### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PANK2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PANK2" "pantothenate kinase 2" "20" "p13" "unknown" "NG_008131.3" "UD_132118549589" "" "https://www.LOVD.nl/PANK2" "" "1" "15894" "80025" "606157" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/PANK2_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2013-02-11 00:00:00" "00006" "2020-11-25 19:42:31" "00006" "2025-12-19 18:53:31" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025254" "PANK2" "transcript variant 1" "003" "NM_153638.2" "" "NP_705902.2" "" "" "" "-6" "2274" "1713" "3869742" "3904502" "00001" "2017-12-15 14:04:38" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 10 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00108" "DYT" "dystonia (DYT)" "" "" "" "" "" "00054" "2013-01-24 21:46:00" "00006" "2018-04-03 21:21:00" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00433" "NBIA1" "neurodegeneration, with brain iron accumulation, type 1 (NBIA)" "AR" "234200" "" "" "" "00006" "2014-06-24 21:43:21" "00006" "2021-12-10 21:51:32" "01026" "HARP" "HARP syndrome" "AR" "607236" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02087" "SIDS" "death, sudden, syndrome, infant (SIDS)" "AR" "272120" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "PANK2" "00139" "PANK2" "00433" "PANK2" "01026" ## Individuals ## Do not remove or alter this header ## ## Count = 47 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00144612" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00292925" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00303031" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat76" "00335132" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "4088" "00335133" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "3855" "00361536" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "simplex case" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "12DG0533" "00363525" "" "" "" "3" "" "00000" "{PMID:Beheshtian 2015:26497376}" "4-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "Iran" "" "0" "" "" "" "9300045/I-40300" "00374431" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5508" "00374432" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5519" "00375425" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#019" "00375427" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#021" "00375642" "" "" "" "1" "" "00006" "{PMID:Srivastava 2014:25131622}" "" "" "" "United States" "" "0" "" "" "" "Pat15" "00387838" "" "" "" "2" "" "00006" "{PMID:Hu 2019:29302074}" "family, 2 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M8800174" "00390469" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "G012676" "00409136" "" "" "" "1" "" "01164" "" "" "F" "likely" "" "" "0" "" "" "" "169458" "00410348" "" "" "" "1" "" "00000" "{PMID:Sakpichaisakul 2019:31088771}" "" "F" "no" "Thailand" "" "0" "" "" "South East Asian" "1 (R.B.)" "00410349" "" "" "" "1" "" "00000" "{PMID:Sakpichaisakul 2019:31088771}" "" "M" "no" "Thailand" "" "0" "" "" "South East Asian" "2 (M.Y.)" "00410350" "" "" "" "1" "" "00000" "{PMID:Sakpichaisakul 2019:31088771}" "" "M" "no" "Thailand" "" "0" "" "" "South East Asian" "3 (K.M.)" "00410351" "" "" "" "1" "" "00000" "{PMID:Sakpichaisakul 2019:31088771}" "" "M" "yes" "Thailand" "" "0" "" "" "Myanmarese" "4 (A.M.)" "00410352" "" "" "" "1" "" "00000" "{PMID:Sakpichaisakul 2019:31088771}" "" "M" "no" "Thailand" "" "0" "" "" "South East Asian" "5 (C.O.)" "00410353" "" "" "" "1" "" "00000" "{PMID:Han 2016:26828840}" "" "F" "" "" "" "0" "" "" "" "?" "00410361" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "1" "00410362" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "yes" "" "" "0" "" "" "" "2" "00410363" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "3" "00410364" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "4" "00410365" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "" "" "" "0" "" "" "" "5" "00410366" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "6" "00410367" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "7" "00410368" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "8" "00410369" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "" "" "" "0" "" "" "" "9" "00410370" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "10" "00410371" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "11" "00410372" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "" "" "" "0" "" "" "" "12" "00410373" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "" "" "" "0" "" "" "" "13" "00410374" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "M" "" "" "" "0" "" "" "" "14" "00410375" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "15" "00410376" "" "" "" "1" "" "00000" "{PMID:Egan 2005:16023068}" "" "F" "" "" "" "0" "" "" "" "16" "00431880" "" "" "" "1" "" "01602" "" "" "M" "" "Switzerland" "00y04m" "" "" "" "Europe" "SIDS107" "00469184" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00469185" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470688" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected mother, maternal uncle, maternal grandfather" "M" "" "Poland" "" "0" "" "" "" "Pat49" "00470699" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected" "F" "" "Poland" "" "0" "" "" "" "Pat60" "00471299" "" "" "" "1" "" "00006" "{PMID:Zech 2020:33098801}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "" "0" "" "" "" "IS-DYS-403" "00471300" "" "" "" "1" "" "00006" "{PMID:Zech 2020:33098801}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "" "0" "" "" "" "IS-DYS-449" "00471348" "" "" "" "1" "" "00006" "{PMID:Zech 2020:33098801}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "" "0" "" "" "" "CB-DYS-133" "00471349" "" "" "" "1" "" "00006" "{PMID:Zech 2020:33098801}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "" "0" "" "" "" "CB-DYS-143" "00471350" "" "" "" "1" "" "00006" "{PMID:Zech 2020:33098801}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "" "0" "" "" "" "CB-DYS-241" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 47 "{{individualid}}" "{{diseaseid}}" "00144612" "00198" "00292925" "00198" "00303031" "05521" "00335132" "00198" "00335133" "00198" "00361536" "00139" "00363525" "04214" "00374431" "00198" "00374432" "00198" "00375425" "04214" "00375427" "04214" "00375642" "00198" "00387838" "00139" "00390469" "05611" "00409136" "00433" "00410348" "01026" "00410349" "01026" "00410350" "01026" "00410351" "01026" "00410352" "01026" "00410353" "01026" "00410361" "01026" "00410362" "01026" "00410363" "01026" "00410364" "01026" "00410365" "01026" "00410366" "01026" "00410367" "01026" "00410368" "01026" "00410369" "01026" "00410370" "01026" "00410371" "01026" "00410372" "01026" "00410373" "01026" "00410374" "01026" "00410375" "01026" "00410376" "01026" "00431880" "02087" "00469184" "00198" "00469185" "00198" "00470688" "07210" "00470699" "07210" "00471299" "00108" "00471300" "00108" "00471348" "00108" "00471349" "00108" "00471350" "00108" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00108, 00139, 00198, 00433, 01026, 02087, 04214, 05521, 05611, 07210 ## Count = 46 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000117353" "00198" "00144612" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Ataxia (HP:0001251); Short stature (HP:0004322); Cerebral palsy (HP:0100021)" "" "" "" "" "" "" "" "" "" "" "" "0000230114" "05521" "00303031" "00006" "Familial, autosomal recessive" "" "Focal epilepsy, unclassified; age onset childhood" "" "" "" "" "" "" "" "" "" "seizures" "" "0000252847" "00198" "00335132" "00000" "Unknown" "" "5y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252848" "00198" "00335133" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000256941" "00139" "00361536" "00006" "Familial, autosomal recessive" "5y" "not syndromic; Neurodegeneration" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000258874" "04214" "00363525" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269641" "00198" "00374431" "00006" "Familial, autosomal recessive" "" "Global developmental delay, dystonia, tremor, chorea and focal seizures" "" "" "" "" "" "" "" "" "" "dystonia" "" "0000269642" "00198" "00374432" "00006" "Familial, autosomal recessive" "" "Progressive dystonia with oromotor dyskinesia" "" "" "" "" "" "" "" "" "" "dystonia" "" "0000270639" "04214" "00375425" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270641" "04214" "00375427" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270855" "00198" "00375642" "00006" "Familial, autosomal recessive" "" "developmental regression; spastic diplegia; autism spectrum disorder; macrocephaly; seizures; spastic diplegia, dystonia; hyper-reflexia; MRI brain globus pallidus signal changes" "" "4y" "" "" "" "" "" "" "" "" "" "0000281406" "00139" "00387838" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, no microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000284007" "05611" "00390469" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Neurological and Developmental Disorders" "" "0000301252" "00433" "00409136" "01164" "Familial, autosomal recessive" "03y" "Global developmental delay, Gait disturbance, Abnormal cerebral morphology, Gait imbalance, Postural instability, Frequent falls, Falls, Functional motor deficit, Neurodevelopmental delay, Abnormality of movement" "" "" "" "" "" "" "" "" "" "" "" "0000302452" "01026" "00410348" "00000" "Familial, autosomal recessive" "" "" "01y" "07y" "gait dystonia" "" "" "" "" "" "pantothenate kinase associated neurodegeneration" "" "" "0000302453" "01026" "00410349" "00000" "Familial, autosomal recessive" "" "" "01y" "09y" "gait dystonia" "" "" "" "" "" "pantothenate kinase associated neurodegeneration" "" "" "0000302454" "01026" "00410350" "00000" "Familial, autosomal recessive" "" "" "02y" "03y" "gait dystonia" "" "" "" "" "" "pantothenate kinase associated neurodegeneration" "" "" "0000302455" "01026" "00410351" "00000" "Familial, autosomal recessive" "" "" "01y" "02y" "developmental delay" "" "" "" "" "" "pantothenate kinase associated neurodegeneration" "" "" "0000302456" "01026" "00410352" "00000" "Familial, autosomal recessive" "" "" "01y" "08y" "cervical dystonia" "" "" "" "" "" "pantothenate kinase associated neurodegeneration" "" "" "0000302457" "01026" "00410353" "00000" "Unknown" "13y" "10y: postural instability (frequent stumbling), followed by cognitive impairment and progressive dystonia (walking on toes); child complained of a tingling sensation below her ankles and observed recurrent episodes of mood lability; no history of consanguinity or family history of ophthalmologic or neurologic disease; visual acuity: 20/40 both eyes; funduscopy: bilateral temporal optic disc pallor; neurological examination: intact toe gait, but abnormal heel gait; finger-to-nose testing was normal but tandem gait revealed swaying to both sides, which may have been due to lower extremity weakness; Romberg test: negative; electroencephalography, electromyography with motor and sensory velocity studies, and visual evoked potentials: normal limits; biochemical laboratory tests including blood and urine levels of copper, ceruloplasmin, ferritin, complete blood count, liver function, lactate and pyruvate levels, and amino acid and organic acid screenings: normal, with the exception of elevated serum creatine kinase (300 IU/L; normal, 135 IU/L); genetic analysis of mitochondrial DNA and the dominant optic atrophy (OPA1) gene, early-onset torsion dystonia (GAC deletion c.901_903 delGAG), dopa-responsive dystonia (GCH1), and myotonic dystrophy (DM kinase CAG repeats): no mutations; magnetic resonance imaging: unremarkable; 8months later reevaluation because of deterioration of cognitive and motor function, and progression of visual impairment; visual acuity: 20/80 bilaterally, pupillary reactions and eye movements: normal; bilateral temporal optic disc pallor; optical coherence tomography: retinal nerve fiber layer loss; electroretinogram: normal; neurological examination: tendency toward dystonic posturing of the right hand and gait ataxia; repeat brain MRI: symmetric T2 hypointensity without focal hyperintensity that involved the globi pallidi and substantia nigra bilaterally" "10y" "" "gait disturbance and vision loss" "" "" "" "" "" "atypical pantothenate kinase-associated neurodegeneration" "" "" "0000302465" "01026" "00410361" "00000" "Familial, autosomal recessive" "7y" "visual acuity: could not perform; color vision: could not perform; Goldmann visual fields: could not perform; dysarthria: yes; abnormal gait: yes; bone spicules: yes; electroretinogram: abnormal; electroretinogram loss pattern: responses severely sub-normal for both rod and cone stimuli or indistinguishable from noise; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes*; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: no; abnormal convergence: no; abnormal optokinetic responses: yes; alternating skew deviation: no; blepharospasm:" "2y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302466" "01026" "00410362" "00000" "Familial, autosomal recessive" "11y" "visual acuity: normal; color vision: abnormal; Goldmann visual fields: normal; dysarthria: yes; abnormal gait: yes; bone spicules: no; electroretinogram: abnormal; electroretinogram loss pattern: mild cone; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: no*; abnormal saccaades: no; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: no; abnormal convergence: no; abnormal optokinetic responses: yes; alternating skew deviation: no; blepharospasm:" "9y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302467" "01026" "00410363" "00000" "Familial, autosomal recessive" "15y" "visual acuity: normal; color vision: normal; Goldmann visual fields: could not perform; dysarthria: yes; abnormal gait: yes; bone spicules: yes; electroretinogram: abnormal; electroretinogram loss pattern: responses severely sub-normal for both rod and cone stimuli or indistinguishable from noise; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes*; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: yes; abnormal convergence: yes; abnormal optokinetic responses: no; alternating skew deviation: no; blepharospasm:" "1y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302468" "01026" "00410364" "00000" "Familial, autosomal recessive" "16y" "electroretinogram: abnormal; electroretinogram loss pattern: mild cone; \"\"eye-of-the-tiger\"\" sign: yes" "13y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302469" "01026" "00410365" "00000" "Familial, autosomal recessive" "16y" "electroretinogram: normal; \"\"eye-of-the-tiger\"\" sign: yes" "14y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302470" "01026" "00410366" "00000" "Familial, autosomal recessive" "18y" "visual acuity: could not perform; color vision: could not perform; Goldmann visual fields: could not perform; dysarthria: yes; abnormal gait: yes; bone spicules: yes; electroretinogram: abnormal; electroretinogram loss pattern: responses severely sub-normal for both rod and cone stimuli or indistinguishable from noise; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: nd; square wave jerks: no; abnormal convergence: yes; abnormal optokinetic responses: yes; alternating skew deviation: no; blepharospasm:" "2y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302471" "01026" "00410367" "00000" "Familial, autosomal recessive" "19y" "electroretinogram: normal; \"\"eye-of-the-tiger\"\" sign: yes" "17y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302472" "01026" "00410368" "00000" "Familial, autosomal recessive" "20y" "visual acuity: normal; color vision: normal; Goldmann visual fields: normal; dysarthria: yes; abnormal gait: yes; bone spicules: no; electroretinogram: abnormal; electroretinogram loss pattern: mild cone; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: no; square wave jerks: no; abnormal convergence: no; abnormal optokinetic responses: no; alternating skew deviation: no; blepharospasm:" "14y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302473" "01026" "00410369" "00000" "Familial, autosomal recessive" "20y" "visual acuity: normal; color vision: normal; Goldmann visual fields: could not perform; dysarthria: yes; abnormal gait: yes; bone spicules: no; electroretinogram: abnormal; electroretinogram loss pattern: mild cone; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes*; abnormal saccaades: no; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: no; abnormal convergence: yes; abnormal optokinetic responses: no; alternating skew deviation: no; blepharospasm: y" "5y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302474" "01026" "00410370" "00000" "Familial, autosomal recessive" "21y" "electroretinogram: abnormal; electroretinogram loss pattern: moderate rod-cone; \"\"eye-of-the-tiger\"\" sign: yes" "10y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302475" "01026" "00410371" "00000" "Familial, autosomal recessive" "23y" "electroretinogram: abnormal; electroretinogram loss pattern: mild rod-cone; \"\"eye-of-the-tiger\"\" sign: yes" "8y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302476" "01026" "00410372" "00000" "Familial, autosomal recessive" "29y" "visual acuity: normal; color vision: normal; Goldmann visual fields: normal; dysarthria: yes; abnormal gait: yes; bone spicules: noelectroretinogram: normal; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: no*; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: yes; abnormal convergence: no; abnormal optokinetic responses: no; alternating skew deviation: no; blepharospasm:" "14y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302477" "01026" "00410373" "00000" "Familial, autosomal recessive" "33y" "visual acuity: could not perform; color vision: could not perform; Goldmann visual fields: could not perform; dysarthria: yes; abnormal gait: yes; bone spicules: yes; electroretinogram: abnormal; electroretinogram loss pattern: responses severely sub-normal for both rod and cone stimuli or indistinguishable from noise; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: nd; square wave jerks: no; abnormal convergence: no; abnormal optokinetic responses: yes; alternating skew deviation: yes; blepharospasm: y" "6y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302478" "01026" "00410374" "00000" "Familial, autosomal recessive" "34y" "visual acuity: normal; color vision: normal; Goldmann visual fields: nasal depression; dysarthria: yes; abnormal gait: yes; bone spicules: no; electroretinogram: abnormal; electroretinogram loss pattern: moderate rod-cone; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes*; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: no; abnormal convergence: no; abnormal optokinetic responses: yes; alternating skew deviation: no; blepharospasm:" "14y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302479" "01026" "00410375" "00000" "Familial, autosomal recessive" "43y" "visual acuity: normal; color vision: normal; Goldmann visual fields: normal; dysarthria: yes; abnormal gait: yes; bone spicules: no; electroretinogram: normal; \"\"eye-of-the-tiger\"\" sign: yes; neuro-ophthalmologic characteristics: Adie\'s pupils: yes; abnormal saccaades: yes; saccadic pursuit: yes; abnormal suppression of the vestibular ocular reflex: yes; square wave jerks: no; abnormal convergence: yes; abnormal optokinetic responses: no; alternating skew deviation: no; blepharospasm:" "17y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000302480" "01026" "00410376" "00000" "Familial, autosomal recessive" "69y" "electroretinogram: normal; \"\"eye-of-the-tiger\"\" sign: yes" "23y" "" "" "" "" "" "" "" "pantothenate kinase-associated neurodegeneration" "" "" "0000322448" "02087" "00431880" "01602" "Unknown" "" "SIDS" "" "" "" "" "" "" "" "" "" "" "" "0000354337" "00198" "00469184" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000354338" "00198" "00469185" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000355582" "07210" "00470688" "00006" "Familial" "14y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; physical activity" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" "0000355593" "07210" "00470699" "00006" "Isolated (sporadic)" "17y" "see paper; ... scoliosis, no other skeletal defects; back pain; depression; no physical activity" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" "0000356136" "00108" "00471299" "00006" "Familial, autosomal recessive" "" "isolated dystonia, coexisting non-movement disorder-related neurological symptoms; onset infancy (0-2y); generalized dystonia; no dystonic cerebral palsy" "" "" "" "" "" "" "" "" "NBIA1" "dystonia" "" "0000356137" "00108" "00471300" "00006" "Familial, autosomal recessive" "" "isolated dystonia, coexisting non-movement disorder-related neurological symptoms; onset childhood (3-12y); segmental dystonia; no dystonic cerebral palsy" "" "" "" "" "" "" "" "" "NBIA1" "dystonia" "" "0000356185" "00108" "00471348" "00006" "Familial, autosomal recessive" "" "combined dystonia, coexisting non-movement disorder-related neurological symptoms; onset infancy (0-2y); generalized dystonia; no dystonic cerebral palsy" "" "" "" "" "" "" "" "" "NBIA1" "dystonia" "" "0000356186" "00108" "00471349" "00006" "Familial, autosomal recessive" "" "combined dystonia, coexisting non-movement disorder-related neurological symptoms; onset infancy (0-2y); generalized dystonia; dystonic cerebral palsy" "" "" "" "" "" "" "" "" "NBIA1" "dystonia" "" "0000356187" "00108" "00471350" "00006" "Familial, autosomal recessive" "" "combined dystonia, coexisting non-movement disorder-related neurological symptoms; onset childhood (3-12y); segmental dystonia; no dystonic cerebral palsy" "" "" "" "" "" "" "" "" "NBIA1" "dystonia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 47 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000145469" "00144612" "0" "01807" "01807" "2017-12-18 12:53:40" "" "" "SEQ" "DNA" "" "" "0000294093" "00292925" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000304156" "00303031" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000336361" "00335132" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000336362" "00335133" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000362764" "00361536" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "758-gene panel" "0000364753" "00363525" "1" "00000" "00006" "2021-04-29 12:09:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000375625" "00374431" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375626" "00374432" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376622" "00375425" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376624" "00375427" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376839" "00375642" "1" "00006" "00006" "2021-06-14 20:30:20" "" "" "SEQ-NG" "DNA" "" "WES" "0000389069" "00387838" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000391710" "00390469" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000410400" "00409136" "1" "01164" "01164" "2022-05-03 13:56:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000411612" "00410348" "1" "00000" "03840" "2022-05-24 14:37:58" "" "" "SEQ" "DNA" "blood" "" "0000411613" "00410349" "1" "00000" "03840" "2022-05-24 14:37:58" "" "" "SEQ" "DNA" "blood" "" "0000411614" "00410350" "1" "00000" "03840" "2022-05-24 14:37:58" "" "" "SEQ" "DNA" "blood" "" "0000411615" "00410351" "1" "00000" "03840" "2022-05-24 14:37:58" "" "" "SEQ" "DNA" "blood" "" "0000411616" "00410352" "1" "00000" "03840" "2022-05-24 14:37:58" "" "" "SEQ" "DNA" "blood" "" "0000411617" "00410353" "1" "00000" "03840" "2022-05-24 19:53:14" "" "" "SEQ" "DNA" "blood" "" "0000411625" "00410361" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411626" "00410362" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411627" "00410363" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411628" "00410364" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411629" "00410365" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411630" "00410366" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411631" "00410367" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411632" "00410368" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411633" "00410369" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411634" "00410370" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411635" "00410371" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411636" "00410372" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411637" "00410373" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411638" "00410374" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411639" "00410375" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000411640" "00410376" "1" "00000" "03840" "2022-05-25 10:27:39" "" "" "SEQ" "DNA" "blood" "" "0000433320" "00431880" "1" "01602" "01602" "2023-02-17 15:09:06" "" "" "SEQ-NG" "DNA" "" "" "0000470852" "00469184" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470853" "00469185" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472355" "00470688" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472366" "00470699" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472969" "00471299" "1" "00006" "00006" "2025-12-19 18:53:19" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000472970" "00471300" "1" "00006" "00006" "2025-12-19 18:53:19" "" "" "SEQ;SEQ-NG" "DNA" "" "solo WES" "0000473018" "00471348" "1" "00006" "00006" "2025-12-19 18:53:19" "" "" "SEQ;SEQ-NG" "DNA" "" "solo WES" "0000473019" "00471349" "1" "00006" "00006" "2025-12-19 18:53:19" "" "" "SEQ;SEQ-NG" "DNA" "" "solo WES" "0000473020" "00471350" "1" "00006" "00006" "2025-12-19 18:53:19" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 32 "{{screeningid}}" "{{geneid}}" "0000304156" "PANK2" "0000336361" "PANK2" "0000336362" "PANK2" "0000362764" "PANK2" "0000364753" "PANK2" "0000375625" "PANK2" "0000375626" "PANK2" "0000389069" "PANK2" "0000391710" "PANK2" "0000410400" "PANK2" "0000411612" "PANK2" "0000411613" "PANK2" "0000411614" "PANK2" "0000411615" "PANK2" "0000411616" "PANK2" "0000411617" "PANK2" "0000411625" "PANK2" "0000411626" "PANK2" "0000411627" "PANK2" "0000411628" "PANK2" "0000411629" "PANK2" "0000411630" "PANK2" "0000411631" "PANK2" "0000411632" "PANK2" "0000411633" "PANK2" "0000411634" "PANK2" "0000411635" "PANK2" "0000411636" "PANK2" "0000411637" "PANK2" "0000411638" "PANK2" "0000411639" "PANK2" "0000411640" "PANK2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 138 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000237841" "0" "90" "20" "3870286" "3870308" "del" "0" "01807" "PANK2_000001" "g.3870286_3870308del" "" "" "" "539_561delAGGGCACGAGGCGGGATCGACTG" "" "Unknown" "" "" "0" "" "" "g.3889639_3889661del" "" "pathogenic" "" "0000249977" "0" "30" "20" "3869884" "3869884" "subst" "0.00330578" "02329" "PANK2_000002" "g.3869884A>T" "" "" "" "PANK2(NM_153638.2):c.137A>T (p.D46V), PANK2(NM_153638.4):c.137A>T (p.D46V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889237A>T" "" "likely benign" "" "0000254068" "0" "30" "20" "3869884" "3869884" "subst" "0.00330578" "01943" "PANK2_000002" "g.3869884A>T" "" "" "" "PANK2(NM_153638.2):c.137A>T (p.D46V), PANK2(NM_153638.4):c.137A>T (p.D46V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889237A>T" "" "likely benign" "" "0000293423" "0" "50" "20" "3869931" "3869931" "subst" "2.15167E-5" "02330" "PANK2_000003" "g.3869931G>A" "" "" "" "PANK2(NM_153638.4):c.184G>A (p.E62K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889284G>A" "" "VUS" "" "0000293424" "0" "10" "20" "3870023" "3870023" "subst" "0.00344387" "02330" "PANK2_000004" "g.3870023G>A" "" "" "" "PANK2(NM_153638.2):c.276G>A (p.R92=), PANK2(NM_153638.4):c.276G>A (p.R92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889376G>A" "" "benign" "" "0000293425" "0" "10" "20" "3870127" "3870127" "subst" "0.00178537" "02330" "PANK2_000009" "g.3870127G>T" "" "" "" "PANK2(NM_153638.2):c.380G>T (p.G127V, p.(Gly127Val)), PANK2(NM_153638.4):c.380G>T (p.G127V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889480G>T" "" "benign" "" "0000293426" "0" "10" "20" "3870332" "3870332" "subst" "0.000276538" "02330" "PANK2_000013" "g.3870332G>T" "" "" "" "PANK2(NM_153638.4):c.585G>T (p.S195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889685G>T" "" "benign" "" "0000296748" "0" "90" "20" "3893186" "3893186" "del" "8.12275E-6" "02325" "PANK2_000020" "g.3893186del" "" "" "" "PANK2(NM_001324191.2):c.444delT (p.R149Vfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3912539del" "" "pathogenic" "" "0000296749" "0" "30" "20" "3897561" "3897561" "dup" "0" "02325" "PANK2_000024" "g.3897561dup" "" "" "" "PANK2(NM_153638.4):c.1413-12delCinsTC, PANK2(NM_153638.4):c.1413-13dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3916914dup" "" "likely benign" "" "0000296750" "0" "30" "20" "3897560" "3897561" "ins" "0" "02325" "PANK2_000023" "g.3897560_3897561insCCCCCT" "" "" "" "PANK2(NM_153638.4):c.1413-13delTinsCCCCCTT, PANK2(NM_153638.4):c.1413-14_1413-13insCCCCCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3916913_3916914insCCCCCT" "" "likely benign" "" "0000296752" "0" "10" "20" "3897560" "3897565" "dup" "0" "02325" "PANK2_000026" "g.3897560_3897565dup" "" "" "" "PANK2(NM_001324191.2):c.540-14_540-9dupTTCCCC, PANK2(NM_153638.4):c.1413-14_1413-9dupTTCCCC, PANK2(NM_153638.4):c.1413-8delCinsTTCCCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3916913_3916918dup" "" "benign" "" "0000296754" "0" "90" "20" "3897603" "3897605" "del" "3.65604E-5" "02325" "PANK2_000027" "g.3897603_3897605del" "" "" "" "PANK2(NM_153638.4):c.1442_1444delGAG (p.R481_E482delinsQ)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3916956_3916958del" "" "pathogenic" "" "0000296755" "0" "30" "20" "3870023" "3870023" "subst" "0.00344387" "02325" "PANK2_000004" "g.3870023G>A" "" "" "" "PANK2(NM_153638.2):c.276G>A (p.R92=), PANK2(NM_153638.4):c.276G>A (p.R92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889376G>A" "" "likely benign" "" "0000296756" "0" "90" "20" "3870102" "3870102" "subst" "6.85401E-6" "02325" "PANK2_000007" "g.3870102C>T" "" "" "" "PANK2(NM_153638.2):c.355C>T (p.R119*), PANK2(NM_153638.4):c.355C>T (p.R119*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889455C>T" "" "pathogenic" "" "0000296757" "0" "10" "20" "3870124" "3870124" "subst" "0.861635" "02325" "PANK2_000008" "g.3870124G>C" "" "" "" "PANK2(NM_153638.2):c.377G>C (p.G126A), PANK2(NM_153638.4):c.377G>C (p.G126A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889477G>C" "" "benign" "" "0000296758" "0" "50" "20" "3870135" "3870135" "subst" "0" "02325" "PANK2_000010" "g.3870135G>T" "" "" "" "PANK2(NM_153638.4):c.388G>T (p.G130C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889488G>T" "" "VUS" "" "0000296759" "0" "50" "20" "3888661" "3888661" "subst" "1.21961E-5" "02325" "PANK2_000016" "g.3888661G>T" "" "" "" "PANK2(NM_153638.4):c.717G>T (p.E239D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3908014G>T" "" "VUS" "" "0000298790" "0" "10" "20" "3870079" "3870079" "subst" "0.0814252" "02329" "PANK2_000006" "g.3870079T>A" "" "" "" "PANK2(NM_153638.2):c.332T>A (p.L111Q), PANK2(NM_153638.4):c.332T>A (p.L111Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889432T>A" "" "benign" "" "0000298791" "0" "10" "20" "3870124" "3870124" "subst" "0.861635" "02329" "PANK2_000008" "g.3870124G>C" "" "" "" "PANK2(NM_153638.2):c.377G>C (p.G126A), PANK2(NM_153638.4):c.377G>C (p.G126A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889477G>C" "" "benign" "" "0000300604" "0" "70" "20" "3899375" "3899375" "subst" "0" "02326" "PANK2_000028" "g.3899375C>T" "" "" "" "PANK2(NM_153638.3):c.1594C>T (p.R532W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3918728C>T" "" "likely pathogenic" "" "0000304988" "0" "30" "20" "3870023" "3870023" "subst" "0.00344387" "01943" "PANK2_000004" "g.3870023G>A" "" "" "" "PANK2(NM_153638.2):c.276G>A (p.R92=), PANK2(NM_153638.4):c.276G>A (p.R92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889376G>A" "" "likely benign" "" "0000304989" "0" "30" "20" "3870030" "3870030" "subst" "4.56298E-5" "01943" "PANK2_000005" "g.3870030C>T" "" "" "" "PANK2(NM_153638.2):c.283C>T (p.L95F, p.(Leu95Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889383C>T" "" "likely benign" "" "0000304990" "0" "10" "20" "3870079" "3870079" "subst" "0.0814252" "01943" "PANK2_000006" "g.3870079T>A" "" "" "" "PANK2(NM_153638.2):c.332T>A (p.L111Q), PANK2(NM_153638.4):c.332T>A (p.L111Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889432T>A" "" "benign" "" "0000304991" "0" "90" "20" "3870102" "3870102" "subst" "6.85401E-6" "01943" "PANK2_000007" "g.3870102C>T" "" "" "" "PANK2(NM_153638.2):c.355C>T (p.R119*), PANK2(NM_153638.4):c.355C>T (p.R119*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889455C>T" "" "pathogenic" "" "0000304992" "0" "10" "20" "3870124" "3870124" "subst" "0.861635" "01943" "PANK2_000008" "g.3870124G>C" "" "" "" "PANK2(NM_153638.2):c.377G>C (p.G126A), PANK2(NM_153638.4):c.377G>C (p.G126A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889477G>C" "" "benign" "" "0000304993" "0" "10" "20" "3870266" "3870266" "subst" "0.00100559" "01943" "PANK2_000011" "g.3870266C>G" "" "" "" "PANK2(NM_153638.2):c.519C>G (p.P173=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889619C>G" "" "benign" "" "0000304994" "0" "30" "20" "3870268" "3870268" "subst" "0" "01943" "PANK2_000012" "g.3870268C>T" "" "" "" "PANK2(NM_153638.2):c.521C>T (p.A174V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889621C>T" "" "likely benign" "" "0000304995" "0" "30" "20" "3888610" "3888610" "subst" "2.43821E-5" "01943" "PANK2_000015" "g.3888610G>A" "" "" "" "PANK2(NM_153638.2):c.666G>A (p.L222=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3907963G>A" "" "likely benign" "" "0000304996" "0" "90" "20" "3888682" "3888683" "del" "0" "01943" "PANK2_000017" "g.3888682_3888683del" "" "" "" "PANK2(NM_153638.2):c.738_739delAA (p.S247Hfs*44)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3908035_3908036del" "" "pathogenic" "" "0000304997" "0" "30" "20" "3888763" "3888763" "subst" "0.000353345" "01943" "PANK2_000018" "g.3888763G>A" "" "" "" "PANK2(NM_153638.2):c.819G>A (p.L273=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3908116G>A" "" "likely benign" "" "0000328285" "0" "50" "20" "3869795" "3869797" "del" "0" "01804" "PANK2_000033" "g.3869795_3869797del" "" "" "" "PANK2(NM_153638.2):c.44_46del (p.(Pro17del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889148_3889150del" "" "VUS" "" "0000328287" "0" "50" "20" "3870377" "3870377" "dup" "0" "01804" "PANK2_000014" "g.3870377dup" "" "" "" "PANK2(NM_153638.2):c.628+1_628+2insT (p.?), PANK2(NM_153638.4):c.628+2dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889730dup" "" "VUS" "" "0000328289" "0" "50" "20" "3891375" "3891375" "subst" "0.000239744" "01804" "PANK2_000019" "g.3891375A>G" "" "" "" "PANK2(NM_024960.4):c.260A>G (p.(Asp87Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3910728A>G" "" "VUS" "" "0000328290" "0" "50" "20" "3899393" "3899393" "subst" "4.06075E-6" "01804" "PANK2_000029" "g.3899393T>G" "" "" "" "PANK2(NM_024960.4):c.739T>G (p.(Leu247Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3918746T>G" "" "VUS" "" "0000342519" "0" "50" "20" "3888777" "3888777" "subst" "0" "02327" "PANK2_000030" "g.3888777G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3908130G>T" "" "VUS" "" "0000345677" "0" "10" "20" "3870124" "3870124" "subst" "0.861635" "02327" "PANK2_000008" "g.3870124G>C" "" "" "" "PANK2(NM_153638.2):c.377G>C (p.G126A), PANK2(NM_153638.4):c.377G>C (p.G126A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3889477G>C" "" "benign" "" "0000346136" "0" "90" "20" "3899342" "3899342" "subst" "8.93365E-5" "02327" "PANK2_000031" "g.3899342G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.3918695G>A" "" "pathogenic" "" "0000569549" "0" "30" "20" "3869776" "3869776" "subst" "0" "01943" "PANK2_000032" "g.3869776G>T" "" "" "" "PANK2(NM_153638.2):c.29G>T (p.R10L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889129G>T" "" "likely benign" "" "0000569550" "0" "10" "20" "3869843" "3869843" "subst" "1.66276E-5" "02330" "PANK2_000034" "g.3869843C>T" "" "" "" "PANK2(NM_153638.4):c.96C>T (p.T32=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889196C>T" "" "benign" "" "0000569551" "0" "30" "20" "3869884" "3869884" "subst" "0.00330578" "02330" "PANK2_000002" "g.3869884A>T" "" "" "" "PANK2(NM_153638.2):c.137A>T (p.D46V), PANK2(NM_153638.4):c.137A>T (p.D46V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889237A>T" "" "likely benign" "" "0000569552" "0" "30" "20" "3870030" "3870030" "subst" "4.56298E-5" "01804" "PANK2_000005" "g.3870030C>T" "" "" "" "PANK2(NM_153638.2):c.283C>T (p.L95F, p.(Leu95Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889383C>T" "" "likely benign" "" "0000569553" "0" "30" "20" "3870068" "3870068" "subst" "0" "02330" "PANK2_000035" "g.3870068G>A" "" "" "" "PANK2(NM_153638.4):c.321G>A (p.R107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889421G>A" "" "likely benign" "" "0000569555" "0" "50" "20" "3870127" "3870127" "subst" "0.00178537" "01943" "PANK2_000009" "g.3870127G>T" "" "" "" "PANK2(NM_153638.2):c.380G>T (p.G127V, p.(Gly127Val)), PANK2(NM_153638.4):c.380G>T (p.G127V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889480G>T" "" "VUS" "" "0000569556" "0" "30" "20" "3870127" "3870127" "subst" "0.00178537" "01804" "PANK2_000009" "g.3870127G>T" "" "" "" "PANK2(NM_153638.2):c.380G>T (p.G127V, p.(Gly127Val)), PANK2(NM_153638.4):c.380G>T (p.G127V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889480G>T" "" "likely benign" "" "0000569557" "0" "30" "20" "3888598" "3888598" "subst" "3.65717E-5" "01943" "PANK2_000037" "g.3888598C>T" "" "" "" "PANK2(NM_153638.2):c.654C>T (p.I218=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3907951C>T" "" "likely benign" "" "0000569558" "0" "50" "20" "3888731" "3888731" "subst" "3.24939E-5" "01943" "PANK2_000038" "g.3888731A>T" "" "" "" "PANK2(NM_153638.2):c.787A>T (p.I263F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3908084A>T" "" "VUS" "" "0000569559" "0" "30" "20" "3888898" "3888898" "subst" "0.000981635" "01943" "PANK2_000039" "g.3888898G>A" "" "" "" "PANK2(NM_001324191.1):c.81G>A (p.A27=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3908251G>A" "" "likely benign" "" "0000569560" "0" "30" "20" "3891273" "3891273" "subst" "1.625E-5" "01804" "PANK2_000040" "g.3891273A>C" "" "" "" "PANK2(NM_024960.4):c.158A>C (p.(Lys53Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3910626A>C" "" "likely benign" "" "0000569561" "0" "10" "20" "3891298" "3891298" "subst" "3.65646E-5" "02330" "PANK2_000041" "g.3891298C>T" "" "" "" "PANK2(NM_153638.4):c.1056C>T (p.V352=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3910651C>T" "" "benign" "" "0000569563" "0" "30" "20" "3897560" "3897565" "dup" "0" "02329" "PANK2_000026" "g.3897560_3897565dup" "" "" "" "PANK2(NM_001324191.2):c.540-14_540-9dupTTCCCC, PANK2(NM_153638.4):c.1413-14_1413-9dupTTCCCC, PANK2(NM_153638.4):c.1413-8delCinsTTCCCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3916913_3916918dup" "" "likely benign" "" "0000569564" "0" "10" "20" "3897561" "3897561" "dup" "0" "02330" "PANK2_000024" "g.3897561dup" "" "" "" "PANK2(NM_153638.4):c.1413-12delCinsTC, PANK2(NM_153638.4):c.1413-13dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3916914dup" "" "benign" "" "0000569565" "0" "30" "20" "3897570" "3897570" "subst" "2.06461E-5" "01943" "PANK2_000042" "g.3897570A>C" "" "" "" "PANK2(NM_001324191.1):c.540-4A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3916923A>C" "" "likely benign" "" "0000569566" "0" "70" "20" "3903937" "3903937" "subst" "0.000117764" "01943" "RNF24_000001" "g.3903937C>T" "" "" "" "PANK2(NM_153638.2):c.1709C>T (p.P570L), PANK2(NM_153638.4):c.1709C>T (p.P570L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3923290C>T" "" "likely pathogenic" "" "0000569567" "0" "50" "20" "3903937" "3903937" "subst" "0.000117764" "02329" "RNF24_000001" "g.3903937C>T" "" "" "" "PANK2(NM_153638.2):c.1709C>T (p.P570L), PANK2(NM_153638.4):c.1709C>T (p.P570L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3923290C>T" "" "VUS" "" "0000618117" "0" "30" "20" "3870159" "3870159" "subst" "0" "01943" "PANK2_000045" "g.3870159A>G" "" "" "" "PANK2(NM_153638.2):c.412A>G (p.R138G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889512A>G" "" "likely benign" "" "0000624154" "0" "90" "20" "3869988" "3870000" "del" "5.20519E-6" "01943" "PANK2_000043" "g.3869988_3870000del" "" "" "" "PANK2(NM_153638.2):c.241_253delGCGCGTTGGCGCA (p.A81Tfs*120)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889341_3889353del" "" "pathogenic" "" "0000624155" "0" "30" "20" "3870073" "3870073" "subst" "0" "01943" "PANK2_000044" "g.3870073C>T" "" "" "" "PANK2(NM_153638.2):c.326C>T (p.P109L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889426C>T" "" "likely benign" "" "0000650782" "1" "90" "20" "3888734" "3888734" "subst" "8.12407E-6" "03575" "PANK2_000047" "g.3888734C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs137852961}" "Germline" "" "rs137852961" "0" "" "" "g.3908087C>T" "" "pathogenic" "" "0000658756" "0" "30" "20" "3870343" "3870343" "subst" "0" "01943" "PANK2_000048" "g.3870343A>G" "" "" "" "PANK2(NM_153638.2):c.596A>G (p.Q199R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889696A>G" "" "likely benign" "" "0000658757" "0" "50" "20" "3870377" "3870377" "dup" "0" "02325" "PANK2_000014" "g.3870377dup" "" "" "" "PANK2(NM_153638.2):c.628+1_628+2insT (p.?), PANK2(NM_153638.4):c.628+2dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3889730dup" "" "VUS" "" "0000658759" "0" "50" "20" "3891459" "3891459" "subst" "0.000162537" "02325" "PANK2_000049" "g.3891459A>G" "" "" "" "PANK2(NM_001324191.1):c.344A>G (p.K115R), PANK2(NM_001324191.2):c.344A>G (p.K115R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.3910812A>G" "" "VUS" "" "0000667554" "3" "90" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Helbig 2016:26795593}" "" "" "" "Germline" "" "" "0" "" "" "g.3918695G>A" "" "pathogenic (recessive)" "ACMG" "0000727676" "0" "30" "20" "3870020" "3870020" "subst" "1.73294E-5" "01943" "PANK2_000050" "g.3870020G>A" "" "" "" "PANK2(NM_153638.2):c.273G>A (p.P91=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727677" "0" "50" "20" "3870030" "3870030" "subst" "2.28149E-5" "01943" "PANK2_000051" "g.3870030C>A" "" "" "" "PANK2(NM_153638.2):c.283C>A (p.L95I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727678" "0" "50" "20" "3891453" "3891453" "subst" "6.50153E-5" "01943" "PANK2_000052" "g.3891453A>T" "" "" "" "PANK2(NM_001324191.1):c.338A>T (p.N113I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000735636" "1" "90" "20" "3893186" "3893186" "del" "8.12275E-6" "00000" "PANK2_000020" "g.3893186del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.3912539del" "" "pathogenic" "" "0000735637" "1" "90" "20" "3869742" "3899444" "del" "0" "00000" "PANK2_000053" "g.(?_3869742)_(3899444_3903890)del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.(?_-6)_(1662+1_1663-1)del" "" "Germline" "" "" "0" "" "" "g.(?_3889095)_(3918797_3923243)del" "" "pathogenic" "" "0000735750" "2" "90" "20" "3893152" "3893152" "subst" "0" "00000" "PANK2_000054" "g.3893152G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.3912505G>A" "" "pathogenic" "" "0000735751" "2" "90" "20" "3893186" "3893186" "del" "8.12275E-6" "00000" "PANK2_000020" "g.3893186del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.3912539del" "" "pathogenic" "" "0000763138" "3" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Anazi 2017:27431290}" "" "" "ACMG PS1, PM2, PP3" "Germline" "" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "ACMG" "0000765660" "3" "90" "20" "3893161" "3893161" "subst" "0" "00000" "PANK2_000055" "g.3893161T>C" "" "{PMID:Beheshtian 2015:26497376}" "" "NM_024960.4:c.419T>C" "" "Germline" "yes" "" "0" "" "" "g.3912514T>C" "" "pathogenic (recessive)" "" "0000786976" "3" "90" "20" "3888772" "3888773" "del" "0" "00006" "PANK2_000056" "g.3888772_3888773del" "" "{PMID:Ganapathy 2019:31069529}" "" "c.828_829delTG" "" "Germline" "" "" "0" "" "" "g.3908125_3908126del" "" "pathogenic" "" "0000786977" "1" "90" "20" "3888800" "3888800" "subst" "8.1246E-6" "00006" "PANK2_000057" "g.3888800C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.3908153C>T" "" "pathogenic" "" "0000787512" "2" "50" "20" "3893208" "3893208" "subst" "0" "00000" "PANK2_000058" "g.3893208G>T" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.3912561G>T" "" "VUS" "" "0000788450" "0" "50" "20" "3891375" "3891375" "subst" "0.000239744" "00000" "PANK2_000019" "g.3891375A>G" "" "{PMID:Katagiri 2014:25268133}" "" "A1133G" "" "Germline" "" "" "0" "" "" "g.3910728A>G" "" "VUS" "" "0000788465" "0" "50" "20" "3870130" "3870130" "subst" "0.000286294" "00000" "PANK2_000059" "g.3870130G>A" "" "{PMID:Katagiri 2014:25268133}" "" "G383A" "" "Germline" "" "" "0" "" "" "g.3889483G>A" "" "VUS" "" "0000788894" "3" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Srivastava 2014:25131622}" "" "" "" "Germline" "" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000809239" "0" "50" "20" "3869784" "3869784" "subst" "4.13492E-5" "01943" "PANK2_000060" "g.3869784T>C" "" "" "" "PANK2(NM_153638.2):c.37T>C (p.W13R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809240" "0" "30" "20" "3870027" "3870027" "subst" "0.000446289" "01943" "PANK2_000061" "g.3870027C>G" "" "" "" "PANK2(NM_153638.2):c.280C>G (p.R94G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809241" "0" "50" "20" "3891347" "3891347" "subst" "0" "01943" "PANK2_000062" "g.3891347T>C" "" "" "" "PANK2(NM_001324191.1):c.232T>C (p.S78P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809242" "0" "30" "20" "3891459" "3891459" "subst" "0.000162537" "01943" "PANK2_000049" "g.3891459A>G" "" "" "" "PANK2(NM_001324191.1):c.344A>G (p.K115R), PANK2(NM_001324191.2):c.344A>G (p.K115R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809243" "0" "90" "20" "3899327" "3899327" "subst" "0" "02329" "PANK2_000063" "g.3899327C>T" "" "" "" "PANK2(NM_001324191.2):c.673C>T (p.Q225*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000809244" "0" "50" "20" "3903933" "3903933" "subst" "0" "01943" "RNF24_000002" "g.3903933A>G" "" "" "" "PANK2(NM_001324191.1):c.832A>G (p.I278V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000817862" "3" "90" "20" "3870285" "3870285" "subst" "0" "00006" "PANK2_000064" "g.3870285G>T" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.3889638G>T" "" "pathogenic (recessive)" "ACMG" "0000821460" "0" "70" "20" "3897593" "3897593" "subst" "0.000146213" "00000" "PANK2_000065" "g.3897593A>G" "" "{PMID:Turro 2020:32581362}" "" "PANK2 c.1432A>G, p.Lys478Glu" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.3916946A>G" "" "likely pathogenic" "" "0000821646" "0" "90" "20" "3897602" "3897602" "subst" "8.12453E-6" "00000" "PANK2_000066" "g.3897602C>T" "" "{PMID:Turro 2020:32581362}" "" "PANK2 c.1441C>T, p.Arg481Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.3916955C>T" "" "pathogenic" "" "0000847689" "3" "70" "20" "3888523" "3893332" "del" "0" "01164" "PANK2_000067" "g.(3870376_3888523)_(3893332_3897573)del" "" "" "" "629-50_1412+51del" "ACMG: PVS1, PM2_SUP" "Germline" "?" "" "0" "" "" "g.(3889729_3907876)_(39126853916926)del" "" "likely pathogenic (recessive)" "ACMG" "0000866455" "0" "30" "20" "3870253" "3870253" "subst" "3.12354E-5" "01943" "PANK2_000068" "g.3870253G>C" "" "" "" "PANK2(NM_153638.2):c.506G>C (p.S169T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866456" "0" "30" "20" "3870254" "3870254" "subst" "3.87285E-5" "01943" "PANK2_000069" "g.3870254C>T" "" "" "" "PANK2(NM_153638.2):c.507C>T (p.S169=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866457" "0" "30" "20" "3870278" "3870278" "subst" "2.8877E-5" "01943" "PANK2_000070" "g.3870278C>A" "" "" "" "PANK2(NM_153638.2):c.531C>A (p.A177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000868794" "3" "70" "20" "3891223" "3891223" "subst" "0" "00000" "PANK2_000077" "g.3891223G>C" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.982-1G>C, NA" "homozygous" "Germline" "yes" "" "0" "" "" "g.3910576G>C" "" "likely pathogenic" "ACMG" "0000868795" "3" "70" "20" "3891223" "3891223" "subst" "0" "00000" "PANK2_000077" "g.3891223G>C" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.982-1G>C, NA" "homozygous" "Germline" "yes" "" "0" "" "" "g.3910576G>C" "" "likely pathogenic" "ACMG" "0000868796" "3" "70" "20" "3891223" "3891223" "subst" "0" "00000" "PANK2_000077" "g.3891223G>C" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.982-1G>C, NA" "homozygous" "Germline" "yes" "" "0" "" "" "g.3910576G>C" "" "likely pathogenic" "ACMG" "0000868797" "3" "70" "20" "3888753" "3888753" "subst" "4.06154E-6" "00000" "PANK2_000074" "g.3888753T>C" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.809T>C, p.Leu270Pro" "homozygous" "Germline" "yes" "" "0" "" "" "g.3908106T>C" "" "likely pathogenic" "ACMG" "0000868798" "1" "70" "20" "3891223" "3891223" "subst" "0" "00000" "PANK2_000077" "g.3891223G>C" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.982-1G>C, NA" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.3910576G>C" "" "likely pathogenic" "ACMG" "0000868799" "2" "90" "20" "3899364" "3899364" "subst" "0" "00000" "PANK2_000083" "g.3899364C>G" "" "{PMID:Sakpichaisakul 2019:31088771}" "" "PANK2 c.1583C>G, p.Thr528Arg" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.3918717C>G" "" "pathogenic" "ACMG" "0000868800" "0" "50" "20" "3897561" "3897562" "ins" "0" "00000" "PANK2_000081" "g.3897561_3897562insTTCCCC" "" "{PMID:Han 2016:26828840}" "" "PANK2 c.540-13_540-12insTTCCCC" "different transcript: NM_001324191.1(PANK2):c.540-13_540-12insTTCCCC; heterozygous" "Unknown" "?" "" "0" "" "" "g.3916914_3916915insTTCCCC" "" "VUS" "" "0000868812" "1" "70" "20" "3891457" "3891457" "subst" "0" "00000" "PANK2_000079" "g.3891457C>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 885C>G; 1231G>A" "different transcript: NM_001386393.1:c.885C>G = NM_153638.2:c.1215C>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3910810C>G" "" "likely pathogenic" "" "0000868813" "1" "70" "20" "3888734" "3888734" "subst" "8.12407E-6" "00000" "PANK2_000047" "g.3888734C>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 460C>T; 460C>T" "different transcript: NM_001386393.1:c.460C>T = NM_153638.2:c.790C>T; homozygous" "Unknown" "?" "" "0" "" "" "g.3908087C>T" "" "likely pathogenic" "" "0000868814" "1" "70" "20" "3870148" "3870148" "subst" "0" "00000" "PANK2_000071" "g.3870148A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 71A>G; IVS4-1G>T" "different transcript: NM_001386393.1:c.71A>G = NM_153638.2:c.401A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3889501A>G" "" "likely pathogenic" "" "0000868815" "1" "70" "20" "3893186" "3893186" "del" "8.12275E-6" "00000" "PANK2_000020" "g.3893186del" "" "{PMID:Egan 2005:16023068}" "" "PANK2 987delT; 1253C>T" "different transcript: NM_001386393.1:c.987del = NM_153638.2:c.1317del; heterozygous" "Unknown" "?" "" "0" "" "" "g.3912539del" "" "likely pathogenic" "" "0000868816" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1255A>G" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868817" "1" "70" "20" "3897573" "3897573" "subst" "1.6349E-5" "00000" "PANK2_000082" "g.3897573G>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 IVS4-1G>T; 1231G>A" "different transcript: NM_153638.2:c.1413-1G>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.3916926G>T" "" "likely pathogenic" "" "0000868818" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1255A>G" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868819" "1" "70" "20" "3888888" "3888896" "del" "0" "00000" "PANK2_000076" "g.3888888_3888896del" "" "{PMID:Egan 2005:16023068}" "" "PANK2 614_622del; 1397C>T" "different transcript: NM_001386393.1:c.614_622del = NM_153638.2:c.944_952del; heterozygous" "Unknown" "?" "" "0" "" "" "g.3908241_3908249del" "" "likely pathogenic" "" "0000868820" "1" "70" "20" "3899364" "3899364" "subst" "1.62434E-5" "00000" "PANK2_000084" "g.3899364C>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1253C>T; UNK" "different transcript: NM_001386393.1:c.1253C>T = NM_153638.2:c.1583C>T; single heterozygous variant, no second allele detected" "Unknown" "?" "" "0" "" "" "g.3918717C>T" "" "likely pathogenic" "" "0000868821" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1061C>G" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868822" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1061C>G" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868823" "1" "70" "20" "3888644" "3888644" "subst" "1.62571E-5" "00000" "PANK2_000073" "g.3888644A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 370A>G; IVS4-1G>T" "different transcript: NM_001386393.1:c.370A>G = NM_153638.2:c.700A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3907997A>G" "" "likely pathogenic" "" "0000868824" "1" "70" "20" "3891339" "3891339" "del" "0" "00000" "PANK2_000078" "g.3891339del" "" "{PMID:Egan 2005:16023068}" "" "PANK2 767delC; UNK" "different transcript: NM_001386393.1:c.767del = NM_153638.2:c.1097del; single heterozygous variant, no second allele detected" "Unknown" "?" "" "0" "" "" "g.3910692del" "" "likely pathogenic" "" "0000868825" "1" "70" "20" "3870362" "3870362" "del" "0" "00000" "PANK2_000072" "g.3870362del" "" "{PMID:Egan 2005:16023068}" "" "PANK2 285delG; 370A>G" "different transcript: NM_001386393.1:c.285del = NM_153638.2:c.615del; heterozygous" "Unknown" "?" "" "0" "" "" "g.3889715del" "" "likely pathogenic" "" "0000868826" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; UNK" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; single heterozygous variant, no second allele detected" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868827" "1" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 568A>G" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868828" "2" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 885C>G; 1231G>A" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868829" "2" "70" "20" "3897573" "3897573" "subst" "1.6349E-5" "00000" "PANK2_000082" "g.3897573G>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 71A>G; IVS4-1G>T" "different transcript: NM_153638.2:c.1413-1G>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.3916926G>T" "" "likely pathogenic" "" "0000868830" "2" "70" "20" "3899364" "3899364" "subst" "1.62434E-5" "00000" "PANK2_000084" "g.3899364C>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 987delT; 1253C>T" "different transcript: NM_001386393.1:c.1253C>T = NM_153638.2:c.1583C>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918717C>T" "" "likely pathogenic" "" "0000868831" "2" "70" "20" "3899366" "3899366" "subst" "2.03037E-5" "00000" "PANK2_000085" "g.3899366A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1255A>G" "different transcript: NM_001386393.1:c.1255A>G = NM_153638.2:c.1585A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918719A>G" "" "likely pathogenic" "" "0000868832" "2" "70" "20" "3899342" "3899342" "subst" "8.93365E-5" "00000" "PANK2_000031" "g.3899342G>A" "" "{PMID:Egan 2005:16023068}" "" "PANK2 IVS4-1G>T; 1231G>A" "different transcript: NM_001386393.1:c.1231G>A = NM_153638.2:c.1561G>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918695G>A" "" "likely pathogenic" "" "0000868833" "2" "70" "20" "3899366" "3899366" "subst" "2.03037E-5" "00000" "PANK2_000085" "g.3899366A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1255A>G" "different transcript: NM_001386393.1:c.1255A>G = NM_153638.2:c.1585A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3918719A>G" "" "likely pathogenic" "" "0000868834" "2" "70" "20" "0" "0" "" "0" "00000" "DNMT3B_000000" "g.?" "" "{PMID:Egan 2005:16023068}" "" "PANK2 614_622del; 1397C>T" "different transcript: error in annotation, impossible to indicate the actual transcript and change; heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000868835" "2" "70" "20" "3893260" "3893260" "subst" "0" "00000" "PANK2_000080" "g.3893260C>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1061C>G" "different transcript: NM_001386393.1:c.1061C>G = NM_153638.2:c.1391C>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3912613C>G" "" "likely pathogenic" "" "0000868836" "2" "70" "20" "3893260" "3893260" "subst" "0" "00000" "PANK2_000080" "g.3893260C>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 1061C>G" "different transcript: NM_001386393.1:c.1061C>G = NM_153638.2:c.1391C>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3912613C>G" "" "likely pathogenic" "" "0000868837" "2" "70" "20" "3897573" "3897573" "subst" "1.6349E-5" "00000" "PANK2_000082" "g.3897573G>T" "" "{PMID:Egan 2005:16023068}" "" "PANK2 370A>G; IVS4-1G>T" "different transcript: NM_153638.2:c.1413-1G>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.3916926G>T" "" "likely pathogenic" "" "0000868838" "2" "70" "20" "3888644" "3888644" "subst" "1.62571E-5" "00000" "PANK2_000073" "g.3888644A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 285delG; 370A>G" "different transcript: NM_001386393.1:c.370A>G = NM_153638.2:c.700A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3907997A>G" "" "likely pathogenic" "" "0000868839" "2" "70" "20" "3888842" "3888842" "subst" "0" "00000" "PANK2_000075" "g.3888842A>G" "" "{PMID:Egan 2005:16023068}" "" "PANK2 1231G>A; 568A>G" "different transcript: NM_001386393.1:c.568A>G = NM_153638.2:c.898A>G; heterozygous" "Unknown" "?" "" "0" "" "" "g.3908195A>G" "" "likely pathogenic" "" "0000918967" "0" "90" "20" "3870317" "3870318" "del" "0" "01602" "PANK2_000086" "g.3870317_3870318del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.3889670_3889671del" "" "pathogenic" "ACMG" "0000926998" "0" "10" "20" "3897560" "3897561" "ins" "0" "02329" "PANK2_000023" "g.3897560_3897561insCCCCCT" "" "" "" "PANK2(NM_153638.4):c.1413-13delTinsCCCCCTT, PANK2(NM_153638.4):c.1413-14_1413-13insCCCCCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001058974" "0" "90" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.3918695G>A" "" "pathogenic" "" "0001058975" "0" "70" "20" "3893133" "3893133" "subst" "0" "00006" "PANK2_000087" "g.3893133T>C" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.3912486T>C" "" "likely pathogenic" "" "0001060753" "0" "90" "20" "3870320" "3870320" "del" "1.44367E-5" "00006" "PANK2_000088" "g.3870320del" "" "{PMID:Horbacz 2025:41210864}" "" "NM_001386393.1:c.243del" "ACMG PVS1, PM2, PP5; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.3889673del" "" "pathogenic" "ACMG" "0001060754" "0" "70" "20" "3893143" "3893143" "subst" "0" "00006" "PANK2_000089" "g.3893143T>C" "" "{PMID:Horbacz 2025:41210864}" "" "NM_001386393.1:c.944T>C" "ACMG PM1, PM2, PP3, PP5; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.3912496T>C" "" "likely pathogenic" "ACMG" "0001061713" "3" "90" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Zech 2020:33098801}" "" "" "" "Germline" "" "" "0" "" "" "g.3918695G>A" "" "pathogenic (recessive)" "" "0001061714" "3" "90" "20" "3899364" "3899364" "subst" "1.62434E-5" "00006" "PANK2_000084" "g.3899364C>T" "" "{PMID:Zech 2020:33098801}" "" "" "" "Germline" "" "" "0" "" "" "g.3918717C>T" "" "pathogenic (recessive)" "" "0001061762" "1" "70" "20" "3891328" "3891328" "subst" "0" "00006" "PANK2_000093" "g.3891328C>A" "" "{PMID:Zech 2020:33098801}" "" "" "ACMG PVS1, PM2" "Germline" "" "" "0" "" "" "g.3910681C>A" "" "likely pathogenic (recessive)" "ACMG" "0001061763" "3" "90" "20" "3888572" "3888926" "del" "0" "00006" "PANK2_000090" "g.(?_3888572)_(3888926_?)del" "" "{PMID:Zech 2020:33098801}" "" "chr20:3888573-3888924del" "ACMG PVS1, PM2, PM3" "Germline" "" "" "0" "" "" "g.(?_3907925)_(3908279_?)del" "" "pathogenic (recessive)" "ACMG" "0001061764" "1" "90" "20" "3888735" "3888735" "subst" "4.0621E-6" "00006" "PANK2_000091" "g.3888735G>A" "" "{PMID:Zech 2020:33098801}" "" "" "" "Germline" "" "" "0" "" "" "g.3908088G>A" "" "pathogenic (recessive)" "" "0001061814" "2" "90" "20" "3899342" "3899342" "subst" "8.93365E-5" "00006" "PANK2_000031" "g.3899342G>A" "" "{PMID:Zech 2020:33098801}" "" "" "" "Germline" "" "" "0" "" "" "g.3918695G>A" "" "pathogenic (recessive)" "" "0001061815" "2" "90" "20" "3888767" "3888768" "del" "0" "00006" "PANK2_000092" "g.3888767_3888768del" "" "{PMID:Zech 2020:33098801}" "" "823_824delCT" "" "Germline" "" "" "0" "" "" "g.3908120_3908121del" "" "pathogenic (recessive)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PANK2 ## Count = 138 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000237841" "00025254" "90" "539" "0" "561" "0" "c.539_561del" "r.(?)" "p.(Glu180Glyfs*42)" "" "0000249977" "00025254" "30" "137" "0" "137" "0" "c.137A>T" "r.(?)" "p.(Asp46Val)" "" "0000254068" "00025254" "30" "137" "0" "137" "0" "c.137A>T" "r.(?)" "p.(Asp46Val)" "" "0000293423" "00025254" "50" "184" "0" "184" "0" "c.184G>A" "r.(?)" "p.(Glu62Lys)" "" "0000293424" "00025254" "10" "276" "0" "276" "0" "c.276G>A" "r.(?)" "p.(Arg92=)" "" "0000293425" "00025254" "10" "380" "0" "380" "0" "c.380G>T" "r.(?)" "p.(Gly127Val)" "" "0000293426" "00025254" "10" "585" "0" "585" "0" "c.585G>T" "r.(?)" "p.(Ser195=)" "" "0000296748" "00025254" "90" "1317" "0" "1317" "0" "c.1317del" "r.(?)" "p.(Arg440ValfsTer10)" "" "0000296749" "00025254" "30" "1413" "-13" "1413" "-13" "c.1413-13dup" "r.(=)" "p.(=)" "" "0000296750" "00025254" "30" "1413" "-14" "1413" "-13" "c.1413-14_1413-13insCCCCCT" "r.(=)" "p.(=)" "" "0000296752" "00025254" "10" "1413" "-14" "1413" "-9" "c.1413-14_1413-9dup" "r.(=)" "p.(=)" "" "0000296754" "00025254" "90" "1442" "0" "1444" "0" "c.1442_1444del" "r.(?)" "p.(Arg481_Glu482delinsGln)" "" "0000296755" "00025254" "30" "276" "0" "276" "0" "c.276G>A" "r.(?)" "p.(Arg92=)" "" "0000296756" "00025254" "90" "355" "0" "355" "0" "c.355C>T" "r.(?)" "p.(Arg119Ter)" "" "0000296757" "00025254" "10" "377" "0" "377" "0" "c.377G>C" "r.(?)" "p.(Gly126Ala)" "" "0000296758" "00025254" "50" "388" "0" "388" "0" "c.388G>T" "r.(?)" "p.(Gly130Cys)" "" "0000296759" "00025254" "50" "717" "0" "717" "0" "c.717G>T" "r.(?)" "p.(Glu239Asp)" "" "0000298790" "00025254" "10" "332" "0" "332" "0" "c.332T>A" "r.(?)" "p.(Leu111Gln)" "" "0000298791" "00025254" "10" "377" "0" "377" "0" "c.377G>C" "r.(?)" "p.(Gly126Ala)" "" "0000300604" "00025254" "70" "1594" "0" "1594" "0" "c.1594C>T" "r.(?)" "p.(Arg532Trp)" "" "0000304988" "00025254" "30" "276" "0" "276" "0" "c.276G>A" "r.(?)" "p.(Arg92=)" "" "0000304989" "00025254" "30" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Leu95Phe)" "" "0000304990" "00025254" "10" "332" "0" "332" "0" "c.332T>A" "r.(?)" "p.(Leu111Gln)" "" "0000304991" "00025254" "90" "355" "0" "355" "0" "c.355C>T" "r.(?)" "p.(Arg119Ter)" "" "0000304992" "00025254" "10" "377" "0" "377" "0" "c.377G>C" "r.(?)" "p.(Gly126Ala)" "" "0000304993" "00025254" "10" "519" "0" "519" "0" "c.519C>G" "r.(?)" "p.(Pro173=)" "" "0000304994" "00025254" "30" "521" "0" "521" "0" "c.521C>T" "r.(?)" "p.(Ala174Val)" "" "0000304995" "00025254" "30" "666" "0" "666" "0" "c.666G>A" "r.(?)" "p.(Leu222=)" "" "0000304996" "00025254" "90" "738" "0" "739" "0" "c.738_739del" "r.(?)" "p.(Ser247HisfsTer44)" "" "0000304997" "00025254" "30" "819" "0" "819" "0" "c.819G>A" "r.(?)" "p.(Leu273=)" "" "0000328285" "00025254" "50" "48" "0" "50" "0" "c.48_50del" "r.(?)" "p.(Pro17del)" "" "0000328287" "00025254" "50" "628" "2" "628" "2" "c.628+2dup" "r.spl?" "p.?" "" "0000328289" "00025254" "50" "1133" "0" "1133" "0" "c.1133A>G" "r.(?)" "p.(Asp378Gly)" "" "0000328290" "00025254" "50" "1612" "0" "1612" "0" "c.1612T>G" "r.(?)" "p.(Leu538Val)" "" "0000342519" "00025254" "50" "833" "0" "833" "0" "c.833G>T" "r.(?)" "p.(Arg278Leu)" "" "0000345677" "00025254" "10" "377" "0" "377" "0" "c.377G>C" "r.(?)" "p.(Gly126Ala)" "" "0000346136" "00025254" "90" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000569549" "00025254" "30" "29" "0" "29" "0" "c.29G>T" "r.(?)" "p.(Arg10Leu)" "" "0000569550" "00025254" "10" "96" "0" "96" "0" "c.96C>T" "r.(?)" "p.(Thr32=)" "" "0000569551" "00025254" "30" "137" "0" "137" "0" "c.137A>T" "r.(?)" "p.(Asp46Val)" "" "0000569552" "00025254" "30" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Leu95Phe)" "" "0000569553" "00025254" "30" "321" "0" "321" "0" "c.321G>A" "r.(?)" "p.(Arg107=)" "" "0000569555" "00025254" "50" "380" "0" "380" "0" "c.380G>T" "r.(?)" "p.(Gly127Val)" "" "0000569556" "00025254" "30" "380" "0" "380" "0" "c.380G>T" "r.(?)" "p.(Gly127Val)" "" "0000569557" "00025254" "30" "654" "0" "654" "0" "c.654C>T" "r.(?)" "p.(Ile218=)" "" "0000569558" "00025254" "50" "787" "0" "787" "0" "c.787A>T" "r.(?)" "p.(Ile263Phe)" "" "0000569559" "00025254" "30" "954" "0" "954" "0" "c.954G>A" "r.(?)" "p.(Ala318=)" "" "0000569560" "00025254" "30" "1031" "0" "1031" "0" "c.1031A>C" "r.(?)" "p.(Lys344Thr)" "" "0000569561" "00025254" "10" "1056" "0" "1056" "0" "c.1056C>T" "r.(?)" "p.(Val352=)" "" "0000569563" "00025254" "30" "1413" "-14" "1413" "-9" "c.1413-14_1413-9dup" "r.(=)" "p.(=)" "" "0000569564" "00025254" "10" "1413" "-13" "1413" "-13" "c.1413-13dup" "r.(=)" "p.(=)" "" "0000569565" "00025254" "30" "1413" "-4" "1413" "-4" "c.1413-4A>C" "r.spl?" "p.?" "" "0000569566" "00025254" "70" "1709" "0" "1709" "0" "c.1709C>T" "r.(?)" "p.(Pro570Leu)" "" "0000569567" "00025254" "50" "1709" "0" "1709" "0" "c.1709C>T" "r.(?)" "p.(Pro570Leu)" "" "0000618117" "00025254" "30" "412" "0" "412" "0" "c.412A>G" "r.(?)" "p.(Arg138Gly)" "" "0000624154" "00025254" "90" "241" "0" "253" "0" "c.241_253del" "r.(?)" "p.(Ala81ThrfsTer120)" "" "0000624155" "00025254" "30" "326" "0" "326" "0" "c.326C>T" "r.(?)" "p.(Pro109Leu)" "" "0000650782" "00025254" "90" "790" "0" "790" "0" "c.790C>T" "r.(?)" "p.(Arg264Trp)" "" "0000658756" "00025254" "30" "596" "0" "596" "0" "c.596A>G" "r.(?)" "p.(Gln199Arg)" "" "0000658757" "00025254" "50" "628" "2" "628" "2" "c.628+2dup" "r.spl?" "p.?" "" "0000658759" "00025254" "50" "1217" "0" "1217" "0" "c.1217A>G" "r.(?)" "p.(Lys406Arg)" "" "0000667554" "00025254" "90" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000727676" "00025254" "30" "273" "0" "273" "0" "c.273G>A" "r.(?)" "p.(Pro91=)" "" "0000727677" "00025254" "50" "283" "0" "283" "0" "c.283C>A" "r.(?)" "p.(Leu95Ile)" "" "0000727678" "00025254" "50" "1211" "0" "1211" "0" "c.1211A>T" "r.(?)" "p.(Asn404Ile)" "" "0000735636" "00025254" "90" "1317" "0" "1317" "0" "c.1317del" "r.(?)" "p.(Arg440Valfs*10)" "" "0000735637" "00025254" "90" "0" "0" "0" "0" "c.-6_(1662+1_1663-1){0}" "r.0" "p.0" "" "0000735750" "00025254" "90" "1283" "0" "1283" "0" "c.1283G>A" "r.(?)" "p.(Cys428Tyr)" "" "0000735751" "00025254" "90" "1317" "0" "1317" "0" "c.1317del" "r.(?)" "p.(Arg440Valfs*10)" "" "0000763138" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000765660" "00025254" "90" "1292" "0" "1292" "0" "c.1292T>C" "r.(?)" "p.(Phe431Ser)" "4" "0000786976" "00025254" "90" "828" "0" "829" "0" "c.828_829del" "r.(?)" "p.(Cys276TrpfsTer15)" "2" "0000786977" "00025254" "90" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286Cys)" "2" "0000787512" "00025254" "50" "1339" "0" "1339" "0" "c.1339G>T" "r.(?)" "p.(Asp447Tyr)" "4" "0000788450" "00025254" "50" "1133" "0" "1133" "0" "c.1133A>G" "r.(?)" "p.(Asp378Gly)" "3" "0000788465" "00025254" "50" "383" "0" "383" "0" "c.383G>A" "r.(?)" "p.(Arg128Gln)" "1" "0000788894" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000809239" "00025254" "50" "37" "0" "37" "0" "c.37T>C" "r.(?)" "p.(Trp13Arg)" "" "0000809240" "00025254" "30" "280" "0" "280" "0" "c.280C>G" "r.(?)" "p.(Arg94Gly)" "" "0000809241" "00025254" "50" "1105" "0" "1105" "0" "c.1105T>C" "r.(?)" "p.(Ser369Pro)" "" "0000809242" "00025254" "30" "1217" "0" "1217" "0" "c.1217A>G" "r.(?)" "p.(Lys406Arg)" "" "0000809243" "00025254" "90" "1546" "0" "1546" "0" "c.1546C>T" "r.(?)" "p.(Gln516*)" "" "0000809244" "00025254" "50" "1705" "0" "1705" "0" "c.1705A>G" "r.(?)" "p.(Ile569Val)" "" "0000817862" "00025254" "90" "538" "0" "538" "0" "c.538G>T" "r.(?)" "p.(Glu180Ter)" "" "0000821460" "00025254" "70" "1432" "0" "1432" "0" "c.1432A>G" "r.(?)" "p.(Lys478Glu)" "" "0000821646" "00025254" "90" "1441" "0" "1441" "0" "c.1441C>T" "r.(?)" "p.(Arg481Ter)" "" "0000847689" "00025254" "70" "629" "-50" "1412" "51" "c.(628+1_629-50)_(1412+51_1413-1)del" "r.(?)" "p.(Leu210Profs*5)" "" "0000866455" "00025254" "30" "506" "0" "506" "0" "c.506G>C" "r.(?)" "p.(Ser169Thr)" "" "0000866456" "00025254" "30" "507" "0" "507" "0" "c.507C>T" "r.(?)" "p.(Ser169=)" "" "0000866457" "00025254" "30" "531" "0" "531" "0" "c.531C>A" "r.(?)" "p.(Ala177=)" "" "0000868794" "00025254" "70" "982" "-1" "982" "-1" "c.982-1G>C" "r.spl" "p.?" "2i" "0000868795" "00025254" "70" "982" "-1" "982" "-1" "c.982-1G>C" "r.spl" "p.?" "2i" "0000868796" "00025254" "70" "982" "-1" "982" "-1" "c.982-1G>C" "r.spl" "p.?" "2i" "0000868797" "00025254" "70" "809" "0" "809" "0" "c.809T>C" "r.(?)" "p.(Leu270Pro)" "2" "0000868798" "00025254" "70" "982" "-1" "982" "-1" "c.982-1G>C" "r.spl" "p.?" "2i" "0000868799" "00025254" "90" "1583" "0" "1583" "0" "c.1583C>G" "r.(?)" "p.(Thr528Arg)" "6" "0000868800" "00025254" "50" "1413" "-13" "1413" "-12" "c.1413-13_1413-12insTTCCCC" "r.spl?" "p.?" "4i" "0000868812" "00025254" "70" "1215" "0" "1215" "0" "c.1215C>G" "r.(?)" "p.(Tyr405Ter)" "" "0000868813" "00025254" "70" "790" "0" "790" "0" "c.790C>T" "r.(?)" "p.(Arg264Trp)" "" "0000868814" "00025254" "70" "401" "0" "401" "0" "c.401A>G" "r.(?)" "p.(Glu134Gly)" "" "0000868815" "00025254" "70" "1317" "0" "1317" "0" "c.1317del" "r.(?)" "p.(Arg440ValfsTer10)" "" "0000868816" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868817" "00025254" "70" "1413" "-1" "1413" "-1" "c.1413-1G>T" "r.(?)" "p.?" "" "0000868818" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868819" "00025254" "70" "944" "0" "952" "0" "c.944_952del" "r.(?)" "p.(Gly315_Gly317del)" "" "0000868820" "00025254" "70" "1583" "0" "1583" "0" "c.1583C>T" "r.(?)" "p.(Thr528Met)" "" "0000868821" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868822" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868823" "00025254" "70" "700" "0" "700" "0" "c.700A>G" "r.(?)" "p.(Thr234Ala)" "" "0000868824" "00025254" "70" "1097" "0" "1097" "0" "c.1097del" "r.(?)" "p.(Pro366LeufsTer14)" "" "0000868825" "00025254" "70" "615" "0" "615" "0" "c.615del" "r.(?)" "p.(Lys207SerfsTer46)" "" "0000868826" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868827" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868828" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868829" "00025254" "70" "1413" "-1" "1413" "-1" "c.1413-1G>T" "r.(?)" "p.?" "" "0000868830" "00025254" "70" "1583" "0" "1583" "0" "c.1583C>T" "r.(?)" "p.(Thr528Met)" "" "0000868831" "00025254" "70" "1585" "0" "1585" "0" "c.1585A>G" "r.(?)" "p.(Ile529Val)" "" "0000868832" "00025254" "70" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0000868833" "00025254" "70" "1585" "0" "1585" "0" "c.1585A>G" "r.(?)" "p.(Ile529Val)" "" "0000868834" "00025254" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000868835" "00025254" "70" "1391" "0" "1391" "0" "c.1391C>G" "r.(?)" "p.(Pro464Arg)" "" "0000868836" "00025254" "70" "1391" "0" "1391" "0" "c.1391C>G" "r.(?)" "p.(Pro464Arg)" "" "0000868837" "00025254" "70" "1413" "-1" "1413" "-1" "c.1413-1G>T" "r.(?)" "p.?" "" "0000868838" "00025254" "70" "700" "0" "700" "0" "c.700A>G" "r.(?)" "p.(Thr234Ala)" "" "0000868839" "00025254" "70" "898" "0" "898" "0" "c.898A>G" "r.(?)" "p.(Arg300Gly)" "" "0000918967" "00025254" "90" "570" "0" "571" "0" "c.570_571del" "r.(?)" "p.(Tyr190*)" "" "0000926998" "00025254" "10" "1413" "-14" "1413" "-13" "c.1413-14_1413-13insCCCCCT" "r.(=)" "p.(=)" "" "0001058974" "00025254" "90" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0001058975" "00025254" "70" "1264" "0" "1264" "0" "c.1264T>C" "r.(?)" "p.(Cys422Arg)" "" "0001060753" "00025254" "90" "243" "0" "243" "0" "c.243del" "r.(?)" "p.(Ser81ArgfsTer14)" "" "0001060754" "00025254" "70" "944" "0" "944" "0" "c.944T>C" "r.(?)" "p.(Leu315Pro)" "" "0001061713" "00025254" "90" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0001061714" "00025254" "90" "1583" "0" "1583" "0" "c.1583C>T" "r.(?)" "p.(Thr528Met)" "" "0001061762" "00025254" "70" "1086" "0" "1086" "0" "c.1086C>A" "r.(?)" "p.(Tyr362Ter)" "" "0001061763" "00025254" "90" "629" "-1" "980" "1" "c.(?_629-1)_(980+1_?)del" "r.0" "p.0" "" "0001061764" "00025254" "90" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264Gln)" "" "0001061814" "00025254" "90" "1561" "0" "1561" "0" "c.1561G>A" "r.(?)" "p.(Gly521Arg)" "" "0001061815" "00025254" "90" "823" "0" "824" "0" "c.823_824del" "r.(?)" "p.(Leu275ValfsTer16)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 66 "{{screeningid}}" "{{variantid}}" "0000145469" "0000237841" "0000294093" "0000650782" "0000304156" "0000667554" "0000336361" "0000735636" "0000336361" "0000735750" "0000336362" "0000735637" "0000336362" "0000735751" "0000362764" "0000763138" "0000364753" "0000765660" "0000375625" "0000786976" "0000375626" "0000786977" "0000375626" "0000787512" "0000376622" "0000788450" "0000376624" "0000788465" "0000376839" "0000788894" "0000389069" "0000817862" "0000391710" "0000821460" "0000391710" "0000821646" "0000410400" "0000847689" "0000411612" "0000868794" "0000411613" "0000868795" "0000411614" "0000868796" "0000411615" "0000868797" "0000411616" "0000868798" "0000411616" "0000868799" "0000411617" "0000868800" "0000411625" "0000868812" "0000411625" "0000868828" "0000411626" "0000868813" "0000411627" "0000868814" "0000411627" "0000868829" "0000411628" "0000868815" "0000411628" "0000868830" "0000411629" "0000868816" "0000411629" "0000868831" "0000411630" "0000868817" "0000411630" "0000868832" "0000411631" "0000868818" "0000411631" "0000868833" "0000411632" "0000868819" "0000411632" "0000868834" "0000411633" "0000868820" "0000411634" "0000868821" "0000411634" "0000868835" "0000411635" "0000868822" "0000411635" "0000868836" "0000411636" "0000868823" "0000411636" "0000868837" "0000411637" "0000868824" "0000411638" "0000868825" "0000411638" "0000868838" "0000411639" "0000868826" "0000411640" "0000868827" "0000411640" "0000868839" "0000433320" "0000918967" "0000470852" "0001058974" "0000470853" "0001058975" "0000472355" "0001060754" "0000472366" "0001060753" "0000472969" "0001061713" "0000472970" "0001061714" "0000473018" "0001061762" "0000473018" "0001061814" "0000473019" "0001061763" "0000473020" "0001061764" "0000473020" "0001061815"