"
"0000411216"	"NRL"
"0000411217"	"NRL"
"0000411218"	"NRL"
"0000411219"	"NRL"
"0000411220"	"NRL"
"0000411221"	"NRL"
"0000411222"	"NRL"
"0000411223"	"NRL"
"0000411224"	"NRL"
"0000411225"	"NRL"
"0000411226"	"NRL"
"0000411228"	"NRL"
"0000411229"	"NRL"
"0000411230"	"NRL"
"0000411231"	"NRL"
"0000411232"	"NRL"
"0000411233"	"NRL"
"0000411234"	"NRL"
"0000411235"	"NRL"
"0000411236"	"NRL"
"0000411237"	"NRL"
"0000411238"	"NRL"
"0000411239"	"NRL"
"0000411240"	"NRL"
"0000411243"	"NRL"
"0000411244"	"NRL"
"0000411245"	"NRL"
"0000411246"	"NRL"
"0000411247"	"NRL"
"0000411248"	"NRL"
"0000411249"	"NRL"
"0000411250"	"NRL"
"0000411252"	"NRL"
"0000411253"	"NRL"
"0000411254"	"NRL"
"0000411255"	"NRL"
"0000411256"	"NRL"
"0000411257"	"NRL"
"0000411258"	"NRL"
"0000411259"	"NRL"
"0000411260"	"NRL"
"0000411261"	"NRL"
"0000411262"	"NRL"
"0000411263"	"NRL"
"0000411264"	"NRL"
"0000411265"	"NRL"
"0000411266"	"NRL"
"0000411267"	"NRL"
"0000411268"	"NRL"
"0000411270"	"NRL"
"0000411271"	"NRL"
"0000411272"	"NRL"
"0000411274"	"NRL"
"0000411275"	"NRL"
"0000411276"	"NRL"
"0000411277"	"NRL"
"0000411278"	"NRL"
"0000411279"	"NRL"
"0000411280"	"NRL"
"0000411282"	"NRL"
"0000411288"	"NRL"
"0000411289"	"NRL"
"0000411290"	"NRL"
"0000411291"	"NRL"
"0000411292"	"NRL"
"0000411293"	"NRL"
"0000411294"	"NRL"
"0000411295"	"NRL"
"0000411296"	"NRL"
"0000411297"	"NRL"
"0000411298"	"NRL"
"0000411299"	"NRL"
"0000411300"	"NRL"
"0000411301"	"NRL"
"0000411302"	"NRL"
"0000411303"	"NRL"
"0000411304"	"NRL"
"0000411305"	"NRL"
"0000411306"	"NRL"
"0000411307"	"NRL"
"0000411308"	"NRL"
"0000411309"	"NRL"
"0000411310"	"NRL"
"0000411311"	"NRL"
"0000411317"	"NRL"
"0000411318"	"NRL"
"0000411319"	"NRL"
"0000431248"	"NRL"
"0000431325"	"NRL"
"0000431462"	"NRL"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 210
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000060121"	"1"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"00229"	"NRL_000001"	"g.24550651G>T"	""	"{PMID:Neveling 2012:22334370}"	""	""	"predicted to affect function, but insufficient evidence for definite conclusion"	"Germline"	"yes"	""	"0"	""	""	"g.24081442G>T"	""	"likely pathogenic"	""
"0000060122"	"2"	"70"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00229"	"NRL_000002"	"g.24550505del"	""	"{PMID:Neveling 2012:22334370}"	""	""	"predicted to affect function, but insufficient evidence for definite conclusion"	"Germline"	"yes"	""	"0"	""	""	"g.24081296del"	""	"likely pathogenic"	""
"0000170925"	"3"	"70"	"14"	"24551719"	"24551719"	"subst"	"0"	"01244"	"NRL_000003"	"g.24551719G>C"	""	"{PMID:de Castro-Miró 2016:28005958}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.24082510G>C"	""	"pathogenic"	"ACMG"
"0000248876"	"0"	"10"	"14"	"24567498"	"24567498"	"subst"	"1"	"02325"	"PCK2_000001"	"g.24567498A>C"	""	""	""	"PCK2(NM_004563.4):c.362A>C (p.Q121P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24098289A>C"	""	"benign"	""
"0000293255"	"0"	"30"	"14"	"24551859"	"24551859"	"subst"	"9.79504E-5"	"02330"	"NRL_000007"	"g.24551859G>A"	""	""	""	"NRL(NM_006177.5):c.199C>T (p.P67S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24082650G>A"	""	"likely benign"	""
"0000293256"	"0"	"10"	"14"	"24550718"	"24550718"	"subst"	"0.00355192"	"02330"	"NRL_000005"	"g.24550718C>T"	""	""	""	"NRL(NM_006177.4):c.441G>A (p.R147=), NRL(NM_006177.5):c.441G>A (p.R147=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081509C>T"	""	"benign"	""
"0000293257"	"0"	"90"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"02330"	"NRL_000002"	"g.24550505del"	""	""	""	"NRL(NM_006177.3):c.654delC (p.(Cys219Valfs*4)), NRL(NM_006177.4):c.654delC (p.C219Vfs*4), NRL(NM_006177.5):c.654delC (p.C219Vfs*4)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081296del"	""	"pathogenic"	""
"0000293258"	"0"	"10"	"14"	"24550448"	"24550448"	"subst"	"0.000461841"	"02330"	"NRL_000004"	"g.24550448G>C"	""	""	""	"NRL(NM_006177.4):c.711C>G (p.L237=), NRL(NM_006177.5):c.711C>G (p.L237=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081239G>C"	""	"benign"	""
"0000304558"	"0"	"30"	"14"	"24550760"	"24550760"	"subst"	"0.000838637"	"01943"	"NRL_000006"	"g.24550760G>A"	""	""	""	"NRL(NM_006177.4):c.399C>T (p.S133=), NRL(NM_006177.5):c.399C>T (p.S133=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081551G>A"	""	"likely benign"	""
"0000304559"	"0"	"30"	"14"	"24550718"	"24550718"	"subst"	"0.00355192"	"01943"	"NRL_000005"	"g.24550718C>T"	""	""	""	"NRL(NM_006177.4):c.441G>A (p.R147=), NRL(NM_006177.5):c.441G>A (p.R147=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081509C>T"	""	"likely benign"	""
"0000304560"	"0"	"90"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"01943"	"NRL_000002"	"g.24550505del"	""	""	""	"NRL(NM_006177.3):c.654delC (p.(Cys219Valfs*4)), NRL(NM_006177.4):c.654delC (p.C219Vfs*4), NRL(NM_006177.5):c.654delC (p.C219Vfs*4)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081296del"	""	"pathogenic"	""
"0000323620"	"0"	"50"	"14"	"24568362"	"24568362"	"subst"	"0"	"01804"	"PCK2_000002"	"g.24568362T>G"	""	""	""	"PCK2(NM_001018073.1):c.769T>G (p.(Ser257Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24099153T>G"	""	"VUS"	""
"0000344315"	"0"	"90"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"02327"	"NRL_000002"	"g.24550505del"	""	""	""	"NRL(NM_006177.3):c.654delC (p.(Cys219Valfs*4)), NRL(NM_006177.4):c.654delC (p.C219Vfs*4), NRL(NM_006177.5):c.654delC (p.C219Vfs*4)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24081296del"	""	"pathogenic"	""
"0000348488"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"02327"	"NRL_000008"	"g.24551906G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.24082697G>T"	""	"likely pathogenic"	""
"0000358301"	"3"	"90"	"14"	"24550693"	"24550700"	"dup"	"0"	"01243"	"NRL_000010"	"g.24550693_24550700dup"	""	"Sharon, submitted"	""	""	"Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000358302"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"01243"	"NRL_000011"	"g.24551967G>A"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000477045"	"0"	"50"	"14"	"24550507"	"24550507"	"subst"	"0"	"02591"	"NRL_000012"	"g.24550507G>A"	"1/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24081298G>A"	""	"VUS"	""
"0000477046"	"0"	"50"	"14"	"24551687"	"24551687"	"subst"	"0"	"02591"	"NRL_000013"	"g.24551687T>G"	"1/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082478T>G"	""	"VUS"	""
"0000477047"	"0"	"90"	"14"	"24551906"	"24551906"	"subst"	"0"	"02591"	"NRL_000014"	"g.24551906G>A"	"1/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082697G>A"	""	"pathogenic"	""
"0000477048"	"0"	"90"	"14"	"24551909"	"24551909"	"subst"	"0"	"02591"	"NRL_000015"	"g.24551909G>A"	"1/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082700G>A"	""	"pathogenic"	""
"0000477049"	"0"	"50"	"14"	"24551985"	"24551985"	"subst"	"0"	"02591"	"NRL_000016"	"g.24551985G>A"	"6/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082776G>A"	""	"VUS"	""
"0000477582"	"3"	"50"	"14"	"24551985"	"24551985"	"subst"	"0"	"02591"	"NRL_000016"	"g.24551985G>A"	"1/1204 cases with retinitis pigmentosa"	"{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082776G>A"	""	"VUS"	""
"0000552424"	"0"	"50"	"14"	"24546585"	"24546585"	"subst"	"0"	"02327"	"DCAF11_000001"	"g.24546585C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24077376C>T"	""	"VUS"	""
"0000552425"	"0"	"10"	"14"	"24550448"	"24550448"	"subst"	"0.000461841"	"01943"	"NRL_000004"	"g.24550448G>C"	""	""	""	"NRL(NM_006177.4):c.711C>G (p.L237=), NRL(NM_006177.5):c.711C>G (p.L237=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24081239G>C"	""	"benign"	""
"0000552426"	"0"	"50"	"14"	"24551765"	"24551765"	"subst"	"0"	"01943"	"DCAF11_000002"	"g.24551765A>G"	""	""	""	"NRL(NM_006177.4):c.293T>C (p.L98P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24082556A>G"	""	"VUS"	""
"0000552430"	"0"	"10"	"14"	"24572991"	"24572991"	"subst"	"0.00120625"	"01943"	"DCAF11_000006"	"g.24572991G>A"	""	""	""	"PCK2(NM_001308054.1):c.1339G>A (p.A447T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24103782G>A"	""	"benign"	""
"0000614936"	"0"	"50"	"14"	"24550554"	"24550554"	"subst"	"0"	"02327"	"DCAF11_000007"	"g.24550554C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24081345C>T"	""	"VUS"	""
"0000648873"	"1"	"90"	"14"	"24551907"	"24551907"	"subst"	"0"	"03575"	"NRL_000017"	"g.24551907G>A"	"1/2793 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs794727281}"	"Germline"	""	"rs794727281"	"0"	""	""	"g.24082698G>A"	""	"pathogenic"	""
"0000657424"	"0"	"30"	"14"	"24567504"	"24567504"	"subst"	"0.000597537"	"01943"	"DCAF11_000008"	"g.24567504C>T"	""	""	""	"PCK2(NM_004563.3):c.368C>T (p.P123L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24098295C>T"	""	"likely benign"	""
"0000657425"	"0"	"50"	"14"	"24572923"	"24572923"	"subst"	"2.84389E-5"	"01943"	"DCAF11_000009"	"g.24572923T>C"	""	""	""	"PCK2(NM_001308054.1):c.1271T>C (p.I424T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24103714T>C"	""	"VUS"	""
"0000657426"	"0"	"30"	"14"	"24573045"	"24573045"	"subst"	"0.000495407"	"01943"	"DCAF11_000010"	"g.24573045C>T"	""	""	""	"PCK2(NM_001308054.1):c.1393C>T (p.P465S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.24103836C>T"	""	"likely benign"	""
"0000679963"	"0"	"70"	"14"	"24550708"	"24550715"	"dup"	"0"	"02327"	"NRL_000010"	"g.24550708_24550715dup"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000684543"	"1"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00004"	"NRL_000014"	"g.24551906G>A"	"3/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000685314"	"3"	"90"	"14"	"24550714"	"24550715"	"ins"	"0"	"00004"	"NRL_000018"	"g.24550714_24550715insCCCGCAGC"	"1/2420 IRD families"	"{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}"	""	"444_445insGCTGCGGG"	"variant not 444_45idup?"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	"ACMG"
"0000685315"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00004"	"NRL_000011"	"g.24551967G>A"	"3/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685316"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00004"	"NRL_000011"	"g.24551967G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000691646"	"0"	"50"	"14"	"24550546"	"24550546"	"subst"	"0"	"01943"	"DCAF11_000011"	"g.24550546C>T"	""	""	""	"NRL(NM_006177.4):c.613G>A (p.V205M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000703790"	"1"	"50"	"14"	"24551906"	"24551906"	"subst"	"0"	"00008"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Milla 2002:12221539}"	""	"P51L"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"VUS"	""
"0000710222"	"1"	"90"	"14"	"24551910"	"24551910"	"subst"	"0"	"00006"	"NRL_000019"	"g.24551910A>G"	"1/143 cases"	"{PMID:Zenteno 2020:31736247}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082701A>G"	""	"pathogenic"	""
"0000711688"	"1"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00008"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Ziviello 2005:15994872}"	""	"P51L"	""	"Germline"	"no"	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000711692"	"1"	"10"	"14"	"24551859"	"24551859"	"subst"	"9.79504E-5"	"00008"	"NRL_000007"	"g.24551859G>A"	""	"{PMID:Ziviello 2005:15994872}"	""	"P67S"	""	"Germline"	"no"	""	"0"	""	""	""	""	"benign"	""
"0000714064"	"3"	"70"	"14"	"24550680"	"24550680"	"subst"	"0"	"00000"	"NRL_000020"	"g.24550680A>G"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24081471A>G"	""	"likely pathogenic (recessive)"	""
"0000724736"	"0"	"50"	"14"	"24550465"	"24550475"	"del"	"0"	"02330"	"DCAF11_000012"	"g.24550465_24550475del"	""	""	""	"NRL(NM_006177.5):c.684_694delGTCCGGGGACC (p.S229Lfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000724737"	"0"	"50"	"14"	"24551693"	"24551693"	"subst"	"4.12698E-6"	"01943"	"DCAF11_000013"	"g.24551693C>T"	""	""	""	"NRL(NM_006177.4):c.365G>A (p.G122E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000724738"	"0"	"30"	"14"	"24551743"	"24551743"	"subst"	"4.91844E-5"	"01943"	"DCAF11_000014"	"g.24551743G>A"	""	""	""	"NRL(NM_006177.4):c.315C>T (p.V105=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000724739"	"0"	"50"	"14"	"24551861"	"24551861"	"subst"	"4.0826E-6"	"02327"	"DCAF11_000015"	"g.24551861C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000724740"	"0"	"50"	"14"	"24567592"	"24567593"	"ins"	"2.44922E-5"	"01943"	"DCAF11_000016"	"g.24567592_24567593insAGAGGTTTC"	""	""	""	"PCK2(NM_001308054.1):c.54_55insAGAGGTTTC (p.M18_Q19insRGF)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000724741"	"0"	"90"	"14"	"24567596"	"24567597"	"ins"	"0"	"01943"	"DCAF11_000017"	"g.24567596_24567597insCTGTGGATGAGAG"	""	""	""	"PCK2(NM_001308054.1):c.58_59insCTGTGGATGAGAG (p.G20Afs*31)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000724742"	"0"	"50"	"14"	"24567800"	"24567800"	"subst"	"8.53603E-5"	"02325"	"DCAF11_000018"	"g.24567800C>T"	""	""	""	"PCK2(NM_004563.4):c.577C>T (p.(Arg193Ter), p.R193*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000724743"	"0"	"30"	"14"	"24569343"	"24569343"	"subst"	"0.000399481"	"01943"	"DCAF11_000019"	"g.24569343C>T"	""	""	""	"PCK2(NM_001308054.1):c.753C>T (p.G251=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000724744"	"0"	"50"	"14"	"24572811"	"24572811"	"subst"	"2.04499E-5"	"01943"	"DCAF11_000020"	"g.24572811C>T"	""	""	""	"PCK2(NM_001308054.1):c.1159C>T (p.R387C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000731160"	"1"	"90"	"14"	"24550743"	"24550743"	"subst"	"0"	"00000"	"NRL_000021"	"g.24550743G>C"	""	"{PMID:Porto 2017:29186038}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000731180"	"2"	"90"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00000"	"NRL_000002"	"g.24550505del"	""	"{PMID:Porto 2017:29186038}"	""	"654delC"	""	"Germline"	""	""	"0"	""	""	"g.24081296del"	""	"pathogenic (recessive)"	""
"0000735634"	"0"	"90"	"14"	"24551959"	"24551959"	"dup"	"0"	"00000"	"NRL_000009"	"g.24551959dup"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082750dup"	""	"pathogenic"	""
"0000735749"	"0"	"90"	"14"	"24551959"	"24551959"	"dup"	"0"	"00000"	"NRL_000009"	"g.24551959dup"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082750dup"	""	"pathogenic"	""
"0000736410"	"1"	"10"	"14"	"24550718"	"24550718"	"subst"	"0.00355192"	"00008"	"NRL_000005"	"g.24550718C>T"	""	"{PMID:Sullivan 2006:16799052}"	""	"441G>A"	"Silent substitution"	"Germline"	"yes"	""	"0"	""	""	""	""	"benign"	""
"0000736411"	"1"	"10"	"14"	"24550638"	"24550638"	"subst"	"7.50616E-6"	"00008"	"NRL_000022"	"g.24550638T>C"	""	"{PMID:Sullivan 2006:16799052}"	""	"521A>G"	""	"Germline"	"no"	""	"0"	""	""	""	""	"benign"	""
"0000736841"	"1"	"50"	"14"	"24551690"	"24551692"	"del"	"0"	"00000"	"NRL_000024"	"g.24551690_24551692del"	"1/486 individuals"	"{PMID:Sergouniotis 2016:27628848}"	""	""	"no genotypes reported"	"Germline"	""	""	"0"	""	""	"g.24082481_24082483del"	""	"VUS"	""
"0000759591"	"1"	"90"	"14"	"24552042"	"24552042"	"del"	"2.0444E-5"	"00000"	"NRL_000025"	"g.24552042del"	""	"{PMID:Carrigan 2016:27624628}"	""	"16delA"	""	"Germline"	""	""	"0"	""	""	"g.24082833del"	""	"pathogenic"	""
"0000759592"	"1"	"90"	"14"	"24550773"	"24550773"	"del"	"0"	"00000"	"NRL_000023"	"g.24550773del"	""	"{PMID:Carrigan 2016:27624628}"	""	"386delC"	""	"Germline"	""	""	"0"	""	""	"g.24081564del"	""	"pathogenic"	""
"0000759618"	"2"	"90"	"14"	"0"	"0"	""	"0"	"00000"	"SERPINA1_000009"	"g.?"	""	"{PMID:Carrigan 2016:27624628}"	""	"p.Ala129fs"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000759619"	"2"	"90"	"14"	"0"	"0"	""	"0"	"00000"	"SERPINA1_000009"	"g.?"	""	"{PMID:Carrigan 2016:27624628}"	""	"p.Ser6fs"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000760269"	"0"	"50"	"14"	"24550544"	"24550585"	"dup"	"0"	"00000"	"NRL_000026"	"g.24550544_24550585dup"	""	"{PMID:Ellingford 2016:27208204}"	""	"586_627dupGCCCAGCTGGACGCGCTGCGGGCCGAGGTGGCCCGCCTGGCC"	""	"Germline"	""	""	"0"	""	""	"g.24081335_24081376dup"	""	"VUS"	""
"0000786402"	"1"	"90"	"14"	"24551835"	"24551835"	"dup"	"0"	"00000"	"NRL_000027"	"g.24551835dup"	""	"{PMID:Consugar 2015:25412400}"	""	"223dupC"	""	"Germline"	"yes"	""	"0"	""	""	"g.24082626dup"	""	"pathogenic (recessive)"	""
"0000786473"	"2"	"90"	"14"	"24551835"	"24551835"	"dup"	"0"	"00000"	"NRL_000027"	"g.24551835dup"	""	"{PMID:Consugar 2015:25412400}"	""	"223dupC"	""	"Germline"	"yes"	""	"0"	""	""	"g.24082626dup"	""	"pathogenic (recessive)"	""
"0000788105"	"1"	"90"	"14"	"24552035"	"24552035"	"del"	"0"	"00000"	"NRL_000028"	"g.24552035del"	""	"{PMID:Oishi 2014:25324289}"	""	"23delT"	""	"Germline"	""	""	"0"	""	""	"g.24082826del"	""	"pathogenic"	""
"0000790688"	"1"	"90"	"14"	"0"	"0"	""	"0"	"00000"	"SERPINA1_000009"	"g.?"	""	"{PMID:Daiger 2014:24664689}"	""	"Pro51Ala"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000791168"	"11"	"90"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"pathogenic"	"ACMG"
"0000791169"	"21"	"90"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"pathogenic"	"ACMG"
"0000791170"	"20"	"90"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"pathogenic"	"ACMG"
"0000791228"	"0"	"50"	"14"	"24551822"	"24551824"	"del"	"0"	"00000"	"NRL_000029"	"g.24551822_24551824del"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	""	""	"0"	""	""	"g.24082613_24082615del"	""	"VUS"	"ACMG"
"0000791441"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	"2/258"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000791442"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	"2/258"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000791443"	"0"	"70"	"14"	"24551771"	"24551771"	"subst"	"4.08413E-6"	"00000"	"NRL_000030"	"g.24551771A>G"	"1/258"	"{PMID:Martin-Merida 2018:29847639}"	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.24082562A>G"	""	"likely pathogenic"	""
"0000793730"	"3"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"00000"	"NRL_000001"	"g.24550651G>T"	"0/360 controls"	"{PMID:Collin-2011:21217109}"	""	"c.508C>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000806378"	"0"	"90"	"14"	"24550473"	"24550473"	"del"	"0"	"01943"	"CPNE6_000004"	"g.24550473del"	""	""	""	"NRL(NM_006177.4):c.687delC (p.D231Tfs*87)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000806379"	"0"	"50"	"14"	"24551984"	"24551984"	"subst"	"8.12929E-6"	"02329"	"DCAF11_000021"	"g.24551984C>T"	""	""	""	"NRL(NM_006177.5):c.74G>A (p.R25Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000806380"	"0"	"30"	"14"	"24572716"	"24572716"	"dup"	"0"	"01943"	"DCAF11_000022"	"g.24572716dup"	""	""	""	"PCK2(NM_001308054.1):c.1067-3dupC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000811436"	"3"	"70"	"14"	"24551719"	"24551719"	"subst"	"0"	"00000"	"NRL_000003"	"g.24551719G>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.339C>G (p.Tyr113*), Allele 2 c.339C>G (p.Tyr113*)"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.24082510G>C"	""	"likely pathogenic"	""
"0000811437"	"3"	"70"	"14"	"24551719"	"24551719"	"subst"	"0"	"00000"	"NRL_000003"	"g.24551719G>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.339C>G (p.Tyr113*), Allele 2 c.339C>G (p.Tyr113*)"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.24082510G>C"	""	"likely pathogenic"	""
"0000813021"	"3"	"70"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Ehrenberg 2019:31814694}"	""	"NRL (NM_006177.3; OMIM: 162080): c.91C>T; p.Arg31* (hom) (ESCS), PABPN1 (NM_004643; OMIM: 602279): (GCN)13 (hom) (OPMD)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"likely pathogenic"	""
"0000813022"	"3"	"70"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Ehrenberg 2019:31814694}"	""	"NRL (NM_006177.3; OMIM: 162080): c.91C>T; p.Arg31* (hom) (ESCS), PABPN1 (NM_004643; OMIM: 602279): (GCN)13 (hom) (OPMD)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"likely pathogenic"	""
"0000813676"	"3"	"70"	"14"	"24550639"	"24550639"	"subst"	"0"	"00000"	"NRL_000031"	"g.24550639G>T"	""	"{PMID:Xu 2020:31630094}"	""	"NRL NM_006177: g.33585C>A, c.520C>A, p.Q174K"	""	"Germline"	"yes"	""	"0"	""	""	"g.24081430G>T"	""	"likely pathogenic"	"ACMG"
"0000816664"	"0"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:Jauregui 2020:32098976}"	""	"NRL c.149C>T, p.S50L"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000820448"	"1"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"NRL, variant 1: c.152C>T/p.P51L"	"solved, heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000820542"	"1"	"70"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"NRL, variant 1: c.91C>T/p.R31*, variant 2: c.223dup/p.L75Pfs*19"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082758G>A"	""	"likely pathogenic"	""
"0000820965"	"1"	"70"	"14"	"24551835"	"24551835"	"dup"	"0"	"00000"	"NRL_000027"	"g.24551835dup"	""	"{PMID:Weisschuh 2020:32531858}"	""	"NRL, variant 1: c.91C>T/p.R31*, variant 2: c.223dup/p.L75Pfs*19"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082626dup"	""	"likely pathogenic"	""
"0000822096"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Booij-2011:20801516}"	""	"c.152C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000823258"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000032"	"g.24551906G>C"	""	"{PMID:Hull 2020:32856788}"	""	"NRL nucleotide 1, protein 1:c.152C>G, p.Pro51Arg nucleotide 2, protein 2:-,"	"heterozygous, ACMG classified, novel (Table 2)"	"Germline"	"?"	""	"0"	""	""	"g.24082697G>C"	""	"likely pathogenic"	"ACMG"
"0000824705"	"0"	"50"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:Ma 2021:33691693}"	""	"NRL c.C149T, p.S50L"	"marked as causative, heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082700G>A"	""	"VUS"	"ACMG"
"0000845540"	"0"	"70"	"14"	"24551771"	"24551771"	"subst"	"4.08413E-6"	"00000"	"NRL_000030"	"g.24551771A>G"	"Novel"	"{PMID:Borràs 2013:23534816}"	""	"c.287T>C"	"incomplete penetrance"	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000845554"	"0"	"30"	"14"	"24551831"	"24551831"	"subst"	"0.000119365"	"00000"	"NRL_000033"	"g.24551831G>A"	"0.008"	"{PMID:Borràs 2013:23534816}"	""	"p.A76V"	"not present in one RP affected member and present in an unaffected member of this family"	"Germline"	""	""	"0"	""	""	""	""	"likely benign"	""
"0000853817"	"0"	"30"	"14"	"24550760"	"24550760"	"subst"	"0.000838637"	"02330"	"NRL_000006"	"g.24550760G>A"	""	""	""	"NRL(NM_006177.4):c.399C>T (p.S133=), NRL(NM_006177.5):c.399C>T (p.S133=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000863540"	"0"	"70"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"01804"	"NRL_000002"	"g.24550505del"	""	""	""	"NRL(NM_006177.3):c.654delC (p.(Cys219Valfs*4)), NRL(NM_006177.4):c.654delC (p.C219Vfs*4), NRL(NM_006177.5):c.654delC (p.C219Vfs*4)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000863541"	"0"	"50"	"14"	"24551831"	"24551831"	"subst"	"0.000119365"	"02327"	"NRL_000033"	"g.24551831G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000863542"	"0"	"30"	"14"	"24569346"	"24569346"	"subst"	"0"	"01943"	"DCAF11_000023"	"g.24569346G>A"	""	""	""	"PCK2(NM_001308054.1):c.756G>A (p.V252=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000868249"	"11"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868250"	"11"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868251"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868252"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868253"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868254"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868255"	"11"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 1999:10192380}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868256"	"20"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 2000:11039579}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868257"	"10"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 2000:11039579}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868258"	"10"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 2000:11039579}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868259"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 2000:11039579}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868260"	"20"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Bessant 2000:11039579}"	""	"NRL c.148T>A, p.(Ser50Thr)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic (dominant)"	""
"0000868261"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"NRL 2316C>T, Pro51Leu"	"obsolete nucleotide annotation 2316C>T; extrapolated from sequence; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000868262"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"NRL 2316C>T, Pro51Leu"	"obsolete nucleotide annotation 2316C>T; extrapolated from sequence; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000868263"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"NRL 2316C>T, Pro51Leu"	"obsolete nucleotide annotation 2316C>T; extrapolated from sequence; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000868264"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"NRL 2316C>T, Pro51Leu"	"obsolete nucleotide annotation 2316C>T; extrapolated from sequence; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000868265"	"0"	"70"	"14"	"24551693"	"24551693"	"subst"	"4.12698E-6"	"00000"	"DCAF11_000013"	"g.24551693C>T"	""	"{PMID:Martinez-Gimeno 2001:11385710}"	""	"NRL 2529G>A, Gly122Glu"	"obsolete nucleotide annotation 2529G>A; extrapolated from sequence; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082484C>T"	""	"likely pathogenic"	""
"0000868268"	"0"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000019"	"g.24551910A>G"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> CCA, Ser50Pro"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>G"	""	"likely pathogenic"	""
"0000868269"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000019"	"g.24551910A>G"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> CCA, Ser50Pro"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>G"	""	"likely pathogenic"	""
"0000868270"	"21"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000019"	"g.24551910A>G"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> CCA, Ser50Pro"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701A>G"	""	"likely pathogenic"	""
"0000868271"	"0"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868272"	"21"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868273"	"21"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868274"	"11"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868275"	"11"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868276"	"10"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868277"	"11"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL TCA -> TTA Ser50Leu"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868278"	"0"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000041"	"g.24551907G>T"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL CCC -> ACC, Pro51Thr"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082698G>T"	""	"likely pathogenic"	""
"0000868279"	"21"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000041"	"g.24551907G>T"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL CCC -> ACC, Pro51Thr"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082698G>T"	""	"likely pathogenic"	""
"0000868280"	"11"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000041"	"g.24551907G>T"	""	"{PMID:DeAngelis 2002:11879142}"	""	"NRL CCC -> ACC, Pro51Thr"	"no nucleotide annotation, extrapolated from protein; heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082698G>T"	""	"likely pathogenic"	""
"0000868283"	"0"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000017"	"g.24551907G>A"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 151C>T, P51S"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082698G>A"	""	"likely pathogenic"	""
"0000868284"	"0"	"70"	"14"	"24551833"	"24551834"	"ins"	"0"	"00000"	"NRL_000039"	"g.24551833_24551834insG"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 224_225insC, L75fs"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082624_24082625insG"	""	"likely pathogenic"	""
"0000868285"	"0"	"70"	"14"	"24550680"	"24550680"	"subst"	"0"	"00000"	"NRL_000020"	"g.24550680A>G"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 479T>C, L160P"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081471A>G"	""	"likely pathogenic"	""
"0000868286"	"0"	"50"	"14"	"24551871"	"24551871"	"subst"	"0.000110132"	"00000"	"NRL_000040"	"g.24551871C>T"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 187G>A, E63K"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24082662C>T"	""	"VUS"	""
"0000868287"	"0"	"50"	"14"	"24551831"	"24551831"	"subst"	"0.000119365"	"00000"	"NRL_000033"	"g.24551831G>A"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 227C>T, A76V"	"single heterozygous variant in a recessive disease"	"Unknown"	"?"	""	"0"	""	""	"g.24082622G>A"	""	"VUS"	""
"0000868288"	"0"	"50"	"14"	"24550689"	"24550707"	"dup"	"0"	"00000"	"NRL_000037"	"g.24550689_24550707dup"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 459_477dup, L160fs"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24081480_24081498dup"	""	"VUS"	""
"0000868289"	"0"	"50"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00000"	"NRL_000002"	"g.24550505del"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 654delC, R218fs"	"first affected amino acid rule shifts it to p.C219Vfs*4; an unaffected sibling was found to share the same two NRL alleles as the patient so probably non-causative; heterozygous"	"Germline"	"no"	""	"0"	""	""	"g.24081296del"	""	"VUS"	""
"0000868290"	"0"	"50"	"14"	"24550485"	"24550485"	"subst"	"0"	"00000"	"NRL_000036"	"g.24550485C>T"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 674G>A, S225N"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.24081276C>T"	""	"VUS"	""
"0000868291"	"0"	"70"	"14"	"24551833"	"24551834"	"ins"	"0"	"00000"	"NRL_000039"	"g.24551833_24551834insG"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 224_225insC, L75fs"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082624_24082625insG"	""	"likely pathogenic"	""
"0000868292"	"0"	"70"	"14"	"24550680"	"24550680"	"subst"	"0"	"00000"	"NRL_000020"	"g.24550680A>G"	""	"{PMID:Nishiguchi 2004:12552256}"	""	"NRL 479T>C, L160P"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081471A>G"	""	"likely pathogenic"	""
"0000868294"	"0"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000034"	"g.24551910A>T"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.148T>A, p.S50T"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082701A>T"	""	"likely pathogenic"	""
"0000868295"	"0"	"70"	"14"	"24551910"	"24551910"	"subst"	"0"	"00000"	"NRL_000019"	"g.24551910A>G"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.148T>C, p.S50P"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082701A>G"	""	"likely pathogenic"	""
"0000868296"	"0"	"70"	"14"	"24551909"	"24551909"	"subst"	"0"	"00000"	"NRL_000015"	"g.24551909G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.149C>T, p.S50L"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082700G>A"	""	"likely pathogenic"	""
"0000868297"	"0"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000041"	"g.24551907G>T"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.151C>A, p.P51T"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082698G>T"	""	"likely pathogenic"	""
"0000868298"	"0"	"70"	"14"	"24551907"	"24551907"	"subst"	"0"	"00000"	"NRL_000017"	"g.24551907G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.151C>T, p.P51S"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082698G>A"	""	"likely pathogenic"	""
"0000868299"	"0"	"70"	"14"	"24551906"	"24551906"	"subst"	"0"	"00000"	"NRL_000014"	"g.24551906G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.152C>T, p.P51L"	"NRL isoforms: 1, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082697G>A"	""	"likely pathogenic"	""
"0000868300"	"0"	"50"	"14"	"24551871"	"24551871"	"subst"	"0.000110132"	"00000"	"NRL_000040"	"g.24551871C>T"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.187G>A, p.E63K"	"NRL isoforms: 5, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): down; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082662C>T"	""	"VUS"	""
"0000868301"	"0"	"30"	"14"	"24551859"	"24551859"	"subst"	"9.79504E-5"	"00000"	"NRL_000007"	"g.24551859G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.199C>T, p.P67S"	"NRL isoforms: 6, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): similar; effect: likely benign variation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082650G>A"	""	"likely benign"	""
"0000868302"	"0"	"70"	"14"	"24551833"	"24551834"	"ins"	"0"	"00000"	"NRL_000039"	"g.24551833_24551834insG"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.224_225insC, p.L75fs"	"NRL isoforms: not detected, localisation: nuclear, cytoplasmic; binding to NRE: no data; luciferase assay (Rho promoter and CRX): No data; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082624_24082625insG"	""	"likely pathogenic"	""
"0000868303"	"0"	"50"	"14"	"24551831"	"24551831"	"subst"	"0.000119365"	"00000"	"NRL_000033"	"g.24551831G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.227C>T, p.A76V"	"NRL isoforms: 6, localisation: nuclear; binding to NRE: weak; luciferase assay (Rho promoter and CRX): similar; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082622G>A"	""	"VUS"	""
"0000868304"	"0"	"50"	"14"	"24551693"	"24551693"	"subst"	"4.12698E-6"	"00000"	"DCAF11_000013"	"g.24551693C>T"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.365G>A, p.G122E"	"NRL isoforms: 5, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): similar; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082484C>T"	""	"VUS"	""
"0000868305"	"0"	"50"	"14"	"24551683"	"24551683"	"subst"	"0.000310038"	"00000"	"NRL_000038"	"g.24551683G>C"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.375C>G, p.H125Q"	"NRL isoforms: 6, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): up; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24082474G>C"	""	"VUS"	""
"0000868306"	"0"	"50"	"14"	"24550689"	"24550707"	"dup"	"0"	"00000"	"NRL_000037"	"g.24550689_24550707dup"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.459_477dup, p.L160fs"	"NRL isoforms: 5, localisation: nuclear; binding to NRE: no; luciferase assay (Rho promoter and CRX): down; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24081480_24081498dup"	""	"VUS"	""
"0000868307"	"0"	"70"	"14"	"24550680"	"24550680"	"subst"	"0"	"00000"	"NRL_000020"	"g.24550680A>G"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.479T>C, p.L160P"	"NRL isoforms: 5, localisation: nuclear; binding to NRE: no; luciferase assay (Rho promoter and CRX): down; effect: likely pathogenic mutation"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24081471A>G"	""	"likely pathogenic"	""
"0000868308"	"0"	"50"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00000"	"NRL_000002"	"g.24550505del"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.654delC, p.R218fs"	"NRL isoforms: 4, localisation: nuclear; binding to NRE: no; luciferase assay (Rho promoter and CRX): down; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24081296del"	""	"VUS"	""
"0000868309"	"0"	"50"	"14"	"24550485"	"24550485"	"subst"	"0"	"00000"	"NRL_000036"	"g.24550485C>T"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.674G>A, p.S225N"	"NRL isoforms: 6, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): down; effect: VUS"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24081276C>T"	""	"VUS"	""
"0000868310"	"0"	"30"	"14"	"24550456"	"24550456"	"subst"	"0.000277194"	"00000"	"NRL_000035"	"g.24550456G>A"	""	"{PMID:Kanda 2007:17335001}"	""	"NRL c.703C>T, p.L235F"	"NRL isoforms: 6, localisation: nuclear; binding to NRE: yes; luciferase assay (Rho promoter and CRX): down; effect: likely benign variation+"	"In vitro (cloned)"	"?"	""	"0"	""	""	"g.24081247G>A"	""	"likely benign"	""
"0000868311"	"0"	"90"	"14"	"24551771"	"24551771"	"subst"	"4.08413E-6"	"00000"	"NRL_000030"	"g.24551771A>G"	""	"{PMID:Hernan 2011:21981118}"	""	"NRL c.287T>C, p.M96T"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082562A>G"	""	"pathogenic"	""
"0000868312"	"0"	"90"	"14"	"24551771"	"24551771"	"subst"	"4.08413E-6"	"00000"	"NRL_000030"	"g.24551771A>G"	""	"{PMID:Hernan 2011:21981118}"	""	"NRL c.287T>C, p.M96T"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082562A>G"	""	"pathogenic"	""
"0000868313"	"21"	"90"	"14"	"24551771"	"24551771"	"subst"	"4.08413E-6"	"00000"	"NRL_000030"	"g.24551771A>G"	""	"{PMID:Hernan 2011:21981118}"	""	"NRL c.287T>C, p.M96T"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082562A>G"	""	"pathogenic"	""
"0000868315"	"10"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868316"	"10"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868317"	"11"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868318"	"11"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868319"	"11"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868320"	"11"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868321"	"21"	"90"	"14"	"24551912"	"24551912"	"subst"	"0"	"00000"	"NRL_000043"	"g.24551912G>A"	""	"{PMID:Gao 2016:27081294}"	""	"NRL c.146 C>T, p.P49L"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082703G>A"	""	"pathogenic"	""
"0000868323"	"21"	"90"	"14"	"24551910"	"24551912"	"del"	"0"	"00000"	"NRL_000042"	"g.24551910_24551912del"	""	"{PMID:Qin 2017:28106895}"	""	"NRL c.147_149del, p.Ser50del"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701_24082703del"	""	"pathogenic"	""
"0000868324"	"10"	"90"	"14"	"24551910"	"24551912"	"del"	"0"	"00000"	"NRL_000042"	"g.24551910_24551912del"	""	"{PMID:Qin 2017:28106895}"	""	"NRL c.147_149del, p.Ser50del"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082701_24082703del"	""	"pathogenic"	""
"0000868332"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868334"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868336"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868338"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868340"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868342"	"11"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868344"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868346"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868348"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868350"	"3"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868352"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868354"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868356"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868358"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868360"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868362"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868364"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868366"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868368"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868370"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868372"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868374"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868376"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868378"	"0"	"90"	"14"	"24551967"	"24551967"	"subst"	"8.12922E-6"	"00000"	"NRL_000011"	"g.24551967G>A"	""	"{PMID:Braverman 2017:28590779}"	""	"NRL p.R31X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24082758G>A"	""	"pathogenic"	""
"0000868385"	"0"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"00000"	"NRL_000001"	"g.24550651G>T"	""	"{PMID:Littink 2018:29385733}"	""	"NRL c.508C>A, p.Arg170Ser"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081442G>T"	""	"likely pathogenic"	""
"0000868386"	"0"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"00000"	"NRL_000001"	"g.24550651G>T"	""	"{PMID:Littink 2018:29385733}"	""	"NRL c.508C>A, p.Arg170Ser"	"compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081442G>T"	""	"likely pathogenic"	""
"0000868387"	"0"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"00000"	"NRL_000001"	"g.24550651G>T"	""	"{PMID:Littink 2018:29385733}"	""	"NRL c.508C>A, p.Arg170Ser"	"compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081442G>T"	""	"likely pathogenic"	""
"0000868388"	"0"	"70"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00000"	"NRL_000002"	"g.24550505del"	""	"{PMID:Littink 2018:29385733}"	""	"NRL c.654del, p.Cys219Valfs*4"	"compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081296del"	""	"likely pathogenic"	""
"0000868389"	"0"	"70"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"00000"	"NRL_000002"	"g.24550505del"	""	"{PMID:Littink 2018:29385733}"	""	"NRL c.654del, p.Cys219Valfs*4"	"compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.24081296del"	""	"likely pathogenic"	""
"0000891758"	"0"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"02327"	"NRL_000001"	"g.24550651G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000891759"	"0"	"50"	"14"	"24551861"	"24551861"	"subst"	"1.22478E-5"	"02330"	"DCAF11_000024"	"g.24551861C>T"	""	""	""	"NRL(NM_006177.5):c.197G>A (p.R66Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000891760"	"0"	"50"	"14"	"24572751"	"24572751"	"subst"	"8.14363E-5"	"02325"	"DCAF11_000025"	"g.24572751C>T"	""	""	""	"PCK2(NM_004563.4):c.1501C>T (p.R501W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000891761"	"0"	"50"	"14"	"24572857"	"24572857"	"subst"	"6.50052E-5"	"02325"	"DCAF11_000026"	"g.24572857G>A"	""	""	""	"PCK2(NM_004563.4):c.1607G>A (p.R536Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000914176"	"0"	"90"	"14"	"24551910"	"24551910"	"subst"	"0"	"02327"	"NRL_000019"	"g.24551910A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000916302"	"3"	"90"	"14"	"24551954"	"24551954"	"dup"	"0"	"04436"	"NRL_000009"	"g.24551954dup"	""	"{PMID:Panneman 2023:36819107}"	""	"c.104dup"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000916418"	"1"	"70"	"14"	"24550651"	"24550651"	"subst"	"0"	"04436"	"NRL_000001"	"g.24550651G>T"	""	"{PMID:Panneman 2023:36819107}"	""	"c.508C>A"	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000916419"	"2"	"90"	"14"	"24550505"	"24550505"	"del"	"0.000124515"	"04436"	"NRL_000002"	"g.24550505del"	""	"{PMID:Panneman 2023:36819107}"	""	"c.654del"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000916633"	"3"	"70"	"14"	"24552086"	"24552086"	"subst"	"1.28648E-5"	"04436"	"NRL_000044"	"g.24552086T>C"	""	"{PMID:Panneman 2023:36819107}"	""	"c.-27-2A>G"	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000930298"	"0"	"50"	"14"	"24567800"	"24567800"	"subst"	"8.53603E-5"	"02327"	"DCAF11_000018"	"g.24567800C>T"	""	""	""	"PCK2(NM_004563.4):c.577C>T (p.(Arg193Ter), p.R193*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000958952"	"0"	"50"	"14"	"24550734"	"24550734"	"subst"	"0"	"00006"	"NRL_000045"	"g.24550734A>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PP2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.24081525A>T"	""	"VUS"	"ACMG"
"0000967477"	"0"	"50"	"14"	"24569423"	"24569423"	"subst"	"0.00103317"	"01943"	"DCAF11_000027"	"g.24569423G>T"	""	""	""	"PCK2(NM_001018073.2):c.1235G>T (p.G412V), PCK2(NM_004563.3):c.1234+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000980860"	"0"	"50"	"14"	"24567800"	"24567800"	"subst"	"8.53603E-5"	"01804"	"DCAF11_000018"	"g.24567800C>T"	""	""	""	"PCK2(NM_004563.4):c.577C>T (p.(Arg193Ter), p.R193*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000980861"	"0"	"50"	"14"	"24567884"	"24567884"	"subst"	"0"	"01804"	"DCAF11_000028"	"g.24567884C>T"	""	""	""	"PCK2(NM_004563.4):c.661C>T (p.(Gln221Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001000943"	"0"	"90"	"14"	"24551907"	"24551907"	"subst"	"0"	"02327"	"NRL_000017"	"g.24551907G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001039929"	"0"	"50"	"14"	"24552017"	"24552017"	"subst"	"4.0658E-6"	"01804"	"DCAF11_000029"	"g.24552017T>G"	""	""	""	"NRL(NM_001354768.3):c.41A>C (p.(Asn14Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes NRL
## Count = 210
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000060121"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	"3"
"0000060122"	"00014819"	"70"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219Valfs*4)"	"3"
"0000170925"	"00014819"	"70"	"339"	"0"	"339"	"0"	"c.339C>G"	"r.(?)"	"p.(Tyr113*)"	"2"
"0000248876"	"00014819"	"10"	"-13797"	"0"	"-13797"	"0"	"c.-13797T>G"	"r.(?)"	"p.(=)"	""
"0000293255"	"00014819"	"30"	"199"	"0"	"199"	"0"	"c.199C>T"	"r.(?)"	"p.(Pro67Ser)"	""
"0000293256"	"00014819"	"10"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Arg147=)"	""
"0000293257"	"00014819"	"90"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000293258"	"00014819"	"10"	"711"	"0"	"711"	"0"	"c.711C>G"	"r.(?)"	"p.(Leu237=)"	""
"0000304558"	"00014819"	"30"	"399"	"0"	"399"	"0"	"c.399C>T"	"r.(?)"	"p.(Ser133=)"	""
"0000304559"	"00014819"	"30"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Arg147=)"	""
"0000304560"	"00014819"	"90"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000323620"	"00014819"	"50"	"-14661"	"0"	"-14661"	"0"	"c.-14661A>C"	"r.(?)"	"p.(=)"	""
"0000344315"	"00014819"	"90"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000348488"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>A"	"r.(?)"	"p.(Pro51His)"	""
"0000358301"	"00014819"	"90"	"452"	"0"	"459"	"0"	"c.452_459dup"	"r.(?)"	"p.(Arg154Alafs*10)"	"3"
"0000358302"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	"2"
"0000477045"	"00014819"	"50"	"652"	"0"	"652"	"0"	"c.652C>T"	"r.(?)"	"p.(Arg218Cys)"	""
"0000477046"	"00014819"	"50"	"371"	"0"	"371"	"0"	"c.371A>C"	"r.(?)"	"p.(Gln124Pro)"	""
"0000477047"	"00014819"	"90"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	""
"0000477048"	"00014819"	"90"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	""
"0000477049"	"00014819"	"50"	"73"	"0"	"73"	"0"	"c.73C>T"	"r.(?)"	"p.(Arg25Trp)"	""
"0000477582"	"00014819"	"50"	"73"	"0"	"73"	"0"	"c.73C>T"	"r.(?)"	"p.(Arg25Trp)"	""
"0000552424"	"00014819"	"50"	"4574"	"0"	"4574"	"0"	"c.*3860G>A"	"r.(=)"	"p.(=)"	""
"0000552425"	"00014819"	"10"	"711"	"0"	"711"	"0"	"c.711C>G"	"r.(?)"	"p.(Leu237=)"	""
"0000552426"	"00014819"	"50"	"293"	"0"	"293"	"0"	"c.293T>C"	"r.(?)"	"p.(Leu98Pro)"	""
"0000552430"	"00014819"	"10"	"-19290"	"0"	"-19290"	"0"	"c.-19290C>T"	"r.(?)"	"p.(=)"	""
"0000614936"	"00014819"	"50"	"605"	"0"	"605"	"0"	"c.605G>A"	"r.(?)"	"p.(Arg202Gln)"	""
"0000648873"	"00014819"	"90"	"151"	"0"	"151"	"0"	"c.151C>T"	"r.(?)"	"p.(Pro51Ser)"	""
"0000657424"	"00014819"	"30"	"-13803"	"0"	"-13803"	"0"	"c.-13803G>A"	"r.(?)"	"p.(=)"	""
"0000657425"	"00014819"	"50"	"-19222"	"0"	"-19222"	"0"	"c.-19222A>G"	"r.(?)"	"p.(=)"	""
"0000657426"	"00014819"	"30"	"-19344"	"0"	"-19344"	"0"	"c.-19344G>A"	"r.(?)"	"p.(=)"	""
"0000679963"	"00014819"	"70"	"452"	"0"	"459"	"0"	"c.452_459dup"	"r.(?)"	"p.(Arg154AlafsTer10)"	""
"0000684543"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	""
"0000685314"	"00014819"	"90"	"444"	"0"	"445"	"0"	"c.444_445insGCTGCGGG"	"r.(?)"	"p.(Leu149Alafs*15)"	""
"0000685315"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000685316"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000691646"	"00014819"	"50"	"613"	"0"	"613"	"0"	"c.613G>A"	"r.(?)"	"p.(Val205Met)"	""
"0000703790"	"00014819"	"50"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"0"
"0000710222"	"00014819"	"90"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	""
"0000711688"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"0"
"0000711692"	"00014819"	"10"	"199"	"0"	"199"	"0"	"c.199C>T"	"r.(?)"	"p.(Pro67Ser)"	"0"
"0000714064"	"00014819"	"70"	"479"	"0"	"479"	"0"	"c.479T>C"	"r.(?)"	"p.(Leu160Pro)"	""
"0000724736"	"00014819"	"50"	"684"	"0"	"694"	"0"	"c.684_694del"	"r.(?)"	"p.(Ser229Leufs*15)"	""
"0000724737"	"00014819"	"50"	"365"	"0"	"365"	"0"	"c.365G>A"	"r.(?)"	"p.(Gly122Glu)"	""
"0000724738"	"00014819"	"30"	"315"	"0"	"315"	"0"	"c.315C>T"	"r.(?)"	"p.(Val105=)"	""
"0000724739"	"00014819"	"50"	"197"	"0"	"197"	"0"	"c.197G>T"	"r.(?)"	"p.(Arg66Leu)"	""
"0000724740"	"00014819"	"50"	"-13892"	"0"	"-13891"	"0"	"c.-13892_-13891insGAAACCTCT"	"r.(?)"	"p.(=)"	""
"0000724741"	"00014819"	"90"	"-13895"	"0"	"-13894"	"0"	"c.-13895_-13894insTCTCATCCACAGC"	"r.(?)"	"p.(=)"	""
"0000724742"	"00014819"	"50"	"-14099"	"0"	"-14099"	"0"	"c.-14099G>A"	"r.(?)"	"p.(=)"	""
"0000724743"	"00014819"	"30"	"-15642"	"0"	"-15642"	"0"	"c.-15642G>A"	"r.(?)"	"p.(=)"	""
"0000724744"	"00014819"	"50"	"-19110"	"0"	"-19110"	"0"	"c.-19110G>A"	"r.(?)"	"p.(=)"	""
"0000731160"	"00014819"	"90"	"416"	"0"	"416"	"0"	"c.416C>G"	"r.(?)"	"p.(Ser139Trp)"	""
"0000731180"	"00014819"	"90"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219Valfs*4)"	""
"0000735634"	"00014819"	"90"	"104"	"0"	"104"	"0"	"c.104dup"	"r.(?)"	"p.(Thr36Tyrfs*20)"	""
"0000735749"	"00014819"	"90"	"104"	"0"	"104"	"0"	"c.104dup"	"r.(?)"	"p.(Thr36Tyrfs*20)"	""
"0000736410"	"00014819"	"10"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(=)"	"0"
"0000736411"	"00014819"	"10"	"521"	"0"	"521"	"0"	"c.521A>G"	"r.(?)"	"p.(Gln174Arg)"	"0"
"0000736841"	"00014819"	"50"	"366"	"0"	"368"	"0"	"c.366_368del"	"r.(?)"	"p.(Ala123del)"	""
"0000759591"	"00014819"	"90"	"16"	"0"	"16"	"0"	"c.16del"	"r.(?)"	"p.(Ser6Alafs*13)"	""
"0000759592"	"00014819"	"90"	"386"	"0"	"386"	"0"	"c.386del"	"r.(?)"	"p.(Ala129Glufs*17)"	""
"0000759618"	"00014819"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0000759619"	"00014819"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0000760269"	"00014819"	"50"	"586"	"0"	"627"	"0"	"c.586_627dup"	"r.(?)"	"p.(Ala196_Ala209dup)"	""
"0000786402"	"00014819"	"90"	"223"	"0"	"223"	"0"	"c.223dup"	"r.(?)"	"p.(Leu75ProfsTer19)"	""
"0000786473"	"00014819"	"90"	"223"	"0"	"223"	"0"	"c.223dup"	"r.(?)"	"p.(Leu75ProfsTer19)"	""
"0000788105"	"00014819"	"90"	"23"	"0"	"23"	"0"	"c.23del"	"r.(?)"	"p.(Leu8ArgfsTer11)"	""
"0000790688"	"00014819"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0000791168"	"00014819"	"90"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000791169"	"00014819"	"90"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000791170"	"00014819"	"90"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000791228"	"00014819"	"50"	"242"	"0"	"244"	"0"	"c.242_244del"	"r.(?)"	"p.(Gln81del)"	"3"
"0000791441"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"2"
"0000791442"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"2"
"0000791443"	"00014819"	"70"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Met96Thr)"	"2"
"0000793730"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	"0"
"0000806378"	"00014819"	"90"	"687"	"0"	"687"	"0"	"c.687del"	"r.(?)"	"p.(Asp231Thrfs*87)"	""
"0000806379"	"00014819"	"50"	"74"	"0"	"74"	"0"	"c.74G>A"	"r.(?)"	"p.(Arg25Gln)"	""
"0000806380"	"00014819"	"30"	"-19009"	"0"	"-19009"	"0"	"c.-19009dup"	"r.(?)"	"p.(=)"	""
"0000811436"	"00014819"	"70"	"339"	"0"	"339"	"0"	"c.339C>G"	"r.(?)"	"p.(Tyr113*)"	""
"0000811437"	"00014819"	"70"	"339"	"0"	"339"	"0"	"c.339C>G"	"r.(?)"	"p.(Tyr113*)"	""
"0000813021"	"00014819"	"70"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000813022"	"00014819"	"70"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000813676"	"00014819"	"70"	"520"	"0"	"520"	"0"	"c.520C>A"	"r.(?)"	"p.(Gln174Lys)"	""
"0000816664"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	""
"0000820448"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	""
"0000820542"	"00014819"	"70"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000820965"	"00014819"	"70"	"223"	"0"	"223"	"0"	"c.223dup"	"r.(?)"	"p.(Leu75Profs*19)"	""
"0000822096"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"0"
"0000823258"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>G"	"r.(?)"	"p.(Pro51Arg)"	""
"0000824705"	"00014819"	"50"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	""
"0000845540"	"00014819"	"70"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Met96Thr)"	"0"
"0000845554"	"00014819"	"30"	"227"	"0"	"227"	"0"	"c.227C>T"	"r.(?)"	"p.(Ala76Val)"	"0"
"0000853817"	"00014819"	"30"	"399"	"0"	"399"	"0"	"c.399C>T"	"r.(?)"	"p.(Ser133=)"	""
"0000863540"	"00014819"	"70"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000863541"	"00014819"	"50"	"227"	"0"	"227"	"0"	"c.227C>T"	"r.(?)"	"p.(Ala76Val)"	""
"0000863542"	"00014819"	"30"	"-15645"	"0"	"-15645"	"0"	"c.-15645C>T"	"r.(?)"	"p.(=)"	""
"0000868249"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868250"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868251"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868252"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868253"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868254"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868255"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868256"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868257"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868258"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868259"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868260"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868261"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"3"
"0000868262"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"3"
"0000868263"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"3"
"0000868264"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	"3"
"0000868265"	"00014819"	"70"	"365"	"0"	"365"	"0"	"c.365G>A"	"r.(?)"	"p.(Gly122Glu)"	"3"
"0000868268"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	"3"
"0000868269"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	"3"
"0000868270"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	"3"
"0000868271"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868272"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868273"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868274"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868275"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868276"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868277"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	"3"
"0000868278"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>A"	"r.(?)"	"p.(Pro51Thr)"	"3"
"0000868279"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>A"	"r.(?)"	"p.(Pro51Thr)"	"3"
"0000868280"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>A"	"r.(?)"	"p.(Pro51Thr)"	"3"
"0000868283"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>T"	"r.(?)"	"p.(Pro51Ser)"	""
"0000868284"	"00014819"	"70"	"224"	"0"	"225"	"0"	"c.224_225insC"	"r.(?)"	"p.(Ala76GlyfsTer18)"	""
"0000868285"	"00014819"	"70"	"479"	"0"	"479"	"0"	"c.479T>C"	"r.(?)"	"p.(Leu160Pro)"	""
"0000868286"	"00014819"	"50"	"187"	"0"	"187"	"0"	"c.187G>A"	"r.(?)"	"p.(Glu63Lys)"	""
"0000868287"	"00014819"	"50"	"227"	"0"	"227"	"0"	"c.227C>T"	"r.(?)"	"p.(Ala76Val)"	""
"0000868288"	"00014819"	"50"	"459"	"0"	"477"	"0"	"c.459_477dup"	"r.(?)"	"p.(Leu160AlafsTer67)"	""
"0000868289"	"00014819"	"50"	"654"	"0"	"654"	"0"	"c.654delC"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000868290"	"00014819"	"50"	"674"	"0"	"674"	"0"	"c.674G>A"	"r.(?)"	"p.(Ser225Asn)"	""
"0000868291"	"00014819"	"70"	"224"	"0"	"225"	"0"	"c.224_225insC"	"r.(?)"	"p.(Ala76GlyfsTer18)"	""
"0000868292"	"00014819"	"70"	"479"	"0"	"479"	"0"	"c.479T>C"	"r.(?)"	"p.(Leu160Pro)"	""
"0000868294"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>A"	"r.(?)"	"p.(Ser50Thr)"	""
"0000868295"	"00014819"	"70"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	""
"0000868296"	"00014819"	"70"	"149"	"0"	"149"	"0"	"c.149C>T"	"r.(?)"	"p.(Ser50Leu)"	""
"0000868297"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>A"	"r.(?)"	"p.(Pro51Thr)"	""
"0000868298"	"00014819"	"70"	"151"	"0"	"151"	"0"	"c.151C>T"	"r.(?)"	"p.(Pro51Ser)"	""
"0000868299"	"00014819"	"70"	"152"	"0"	"152"	"0"	"c.152C>T"	"r.(?)"	"p.(Pro51Leu)"	""
"0000868300"	"00014819"	"50"	"187"	"0"	"187"	"0"	"c.187G>A"	"r.(?)"	"p.(Glu63Lys)"	""
"0000868301"	"00014819"	"30"	"199"	"0"	"199"	"0"	"c.199C>T"	"r.(?)"	"p.(Pro67Ser)"	""
"0000868302"	"00014819"	"70"	"224"	"0"	"225"	"0"	"c.224_225insC"	"r.(?)"	"p.(Ala76GlyfsTer18)"	""
"0000868303"	"00014819"	"50"	"227"	"0"	"227"	"0"	"c.227C>T"	"r.(?)"	"p.(Ala76Val)"	""
"0000868304"	"00014819"	"50"	"365"	"0"	"365"	"0"	"c.365G>A"	"r.(?)"	"p.(Gly122Glu)"	""
"0000868305"	"00014819"	"50"	"375"	"0"	"375"	"0"	"c.375C>G"	"r.(?)"	"p.(His125Gln)"	""
"0000868306"	"00014819"	"50"	"459"	"0"	"477"	"0"	"c.459_477dup"	"r.(?)"	"p.(Leu160AlafsTer67)"	""
"0000868307"	"00014819"	"70"	"479"	"0"	"479"	"0"	"c.479T>C"	"r.(?)"	"p.(Leu160Pro)"	""
"0000868308"	"00014819"	"50"	"654"	"0"	"654"	"0"	"c.654delC"	"r.(?)"	"p.(Cys219ValfsTer4)"	""
"0000868309"	"00014819"	"50"	"674"	"0"	"674"	"0"	"c.674G>A"	"r.(?)"	"p.(Ser225Asn)"	""
"0000868310"	"00014819"	"30"	"703"	"0"	"703"	"0"	"c.703C>T"	"r.(?)"	"p.(Leu235Phe)"	""
"0000868311"	"00014819"	"90"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Met96Thr)"	""
"0000868312"	"00014819"	"90"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Met96Thr)"	""
"0000868313"	"00014819"	"90"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Met96Thr)"	""
"0000868315"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868316"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868317"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868318"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868319"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868320"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868321"	"00014819"	"90"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Pro49Leu)"	"3"
"0000868323"	"00014819"	"90"	"147"	"0"	"149"	"0"	"c.147_149del"	"r.(?)"	"p.Ser50del"	"3"
"0000868324"	"00014819"	"90"	"147"	"0"	"149"	"0"	"c.147_149del"	"r.(?)"	"p.Ser50del"	"3"
"0000868332"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868334"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868336"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868338"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868340"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868342"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868344"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868346"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868348"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868350"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868352"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868354"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868356"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868358"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868360"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868362"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868364"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868366"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868368"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868370"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868372"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868374"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868376"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868378"	"00014819"	"90"	"91"	"0"	"91"	"0"	"c.91C>T"	"r.(?)"	"p.(Arg31*)"	""
"0000868385"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	""
"0000868386"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	""
"0000868387"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	""
"0000868388"	"00014819"	"70"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219Valfs*4)"	""
"0000868389"	"00014819"	"70"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219Valfs*4)"	""
"0000891758"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	""
"0000891759"	"00014819"	"50"	"197"	"0"	"197"	"0"	"c.197G>A"	"r.(?)"	"p.(Arg66Gln)"	""
"0000891760"	"00014819"	"50"	"-19050"	"0"	"-19050"	"0"	"c.-19050G>A"	"r.(?)"	"p.(=)"	""
"0000891761"	"00014819"	"50"	"-19156"	"0"	"-19156"	"0"	"c.-19156C>T"	"r.(?)"	"p.(=)"	""
"0000914176"	"00014819"	"90"	"148"	"0"	"148"	"0"	"c.148T>C"	"r.(?)"	"p.(Ser50Pro)"	""
"0000916302"	"00014819"	"90"	"104"	"0"	"104"	"0"	"c.104dup"	"r.(?)"	"p.(Thr36Tyrfs*20)"	"0"
"0000916418"	"00014819"	"70"	"508"	"0"	"508"	"0"	"c.508C>A"	"r.(?)"	"p.(Arg170Ser)"	"0"
"0000916419"	"00014819"	"90"	"654"	"0"	"654"	"0"	"c.654del"	"r.(?)"	"p.(Cys219Valfs*4)"	"0"
"0000916633"	"00014819"	"70"	"-27"	"-2"	"-27"	"-2"	"c.-27-2A>G"	"r.spl?"	"p.(?)"	"0"
"0000930298"	"00014819"	"50"	"-14099"	"0"	"-14099"	"0"	"c.-14099G>A"	"r.(?)"	"p.(=)"	""
"0000958952"	"00014819"	"50"	"425"	"0"	"425"	"0"	"c.425T>A"	"r.(?)"	"p.(Val142Glu)"	""
"0000967477"	"00014819"	"50"	"-15722"	"0"	"-15722"	"0"	"c.-15722C>A"	"r.(?)"	"p.(=)"	""
"0000980860"	"00014819"	"50"	"-14099"	"0"	"-14099"	"0"	"c.-14099G>A"	"r.(?)"	"p.(=)"	""
"0000980861"	"00014819"	"50"	"-14183"	"0"	"-14183"	"0"	"c.-14183G>A"	"r.(?)"	"p.(=)"	""
"0001000943"	"00014819"	"90"	"151"	"0"	"151"	"0"	"c.151C>T"	"r.(?)"	"p.(Pro51Ser)"	""
"0001039929"	"00014819"	"50"	"41"	"0"	"41"	"0"	"c.41A>C"	"r.(?)"	"p.(Asn14Thr)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 162
"{{screeningid}}"	"{{variantid}}"
"0000033229"	"0000060121"
"0000033229"	"0000060122"
"0000105491"	"0000170925"
"0000156379"	"0000358301"
"0000156380"	"0000358302"
"0000234337"	"0000477045"
"0000234338"	"0000477046"
"0000234339"	"0000477047"
"0000234340"	"0000477048"
"0000234341"	"0000477049"
"0000234874"	"0000477582"
"0000292184"	"0000648873"
"0000309670"	"0000684543"
"0000310403"	"0000685314"
"0000310404"	"0000685315"
"0000310405"	"0000685316"
"0000321017"	"0000703790"
"0000326630"	"0000710222"
"0000327895"	"0000711688"
"0000327899"	"0000711692"
"0000329707"	"0000714064"
"0000333506"	"0000731160"
"0000333506"	"0000731180"
"0000336359"	"0000735634"
"0000336359"	"0000735749"
"0000336872"	"0000736410"
"0000336873"	"0000736411"
"0000337211"	"0000736841"
"0000359960"	"0000759591"
"0000359960"	"0000759618"
"0000359961"	"0000759592"
"0000359961"	"0000759619"
"0000360377"	"0000760269"
"0000375107"	"0000786402"
"0000375107"	"0000786473"
"0000376497"	"0000788105"
"0000378028"	"0000790688"
"0000378413"	"0000791168"
"0000378414"	"0000791169"
"0000378415"	"0000791170"
"0000378473"	"0000791228"
"0000378592"	"0000791441"
"0000378593"	"0000791442"
"0000378594"	"0000791443"
"0000380585"	"0000793730"
"0000384675"	"0000811436"
"0000384676"	"0000811437"
"0000385864"	"0000813021"
"0000385865"	"0000813022"
"0000386269"	"0000813676"
"0000388205"	"0000816664"
"0000391103"	"0000820448"
"0000391197"	"0000820542"
"0000391197"	"0000820965"
"0000392012"	"0000822096"
"0000392823"	"0000823258"
"0000393883"	"0000824705"
"0000408605"	"0000845540"
"0000408607"	"0000845554"
"0000411210"	"0000868249"
"0000411211"	"0000868250"
"0000411212"	"0000868251"
"0000411213"	"0000868252"
"0000411214"	"0000868253"
"0000411215"	"0000868254"
"0000411216"	"0000868255"
"0000411217"	"0000868256"
"0000411218"	"0000868257"
"0000411219"	"0000868258"
"0000411220"	"0000868259"
"0000411221"	"0000868260"
"0000411222"	"0000868261"
"0000411223"	"0000868262"
"0000411224"	"0000868263"
"0000411225"	"0000868264"
"0000411226"	"0000868265"
"0000411228"	"0000868268"
"0000411229"	"0000868269"
"0000411230"	"0000868270"
"0000411231"	"0000868271"
"0000411232"	"0000868272"
"0000411233"	"0000868273"
"0000411234"	"0000868274"
"0000411235"	"0000868275"
"0000411236"	"0000868276"
"0000411237"	"0000868277"
"0000411238"	"0000868278"
"0000411239"	"0000868279"
"0000411240"	"0000868280"
"0000411243"	"0000868283"
"0000411244"	"0000868284"
"0000411244"	"0000868285"
"0000411245"	"0000868286"
"0000411246"	"0000868287"
"0000411247"	"0000868288"
"0000411248"	"0000868289"
"0000411249"	"0000868290"
"0000411250"	"0000868291"
"0000411250"	"0000868292"
"0000411252"	"0000868294"
"0000411253"	"0000868295"
"0000411254"	"0000868296"
"0000411255"	"0000868297"
"0000411256"	"0000868298"
"0000411257"	"0000868299"
"0000411258"	"0000868300"
"0000411259"	"0000868301"
"0000411260"	"0000868302"
"0000411261"	"0000868303"
"0000411262"	"0000868304"
"0000411263"	"0000868305"
"0000411264"	"0000868306"
"0000411265"	"0000868307"
"0000411266"	"0000868308"
"0000411267"	"0000868309"
"0000411268"	"0000868310"
"0000411270"	"0000868311"
"0000411271"	"0000868312"
"0000411272"	"0000868313"
"0000411274"	"0000868315"
"0000411275"	"0000868316"
"0000411276"	"0000868317"
"0000411277"	"0000868318"
"0000411278"	"0000868319"
"0000411279"	"0000868320"
"0000411280"	"0000868321"
"0000411282"	"0000868323"
"0000411283"	"0000868324"
"0000411288"	"0000868332"
"0000411289"	"0000868334"
"0000411290"	"0000868336"
"0000411291"	"0000868338"
"0000411292"	"0000868340"
"0000411293"	"0000868342"
"0000411294"	"0000868344"
"0000411295"	"0000868346"
"0000411296"	"0000868348"
"0000411297"	"0000868350"
"0000411298"	"0000868352"
"0000411299"	"0000868354"
"0000411300"	"0000868356"
"0000411301"	"0000868358"
"0000411302"	"0000868360"
"0000411303"	"0000868362"
"0000411304"	"0000868364"
"0000411305"	"0000868366"
"0000411306"	"0000868368"
"0000411307"	"0000868370"
"0000411308"	"0000868372"
"0000411309"	"0000868374"
"0000411310"	"0000868376"
"0000411311"	"0000868378"
"0000411317"	"0000868385"
"0000411318"	"0000868386"
"0000411318"	"0000868388"
"0000411319"	"0000868387"
"0000411319"	"0000868389"
"0000431248"	"0000916302"
"0000431325"	"0000916418"
"0000431325"	"0000916419"
"0000431462"	"0000916633"
"0000449185"	"0000958952"