### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PACS1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PACS1" "phosphofurin acidic cluster sorting protein 1" "11" "q13.1-q13.2" "unknown" "NG_033900.1" "UD_136019512180" "" "https://www.LOVD.nl/PACS1" "" "1" "30032" "55690" "607492" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/PACS1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-06-04 21:30:12" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00015587" "PACS1" "phosphofurin acidic cluster sorting protein 1" "001" "NM_018026.3" "" "NP_060496.2" "" "" "" "-134" "4359" "2892" "65837824" "66012218" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00851" "SHMS;MRD17" "Schuurs-Hoeijmakers syndrome (SHMS, mental retardation, autosomal dominant, type 17 (MRD-17))" "AD" "615009" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "PACS1" "00139" "PACS1" "00851" ## Individuals ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00050380" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050384" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050525" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050682" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00092244" "" "" "" "1" "" "00006" "{PMID:Tarailo-Graovac 2016:27276562}, {DOI:Tarailo-Graovac 2016:10.1056/NEJMoa1515792}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "" "00164662" "" "" "" "1" "" "00006" "{PMID:Schuurs-Hoeijmakers 2012:23159249}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Netherlands" "" "0" "" "" "" "23159249-Pat1" "00164663" "" "" "" "1" "" "00006" "{PMID:Schuurs-Hoeijmakers 2012:23159249}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Belgium" "" "0" "" "" "" "23159249-Pat2" "00303029" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat74" "00325388" "" "" "" "1" "" "00006" "{PMID:Hong 2020:33333793}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 9 "{{individualid}}" "{{diseaseid}}" "00050380" "00198" "00050384" "00198" "00050525" "00198" "00050682" "00198" "00092244" "00851" "00164662" "00139" "00164663" "00139" "00303029" "05521" "00325388" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00851, 05521 ## Count = 9 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000036992" "00198" "00050380" "00006" "Isolated (sporadic)" "" "global developmental delay, defect in the atrial septum, inguinal hernia, postnatal microcephaly, progressive microcephaly, slender tapering fingers, hypoplastic male genitalia, hypertelorism, shallow orbits, thin upper lip vermilion, long palpebral fissure, downslanted palpebral fissures, slender long bone, flared iliac wings" "" "" "" "" "" "" "" "" "" "" "" "" "0000036996" "00198" "00050384" "00006" "Isolated (sporadic)" "" "defect in the atrial septum, seizures, microcephaly, delayed speech and language development, cryptorchidism, global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "0000037137" "00198" "00050525" "00006" "Isolated (sporadic)" "" "global developmental delay, delayed speech and language development, low-set ears, anteverted nares, bulbous nose, flat forehead, 2-3 toe syndactyly, joint laxity, cortical dysplasia, abnormality of blood and blood-forming tissues" "" "" "" "" "" "" "" "" "" "" "" "" "0000037294" "00198" "00050682" "00006" "Isolated (sporadic)" "" "absence seizures, generalized tonic-clonic seizures, seizures, seizures, frontal upsweep of hair, abnormality of the orbital region, downslanted palpebral fissures, long palpebral fissure, thin upper lip vermilion, umbilical hernia, webbed neck, pectus excavatum" "" "" "" "" "" "" "" "" "" "" "" "" "0000070578" "00851" "00092244" "00006" "Familial, autosomal dominant" "" "severe IDD, microcephaly, facial dysmorphisms, myopia, bifid uvula and submucous cleft, dysplastic pulmonary, aortic valves, failure to thrive progressive ataxia and cerebellar atrophy; neurodegeneration progressive cerebellar atrophy" "" "" "" "" "" "" "" "" "" "" "" "" "0000129699" "00139" "00164662" "00006" "Familial, autosomal dominant" "" "see paper; ..., remarkable face" "" "" "" "" "" "" "" "" "" "SHMS" "" "" "0000129700" "00139" "00164663" "00006" "Familial, autosomal dominant" "" "see paper; ..., remarkable face" "" "" "" "" "" "" "" "" "" "SHMS" "" "" "0000230112" "05521" "00303029" "00006" "Isolated (sporadic)" "" "Unclassified epilepsy; age onset neonatal" "" "" "" "" "" "" "" "" "" "MRD17" "seizures" "" "0000243875" "00198" "00325388" "00006" "Isolated (sporadic)" "" "1d-onset seizures; focal seizures; walk with aids; 14y-cognition delay" "" "" "12y" "" "" "" "" "" "" "" "developmental epileptic encephalopathy, spinal tethered cord" "" ## Screenings ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000050325" "00050380" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050329" "00050384" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050470" "00050525" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050627" "00050682" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000092385" "00092244" "1" "00006" "00006" "2016-12-16 19:09:22" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000165528" "00164662" "1" "00006" "00006" "2018-06-04 21:36:34" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000165529" "00164663" "1" "00006" "00006" "2018-06-04 21:40:57" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304154" "00303029" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000326599" "00325388" "1" "00006" "00006" "2021-01-02 12:18:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 9 "{{screeningid}}" "{{geneid}}" "0000050325" "PACS1" "0000050329" "PACS1" "0000050470" "PACS1" "0000050627" "PACS1" "0000092385" "PACS1" "0000165528" "PACS1" "0000165529" "PACS1" "0000304154" "PACS1" "0000326599" "PACS1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 79 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000079305" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000079309" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000079450" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000079607" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000150687" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:Tarailo-Graovac 2016:27276562}, {DOI:Tarailo-Graovac 2016:10.1056/NEJMoa1515792}" "" "" "" "Germline" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000298776" "0" "90" "11" "65978677" "65978677" "subst" "0" "02329" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000300537" "0" "90" "11" "65978677" "65978677" "subst" "0" "02326" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000304903" "0" "50" "11" "65838263" "65838263" "subst" "0" "01943" "PACS1_000005" "g.65838263C>A" "" "" "" "PACS1(NM_018026.3):c.306C>A (p.N102K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66070792C>A" "" "VUS" "" "0000322319" "0" "50" "11" "65988130" "65988130" "subst" "3.655E-5" "01804" "PACS1_000006" "g.65988130G>A" "" "" "" "PACS1(NM_018026.3):c.1067G>A (p.(Arg356His)), PACS1(NM_018026.4):c.1067G>A (p.R356H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66220659G>A" "" "VUS" "" "0000322320" "0" "30" "11" "65988161" "65988161" "subst" "1.21823E-5" "01804" "PACS1_000007" "g.65988161G>C" "" "" "" "PACS1(NM_018026.3):c.1098G>C (p.(Leu366Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66220690G>C" "" "likely benign" "" "0000338586" "0" "10" "11" "66001418" "66001418" "subst" "0.177173" "02327" "PACS1_000009" "g.66001418C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66233947C>T" "" "benign" "" "0000338588" "0" "10" "11" "66006323" "66006323" "subst" "0.176231" "02327" "PACS1_000010" "g.66006323G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66238852G>C" "" "benign" "" "0000338589" "0" "10" "11" "66010633" "66010633" "subst" "0.99633" "02327" "PACS1_000011" "g.66010633T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66243162T>C" "" "benign" "" "0000339012" "0" "90" "11" "65978677" "65978677" "subst" "0" "02327" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000346541" "0" "30" "11" "65983671" "65983671" "subst" "0" "02327" "PACS1_000008" "g.65983671A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66216200A>C" "" "likely benign" "" "0000369246" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:Schuurs-Hoeijmakers 2012:23159249}" "" "" "" "De novo" "-" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000369247" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:Schuurs-Hoeijmakers 2012:23159249}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic" "" "0000545053" "0" "30" "11" "65838061" "65838061" "subst" "0" "01804" "PACS1_000014" "g.65838061A>C" "" "" "" "PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070590A>C" "" "likely benign" "" "0000545054" "0" "30" "11" "65838229" "65838229" "subst" "0" "01804" "PACS1_000015" "g.65838229G>C" "" "" "" "PACS1(NM_018026.3):c.272G>C (p.(Gly91Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070758G>C" "" "likely benign" "" "0000545061" "0" "30" "11" "65978601" "65978601" "subst" "0.00121524" "01804" "PACS1_000016" "g.65978601G>A" "" "" "" "PACS1(NM_018026.3):c.535-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66211130G>A" "" "likely benign" "" "0000545062" "0" "90" "11" "65978677" "65978677" "subst" "0" "01943" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66211206C>T" "" "pathogenic" "" "0000545063" "0" "90" "11" "65978677" "65978677" "subst" "0" "02325" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66211206C>T" "" "pathogenic" "" "0000545064" "0" "30" "11" "65978707" "65978707" "subst" "0.000162639" "01804" "PACS1_000017" "g.65978707G>A" "" "" "" "PACS1(NM_018026.3):c.637G>A (p.(Val213Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66211236G>A" "" "likely benign" "" "0000545065" "0" "30" "11" "65983585" "65983585" "subst" "0.000598451" "01943" "PACS1_000018" "g.65983585C>G" "" "" "" "PACS1(NM_018026.3):c.661-5C>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66216114C>G" "" "likely benign" "" "0000545066" "0" "30" "11" "65983585" "65983585" "subst" "0.000598451" "01804" "PACS1_000018" "g.65983585C>G" "" "" "" "PACS1(NM_018026.3):c.661-5C>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66216114C>G" "" "likely benign" "" "0000613575" "0" "30" "11" "65838073" "65838078" "dup" "0" "01804" "PACS1_000019" "g.65838073_65838078dup" "" "" "" "PACS1(NM_018026.3):c.101_102insGCAGCA (p.(Gln39_Gln40dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070602_66070607dup" "" "likely benign" "" "0000622682" "0" "50" "11" "65988684" "65988684" "subst" "0" "01943" "PACS1_000020" "g.65988684G>T" "" "" "" "PACS1(NM_018026.3):c.1259G>T (p.S420I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66221213G>T" "" "VUS" "" "0000667552" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:Helbig 2016:26795593}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic (dominant)" "ACMG" "0000710184" "0" "90" "11" "65978677" "65978677" "subst" "0" "00006" "PACS1_000001" "g.65978677C>T" "" "{PMID:Hong 2020:33333793}" "" "" "" "De novo" "" "" "0" "" "" "g.66211206C>T" "" "pathogenic (dominant)" "" "0000723592" "0" "50" "11" "65838061" "65838081" "dup" "0" "02325" "PACS1_000022" "g.65838061_65838081dup" "" "" "" "PACS1(NM_018026.4):c.104_124dupAGCAGCAGCAGCAGCAGCCGC (p.Q35_P41dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723593" "0" "50" "11" "65838163" "65838163" "subst" "5.00636E-6" "02329" "PACS1_000003" "g.65838163C>T" "" "" "" "PACS1(NM_018026.4):c.206C>T (p.S69F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723596" "0" "30" "11" "65978601" "65978601" "subst" "0.00121524" "01943" "PACS1_000016" "g.65978601G>A" "" "" "" "PACS1(NM_018026.3):c.535-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723597" "0" "50" "11" "65983589" "65983589" "subst" "0" "01943" "PACS1_000023" "g.65983589G>C" "" "" "" "PACS1(NM_018026.3):c.661-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000815928" "0" "90" "11" "65978677" "65978677" "subst" "0" "03779" "PACS1_000001" "g.65978677C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs398123009" "0" "" "" "" "" "pathogenic" "" "0000862638" "0" "10" "11" "65835675" "65835675" "subst" "0.00256498" "02330" "PACS1_000024" "g.65835675G>A" "" "" "" "SF3B2(NM_006842.3):c.2487G>A (p.A829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000862639" "0" "30" "11" "65838061" "65838061" "subst" "0" "01943" "PACS1_000014" "g.65838061A>C" "" "" "" "PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862640" "0" "50" "11" "65960956" "65960956" "subst" "0" "02327" "PACS1_000025" "g.65960956G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890084" "0" "50" "11" "65961030" "65961030" "subst" "0" "02329" "PACS1_000026" "g.65961030G>A" "" "" "" "PACS1(NM_018026.4):c.430G>A (p.A144T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890085" "0" "30" "11" "66009061" "66009061" "subst" "0.000170655" "02325" "PACS1_000027" "g.66009061G>C" "" "" "" "PACS1(NM_018026.4):c.2593G>C (p.G865R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000909456" "0" "50" "11" "65978659" "65978659" "subst" "0" "03779" "PACS1_000028" "g.65978659A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000929952" "0" "50" "11" "65988663" "65988663" "subst" "1.21856E-5" "02325" "PACS1_000029" "g.65988663C>T" "" "" "" "PACS1(NM_018026.4):c.1238C>T (p.T413M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979757" "0" "30" "11" "65835612" "65835612" "subst" "2.03495E-5" "01804" "PACS1_000030" "g.65835612T>C" "" "" "" "SF3B2(NM_006842.3):c.2431-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979758" "0" "30" "11" "65838234" "65838234" "subst" "0" "01804" "PACS1_000031" "g.65838234G>C" "" "" "" "PACS1(NM_018026.4):c.277G>C (p.(Gly93Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979759" "0" "30" "11" "65855947" "65855947" "subst" "0" "01804" "PACS1_000032" "g.65855947A>G" "" "" "" "PACS1(NM_018026.4):c.356+17634A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979760" "0" "30" "11" "65872547" "65872547" "subst" "0" "01804" "PACS1_000033" "g.65872547A>G" "" "" "" "PACS1(NM_018026.4):c.356+34234A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979761" "0" "50" "11" "65984605" "65984605" "subst" "0" "01804" "PACS1_000034" "g.65984605C>T" "" "" "" "PACS1(NM_018026.4):c.978+359C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979762" "0" "30" "11" "65994758" "65994758" "subst" "0" "01804" "PACS1_000035" "g.65994758G>A" "" "" "" "PACS1(NM_018026.4):c.1294-217G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979763" "0" "50" "11" "65998133" "65998133" "subst" "0" "01804" "PACS1_000036" "g.65998133A>C" "" "" "" "PACS1(NM_018026.4):c.1489A>C (p.(Ser497Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999297" "0" "30" "11" "65835811" "65835811" "subst" "0.000530248" "01804" "PACS1_000037" "g.65835811G>A" "" "" "" "SF3B2(NM_006842.2):c.2616+7G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999298" "0" "30" "11" "65838076" "65838078" "del" "0" "01804" "PACS1_000038" "g.65838076_65838078del" "" "" "" "PACS1(NM_018026.3):c.119_121delAGC (p.(Gln40del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999299" "0" "30" "11" "65838096" "65838096" "subst" "0" "01804" "PACS1_000039" "g.65838096C>A" "" "" "" "PACS1(NM_018026.3):c.139C>A (p.(Pro47Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999300" "0" "30" "11" "65838115" "65838115" "subst" "0" "01804" "PACS1_000040" "g.65838115C>T" "" "" "" "PACS1(NM_018026.3):c.158C>T (p.(Ala53Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999301" "0" "50" "11" "65838306" "65838306" "subst" "0" "01804" "PACS1_000041" "g.65838306G>A" "" "" "" "PACS1(NM_018026.3):c.349G>A (p.(Val117Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999311" "0" "30" "11" "65978600" "65978600" "subst" "8.12902E-5" "01804" "PACS1_000042" "g.65978600C>T" "" "" "" "PACS1(NM_018026.3):c.535-5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999312" "0" "90" "11" "65978677" "65978677" "subst" "0" "01804" "PACS1_000001" "g.65978677C>T" "" "" "" "PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000999313" "0" "30" "11" "65984207" "65984207" "subst" "0" "01804" "PACS1_000043" "g.65984207G>C" "" "" "" "PACS1(NM_018026.3):c.939G>C (p.(Lys313Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999314" "0" "50" "11" "65988130" "65988130" "subst" "3.655E-5" "02325" "PACS1_000006" "g.65988130G>A" "" "" "" "PACS1(NM_018026.3):c.1067G>A (p.(Arg356His)), PACS1(NM_018026.4):c.1067G>A (p.R356H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999315" "0" "50" "11" "65988694" "65988694" "subst" "4.06312E-6" "01804" "PACS1_000044" "g.65988694C>A" "" "" "" "PACS1(NM_018026.3):c.1269C>A (p.(Ser423Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999316" "0" "50" "11" "65998371" "65998371" "subst" "0" "01804" "PACS1_000045" "g.65998371C>G" "" "" "" "PACS1(NM_018026.3):c.1586C>G (p.(Ser529Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999317" "0" "30" "11" "65998397" "65998397" "subst" "1.64171E-5" "01804" "PACS1_000046" "g.65998397G>A" "" "" "" "PACS1(NM_018026.3):c.1612G>A (p.(Gly538Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999318" "0" "50" "11" "66001638" "66001638" "subst" "8.12137E-6" "01804" "PACS1_000047" "g.66001638G>A" "" "" "" "PACS1(NM_018026.3):c.2029G>A (p.(Asp677Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999319" "0" "50" "11" "66003381" "66003381" "subst" "4.06055E-6" "01804" "PACS1_000048" "g.66003381C>G" "" "" "" "PACS1(NM_018026.3):c.2220C>G (p.(Asp740Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999320" "0" "50" "11" "66009047" "66009047" "subst" "0" "01804" "PACS1_000049" "g.66009047G>A" "" "" "" "PACS1(NM_018026.3):c.2579G>A (p.(Arg860His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038608" "0" "30" "11" "65838058" "65838058" "subst" "0" "01804" "PACS1_000050" "g.65838058C>A" "" "" "" "PACS1(NM_018026.4):c.101C>A (p.(Pro34Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038609" "0" "30" "11" "65838059" "65838059" "subst" "0.00167261" "01804" "PACS1_000051" "g.65838059G>A" "" "" "" "PACS1(NM_018026.4):c.102G>A (p.(Pro34=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038610" "0" "30" "11" "65955458" "65955458" "subst" "0" "01804" "PACS1_000052" "g.65955458C>T" "" "" "" "PACS1(NM_018026.4):c.357-5499C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038611" "0" "30" "11" "65977878" "65977878" "subst" "4.06058E-6" "01804" "PACS1_000053" "g.65977878A>G" "" "" "" "PACS1(NM_018026.4):c.490A>G (p.(Ser164Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038612" "0" "50" "11" "65987241" "65987241" "subst" "0" "01804" "PACS1_000054" "g.65987241G>A" "" "" "" "PACS1(NM_018026.4):c.1003G>A (p.(Val335Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038613" "0" "30" "11" "65988129" "65988129" "subst" "1.21837E-5" "01804" "PACS1_000055" "g.65988129C>T" "" "" "" "PACS1(NM_018026.4):c.1066C>T (p.(Arg356Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038614" "0" "30" "11" "65997819" "65997819" "subst" "0" "01804" "PACS1_000056" "g.65997819C>G" "" "" "" "PACS1(NM_018026.4):c.1375-200C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038615" "0" "30" "11" "65998052" "65998052" "subst" "4.06058E-6" "01804" "PACS1_000057" "g.65998052A>G" "" "" "" "PACS1(NM_018026.4):c.1408A>G (p.(Ser470Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038616" "0" "50" "11" "65998380" "65998380" "subst" "0" "01804" "PACS1_000058" "g.65998380A>G" "" "" "" "PACS1(NM_018026.4):c.1595A>G (p.(Glu532Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038617" "0" "50" "11" "66001293" "66001293" "subst" "0" "01804" "PACS1_000059" "g.66001293G>T" "" "" "" "PACS1(NM_018026.4):c.1876G>T (p.(Val626Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038618" "0" "50" "11" "66002783" "66002783" "subst" "0" "01804" "PACS1_000060" "g.66002783G>A" "" "" "" "PACS1(NM_018026.4):c.2116G>A (p.(Val706Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038619" "0" "30" "11" "66002884" "66002884" "subst" "8.96517E-5" "01804" "PACS1_000061" "g.66002884A>T" "" "" "" "PACS1(NM_018026.4):c.2207+10A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038620" "0" "30" "11" "66003842" "66003842" "subst" "0" "01804" "PACS1_000062" "g.66003842C>T" "" "" "" "PACS1(NM_018026.4):c.2250+431C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038621" "0" "50" "11" "66010854" "66010854" "subst" "0" "01804" "PACS1_000063" "g.66010854C>T" "" "" "" "PACS1(NM_018026.4):c.*103C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053936" "0" "50" "11" "65978623" "65978623" "subst" "0" "01804" "PACS1_000064" "g.65978623C>T" "" "" "" "PACS1(NM_018026.4):c.553C>T (p.(Arg185*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053937" "0" "50" "11" "66001629" "66001629" "subst" "0" "01804" "PACS1_000065" "g.66001629G>C" "" "" "" "PACS1(NM_018026.4):c.2020G>C (p.(Gly674Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PACS1 ## Count = 79 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000079305" "00015587" "00" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000079309" "00015587" "00" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000079450" "00015587" "00" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000079607" "00015587" "00" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000150687" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000298776" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000300537" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000304903" "00015587" "50" "306" "0" "306" "0" "c.306C>A" "r.(?)" "p.(Asn102Lys)" "" "0000322319" "00015587" "50" "1067" "0" "1067" "0" "c.1067G>A" "r.(?)" "p.(Arg356His)" "" "0000322320" "00015587" "30" "1098" "0" "1098" "0" "c.1098G>C" "r.(?)" "p.(Leu366Phe)" "" "0000338586" "00015587" "10" "1993" "8" "1993" "8" "c.1993+8C>T" "r.(=)" "p.(=)" "" "0000338588" "00015587" "10" "2293" "6" "2293" "6" "c.2293+6G>C" "r.(=)" "p.(=)" "" "0000338589" "00015587" "10" "2777" "-3" "2777" "-3" "c.2777-3T>C" "r.spl?" "p.?" "" "0000339012" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000346541" "00015587" "30" "742" "0" "742" "0" "c.742A>C" "r.(?)" "p.(Ile248Leu)" "" "0000369246" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000369247" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000545053" "00015587" "30" "104" "0" "104" "0" "c.104A>C" "r.(?)" "p.(Gln35Pro)" "" "0000545054" "00015587" "30" "272" "0" "272" "0" "c.272G>C" "r.(?)" "p.(Gly91Ala)" "" "0000545061" "00015587" "30" "535" "-4" "535" "-4" "c.535-4G>A" "r.spl?" "p.?" "" "0000545062" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000545063" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000545064" "00015587" "30" "637" "0" "637" "0" "c.637G>A" "r.(?)" "p.(Val213Met)" "" "0000545065" "00015587" "30" "661" "-5" "661" "-5" "c.661-5C>G" "r.spl?" "p.?" "" "0000545066" "00015587" "30" "661" "-5" "661" "-5" "c.661-5C>G" "r.spl?" "p.?" "" "0000613575" "00015587" "30" "116" "0" "121" "0" "c.116_121dup" "r.(?)" "p.(Gln39_Gln40dup)" "" "0000622682" "00015587" "50" "1259" "0" "1259" "0" "c.1259G>T" "r.(?)" "p.(Ser420Ile)" "" "0000667552" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000710184" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000723592" "00015587" "50" "104" "0" "124" "0" "c.104_124dup" "r.(?)" "p.(Gln35_Pro41dup)" "" "0000723593" "00015587" "50" "206" "0" "206" "0" "c.206C>T" "r.(?)" "p.(Ser69Phe)" "" "0000723596" "00015587" "30" "535" "-4" "535" "-4" "c.535-4G>A" "r.spl?" "p.?" "" "0000723597" "00015587" "50" "661" "-1" "661" "-1" "c.661-1G>C" "r.spl?" "p.?" "" "0000815928" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000862638" "00015587" "10" "-2283" "0" "-2283" "0" "c.-2283G>A" "r.(?)" "p.(=)" "" "0000862639" "00015587" "30" "104" "0" "104" "0" "c.104A>C" "r.(?)" "p.(Gln35Pro)" "" "0000862640" "00015587" "50" "357" "-1" "357" "-1" "c.357-1G>T" "r.spl?" "p.?" "" "0000890084" "00015587" "50" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Ala144Thr)" "" "0000890085" "00015587" "30" "2593" "0" "2593" "0" "c.2593G>C" "r.(?)" "p.(Gly865Arg)" "" "0000909456" "00015587" "50" "589" "0" "589" "0" "c.589A>G" "r.(?)" "p.(Arg197Gly)" "" "0000929952" "00015587" "50" "1238" "0" "1238" "0" "c.1238C>T" "r.(?)" "p.(Thr413Met)" "" "0000979757" "00015587" "30" "-2346" "0" "-2346" "0" "c.-2346T>C" "r.(?)" "p.(=)" "" "0000979758" "00015587" "30" "277" "0" "277" "0" "c.277G>C" "r.(?)" "p.(Gly93Arg)" "" "0000979759" "00015587" "30" "356" "17634" "356" "17634" "c.356+17634A>G" "r.(=)" "p.(=)" "" "0000979760" "00015587" "30" "356" "34234" "356" "34234" "c.356+34234A>G" "r.(=)" "p.(=)" "" "0000979761" "00015587" "50" "978" "359" "978" "359" "c.978+359C>T" "r.(=)" "p.(=)" "" "0000979762" "00015587" "30" "1294" "-217" "1294" "-217" "c.1294-217G>A" "r.(=)" "p.(=)" "" "0000979763" "00015587" "50" "1489" "0" "1489" "0" "c.1489A>C" "r.(?)" "p.(Ser497Arg)" "" "0000999297" "00015587" "30" "-2147" "0" "-2147" "0" "c.-2147G>A" "r.(?)" "p.(=)" "" "0000999298" "00015587" "30" "119" "0" "121" "0" "c.119_121del" "r.(?)" "p.(Gln40del)" "" "0000999299" "00015587" "30" "139" "0" "139" "0" "c.139C>A" "r.(?)" "p.(Pro47Thr)" "" "0000999300" "00015587" "30" "158" "0" "158" "0" "c.158C>T" "r.(?)" "p.(Ala53Val)" "" "0000999301" "00015587" "50" "349" "0" "349" "0" "c.349G>A" "r.(?)" "p.(Val117Met)" "" "0000999311" "00015587" "30" "535" "-5" "535" "-5" "c.535-5C>T" "r.spl?" "p.?" "" "0000999312" "00015587" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Arg203Trp)" "" "0000999313" "00015587" "30" "939" "0" "939" "0" "c.939G>C" "r.(?)" "p.(Lys313Asn)" "" "0000999314" "00015587" "50" "1067" "0" "1067" "0" "c.1067G>A" "r.(?)" "p.(Arg356His)" "" "0000999315" "00015587" "50" "1269" "0" "1269" "0" "c.1269C>A" "r.(?)" "p.(Ser423Arg)" "" "0000999316" "00015587" "50" "1586" "0" "1586" "0" "c.1586C>G" "r.(?)" "p.(Ser529Cys)" "" "0000999317" "00015587" "30" "1612" "0" "1612" "0" "c.1612G>A" "r.(?)" "p.(Gly538Ser)" "" "0000999318" "00015587" "50" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Asp677Asn)" "" "0000999319" "00015587" "50" "2220" "0" "2220" "0" "c.2220C>G" "r.(?)" "p.(Asp740Glu)" "" "0000999320" "00015587" "50" "2579" "0" "2579" "0" "c.2579G>A" "r.(?)" "p.(Arg860His)" "" "0001038608" "00015587" "30" "101" "0" "101" "0" "c.101C>A" "r.(?)" "p.(Pro34Gln)" "" "0001038609" "00015587" "30" "102" "0" "102" "0" "c.102G>A" "r.(?)" "p.(=)" "" "0001038610" "00015587" "30" "357" "-5499" "357" "-5499" "c.357-5499C>T" "r.(=)" "p.(=)" "" "0001038611" "00015587" "30" "490" "0" "490" "0" "c.490A>G" "r.(?)" "p.(Ser164Gly)" "" "0001038612" "00015587" "50" "1003" "0" "1003" "0" "c.1003G>A" "r.(?)" "p.(Val335Met)" "" "0001038613" "00015587" "30" "1066" "0" "1066" "0" "c.1066C>T" "r.(?)" "p.(Arg356Cys)" "" "0001038614" "00015587" "30" "1375" "-200" "1375" "-200" "c.1375-200C>G" "r.(=)" "p.(=)" "" "0001038615" "00015587" "30" "1408" "0" "1408" "0" "c.1408A>G" "r.(?)" "p.(Ser470Gly)" "" "0001038616" "00015587" "50" "1595" "0" "1595" "0" "c.1595A>G" "r.(?)" "p.(Glu532Gly)" "" "0001038617" "00015587" "50" "1876" "0" "1876" "0" "c.1876G>T" "r.(?)" "p.(Val626Leu)" "" "0001038618" "00015587" "50" "2116" "0" "2116" "0" "c.2116G>A" "r.(?)" "p.(Val706Met)" "" "0001038619" "00015587" "30" "2207" "10" "2207" "10" "c.2207+10A>T" "r.(=)" "p.(=)" "" "0001038620" "00015587" "30" "2250" "431" "2250" "431" "c.2250+431C>T" "r.(=)" "p.(=)" "" "0001038621" "00015587" "50" "2995" "0" "2995" "0" "c.*103C>T" "r.(=)" "p.(=)" "" "0001053936" "00015587" "50" "553" "0" "553" "0" "c.553C>T" "r.(?)" "p.(Arg185*)" "" "0001053937" "00015587" "50" "2020" "0" "2020" "0" "c.2020G>C" "r.(?)" "p.(Gly674Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 9 "{{screeningid}}" "{{variantid}}" "0000050325" "0000079305" "0000050329" "0000079309" "0000050470" "0000079450" "0000050627" "0000079607" "0000092385" "0000150687" "0000165528" "0000369246" "0000165529" "0000369247" "0000304154" "0000667552" "0000326599" "0000710184"