### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PCDH15) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PCDH15" "protocadherin-related 15" "10" "q21.1" "unknown" "NG_009191.3" "UD_132118599259" "{PMID:Bonnet 2016:27460420}" "https://www.LOVD.nl/PCDH15" "KMeyeDB \r\nUSMA (Usher Syndrome Missense Analysis) \r\nDeafness Variation Database \r\nMoBiDiC " "1" "14674" "65217" "605514" "1" "1" "1" "1" "The database is curated by the Montpellier Usher group.
You can directly access the PCDH15 database using: www.LOVD.nl/PCDH15
If you wish to perform particular analyses, please do not hesitate to contact us. We hope that you will find these databases useful!
This database is one of the ”Retinal and hearing impairment genetic variant databases”.
Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/PCDH15_codingDNA.html" "1" "" "
\r\nThis database is one of the ”Retinal and hearing impairment genetic variant databases”." "-1" "" "-1" "00001" "2010-03-02 00:00:00" "00110" "2018-07-20 14:49:34" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00015744" "PCDH15" "transcript variant C" "010" "NM_033056.3" "" "NP_149045.3" "" "" "" "-395" "6626" "5868" "56561051" "55580860" "" "0000-00-00 00:00:00" "" "" "00025927" "PCDH15" "transcript variant R (removed from reference sequence) (removed from reference sequence)" "000" "NM_001384140.1" "" "NP_001371069.1" "" "" "MANE select" "-335" "9031" "5223" "1" "1" "00006" "2024-05-24 11:57:06" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00531" "DFNB;ARNSHL" "deafness, autosomal recessive, nonsyndromic (DFNB, autosomal recessive non syndromic hearing loss (ARNSHL))" "" "" "" "" "" "00006" "2014-09-21 11:25:16" "00006" "2015-12-08 23:59:30" "02115" "USH1" "Usher syndrome, type I (USH-1)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-11 13:56:28" "02283" "DFNB2" "deafness, autosomal recessive, type 2 (DFNB-2)" "AR" "600060" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02413" "USH1F" "Usher syndrome, type 1F (USH-1F)" "AR" "602083" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02858" "DFNB23" "deafness, autosomal recessive, type 23 (DFNB-23)" "AR" "609533" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05103" "deafness" "deafness" "" "" "" "" "" "00006" "2015-12-02 12:30:46" "00006" "2017-08-25 19:47:08" "05400" "DFNB" "deafness, autosomal recessive (DFNB)" "" "" "" "autosomal recessive" "" "00006" "2018-02-24 17:20:21" "" "" "05414" "USH2" "Usher syndrome, type II (USH-2)" "" "" "" "" "" "00006" "2018-04-02 14:40:34" "00006" "2021-12-11 13:56:28" "05415" "USH" "Usher syndrome (USH)" "" "" "" "" "" "00006" "2018-04-02 16:40:44" "" "" "05458" "DFN" "deafness, nonsyndromic (DFN)" "" "" "" "" "" "00006" "2018-07-12 10:48:26" "" "" "05459" "USH3" "Usher syndrome, type III (USH-3)" "" "" "" "" "" "00006" "2018-07-12 10:56:37" "00006" "2021-12-11 13:56:28" "05476" "SEMDSP" "dysplasia, spondyloepimetaphyseal, SPONASTRIME type (SEMDSP)" "AR" "271510" "" "autosomal recesive" "" "00006" "2018-10-20 03:14:40" "00006" "2020-05-19 10:37:38" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 6 "{{geneid}}" "{{diseaseid}}" "PCDH15" "02115" "PCDH15" "02413" "PCDH15" "02858" "PCDH15" "05400" "PCDH15" "05415" "PCDH15" "05458" ## Individuals ## Do not remove or alter this header ## ## Count = 371 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00059177" "" "" "" "1" "" "01551" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "" "" "0" "" "" "" "" "00060237" "" "" "" "1" "" "01542" "{PMID:Brownstein 2014:24105371}, {DOI:Brownstein 2014:10.1038/ejhg.2013.232}" "digenic inheritance DFNB2/DFNB23" "" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00080031" "" "" "" "1" "" "01740" "{PMID:Zazo Seco 2017:28000701}, {DOI:Zazo Seco 2017:10.1038/ejhg.2016.182}" "" "" "" "" "" "0" "" "" "" "" "00081034" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00155516" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00165754" "" "" "" "1" "" "02416" "{PMID:Oshima 2008:18429043}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00166131" "" "" "" "1" "" "02416" "" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166132" "" "" "" "1" "" "02416" "{PMID:Doucette 2009:19107147}" "Relative" "F" "" "Canada" "" "0" "" "" "" "" "00166133" "" "" "" "1" "" "02416" "{PMID:Doucette 2009:19107147}" "Relative" "M" "" "Canada" "" "0" "" "" "" "" "00166134" "" "" "" "1" "" "02416" "{PMID:Doucette 2009:19107147}" "Relative" "F" "" "Canada" "" "0" "" "" "" "" "00166135" "" "" "" "1" "" "02416" "{PMID:Doucette 2009:19107147}" "Proband" "F" "" "Canada" "" "0" "" "" "" "" "00166136" "" "" "" "1" "" "02416" "{PMID:Doucette 2009:19107147}" "Relative" "M" "" "Canada" "" "0" "" "" "" "" "00166137" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166138" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00166139" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00166140" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166141" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166142" "" "" "" "1" "" "02416" "{PMID:Roux 2006:16679490}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00166143" "" "" "" "1" "" "02416" "{PMID:Brownstein 2004:15028842}" "Relative" "F" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00166144" "" "" "" "1" "" "02416" "{PMID:Brownstein 2004:15028842}" "Proband" "M" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00166145" "" "" "" "1" "" "02416" "{PMID:Brownstein 2004:15028842}" "Relative" "M" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00166146" "" "" "" "1" "" "02416" "{PMID:Brownstein 2004:15028842}" "Proband" "M" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00166147" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "United States" "" "0" "" "" "" "" "00166148" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "" "00166149" "" "" "" "1" "" "02416" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "Proband" "" "" "Spain" "" "0" "" "" "" "RP-1034" "00166150" "" "" "" "1" "" "02418" "{PMID:Jaijo 2012:22815625}" "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "RP-1387" "00166151" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "United States" "" "0" "" "" "" "" "00166152" "" "" "" "1" "" "02416" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "Proband" "" "" "Spain" "" "0" "" "" "" "RP-367" "00166153" "" "" "" "1" "" "02418" "{PMID:Jaijo 2012:22815625}" "Proband" "" "" "Spain" "" "0" "" "" "" "RP-576M" "00166154" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "" "00166155" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "" "00166157" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "" "00166158" "" "" "" "1" "" "02418" "Oshima et al." "Proband - P51 6th Molecular Biology of Hearing and Deafness Conference, Cambridge, 2007" "" "" "Spain" "" "0" "" "" "" "" "00166159" "" "" "" "1" "" "02418" "{PMID:Jaijo 2012:22815625}" "Proband - Minigene studies in Aparisi et al., 2013" "" "" "Spain" "" "0" "" "" "" "RP-1323" "00166160" "" "" "" "1" "" "02416" "{PMID:Jaijo 2010:19683999}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00166161" "" "" "" "1" "" "02416" "{PMID:Jaijo 2010:19683999}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00166162" "" "" "" "1" "" "02416" "{PMID:Jaijo 2010:19683999}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00166163" "" "" "" "1" "" "02416" "{PMID:Hutchin 2005:16283880}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166164" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Proband" "F" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166165" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166166" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "F" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166167" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166168" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Proband" "F" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166169" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166170" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166171" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Relative" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166172" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Proband" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166173" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Proband" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166174" "" "" "" "1" "" "02416" "{PMID:Ben-Yosef 2003:12711741}" "Proband" "F" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00166175" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166176" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166177" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166178" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166179" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166180" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166181" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166182" "" "" "" "1" "" "02416" "{PMID:Ahmed 2001:11398101}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166183" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166184" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166185" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166186" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166187" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166188" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166189" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166190" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166191" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166192" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166193" "" "" "" "1" "" "02416" "{PMID:Ahmed 2003:14570705}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166194" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166195" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166196" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166197" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166198" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166199" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166200" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166201" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166202" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166203" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166204" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166205" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166206" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "F" "" "Pakistan" "" "0" "" "" "" "" "00166207" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166208" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166209" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166210" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166211" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166212" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166213" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166214" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166215" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166216" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166217" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "F" "" "Pakistan" "" "0" "" "" "" "" "00166218" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166219" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166220" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166221" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166222" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166223" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166224" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166225" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166226" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166227" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "M" "" "Pakistan" "" "0" "" "" "" "" "00166228" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166229" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166230" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166231" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166232" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Proband" "F" "" "Pakistan" "" "0" "" "" "" "" "00166233" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166234" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "F" "" "Pakistan" "" "0" "" "" "" "" "00166235" "" "" "" "1" "" "02416" "{PMID:Ahmed 2008:18719945}" "Relative" "M" "" "Pakistan" "" "0" "" "" "" "" "00166236" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Proband" "M" "" "United States" "" "0" "" "" "Hutterite" "" "00166237" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Relative" "M" "" "United States" "" "0" "" "" "Hutterite" "" "00166238" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Proband" "M" "" "India" "" "0" "" "" "" "" "00166239" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Relative" "M" "" "India" "" "0" "" "" "" "" "00166240" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Relative" "F" "" "India" "" "0" "" "" "" "" "00166241" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Relative" "M" "" "India" "" "0" "" "" "" "" "00166242" "" "" "" "1" "" "02416" "{PMID:Alagramam 2001:11487575}" "Relative" "M" "" "India" "" "0" "" "" "" "" "00166243" "" "" "" "1" "" "02416" "{PMID:Ouyang 2005:15660226}" "Proband" "" "" "United States" "" "0" "" "" "" "" "00166244" "" "" "" "1" "" "02416" "{PMID:Ouyang 2005:15660226}" "Proband" "" "" "United States" "" "0" "" "" "" "" "00166245" "" "" "" "1" "" "02416" "{PMID:Ouyang 2005:15660226}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166246" "" "" "" "1" "" "02416" "{PMID:Ouyang 2005:15660226}" "Proband" "F" "" "United States" "" "0" "" "" "" "" "00166247" "" "" "" "1" "" "02416" "{PMID:Zheng 2005:15537665}" "Proband" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166248" "" "" "" "1" "" "02416" "{PMID:Ouyang 2005:15660226}" "Proband" "M" "" "United States" "" "0" "" "" "" "" "00166249" "" "" "" "1" "" "02416" "{PMID:Jacobson 2008:18463160}" "Proband" "M" "" "" "" "0" "" "" "" "" "00166250" "" "" "" "1" "" "02416" "{PMID:Baux 2008:18484607}" "Proband - also in Ammar-Khodja et al., 2009" "" "" "Algeria" "" "0" "" "" "" "" "00166467" "" "" "" "1" "" "02416" "{PMID:Roux 2011:21436283}" "Proband" "F" "" "Belgium" "" "0" "" "" "" "" "00166470" "" "" "" "1" "" "02416" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "Proband" "" "" "Spain" "" "0" "" "" "" "RP-982" "00166474" "" "" "" "1" "" "02416" "{PMID:Roux 2011:21436283}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166475" "" "" "" "1" "" "02416" "{PMID:Roux 2011:21436283}" "Proband" "M" "" "Italy" "" "0" "" "" "" "" "00166476" "" "" "" "1" "" "02416" "{PMID:Roux 2011:21436283}" "Proband" "" "" "France" "" "0" "" "" "" "" "00166477" "" "" "" "1" "" "02416" "{PMID:Roux 2011:21436283}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00166498" "" "" "" "1" "" "02416" "{PMID:Malm 2010:21174530}" "Proband" "" "" "Sweden" "" "0" "" "" "" "" "00166510" "" "" "" "1" "" "02416" "{PMID:Duman 2011:21117948}" "Proband" "" "" "Turkey" "" "0" "" "" "" "" "00166511" "" "" "" "1" "" "02416" "{PMID:Duman 2011:21117948}" "Relative" "" "" "Turkey" "" "0" "" "" "" "" "00166512" "" "" "" "1" "" "02416" "{PMID:Duman 2011:21117948}" "Relative" "" "" "Turkey" "" "0" "" "" "" "" "00166525" "" "" "" "1" "" "02416" "{PMID:Bonnet 2011:21569298}" "Proband" "" "" "" "" "0" "" "" "" "" "00166526" "" "" "" "1" "" "02416" "{PMID:Bonnet 2011:21569298}" "Proband" "" "" "" "" "0" "" "" "" "" "00166566" "" "" "" "1" "" "02416" "{PMID:Vozzi 2011:21738395}" "Proband" "" "" "Italy" "" "0" "" "" "" "" "00166568" "" "" "" "1" "" "02416" "{PMID:Vozzi 2011:21738395}" "Proband" "" "" "Italy" "" "0" "" "" "" "" "00166590" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166593" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166594" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166595" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166596" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166597" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166600" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166602" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166603" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166607" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166611" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166615" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166616" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166617" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166618" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166622" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166628" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166629" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166638" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166639" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166640" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166642" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166646" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166653" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166654" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166655" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166660" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166661" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166663" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166667" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166668" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166670" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166672" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166673" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166675" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166677" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166679" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166681" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166684" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166690" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166691" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166693" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166694" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166695" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166702" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166704" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166713" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166727" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166733" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166734" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166735" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166739" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166740" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166746" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166748" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166750" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166752" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166754" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166758" "" "" "" "1" "" "02419" "{PMID:Le Quesne Stabej 2012:22135276}" "Proband" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00166894" "" "" "" "1" "" "02416" "{PMID:Neveling 2012:22334370}" "Proband" "F" "" "" "" "0" "" "" "" "" "00166907" "" "" "" "1" "" "02416" "{PMID:Neveling 2012:22334370}" "Proband" "F" "" "" "" "0" "" "" "" "" "00167050" "" "" "" "1" "" "02416" "{PMID:Jaijo 2012:22815625}" "Proband - Minigene studies in Aparisi et al., 2013" "" "" "Spain" "" "0" "" "" "" "RP-219" "00167051" "" "" "" "1" "" "02416" "{PMID:Jaijo 2012:22815625}" "Proband - Minigene studies in Aparisi et al., 2013" "" "" "Spain" "" "0" "" "" "" "RP-1286" "00167139" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia 2014:24498627}" "Proband" "M" "" "Spain" "" "0" "" "" "" "" "00167140" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia 2014:24498627}" "Proband" "F" "" "" "" "0" "" "" "" "" "00167147" "" "" "" "1" "" "02416" "{PMID:Glöcke 2013:23591405}" "Proband" "" "" "" "" "0" "" "" "" "" "00167154" "" "" "" "1" "" "02416" "{PMID:Yang 2013:23767834}" "Proband" "" "" "China" "" "0" "" "" "" "" "00167155" "" "" "" "1" "" "02416" "{PMID:Yang 2013:23767834}" "Proband" "" "" "China" "" "0" "" "" "" "" "00167156" "" "" "" "1" "" "02416" "{PMID:Yang 2013:23767834}" "Proband" "" "" "China" "" "0" "" "" "" "" "00167238" "" "" "" "1" "" "00143" "{PMID:Krawitz 2014:25333064}" "Proband" "M" "" "Germany" "" "0" "" "" "" "" "00167281" "" "" "" "1" "" "02416" "{PMID:Mutai 2013:24164807}" "Proband" "F" "" "Japan" "" "0" "" "" "" "" "00167282" "" "" "" "1" "" "02416" "{PMID:Mutai 2013:24164807}" "Relative" "F" "" "Japan" "" "0" "" "" "" "" "00167283" "" "" "" "1" "" "02416" "{PMID:Mutai 2013:24164807}" "Relative" "F" "" "Japan" "" "0" "" "" "" "" "00167301" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167302" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167303" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167304" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167305" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167306" "" "" "" "1" "" "02416" "{PMID:Yoshimura 2014:24618850}" "Proband" "" "" "Japan" "" "0" "" "" "" "" "00167441" "" "" "" "1" "" "02416" "{PMID:Rong 2014:24831256}" "Proband - variants found in samples of two affected brothers. They carry the same causative mutations in MYO7A, but other variants cannot be discriminated from the publication." "M" "" "China" "" "0" "" "" "" "" "00167442" "" "" "" "1" "" "02416" "{PMID:Rong 2014:24831256}" "Proband" "F" "" "China" "" "0" "" "" "" "" "00167443" "" "" "" "1" "" "02416" "{PMID:Rong 2014:24831256}" "Proband" "M" "" "China" "" "0" "" "" "" "" "00167648" "" "" "" "1" "" "02416" "{PMID:Aparisi 2014:25404053}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00167651" "" "" "" "1" "" "02416" "{PMID:Aparisi 2014:25404053}" "Proband" "" "" "Spain" "" "0" "" "" "" "" "00167668" "" "" "" "1" "" "02416" "{PMID:Bujakowska 2014:25468891}" "Proband" "M" "" "United States" "" "0" "" "" "" "" "00167669" "" "" "" "1" "" "02416" "{PMID:Bujakowska 2014:25468891}" "Relative" "M" "" "United States" "" "0" "" "" "" "" "00167673" "" "" "" "1" "" "02416" "{PMID:Bujakowska 2014:25468891}" "Proband" "F" "" "United States" "" "0" "" "" "" "" "00167684" "" "" "" "1" "" "02416" "{PMID:Bujakowska 2014:25468891}" "Proband" "" "" "United States" "" "0" "" "" "" "" "00167685" "" "" "" "1" "" "02416" "{PMID:Bujakowska 2014:25468891}" "Proband" "" "" "United States" "" "0" "" "" "" "" "00167703" "" "" "" "1" "" "02416" "{PMID:Lenarduzzi 2015:25575603}" "Proband" "" "" "Italy" "" "0" "" "" "" "" "00167706" "" "" "" "1" "" "02416" "{PMID:Lenarduzzi 2015:25575603}" "Proband" "" "" "Italy" "" "0" "" "" "" "" "00167731" "" "" "" "1" "" "02416" "{PMID:Zhan 2015:25930172}" "Proband" "M" "" "China" "" "0" "" "" "" "" "00167732" "" "" "" "1" "" "02416" "{PMID:Zhan 2015:25930172}" "Relative" "M" "" "China" "" "0" "" "" "" "" "00167733" "" "" "" "1" "" "02416" "{PMID:Zhan 2015:25930172}" "Relative" "M" "" "China" "" "0" "" "" "" "" "00167734" "" "" "" "1" "" "02416" "{PMID:Zhan 2015:25930172}" "Relative" "M" "" "China" "" "0" "" "" "" "" "00167763" "" "" "" "1" "" "02416" "{PMID:Jiang 2015:26338283}" "Proband" "M" "" "China" "" "0" "" "" "" "" "00167807" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "Slovenia" "" "0" "" "" "" "" "00167808" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "Slovenia" "" "0" "" "" "" "" "00167809" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "Slovenia" "" "0" "" "" "" "" "00167810" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "Slovenia" "" "0" "" "" "" "" "00167811" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "M" "" "Spain" "" "0" "" "" "" "" "00167812" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "France" "" "0" "" "" "" "" "00167813" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00167814" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "M" "" "Germany" "" "0" "" "" "" "" "00167815" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00167816" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "France" "" "0" "" "" "" "" "00167817" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "" "" "France" "" "0" "" "" "" "" "00167818" "" "" "" "1" "" "02428" "{PMID:Bonnet 2016:27460420}" "Proband" "F" "" "Italy" "" "0" "" "" "" "" "00167853" "" "" "" "1" "" "02428" "{PMID:Abdi 2016:27583663}" "Proband" "F" "" "Algeria" "" "0" "" "" "" "" "00168034" "" "" "" "1" "" "02430" "{PMID:Ivanova 2018:30358468}" "Proband" "F" "" "Ukraine" "" "0" "" "" "" "Pat10" "00225452" "" "" "" "1" "" "00006" "{DOI:Chang 2019:10.1016/j.ajhg.2019.01.009}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Brazil" "" "0" "" "" "African black;non-Latin European" "-Pat4" "00267037" "" "" "" "1" "" "00110" "{PMID:Vaché 2020:32714370}, {DOI:Vaché 2020:10.3389/fgene.2020.00623}" "" "F" "no" "France" "" "0" "" "" "" "patient" "00269123" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00290059" "" "" "" "25" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290060" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290061" "" "" "" "18" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290062" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290063" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290064" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290065" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290066" "" "" "" "216" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290067" "" "" "" "13" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304248" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308528" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308731" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00308732" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00308791" "" "" "" "3" "" "00004" "{PMID:Santana 2019:31231422}" "2-generation family, 3 affected (2F, M), unaffected parents" "" "" "Cuba" "" "0" "" "" "white" "FamUS-10" "00309282" "" "" "" "5" "" "00004" "{PMID:Sharon 2019:31456290}" "5 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309592" "" "" "" "1" "" "00004" "{PMID:Fuster-Garcia 2018:30459346}" "analysis 77 USH patients" "" "" "Spain" "" "0" "" "" "" "RP2007" "00331309" "" "" "" "1" "" "00000" "{PMID:Chen 2018:29692870}" "" "" "" "China" "" "0" "" "" "Uyghur" "FamJ08" "00331310" "" "" "" "1" "" "00000" "{PMID:Chen 2018:29692870}" "" "" "" "China" "" "0" "" "" "Uyghur" "FamJ13" "00331615" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19230" "00331616" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19261" "00331617" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "yes" "China" "" "0" "" "" "" "19722" "00331618" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19946" "00331619" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19791" "00331632" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19144" "00331708" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "" "" "" "China" "" "0" "" "" "" "19493" "00333355" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat15" "00333361" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat1" "00333364" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat4" "00333648" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "538" "00334013" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "531" "00334014" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "532" "00334015" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "533" "00334016" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "534" "00334017" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "535" "00334018" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "536" "00334019" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "537" "00335340" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Spain" "" "0" "" "" "" "Pat99" "00335984" "" "" "" "2" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00335985" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00335986" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00335987" "" "" "" "5" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00358829" "" "" "" "2" "" "00000" "{PMID:Ben-Rebeh 2016:27440999}" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents" "" "yes" "Tunisia" "" "0" "" "" "" "USHTF4" "00358949" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71674" "00358972" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case70559" "00359118" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12002962" "00361426" "" "" "" "1" "" "04036" "{PMID:Xu 2014:24938718}" "index case" "M" "no" "China" "" "0" "" "" "Asia" "RP405" "00363223" "" "" "" "1" "" "00000" "{PMID:Neuhaus 2017:28944237}" "" "" "yes" "Syria;Turkey" "" "0" "" "" "" "Pat7" "00363224" "" "" "" "1" "" "00000" "{PMID:Neuhaus 2017:28944237}" "" "" "yes" "Syria" "" "0" "" "" "" "Pat8" "00372513" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "728" "00372517" "" "" "" "2" "" "00006" "{PMID:Chen 2015:26011067}" "2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "China" "" "0" "" "" "Uyghur" "KLX213" "00372523" "" "" "" "1" "" "00006" "{PMID:Xu 2015:25999675}" "2-generation family, 1 affected, unaffected heterozygous carrier mother" "M" "" "China" "" "0" "" "" "" "RP403" "00372683" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP396" "00373464" "" "" "" "1" "" "00006" "{PMID:Kikuchi 2015:25692141Kikuchi 2015}" "4-generation family, 1 affected" "F" "" "Japan" "" "0" "" "" "" "patient" "00375413" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#005" "00375428" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#022" "00376863" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "" "" "" "0" "" "" "" "Fam11" "00379620" "" "" "" "1" "" "00000" "{PMID:Nishiguchi-2012:22848652}" "" "" "" "" "" "0" "" "" "Chinese" "" "00379623" "" "" "" "1" "" "00000" "{PMID:Nishiguchi-2012:22848652}" "" "" "" "" "" "0" "" "" "Luhya" "" "00379705" "" "" "" "1" "" "00000" "{PMID:Wan 2018:30245926}" "" "?" "" "China" "" "0" "" "" "Han Chinese" "R0018" "00379850" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016102401" "00380215" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP92, II:2" "?" "no" "Spain" "" "0" "" "" "" "II:2" "00380861" "" "" "" "1" "" "00000" "{PMID:Perez-Carro 2018:29912909}" "family RP-0004" "M" "no" "Spain" "" "0" "" "" "" "RP-0004" "00382243" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "72" "00382570" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "432" "00382571" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "433" "00385136" "" "" "" "1" "" "00000" "{PMID:Jiman 2020:31836858}" "" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "8" "00386829" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI635_001299" "00387110" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "136" "00388473" "" "" "" "1" "" "00000" "{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15010972" "00388734" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 10, Usher syndrome type I, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "18" "00388786" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 35, Usher syndrome type I, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "70" "00388795" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 40, Usher syndrome type I, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "79" "00388872" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 64, Usher syndrome type I, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "156" "00388873" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 64, Usher syndrome type I, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "157" "00390476" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001026" "00391371" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "39" "00391493" "" "" "" "1" "" "00000" "{PMID:Zheng 2020:32835555}" "" "?" "" "China" "" "0" "" "" "" "II:2" "00393585" "" "" "" "1" "" "00000" "{PMID:Liujalopez2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393649" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393671" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393964" "" "" "" "1" "" "00000" "{PMID:Khalaileh-2018:29490346}" "" "" "yes" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00393988" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" "" "00394712" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394713" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "?" "" "" "0" "" "" "" "" "00395812" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F052" "00395915" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F205" "00396239" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396240" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396268" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396269" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396292" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396293" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396294" "" "" "" "1" "" "00000" "{PMID:Wafa 2021:33089500}" "" "" "" "United States" "" "0" "" "" "" "" "00396417" "" "" "" "1" "" "00006" "{PMID:Ellingford 2016:26872967}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "12002355" "00408990" "" "" "" "1" "" "00000" "{PMID:Saleha 2016:27275418}" "" "M" "" "Pakistan" "" "0" "" "" "" "III:2" "00408991" "" "" "" "1" "" "00000" "{PMID:Saleha 2016:27275418}" "" "F" "" "Pakistan" "" "0" "" "" "" "III:3" "00408992" "" "" "" "1" "" "00000" "{PMID:Saleha 2016:27275418}" "" "M" "" "Pakistan" "" "0" "" "" "" "III:4" "00408993" "" "" "" "1" "" "00000" "{PMID:Saleha 2016:27275418}" "" "F" "" "Pakistan" "" "0" "" "" "" "III:6" "00413662" "" "" "" "1" "" "01741" "" "" "" "" "Germany" "" "" "" "" "" "" "00420428" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F052" "00420516" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F205" "00430927" "" "" "" "1" "" "04091" "{PMID:Velde 2022:35226187}, {DOI:Velde 2022: 10.1007/s00439-022-02441-0}, {PMID:de Bruijn 2023:36524988}" "" "M" "" "Ireland" "" "0" "" "" "white" "PatD;071951" "00441345" "" "" "" "1" "" "00006" "{PMID:Richard 2019: 30303587}" "" "" "yes" "Pakistan" "" "0" "" "" "" "PKDF627" "00441346" "" "" "" "1" "" "00006" "{PMID:Richard 2019: 30303587}" "" "" "yes" "Pakistan" "" "0" "" "" "" "PKDF1440" "00441347" "" "" "" "1" "" "00006" "{PMID:Richard 2019: 30303587}" "" "" "yes" "Pakistan" "" "0" "" "" "" "PKDF1499" "00441348" "" "" "" "1" "" "00006" "{PMID:Richard 2019: 30303587}" "" "" "yes" "Pakistan" "" "0" "" "" "" "DEM4711" "00443407" "" "" "" "1" "" "00006" "{PMID:Redfield 2024:38459354}, {PMID:Redfield 2023:37873491}, {DOI:Redfield 2023:10.1101/2023.10.08.23296081}" "2-generation family, 1 affected, unaffected heterozygous parents" "M" "yes" "United States" "" "0" "" "" "" "Fam2" "00446959" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "ADRP-516" "00447001" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-456" "00447401" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "M" "" "Germany" "" "0" "" "" "" "USHI-21" "00447405" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "USHI-78" "00447406" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "USHI-79" "00447411" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "USHI-88" "00447438" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "USHII-361" "00447497" "" "" "00447496" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "relative" "M" "" "Germany" "" "0" "" "" "" "ARRP-331-2" "00447594" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-867" "00449983" "" "" "" "1" "" "02230" "{PMID:Zeuli 2024:38816995}" "" "M" "" "Italy" "" "0" "" "" "white" "Pt-21" "00465320" "" "" "" "2" "" "04847" "" "" "M" "no" "China" "" "" "" "" "" "" "00465990" "" "" "" "2" "" "04656" "" "" "" "" "Pakistan" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 371 "{{individualid}}" "{{diseaseid}}" "00059177" "00531" "00060237" "02283" "00080031" "05103" "00081034" "02858" "00155516" "02115" "00165754" "02115" "00166131" "02115" "00166132" "05400" "00166133" "05400" "00166134" "05400" "00166135" "05400" "00166136" "05400" "00166137" "02115" "00166138" "02115" "00166139" "02115" "00166140" "02115" "00166141" "02115" "00166142" "02115" "00166143" "02115" "00166144" "02115" "00166145" "02115" "00166146" "02115" "00166147" "02115" "00166148" "02115" "00166149" "02115" "00166150" "02115" "00166151" "02115" "00166152" "02115" "00166153" "02115" "00166154" "02115" "00166155" "02115" "00166157" "02115" "00166158" "02115" "00166159" "02115" "00166160" "05459" "00166161" "02115" "00166162" "02115" "00166163" "05400" "00166164" "02115" "00166165" "02115" "00166166" "05400" "00166167" "05400" "00166168" "02115" "00166169" "02115" "00166170" "02115" "00166171" "02115" "00166172" "02115" "00166173" "02115" "00166174" "02115" "00166175" "02115" "00166176" "02115" "00166177" "02115" "00166178" "02115" "00166179" "02115" "00166180" "02115" "00166181" "02115" "00166182" "02115" "00166183" "05400" "00166184" "05400" "00166185" "05400" "00166186" "05400" "00166187" "05400" "00166188" "05400" "00166189" "05400" "00166190" "05400" "00166191" "02115" "00166192" "02115" "00166193" "02115" "00166194" "02115" "00166195" "02115" "00166196" "02115" "00166197" "02115" "00166198" "02115" "00166199" "02115" "00166200" "02115" "00166201" "02115" "00166202" "02115" "00166203" "05400" "00166204" "05400" "00166205" "05400" "00166206" "02115" "00166207" "02115" "00166208" "02115" "00166209" "02115" "00166210" "02115" "00166211" "02115" "00166212" "02115" "00166213" "02115" "00166214" "02115" "00166215" "02115" "00166216" "02115" "00166217" "02115" "00166218" "02115" "00166219" "02115" "00166220" "02115" "00166221" "02115" "00166222" "02115" "00166223" "02115" "00166224" "02115" "00166225" "02115" "00166226" "02115" "00166227" "02115" "00166228" "02115" "00166229" "02115" "00166230" "02115" "00166231" "02115" "00166232" "02115" "00166233" "02115" "00166234" "02115" "00166235" "02115" "00166236" "02115" "00166237" "02115" "00166238" "02115" "00166239" "02115" "00166240" "02115" "00166241" "02115" "00166242" "02115" "00166243" "02115" "00166244" "02115" "00166245" "02115" "00166246" "02115" "00166247" "02115" "00166248" "02115" "00166249" "02115" "00166250" "02115" "00166467" "02115" "00166470" "02115" "00166474" "02115" "00166475" "02115" "00166476" "02115" "00166477" "02115" "00166498" "02115" "00166510" "05400" "00166511" "05400" "00166512" "05400" "00166525" "02115" "00166526" "02115" "00166566" "02115" "00166568" "02115" "00166590" "05414" "00166593" "05414" "00166594" "05414" "00166595" "05414" "00166596" "05414" "00166597" "02115" "00166600" "02115" "00166602" "05459" "00166603" "05459" "00166607" "05414" "00166611" "02115" "00166615" "05415" "00166616" "02115" "00166617" "02115" "00166618" "02115" "00166622" "02115" "00166628" "02115" "00166629" "05414" "00166638" "05414" "00166639" "05414" "00166640" "02115" "00166642" "05414" "00166646" "05414" "00166653" "05414" "00166654" "05414" "00166655" "05415" "00166660" "05414" "00166661" "05414" "00166663" "02115" "00166667" "02115" "00166668" "02115" "00166670" "05414" "00166672" "05414" "00166673" "02115" "00166675" "05414" "00166677" "05414" "00166679" "05414" "00166681" "05414" "00166684" "05414" "00166690" "05414" "00166691" "05414" "00166693" "05414" "00166694" "02115" "00166695" "05414" "00166702" "05414" "00166704" "05414" "00166713" "05414" "00166727" "05414" "00166733" "05414" "00166734" "05414" "00166735" "05415" "00166739" "05414" "00166740" "05414" "00166746" "05414" "00166748" "02115" "00166750" "05414" "00166752" "02115" "00166754" "05414" "00166758" "02115" "00166894" "04211" "00166907" "04211" "00167050" "02115" "00167051" "02115" "00167139" "05458" "00167140" "05458" "00167147" "02115" "00167154" "05400" "00167155" "05400" "00167156" "05400" "00167238" "05414" "00167281" "05458" "00167282" "05458" "00167283" "05458" "00167301" "02115" "00167302" "02115" "00167303" "02115" "00167304" "02115" "00167305" "02115" "00167306" "02115" "00167441" "05414" "00167442" "02115" "00167443" "02115" "00167648" "02115" "00167651" "02115" "00167668" "02115" "00167669" "02115" "00167673" "02115" "00167684" "02115" "00167685" "02115" "00167703" "02115" "00167706" "02115" "00167731" "05400" "00167732" "05400" "00167733" "05400" "00167734" "05400" "00167763" "02115" "00167807" "02115" "00167808" "02115" "00167809" "02115" "00167810" "02115" "00167811" "02115" "00167812" "02115" "00167813" "02115" "00167814" "02115" "00167815" "02115" "00167816" "02115" "00167817" "02115" "00167818" "02115" "00167853" "02115" "00168034" "02115" "00225452" "05476" "00267037" "02413" "00269123" "00198" "00290059" "00198" "00290060" "00198" "00290061" "00198" "00290062" "00198" "00290063" "00198" "00290064" "00198" "00290065" "00198" "00290066" "00198" "00290067" "00198" "00304248" "00198" "00308528" "04214" "00308731" "00000" "00308732" "00000" "00308791" "05415" "00309282" "04214" "00309592" "04214" "00331309" "05086" "00331310" "05086" "00331615" "05086" "00331616" "05086" "00331617" "05086" "00331618" "05086" "00331619" "05086" "00331632" "05086" "00331708" "05086" "00333355" "04214" "00333361" "04214" "00333364" "04214" "00333648" "04214" "00334013" "04214" "00334014" "04214" "00334015" "04214" "00334016" "04214" "00334017" "04214" "00334018" "04214" "00334019" "04214" "00335340" "04214" "00335984" "04214" "00335985" "04214" "00335986" "04214" "00335987" "04214" "00358829" "04214" "00358949" "04214" "00358972" "04214" "00359118" "04214" "00361426" "04214" "00363223" "05415" "00363224" "05415" "00372513" "04214" "00372517" "05086" "00372523" "04214" "00372683" "04214" "00373464" "04214" "00375413" "04214" "00375428" "04214" "00376863" "04214" "00379620" "00000" "00379623" "00000" "00379705" "04214" "00379850" "04214" "00380215" "04214" "00380861" "04214" "00382243" "04214" "00382570" "04214" "00382571" "04214" "00385136" "04214" "00386829" "04214" "00387110" "04214" "00388473" "04214" "00388734" "04214" "00388786" "04214" "00388795" "04214" "00388872" "04214" "00388873" "04214" "00390476" "04214" "00391371" "04214" "00391493" "04214" "00393585" "04214" "00393649" "04214" "00393671" "04214" "00393964" "04214" "00393988" "04214" "00394712" "04214" "00394713" "04214" "00395812" "04214" "00395915" "04214" "00396239" "04214" "00396240" "04214" "00396268" "04214" "00396269" "04214" "00396292" "04214" "00396293" "04214" "00396294" "04214" "00396417" "04214" "00408990" "05415" "00408991" "05415" "00408992" "05415" "00408993" "05415" "00413662" "02413" "00420428" "04214" "00420516" "04214" "00430927" "04214" "00441345" "05086" "00441346" "05086" "00441347" "05086" "00441348" "05086" "00443407" "05086" "00446959" "00198" "00447001" "00198" "00447401" "00198" "00447405" "00198" "00447406" "00198" "00447411" "00198" "00447438" "00198" "00447497" "00198" "00447594" "00198" "00449983" "04214" "00465320" "02413" "00465990" "05400" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00531, 02115, 02283, 02413, 02858, 04211, 04214, 05086, 05103, 05400, 05414, 05415, 05458, 05459, 05476 ## Count = 356 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000046724" "02283" "00060237" "01542" "Complex" "" "di-genic inheritance; congenital, profound" "" "" "" "" "" "" "" "" "" "" "" "0000060262" "05103" "00080031" "01740" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060603" "02858" "00081034" "01758" "Familial, autosomal recessive" "" "Deafness, autosomal recessive 23 (OMIM:609533)" "" "" "" "" "" "" "" "" "" "" "" "0000128016" "02115" "00155516" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000130618" "02115" "00165754" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000130995" "02115" "00166131" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000130996" "05400" "00166132" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000130997" "05400" "00166133" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000130998" "05400" "00166134" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000130999" "05400" "00166135" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131000" "05400" "00166136" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131001" "02115" "00166137" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131002" "02115" "00166138" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131003" "02115" "00166139" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131004" "02115" "00166140" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131005" "02115" "00166141" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131006" "02115" "00166142" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131007" "02115" "00166143" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131008" "02115" "00166144" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131009" "02115" "00166145" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131010" "02115" "00166146" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131011" "02115" "00166147" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131012" "02115" "00166148" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131013" "02115" "00166149" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131014" "02115" "00166150" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131015" "02115" "00166151" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131016" "02115" "00166152" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131017" "02115" "00166153" "02418" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131018" "02115" "00166154" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131019" "02115" "00166155" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131021" "02115" "00166157" "02418" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131022" "02115" "00166158" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131023" "02115" "00166159" "02418" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131024" "05459" "00166160" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131025" "02115" "00166161" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131026" "02115" "00166162" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131027" "05400" "00166163" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131028" "02115" "00166164" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131029" "02115" "00166165" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131030" "05400" "00166166" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131031" "05400" "00166167" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131032" "02115" "00166168" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131033" "02115" "00166169" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131034" "02115" "00166170" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131035" "02115" "00166171" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131036" "02115" "00166172" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131037" "02115" "00166173" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131038" "02115" "00166174" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131039" "02115" "00166175" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131040" "02115" "00166176" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131041" "02115" "00166177" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131042" "02115" "00166178" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131043" "02115" "00166179" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131044" "02115" "00166180" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131045" "02115" "00166181" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131046" "02115" "00166182" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131047" "05400" "00166183" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131048" "05400" "00166184" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131049" "05400" "00166185" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131050" "05400" "00166186" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131051" "05400" "00166187" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131052" "05400" "00166188" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131053" "05400" "00166189" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131054" "05400" "00166190" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131055" "02115" "00166191" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131056" "02115" "00166192" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131057" "02115" "00166193" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131058" "02115" "00166194" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131059" "02115" "00166195" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131060" "02115" "00166196" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131061" "02115" "00166197" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131062" "02115" "00166198" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131063" "02115" "00166199" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131064" "02115" "00166200" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131065" "02115" "00166201" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131066" "02115" "00166202" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131067" "05400" "00166203" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131068" "05400" "00166204" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131069" "05400" "00166205" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131070" "02115" "00166206" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131071" "02115" "00166207" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131072" "02115" "00166208" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131073" "02115" "00166209" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131074" "02115" "00166210" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131075" "02115" "00166211" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131076" "02115" "00166212" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131077" "02115" "00166213" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131078" "02115" "00166214" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131079" "02115" "00166215" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131080" "02115" "00166216" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131081" "02115" "00166217" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131082" "02115" "00166218" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131083" "02115" "00166219" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131084" "02115" "00166220" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131085" "02115" "00166221" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131086" "02115" "00166222" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131087" "02115" "00166223" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131088" "02115" "00166224" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131089" "02115" "00166225" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131090" "02115" "00166226" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131091" "02115" "00166227" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131092" "02115" "00166228" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131093" "02115" "00166229" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131094" "02115" "00166230" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131095" "02115" "00166231" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131096" "02115" "00166232" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131097" "02115" "00166233" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131098" "02115" "00166234" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131099" "02115" "00166235" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131100" "02115" "00166236" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131101" "02115" "00166237" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131102" "02115" "00166238" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131103" "02115" "00166239" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131104" "02115" "00166240" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131105" "02115" "00166241" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131106" "02115" "00166242" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131107" "02115" "00166243" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131108" "02115" "00166244" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131109" "02115" "00166245" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131110" "02115" "00166246" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131111" "02115" "00166247" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131112" "02115" "00166248" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131113" "02115" "00166249" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131114" "02115" "00166250" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131331" "02115" "00166467" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131334" "02115" "00166470" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131338" "02115" "00166474" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131339" "02115" "00166475" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131340" "02115" "00166476" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131341" "02115" "00166477" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131362" "02115" "00166498" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131374" "05400" "00166510" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131375" "05400" "00166511" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131376" "05400" "00166512" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000131389" "02115" "00166525" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131390" "02115" "00166526" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131430" "02115" "00166566" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131432" "02115" "00166568" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131454" "05414" "00166590" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131457" "05414" "00166593" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131458" "05414" "00166594" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131459" "05414" "00166595" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131460" "05414" "00166596" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131461" "02115" "00166597" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131464" "02115" "00166600" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131466" "05459" "00166602" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131467" "05459" "00166603" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131471" "05414" "00166607" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131475" "02115" "00166611" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131479" "05415" "00166615" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "atypical Usher" "" "0000131480" "02115" "00166616" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131481" "02115" "00166617" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131482" "02115" "00166618" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131486" "02115" "00166622" "02419" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131492" "02115" "00166628" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131493" "05414" "00166629" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131502" "05414" "00166638" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131503" "05414" "00166639" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131504" "02115" "00166640" "02419" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131506" "05414" "00166642" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131510" "05414" "00166646" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131517" "05414" "00166653" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131518" "05414" "00166654" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131519" "05415" "00166655" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "atypical Usher" "" "0000131524" "05414" "00166660" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131525" "05414" "00166661" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131527" "02115" "00166663" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131531" "02115" "00166667" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131532" "02115" "00166668" "02419" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131534" "05414" "00166670" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131536" "05414" "00166672" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131537" "02115" "00166673" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131539" "05414" "00166675" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131541" "05414" "00166677" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131543" "05414" "00166679" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131545" "05414" "00166681" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131548" "05414" "00166684" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131554" "05414" "00166690" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131555" "05414" "00166691" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131557" "05414" "00166693" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131558" "02115" "00166694" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131559" "05414" "00166695" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131566" "05414" "00166702" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131568" "05414" "00166704" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131577" "05414" "00166713" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131591" "05414" "00166727" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131597" "05414" "00166733" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131598" "05414" "00166734" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131599" "05415" "00166735" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "atypical Usher" "" "0000131603" "05414" "00166739" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131604" "05414" "00166740" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131610" "05414" "00166746" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131612" "02115" "00166748" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131614" "05414" "00166750" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131616" "02115" "00166752" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131618" "05414" "00166754" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131622" "02115" "00166758" "02419" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131758" "04211" "00166894" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000131771" "04211" "00166907" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000131914" "02115" "00167050" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000131915" "02115" "00167051" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132003" "05458" "00167139" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic deafness" "" "0000132004" "05458" "00167140" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic deafness" "" "0000132011" "02115" "00167147" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132018" "05400" "00167154" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132019" "05400" "00167155" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132020" "05400" "00167156" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132102" "05414" "00167238" "00143" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132145" "05458" "00167281" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic deafness" "" "0000132146" "05458" "00167282" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic deafness" "" "0000132147" "05458" "00167283" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic deafness" "" "0000132165" "02115" "00167301" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132166" "02115" "00167302" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132167" "02115" "00167303" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132168" "02115" "00167304" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132169" "02115" "00167305" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132170" "02115" "00167306" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132305" "05414" "00167441" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132306" "02115" "00167442" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132307" "02115" "00167443" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132512" "02115" "00167648" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132515" "02115" "00167651" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132532" "02115" "00167668" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132533" "02115" "00167669" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132537" "02115" "00167673" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132548" "02115" "00167684" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132549" "02115" "00167685" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132567" "02115" "00167703" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132570" "02115" "00167706" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132595" "05400" "00167731" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132596" "05400" "00167732" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132597" "05400" "00167733" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132598" "05400" "00167734" "02416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "DFNB-23" "deafness" "" "0000132627" "02115" "00167763" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132671" "02115" "00167807" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132672" "02115" "00167808" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132673" "02115" "00167809" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132674" "02115" "00167810" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132675" "02115" "00167811" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132676" "02115" "00167812" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132677" "02115" "00167813" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132678" "02115" "00167814" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132679" "02115" "00167815" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132680" "02115" "00167816" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132681" "02115" "00167817" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132682" "02115" "00167818" "02428" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132717" "02115" "00167853" "02428" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000132898" "02115" "00168034" "02430" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "USH1F" "Usher syndrome" "" "0000170567" "05476" "00225452" "00006" "Familial, autosomal recessive" "2y2m" "see paper; …" "" "" "" "" "" "" "" "" "" "SPONASTRIME dysplasia" "" "0000204967" "02413" "00267037" "00110" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "USH1F" "USH1" "" "0000206968" "00198" "00269123" "01807" "Unknown" "" "Hearing impairment (HP:0000365); Rod-cone dystrophy (HP:0000510)" "" "" "" "" "" "" "" "" "" "" "" "0000233956" "04214" "00308528" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234113" "05415" "00308791" "00004" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "USH2" "" "0000234602" "04214" "00309282" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000234912" "04214" "00309592" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249503" "05086" "00331309" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "non-syndromic hearing loss" "" "0000249504" "05086" "00331310" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "non-syndromic hearing loss" "" "0000249807" "05086" "00331615" "00000" "Familial, autosomal recessive" "19y" "profound hearing loss (acouophone or cochlear implant)" "<1y" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249808" "05086" "00331616" "00000" "Familial, autosomal recessive" "16y" "profound hearing loss (acouophone or cochlear implant)" "<1y" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249809" "05086" "00331617" "00000" "Familial, autosomal recessive" "27y" "profound hearing loss" "<1y" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249810" "05086" "00331618" "00000" "Familial, autosomal recessive" "8y" "profound hearing loss (acouophone or cochlear implant)" "<1y" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249811" "05086" "00331619" "00000" "Familial, autosomal recessive" "7y" "profound hearing loss (acouophone or cochlear implant)" "1y" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000249824" "05086" "00331632" "00000" "Familial, autosomal recessive" "36y" "" "3y" "" "" "" "" "" "" "" "" "Usher syndrome, type II" "" "0000249900" "05086" "00331708" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000251542" "04214" "00333355" "00000" "Familial, autosomal dominant" "53y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251548" "04214" "00333361" "00000" "Unknown" "43y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251551" "04214" "00333364" "00000" "Unknown" "17y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251832" "04214" "00333648" "00000" "Familial, autosomal recessive" "14y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252198" "04214" "00334013" "00000" "Familial, autosomal recessive" "32y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252199" "04214" "00334014" "00000" "Familial, autosomal recessive" "15y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252200" "04214" "00334015" "00000" "Familial, autosomal recessive" "58y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252201" "04214" "00334016" "00000" "Familial, autosomal recessive" "46y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252202" "04214" "00334017" "00000" "Familial, autosomal recessive" "43y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252203" "04214" "00334018" "00000" "Familial, autosomal recessive" "19y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000252204" "04214" "00334019" "00000" "Familial, autosomal recessive" "50y" "clinical category IB1a" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000253054" "04214" "00335340" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253899" "04214" "00335984" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000253900" "04214" "00335985" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000253901" "04214" "00335986" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000253902" "04214" "00335987" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000254044" "04214" "00358829" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Usher syndrome type 1" "" "0000254247" "04214" "00358949" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy, DD: retinitis pigmentosa" "" "0000254270" "04214" "00358972" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Best macular dystrophy" "" "0000254415" "04214" "00359118" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000256831" "04214" "00361426" "04036" "Familial, autosomal dominant" "" "visual acuity: OD = 0.2, OS = 0.2. ERG: Not performed." "55y" "" "Poor vision" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258588" "05415" "00363223" "00000" "Familial, autosomal recessive" "30y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000258589" "05415" "00363224" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000267828" "04214" "00372513" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267832" "05086" "00372517" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000267837" "04214" "00372523" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000267962" "04214" "00372683" "00000" "Familial, X-linked" "40y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268740" "04214" "00373464" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone dystrophy" "" "0000270627" "04214" "00375413" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270642" "04214" "00375428" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272074" "04214" "00376863" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000273550" "04214" "00379705" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "high myopia" "" "0000273704" "04214" "00379850" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000274070" "04214" "00380215" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274714" "04214" "00380861" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa 39" "" "0000276092" "04214" "00382243" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Aland eye disease" "" "0000276419" "04214" "00382570" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone dystrophy" "" "0000276420" "04214" "00382571" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278932" "04214" "00385136" "00000" "Familial, autosomal recessive" "16y6m" "HP:0008527 Congenital sensorineural hearing impairment; HP:0000510 Rod-cone dystrophy; HP:0001249 Intellectual disability" "" "" "" "" "" "" "" "" "Usher syndrome" "Usher syndrome" "" "0000280629" "04214" "00386829" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280888" "04214" "00387110" "00000" "Familial, autosomal recessive" "12y" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "" "0000282025" "04214" "00388473" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000282275" "04214" "00388734" "00000" "Familial, autosomal recessive" "38y" "age at genetic diagnosis mentioned" "" "31y" "" "" "" "" "" "" "Usher syndrome type I" "" "" "0000282327" "04214" "00388786" "00000" "Familial, autosomal recessive" "78y" "age at genetic diagnosis mentioned" "" "70y" "" "" "" "" "" "" "Usher syndrome type I" "" "" "0000282336" "04214" "00388795" "00000" "Familial, autosomal recessive" "18y" "age at genetic diagnosis mentioned" "" "16y" "" "" "" "" "" "" "Usher syndrome type I" "" "" "0000282413" "04214" "00388872" "00000" "Familial, autosomal recessive" "15y" "age at genetic diagnosis mentioned" "" "12y" "" "" "" "" "" "" "Usher syndrome type I" "" "" "0000282414" "04214" "00388873" "00000" "Familial, autosomal recessive" "7y" "age at genetic diagnosis mentioned" "" "4y" "" "" "" "" "" "" "Usher syndrome type I" "" "" "0000284014" "04214" "00390476" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" "" "0000284811" "04214" "00391371" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type 1F (602083)" "Usher syndrome, type 1F (602083)" "" "0000284830" "04214" "00391493" "00000" "Di-genic" "23y" "congenital sensorineural deafness, night blindness worsening for 5 years" "1y" "" "" "" "" "" "" "" "Usher syndrome" "Usher syndrome" "" "0000286791" "04214" "00393585" "00000" "Familial, X-linked" "63y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286855" "04214" "00393649" "00000" "Isolated (sporadic)" "40y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286877" "04214" "00393671" "00000" "Familial, X-linked" "47y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287170" "04214" "00393964" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher Syndrome" "" "0000287194" "04214" "00393988" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000287915" "04214" "00394712" "00000" "Familial, autosomal recessive" "18y" "" "5y" "" "" "" "" "" "" "" "" "Usher syndrome (US)" "" "0000287916" "04214" "00394713" "00000" "Familial, autosomal recessive" "22y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome (US)" "" "0000288974" "04214" "00395812" "00000" "Unknown" "32y7m" "" "30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289077" "04214" "00395915" "00000" "Unknown" "6m" "error, age of onset and age were probably switched" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000289401" "04214" "00396239" "00000" "Familial, autosomal recessive" "56y8m" "atypical vestibular findings, Moderate hearing loss, Absent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289402" "04214" "00396240" "00000" "Familial, autosomal recessive" "19y4m" "atypical vestibular findings, Profound hearing loss, Low sinusoidal harmonic accelerationAbsent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289430" "04214" "00396268" "00000" "Familial, autosomal recessive" "56y8m" "atypical vestibular findings, Moderate hearing loss, Absent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289431" "04214" "00396269" "00000" "Familial, autosomal recessive" "19y4m" "atypical vestibular findings, Profound hearing loss, Low sinusoidal harmonic accelerationAbsent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289454" "04214" "00396292" "00000" "Familial, autosomal recessive" "61y4m" "typical vestibular findings, Profound hearing loss," "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289455" "04214" "00396293" "00000" "Familial, autosomal recessive" "38y4m" "typical vestibular findings, Profound hearing loss, Absent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289456" "04214" "00396294" "00000" "Familial, autosomal recessive" "41y10m" "typical vestibular findings, Profound hearing loss, Absent cervical vestibular evoked myogenic potential" "" "" "" "" "" "" "" "" "" "Usher syndrome type I (USH1)" "" "0000289579" "04214" "00396417" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000301108" "05415" "00408990" "00000" "Familial, autosomal recessive" "15y" "hearing loss: congenital, bilateral and profound; vestibular balance: disturbed; blindness: profound" "" "" "" "" "" "" "" "" "Usher syndrome (USH)" "" "" "0000301109" "05415" "00408991" "00000" "Familial, autosomal recessive" "13y" "hearing loss: congenital, bilateral and profound; vestibular balance: disturbed; blindness: profound" "" "" "" "" "" "" "" "" "Usher syndrome (USH)" "" "" "0000301110" "05415" "00408992" "00000" "Familial, autosomal recessive" "11y" "hearing loss: congenital, bilateral and profound; vestibular balance: disturbed; blindness: progressive" "" "" "" "" "" "" "" "" "Usher syndrome (USH)" "" "" "0000301111" "05415" "00408993" "00000" "Familial, autosomal recessive" "10y" "hearing loss: congenital, bilateral and profound; vestibular balance: disturbed; blindness: progressive" "" "" "" "" "" "" "" "" "Usher syndrome (USH)" "" "" "0000305627" "02413" "00413662" "01741" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000311676" "04214" "00420428" "00000" "Familial, autosomal recessive" "32y7m" "" "30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311764" "04214" "00420516" "00000" "Familial, autosomal recessive" "6m" "" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000321536" "04214" "00430927" "04091" "Familial, autosomal recessive" "87y" "see paper" "" "" "" "" "" "" "" "" "USH4" "Usher syndrome" "" "0000330785" "05086" "00441345" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000330786" "05086" "00441346" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000330787" "05086" "00441347" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000330788" "05086" "00441348" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000332748" "05086" "00443407" "00006" "Familial, autosomal recessive" "<10y" "see paper; ..., moderate to severe congenital bilateral sensorineural hearing loss" "" "" "" "" "" "" "" "" "DFNB124" "hearing loss" "" "0000336158" "00198" "00446959" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336200" "00198" "00447001" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336600" "00198" "00447401" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000336604" "00198" "00447405" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000336605" "00198" "00447406" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000336610" "00198" "00447411" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000336637" "00198" "00447438" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000336696" "00198" "00447497" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336793" "00198" "00447594" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000339043" "04214" "00449983" "02230" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "USH1F" "retinal disease" "" "0000350872" "02413" "00465320" "04847" "Familial, autosomal recessive" "26y" "congenital bilateral hearing loss and first began to experience night blindness when the proband was about 10 years old" "congenital" "26y" "congenital" "We" "" "" "" "" "USH1F" "USH" "" "0000351378" "05400" "00465990" "04656" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Hearing Loss" "" ## Screenings ## Do not remove or alter this header ## ## Count = 371 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000059160" "00059177" "1" "01551" "01551" "2016-02-29 16:18:25" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000060223" "00060237" "1" "01542" "01542" "2016-03-15 13:28:22" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000080110" "00080031" "1" "01740" "01740" "2016-09-01 12:58:43" "" "" "SEQ-NG" "DNA" "" "" "0000081146" "00081034" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000156381" "00155516" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000166633" "00165754" "1" "02416" "02416" "2010-03-01 15:19:44" "00110" "2016-05-30 18:09:31" "SEQ" "DNA" "" "" "0000167010" "00166131" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-10-15 17:29:22" "SEQ" "DNA" "" "" "0000167011" "00166132" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167012" "00166133" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167013" "00166134" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167014" "00166135" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-03-15 16:33:22" "SEQ" "DNA" "" "" "0000167015" "00166136" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167016" "00166137" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-09-13 15:12:35" "SEQ" "DNA" "" "" "0000167017" "00166138" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-09-13 15:12:35" "SEQ" "DNA" "" "" "0000167018" "00166139" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-09-13 15:12:35" "SEQ" "DNA" "" "" "0000167019" "00166140" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-09-13 15:12:35" "SEQ" "DNA" "" "" "0000167020" "00166141" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-10-15 17:38:31" "SEQ" "DNA" "" "" "0000167021" "00166142" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-10-15 17:38:31" "SEQ" "DNA" "" "" "0000167022" "00166143" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167023" "00166144" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167024" "00166145" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167025" "00166146" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167026" "00166147" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167027" "00166148" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167028" "00166149" "1" "02416" "02416" "2010-09-14 17:19:12" "00110" "2015-02-02 16:55:04" "arrayCGH;MLPA;SEQ" "DNA" "" "" "0000167029" "00166150" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167030" "00166151" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167031" "00166152" "1" "02416" "02416" "2010-09-15 11:49:38" "00110" "2015-02-02 16:54:37" "arrayCGH;MLPA;SEQ" "DNA" "" "" "0000167032" "00166153" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2012-08-13 17:31:15" "SEQ" "DNA" "" "" "0000167033" "00166154" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167034" "00166155" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167036" "00166157" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167037" "00166158" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167038" "00166159" "1" "02418" "02418" "2010-03-05 11:21:07" "00110" "2012-08-13 17:30:17" "minigene;SEQ" "DNA" "" "" "0000167039" "00166160" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167040" "00166161" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167041" "00166162" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167042" "00166163" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:43:19" "SEQ" "DNA" "" "" "0000167043" "00166164" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167044" "00166165" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167045" "00166166" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167046" "00166167" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167047" "00166168" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167048" "00166169" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167049" "00166170" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167050" "00166171" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167051" "00166172" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167052" "00166173" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167053" "00166174" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167054" "00166175" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167055" "00166176" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167056" "00166177" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167057" "00166178" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:07:23" "SEQ" "DNA" "" "" "0000167058" "00166179" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:07:23" "SEQ" "DNA" "" "" "0000167059" "00166180" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:07:23" "SEQ" "DNA" "" "" "0000167060" "00166181" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:07:23" "SEQ" "DNA" "" "" "0000167061" "00166182" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:07:23" "SEQ" "DNA" "" "" "0000167062" "00166183" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167063" "00166184" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167064" "00166185" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167065" "00166186" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167066" "00166187" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167067" "00166188" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167068" "00166189" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167069" "00166190" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167070" "00166191" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167071" "00166192" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167072" "00166193" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167073" "00166194" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167074" "00166195" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167075" "00166196" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167076" "00166197" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167077" "00166198" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167078" "00166199" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167079" "00166200" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167080" "00166201" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167081" "00166202" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167082" "00166203" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167083" "00166204" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167084" "00166205" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167085" "00166206" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167086" "00166207" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167087" "00166208" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167088" "00166209" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167089" "00166210" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167090" "00166211" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167091" "00166212" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167092" "00166213" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167093" "00166214" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167094" "00166215" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167095" "00166216" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-12-30 17:01:18" "SEQ" "DNA" "" "" "0000167096" "00166217" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167097" "00166218" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167098" "00166219" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167099" "00166220" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167100" "00166221" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167101" "00166222" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167102" "00166223" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167103" "00166224" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167104" "00166225" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167105" "00166226" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:40:53" "SEQ" "DNA" "" "" "0000167106" "00166227" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167107" "00166228" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167108" "00166229" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167109" "00166230" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167110" "00166231" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167111" "00166232" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:41:18" "SEQ" "DNA" "" "" "0000167112" "00166233" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:41:18" "SEQ" "DNA" "" "" "0000167113" "00166234" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:41:18" "SEQ" "DNA" "" "" "0000167114" "00166235" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:41:18" "SEQ" "DNA" "" "" "0000167115" "00166236" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:20" "SEQ" "DNA" "" "" "0000167116" "00166237" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:20" "SEQ" "DNA" "" "" "0000167117" "00166238" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167118" "00166239" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167119" "00166240" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167120" "00166241" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167121" "00166242" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167122" "00166243" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2015-03-05 12:36:20" "SEQ" "DNA" "" "" "0000167123" "00166244" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:41:35" "SEQ" "DNA" "" "" "0000167124" "00166245" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:20" "SEQ" "DNA" "" "" "0000167125" "00166246" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2015-03-05 12:36:48" "SEQ" "DNA" "" "" "0000167126" "00166247" "1" "02416" "02416" "2012-01-09 15:30:14" "00110" "2012-09-04 12:16:12" "SEQ" "DNA" "" "" "0000167127" "00166248" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 16:37:39" "SEQ" "DNA" "" "" "0000167128" "00166249" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2012-04-06 17:36:01" "SEQ" "DNA" "" "" "0000167129" "00166250" "1" "02416" "02416" "2010-03-05 11:21:07" "00110" "2010-09-13 15:12:35" "SEQ" "DNA" "" "" "0000167346" "00166467" "1" "02416" "02416" "2010-04-29 09:41:47" "00110" "2010-10-18 09:32:28" "SEQ" "DNA" "" "" "0000167349" "00166470" "1" "02416" "02416" "2010-09-15 11:59:07" "00110" "2012-04-06 17:36:01" "arrayCGH;MLPA" "DNA" "" "" "0000167353" "00166474" "1" "02416" "02416" "2010-10-15 18:08:59" "00110" "2012-04-06 16:37:39" "MLPA;SEQ" "DNA" "" "" "0000167354" "00166475" "1" "02416" "02416" "2010-10-18 09:28:51" "00110" "2010-10-18 09:32:53" "MLPA;SEQ" "DNA" "" "" "0000167355" "00166476" "1" "02416" "02416" "2010-10-18 10:58:20" "00110" "2010-10-18 15:29:04" "SEQ" "DNA" "" "" "0000167356" "00166477" "1" "02416" "02416" "2010-10-18 11:41:00" "00110" "2013-02-08 17:01:50" "MLPA;SEQ" "DNA" "" "" "0000167377" "00166498" "1" "02416" "02416" "2011-02-08 17:33:54" "00006" "2019-02-14 13:10:47" "PE;SEQ" "DNA" "" "APEX" "0000167389" "00166510" "1" "02416" "02416" "2011-03-29 17:25:40" "00110" "2011-10-04 14:48:39" "SEQ" "DNA" "" "" "0000167390" "00166511" "1" "02416" "02416" "2011-03-29 17:26:37" "00110" "2011-10-04 14:48:39" "SEQ" "DNA" "" "" "0000167391" "00166512" "1" "02416" "02416" "2011-03-29 17:27:28" "00110" "2011-10-04 14:48:39" "SEQ" "DNA" "" "" "0000167404" "00166525" "1" "02416" "02416" "2011-05-25 16:53:01" "00110" "2012-04-06 17:41:35" "SEQ" "DNA" "" "" "0000167405" "00166526" "1" "02416" "02416" "2011-05-25 16:56:22" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167445" "00166566" "1" "02416" "02416" "2011-07-20 14:12:53" "00006" "2019-02-14 13:10:47" "PE;SEQ" "DNA" "" "APEX" "0000167447" "00166568" "1" "02416" "02416" "2011-07-20 14:22:04" "00006" "2019-02-14 13:10:47" "PE;SEQ" "DNA" "" "APEX" "0000167469" "00166590" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167472" "00166593" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167473" "00166594" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167474" "00166595" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167475" "00166596" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167476" "00166597" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167479" "00166600" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167481" "00166602" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167482" "00166603" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167486" "00166607" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167490" "00166611" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167494" "00166615" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167495" "00166616" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167496" "00166617" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167497" "00166618" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167501" "00166622" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2016-05-30 18:09:35" "SEQ" "DNA" "" "" "0000167507" "00166628" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167508" "00166629" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167517" "00166638" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167518" "00166639" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167519" "00166640" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167521" "00166642" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167525" "00166646" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167532" "00166653" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167533" "00166654" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167534" "00166655" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167539" "00166660" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167540" "00166661" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167542" "00166663" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167546" "00166667" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167547" "00166668" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167549" "00166670" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167551" "00166672" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167552" "00166673" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167554" "00166675" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167556" "00166677" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167558" "00166679" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167560" "00166681" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167563" "00166684" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167569" "00166690" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167570" "00166691" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167572" "00166693" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167573" "00166694" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167574" "00166695" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167581" "00166702" "1" "02419" "02419" "2011-09-12 16:33:22" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167583" "00166704" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2013-02-14 16:56:01" "SEQ" "DNA" "" "" "0000167592" "00166713" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167606" "00166727" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167612" "00166733" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167613" "00166734" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167614" "00166735" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167618" "00166739" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167619" "00166740" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167625" "00166746" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167627" "00166748" "1" "02419" "02419" "2011-09-12 16:33:57" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167629" "00166750" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167631" "00166752" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167633" "00166754" "1" "02419" "02419" "2011-09-12 16:35:05" "00110" "2012-07-11 09:30:41" "SEQ" "DNA" "" "" "0000167637" "00166758" "1" "02419" "02419" "2011-10-03 16:54:04" "00110" "2012-07-11 09:30:40" "SEQ" "DNA" "" "" "0000167773" "00166894" "1" "02416" "02416" "2012-03-15 16:34:06" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000167786" "00166907" "1" "02416" "02416" "2012-03-16 16:04:05" "00110" "2012-03-16 16:05:43" "SEQ;SEQ-NG-S" "DNA" "" "" "0000167929" "00167050" "1" "02416" "02416" "2012-08-13 17:19:24" "00110" "2013-03-11 12:30:17" "minigene;SEQ" "DNA" "" "" "0000167930" "00167051" "1" "02416" "02416" "2012-08-13 17:28:05" "" "" "minigene" "DNA" "" "" "0000168018" "00167139" "1" "02416" "02416" "2013-02-11 11:51:03" "00110" "2014-02-06 10:22:10" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168019" "00167140" "1" "02416" "02416" "2013-02-11 12:08:42" "00110" "2014-02-06 10:22:10" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168026" "00167147" "1" "02416" "02416" "2013-06-05 16:16:22" "00110" "2016-06-06 09:35:48" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168033" "00167154" "1" "02416" "02416" "2013-06-26 15:47:49" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168034" "00167155" "1" "02416" "02416" "2013-06-26 15:58:25" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168035" "00167156" "1" "02416" "02416" "2013-06-26 16:03:26" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168117" "00167238" "1" "00143" "00143" "2014-01-30 14:39:41" "00110" "2016-05-30 18:09:35" "SEQ-NG-S" "DNA" "" "" "0000168160" "00167281" "1" "02416" "02416" "2014-02-10 11:20:34" "00110" "2014-02-10 11:27:36" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168161" "00167282" "1" "02416" "02416" "2014-02-10 11:22:45" "00110" "2014-02-10 11:27:36" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168162" "00167283" "1" "02416" "02416" "2014-02-10 11:25:19" "00110" "2014-02-10 11:27:36" "SEQ" "DNA" "" "" "0000168180" "00167301" "1" "02416" "02416" "2014-03-25 14:51:44" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168181" "00167302" "1" "02416" "02416" "2014-03-25 14:53:07" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168182" "00167303" "1" "02416" "02416" "2014-03-25 14:59:45" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168183" "00167304" "1" "02416" "02416" "2014-03-25 15:03:42" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168184" "00167305" "1" "02416" "02416" "2014-03-25 15:08:47" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168185" "00167306" "1" "02416" "02416" "2014-03-25 15:37:07" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168320" "00167441" "1" "02416" "02416" "2014-08-04 11:55:33" "00110" "2014-08-04 11:57:51" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168321" "00167442" "1" "02416" "02416" "2014-08-04 14:53:08" "00110" "2014-08-04 14:54:07" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168322" "00167443" "1" "02416" "02416" "2014-08-04 15:55:38" "00110" "2016-05-30 18:09:32" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168527" "00167648" "1" "02416" "02416" "2014-12-10 16:02:01" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168530" "00167651" "1" "02416" "02416" "2014-12-10 16:31:16" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168547" "00167668" "1" "02416" "02416" "2015-02-09 16:00:42" "00110" "2015-02-09 16:15:24" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168548" "00167669" "1" "02416" "02416" "2015-02-09 16:09:55" "00110" "2015-02-09 16:15:24" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168552" "00167673" "1" "02416" "02416" "2015-02-09 16:48:56" "00110" "2015-02-09 17:22:35" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168563" "00167684" "1" "02416" "02416" "2015-02-11 16:04:17" "00110" "2016-05-30 18:09:35" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168564" "00167685" "1" "02416" "02416" "2015-02-10 17:40:01" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168582" "00167703" "1" "02416" "02416" "2015-02-12 11:14:25" "00110" "2015-02-12 11:17:05" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168585" "00167706" "1" "02416" "02416" "2015-02-12 14:18:54" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168610" "00167731" "1" "02416" "02416" "2015-05-21 17:48:53" "00110" "2015-05-21 17:50:11" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168611" "00167732" "1" "02416" "02416" "2015-05-21 17:49:59" "00110" "2015-05-21 17:50:11" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168612" "00167733" "1" "02416" "02416" "2015-05-21 17:51:11" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168613" "00167734" "1" "02416" "02416" "2015-05-21 17:52:33" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168642" "00167763" "1" "02416" "02416" "2015-10-05 09:24:01" "00110" "2015-10-05 09:27:36" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168686" "00167807" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168687" "00167808" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168688" "00167809" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168689" "00167810" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168690" "00167811" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168691" "00167812" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168692" "00167813" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168693" "00167814" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S" "DNA" "" "" "0000168694" "00167815" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S;PCRq;arrayCGH" "DNA" "" "" "0000168695" "00167816" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "PCRq;arrayCGH" "DNA" "" "" "0000168696" "00167817" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2016-08-01 14:49:17" "SEQ;SEQ-NG-S;PCRq;arrayCGH" "DNA" "" "" "0000168697" "00167818" "1" "02428" "02428" "2016-05-30 10:30:17" "00110" "2017-10-27 14:07:07" "PCRq;arrayCGH" "DNA" "" "" "0000168732" "00167853" "1" "02428" "02428" "2016-08-08 17:40:33" "" "" "SEQ" "DNA" "" "" "0000168913" "00168034" "1" "02430" "02430" "2018-02-24 13:52:47" "" "" "MLPA;SEQ-NG-S" "DNA" "" "" "0000226531" "00225452" "1" "00006" "00006" "2019-02-16 14:29:08" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000268165" "00267037" "1" "00110" "00110" "2019-10-31 16:34:38" "" "" "arrayCGH;RT-PCR;SEQ;SEQ-ON;SEQ-NG-I" "DNA" "blood" "" "0000270254" "00269123" "1" "01807" "01807" "2019-11-06 14:42:54" "" "" "SEQ" "DNA" "" "" "0000291227" "00290059" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291228" "00290060" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291229" "00290061" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291230" "00290062" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291231" "00290063" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291232" "00290064" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291233" "00290065" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291234" "00290066" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291235" "00290067" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305377" "00304248" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309673" "00308528" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309876" "00308731" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000309877" "00308732" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000309936" "00308791" "1" "00004" "00006" "2020-08-27 19:07:12" "" "" "SEQ;SEQ-NG" "DNA" "" "14 gene panel" "0000310427" "00309282" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310737" "00309592" "1" "00004" "00006" "2020-08-29 15:23:37" "" "" "arraySEQ" "DNA" "" "" "0000332528" "00331309" "1" "00000" "00006" "2021-02-11 11:56:16" "" "" "SEQ" "DNA" "" "" "0000332529" "00331310" "1" "00000" "00006" "2021-02-11 11:56:16" "" "" "SEQ" "DNA" "" "" "0000332834" "00331615" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332835" "00331616" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332836" "00331617" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332837" "00331618" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332838" "00331619" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332851" "00331632" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000332927" "00331708" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000334580" "00333355" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334586" "00333361" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334589" "00333364" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334874" "00333648" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000335239" "00334013" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335240" "00334014" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335241" "00334015" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335242" "00334016" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335243" "00334017" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335244" "00334018" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335245" "00334019" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000336569" "00335340" "1" "02485" "00006" "2021-03-04 17:06:33" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000337214" "00335984" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000337215" "00335985" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000337216" "00335986" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000337217" "00335987" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360059" "00358829" "1" "00000" "00006" "2021-03-14 09:54:57" "" "" "SEQ" "DNA" "" "" "0000360186" "00358949" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360209" "00358972" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360356" "00359118" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000362654" "00361426" "1" "04036" "00006" "2021-04-06 16:50:09" "" "" "PCR;SEQ;SEQ-NG" "DNA" "blood" "WES" "0000364451" "00363223" "1" "00000" "00006" "2021-04-26 15:58:48" "" "" "MLPA;SEQ" "DNA" "" "locus‐specific polymorphic microsatellite marker" "0000364452" "00363224" "1" "00000" "00006" "2021-04-26 15:58:48" "" "" "MLPA;SEQ" "DNA" "" "locus‐specific polymorphic microsatellite marker" "0000373746" "00372513" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373750" "00372517" "1" "00006" "00006" "2021-05-08 11:11:33" "" "" "SEQ" "DNA" "" "" "0000373756" "00372523" "1" "00006" "00006" "2021-05-08 12:22:23" "" "" "SEQ-NG" "DNA" "" "" "0000373915" "00372683" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374699" "00373464" "1" "00006" "00006" "2021-05-14 15:56:17" "" "" "SEQ;SEQ-NG" "DNA" "" "123-gene panel" "0000376610" "00375413" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376625" "00375428" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000378068" "00376863" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000380819" "00379620" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ" "DNA" "blood" "" "0000380822" "00379623" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ" "DNA" "blood" "" "0000380907" "00379705" "1" "00000" "03840" "2021-08-06 16:45:16" "" "" "SEQ-NG-I" "DNA" "blood" "Whole-exome sequencing" "0000381052" "00379850" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "exome sequencing" "0000381417" "00380215" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000382075" "00380861" "1" "00000" "03840" "2021-08-23 13:21:22" "" "" "SEQ" "DNA" "blood" "" "0000383457" "00382243" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383784" "00382570" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383785" "00382571" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000386365" "00385136" "1" "00000" "03840" "2021-10-08 17:29:22" "" "" "SEQ-NG-I" "DNA" "" "176 genes panel" "0000388057" "00386829" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000388336" "00387110" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000389714" "00388473" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389977" "00388734" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390029" "00388786" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET1 targeted sequencing panel - see paper" "0000390038" "00388795" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390115" "00388872" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390116" "00388873" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "MLPA" "DNA" "blood" "MLPA" "0000391717" "00390476" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000392613" "00391371" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing" "0000392735" "00391493" "1" "00000" "03840" "2021-11-15 19:12:31" "" "" "SEQ-NG" "DNA" "" "" "0000394833" "00393585" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394897" "00393649" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394919" "00393671" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395212" "00393964" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "PCR;SEQ" "DNA" "blood" "" "0000395236" "00393988" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000395959" "00394712" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395960" "00394713" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000397051" "00395812" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397154" "00395915" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397480" "00396239" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397481" "00396240" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397509" "00396268" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397510" "00396269" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397533" "00396292" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397534" "00396293" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397535" "00396294" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000397658" "00396417" "1" "00006" "00006" "2021-12-15 14:29:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000410255" "00408990" "1" "00000" "03840" "2022-04-29 20:33:43" "" "" "STR;SEQ" "DNA" "" "" "0000410256" "00408991" "1" "00000" "03840" "2022-04-29 20:33:43" "" "" "STR;SEQ" "DNA" "" "" "0000410257" "00408992" "1" "00000" "03840" "2022-04-29 20:33:43" "" "" "STR;SEQ" "DNA" "" "" "0000410258" "00408993" "1" "00000" "03840" "2022-04-29 20:33:43" "" "" "STR;SEQ" "DNA" "" "" "0000414942" "00413662" "1" "01741" "01741" "2022-07-21 11:12:10" "" "" "SEQ-NG" "DNA" "" "" "0000421737" "00420428" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421825" "00420516" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000432338" "00430927" "1" "04091" "00006" "2023-01-25 13:11:03" "" "" "SEQ-NG" "DNA" "" "WGS" "0000442831" "00441345" "1" "00006" "00006" "2023-11-07 16:38:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000442832" "00441346" "1" "00006" "00006" "2023-11-07 16:38:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000442833" "00441347" "1" "00006" "00006" "2023-11-07 16:38:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000442834" "00441348" "1" "00006" "00006" "2023-11-07 16:38:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000444896" "00443407" "1" "00006" "00006" "2023-11-26 09:32:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000448536" "00446959" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448578" "00447001" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448978" "00447401" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448982" "00447405" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448983" "00447406" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448988" "00447411" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449015" "00447438" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449074" "00447497" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449171" "00447594" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000451579" "00449983" "1" "02230" "00006" "2024-05-24 14:55:58" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WGS" "0000466968" "00465320" "1" "04847" "04847" "2025-05-13 09:01:56" "00006" "2025-05-14 09:27:31" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000467641" "00465990" "1" "04656" "04656" "2025-07-01 19:57:39" "" "" "SEQ-NG-I" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 89 "{{screeningid}}" "{{geneid}}" "0000059160" "PCDH15" "0000081146" "PCDH15" "0000156381" "PCDH15" "0000226531" "TONSL" "0000268165" "PCDH15" "0000309673" "PCDH15" "0000309876" "PCDH15" "0000309877" "PCDH15" "0000309936" "PCDH15" "0000310427" "PCDH15" "0000310737" "PCDH15" "0000332528" "PCDH15" "0000332529" "PCDH15" "0000332834" "PCDH15" "0000332835" "PCDH15" "0000332836" "PCDH15" "0000332837" "PCDH15" "0000332838" "PCDH15" "0000332838" "TULP1" "0000332851" "PCDH15" "0000332927" "PCDH15" "0000334580" "SNRNP200" "0000334874" "PCDH15" "0000335239" "PCDH15" "0000335240" "PCDH15" "0000335241" "PCDH15" "0000335242" "PCDH15" "0000335243" "PCDH15" "0000335244" "PCDH15" "0000335245" "PCDH15" "0000336569" "PCDH15" "0000337214" "PCDH15" "0000337215" "PCDH15" "0000337216" "PCDH15" "0000337217" "PCDH15" "0000360059" "PCDH15" "0000362654" "PRPH2" "0000364451" "PCDH15" "0000364452" "PCDH15" "0000373746" "PCDH15" "0000373750" "PCDH15" "0000373756" "CACNA1F" "0000374699" "RP1L1" "0000380819" "PCDH15" "0000380822" "PCDH15" "0000380907" "HSPG2" "0000381052" "PCDH15" "0000381417" "CDH23" "0000382075" "USH2A" "0000383457" "CACNA1F" "0000383784" "PCDH15" "0000383785" "PCDH15" "0000386365" "PCDH15" "0000388057" "PCDH15" "0000388336" "PCDH15" "0000389714" "PCDH15" "0000389977" "PCDH15" "0000390029" "PCDH15" "0000390038" "PCDH15" "0000390115" "PCDH15" "0000390116" "PCDH15" "0000391717" "PCDH15" "0000392613" "PCDH15" "0000392735" "CDH23" "0000394833" "PCDH15" "0000394897" "PCDH15" "0000394919" "PCDH15" "0000395212" "PCDH15" "0000395236" "PCDH15" "0000395959" "PCDH15" "0000395960" "PCDH15" "0000397051" "PCDH15" "0000397154" "PCDH15" "0000397480" "PCDH15" "0000397481" "PCDH15" "0000397509" "PCDH15" "0000397510" "PCDH15" "0000397533" "PCDH15" "0000397534" "PCDH15" "0000397535" "PCDH15" "0000410255" "PCDH15" "0000410256" "PCDH15" "0000410257" "PCDH15" "0000410258" "PCDH15" "0000414942" "PCDH15" "0000421737" "PCDH15" "0000421825" "PCDH15" "0000466968" "PCDH15" "0000467641" "PCDH15" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 1143 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000089977" "0" "50" "10" "55779977" "55779977" "subst" "0" "01551" "PCDH15_000291" "g.55779977A>T" "" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "Germline" "" "" "0" "" "" "g.54020217A>T" "" "VUS" "" "0000089978" "0" "50" "10" "55892721" "55892724" "del" "0" "01551" "PCDH15_000290" "g.55892721_55892724del" "" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "Germline" "" "" "0" "" "" "g.54132961_54132964del" "" "VUS" "" "0000091209" "0" "90" "10" "56077174" "56077174" "subst" "0.000207462" "01542" "PCDH15_000039" "g.56077174G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000128993" "1" "70" "10" "55663132" "55663132" "subst" "4.07266E-6" "01740" "PCDH15_000202" "g.55663132T>C" "" "{PMID:Zazo Seco 2017:28000701}, {DOI:Zazo Seco 2017:10.1038/ejhg.2016.182}" "" "" "" "Germline" "" "" "0" "" "" "g.53903372T>C" "" "likely pathogenic" "" "0000128994" "2" "70" "10" "55591150" "55591150" "subst" "1.21827E-5" "01740" "PCDH15_000201" "g.55591150G>T" "" "{PMID:Zazo Seco 2017:28000701}, {DOI:Zazo Seco 2017:10.1038/ejhg.2016.182}" "" "" "" "Germline" "" "" "0" "" "" "g.53831390G>T" "" "likely pathogenic" "" "0000130232" "3" "70" "10" "56089354" "56089354" "subst" "0" "01758" "PCDH15_000203" "g.56089354A>G" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.54329594A>G" "" "likely pathogenic" "ACMG" "0000246875" "0" "10" "10" "55582602" "55582602" "subst" "0.00129145" "02330" "PCDH15_000268" "g.55582602A>G" "" "" "" "PCDH15(NM_001142763.1):c.4905T>C (p.T1635=), PCDH15(NM_001142763.2):c.4905T>C (p.T1635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822842A>G" "" "benign" "" "0000246893" "0" "50" "10" "55600206" "55600206" "subst" "2.84308E-5" "02330" "PCDH15_000225" "g.55600206A>T" "" "" "" "PCDH15(NM_001142771.1):c.3872T>A (p.V1291E), PCDH15(NM_001142771.2):c.3872T>A (p.V1291E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53840446A>T" "" "VUS" "" "0000246925" "0" "10" "10" "55719622" "55719622" "subst" "8.55564E-5" "02330" "PCDH15_000281" "g.55719622A>G" "" "" "" "PCDH15(NM_001142771.2):c.3025-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53959862A>G" "" "benign" "" "0000248897" "0" "10" "10" "56423968" "56423968" "subst" "0.219841" "02325" "PCDH15_000253" "g.56423968A>C" "" "" "" "PCDH15(NM_001142771.2):c.55T>G (p.S19A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54664208A>C" "" "benign" "" "0000253356" "0" "10" "10" "55582602" "55582602" "subst" "0.00129145" "01943" "PCDH15_000268" "g.55582602A>G" "" "" "" "PCDH15(NM_001142763.1):c.4905T>C (p.T1635=), PCDH15(NM_001142763.2):c.4905T>C (p.T1635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822842A>G" "" "benign" "" "0000254576" "0" "30" "10" "55782743" "55782743" "subst" "0.000686724" "01943" "PCDH15_000230" "g.55782743A>G" "" "" "" "PCDH15(NM_001142771.1):c.2450T>C (p.I817T), PCDH15(NM_001354429.2):c.2435T>C (p.I812T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54022983A>G" "" "likely benign" "" "0000254663" "0" "30" "10" "55582054" "55582054" "subst" "8.31545E-5" "01943" "PCDH15_000208" "g.55582054A>G" "" "" "" "PCDH15(NM_001142763.1):c.5453T>C (p.L1818P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822294A>G" "" "likely benign" "" "0000254980" "0" "30" "10" "55582133" "55582133" "subst" "0.000342345" "01943" "PCDH15_000213" "g.55582133A>G" "" "" "" "PCDH15(NM_001142763.1):c.5374T>C (p.S1792P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822373A>G" "" "likely benign" "" "0000255120" "0" "30" "10" "55582753" "55582753" "subst" "0.00031284" "01943" "PCDH15_000223" "g.55582753A>G" "" "" "" "PCDH15(NM_001142763.1):c.4754T>C (p.V1585A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822993A>G" "" "likely benign" "" "0000255692" "0" "90" "10" "55755407" "55755407" "subst" "0" "01943" "PCDH15_000229" "g.55755407A>G" "" "" "" "PCDH15(NM_001142771.1):c.2883+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53995647A>G" "" "pathogenic" "" "0000255832" "0" "50" "10" "55600206" "55600206" "subst" "2.84308E-5" "01943" "PCDH15_000225" "g.55600206A>T" "" "" "" "PCDH15(NM_001142771.1):c.3872T>A (p.V1291E), PCDH15(NM_001142771.2):c.3872T>A (p.V1291E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53840446A>T" "" "VUS" "" "0000255868" "0" "50" "10" "55582926" "55582926" "subst" "0" "01943" "PCDH15_000224" "g.55582926A>T" "" "" "" "PCDH15(NM_001142763.1):c.4581T>A (p.D1527E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53823166A>T" "" "VUS" "" "0000293442" "0" "10" "10" "55566323" "55566323" "subst" "0.00162244" "02330" "PCDH15_000304" "g.55566323T>G" "" "" "" "PCDH15(NM_001142771.2):c.*16A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53806563T>G" "" "benign" "" "0000293443" "0" "10" "10" "55973755" "55973755" "subst" "0.00379022" "02330" "PCDH15_000243" "g.55973755G>A" "" "" "" "PCDH15(NM_001142771.1):c.1054C>T (p.L352F), PCDH15(NM_001142771.2):c.1054C>T (p.L352F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54213995G>A" "" "benign" "" "0000293444" "0" "10" "10" "56288130" "56288130" "subst" "0.00194274" "02330" "PCDH15_000251" "g.56288130T>A" "" "" "" "PCDH15(NM_001354429.2):c.92-493A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54528370T>A" "" "benign" "" "0000293445" "0" "10" "10" "56287647" "56287647" "subst" "6.51201E-5" "02330" "PCDH15_000250" "g.56287647G>A" "" "" "" "PCDH15(NM_001142771.2):c.107-10C>T, PCDH15(NM_001354429.1):c.92-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54527887G>A" "" "benign" "" "0000293446" "0" "10" "10" "55943189" "55943189" "subst" "0.00102443" "02330" "PCDH15_000239" "g.55943189T>C" "" "" "" "PCDH15(NM_001142771.2):c.1605+15A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54183429T>C" "" "benign" "" "0000293447" "0" "10" "10" "55943187" "55943191" "del" "0" "02330" "PCDH15_000236" "g.55943187_55943191del" "" "" "" "PCDH15(NM_001142771.2):c.1605+17_1605+21delTATAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54183427_54183431del" "" "benign" "" "0000293448" "0" "30" "10" "55943184" "55943184" "subst" "0.000439232" "02330" "PCDH15_000237" "g.55943184T>G" "" "" "" "PCDH15(NM_001142771.2):c.1605+20A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54183424T>G" "" "likely benign" "" "0000293449" "0" "10" "10" "55912942" "55912942" "subst" "0.00161858" "02330" "PCDH15_000235" "g.55912942C>T" "" "" "" "PCDH15(NM_001142771.1):c.1717G>A (p.A573T), PCDH15(NM_001142771.2):c.1717G>A (p.A573T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54153182C>T" "" "benign" "" "0000293450" "0" "50" "10" "55892664" "55892664" "subst" "0" "02330" "PCDH15_000234" "g.55892664T>C" "" "" "" "PCDH15(NM_001142771.2):c.1903A>G (p.R635G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54132904T>C" "" "VUS" "" "0000293451" "0" "10" "10" "55849812" "55849812" "subst" "0" "02330" "PCDH15_000233" "g.55849812T>G" "" "" "" "PCDH15(NM_001142771.2):c.1944A>C (p.R648=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54090052T>G" "" "benign" "" "0000293452" "0" "50" "10" "55826644" "55826644" "subst" "1.22142E-5" "02330" "PCDH15_000231" "g.55826644G>A" "" "" "" "PCDH15(NM_001142771.2):c.2108C>T (p.T703I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54066884G>A" "" "VUS" "" "0000293453" "0" "30" "10" "55782808" "55782808" "subst" "0" "02330" "PCDH15_000286" "g.55782808C>T" "" "" "" "PCDH15(NM_001142771.2):c.2385G>A (p.V795=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54023048C>T" "" "likely benign" "" "0000293454" "0" "10" "10" "55780078" "55780078" "subst" "0.00341842" "02330" "PCDH15_000285" "g.55780078C>T" "" "" "" "PCDH15(NM_001142771.1):c.2640G>A (p.S880=), PCDH15(NM_001142771.2):c.2640G>A (p.S880=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54020318C>T" "" "benign" "" "0000293455" "0" "30" "10" "55721637" "55721637" "subst" "0.000874866" "02330" "PCDH15_000284" "g.55721637G>A" "" "" "" "PCDH15(NM_001142771.1):c.2899C>T (p.R967C), PCDH15(NM_001142771.2):c.2899C>T (p.R967C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961877G>A" "" "likely benign" "" "0000293456" "0" "10" "10" "55721636" "55721636" "subst" "0.000870612" "02330" "PCDH15_000283" "g.55721636C>T" "" "" "" "PCDH15(NM_001142771.1):c.2900G>A (p.R967H), PCDH15(NM_001142771.2):c.2900G>A (p.R967H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961876C>T" "" "benign" "" "0000293457" "0" "50" "10" "55721523" "55721523" "subst" "4.10159E-6" "02330" "PCDH15_000282" "g.55721523T>C" "" "" "" "PCDH15(NM_001142771.2):c.3013A>G (p.T1005A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961763T>C" "" "VUS" "" "0000293458" "0" "10" "10" "55719596" "55719596" "subst" "0.00343287" "02330" "PCDH15_000228" "g.55719596C>A" "" "" "" "PCDH15(NM_001142771.2):c.3033G>T (p.V1011=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53959836C>A" "" "benign" "" "0000293459" "0" "50" "10" "55719538" "55719538" "subst" "0" "02330" "PCDH15_000227" "g.55719538C>G" "" "" "" "PCDH15(NM_001142771.2):c.3091G>C (p.V1031L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53959778C>G" "" "VUS" "" "0000293460" "0" "50" "10" "55663049" "55663049" "subst" "0" "02330" "PCDH15_000279" "g.55663049C>T" "" "" "" "PCDH15(NM_001142771.2):c.3470G>A (p.G1157D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53903289C>T" "" "VUS" "" "0000293462" "0" "10" "10" "55626625" "55626625" "subst" "0.00442998" "02330" "PCDH15_000278" "g.55626625G>A" "" "" "" "PCDH15(NM_001142771.1):c.3517-8C>T, PCDH15(NM_001142771.2):c.3517-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866865G>A" "" "benign" "" "0000293463" "0" "10" "10" "55626394" "55626394" "subst" "0.000725092" "02330" "PCDH15_000276" "g.55626394C>G" "" "" "" "PCDH15(NM_001142771.1):c.3732+8G>C, PCDH15(NM_001142771.2):c.3732+8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866634C>G" "" "benign" "" "0000293464" "0" "10" "10" "55591253" "55591253" "subst" "0.00173817" "02330" "PCDH15_000256" "g.55591253G>T" "" "" "" "PCDH15(NM_001142763.1):c.4039C>A (p.(Gln1347Lys)), PCDH15(NM_001142771.1):c.4039C>A (p.Q1347K), PCDH15(NM_001142771.2):c.4039C>A (p.Q1347K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831493G>T" "" "benign" "" "0000293465" "0" "10" "10" "55587245" "55587245" "subst" "4.10203E-6" "02330" "PCDH15_000275" "g.55587245T>A" "" "" "" "PCDH15(NM_001142771.2):c.4290A>T (p.A1430=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53827485T>A" "" "benign" "" "0000293467" "0" "50" "10" "55583005" "55583021" "del" "4.06712E-6" "02330" "PCDH15_000273" "g.55583005_55583021del" "" "" "" "PCDH15(NM_001142763.2):c.4486_4502delACTATTGAGGCTCACAA (p.T1496Vfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53823245_53823261del" "" "VUS" "" "0000293468" "0" "10" "10" "55569249" "55569249" "subst" "0.000500835" "02330" "PCDH15_000300" "g.55569249C>T" "" "" "" "PCDH15(NM_001142769.3):c.4576G>A (p.E1526K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809489C>T" "" "benign" "" "0000293469" "0" "10" "10" "55569263" "55569263" "subst" "0.00131103" "02330" "PCDH15_000302" "g.55569263T>G" "" "" "" "PCDH15(NM_001142770.2):c.4597A>C (p.S1533R), PCDH15(NM_001142770.3):c.4597A>C (p.S1533R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809503T>G" "" "benign" "" "0000293470" "0" "10" "10" "55566671" "55566671" "subst" "0.000810247" "02330" "PCDH15_000307" "g.55566671G>A" "" "" "" "PCDH15(NM_001142771.1):c.4717C>T (p.L1573=), PCDH15(NM_001142771.2):c.4717C>T (p.L1573=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53806911G>A" "" "benign" "" "0000293471" "0" "30" "10" "55582769" "55582769" "subst" "3.25142E-5" "02330" "PCDH15_000271" "g.55582769G>C" "" "" "" "PCDH15(NM_001142763.1):c.4738C>G (p.L1580V), PCDH15(NM_001142763.2):c.4738C>G (p.L1580V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53823009G>C" "" "likely benign" "" "0000293473" "0" "10" "10" "55568878" "55568878" "subst" "0.00102702" "02330" "PCDH15_000297" "g.55568878T>G" "" "" "" "PCDH15(NM_001142769.2):c.4947A>C (p.E1649D), PCDH15(NM_001142769.3):c.4947A>C (p.E1649D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809118T>G" "" "benign" "" "0000293474" "0" "10" "10" "55582418" "55582418" "subst" "0" "02330" "PCDH15_000220" "g.55582418T>C" "" "" "" "PCDH15(NM_001142763.2):c.5089A>G (p.I1697V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822658T>C" "" "benign" "" "0000293475" "0" "30" "10" "55582239" "55582241" "del" "0" "02330" "PCDH15_000219" "g.55582239_55582241del" "" "" "" "PCDH15(NM_001142763.1):c.5275_5277delCCT (p.P1759del), PCDH15(NM_001142763.2):c.5275_5277delCCT (p.P1759del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822479_53822481del" "" "likely benign" "" "0000293476" "0" "10" "10" "55568530" "55568530" "subst" "0.000514336" "02330" "PCDH15_000293" "g.55568530T>C" "" "" "" "PCDH15(NM_001142769.3):c.5295A>G (p.P1765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53808770T>C" "" "benign" "" "0000293477" "0" "30" "10" "55582211" "55582216" "del" "0" "02330" "PCDH15_000217" "g.55582211_55582216del" "" "" "" "PCDH15(NM_001142763.2):c.5296_5301delCCTCCT (p.P1766_P1767del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822451_53822456del" "" "likely benign" "" "0000293478" "0" "30" "10" "55582088" "55582088" "subst" "0.00140531" "02330" "PCDH15_000210" "g.55582088C>T" "" "" "" "PCDH15(NM_001142763.1):c.5419G>A (p.V1807I), PCDH15(NM_001142763.2):c.5419G>A (p.V1807I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822328C>T" "" "likely benign" "" "0000293479" "0" "10" "10" "55582072" "55582072" "subst" "0.00104678" "02330" "PCDH15_000209" "g.55582072G>A" "" "" "" "PCDH15(NM_001142763.2):c.5435C>T (p.P1812L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822312G>A" "" "benign" "" "0000293480" "0" "10" "10" "55581929" "55581929" "subst" "0.00067841" "02330" "PCDH15_000207" "g.55581929T>G" "" "" "" "PCDH15(NM_001142763.1):c.5578A>C (p.M1860L), PCDH15(NM_001142763.2):c.5578A>C (p.M1860L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822169T>G" "" "benign" "" "0000293481" "0" "10" "10" "55581921" "55581921" "subst" "0.00177122" "02330" "PCDH15_000206" "g.55581921G>A" "" "" "" "PCDH15(NM_001142763.1):c.5586C>T (p.A1862=), PCDH15(NM_001142763.2):c.5586C>T (p.A1862=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822161G>A" "" "benign" "" "0000293482" "0" "30" "10" "55581760" "55581760" "subst" "0.000138168" "02330" "PCDH15_000204" "g.55581760C>T" "" "" "" "PCDH15(NM_001142763.1):c.5747G>A (p.R1916H), PCDH15(NM_001142763.2):c.5747G>A (p.R1916H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822000C>T" "" "likely benign" "" "0000296783" "0" "10" "10" "55943184" "55943184" "subst" "0.661706" "02325" "PCDH15_000238" "g.55943184T>C" "" "" "" "PCDH15(NM_001142771.2):c.1605+20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54183424T>C" "" "benign" "" "0000296784" "0" "10" "10" "55755491" "55755491" "subst" "0.25214" "02325" "PCDH15_000262" "g.55755491C>T" "" "" "" "PCDH15(NM_001142771.2):c.2801G>A (p.R934Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53995731C>T" "" "benign" "" "0000296785" "0" "10" "10" "55591313" "55591313" "subst" "0.429407" "02325" "PCDH15_000257" "g.55591313G>A" "" "" "" "PCDH15(NM_001142771.2):c.3999-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831553G>A" "" "benign" "" "0000296786" "0" "10" "10" "56345303" "56345303" "subst" "0" "02325" "PCDH15_000252" "g.56345303T>C" "" "" "" "PCDH15(NM_001142771.2):c.92-57141A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54585543T>C" "" "benign" "" "0000305080" "0" "50" "10" "55973766" "55973766" "subst" "0.000162558" "01943" "PCDH15_000244" "g.55973766C>T" "" "" "" "PCDH15(NM_001142771.1):c.1043G>A (p.R348K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54214006C>T" "" "VUS" "" "0000305081" "0" "30" "10" "55973755" "55973755" "subst" "0.00379022" "01943" "PCDH15_000243" "g.55973755G>A" "" "" "" "PCDH15(NM_001142771.1):c.1054C>T (p.L352F), PCDH15(NM_001142771.2):c.1054C>T (p.L352F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54213995G>A" "" "likely benign" "" "0000305082" "0" "50" "10" "55955543" "55955543" "subst" "0.000402073" "01943" "PCDH15_000242" "g.55955543C>G" "" "" "" "PCDH15(NM_001142771.1):c.1220G>C (p.G407A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54195783C>G" "" "VUS" "" "0000305083" "0" "30" "10" "55944972" "55944972" "subst" "0.000706955" "01943" "PCDH15_000241" "g.55944972G>A" "" "" "" "PCDH15(NM_001142771.2):c.1377C>T (p.V459=), PCDH15(NM_001354429.1):c.1362C>T (p.V454=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54185212G>A" "" "likely benign" "" "0000305084" "0" "30" "10" "55944900" "55944900" "subst" "2.84551E-5" "01943" "PCDH15_000240" "g.55944900G>A" "" "" "" "PCDH15(NM_001142771.1):c.1449C>T (p.T483=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54185140G>A" "" "likely benign" "" "0000305085" "0" "10" "10" "55912942" "55912942" "subst" "0.00161858" "01943" "PCDH15_000235" "g.55912942C>T" "" "" "" "PCDH15(NM_001142771.1):c.1717G>A (p.A573T), PCDH15(NM_001142771.2):c.1717G>A (p.A573T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54153182C>T" "" "benign" "" "0000305086" "0" "30" "10" "55849806" "55849806" "subst" "0" "01943" "PCDH15_000232" "g.55849806T>A" "" "" "" "PCDH15(NM_001142771.1):c.1950A>T (p.G650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54090046T>A" "" "likely benign" "" "0000305087" "0" "50" "10" "55782888" "55782888" "subst" "0.000374523" "01943" "PCDH15_000288" "g.55782888G>A" "" "" "" "PCDH15(NM_001142771.1):c.2305C>T (p.R769C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54023128G>A" "" "VUS" "" "0000305088" "0" "50" "10" "55782824" "55782824" "subst" "2.44075E-5" "01943" "PCDH15_000287" "g.55782824T>C" "" "" "" "PCDH15(NM_001142771.1):c.2369A>G (p.Y790C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54023064T>C" "" "VUS" "" "0000305089" "0" "30" "10" "56138617" "56138617" "subst" "0.000942737" "01943" "PCDH15_000249" "g.56138617C>T" "" "" "" "PCDH15(NM_001142771.1):c.258G>A (p.V86=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54378857C>T" "" "likely benign" "" "0000305090" "0" "30" "10" "55780078" "55780078" "subst" "0.00341842" "01943" "PCDH15_000285" "g.55780078C>T" "" "" "" "PCDH15(NM_001142771.1):c.2640G>A (p.S880=), PCDH15(NM_001142771.2):c.2640G>A (p.S880=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54020318C>T" "" "likely benign" "" "0000305091" "0" "30" "10" "55721637" "55721637" "subst" "0.000874866" "01943" "PCDH15_000284" "g.55721637G>A" "" "" "" "PCDH15(NM_001142771.1):c.2899C>T (p.R967C), PCDH15(NM_001142771.2):c.2899C>T (p.R967C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961877G>A" "" "likely benign" "" "0000305092" "0" "30" "10" "55721636" "55721636" "subst" "0.000870612" "01943" "PCDH15_000283" "g.55721636C>T" "" "" "" "PCDH15(NM_001142771.1):c.2900G>A (p.R967H), PCDH15(NM_001142771.2):c.2900G>A (p.R967H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961876C>T" "" "likely benign" "" "0000305093" "0" "30" "10" "56138570" "56138570" "subst" "0" "01943" "PCDH15_000248" "g.56138570T>C" "" "" "" "PCDH15(NM_001142771.1):c.305A>G (p.N102S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54378810T>C" "" "likely benign" "" "0000305094" "0" "50" "10" "55698631" "55698631" "subst" "8.13339E-6" "01943" "PCDH15_000226" "g.55698631C>G" "" "" "" "PCDH15(NM_001142771.1):c.3332G>C (p.R1111P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53938871C>G" "" "VUS" "" "0000305095" "0" "50" "10" "55663132" "55663132" "subst" "4.07266E-6" "01943" "PCDH15_000202" "g.55663132T>C" "" "" "" "PCDH15(NM_001142771.1):c.3389-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53903372T>C" "" "VUS" "" "0000305096" "0" "50" "10" "55663056" "55663056" "subst" "0" "01943" "PCDH15_000280" "g.55663056T>C" "" "" "" "PCDH15(NM_001142771.1):c.3463A>G (p.I1155V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53903296T>C" "" "VUS" "" "0000305097" "0" "30" "10" "55626625" "55626625" "subst" "0.00442998" "01943" "PCDH15_000278" "g.55626625G>A" "" "" "" "PCDH15(NM_001142771.1):c.3517-8C>T, PCDH15(NM_001142771.2):c.3517-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866865G>A" "" "likely benign" "" "0000305098" "0" "30" "10" "55626394" "55626394" "subst" "0.000725092" "01943" "PCDH15_000276" "g.55626394C>G" "" "" "" "PCDH15(NM_001142771.1):c.3732+8G>C, PCDH15(NM_001142771.2):c.3732+8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866634C>G" "" "likely benign" "" "0000305099" "0" "30" "10" "55582988" "55582988" "subst" "2.03346E-5" "01943" "PCDH15_000272" "g.55582988C>T" "" "" "" "PCDH15(NM_001142763.1):c.4519G>A (p.G1507R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53823228C>T" "" "likely benign" "" "0000305100" "0" "30" "10" "55569229" "55569229" "subst" "0.00504278" "01943" "PCDH15_000299" "g.55569229G>A" "" "" "" "PCDH15(NM_001142769.2):c.4596C>T (p.I1532=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809469G>A" "" "likely benign" "" "0000305101" "0" "10" "10" "55569263" "55569263" "subst" "0.00131103" "01943" "PCDH15_000302" "g.55569263T>G" "" "" "" "PCDH15(NM_001142770.2):c.4597A>C (p.S1533R), PCDH15(NM_001142770.3):c.4597A>C (p.S1533R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809503T>G" "" "benign" "" "0000305102" "0" "30" "10" "55566702" "55566702" "subst" "0.00262362" "01943" "PCDH15_000308" "g.55566702C>T" "" "" "" "PCDH15(NM_001142771.1):c.4686G>A (p.T1562=), PCDH15(NM_001354429.2):c.4794G>A (p.T1598=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53806942C>T" "" "likely benign" "" "0000305103" "0" "30" "10" "55582769" "55582769" "subst" "3.25142E-5" "01943" "PCDH15_000271" "g.55582769G>C" "" "" "" "PCDH15(NM_001142763.1):c.4738C>G (p.L1580V), PCDH15(NM_001142763.2):c.4738C>G (p.L1580V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53823009G>C" "" "likely benign" "" "0000305104" "0" "10" "10" "55582674" "55582674" "subst" "0.00203979" "01943" "PCDH15_000270" "g.55582674C>A" "" "" "" "PCDH15(NM_001142763.1):c.4833G>T (p.R1611S), PCDH15(NM_033056.4):c.4812G>T (p.R1604S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822914C>A" "" "benign" "" "0000305105" "0" "30" "10" "56106247" "56106247" "subst" "0.00820126" "01943" "PCDH15_000247" "g.56106247G>A" "" "" "" "PCDH15(NM_001142771.1):c.490-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54346487G>A" "" "likely benign" "" "0000305106" "0" "50" "10" "55582594" "55582594" "subst" "9.34086E-5" "01943" "PCDH15_000222" "g.55582594G>T" "" "" "" "PCDH15(NM_001142763.1):c.4913C>A (p.A1638E), PCDH15(NM_001142763.2):c.4913C>A (p.A1638E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822834G>T" "" "VUS" "" "0000305107" "0" "90" "10" "55582579" "55582580" "del" "0" "01943" "PCDH15_000221" "g.55582579_55582580del" "" "" "" "PCDH15(NM_001142763.1):c.4928_4929delAA (p.K1643Rfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822819_53822820del" "" "pathogenic" "" "0000305108" "0" "30" "10" "55568876" "55568876" "subst" "0.000207953" "01943" "PCDH15_000296" "g.55568876G>A" "" "" "" "PCDH15(NM_001142769.2):c.4949C>T (p.S1650L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809116G>A" "" "likely benign" "" "0000305109" "0" "30" "10" "55568589" "55568589" "subst" "0.000575206" "01943" "PCDH15_000294" "g.55568589C>T" "" "" "" "PCDH15(NM_001142769.2):c.5236G>A (p.G1746S), PCDH15(NM_001142769.3):c.5236G>A (p.G1746S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53808829C>T" "" "likely benign" "" "0000305110" "0" "30" "10" "55582239" "55582241" "del" "0" "01943" "PCDH15_000219" "g.55582239_55582241del" "" "" "" "PCDH15(NM_001142763.1):c.5275_5277delCCT (p.P1759del), PCDH15(NM_001142763.2):c.5275_5277delCCT (p.P1759del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822479_53822481del" "" "likely benign" "" "0000305111" "0" "30" "10" "55582223" "55582223" "subst" "0" "01943" "PCDH15_000218" "g.55582223G>A" "" "" "" "PCDH15(NM_001142763.1):c.5284C>T (p.P1762S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822463G>A" "" "likely benign" "" "0000305112" "0" "30" "10" "55568527" "55568527" "subst" "0.00712305" "01943" "PCDH15_000292" "g.55568527C>T" "" "" "" "PCDH15(NM_001142769.2):c.5298G>A (p.A1766=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53808767C>T" "" "likely benign" "" "0000305113" "0" "50" "10" "55582205" "55582210" "del" "0" "01943" "PCDH15_000216" "g.55582205_55582210del" "" "" "" "PCDH15(NM_001142763.1):c.5308_5313delGCTCCT (p.A1770_P1771del), PCDH15(NM_001142763.2):c.5308_5313delGCTCCT (p.A1770_P1771del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822445_53822450del" "" "VUS" "" "0000305115" "0" "10" "10" "55582127" "55582127" "subst" "0.0187812" "01943" "PCDH15_000212" "g.55582127G>A" "" "" "" "PCDH15(NM_001142763.1):c.5380C>T (p.P1794S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822367G>A" "" "benign" "" "0000305116" "0" "30" "10" "55582089" "55582089" "subst" "7.05113E-5" "01943" "PCDH15_000211" "g.55582089G>A" "" "" "" "PCDH15(NM_001142763.1):c.5418C>T (p.S1806=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822329G>A" "" "likely benign" "" "0000305117" "0" "30" "10" "55582088" "55582088" "subst" "0.00140531" "01943" "PCDH15_000210" "g.55582088C>T" "" "" "" "PCDH15(NM_001142763.1):c.5419G>A (p.V1807I), PCDH15(NM_001142763.2):c.5419G>A (p.V1807I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822328C>T" "" "likely benign" "" "0000305118" "0" "30" "10" "55581921" "55581921" "subst" "0.00177122" "01943" "PCDH15_000206" "g.55581921G>A" "" "" "" "PCDH15(NM_001142763.1):c.5586C>T (p.A1862=), PCDH15(NM_001142763.2):c.5586C>T (p.A1862=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822161G>A" "" "likely benign" "" "0000305119" "0" "50" "10" "55581895" "55581895" "subst" "0" "01943" "PCDH15_000205" "g.55581895T>C" "" "" "" "PCDH15(NM_001142763.1):c.5612A>G (p.Q1871R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822135T>C" "" "VUS" "" "0000305120" "0" "50" "10" "56106126" "56106126" "subst" "0.000207398" "01943" "PCDH15_000246" "g.56106126G>A" "" "" "" "PCDH15(NM_001142771.1):c.608C>T (p.P203L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54346366G>A" "" "VUS" "" "0000305121" "0" "30" "10" "56077022" "56077022" "subst" "0" "01943" "PCDH15_000245" "g.56077022T>G" "" "" "" "PCDH15(NM_001142771.1):c.891+9A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54317262T>G" "" "likely benign" "" "0000321537" "0" "50" "10" "55582183" "55582191" "dup" "0" "01804" "PCDH15_000215" "g.55582183_55582191dup" "" "" "" "PCDH15(NM_001142763.1):c.5317_5325dupGCTCCTCCT (p.A1773_P1775dup), PCDH15(NM_001142763.1):c.5325_5326insGCTCCTCCT (p.(Ala1773_Pro1775dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822423_53822431dup" "" "VUS" "" "0000321538" "0" "50" "10" "55591253" "55591253" "subst" "0.00173817" "01804" "PCDH15_000067" "g.55591253G>T" "" "" "" "PCDH15(NM_001142763.1):c.4039C>A (p.(Gln1347Lys)), PCDH15(NM_001142771.1):c.4039C>A (p.Q1347K), PCDH15(NM_001142771.2):c.4039C>A (p.Q1347K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831493G>T" "" "VUS" "" "0000338393" "0" "10" "10" "55591313" "55591313" "subst" "0.429407" "02327" "PCDH15_000257" "g.55591313G>A" "" "" "" "PCDH15(NM_001142771.2):c.3999-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831553G>A" "" "benign" "" "0000338394" "0" "50" "10" "55626397" "55626397" "subst" "4.07232E-6" "02327" "PCDH15_000259" "g.55626397C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866637C>T" "" "VUS" "" "0000338397" "0" "90" "10" "55755407" "55755407" "subst" "0" "02327" "PCDH15_000229" "g.55755407A>G" "" "" "" "PCDH15(NM_001142771.1):c.2883+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53995647A>G" "" "pathogenic" "" "0000338398" "0" "10" "10" "56077209" "56077209" "subst" "0.657115" "02327" "PCDH15_000265" "g.56077209G>A" "" "" "" "PCDH15(NM_001142771.2):c.721-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54317449G>A" "" "benign" "" "0000338399" "0" "10" "10" "56287569" "56287569" "subst" "0.0778492" "02327" "PCDH15_000266" "g.56287569T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54527809T>C" "" "benign" "" "0000341417" "0" "50" "10" "55955613" "55955613" "subst" "0" "02327" "PCDH15_000263" "g.55955613C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54195853C>A" "" "VUS" "" "0000341966" "0" "50" "10" "55569264" "55569267" "del" "0" "02327" "PCDH15_000301" "g.55569264_55569267del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809504_53809507del" "" "VUS" "" "0000342395" "0" "90" "10" "56077174" "56077174" "subst" "0.000207462" "02327" "PCDH15_000039" "g.56077174G>A" "" "" "" "PCDH15(NM_001142771.1):c.748C>T (p.R250*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000343491" "0" "10" "10" "55755491" "55755491" "subst" "0.25214" "02327" "PCDH15_000262" "g.55755491C>T" "" "" "" "PCDH15(NM_001142771.2):c.2801G>A (p.R934Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53995731C>T" "" "benign" "" "0000344544" "0" "30" "10" "55591253" "55591253" "subst" "0.00173817" "02327" "PCDH15_000256" "g.55591253G>T" "" "" "" "PCDH15(NM_001142763.1):c.4039C>A (p.(Gln1347Lys)), PCDH15(NM_001142771.1):c.4039C>A (p.Q1347K), PCDH15(NM_001142771.2):c.4039C>A (p.Q1347K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831493G>T" "" "likely benign" "" "0000344581" "0" "70" "10" "55569099" "55569099" "subst" "0" "02327" "PCDH15_000298" "g.55569099G>A" "" "" "" "PCDH15(NM_001142769.3):c.4726C>T (p.Q1576*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53809339G>A" "" "likely pathogenic" "" "0000345661" "0" "50" "10" "55626598" "55626598" "subst" "9.76054E-5" "02327" "PCDH15_000260" "g.55626598C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53866838C>T" "" "VUS" "" "0000345702" "0" "50" "10" "55591241" "55591241" "subst" "0" "02327" "PCDH15_000255" "g.55591241C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53831481C>T" "" "VUS" "" "0000346744" "0" "50" "10" "56287601" "56287601" "subst" "1.22028E-5" "02327" "PCDH15_000267" "g.56287601A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54527841A>G" "" "VUS" "" "0000348246" "0" "10" "10" "55582127" "55582127" "subst" "0.0187812" "02327" "PCDH15_000212" "g.55582127G>A" "" "" "" "PCDH15(NM_001142763.1):c.5380C>T (p.P1794S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53822367G>A" "" "benign" "" "0000348357" "0" "50" "10" "56077032" "56077032" "subst" "4.47213E-5" "02327" "PCDH15_000264" "g.56077032G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54317272G>A" "" "VUS" "" "0000350222" "0" "90" "10" "55721599" "55721599" "subst" "0" "02327" "PCDH15_000261" "g.55721599G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53961839G>T" "" "pathogenic" "" "0000351284" "0" "90" "10" "55663132" "55663132" "subst" "4.07266E-6" "02327" "PCDH15_000202" "g.55663132T>C" "" "" "" "PCDH15(NM_001142771.1):c.3389-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.53903372T>C" "" "pathogenic" "" "0000358303" "3" "90" "10" "56077174" "56077174" "subst" "0.000207462" "01243" "PCDH15_000039" "g.56077174G>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374256" "10" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Baux 2008:18484607}" "+DdeI;+BspCNI;+TspRI;" "" "homozygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374257" "20" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Baux 2008:18484607}" "+DdeI;+BspCNI;+TspRI;" "" "homozygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374258" "10" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Roux 2011:21436283}" "+DdeI;+BspCNI;+TspRI;" "" "homozygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374259" "20" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Roux 2011:21436283}" "+DdeI;+BspCNI;+TspRI;" "" "homozygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374260" "0" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Roux 2011:21436283}" "+DdeI;+BspCNI;+TspRI;" "" "hemizygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374261" "0" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "{PMID:Roux 2011:21436283}" "+DdeI;+BspCNI;+TspRI;" "" "heterozygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374262" "1" "11" "10" "56287689" "56287689" "subst" "0" "02416" "PCDH15_000001" "g.56287689A>C" "" "" "+DdeI;+BspCNI;+TspRI;" "" "hemizygous" "Germline" "" "rs10825347" "0" "" "" "g.54527929A>C" "" "benign" "" "0000374266" "0" "11" "10" "56129066" "56129066" "subst" "0.197641" "02416" "PCDH15_000002" "g.56129066A>G" "" "{PMID:Roux 2006:16679490}" "none" "" "heterozygous" "Germline" "" "rs11594958" "0" "" "" "g.54369306A>G" "" "benign" "" "0000374267" "0" "11" "10" "56129066" "56129066" "subst" "0.197641" "02416" "PCDH15_000002" "g.56129066A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs11594958" "0" "" "" "g.54369306A>G" "" "benign" "" "0000374268" "10" "11" "10" "56129066" "56129066" "subst" "0.197641" "02416" "PCDH15_000002" "g.56129066A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11594958" "0" "" "" "g.54369306A>G" "" "benign" "" "0000374269" "20" "11" "10" "56129066" "56129066" "subst" "0.197641" "02416" "PCDH15_000002" "g.56129066A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11594958" "0" "" "" "g.54369306A>G" "" "benign" "" "0000374270" "1" "11" "10" "56129066" "56129066" "subst" "0.197641" "02416" "PCDH15_000002" "g.56129066A>G" "" "" "none" "" "hemizygous" "Germline" "" "rs11594958" "0" "" "" "g.54369306A>G" "" "benign" "" "0000374271" "0" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374272" "0" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374273" "0" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374274" "0" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374275" "10" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374276" "20" "75" "10" "55943211" "55943211" "subst" "4.06379E-6" "02416" "PCDH15_000003" "g.55943211A>T" "0/152 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15V528D:} USMA-{MSV3dQ96QU1p.Val528Asp:}" "+Tsp45I;-Tth111I;-PflFI;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54183451A>T" "" "VUS" "ACMG" "0000374279" "0" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2006:16679490}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "heterozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374280" "10" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "69/156 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374281" "20" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "69/156 controls" "{PMID:Doucette 2009:19107147}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374282" "10" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374283" "20" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374284" "10" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374285" "20" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "homozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374286" "0" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "heterozygous" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374287" "0" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "heterozygous; non causative" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374288" "0" "11" "10" "56423968" "56423968" "subst" "0.219841" "02416" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15S19A:} USMA-{MSV3dQ96QU1p.Ser19Ala:}" "+HinP1I;+HaeII;+HhaI;-Bsp1286I;-BanII;-CviKI_1;" "" "heterozygous; non causative" "Germline" "" "rs11004439" "0" "" "" "g.54664208A>C" "" "benign" "" "0000374289" "0" "11" "10" "55617042" "55617042" "subst" "0.0229449" "02416" "PCDH15_000005" "g.55617042G>T" "" "{PMID:Roux 2006:16679490}" "-EcoRI;-ApoI;" "" "heterozygous" "Germline" "" "rs75248212" "0" "" "" "g.53857282G>T" "" "benign" "" "0000374290" "10" "11" "10" "55617042" "55617042" "subst" "0.0229449" "02416" "PCDH15_000005" "g.55617042G>T" "6/159 controls" "{PMID:Doucette 2009:19107147}" "-EcoRI;-ApoI;" "" "homozygous" "Germline" "" "rs75248212" "0" "" "" "g.53857282G>T" "" "benign" "" "0000374291" "20" "11" "10" "55617042" "55617042" "subst" "0.0229449" "02416" "PCDH15_000005" "g.55617042G>T" "6/159 controls" "{PMID:Doucette 2009:19107147}" "-EcoRI;-ApoI;" "" "homozygous" "Germline" "" "rs75248212" "0" "" "" "g.53857282G>T" "" "benign" "" "0000374292" "10" "11" "10" "55617042" "55617042" "subst" "0.0229449" "02416" "PCDH15_000005" "g.55617042G>T" "" "{PMID:Neveling 2012:22334370}" "-EcoRI;-ApoI;" "" "homozygous" "Germline" "" "rs75248212" "0" "" "" "g.53857282G>T" "" "benign" "" "0000374293" "20" "11" "10" "55617042" "55617042" "subst" "0.0229449" "02416" "PCDH15_000005" "g.55617042G>T" "" "{PMID:Neveling 2012:22334370}" "-EcoRI;-ApoI;" "" "homozygous" "Germline" "" "rs75248212" "0" "" "" "g.53857282G>T" "" "benign" "" "0000374294" "0" "11" "10" "55719596" "55719596" "subst" "0.00343287" "02416" "PCDH15_000006" "g.55719596C>A" "" "{PMID:Roux 2006:16679490}" "none" "" "heterozygous" "Germline" "" "rs41307518" "0" "" "" "g.53959836C>A" "" "benign" "" "0000374295" "0" "11" "10" "55719596" "55719596" "subst" "0.00343287" "02419" "PCDH15_000006" "g.55719596C>A" "6/840 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41307518" "0" "" "" "g.53959836C>A" "" "benign" "" "0000374296" "0" "11" "10" "55719596" "55719596" "subst" "0.00343287" "02419" "PCDH15_000006" "g.55719596C>A" "6/840 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41307518" "0" "" "" "g.53959836C>A" "" "benign" "" "0000374297" "0" "11" "10" "55892642" "55892642" "subst" "0.0276228" "02416" "PCDH15_000007" "g.55892642T>C" "" "{PMID:Roux 2006:16679490}; USMA-{USMAPCDH15N637S:} USMA-{MSV3dQ96QU1p.Asn637Ser:}" "" "" "heterozygous" "Germline" "" "rs61731389" "0" "" "" "g.54132882T>C" "" "benign" "" "0000374298" "1" "99" "10" "56128923" "56128931" "dup" "0" "02416" "PCDH15_000008" "g.56128923_56128931dup" "" "{PMID:Roux 2006:16679490}" "" "" "hemizygous" "Germline" "" "" "0" "" "" "g.54369163_54369171dup" "" "pathogenic" "" "0000374299" "2" "99" "10" "56128879" "56287638" "del" "0" "02416" "PCDH15_000009" "g.(56106245_56128879)_(56287638_56423931)del" "" "{PMID:Roux 2006:16679490}" "" "del ex3-5" "heterozygous" "Germline" "" "" "0" "" "" "g.(54346485_54369119)_(54527878_54664171)del" "" "pathogenic" "" "0000374300" "0" "11" "10" "55587362" "55587362" "subst" "0" "02416" "PCDH15_000010" "g.55587362A>G" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53827602A>G" "" "benign" "" "0000374301" "0" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "heterozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374302" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374303" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374304" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374305" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374306" "0" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "heterozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374307" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374308" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374309" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374310" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2006:16679490}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374311" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2011:21436283}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374312" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2011:21436283}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374313" "10" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2011:21436283}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374314" "20" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2011:21436283}" "+CviQI;+RsaI;-SspI;" "" "homozygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374315" "11" "11" "10" "55663198" "55663198" "subst" "0" "02416" "PCDH15_000011" "g.55663198A>C" "" "{PMID:Roux 2011:21436283}" "+CviQI;+RsaI;-SspI;" "" "hemizygous" "Germline" "" "rs10740559" "0" "" "" "g.53903438A>C" "" "benign" "" "0000374318" "0" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "heterozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374319" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374320" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374321" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374322" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374323" "0" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "heterozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374324" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374325" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374326" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374327" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2006:16679490}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374328" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2011:21436283}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374329" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2011:21436283}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374330" "10" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2011:21436283}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374331" "20" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2011:21436283}" "-SspI" "" "homozygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374332" "11" "11" "10" "55663202" "55663202" "subst" "0" "02416" "PCDH15_000012" "g.55663202T>C" "" "{PMID:Roux 2011:21436283}" "-SspI" "" "hemizygous" "Germline" "" "rs2593124" "0" "" "" "g.53903442T>C" "" "benign" "" "0000374339" "0" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "heterozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374340" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374341" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374342" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374343" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374344" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374345" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2006:16679490}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374346" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Baux 2008:18484607}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374347" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Baux 2008:18484607}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374348" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374349" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374350" "0" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "heterozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374351" "10" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374352" "20" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "homozygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374353" "11" "11" "10" "55719652" "55719652" "subst" "0.743565" "02416" "PCDH15_000013" "g.55719652C>T" "" "{PMID:Roux 2011:21436283}" "+HpyCH4III;+TspRI;" "" "hemizygous" "Germline" "" "rs2593107" "0" "" "" "g.53959892C>T" "" "benign" "" "0000374360" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374361" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374362" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374363" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374364" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374365" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374366" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374367" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374368" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374369" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2006:16679490}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374370" "0" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2011:21436283}" "-MwoI" "" "heterozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374371" "10" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2011:21436283}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374372" "20" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2011:21436283}" "-MwoI" "" "homozygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374373" "11" "11" "10" "55779915" "55779915" "subst" "0.64799" "02416" "PCDH15_000014" "g.55779915G>A" "" "{PMID:Roux 2011:21436283}" "-MwoI" "" "hemizygous" "Germline" "" "rs3812658" "0" "" "" "g.54020155G>A" "" "benign" "" "0000374377" "10" "11" "10" "55892621" "55892622" "dup" "0" "02416" "PCDH15_000015" "g.55892621_55892622dup" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "rs5785040" "0" "" "" "g.54132861_54132862dup" "" "benign" "" "0000374378" "10" "11" "10" "55892621" "55892622" "dup" "0" "02416" "PCDH15_000015" "g.55892621_55892622dup" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "rs5785040" "0" "" "" "g.54132861_54132862dup" "" "benign" "" "0000374379" "0" "11" "10" "55892621" "55892622" "dup" "0" "02416" "PCDH15_000015" "g.55892621_55892622dup" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "rs5785040" "0" "" "" "g.54132861_54132862dup" "" "benign" "" "0000374380" "20" "11" "10" "55892621" "55892622" "dup" "0" "02416" "PCDH15_000015" "g.55892621_55892622dup" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "rs5785040" "0" "" "" "g.54132861_54132862dup" "" "benign" "" "0000374381" "20" "11" "10" "55892621" "55892622" "dup" "0" "02416" "PCDH15_000015" "g.55892621_55892622dup" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "rs5785040" "0" "" "" "g.54132861_54132862dup" "" "benign" "" "0000374382" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374383" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374384" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374385" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374386" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374387" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374388" "0" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "heterozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374389" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374390" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374391" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374392" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374393" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374394" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374395" "10" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374396" "20" "11" "10" "55943184" "55943184" "subst" "0.661706" "02416" "PCDH15_000016" "g.55943184T>C" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7093302" "0" "" "" "g.54183424T>C" "" "benign" "" "0000374404" "0" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374405" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374406" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374407" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374408" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374409" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374410" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374411" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374412" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2006:16679490}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374413" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374414" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374415" "0" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374416" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374417" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374418" "10" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374419" "20" "11" "10" "55973889" "55973889" "subst" "0" "02416" "PCDH15_000017" "g.55973889G>A" "" "{PMID:Roux 2011:21436283}" "-Bpu10I;-AluI;-CviKI_1;-BbvCI;-MspA1I;-PvuII;" "" "homozygous" "Germline" "" "" "0" "" "" "g.54214129G>A" "" "benign" "" "0000374427" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374428" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374429" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374430" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374431" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374432" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374433" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374434" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374435" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374436" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374437" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374438" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2006:16679490}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374439" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374440" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374441" "0" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "heterozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374442" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374443" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374444" "10" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374445" "20" "11" "10" "55996761" "55996761" "subst" "0" "02416" "PCDH15_000018" "g.55996761C>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs721825" "0" "" "" "g.54237001C>T" "" "benign" "" "0000374453" "0" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "heterozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374454" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374455" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374456" "2" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "hemizygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374457" "2" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "heterozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374458" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374459" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374460" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374461" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2006:16679490}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374462" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Baux 2008:18484607}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374463" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Baux 2008:18484607}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374464" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2011:21436283}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374465" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2011:21436283}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374466" "10" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2011:21436283}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374467" "20" "11" "10" "56076975" "56076975" "subst" "0" "02416" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Roux 2011:21436283}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374468" "10" "11" "10" "56076975" "56076975" "subst" "0" "02419" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous; Neutral" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374469" "20" "11" "10" "56076975" "56076975" "subst" "0" "02419" "PCDH15_000019" "g.56076975A>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+NspI;-AlwI;-Sau3AI;-MboI;-DpnI;-BfuCI;" "" "homozygous; Neutral" "Germline" "" "rs10763098" "0" "" "" "g.54317215A>C" "" "benign" "" "0000374477" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374478" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374479" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374480" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374481" "2" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "hemizygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374482" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374483" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374484" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374485" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374486" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374487" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374488" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Baux 2008:18484607}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374489" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Baux 2008:18484607}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374490" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374491" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374492" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374493" "0" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374494" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374495" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374496" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374497" "10" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374498" "20" "11" "10" "56077209" "56077209" "subst" "0.657115" "02416" "PCDH15_000020" "g.56077209G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740579" "0" "" "" "g.54317449G>A" "" "benign" "" "0000374506" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374507" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374508" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374509" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374510" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374511" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374512" "2" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "hemizygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374513" "0" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "heterozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374514" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374515" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2006:16679490}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374516" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Baux 2008:18484607}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374517" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Baux 2008:18484607}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374518" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374519" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374520" "0" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "heterozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374521" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374522" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374523" "10" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374524" "20" "11" "10" "56089263" "56089263" "subst" "0" "02416" "PCDH15_000021" "g.56089263G>A" "" "{PMID:Roux 2011:21436283}" "+Tsp45I" "" "homozygous" "Germline" "" "rs857395" "0" "" "" "g.54329503G>A" "" "benign" "" "0000374532" "1" "99" "10" "55719493" "55719493" "subst" "0" "02416" "PCDH15_000022" "g.55719493T>A" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53959733T>A" "" "pathogenic" "" "0000374533" "10" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374534" "10" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374535" "10" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374536" "20" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374537" "20" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374538" "20" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "0/200 controls" "{PMID:Ahmed 2003:14570705}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374539" "2" "99" "10" "55849814" "55849814" "subst" "0" "02416" "PCDH15_000023" "g.55849814G>A" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54090054G>A" "" "pathogenic" "" "0000374540" "10" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374541" "20" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374542" "0" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "heterozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374543" "0" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "heterozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374544" "10" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374545" "20" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2006:16679490}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374546" "0" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2011:21436283}" "-AluI" "" "heterozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374547" "10" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2011:21436283}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374548" "20" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2011:21436283}" "-AluI" "" "homozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374549" "0" "11" "10" "55626367" "55626367" "subst" "0.362784" "02416" "PCDH15_000024" "g.55626367A>G" "" "{PMID:Roux 2011:21436283}" "-AluI" "" "heterozygous" "Germline" "" "rs10825135" "0" "" "" "g.53866607A>G" "" "benign" "" "0000374552" "2" "99" "10" "56077039" "56077039" "subst" "0" "02416" "PCDH15_000025" "g.56077039T>A" "" "{PMID:Roux 2006:16679490}" "" "" "" "Germline" "" "" "0" "" "" "g.54317279T>A" "" "pathogenic (recessive)" "" "0000374553" "1" "99" "10" "56077030" "56077202" "del" "0" "02416" "PCDH15_000026" "g.(55996692_56077030)_(56077202_56089355)del" "" "{PMID:Roux 2006:16679490}" "" "del ex8" "" "Germline" "" "" "0" "" "" "g.(54236932_54317270)_(54317442_54329595)del" "" "pathogenic (recessive)" "" "0000374554" "0" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "heterozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374555" "0" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "heterozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374556" "10" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Baux 2008:18484607}" "none" "" "homozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374557" "20" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Baux 2008:18484607}" "none" "" "homozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374558" "10" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374559" "20" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374560" "0" "11" "10" "55591313" "55591313" "subst" "0.429407" "02416" "PCDH15_000027" "g.55591313G>A" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs7089209" "0" "" "" "g.53831553G>A" "" "benign" "" "0000374562" "0" "11" "10" "55826470" "55826470" "subst" "0.202544" "02416" "PCDH15_000028" "g.55826470A>G" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "rs3812657" "0" "" "" "g.54066710A>G" "" "benign" "" "0000374563" "0" "11" "10" "55826470" "55826470" "subst" "0.202544" "02416" "PCDH15_000028" "g.55826470A>G" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "rs3812657" "0" "" "" "g.54066710A>G" "" "benign" "" "0000374565" "2" "99" "10" "55973758" "55973758" "subst" "0" "02416" "PCDH15_000029" "g.55973758C>A" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54213998C>A" "" "pathogenic" "" "0000374566" "1" "99" "10" "56077031" "56077041" "del" "0" "02416" "PCDH15_000030" "g.56077031_56077041del" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54317271_54317281del" "" "pathogenic" "" "0000374567" "0" "11" "10" "55700804" "55700804" "subst" "0" "02416" "PCDH15_000031" "g.55700804A>C" "" "{PMID:Roux 2006:16679490}" "" "" "heterozygous" "Germline" "" "rs79035890" "0" "" "" "g.53941044A>C" "" "benign" "" "0000374568" "0" "11" "10" "55755340" "55755340" "subst" "0" "02416" "PCDH15_000032" "g.55755340C>T" "" "{PMID:Roux 2006:16679490}" "-TfiI;-HinfI;" "" "heterozygous" "Germline" "" "rs11003980" "0" "" "" "g.53995580C>T" "" "benign" "" "0000374569" "0" "11" "10" "55755340" "55755340" "subst" "0" "02416" "PCDH15_000032" "g.55755340C>T" "" "{PMID:Roux 2011:21436283}" "-TfiI;-HinfI;" "" "heterozygous" "Germline" "" "rs11003980" "0" "" "" "g.53995580C>T" "" "benign" "" "0000374571" "3" "99" "10" "56560684" "56561051" "del" "0" "02416" "PCDH15_000033" "g.(56424051_56560684)_(56561051_?)del" "" "{PMID:Roux 2006:16679490}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(54664291_54800924)_(54801291_?)del" "" "pathogenic (recessive)" "" "0000374575" "10" "11" "10" "55663069" "55663069" "subst" "0" "02416" "PCDH15_000034" "g.55663069C>T" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53903309C>T" "" "benign" "" "0000374576" "20" "11" "10" "55663069" "55663069" "subst" "0" "02416" "PCDH15_000034" "g.55663069C>T" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53903309C>T" "" "benign" "" "0000374577" "10" "11" "10" "55996608" "55996608" "subst" "0.0302854" "02416" "PCDH15_000035" "g.55996608T>C" "" "{PMID:Roux 2006:16679490}" "+MspI;+HpaII;+NciI;-PspGI;-BstNI;" "" "homozygous" "Germline" "" "rs41274634" "0" "" "" "g.54236848T>C" "" "benign" "" "0000374578" "20" "11" "10" "55996608" "55996608" "subst" "0.0302854" "02416" "PCDH15_000035" "g.55996608T>C" "" "{PMID:Roux 2006:16679490}" "+MspI;+HpaII;+NciI;-PspGI;-BstNI;" "" "homozygous" "Germline" "" "rs41274634" "0" "" "" "g.54236848T>C" "" "benign" "" "0000374579" "10" "11" "10" "55996608" "55996608" "subst" "0.0302854" "02419" "PCDH15_000035" "g.55996608T>C" "1/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+MspI;+HpaII;+NciI;-PspGI;-BstNI;" "" "homozygous; Neutral" "Germline" "" "rs41274634" "0" "" "" "g.54236848T>C" "" "benign" "" "0000374580" "20" "11" "10" "55996608" "55996608" "subst" "0.0302854" "02419" "PCDH15_000035" "g.55996608T>C" "1/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+MspI;+HpaII;+NciI;-PspGI;-BstNI;" "" "homozygous; Neutral" "Germline" "" "rs41274634" "0" "" "" "g.54236848T>C" "" "benign" "" "0000374581" "10" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02416" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374582" "20" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02416" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Roux 2006:16679490}" "none" "" "homozygous" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374583" "0" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02419" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374584" "0" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02419" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374585" "0" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02419" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374586" "0" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02419" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374587" "0" "11" "10" "56106247" "56106247" "subst" "0.00820126" "02419" "PCDH15_000036" "g.56106247G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Neutral" "Germline" "" "rs41304641" "0" "" "" "g.54346487G>A" "" "benign" "" "0000374588" "10" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374589" "20" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Roux 2006:16679490}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374590" "10" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Roux 2011:21436283}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374591" "20" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Roux 2011:21436283}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374592" "10" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Bonnet 2011:21569298}" "+FatI;+NlaIII;+CviAII;-BssSI;" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374593" "20" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Bonnet 2011:21569298}" "+FatI;+NlaIII;+CviAII;-BssSI;" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374594" "10" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Yoshimura 2014:24618850}" "" "" "homozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374595" "20" "99" "10" "55721550" "55721550" "subst" "2.03494E-5" "02416" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Yoshimura 2014:24618850}" "" "" "homozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000374598" "10" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Roux 2006:16679490}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374599" "20" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Roux 2006:16679490}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374600" "10" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374601" "20" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374602" "0" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "heterozygous" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374603" "10" "11" "10" "55755491" "55755491" "subst" "0.25214" "02419" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; Neutral" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374604" "20" "11" "10" "55755491" "55755491" "subst" "0.25214" "02419" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; Neutral" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374605" "10" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; non causative" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374606" "20" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; non causative" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374607" "10" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; non causative" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374608" "20" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "homozygous; non causative" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374609" "0" "11" "10" "55755491" "55755491" "subst" "0.25214" "02416" "PCDH15_000038" "g.55755491C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15R929Q:} USMA-{MSV3dQ96QU1p.Arg929Gln:}" "none" "" "heterozygous; het/hom status not reported in table; non causative" "Germline" "" "rs2135720" "0" "" "" "g.53995731C>T" "" "benign" "" "0000374610" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374611" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374612" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374613" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374614" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374615" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374616" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374617" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374618" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374619" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374620" "2" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "heterozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374621" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374622" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374623" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374624" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374625" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374626" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374627" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374628" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374629" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374630" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "8/581 controls" "{PMID:Ben-Yosef 2003:12711741}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374631" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374632" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374633" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374634" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374635" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374636" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374637" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374638" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "5/1010 controls" "{PMID:Brownstein 2004:15028842}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374639" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Jacobson 2008:18463160}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374640" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Jacobson 2008:18463160}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374641" "2" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "" "" "heterozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic (recessive)" "" "0000374642" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Bujakowska 2014:25468891}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374643" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02416" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Bujakowska 2014:25468891}" "" "" "homozygous" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374644" "10" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02428" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374645" "20" "99" "10" "56077174" "56077174" "subst" "0.000207462" "02428" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "rs111033260" "0" "" "" "g.54317414G>A" "" "pathogenic" "" "0000374646" "0" "35" "10" "55943311" "55943311" "subst" "0.000109693" "02418" "PCDH15_000040" "g.55943311C>T" "" "Oshima et al.; USMA-{USMAPCDH15:V495I} USMA-{MSV3dQ96QU1:p.Val495Ile}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54183551C>T" "" "likely benign" "ACMG" "0000374647" "0" "11" "10" "55582636" "55582636" "subst" "0.00542653" "02419" "PCDH15_000041" "g.55582636T>C" "10/844 controls" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15N1617S:} USMA-{MSV3dQ96QU1p.Asn1617Ser:}" "none" "" "heterozygous; Neutral" "Germline" "" "rs111033362" "0" "" "" "g.53822876T>C" "" "benign" "" "0000374648" "0" "11" "10" "55582636" "55582636" "subst" "0.00542653" "02419" "PCDH15_000041" "g.55582636T>C" "10/844 controls" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15N1617S:} USMA-{MSV3dQ96QU1p.Asn1617Ser:}" "none" "" "heterozygous; Neutral" "Germline" "" "rs111033362" "0" "" "" "g.53822876T>C" "" "benign" "" "0000374649" "0" "11" "10" "55582636" "55582636" "subst" "0.00542653" "02419" "PCDH15_000041" "g.55582636T>C" "10/844 controls" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15N1617S:} USMA-{MSV3dQ96QU1p.Asn1617Ser:}" "none" "" "heterozygous; Neutral" "Germline" "" "rs111033362" "0" "" "" "g.53822876T>C" "" "benign" "" "0000374650" "0" "11" "10" "55582636" "55582636" "subst" "0.00542653" "02419" "PCDH15_000041" "g.55582636T>C" "10/844 controls" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15N1617S:} USMA-{MSV3dQ96QU1p.Asn1617Ser:}" "none" "" "heterozygous; Neutral" "Germline" "" "rs111033362" "0" "" "" "g.53822876T>C" "" "benign" "" "0000374651" "0" "11" "10" "55582636" "55582636" "subst" "0.00542653" "02418" "PCDH15_000041" "g.55582636T>C" "" "Oshima et al.; USMA-{USMAPCDH15:N1617S} USMA-{MSV3dQ96QU1:p.Asn1617Ser}" "none" "" "heterozygous" "Germline" "" "rs111033362" "0" "" "" "g.53822876T>C" "" "benign" "" "0000374652" "1" "35" "10" "56106198" "56106198" "subst" "0.000170683" "02416" "PCDH15_000042" "g.56106198T>C" "0/100 controls" "{PMID:Jaijo 2012:22815625}; USMA-{USMAPCDH15N174S:} USMA-{MSV3dQ96QU1p.Asn174Ser:}" "" "" "heterozygous; probably non pathogenic" "Germline" "" "" "0" "" "" "g.54346438T>C" "" "likely benign" "ACMG" "0000374653" "0" "35" "10" "55600246" "55600246" "subst" "0.000613412" "02416" "PCDH15_000043" "g.55600246G>T" "0/306 controls" "{PMID:Bonnet 2011:21569298}; USMA-{USMAPCDH15R1273S:} USMA-{MSV3dQ96QU1p.Arg1273Ser:}" "+AluI;+CviKI_1;+AlwI;+Sau3AI;+MboI;+DpnI;" "" "heterozygous; Presumably pathogenic" "Germline" "" "rs111033363" "0" "" "" "g.53840486G>T" "" "likely benign" "ACMG" "0000374654" "0" "35" "10" "55600246" "55600246" "subst" "0.000613412" "02418" "PCDH15_000043" "g.55600246G>T" "0/100 controls" "{PMID:Jaijo 2012:22815625}; USMA-{USMAPCDH15R1273S:} USMA-{MSV3dQ96QU1p.Arg1273Ser:}" "+BfaI;-PflMI;-BslI;" "" "heterozygous; presumed non-pathogenic variant" "Germline" "" "rs111033363" "0" "" "" "g.53840486G>T" "" "likely benign" "ACMG" "0000374655" "0" "35" "10" "55600246" "55600246" "subst" "0.000613412" "02416" "PCDH15_000043" "g.55600246G>T" "" "{PMID:Bujakowska 2014:25468891}; USMA-{USMAPCDH15R1273S:} USMA-{MSV3dQ96QU1p.Arg1273Ser:}" "+BfaI;-PflMI;-BslI;" "" "heterozygous" "Germline" "" "rs111033363" "0" "" "" "g.53840486G>T" "" "likely benign" "ACMG" "0000374656" "0" "75" "10" "55719538" "55719538" "subst" "0" "02418" "PCDH15_000044" "g.55719538C>G" "" "Oshima et al.; USMA-{USMAPCDH15:V1026L} USMA-{MSV3dQ96QU1:p.Val1026Leu}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53959778C>G" "" "VUS" "ACMG" "0000374657" "1" "75" "10" "56128953" "56128953" "subst" "8.14458E-6" "02416" "PCDH15_000045" "g.56128953C>T" "" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}; USMA-{USMAPCDH15R134Q:} USMA-{MSV3dQ96QU1p.Arg134Gln:}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54369193C>T" "" "VUS" "ACMG" "0000374658" "3" "99" "10" "55755495" "55755495" "subst" "0" "02418" "PCDH15_000046" "g.55755495T>A" "" "{PMID:Jaijo 2012:22815625}" "" "" "homozygous; Probable pathogenic" "Germline" "" "" "0" "" "" "g.53995735T>A" "" "pathogenic (recessive)" "" "0000374660" "0" "75" "10" "55587229" "55587229" "subst" "0" "02418" "PCDH15_000047" "g.55587229G>A" "" "Oshima et al.; USMA-{USMAPCDH15:P1431S} USMA-{MSV3dQ96QU1:p.Pro1431Ser}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53827469G>A" "" "VUS" "ACMG" "0000374661" "0" "75" "10" "55587219" "55587219" "subst" "1.64821E-5" "02418" "PCDH15_000048" "g.55587219G>A" "" "Oshima et al.; USMA-{USMAPCDH15:A1434V} USMA-{MSV3dQ96QU1:p.Ala1434Val}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53827459G>A" "" "VUS" "ACMG" "0000374662" "0" "75" "10" "55587219" "55587219" "subst" "1.64821E-5" "02418" "PCDH15_000048" "g.55587219G>A" "" "Oshima et al.; USMA-{USMAPCDH15:A1434V} USMA-{MSV3dQ96QU1:p.Ala1434Val}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53827459G>A" "" "VUS" "ACMG" "0000374664" "10" "75" "10" "55587192" "55587192" "subst" "8.2335E-6" "02418" "PCDH15_000050" "g.55587192G>A" "" "Oshima et al.; USMA-{USMAPCDH15:P1443L} USMA-{MSV3dQ96QU1:p.Pro1443Leu}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827432G>A" "" "VUS" "ACMG" "0000374665" "20" "75" "10" "55587192" "55587192" "subst" "8.2335E-6" "02418" "PCDH15_000050" "g.55587192G>A" "" "Oshima et al.; USMA-{USMAPCDH15:P1443L} USMA-{MSV3dQ96QU1:p.Pro1443Leu}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827432G>A" "" "VUS" "ACMG" "0000374666" "2" "99" "10" "55912907" "55912907" "subst" "4.0699E-6" "02418" "PCDH15_000051" "g.55912907G>C" "" "{PMID:Jaijo 2012:22815625}" "" "" "heterozygous; Probable pathogenic" "Germline" "" "" "0" "" "" "g.54153147G>C" "" "pathogenic" "" "0000374667" "1" "73" "10" "55755404" "55755404" "subst" "4.07206E-6" "02418" "PCDH15_000052" "g.55755404C>T" "" "{PMID:Jaijo 2012:22815625}" "" "" "heterozygous; shown in Aparisi , 2013 NOT to affect splicing; Probable pathogenic - Neutral in Aparisi , 2013" "Germline" "" "" "0" "" "" "g.53995644C>T" "" "likely benign" "ACMG" "0000374668" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374669" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374670" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374671" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374672" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374673" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374674" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374675" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374676" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374677" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374678" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374679" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374680" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374681" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374682" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374683" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374684" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374685" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374686" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374687" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374688" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374689" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374690" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Jaijo 2010:19683999}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374691" "1" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Jaijo 2010:19683999}" "-TaqI" "" "heterozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374692" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Jaijo 2010:19683999}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374693" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Jaijo 2010:19683999}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374694" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Jaijo 2010:19683999}" "-TaqI" "" "homozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374695" "0" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02416" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Roux 2011:21436283}" "-TaqI" "" "heterozygous" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374696" "10" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02428" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374697" "20" "99" "10" "56424016" "56424016" "subst" "2.0555E-5" "02428" "PCDH15_000053" "g.56424016G>A" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "rs137853001" "0" "" "" "g.54664256G>A" "" "pathogenic" "" "0000374700" "1" "99" "10" "55587197" "55587202" "del" "0" "02416" "PCDH15_000054" "g.55587197_55587202del" "0/330 controls" "{PMID:Hutchin 2005:16283880}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53827437_53827442del" "" "pathogenic" "" "0000374701" "1" "11" "10" "55581929" "55581929" "subst" "0.00067841" "02416" "PCDH15_000055" "g.55581929T>G" "4/561 controls" "{PMID:Ben-Yosef 2003:12711741}; USMA-{USMAPCDH15M1853L:} USMA-{MSV3dQ96QU1p.Met1853Leu:}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53822169T>G" "" "benign" "" "0000374702" "10" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374703" "10" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374704" "10" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374705" "10" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374706" "10" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374707" "20" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374708" "20" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374709" "20" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374710" "20" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374711" "20" "99" "10" "55617025" "55617025" "subst" "4.06835E-6" "02416" "PCDH15_000056" "g.55617025T>C" "0/240 controls" "{PMID:Ahmed 2001:11398101}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53857265T>C" "" "pathogenic" "" "0000374712" "10" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374713" "10" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374714" "10" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374715" "10" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374716" "10" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374717" "20" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374718" "20" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374719" "20" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374720" "20" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374721" "20" "99" "10" "56077122" "56077122" "subst" "0" "02416" "PCDH15_000057" "g.56077122C>T" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15G262D:} USMA-{MSV3dQ96QU1p.Gly262Asp:}" "" "" "homozygous" "Germline" "" "rs137853002" "0" "" "" "g.54317362C>T" "" "VUS" "ACMG" "0000374722" "10" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374723" "10" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374724" "10" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374725" "20" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374726" "20" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374727" "20" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/300 controls" "{PMID:Ahmed 2003:14570705}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374728" "10" "95" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374729" "10" "95" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374730" "10" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374731" "20" "95" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374732" "20" "95" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374733" "20" "99" "10" "56128954" "56128954" "subst" "0" "02416" "PCDH15_000058" "g.56128954G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374734" "0" "75" "10" "56128954" "56128954" "subst" "0" "00143" "PCDH15_000058" "g.56128954G>C" "" "{PMID:Krawitz 2014:25333064}; USMA-{USMAPCDH15R134G:} USMA-{MSV3dQ96QU1p.Arg134Gly:}" "" "" "homozygous; mutation" "Germline" "" "rs137853003" "0" "" "" "g.54369194G>C" "" "VUS" "ACMG" "0000374735" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374736" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374737" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374738" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374739" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374740" "10" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374741" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374742" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374743" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374744" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374745" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374746" "20" "99" "10" "55626401" "55626401" "subst" "4.07027E-6" "02416" "PCDH15_000059" "g.55626401C>A" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866641C>A" "" "pathogenic" "" "0000374747" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374748" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374749" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374750" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374751" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374752" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374753" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374754" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374755" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374756" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374757" "10" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374758" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374759" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374760" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374761" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374762" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374763" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374764" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374765" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374766" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374767" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374768" "20" "99" "10" "55587263" "55587263" "del" "0" "02416" "PCDH15_000060" "g.55587263del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53827503del" "" "pathogenic" "" "0000374769" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374770" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374771" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374772" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374773" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374774" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374775" "10" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374776" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374777" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374778" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374779" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374780" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374781" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374782" "20" "99" "10" "55839130" "55839130" "subst" "0" "02416" "PCDH15_000061" "g.55839130G>T" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54079370G>T" "" "pathogenic" "" "0000374783" "10" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374784" "10" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374785" "10" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374786" "20" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374787" "20" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374788" "20" "99" "10" "55849801" "55849801" "subst" "0" "02416" "PCDH15_000062" "g.55849801G>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "rs137853004" "0" "" "" "g.54090041G>C" "" "pathogenic" "" "0000374789" "10" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374790" "10" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374791" "10" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374792" "10" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374793" "10" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374794" "20" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374795" "20" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374796" "20" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374797" "20" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374798" "20" "95" "10" "56106186" "56106186" "subst" "0" "02416" "PCDH15_000063" "g.56106186T>C" "0/200 controls" "{PMID:Ahmed 2008:18719945}; USMA-{USMAPCDH15D178G:} USMA-{MSV3dQ96QU1p.Asp178Gly:}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54346426T>C" "" "VUS" "ACMG" "0000374799" "10" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374800" "10" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374801" "10" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374802" "10" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374803" "20" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374804" "20" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374805" "20" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374806" "20" "99" "10" "55782695" "55782695" "del" "0" "02416" "PCDH15_000064" "g.55782695del" "0/200 controls" "{PMID:Ahmed 2008:18719945}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54022935del" "" "pathogenic" "" "0000374807" "10" "99" "10" "55973708" "55973708" "del" "0" "02416" "PCDH15_000065" "g.55973708del" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374808" "10" "99" "10" "55973708" "55973708" "del" "0" "02416" "PCDH15_000065" "g.55973708del" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374809" "20" "99" "10" "55973708" "55973708" "del" "0" "02416" "PCDH15_000065" "g.55973708del" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374810" "20" "99" "10" "55973708" "55973708" "del" "0" "02416" "PCDH15_000065" "g.55973708del" "0/100 controls" "{PMID:Alagramam 2001:11487575}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374811" "10" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374812" "10" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374813" "10" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374814" "1" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374815" "20" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374816" "20" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374817" "20" "99" "10" "55973708" "55973708" "del" "0" "02428" "PCDH15_000065" "g.55973708del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation" "Germline" "" "" "0" "" "" "g.54213948del" "" "pathogenic" "" "0000374818" "21" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "0/200 controls" "{PMID:Zheng 2005:15537665}" "none" "" "heterozygous" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374819" "2" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "" "{PMID:Ouyang 2005:15660226}" "none" "" "heterozygous" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374820" "0" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "" "{PMID:Ouyang 2005:15660226}" "none" "" "heterozygous" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374821" "0" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "" "{PMID:Vozzi 2011:21738395}" "none" "" "heterozygous; Mutation" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374822" "2" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "" "{PMID:Vozzi 2011:21738395}" "none" "" "heterozygous; Mutation" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374823" "0" "15" "10" "55581887" "55581889" "del" "0" "02416" "PCDH15_000066" "g.55581887_55581889del" "" "{PMID:Bujakowska 2014:25468891}" "none" "" "heterozygous" "Germline" "" "rs113363047" "0" "" "" "g.53822127_53822129del" "" "likely benign" "ACMG" "0000374824" "1" "35" "10" "55591253" "55591253" "subst" "0.00173817" "02416" "PCDH15_000067" "g.55591253G>T" "0/200 controls" "{PMID:Ouyang 2005:15660226}; USMA-{USMAPCDH15Q1342K:} USMA-{MSV3dQ96QU1p.Gln1342Lys:}" "" "" "heterozygous" "Germline" "" "rs61731387" "0" "" "" "g.53831493G>T" "" "likely benign" "ACMG" "0000374825" "0" "99" "10" "55755492" "55755492" "subst" "8.14359E-6" "02416" "PCDH15_000068" "g.55755492G>A" "" "{PMID:Ouyang 2005:15660226}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.53995732G>A" "" "pathogenic" "" "0000374826" "0" "99" "10" "55973795" "55973798" "del" "0" "02416" "PCDH15_000069" "g.55973795_55973798del" "" "{PMID:Ouyang 2005:15660226}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54214035_54214038del" "" "pathogenic" "" "0000374827" "0" "99" "10" "56424010" "56424010" "del" "0" "02416" "PCDH15_000070" "g.56424010del" "" "{PMID:Ouyang 2005:15660226}" "" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54664250del" "" "pathogenic" "" "0000374828" "10" "11" "10" "56287569" "56287569" "subst" "0.0778492" "02416" "PCDH15_000071" "g.56287569T>C" "" "{PMID:Baux 2008:18484607}" "+HphI" "" "homozygous" "Germline" "" "rs41274636" "0" "" "" "g.54527809T>C" "" "benign" "" "0000374829" "20" "11" "10" "56287569" "56287569" "subst" "0.0778492" "02416" "PCDH15_000071" "g.56287569T>C" "" "{PMID:Baux 2008:18484607}" "+HphI" "" "homozygous" "Germline" "" "rs41274636" "0" "" "" "g.54527809T>C" "" "benign" "" "0000374830" "0" "11" "10" "56287569" "56287569" "subst" "0.0778492" "02419" "PCDH15_000071" "g.56287569T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HphI" "" "heterozygous; Neutral" "Germline" "" "rs41274636" "0" "" "" "g.54527809T>C" "" "benign" "" "0000374833" "10" "11" "10" "55996665" "55996665" "subst" "0.000142175" "02416" "PCDH15_000072" "g.55996665C>T" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54236905C>T" "" "benign" "" "0000374834" "20" "11" "10" "55996665" "55996665" "subst" "0.000142175" "02416" "PCDH15_000072" "g.55996665C>T" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54236905C>T" "" "benign" "" "0000374835" "10" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Baux 2008:18484607}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374836" "20" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Baux 2008:18484607}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374837" "10" "11" "10" "55955444" "55955444" "subst" "0.238381" "02419" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "+AluI;+CviKI_1;-MboII;" "" "homozygous; Neutral" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374838" "20" "11" "10" "55955444" "55955444" "subst" "0.238381" "02419" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "+AluI;+CviKI_1;-MboII;" "" "homozygous; Neutral" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374839" "10" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374840" "20" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374841" "10" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374842" "20" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374843" "10" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374844" "20" "11" "10" "55955444" "55955444" "subst" "0.238381" "02416" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15D435A:} USMA-{MSV3dQ96QU1p.Asp435Ala:}" "" "" "homozygous; non causative" "Germline" "" "rs4935502" "0" "" "" "g.54195684T>G" "" "benign" "" "0000374845" "10" "11" "10" "55892602" "55892602" "dup" "0" "02416" "PCDH15_000074" "g.55892602dup" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54132842dup" "" "benign" "" "0000374846" "20" "11" "10" "55892602" "55892602" "dup" "0" "02416" "PCDH15_000074" "g.55892602dup" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54132842dup" "" "benign" "" "0000374847" "10" "11" "10" "55782991" "55782991" "subst" "0.0375568" "02416" "PCDH15_000075" "g.55782991C>T" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "rs57385317" "0" "" "" "g.54023231C>T" "" "benign" "" "0000374848" "20" "11" "10" "55782991" "55782991" "subst" "0.0375568" "02416" "PCDH15_000075" "g.55782991C>T" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "rs57385317" "0" "" "" "g.54023231C>T" "" "benign" "" "0000374851" "10" "11" "10" "55779909" "55779909" "subst" "0.0925889" "02416" "PCDH15_000076" "g.55779909G>C" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "rs2660169" "0" "" "" "g.54020149G>C" "" "benign" "" "0000374852" "20" "11" "10" "55779909" "55779909" "subst" "0.0925889" "02416" "PCDH15_000076" "g.55779909G>C" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "rs2660169" "0" "" "" "g.54020149G>C" "" "benign" "" "0000374855" "10" "99" "10" "55698632" "55698632" "subst" "2.44019E-5" "02416" "PCDH15_000077" "g.55698632G>A" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53938872G>A" "" "pathogenic" "" "0000374856" "20" "99" "10" "55698632" "55698632" "subst" "2.44019E-5" "02416" "PCDH15_000077" "g.55698632G>A" "" "{PMID:Baux 2008:18484607}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53938872G>A" "" "pathogenic" "" "0000374858" "0" "11" "10" "56089223" "56089223" "subst" "0" "02416" "PCDH15_000079" "g.56089223A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs11004240" "0" "" "" "g.54329463A>G" "" "benign" "" "0000374859" "10" "11" "10" "56089223" "56089223" "subst" "0" "02416" "PCDH15_000079" "g.56089223A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11004240" "0" "" "" "g.54329463A>G" "" "benign" "" "0000374860" "20" "11" "10" "56089223" "56089223" "subst" "0" "02416" "PCDH15_000079" "g.56089223A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11004240" "0" "" "" "g.54329463A>G" "" "benign" "" "0000374861" "10" "11" "10" "56089223" "56089223" "subst" "0" "02416" "PCDH15_000079" "g.56089223A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11004240" "0" "" "" "g.54329463A>G" "" "benign" "" "0000374862" "20" "11" "10" "56089223" "56089223" "subst" "0" "02416" "PCDH15_000079" "g.56089223A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs11004240" "0" "" "" "g.54329463A>G" "" "benign" "" "0000374870" "0" "11" "10" "55996408" "55996408" "subst" "0" "02416" "PCDH15_000080" "g.55996408A>T" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs7915391" "0" "" "" "g.54236648A>T" "" "benign" "" "0000374871" "10" "11" "10" "55996408" "55996408" "subst" "0" "02416" "PCDH15_000080" "g.55996408A>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs7915391" "0" "" "" "g.54236648A>T" "" "benign" "" "0000374872" "20" "11" "10" "55996408" "55996408" "subst" "0" "02416" "PCDH15_000080" "g.55996408A>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs7915391" "0" "" "" "g.54236648A>T" "" "benign" "" "0000374873" "10" "11" "10" "55996408" "55996408" "subst" "0" "02416" "PCDH15_000080" "g.55996408A>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs7915391" "0" "" "" "g.54236648A>T" "" "benign" "" "0000374874" "20" "11" "10" "55996408" "55996408" "subst" "0" "02416" "PCDH15_000080" "g.55996408A>T" "" "{PMID:Roux 2011:21436283}" "-SfaNI" "" "homozygous" "Germline" "" "rs7915391" "0" "" "" "g.54236648A>T" "" "benign" "" "0000374882" "0" "11" "10" "55973589" "55973589" "subst" "0" "02416" "PCDH15_000081" "g.55973589C>T" "" "{PMID:Roux 2011:21436283}" "+AccI" "" "heterozygous" "Germline" "" "rs10825279" "0" "" "" "g.54213829C>T" "" "benign" "" "0000374883" "0" "11" "10" "55973589" "55973589" "subst" "0" "02416" "PCDH15_000081" "g.55973589C>T" "" "{PMID:Roux 2011:21436283}" "+AccI" "" "heterozygous" "Germline" "" "rs10825279" "0" "" "" "g.54213829C>T" "" "benign" "" "0000374884" "10" "11" "10" "55973589" "55973589" "subst" "0" "02416" "PCDH15_000081" "g.55973589C>T" "" "{PMID:Roux 2011:21436283}" "+AccI" "" "homozygous" "Germline" "" "rs10825279" "0" "" "" "g.54213829C>T" "" "benign" "" "0000374885" "20" "11" "10" "55973589" "55973589" "subst" "0" "02416" "PCDH15_000081" "g.55973589C>T" "" "{PMID:Roux 2011:21436283}" "+AccI" "" "homozygous" "Germline" "" "rs10825279" "0" "" "" "g.54213829C>T" "" "benign" "" "0000374892" "0" "11" "10" "55838950" "55838950" "subst" "0" "02416" "PCDH15_000083" "g.55838950A>G" "" "{PMID:Roux 2011:21436283}" "-MboII" "" "heterozygous" "Germline" "" "rs1911433" "0" "" "" "g.54079190A>G" "" "benign" "" "0000374893" "10" "11" "10" "55838950" "55838950" "subst" "0" "02416" "PCDH15_000083" "g.55838950A>G" "" "{PMID:Roux 2011:21436283}" "-MboII" "" "homozygous" "Germline" "" "rs1911433" "0" "" "" "g.54079190A>G" "" "benign" "" "0000374894" "20" "11" "10" "55838950" "55838950" "subst" "0" "02416" "PCDH15_000083" "g.55838950A>G" "" "{PMID:Roux 2011:21436283}" "-MboII" "" "homozygous" "Germline" "" "rs1911433" "0" "" "" "g.54079190A>G" "" "benign" "" "0000374902" "10" "11" "10" "55755237" "55755237" "subst" "0" "02416" "PCDH15_000085" "g.55755237C>T" "" "{PMID:Roux 2011:21436283}" "" "" "homozygous" "Germline" "" "rs2135721" "0" "" "" "g.53995477C>T" "" "benign" "" "0000374903" "20" "11" "10" "55755237" "55755237" "subst" "0" "02416" "PCDH15_000085" "g.55755237C>T" "" "{PMID:Roux 2011:21436283}" "" "" "homozygous" "Germline" "" "rs2135721" "0" "" "" "g.53995477C>T" "" "benign" "" "0000374906" "10" "11" "10" "55721761" "55721761" "subst" "0" "02416" "PCDH15_000086" "g.55721761A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs2456699" "0" "" "" "g.53962001A>G" "" "benign" "" "0000374907" "20" "11" "10" "55721761" "55721761" "subst" "0" "02416" "PCDH15_000086" "g.55721761A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs2456699" "0" "" "" "g.53962001A>G" "" "benign" "" "0000374908" "10" "11" "10" "55721761" "55721761" "subst" "0" "02416" "PCDH15_000086" "g.55721761A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs2456699" "0" "" "" "g.53962001A>G" "" "benign" "" "0000374909" "20" "11" "10" "55721761" "55721761" "subst" "0" "02416" "PCDH15_000086" "g.55721761A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs2456699" "0" "" "" "g.53962001A>G" "" "benign" "" "0000374910" "1" "99" "10" "56246204" "56301416" "del" "0" "02416" "PCDH15_000087" "g.56246204_56301416del" "" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "" "" "" "Germline" "" "" "0" "" "" "g.54486444_54541656del" "" "pathogenic (recessive)" "" "0000374911" "2" "99" "10" "56109539" "56191483" "dup" "0" "02416" "PCDH15_000088" "g.56109539_56191483dup" "" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "" "" "" "Germline" "" "" "0" "" "" "g.54349779_54431723dup" "" "pathogenic (recessive)" "" "0000374912" "3" "99" "10" "56109539" "56191483" "dup" "0" "02416" "PCDH15_000088" "g.56109539_56191483dup" "" "{PMID:Aller 2010:20538994}, {PMID:Jaijo 2012:22815625}" "" "" "" "Germline" "" "" "0" "" "" "g.54349779_54431723dup" "" "pathogenic (recessive)" "" "0000374914" "0" "99" "10" "56287572" "56287637" "del" "0" "02416" "PCDH15_000089" "g.56287572_56287637del" "" "{PMID:Roux 2011:21436283}" "" "" "heterozygous\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000374915" "10" "11" "10" "55587034" "55587034" "subst" "0" "02416" "PCDH15_000090" "g.55587034A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740555" "0" "" "" "g.53827274A>G" "" "benign" "" "0000374916" "20" "11" "10" "55587034" "55587034" "subst" "0" "02416" "PCDH15_000090" "g.55587034A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "rs10740555" "0" "" "" "g.53827274A>G" "" "benign" "" "0000374917" "0" "11" "10" "55587034" "55587034" "subst" "0" "02416" "PCDH15_000090" "g.55587034A>G" "" "{PMID:Roux 2011:21436283}" "none" "" "heterozygous" "Germline" "" "rs10740555" "0" "" "" "g.53827274A>G" "" "benign" "" "0000374921" "11" "75" "10" "56128947" "56128947" "subst" "0" "02416" "PCDH15_000091" "g.56128947A>G" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15V136A:} USMA-{MSV3dQ96QU1p.Val136Ala:}" "+AciI" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54369187A>G" "" "VUS" "ACMG" "0000374922" "21" "99" "10" "55587153" "55600256" "del" "0" "02416" "PCDH15_000092" "g.55587153_55600256del" "" "{PMID:Roux 2011:21436283}" "" "" "heterozygous\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000374925" "10" "11" "10" "55955610" "55955610" "subst" "0.161682" "02416" "PCDH15_000093" "g.55955610C>T" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15G380S:} USMA-{MSV3dQ96QU1p.Gly380Ser:}" "+BsrI;-MspI;-HpaII;-BsrFI;" "" "homozygous" "Germline" "" "rs10825269" "0" "" "" "g.54195850C>T" "" "benign" "" "0000374926" "20" "11" "10" "55955610" "55955610" "subst" "0.161682" "02416" "PCDH15_000093" "g.55955610C>T" "" "{PMID:Roux 2011:21436283}; USMA-{USMAPCDH15G380S:} USMA-{MSV3dQ96QU1p.Gly380Ser:}" "+BsrI;-MspI;-HpaII;-BsrFI;" "" "homozygous" "Germline" "" "rs10825269" "0" "" "" "g.54195850C>T" "" "benign" "" "0000374927" "10" "11" "10" "55955610" "55955610" "subst" "0.161682" "02419" "PCDH15_000093" "g.55955610C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15G380S:} USMA-{MSV3dQ96QU1p.Gly380Ser:}" "+BsrI;-MspI;-HpaII;-BsrFI;" "" "homozygous; Neutral" "Germline" "" "rs10825269" "0" "" "" "g.54195850C>T" "" "benign" "" "0000374928" "20" "11" "10" "55955610" "55955610" "subst" "0.161682" "02419" "PCDH15_000093" "g.55955610C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15G380S:} USMA-{MSV3dQ96QU1p.Gly380Ser:}" "+BsrI;-MspI;-HpaII;-BsrFI;" "" "homozygous; Neutral" "Germline" "" "rs10825269" "0" "" "" "g.54195850C>T" "" "benign" "" "0000374929" "0" "11" "10" "55955610" "55955610" "subst" "0.161682" "02416" "PCDH15_000093" "g.55955610C>T" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15G380S:} USMA-{MSV3dQ96QU1p.Gly380Ser:}" "+BsrI;-MspI;-HpaII;-BsrFI;" "" "heterozygous; non causative" "Germline" "" "rs10825269" "0" "" "" "g.54195850C>T" "" "benign" "" "0000374930" "10" "11" "10" "55955485" "55955485" "subst" "0.164539" "02416" "PCDH15_000094" "g.55955485A>G" "" "{PMID:Roux 2011:21436283}" "+MnlI" "" "homozygous" "Germline" "" "rs7921598" "0" "" "" "g.54195725A>G" "" "benign" "" "0000374931" "20" "11" "10" "55955485" "55955485" "subst" "0.164539" "02416" "PCDH15_000094" "g.55955485A>G" "" "{PMID:Roux 2011:21436283}" "+MnlI" "" "homozygous" "Germline" "" "rs7921598" "0" "" "" "g.54195725A>G" "" "benign" "" "0000374934" "10" "15" "10" "55913121" "55913121" "subst" "0" "02416" "PCDH15_000095" "g.55913121C>T" "" "{PMID:Roux 2011:21436283}" "+MnlI;+MmeI;" "" "homozygous" "Germline" "" "rs41274632" "0" "" "" "g.54153361C>T" "" "likely benign" "ACMG" "0000374935" "20" "15" "10" "55913121" "55913121" "subst" "0" "02416" "PCDH15_000095" "g.55913121C>T" "" "{PMID:Roux 2011:21436283}" "+MnlI;+MmeI;" "" "homozygous" "Germline" "" "rs41274632" "0" "" "" "g.54153361C>T" "" "likely benign" "ACMG" "0000374936" "10" "99" "10" "55698574" "55698574" "subst" "0" "02416" "PCDH15_000096" "g.55698574C>T" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "" "0" "" "" "g.53938814C>T" "" "pathogenic" "" "0000374937" "20" "99" "10" "55698574" "55698574" "subst" "0" "02416" "PCDH15_000096" "g.55698574C>T" "" "{PMID:Roux 2011:21436283}" "none" "" "homozygous" "Germline" "" "" "0" "" "" "g.53938814C>T" "" "pathogenic" "" "0000374938" "21" "11" "10" "55663003" "55826645" "del" "0" "02416" "PCDH15_000097" "g.55663003_55826645del" "" "{PMID:Roux 2011:21436283}" "" "" "heterozygous\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000374939" "0" "35" "10" "55944991" "55944991" "subst" "4.06329E-6" "02416" "PCDH15_000098" "g.55944991T>C" "" "{PMID:Malm 2010:21174530}; USMA-{USMAPCDH15Y448C:} USMA-{MSV3dQ96QU1p.Tyr448Cys:}" "+BsgI;+HpyCH4V;" "" "heterozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.54185231T>C" "" "likely benign" "ACMG" "0000374940" "10" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374941" "10" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374942" "10" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374943" "20" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374944" "20" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374945" "20" "99" "10" "55839090" "55839090" "subst" "0" "02416" "PCDH15_000099" "g.55839090C>A" "0/192 controls" "{PMID:Duman 2011:21117948}" "-HphI" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54079330C>A" "" "pathogenic" "" "0000374950" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000105" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374951" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000105" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374952" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000105" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374953" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000105" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374954" "0" "11" "10" "55755303" "55755303" "subst" "0" "02419" "PCDH15_000106" "g.55755303T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HphI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs78521134" "0" "" "" "g.53995543T>C" "" "benign" "" "0000374955" "0" "11" "10" "55755303" "55755303" "subst" "0" "02419" "PCDH15_000106" "g.55755303T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HphI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs78521134" "0" "" "" "g.53995543T>C" "" "benign" "" "0000374956" "0" "11" "10" "55755303" "55755303" "subst" "0" "02419" "PCDH15_000106" "g.55755303T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HphI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs78521134" "0" "" "" "g.53995543T>C" "" "benign" "" "0000374957" "0" "11" "10" "55698770" "55698770" "subst" "0" "02419" "PCDH15_000107" "g.55698770A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Tsp509I;-ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs146400185" "0" "" "" "g.53939010A>G" "" "benign" "" "0000374958" "0" "11" "10" "55698770" "55698770" "subst" "0" "02419" "PCDH15_000107" "g.55698770A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Tsp509I;-ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs146400185" "0" "" "" "g.53939010A>G" "" "benign" "" "0000374959" "0" "11" "10" "55698770" "55698770" "subst" "0" "02419" "PCDH15_000107" "g.55698770A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Tsp509I;-ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs146400185" "0" "" "" "g.53939010A>G" "" "benign" "" "0000374960" "0" "11" "10" "55698770" "55698770" "subst" "0" "02419" "PCDH15_000107" "g.55698770A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Tsp509I;-ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs146400185" "0" "" "" "g.53939010A>G" "" "benign" "" "0000374961" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000108" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374962" "0" "11" "10" "55782992" "55782992" "subst" "0.00209278" "02419" "PCDH15_000109" "g.55782992G>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+DdeI;+HphI;-HpyCH4IV;-BsaAI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs35308619" "0" "" "" "g.54023232G>C" "" "benign" "" "0000374963" "0" "11" "10" "55782992" "55782992" "subst" "0.00209278" "02419" "PCDH15_000109" "g.55782992G>C" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+DdeI;+HphI;-HpyCH4IV;-BsaAI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs35308619" "0" "" "" "g.54023232G>C" "" "benign" "" "0000374964" "0" "11" "10" "55782992" "55782992" "subst" "0.00209278" "02419" "PCDH15_000109" "g.55782992G>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+DdeI;+HphI;-HpyCH4IV;-BsaAI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs35308619" "0" "" "" "g.54023232G>C" "" "benign" "" "0000374965" "0" "15" "10" "56129055" "56129055" "subst" "1.23753E-5" "02419" "PCDH15_000110" "g.56129055T>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-SfaNI" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.54369295T>A" "" "likely benign" "ACMG" "0000374966" "0" "15" "10" "55780078" "55780078" "subst" "0" "02419" "PCDH15_000111" "g.55780078C>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BslI" "" "heterozygous; UV1" "Germline" "" "rs111033516" "0" "" "" "g.54020318C>G" "" "likely benign" "ACMG" "0000374967" "0" "15" "10" "55780078" "55780078" "subst" "0" "02419" "PCDH15_000111" "g.55780078C>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BslI" "" "heterozygous; UV1" "Germline" "" "rs111033516" "0" "" "" "g.54020318C>G" "" "likely benign" "ACMG" "0000374968" "0" "15" "10" "55780078" "55780078" "subst" "0" "02419" "PCDH15_000111" "g.55780078C>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BslI" "" "heterozygous; UV1" "Germline" "" "rs111033516" "0" "" "" "g.54020318C>G" "" "likely benign" "ACMG" "0000374969" "0" "15" "10" "55780078" "55780078" "subst" "0" "02419" "PCDH15_000111" "g.55780078C>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BslI" "" "heterozygous; UV1" "Germline" "" "rs111033516" "0" "" "" "g.54020318C>G" "" "likely benign" "ACMG" "0000374970" "0" "15" "10" "55600068" "55600068" "subst" "0.00502408" "02419" "PCDH15_000112" "g.55600068A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; UV1" "Germline" "" "rs149867749" "0" "" "" "g.53840308A>G" "" "likely benign" "ACMG" "0000374971" "0" "15" "10" "55600068" "55600068" "subst" "0.00502408" "02419" "PCDH15_000112" "g.55600068A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; UV1" "Germline" "" "rs149867749" "0" "" "" "g.53840308A>G" "" "likely benign" "ACMG" "0000374972" "0" "11" "10" "55583260" "55583261" "ins" "0" "02419" "PCDH15_000113" "g.55583260_55583261insTGTC" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4III" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53823500_53823501insTGTC" "" "benign" "" "0000374973" "0" "15" "10" "55581779" "55581779" "subst" "0.00926076" "02419" "PCDH15_000114" "g.55581779T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15I1903V:} USMA-{MSV3dQ96QU1p.Ile1903Val:}" "none" "" "heterozygous; UV1" "Germline" "" "rs79854148" "0" "" "" "g.53822019T>C" "" "likely benign" "ACMG" "0000374974" "0" "15" "10" "55581779" "55581779" "subst" "0.00926076" "02419" "PCDH15_000114" "g.55581779T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15I1903V:} USMA-{MSV3dQ96QU1p.Ile1903Val:}" "none" "" "heterozygous; UV1" "Germline" "" "rs79854148" "0" "" "" "g.53822019T>C" "" "likely benign" "ACMG" "0000374975" "10" "15" "10" "55996771" "55996771" "subst" "0" "02419" "PCDH15_000115" "g.55996771G>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "homozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54237011G>T" "" "likely benign" "ACMG" "0000374976" "20" "15" "10" "55996771" "55996771" "subst" "0" "02419" "PCDH15_000115" "g.55996771G>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "homozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54237011G>T" "" "likely benign" "ACMG" "0000374977" "0" "15" "10" "55783039" "55783039" "subst" "0" "02419" "PCDH15_000116" "g.55783039A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54023279A>G" "" "likely benign" "ACMG" "0000374978" "0" "11" "10" "55839021" "55839021" "subst" "0" "02419" "PCDH15_000117" "g.55839021T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp45I" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs139399915" "0" "" "" "g.54079261T>C" "" "benign" "" "0000374979" "0" "11" "10" "55839021" "55839021" "subst" "0" "02419" "PCDH15_000117" "g.55839021T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp45I" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs139399915" "0" "" "" "g.54079261T>C" "" "benign" "" "0000374980" "0" "11" "10" "55839021" "55839021" "subst" "0" "02419" "PCDH15_000117" "g.55839021T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp45I" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs139399915" "0" "" "" "g.54079261T>C" "" "benign" "" "0000374981" "0" "11" "10" "55839021" "55839021" "subst" "0" "02419" "PCDH15_000117" "g.55839021T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp45I" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs139399915" "0" "" "" "g.54079261T>C" "" "benign" "" "0000374982" "21" "15" "10" "55582512" "55582512" "subst" "0.000259981" "02419" "PCDH15_000118" "g.55582512T>G" "1/874 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+MmeI;-AcuI;" "" "heterozygous; UV1" "Germline" "" "rs147993163" "0" "" "" "g.53822752T>G" "" "likely benign" "ACMG" "0000374983" "0" "11" "10" "56076897" "56076897" "subst" "0" "02419" "PCDH15_000119" "g.56076897C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Hpy188I" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs11004226" "0" "" "" "g.54317137C>T" "" "benign" "" "0000374984" "10" "11" "10" "56076897" "56076897" "subst" "0" "02419" "PCDH15_000119" "g.56076897C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Hpy188I" "" "homozygous; pathogenicity not assessed" "Germline" "" "rs11004226" "0" "" "" "g.54317137C>T" "" "benign" "" "0000374985" "20" "11" "10" "56076897" "56076897" "subst" "0" "02419" "PCDH15_000119" "g.56076897C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-Hpy188I" "" "homozygous; pathogenicity not assessed" "Germline" "" "rs11004226" "0" "" "" "g.54317137C>T" "" "benign" "" "0000374986" "0" "35" "10" "55582223" "55582223" "subst" "0" "02419" "PCDH15_000120" "g.55582223G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15P1755S:} USMA-{MSV3dQ96QU1p.Pro1755Ser:}" "+MboII;-BseRI;-MnlI;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53822463G>A" "" "likely benign" "ACMG" "0000374987" "0" "15" "10" "56423830" "56423830" "subst" "0" "02419" "PCDH15_000121" "g.56423830A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54664070A>G" "" "likely benign" "ACMG" "0000374988" "0" "15" "10" "55581509" "55581509" "subst" "0" "02419" "PCDH15_000122" "g.55581509T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+TspRI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53821749T>C" "" "likely benign" "ACMG" "0000374989" "0" "15" "10" "55581550" "55581550" "subst" "0" "02419" "PCDH15_000123" "g.55581550A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Hpy188I;-Tsp509I;-ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53821790A>G" "" "likely benign" "ACMG" "0000374990" "0" "15" "10" "55826740" "55826740" "subst" "0" "02419" "PCDH15_000124" "g.55826740A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BsmBI;+BsmAI;+HgaI;-SfaNI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54066980A>G" "" "likely benign" "ACMG" "0000374991" "0" "11" "10" "55626625" "55626625" "subst" "0.00442998" "02419" "PCDH15_000125" "g.55626625G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyAV;-MnlI;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53866865G>A" "" "benign" "" "0000374992" "0" "11" "10" "55626625" "55626625" "subst" "0.00442998" "02419" "PCDH15_000125" "g.55626625G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyAV;-MnlI;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53866865G>A" "" "benign" "" "0000374993" "0" "11" "10" "55626625" "55626625" "subst" "0.00442998" "02419" "PCDH15_000125" "g.55626625G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyAV;-MnlI;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53866865G>A" "" "benign" "" "0000374994" "0" "11" "10" "55626625" "55626625" "subst" "0.00442998" "02419" "PCDH15_000125" "g.55626625G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyAV;-MnlI;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53866865G>A" "" "benign" "" "0000374995" "0" "15" "10" "55588537" "55588537" "subst" "0" "02419" "PCDH15_000126" "g.55588537C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+AluI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53828777C>T" "" "likely benign" "ACMG" "0000374996" "10" "99" "10" "55755454" "55755454" "del" "0" "02419" "PCDH15_000127" "g.55755454del" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53995694del" "" "pathogenic" "" "0000374997" "20" "99" "10" "55755454" "55755454" "del" "0" "02419" "PCDH15_000127" "g.55755454del" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53995694del" "" "pathogenic" "" "0000374998" "0" "35" "10" "55582122" "55582127" "dup" "0" "02419" "PCDH15_000128" "g.55582122_55582127dup" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+MnlI;+EarI;+MboII;" "" "heterozygous; UV1" "Germline" "" "" "0" "" "" "g.53822362_53822367dup" "" "likely benign" "ACMG" "0000375001" "0" "15" "10" "55996755" "55996755" "subst" "0" "02419" "PCDH15_000130" "g.55996755C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "-BsmAI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs12251663" "0" "" "" "g.54236995C>T" "" "likely benign" "ACMG" "0000375002" "0" "99" "10" "55626401" "55626401" "subst" "0" "02419" "PCDH15_000131" "g.55626401C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53866641C>T" "" "pathogenic" "" "0000375003" "2" "99" "10" "55626401" "55626401" "subst" "0" "02428" "PCDH15_000131" "g.55626401C>T" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.53866641C>T" "" "pathogenic" "" "0000375004" "0" "15" "10" "55782590" "55782590" "subst" "0" "02419" "PCDH15_000132" "g.55782590C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54022830C>T" "" "likely benign" "ACMG" "0000375005" "20" "11" "10" "55582239" "55582241" "del" "0" "02419" "PCDH15_000133" "g.55582239_55582241del" "5/844 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "-MnlI" "" "heterozygous; Neutral" "Germline" "" "" "0" "" "" "g.53822479_53822481del" "" "benign" "" "0000375006" "0" "15" "10" "56106289" "56106289" "subst" "0" "02419" "PCDH15_000134" "g.56106289C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp509I;+MfeI;-BsgI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54346529C>T" "" "likely benign" "ACMG" "0000375007" "10" "99" "10" "55663001" "55663001" "subst" "4.06981E-6" "02419" "PCDH15_000135" "g.55663001A>G" "0/878 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+NlaIII;+FatI;+SphI;+CviAII;+Cac8I;+NspI;" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53903241A>G" "" "pathogenic" "" "0000375008" "20" "99" "10" "55663001" "55663001" "subst" "4.06981E-6" "02419" "PCDH15_000135" "g.55663001A>G" "0/878 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+NlaIII;+FatI;+SphI;+CviAII;+Cac8I;+NspI;" "" "homozygous; Pathogenic" "Germline" "" "" "0" "" "" "g.53903241A>G" "" "pathogenic" "" "0000375009" "0" "15" "10" "55582088" "55582088" "subst" "0.00140531" "02419" "PCDH15_000136" "g.55582088C>T" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15V1800I:} USMA-{MSV3dQ96QU1p.Val1800Ile:}" "none" "" "heterozygous; UV1" "Germline" "" "rs111033463" "0" "" "" "g.53822328C>T" "" "likely benign" "ACMG" "0000375010" "0" "15" "10" "55996720" "55996720" "subst" "0.00477856" "02419" "PCDH15_000137" "g.55996720C>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+MseI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs116339167" "0" "" "" "g.54236960C>A" "" "likely benign" "ACMG" "0000375013" "0" "15" "10" "55944863" "55944863" "subst" "5.29247E-5" "02419" "PCDH15_000138" "g.55944863A>G" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+NlaIII;+FatI;+NsiI;+CviAII;+NspI;+HpyCH4V;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54185103A>G" "" "likely benign" "ACMG" "0000375014" "0" "15" "10" "55826765" "55826765" "subst" "0" "02419" "PCDH15_000139" "g.55826765G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+MseI;-DdeI;-Bpu10I;-AluI;-CviKI_1;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54067005G>A" "" "likely benign" "ACMG" "0000375015" "10" "15" "10" "56076916" "56076916" "subst" "0" "02419" "PCDH15_000140" "g.56076916A>G" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+TspRI" "" "homozygous; pathogenicity not assessed" "Germline" "" "rs116363748" "0" "" "" "g.54317156A>G" "" "likely benign" "ACMG" "0000375016" "20" "15" "10" "56076916" "56076916" "subst" "0" "02419" "PCDH15_000140" "g.56076916A>G" "0/96 controls" "{PMID:Le Quesne Stabej 2012:22135276}" "+TspRI" "" "homozygous; pathogenicity not assessed" "Germline" "" "rs116363748" "0" "" "" "g.54317156A>G" "" "likely benign" "ACMG" "0000375017" "0" "15" "10" "55700374" "55700374" "subst" "0" "02419" "PCDH15_000141" "g.55700374G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs45563941" "0" "" "" "g.53940614G>A" "" "likely benign" "ACMG" "0000375018" "0" "15" "10" "55616777" "55616777" "subst" "0" "02419" "PCDH15_000142" "g.55616777G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BtsCI;+BccI;+FokI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.53857017G>A" "" "likely benign" "ACMG" "0000375019" "0" "15" "10" "55582127" "55582127" "subst" "0.0187812" "02419" "PCDH15_000143" "g.55582127G>A" "" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15P1787S:} USMA-{MSV3dQ96QU1p.Pro1787Ser:}" "-MnlI" "" "heterozygous; UV1" "Germline" "" "rs61862390" "0" "" "" "g.53822367G>A" "" "likely benign" "ACMG" "0000375020" "0" "15" "10" "55849613" "55849613" "subst" "0" "02419" "PCDH15_000144" "g.55849613T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+BfaI" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54089853T>C" "" "likely benign" "ACMG" "0000375021" "0" "15" "10" "55839229" "55839229" "subst" "0.00214244" "02419" "PCDH15_000145" "g.55839229T>C" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+HpyCH4IV" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs149992956" "0" "" "" "g.54079469T>C" "" "likely benign" "ACMG" "0000375022" "0" "15" "10" "55755755" "55755755" "subst" "0" "02419" "PCDH15_000146" "g.55755755G>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "+Tsp509;+XmnI;+ApoI;" "" "heterozygous; pathogenicity not assessed" "Germline" "" "rs140975710" "0" "" "" "g.53995995G>T" "" "likely benign" "ACMG" "0000375023" "0" "15" "10" "55616946" "55616946" "subst" "0" "02419" "PCDH15_000147" "g.55616946T>C" "0/878 controls" "{PMID:Le Quesne Stabej 2012:22135276}; USMA-{USMAPCDH15E1265D:} USMA-{MSV3dQ96QU1p.Glu1265Asp:}" "+MnlI;+AlwI;-BglII;-MboII;" "" "heterozygous; UV1" "Germline" "" "rs111033496" "0" "" "" "g.53857186T>C" "" "likely benign" "ACMG" "0000375024" "0" "15" "10" "55581936" "55581936" "subst" "0.00103589" "02419" "PCDH15_000148" "g.55581936G>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; UV1" "Germline" "" "rs112097891" "0" "" "" "g.53822176G>T" "" "likely benign" "ACMG" "0000375025" "0" "15" "10" "55955705" "55955705" "subst" "0" "02419" "PCDH15_000149" "g.55955705G>T" "" "{PMID:Le Quesne Stabej 2012:22135276}" "none" "" "heterozygous; pathogenicity not assessed" "Germline" "" "" "0" "" "" "g.54195945G>T" "" "likely benign" "ACMG" "0000375026" "20" "15" "10" "55663134" "55663134" "subst" "0.0059727" "02416" "PCDH15_000150" "g.55663134G>A" "" "{PMID:Neveling 2012:22334370}" "+AcuI;+HpyAV;-BpmI;-BssKI;-StyD4I;-BstNI;" "" "heterozygous; Predicted benign" "Germline" "" "rs111739360" "0" "" "" "g.53903374G>A" "" "likely benign" "ACMG" "0000375029" "11" "75" "10" "55582934" "55582935" "ins" "0" "02416" "PCDH15_000151" "g.55582934_55582935insCAA" "" "{PMID:Neveling 2012:22334370}" "+BtsCI;+FokI;-Hpy188I;" "" "heterozygous; Predicted benign" "Germline" "" "" "0" "" "" "g.53823174_53823175insCAA" "" "likely benign" "ACMG" "0000375030" "3" "99" "10" "55626400" "55626400" "dup" "0" "02416" "PCDH15_000152" "g.55626400dup" "" "{PMID:Jaijo 2012:22815625}" "+MseI" "3717+2dupT" "pathogenic - was shown in Aparisi et al., 2013 to affect splicing (p.(Val1242Argfs*2) and p.(Ala1168_Leu1239del)) - New donor site and exon skipping" "Germline" "" "" "0" "" "" "g.53866640dup" "" "pathogenic" "" "0000375031" "2" "99" "10" "55626400" "55626400" "dup" "0" "02416" "PCDH15_000152" "g.55626400dup" "" "{PMID:Jaijo 2012:22815625}" "+MseI" "Pathogenic - was shown in Aparisi et al., 2013 to affect splicing (p.(Val1242Argfs*2) and p.(Ala1168_Leu1239del)) - New donor site and exon skipping" "homozygous" "Germline" "" "" "0" "" "" "g.53866640dup" "" "pathogenic" "" "0000375033" "11" "99" "10" "55955443" "55955444" "ins" "0" "02416" "PCDH15_000153" "g.55955443_55955444insG" "" "{PMID:Jaijo 2012:22815625}" "+BbsI;+HpyCH4III;" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.54195683_54195684insG" "" "pathogenic" "" "0000375034" "0" "35" "10" "55955543" "55955543" "subst" "0.000402073" "02416" "PCDH15_000154" "g.55955543C>G" "" "{PMID:Besnard, Garcia-Garcia 2014:24498627}; USMA-{USMAPCDH15G402A:} USMA-{MSV3dQ96QU1p.Gly402Ala:}" "" "" "heterozygous" "Germline" "" "rs145017164" "0" "" "" "g.54195783C>G" "" "likely benign" "ACMG" "0000375035" "0" "75" "10" "56077032" "56077032" "subst" "4.06557E-6" "02416" "PCDH15_000155" "g.56077032G>C" "" "{PMID:Besnard, Garcia-Garcia 2014:24498627}; USMA-{USMAPCDH15P292R:} USMA-{MSV3dO75445p.Pro292Arg:}" "+AvaI;+BsoBI;-BsaWI;-HpaII;-MspI;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54317272G>C" "" "VUS" "ACMG" "0000375036" "0" "15" "10" "56423968" "56423968" "subst" "4.0836E-6" "02416" "PCDH15_000156" "g.56423968A>T" "" "{PMID:Besnard, Garcia-Garcia 2014:24498627}; USMA-{USMAPCDH15S19T:} USMA-{MSV3dQ96QU1p.Ser19Thr:}" "+BaeGI;-BanII;" "" "heterozygous" "Germline" "" "" "0" "" "" "g.54664208A>T" "" "likely benign" "ACMG" "0000375047" "0" "99" "10" "55616950" "55616953" "del" "0" "02416" "PCDH15_000162" "g.55616950_55616953del" "" "{PMID:Glöcke 2013:23591405}" "" "" "heterozygous; likely pathogenic" "Germline" "" "" "0" "" "" "g.53857190_53857193del" "" "pathogenic" "" "0000375048" "0" "99" "10" "56423932" "56424050" "del" "0" "02416" "PCDH15_000163" "g.56423932_56424050del" "" "{PMID:Glöcke 2013:23591405}" "" "E02del" "heterozygous; likely pathogenic\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375049" "10" "75" "10" "55955462" "55955462" "subst" "0" "02416" "PCDH15_000164" "g.55955462A>G" "0/400 controls" "{PMID:Yang 2013:23767834}; USMA-{USMAPCDH15L429P:} USMA-{MSV3dQ96QU1p.Leu429Pro:}" "" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54195702A>G" "" "VUS" "ACMG" "0000375050" "20" "75" "10" "55955462" "55955462" "subst" "0" "02416" "PCDH15_000164" "g.55955462A>G" "0/400 controls" "{PMID:Yang 2013:23767834}; USMA-{USMAPCDH15L429P:} USMA-{MSV3dQ96QU1p.Leu429Pro:}" "" "" "homozygous; Mutation" "Germline" "" "" "0" "" "" "g.54195702A>G" "" "VUS" "ACMG" "0000375051" "0" "75" "10" "55600201" "55600201" "subst" "0" "02416" "PCDH15_000165" "g.55600201A>G" "0/400 controls" "{PMID:Yang 2013:23767834}; USMA-{USMAPCDH15S1288P:} USMA-{MSV3dQ96QU1p.Ser1288Pro:}" "" "" "heterozygous; Mutation" "Germline" "" "" "0" "" "" "g.53840441A>G" "" "VUS" "ACMG" "0000375052" "0" "75" "10" "55591159" "55591159" "subst" "8.12183E-6" "02416" "PCDH15_000166" "g.55591159G>A" "0/400 controls" "{PMID:Yang 2013:23767834}; USMA-{USMAPCDH15T1373I:} USMA-{MSV3dQ96QU1T1373I:}" "" "" "heterozygous; Mutation" "Germline" "" "" "0" "" "" "g.53831399G>A" "" "VUS" "ACMG" "0000375053" "0" "75" "10" "55591159" "55591159" "subst" "8.12183E-6" "02416" "PCDH15_000166" "g.55591159G>A" "0/400 controls" "{PMID:Yang 2013:23767834}; USMA-{USMAPCDH15T1373I:} USMA-{MSV3dQ96QU1T1373I:}" "" "" "heterozygous; Mutation" "Germline" "" "" "0" "" "" "g.53831399G>A" "" "VUS" "ACMG" "0000375054" "0" "99" "10" "55944899" "55944899" "del" "0" "02416" "PCDH15_000167" "g.55944899del" "0/400 controls" "{PMID:Yang 2013:23767834}" "" "" "heterozygous; Mutation" "Germline" "" "" "0" "" "" "g.54185139del" "" "pathogenic" "" "0000375055" "2" "35" "10" "56077074" "56077074" "subst" "2.8449E-5" "02416" "PCDH15_000168" "g.56077074C>T" "0/192 controls" "{PMID:Mutai 2013:24164807}; USMA-{USMAPCDH15R278H:} USMA-{MSV3dO75445p.Arg278His:}" "" "NM_001142763.1:c.848G>A - p.(Arg283His)" "heterozygous; possible pathogenic" "Germline" "" "rs369442293" "0" "" "" "g.54317314C>T" "" "likely benign" "ACMG" "0000375056" "2" "35" "10" "56077074" "56077074" "subst" "2.8449E-5" "02416" "PCDH15_000168" "g.56077074C>T" "0/192 controls" "{PMID:Mutai 2013:24164807}; USMA-{USMAPCDH15R278H:} USMA-{MSV3dO75445p.Arg278His:}" "" "NM_001142763.1:c.848G>A - p.(Arg283His)" "heterozygous; possible pathogenic" "Germline" "" "rs369442293" "0" "" "" "g.54317314C>T" "" "likely benign" "ACMG" "0000375057" "2" "35" "10" "56077074" "56077074" "subst" "2.8449E-5" "02416" "PCDH15_000168" "g.56077074C>T" "0/192 controls" "{PMID:Mutai 2013:24164807}; USMA-{USMAPCDH15R278H:} USMA-{MSV3dO75445p.Arg278His:}" "" "NM_001142763.1:c.848G>A - p.(Arg283His)" "heterozygous; possible pathogenic" "Germline" "" "rs369442293" "0" "" "" "g.54317314C>T" "" "likely benign" "ACMG" "0000375058" "10" "99" "10" "55698611" "55698611" "subst" "0" "02416" "PCDH15_000169" "g.55698611C>A" "" "{PMID:Yoshimura 2014:24618850}" "" "" "homozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.53938851C>A" "" "pathogenic" "" "0000375059" "20" "99" "10" "55698611" "55698611" "subst" "0" "02416" "PCDH15_000169" "g.55698611C>A" "" "{PMID:Yoshimura 2014:24618850}" "" "" "homozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.53938851C>A" "" "pathogenic" "" "0000375060" "0" "35" "10" "55721637" "55721637" "subst" "0.000874866" "02416" "PCDH15_000170" "g.55721637G>A" "" "{PMID:Yoshimura 2014:24618850}; USMA-{USMAPCDH15R962C:} USMA-{MSV3dQ96QU1p.Arg962Cys:}" "" "" "heterozygous; possible pathogenic" "Germline" "" "rs201816080" "0" "" "" "g.53961877G>A" "" "likely benign" "ACMG" "0000375061" "0" "99" "10" "55973788" "55973788" "subst" "4.06362E-6" "02416" "PCDH15_000171" "g.55973788G>A" "" "{PMID:Yoshimura 2014:24618850}" "" "" "heterozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.54214028G>A" "" "pathogenic" "" "0000375062" "2" "99" "10" "55973788" "55973788" "subst" "4.06362E-6" "02428" "PCDH15_000171" "g.55973788G>A" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.54214028G>A" "" "pathogenic" "" "0000375063" "0" "75" "10" "55617017" "55617017" "subst" "0.000366026" "02416" "PCDH15_000172" "g.55617017C>T" "" "{PMID:Yoshimura 2014:24618850}; USMA-{USMAPCDH15V1242M:} USMA-{MSV3dQ96QU1p.(Val1242Met:}" "" "" "heterozygous; possible pathogenic" "Germline" "" "rs201137087" "0" "" "" "g.53857257C>T" "" "VUS" "ACMG" "0000375064" "11" "99" "10" "56138703" "56138703" "subst" "0" "02416" "PCDH15_000173" "g.56138703C>T" "" "{PMID:Yoshimura 2014:24618850}" "" "" "heterozygous; possible pathogenic" "Germline" "" "" "0" "" "" "g.54378943C>T" "" "pathogenic" "" "0000375066" "3" "11" "10" "55568972" "55568972" "subst" "0.253026" "02416" "PCDH15_000174" "g.55568972T>G" "" "{PMID:Rong 2014:24831256}; USMA-{MSV3dA2A3E2p.Glu1618Ala:}" "" "" "non causative" "Germline" "" "rs11003863" "0" "" "" "g.53809212T>G" "" "benign" "" "0000375067" "10" "11" "10" "56345303" "56345303" "subst" "0" "02416" "PCDH15_000175" "g.56345303T>C" "" "{PMID:Rong 2014:24831256}" "" "chr10:g.56345303T>C-c.97A>G-p.S33G in ENST00000361849" "homozygous; non causative" "Germline" "" "rs4570492" "0" "" "" "g.54585543T>C" "" "benign" "" "0000375068" "20" "11" "10" "56345303" "56345303" "subst" "0" "02416" "PCDH15_000175" "g.56345303T>C" "" "{PMID:Rong 2014:24831256}" "" "chr10:g.56345303T>C-c.97A>G-p.S33G in ENST00000361849" "homozygous; non causative" "Germline" "" "rs4570492" "0" "" "" "g.54585543T>C" "" "benign" "" "0000375069" "0" "11" "10" "55913053" "55913053" "subst" "0.000142426" "02416" "PCDH15_000176" "g.55913053G>A" "" "{PMID:Rong 2014:24831256}; USMA-{USMAPCDH15L531F:} USMA-{MSV3dQ96QU1p.Leu531Phe:}" "" "" "heterozygous; 1st nt exon 14; non causative" "Germline" "" "" "0" "" "" "g.54153293G>A" "" "likely benign" "ACMG" "0000375070" "10" "99" "10" "55719492" "55721652" "dup" "0" "02416" "PCDH15_000177" "g.55719492_55721652dup" "" "{PMID:Aparisi 2014:25404053}" "" "" "homozygous; UV4\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375071" "20" "99" "10" "55719492" "55721652" "dup" "0" "02416" "PCDH15_000177" "g.55719492_55721652dup" "" "{PMID:Aparisi 2014:25404053}" "" "" "homozygous; UV4\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375072" "10" "99" "10" "55626608" "55626608" "del" "0" "02416" "PCDH15_000178" "g.55626608del" "" "{PMID:Aparisi 2014:25404053}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866848del" "" "pathogenic" "" "0000375073" "20" "99" "10" "55626608" "55626608" "del" "0" "02416" "PCDH15_000178" "g.55626608del" "" "{PMID:Aparisi 2014:25404053}" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.53866848del" "" "pathogenic" "" "0000375074" "21" "15" "10" "55973766" "55973766" "subst" "0.000162558" "02416" "PCDH15_000179" "g.55973766C>T" "" "{PMID:Bujakowska 2014:25468891}; USMA-{USMAPCDH15R343K:} USMA-{MSV3dQ96QU1p.Arg343Lys:}" "" "" "heterozygous" "Germline" "" "rs141169746" "0" "" "" "g.54214006C>T" "" "likely benign" "ACMG" "0000375075" "21" "15" "10" "55973766" "55973766" "subst" "0.000162558" "02416" "PCDH15_000179" "g.55973766C>T" "" "{PMID:Bujakowska 2014:25468891}; USMA-{USMAPCDH15R343K:} USMA-{MSV3dQ96QU1p.Arg343Lys:}" "" "" "heterozygous" "Germline" "" "rs141169746" "0" "" "" "g.54214006C>T" "" "likely benign" "ACMG" "0000375076" "10" "99" "10" "55973731" "55973731" "del" "0" "02416" "PCDH15_000180" "g.55973731del" "" "{PMID:Lenarduzzi 2015:25575603}" "" "" "homozygous; UV3" "Germline" "" "" "0" "" "" "g.54213971del" "" "pathogenic" "" "0000375077" "20" "99" "10" "55973731" "55973731" "del" "0" "02416" "PCDH15_000180" "g.55973731del" "" "{PMID:Lenarduzzi 2015:25575603}" "" "" "homozygous; UV3" "Germline" "" "" "0" "" "" "g.54213971del" "" "pathogenic" "" "0000375078" "21" "99" "10" "55591074" "55591074" "subst" "0" "02416" "PCDH15_000181" "g.55591074C>A" "" "{PMID:Lenarduzzi 2015:25575603}" "" "IVS30+1G>T" "heterozygous; UV3" "Germline" "" "" "0" "" "" "g.53831314C>A" "" "pathogenic" "" "0000375079" "11" "99" "10" "55700628" "55700628" "dup" "0" "02416" "PCDH15_000182" "g.55700628dup" "" "{PMID:Lenarduzzi 2015:25575603}" "" "3229_3230insA" "heterozygous; UV3" "Germline" "" "" "0" "" "" "g.53940868dup" "" "pathogenic" "" "0000375080" "10" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375081" "10" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375082" "10" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375083" "10" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375084" "20" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375085" "20" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375086" "20" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375087" "20" "75" "10" "55782816" "55782818" "del" "0" "02416" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zhan 2015:25930172}" "" "" "homozygous; pathogenic" "Germline" "" "" "0" "" "" "g.54023056_54023058del" "" "VUS" "ACMG" "0000375088" "1" "99" "10" "55892686" "55892687" "ins" "0" "02416" "PCDH15_000184" "g.55892686_55892687insTA" "" "{PMID:Jiang 2015:26338283}" "" "NM_001142773.1:1799_1800insTA - p.S600fs" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.54132926_54132927insTA" "" "pathogenic" "" "0000375089" "2" "99" "10" "55721562" "55721562" "subst" "0" "02416" "PCDH15_000185" "g.55721562T>A" "" "{PMID:Jiang 2015:26338283}" "" "NM_001142773.1:A2893T - p.R965X" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.53961802T>A" "" "pathogenic" "" "0000375090" "1" "99" "10" "56287639" "56287639" "subst" "0" "02428" "PCDH15_000186" "g.56287639T>C" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.54527879T>C" "" "pathogenic" "" "0000375091" "1" "75" "10" "55591150" "55591150" "dup" "0" "02428" "PCDH15_000187" "g.55591150dup" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.53831390dup" "" "VUS" "ACMG" "0000375092" "2" "99" "10" "55955443" "55955649" "del" "0" "02428" "PCDH15_000188" "g.55955443_55955649del" "" "{PMID:Bonnet 2016:27460420}" "" "NM_001142769.1:1114-?_1320+?del" "heterozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375093" "1" "99" "10" "55849791" "55849791" "subst" "0" "02428" "PCDH15_000189" "g.55849791A>C" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.54090031A>C" "" "pathogenic" "" "0000375094" "10" "99" "10" "56423932" "56561051" "del" "0" "02428" "PCDH15_000190" "g.56423932_56561051del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375095" "1" "99" "10" "56423932" "56561051" "del" "0" "02428" "PCDH15_000190" "g.56423932_56561051del" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375096" "2" "99" "10" "56423932" "56561051" "del" "0" "02428" "PCDH15_000190" "g.56423932_56561051del" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375097" "20" "99" "10" "56423932" "56561051" "del" "0" "02428" "PCDH15_000190" "g.56423932_56561051del" "" "{PMID:Bonnet 2016:27460420}" "" "" "homozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375098" "2" "99" "10" "55568454" "55568454" "subst" "0.000185393" "02428" "PCDH15_000191" "g.55568454A>G" "" "{PMID:Bonnet 2016:27460420}" "" "p.(*1791Argext*5)" "heterozygous; mutation" "Germline" "" "" "0" "" "" "g.53808694A>G" "" "pathogenic" "" "0000375099" "0" "99" "10" "55826517" "55892767" "del" "0" "02428" "PCDH15_000192" "g.55826517_55892767del" "" "{PMID:Bonnet 2016:27460420}" "" "" "heterozygous; mutation\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000375100" "10" "99" "10" "55939713" "56047942" "del" "0" "02428" "PCDH15_000193" "g.55939713_56047942del" "" "Abdi accepted in Plos One" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54179953_54288182del" "" "pathogenic" "" "0000375101" "20" "99" "10" "55939713" "56047942" "del" "0" "02428" "PCDH15_000193" "g.55939713_56047942del" "" "Abdi accepted in Plos One" "" "" "homozygous" "Germline" "" "" "0" "" "" "g.54179953_54288182del" "" "pathogenic" "" "0000375102" "1" "99" "10" "55600162" "55600162" "subst" "0" "02430" "PCDH15_000194" "g.55600162C>A" "" "{PMID:Ivanova 2018:30358468}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000375103" "2" "90" "10" "56138541" "56138703" "del" "0" "02430" "PCDH15_000195" "g.(56129036_56138541)_(56138703_56287571)del" "" "{PMID:Ivanova 2018:30358468}" "" "158-?_318+?del" "" "Germline" "" "" "0" "" "" "g.(54369276_54378781)_(54378943_54527811)del" "" "pathogenic (recessive)" "" "0000458829" "3" "50" "10" "55955567" "55955567" "subst" "0.000446737" "00006" "PCDH15_000303" "g.55955567T>C" "" "{DOI:Reynhout 2019:10.1016/j.ajhg.2019.01.009}" "" "" "" "Germline" "" "" "0" "" "" "g.54195807T>C" "" "VUS" "" "0000540034" "0" "30" "10" "55566546" "55566546" "subst" "4.06997E-6" "01943" "PCDH15_000305" "g.55566546T>C" "" "" "" "PCDH15(NM_001142771.1):c.4842A>G (p.T1614=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53806786T>C" "" "likely benign" "" "0000540035" "0" "50" "10" "55566587" "55566587" "dup" "0" "02330" "PCDH15_000306" "g.55566587dup" "" "" "" "PCDH15(NM_001142771.1):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001142771.2):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001354429.1):c.4912dupT (p.S1638Ffs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53806827dup" "" "VUS" "" "0000540036" "0" "70" "10" "55566587" "55566587" "dup" "0" "01943" "PCDH15_000306" "g.55566587dup" "" "" "" "PCDH15(NM_001142771.1):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001142771.2):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001354429.1):c.4912dupT (p.S1638Ffs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53806827dup" "" "likely pathogenic" "" "0000540037" "0" "50" "10" "55568468" "55568468" "subst" "0" "02330" "PCDH15_000309" "g.55568468T>C" "" "" "" "PCDH15(NM_001142769.3):c.5357A>G (p.Y1786C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53808708T>C" "" "VUS" "" "0000540038" "0" "10" "10" "55568878" "55568878" "subst" "0.00102702" "01943" "PCDH15_000297" "g.55568878T>G" "" "" "" "PCDH15(NM_001142769.2):c.4947A>C (p.E1649D), PCDH15(NM_001142769.3):c.4947A>C (p.E1649D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809118T>G" "" "benign" "" "0000540039" "0" "50" "10" "55568961" "55568961" "subst" "9.76745E-5" "01943" "PCDH15_000310" "g.55568961T>C" "" "" "" "PCDH15(NM_001142769.2):c.4864A>G (p.S1622G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809201T>C" "" "VUS" "" "0000540040" "0" "30" "10" "55568971" "55568971" "subst" "0.0018679" "02330" "PCDH15_000311" "g.55568971C>G" "" "" "" "PCDH15(NM_001142769.2):c.4854G>C (p.E1618D), PCDH15(NM_001142769.3):c.4854G>C (p.E1618D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809211C>G" "" "likely benign" "" "0000540041" "0" "30" "10" "55568971" "55568971" "subst" "0.0018679" "01943" "PCDH15_000311" "g.55568971C>G" "" "" "" "PCDH15(NM_001142769.2):c.4854G>C (p.E1618D), PCDH15(NM_001142769.3):c.4854G>C (p.E1618D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809211C>G" "" "likely benign" "" "0000540042" "0" "10" "10" "55568972" "55568972" "subst" "0.253026" "02325" "PCDH15_000174" "g.55568972T>G" "" "" "" "PCDH15(NM_001142769.3):c.4853A>C (p.E1618A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809212T>G" "" "benign" "" "0000540043" "0" "50" "10" "55569092" "55569118" "del" "0" "01943" "PCDH15_000312" "g.55569092_55569118del" "" "" "" "PCDH15(NM_001142769.2):c.4715_4741delGTGAAGAGTGGCAGAGACGCCTTGAGG (p.G1572_E1580del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809332_53809358del" "" "VUS" "" "0000540045" "0" "50" "10" "55570398" "55570398" "subst" "0.00013423" "01943" "PCDH15_000314" "g.55570398C>T" "" "" "" "PCDH15(NM_001142771.1):c.4415G>A (p.R1472H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53810638C>T" "" "VUS" "" "0000540046" "0" "30" "10" "55581731" "55581731" "subst" "1.21912E-5" "01943" "PCDH15_000315" "g.55581731A>T" "" "" "" "PCDH15(NM_001142763.1):c.5776T>A (p.C1926S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53821971A>T" "" "likely benign" "" "0000540047" "0" "10" "10" "55581883" "55581883" "subst" "0.000962773" "02330" "PCDH15_000316" "g.55581883G>A" "" "" "" "PCDH15(NM_001142763.1):c.5624C>T (p.T1875M), PCDH15(NM_001142763.2):c.5624C>T (p.T1875M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822123G>A" "" "benign" "" "0000540048" "0" "30" "10" "55581883" "55581883" "subst" "0.000962773" "01943" "PCDH15_000316" "g.55581883G>A" "" "" "" "PCDH15(NM_001142763.1):c.5624C>T (p.T1875M), PCDH15(NM_001142763.2):c.5624C>T (p.T1875M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822123G>A" "" "likely benign" "" "0000540049" "0" "10" "10" "55581887" "55581889" "del" "0" "02330" "PCDH15_000317" "g.55581887_55581889del" "" "" "" "PCDH15(NM_001142763.2):c.5622_5624delAAC (p.T1876del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822127_53822129del" "" "benign" "" "0000540050" "0" "50" "10" "55581912" "55581915" "dup" "0" "02330" "PCDH15_000318" "g.55581912_55581915dup" "" "" "" "PCDH15(NM_001142763.2):c.5594_5597dupTTAA (p.K1866Nfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822152_53822155dup" "" "VUS" "" "0000540051" "0" "10" "10" "55581936" "55581936" "subst" "0.00103589" "01943" "PCDH15_000148" "g.55581936G>T" "" "" "" "PCDH15(NM_001142763.1):c.5571C>A (p.T1857=), PCDH15(NM_033056.4):c.5550C>A (p.T1850=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822176G>T" "" "benign" "" "0000540052" "0" "30" "10" "55582047" "55582047" "subst" "0.000255985" "01943" "PCDH15_000319" "g.55582047T>G" "" "" "" "PCDH15(NM_001142763.1):c.5460A>C (p.P1820=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822287T>G" "" "likely benign" "" "0000540054" "0" "50" "10" "55582183" "55582191" "dup" "0" "01943" "PCDH15_000215" "g.55582183_55582191dup" "" "" "" "PCDH15(NM_001142763.1):c.5317_5325dupGCTCCTCCT (p.A1773_P1775dup), PCDH15(NM_001142763.1):c.5325_5326insGCTCCTCCT (p.(Ala1773_Pro1775dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822423_53822431dup" "" "VUS" "" "0000540055" "0" "50" "10" "55582192" "55582200" "del" "0" "01943" "PCDH15_000321" "g.55582192_55582200del" "" "" "" "PCDH15(NM_001142763.1):c.5315_5323delTTGCTCCTC (p.L1772_P1774del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822432_53822440del" "" "VUS" "" "0000540056" "0" "10" "10" "55582205" "55582210" "del" "0" "02330" "PCDH15_000216" "g.55582205_55582210del" "" "" "" "PCDH15(NM_001142763.1):c.5308_5313delGCTCCT (p.A1770_P1771del), PCDH15(NM_001142763.2):c.5308_5313delGCTCCT (p.A1770_P1771del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822445_53822450del" "" "benign" "" "0000540057" "0" "30" "10" "55582205" "55582213" "del" "0" "02330" "PCDH15_000322" "g.55582205_55582213del" "" "" "" "PCDH15(NM_001142763.1):c.5299_5307delCCTGCTCCT (p.P1767_P1769del), PCDH15(NM_001142763.2):c.5299_5307delCCTGCTCCT (p.P1767_P1769del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822445_53822453del" "" "likely benign" "" "0000540058" "0" "50" "10" "55582217" "55582237" "del" "0" "01943" "PCDH15_000323" "g.55582217_55582237del" "" "" "" "PCDH15(NM_001142763.1):c.5278_5298delATTTCTCCTCCTTCTCCTCCT (p.I1760_P1766del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822457_53822477del" "" "VUS" "" "0000540059" "0" "10" "10" "55582512" "55582512" "subst" "0.000259981" "02330" "PCDH15_000118" "g.55582512T>G" "" "" "" "PCDH15(NM_001142763.1):c.4995A>C (p.S1665=), PCDH15(NM_001142763.2):c.4995A>C (p.S1665=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822752T>G" "" "benign" "" "0000540060" "0" "30" "10" "55582512" "55582512" "subst" "0.000259981" "01943" "PCDH15_000118" "g.55582512T>G" "" "" "" "PCDH15(NM_001142763.1):c.4995A>C (p.S1665=), PCDH15(NM_001142763.2):c.4995A>C (p.S1665=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822752T>G" "" "likely benign" "" "0000540061" "0" "30" "10" "55582547" "55582547" "subst" "0" "01943" "PCDH15_000324" "g.55582547T>C" "" "" "" "PCDH15(NM_001142763.1):c.4960A>G (p.I1654V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822787T>C" "" "likely benign" "" "0000540062" "0" "30" "10" "55582594" "55582594" "subst" "9.34086E-5" "02330" "PCDH15_000222" "g.55582594G>T" "" "" "" "PCDH15(NM_001142763.1):c.4913C>A (p.A1638E), PCDH15(NM_001142763.2):c.4913C>A (p.A1638E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822834G>T" "" "likely benign" "" "0000540063" "0" "10" "10" "55582653" "55582656" "dup" "0" "02330" "PCDH15_000325" "g.55582653_55582656dup" "" "" "" "PCDH15(NM_001142763.2):c.4852_4855dupAACA (p.T1619Kfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822893_53822896dup" "" "benign" "" "0000540064" "0" "30" "10" "55582676" "55582676" "subst" "7.31309E-5" "01943" "PCDH15_000326" "g.55582676T>C" "" "" "" "PCDH15(NM_001142763.1):c.4831A>G (p.R1611G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822916T>C" "" "likely benign" "" "0000540065" "0" "50" "10" "55582711" "55582711" "subst" "0" "01943" "PCDH15_000327" "g.55582711G>T" "" "" "" "PCDH15(NM_001142763.1):c.4796C>A (p.P1599Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822951G>T" "" "VUS" "" "0000540066" "0" "30" "10" "55582712" "55582712" "subst" "4.46929E-5" "02330" "PCDH15_000328" "g.55582712G>A" "" "" "" "PCDH15(NM_001142763.2):c.4795C>T (p.P1599S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822952G>A" "" "likely benign" "" "0000540067" "0" "30" "10" "55582894" "55582894" "subst" "4.0656E-6" "01943" "PCDH15_000329" "g.55582894T>C" "" "" "" "PCDH15(NM_001142763.1):c.4613A>G (p.E1538G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53823134T>C" "" "likely benign" "" "0000540068" "0" "50" "10" "55583066" "55583076" "del" "2.03252E-5" "02327" "PCDH15_000330" "g.55583066_55583076del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53823306_53823316del" "" "VUS" "" "0000540069" "0" "30" "10" "55587212" "55587214" "dup" "0" "02330" "PCDH15_000254" "g.55587212_55587214dup" "" "" "" "PCDH15(NM_001142771.2):c.4335_4337dupGCC (p.P1448dup), PCDH15(NM_001354429.1):c.4320_4322dupGCC (p.P1443dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53827452_53827454dup" "" "likely benign" "" "0000540070" "0" "70" "10" "55588323" "55588323" "subst" "4.06646E-5" "02327" "PCDH15_000331" "g.55588323A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53828563A>C" "" "likely pathogenic" "" "0000540071" "0" "10" "10" "55591253" "55591253" "subst" "0.00173817" "01943" "PCDH15_000067" "g.55591253G>T" "" "" "" "PCDH15(NM_001142763.1):c.4039C>A (p.(Gln1347Lys)), PCDH15(NM_001142771.1):c.4039C>A (p.Q1347K), PCDH15(NM_001142771.2):c.4039C>A (p.Q1347K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53831493G>T" "" "benign" "" "0000540072" "0" "10" "10" "55600068" "55600068" "subst" "0.00502408" "02330" "PCDH15_000112" "g.55600068A>G" "" "" "" "PCDH15(NM_001142771.2):c.3998+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53840308A>G" "" "benign" "" "0000540073" "0" "50" "10" "55600152" "55600152" "subst" "4.06144E-6" "01943" "PCDH15_000332" "g.55600152G>C" "" "" "" "PCDH15(NM_001142771.1):c.3926C>G (p.T1309S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53840392G>C" "" "VUS" "" "0000540074" "0" "50" "10" "55600246" "55600246" "subst" "0.000613412" "02330" "PCDH15_000043" "g.55600246G>T" "" "" "" "PCDH15(NM_001142771.1):c.3832C>A (p.R1278S), PCDH15(NM_001142771.2):c.3832C>A (p.R1278S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53840486G>T" "" "VUS" "" "0000540075" "0" "70" "10" "55600246" "55600246" "subst" "0.000613412" "01943" "PCDH15_000043" "g.55600246G>T" "" "" "" "PCDH15(NM_001142771.1):c.3832C>A (p.R1278S), PCDH15(NM_001142771.2):c.3832C>A (p.R1278S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53840486G>T" "" "likely pathogenic" "" "0000540076" "0" "30" "10" "55600262" "55600262" "subst" "6.0984E-5" "02330" "PCDH15_000333" "g.55600262A>C" "" "" "" "PCDH15(NM_001142771.2):c.3822-6T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53840502A>C" "" "likely benign" "" "0000540078" "0" "10" "10" "55626587" "55626587" "subst" "0.00191519" "02330" "PCDH15_000335" "g.55626587C>T" "" "" "" "PCDH15(NM_001142771.1):c.3547G>A (p.V1183I), PCDH15(NM_001142771.2):c.3547G>A (p.V1183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53866827C>T" "" "benign" "" "0000540079" "0" "10" "10" "55626587" "55626587" "subst" "0.00191519" "01943" "PCDH15_000335" "g.55626587C>T" "" "" "" "PCDH15(NM_001142771.1):c.3547G>A (p.V1183I), PCDH15(NM_001142771.2):c.3547G>A (p.V1183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53866827C>T" "" "benign" "" "0000540080" "0" "10" "10" "55626630" "55626630" "dup" "0" "02330" "PCDH15_000336" "g.55626630dup" "" "" "" "PCDH15(NM_001142771.2):c.3517-10dupC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53866870dup" "" "benign" "" "0000540081" "0" "10" "10" "55626639" "55626639" "del" "0" "02330" "PCDH15_000337" "g.55626639del" "" "" "" "PCDH15(NM_001142771.2):c.3517-14delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53866879del" "" "benign" "" "0000540082" "0" "10" "10" "55698563" "55698563" "subst" "0" "02330" "PCDH15_000338" "g.55698563A>C" "" "" "" "PCDH15(NM_001142771.2):c.3388+12T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53938803A>C" "" "benign" "" "0000540083" "0" "30" "10" "55698624" "55698624" "subst" "1.22E-5" "01943" "PCDH15_000339" "g.55698624T>C" "" "" "" "PCDH15(NM_001142771.1):c.3339A>G (p.Q1113=), PCDH15(NM_001354429.2):c.3324A>G (p.Q1108=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53938864T>C" "" "likely benign" "" "0000540084" "0" "30" "10" "55700623" "55700623" "subst" "4.06904E-6" "01943" "PCDH15_000340" "g.55700623C>A" "" "" "" "PCDH15(NM_001142771.1):c.3247+3G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53940863C>A" "" "likely benign" "" "0000540085" "0" "50" "10" "55721531" "55721531" "subst" "0.000253815" "01943" "PCDH15_000341" "g.55721531T>C" "" "" "" "PCDH15(NM_001142771.1):c.3005A>G (p.E1002G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53961771T>C" "" "VUS" "" "0000540087" "0" "10" "10" "55721636" "55721636" "subst" "0.00271354" "02330" "PCDH15_000343" "g.55721636C>A" "" "" "" "PCDH15(NM_001142771.1):c.2900G>T (p.R967L), PCDH15(NM_001142771.2):c.2900G>T (p.R967L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53961876C>A" "" "benign" "" "0000540088" "0" "30" "10" "55721636" "55721636" "subst" "0.00271354" "01943" "PCDH15_000343" "g.55721636C>A" "" "" "" "PCDH15(NM_001142771.1):c.2900G>T (p.R967L), PCDH15(NM_001142771.2):c.2900G>T (p.R967L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53961876C>A" "" "likely benign" "" "0000540089" "0" "30" "10" "55779943" "55779943" "subst" "0.000261314" "02330" "PCDH15_000344" "g.55779943A>G" "" "" "" "PCDH15(NM_001142771.1):c.2766+9T>C, PCDH15(NM_001142771.2):c.2766+9T>C, PCDH15(NM_001384140.1):c.2751+9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020183A>G" "" "likely benign" "" "0000540090" "0" "30" "10" "55779943" "55779943" "subst" "0.000261314" "01943" "PCDH15_000344" "g.55779943A>G" "" "" "" "PCDH15(NM_001142771.1):c.2766+9T>C, PCDH15(NM_001142771.2):c.2766+9T>C, PCDH15(NM_001384140.1):c.2751+9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020183A>G" "" "likely benign" "" "0000540091" "0" "50" "10" "55780122" "55780122" "subst" "0.000674572" "02330" "PCDH15_000345" "g.55780122C>T" "" "" "" "PCDH15(NM_001142771.2):c.2596G>A (p.V866M), PCDH15(NM_001354429.1):c.2581G>A (p.V861M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020362C>T" "" "VUS" "" "0000540092" "0" "50" "10" "55780122" "55780122" "subst" "0.000674572" "01943" "PCDH15_000345" "g.55780122C>T" "" "" "" "PCDH15(NM_001142771.2):c.2596G>A (p.V866M), PCDH15(NM_001354429.1):c.2581G>A (p.V861M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020362C>T" "" "VUS" "" "0000540093" "0" "50" "10" "55780140" "55780140" "subst" "0.000406402" "01943" "PCDH15_000346" "g.55780140G>A" "" "" "" "PCDH15(NM_001142771.1):c.2578C>T (p.R860W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020380G>A" "" "VUS" "" "0000540094" "0" "50" "10" "55782732" "55782732" "subst" "0" "02325" "PCDH15_000347" "g.55782732T>C" "" "" "" "PCDH15(NM_001354429.2):c.2446A>G (p.S816G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54022972T>C" "" "VUS" "" "0000540095" "0" "50" "10" "55782792" "55782792" "subst" "5.28335E-5" "01943" "PCDH15_000348" "g.55782792C>T" "" "" "" "PCDH15(NM_001142771.1):c.2401G>A (p.V801I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54023032C>T" "" "VUS" "" "0000540096" "0" "30" "10" "55782853" "55782853" "subst" "3.25521E-5" "01943" "PCDH15_000349" "g.55782853C>T" "" "" "" "PCDH15(NM_001142771.1):c.2340G>A (p.V780=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54023093C>T" "" "likely benign" "" "0000540097" "0" "50" "10" "55826523" "55826523" "subst" "5.29079E-5" "01943" "PCDH15_000350" "g.55826523T>G" "" "" "" "PCDH15(NM_001142771.1):c.2229A>C (p.Q743H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54066763T>G" "" "VUS" "" "0000540098" "0" "50" "10" "55826543" "55826543" "subst" "6.91512E-5" "02330" "PCDH15_000351" "g.55826543C>T" "" "" "" "PCDH15(NM_001142771.2):c.2209G>A (p.A737T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54066783C>T" "" "VUS" "" "0000540099" "0" "30" "10" "55839184" "55839184" "subst" "1.21845E-5" "02330" "PCDH15_000352" "g.55839184G>A" "" "" "" "PCDH15(NM_001142771.2):c.2013C>T (p.T671=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54079424G>A" "" "likely benign" "" "0000540100" "0" "10" "10" "55839205" "55839208" "del" "0" "02330" "PCDH15_000353" "g.55839205_55839208del" "" "" "" "PCDH15(NM_001142771.2):c.2013-13_2013-10delGTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54079445_54079448del" "" "benign" "" "0000540101" "0" "10" "10" "55892622" "55892623" "dup" "0" "02330" "PCDH15_000354" "g.55892622_55892623dup" "" "" "" "PCDH15(NM_001142771.2):c.1932+12_1932+13dupGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54132862_54132863dup" "" "benign" "" "0000540102" "0" "30" "10" "55892652" "55892652" "subst" "0.000599481" "02330" "PCDH15_000355" "g.55892652C>T" "" "" "" "PCDH15(NM_001142771.1):c.1915G>A (p.V639I), PCDH15(NM_001142771.2):c.1915G>A (p.V639I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54132892C>T" "" "likely benign" "" "0000540103" "0" "50" "10" "55892652" "55892652" "subst" "0.000599481" "01943" "PCDH15_000355" "g.55892652C>T" "" "" "" "PCDH15(NM_001142771.1):c.1915G>A (p.V639I), PCDH15(NM_001142771.2):c.1915G>A (p.V639I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54132892C>T" "" "VUS" "" "0000540104" "0" "50" "10" "55892726" "55892726" "subst" "0" "01943" "PCDH15_000356" "g.55892726T>C" "" "" "" "PCDH15(NM_001142771.1):c.1841A>G (p.N614S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54132966T>C" "" "VUS" "" "0000540105" "0" "30" "10" "55912991" "55912991" "subst" "0.00014635" "01943" "PCDH15_000357" "g.55912991C>T" "" "" "" "PCDH15(NM_001142771.1):c.1668G>A (p.G556=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54153231C>T" "" "likely benign" "" "0000540106" "0" "50" "10" "55943300" "55943300" "subst" "0.000125935" "02330" "PCDH15_000358" "g.55943300T>C" "" "" "" "PCDH15(NM_001142771.2):c.1509A>G (p.Q503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54183540T>C" "" "VUS" "" "0000540107" "0" "30" "10" "55944887" "55944887" "subst" "6.50581E-5" "01943" "PCDH15_000359" "g.55944887T>G" "" "" "" "PCDH15(NM_001142771.1):c.1455+7A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54185127T>G" "" "likely benign" "" "0000540108" "0" "10" "10" "55944972" "55944972" "subst" "0.000706955" "02330" "PCDH15_000241" "g.55944972G>A" "" "" "" "PCDH15(NM_001142771.2):c.1377C>T (p.V459=), PCDH15(NM_001354429.1):c.1362C>T (p.V454=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54185212G>A" "" "benign" "" "0000540109" "0" "10" "10" "55945041" "55945041" "dup" "0" "02330" "PCDH15_000360" "g.55945041dup" "" "" "" "PCDH15(NM_001142771.2):c.1321-6dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54185281dup" "" "benign" "" "0000540110" "0" "50" "10" "55955466" "55955466" "subst" "0" "01943" "PCDH15_000361" "g.55955466C>G" "" "" "" "PCDH15(NM_001142771.1):c.1297G>C (p.A433P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54195706C>G" "" "VUS" "" "0000540111" "0" "90" "10" "55955539" "55955539" "subst" "4.06128E-6" "02327" "PCDH15_000362" "g.55955539A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54195779A>C" "" "pathogenic" "" "0000540112" "0" "10" "10" "56077209" "56077209" "subst" "0.657115" "02325" "PCDH15_000020" "g.56077209G>A" "" "" "" "PCDH15(NM_001142771.2):c.721-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54317449G>A" "" "benign" "" "0000540113" "0" "50" "10" "56106156" "56106156" "subst" "0" "02330" "PCDH15_000363" "g.56106156T>G" "" "" "" "PCDH15(NM_001142771.2):c.578A>C (p.E193A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54346396T>G" "" "VUS" "" "0000540114" "0" "50" "10" "56128896" "56128896" "subst" "1.22188E-5" "01943" "PCDH15_000364" "g.56128896T>C" "" "" "" "PCDH15(NM_001142771.1):c.473A>G (p.Y158C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54369136T>C" "" "VUS" "" "0000540115" "0" "10" "10" "56423968" "56423968" "subst" "0.219841" "02327" "PCDH15_000004" "g.56423968A>C" "" "" "" "PCDH15(NM_001142771.2):c.55T>G (p.S19A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54664208A>C" "" "benign" "" "0000540116" "0" "10" "10" "56424027" "56424027" "subst" "0.00134711" "02330" "PCDH15_000365" "g.56424027T>C" "" "" "" "PCDH15(NM_001142771.2):c.-5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54664267T>C" "" "benign" "" "0000600841" "21" "99" "10" "55640819" "55829214" "delins" "0" "00110" "PCDH15_000366" "g.55640819_55829214delinsGTG" "" "{PMID:Vaché 2020:32714370}, {DOI:Vaché 2020:10.3389/fgene.2020.00623}" "" "" "" "Germline" "yes" "" "0" "" "" "g.53881059_54069454delinsGTG" "" "pathogenic" "ACMG" "0000600842" "11" "11" "10" "56423968" "56423968" "subst" "0.219841" "00110" "PCDH15_000004" "g.56423968A>C" "" "{PMID:Vaché 2020:32714370}, {DOI:Vaché 2020:10.3389/fgene.2020.00623}" "" "" "" "Germline" "" "" "0" "" "" "g.54664208A>C" "" "benign" "ACMG" "0000600843" "11" "99" "10" "55930707" "55930922" "" "0" "00110" "BICC1_000014" "g.[(55930526_55930707)_(55930922_55930971)del;(55930922_55930971)_(60622315_60622496)inv;(60622051_60622100)_(60622315_60622496)dup]" "" "{PMID:Vaché 2020:32714370}, {DOI:Vaché 2020:10.3389/fgene.2020.00623}" "" "" "SV consisting in the inversion of 4.6Mb in chr10. The breakpoints are located between exons 13 and 14 of PCDH15 on one end and between BICC1 and LINC00844 on the other end." "Germline" "yes" "" "0" "" "" "g.[(54170766_54170947)_(54171162_54171211)del;(54171162_54171211)_(58862555_58862736)inv;(58862291_58862340)_(58862555_58862736)dup]" "" "pathogenic" "" "0000602994" "3" "90" "10" "55826546" "55826546" "subst" "0" "01807" "PCDH15_000367" "g.55826546C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.54066786C>A" "" "pathogenic" "" "0000612500" "0" "50" "10" "55566587" "55566587" "dup" "0" "02327" "PCDH15_000306" "g.55566587dup" "" "" "" "PCDH15(NM_001142771.1):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001142771.2):c.4804dupT (p.S1602Ffs*3), PCDH15(NM_001354429.1):c.4912dupT (p.S1638Ffs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53806827dup" "" "VUS" "" "0000612501" "0" "30" "10" "55566671" "55566671" "subst" "0.000810247" "01943" "PCDH15_000307" "g.55566671G>A" "" "" "" "PCDH15(NM_001142771.1):c.4717C>T (p.L1573=), PCDH15(NM_001142771.2):c.4717C>T (p.L1573=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53806911G>A" "" "likely benign" "" "0000612502" "0" "50" "10" "55582135" "55582135" "subst" "5.68201E-6" "01943" "PCDH15_000368" "g.55582135G>T" "" "" "" "PCDH15(NM_001142763.1):c.5372C>A (p.P1791H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822375G>T" "" "VUS" "" "0000612503" "0" "30" "10" "55582280" "55582280" "subst" "2.46324E-5" "01943" "PCDH15_000369" "g.55582280G>A" "" "" "" "PCDH15(NM_001142763.1):c.5227C>T (p.H1743Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822520G>A" "" "likely benign" "" "0000612504" "0" "50" "10" "55582413" "55582413" "subst" "0" "01943" "PCDH15_000370" "g.55582413A>C" "" "" "" "PCDH15(NM_001142763.1):c.5094T>G (p.S1698R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822653A>C" "" "VUS" "" "0000612505" "0" "50" "10" "55616987" "55616987" "subst" "4.06544E-6" "01943" "PCDH15_000372" "g.55616987C>G" "" "" "" "PCDH15(NM_001142771.1):c.3769G>C (p.V1257L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53857227C>G" "" "VUS" "" "0000612506" "0" "50" "10" "55617026" "55617026" "subst" "2.84768E-5" "02330" "PCDH15_000373" "g.55617026G>C" "" "" "" "PCDH15(NM_001142771.2):c.3733-3C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53857266G>C" "" "VUS" "" "0000612507" "0" "50" "10" "55626564" "55626564" "subst" "0.000134131" "01943" "PCDH15_000374" "g.55626564T>C" "" "" "" "PCDH15(NM_001142771.1):c.3570A>G (p.I1190M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53866804T>C" "" "VUS" "" "0000612508" "0" "30" "10" "55700675" "55700675" "subst" "0" "01943" "PCDH15_000376" "g.55700675A>T" "" "" "" "PCDH15(NM_001142771.1):c.3198T>A (p.A1066=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53940915A>T" "" "likely benign" "" "0000612509" "0" "50" "10" "55892753" "55892753" "subst" "4.06329E-6" "01943" "PCDH15_000378" "g.55892753G>C" "" "" "" "PCDH15(NM_001354429.1):c.1799C>G (p.T600S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54132993G>C" "" "VUS" "" "0000612510" "0" "90" "10" "56424016" "56424016" "subst" "2.0555E-5" "02327" "PCDH15_000053" "g.56424016G>A" "" "" "" "PCDH15(NM_001354429.1):c.7C>T (p.R3*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54664256G>A" "" "pathogenic" "" "0000622389" "0" "50" "10" "55587212" "55587214" "dup" "0" "01943" "PCDH15_000254" "g.55587212_55587214dup" "" "" "" "PCDH15(NM_001142771.2):c.4335_4337dupGCC (p.P1448dup), PCDH15(NM_001354429.1):c.4320_4322dupGCC (p.P1443dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53827452_53827454dup" "" "VUS" "" "0000622390" "0" "50" "10" "55591145" "55591145" "subst" "0" "01943" "PCDH15_000371" "g.55591145A>T" "" "" "" "PCDH15(NM_001354429.1):c.4132T>A (p.L1378M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53831385A>T" "" "VUS" "" "0000622391" "0" "50" "10" "55700664" "55700664" "subst" "0" "01943" "PCDH15_000375" "g.55700664T>C" "" "" "" "PCDH15(NM_001354429.1):c.3194A>G (p.Q1065R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53940904T>C" "" "VUS" "" "0000622392" "0" "90" "10" "55719606" "55719607" "del" "0" "01943" "PCDH15_000377" "g.55719606_55719607del" "" "" "" "PCDH15(NM_001354429.1):c.3010-3_3010-2delAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53959846_53959847del" "" "pathogenic" "" "0000647916" "1" "10" "10" "55566438" "55566438" "subst" "0.0191766" "03575" "PCDH15_000379" "g.55566438C>T" "25/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "25 heterozygous, no homozygous; {DB:CLININrs74609306}" "Germline" "" "rs74609306" "0" "" "" "g.53806678C>T" "" "benign" "" "0000647917" "1" "10" "10" "55570347" "55570347" "subst" "0.00773693" "03575" "PCDH15_000380" "g.55570347C>T" "3/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs41274622}" "Germline" "" "rs41274622" "0" "" "" "g.53810587C>T" "" "benign" "" "0000647918" "1" "30" "10" "55663053" "55663053" "subst" "0.00126144" "03575" "PCDH15_000381" "g.55663053C>T" "18/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "18 heterozygous, no homozygous; {DB:CLININrs149478475}" "Germline" "" "rs149478475" "0" "" "" "g.53903293C>T" "" "likely benign" "" "0000647919" "1" "50" "10" "55721637" "55721637" "subst" "0.000874866" "03575" "PCDH15_000170" "g.55721637G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs201816080}" "Germline" "" "rs201816080" "0" "" "" "g.53961877G>A" "" "VUS" "" "0000647920" "1" "50" "10" "55755509" "55755509" "subst" "0.000171255" "03575" "PCDH15_000382" "g.55755509G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs191577774}" "Germline" "" "rs191577774" "0" "" "" "g.53995749G>A" "" "VUS" "" "0000647921" "1" "50" "10" "55780122" "55780122" "subst" "0.000674572" "03575" "PCDH15_000345" "g.55780122C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs142512524}" "Germline" "" "rs142512524" "0" "" "" "g.54020362C>T" "" "VUS" "" "0000647922" "1" "50" "10" "55780140" "55780140" "subst" "0.000406402" "03575" "PCDH15_000346" "g.55780140G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs138010738}" "Germline" "" "rs138010738" "0" "" "" "g.54020380G>A" "" "VUS" "" "0000647923" "1" "50" "10" "55892642" "55892642" "subst" "0.0276228" "03575" "PCDH15_000007" "g.55892642T>C" "216/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 216 heterozygous; {DB:CLININrs61731389}" "Germline" "" "rs61731389" "0" "" "" "g.54132882T>C" "" "VUS" "" "0000647924" "1" "50" "10" "56106173" "56106173" "subst" "0.013703" "03575" "PCDH15_000383" "g.56106173T>C" "13/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 13 heterozygous, no homozygous; {DB:CLININrs34164469}" "Germline" "" "rs34164469" "0" "" "" "g.54346413T>C" "" "VUS" "" "0000656499" "0" "30" "10" "55569013" "55569013" "subst" "0" "01943" "PCDH15_000384" "g.55569013C>T" "" "" "" "PCDH15(NM_001142769.2):c.4812G>A (p.E1604=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53809253C>T" "" "likely benign" "" "0000656500" "0" "10" "10" "55581936" "55581936" "subst" "0.00103589" "02330" "PCDH15_000148" "g.55581936G>T" "" "" "" "PCDH15(NM_001142763.1):c.5571C>A (p.T1857=), PCDH15(NM_033056.4):c.5550C>A (p.T1850=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.53822176G>T" "" "benign" "" "0000656501" "0" "30" "10" "55780079" "55780079" "subst" "3.65827E-5" "01943" "PCDH15_000385" "g.55780079G>A" "" "" "" "PCDH15(NM_001354429.1):c.2624C>T (p.S875L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54020319G>A" "" "likely benign" "" "0000656502" "0" "30" "10" "56077173" "56077173" "subst" "0.000130139" "01943" "PCDH15_000386" "g.56077173C>T" "" "" "" "PCDH15(NM_001354429.1):c.734G>A (p.R245Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54317413C>T" "" "likely benign" "" "0000669065" "3" "50" "10" "55892642" "55892642" "subst" "0.0276228" "03575" "PCDH15_000007" "g.55892642T>C" "7/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 7 homozygous; {DB:CLININrs61731389}" "Germline" "" "rs61731389" "0" "" "" "g.54132882T>C" "" "VUS" "" "0000678848" "0" "50" "10" "55582797" "55582842" "dup" "0" "02330" "PCDH15_000387" "g.55582797_55582842dup" "" "" "" "PCDH15(NM_033056.4):c.4644_4689dup (p.R1564Cfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000678849" "0" "50" "10" "55755464" "55755464" "subst" "0" "01943" "PCDH15_000388" "g.55755464T>C" "" "" "" "PCDH15(NM_001354429.1):c.2813A>G (p.D938G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000684546" "1" "70" "10" "56128954" "56128954" "subst" "0" "00004" "PCDH15_000058" "g.56128954G>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.54369194G>C" "" "likely pathogenic" "" "0000684778" "0" "30" "10" "55582674" "55582674" "subst" "0.00203979" "00004" "PCDH15_000270" "g.55582674C>A" "frequency 0.018" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.53822914C>A" "" "likely benign" "" "0000684779" "0" "30" "10" "55721637" "55721637" "subst" "0.000874866" "00004" "PCDH15_000170" "g.55721637G>A" "frequency 0.014" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.53961877G>A" "" "likely benign" "" "0000684839" "3" "90" "10" "55626458" "55626458" "subst" "0" "00004" "PCDH15_000389" "g.55626458G>A" "" "{PMID:Santana 2019:31231422}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000685338" "0" "90" "10" "56077174" "56077174" "subst" "0.000207462" "00004" "PCDH15_000039" "g.56077174G>A" "5/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685685" "3" "90" "10" "55912907" "55912907" "subst" "4.0699E-6" "00004" "PCDH15_000051" "g.55912907G>C" "" "{PMID:Fuster-Garcia 2018:30459346}" "" "" "" "Germline" "" "" "0" "" "" "g.54153147G>C" "" "pathogenic (recessive)" "" "0000690725" "0" "50" "10" "55582214" "55582225" "del" "0" "01943" "PCDH15_000390" "g.55582214_55582225del" "" "" "" "PCDH15(NM_001142763.1):c.5290_5301delTCTCCTCCTCCT (p.S1764_P1767del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690726" "0" "30" "10" "55582442" "55582442" "subst" "9.75491E-5" "01943" "PCDH15_000391" "g.55582442C>T" "" "" "" "PCDH15(NM_001142763.1):c.5065G>A (p.E1689K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690727" "0" "30" "10" "55582934" "55582934" "subst" "8.13121E-6" "01943" "PCDH15_000392" "g.55582934C>T" "" "" "" "PCDH15(NM_001142763.1):c.4573G>A (p.D1525N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690728" "0" "50" "10" "55587197" "55587202" "dup" "0" "01943" "PCDH15_000393" "g.55587197_55587202dup" "" "" "" "PCDH15(NM_001354429.1):c.4323_4328dupTCCGCC (p.P1442_P1443dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000708851" "0" "50" "10" "55782873" "55782873" "subst" "4.06934E-6" "03779" "PCDH15_000394" "g.55782873C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs748808565" "0" "" "" "" "" "VUS" "" "0000722842" "0" "90" "10" "55566577" "55566577" "dup" "0" "01943" "PCDH15_000395" "g.55566577dup" "" "" "" "PCDH15(NM_001354429.1):c.4924dupA (p.M1642Nfs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000722843" "0" "50" "10" "55568981" "55568981" "del" "0" "01943" "PCDH15_000396" "g.55568981del" "" "" "" "PCDH15(NM_001142769.2):c.4844delG (p.S1615Mfs*205), PCDH15(NM_001142771.1):c.4497+1335delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722844" "0" "50" "10" "55569247" "55569249" "del" "0" "01943" "PCDH15_000397" "g.55569247_55569249del" "" "" "" "PCDH15(NM_001142770.2):c.4615_4617delAAG (p.K1539*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722845" "0" "50" "10" "55582199" "55582213" "del" "0" "01943" "PCDH15_000398" "g.55582199_55582213del" "" "" "" "PCDH15(NM_001142763.1):c.5300_5314delCTGCTCCTGCTCCTC (p.P1767_P1771del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722846" "0" "30" "10" "55663054" "55663054" "subst" "0.000512787" "01943" "PCDH15_000400" "g.55663054G>T" "" "" "" "PCDH15(NM_001354429.1):c.3450C>A (p.I1150=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722847" "0" "50" "10" "55944894" "55944894" "subst" "8.13193E-5" "01943" "PCDH15_000404" "g.55944894C>T" "" "" "" "PCDH15(NM_001354429.1):c.1440G>A (p.S480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722848" "0" "90" "10" "56077174" "56077174" "subst" "0.000207462" "01943" "PCDH15_000039" "g.56077174G>A" "" "" "" "PCDH15(NM_001142771.1):c.748C>T (p.R250*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000722849" "0" "30" "10" "56287647" "56287647" "subst" "6.51201E-5" "01943" "PCDH15_000250" "g.56287647G>A" "" "" "" "PCDH15(NM_001142771.2):c.107-10C>T, PCDH15(NM_001354429.1):c.92-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729807" "3" "90" "10" "55582918" "55582918" "del" "0" "00000" "PCDH15_000399" "g.55582918del" "" "{PMID:Chen 2018:29692870}" "" "" "" "Germline" "" "" "0" "" "" "g.53823158del" "" "pathogenic (recessive)" "" "0000729808" "3" "90" "10" "55582918" "55582918" "del" "0" "00000" "PCDH15_000399" "g.55582918del" "" "{PMID:Chen 2018:29692870}" "" "" "" "Germline" "" "" "0" "" "" "g.53823158del" "" "pathogenic (recessive)" "" "0000730122" "1" "90" "10" "55700625" "55700625" "subst" "0" "00000" "PCDH15_000402" "g.55700625C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.53940865C>T" "" "pathogenic" "ACMG" "0000730123" "1" "90" "10" "56138666" "56138671" "delins" "0" "00000" "PCDH15_000408" "g.56138666_56138671delinsTGTTGTCC" "" "{PMID:Sun 2018:29625443}" "" "c.189_194delAGGGACinsGGACAACA" "" "Germline" "" "" "0" "" "" "g.54378906_54378911delinsTGTTGTCC" "" "pathogenic" "ACMG" "0000730124" "3" "70" "10" "55913053" "55913053" "subst" "0.000142426" "00000" "PCDH15_000176" "g.55913053G>A" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.54153293G>A" "" "likely pathogenic" "ACMG" "0000730125" "1" "90" "10" "55955550" "55955550" "delins" "0" "00000" "PCDH15_000405" "g.55955550delinsTCT" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.54195790delinsTCT" "" "pathogenic" "ACMG" "0000730139" "1" "70" "10" "55955614" "55955614" "subst" "2.03108E-5" "00000" "PCDH15_000406" "g.55955614A>C" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.54195854A>C" "" "likely pathogenic" "ACMG" "0000730215" "1" "50" "10" "55663053" "55663053" "subst" "0.00126144" "00000" "PCDH15_000381" "g.55663053C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.53903293C>T" "" "VUS" "ACMG" "0000730218" "0" "50" "10" "55973787" "55973787" "subst" "4.06375E-5" "00000" "PCDH15_000407" "g.55973787C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.54214027C>T" "" "VUS" "ACMG" "0000730226" "2" "90" "10" "55912906" "55912907" "ins" "0" "00000" "PCDH15_000403" "g.55912906_55912907insT" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.54153146_54153147insT" "" "pathogenic" "ACMG" "0000730254" "0" "70" "10" "55721637" "55721637" "subst" "0.000874866" "00000" "PCDH15_000170" "g.55721637G>A" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.53961877G>A" "" "likely pathogenic" "ACMG" "0000730261" "2" "90" "10" "56138666" "56138671" "delins" "0" "00000" "PCDH15_000408" "g.56138666_56138671delinsTGTTGTCC" "" "{PMID:Sun 2018:29625443}" "" "c.189_194delAGGGACinsGGACAACA" "" "Germline" "" "" "0" "" "" "g.54378906_54378911delinsTGTTGTCC" "" "pathogenic" "ACMG" "0000730298" "2" "90" "10" "55663068" "55663068" "dup" "0" "00000" "PCDH15_000401" "g.55663068dup" "" "{PMID:Sun 2018:29625443}" "" "c.3436dupA" "" "Germline" "" "" "0" "" "" "g.53903308dup" "" "pathogenic" "ACMG" "0000730308" "0" "50" "10" "55582674" "55582674" "subst" "0.00203979" "00000" "PCDH15_000270" "g.55582674C>A" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.53822914C>A" "" "VUS" "ACMG" "0000732466" "0" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Costa 2017:28912962}" "" "2596G>A (Val866Met)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000732497" "0" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Costa 2017:28912962}" "" "608C>T (Pro203Leu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000732507" "0" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Costa 2017:28912962}" "" "2578C>T (Arg860Trp)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000732881" "0" "70" "10" "56077192" "56077206" "del" "0" "00000" "PCDH15_000409" "g.56077192_56077206del" "" "{PMID:Stone 2017:28559085}" "" "IVS7-5 del15tAACAGGACCGTGCCC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.54317432_54317446del" "" "likely pathogenic" "" "0000733248" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733249" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733250" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733251" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733252" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733253" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733254" "1" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000733662" "2" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Stone 2017:28559085}" "" "2800C>T Arg934StopCGA>TGA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000735994" "1" "50" "10" "55582183" "55582191" "dup" "0" "02485" "PCDH15_000215" "g.55582183_55582191dup" "" "{PMID:Bravo-Gil 2017:28157192}" "" "c.5296_5304dupGCTCCTCCT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.53822423_53822431dup" "" "VUS" "" "0000736844" "0" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "2/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "NM_033056.3:c.5275_5277del (Pro1759del)" "no genotypes reported" "Germline" "" "rs397517462" "0" "" "" "" "" "VUS" "" "0000736845" "0" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "1/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "NM_033056.3:c.5308_5313del (Ala1770_Pro1771del)" "no genotypes reported" "Germline" "" "rs397517465" "0" "" "" "" "" "VUS" "" "0000736846" "0" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "1/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "NM_033056.3:c.5390_5395del (Leu1797_Pro1798del)" "no genotypes reported" "Germline" "" "rs779691085" "0" "" "" "" "" "VUS" "" "0000736847" "0" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "5/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "NM_033056.3:c.5622_5624del (Thr1876del)" "no genotypes reported" "Germline" "" "rs113363047" "0" "" "" "" "" "VUS" "" "0000759737" "3" "90" "10" "56128954" "56128954" "subst" "4.07282E-6" "00000" "PCDH15_000078" "g.56128954G>A" "" "{PMID:Ben-Rebeh 2016:27440999}" "" "" "" "Germline" "yes" "" "0" "" "" "g.54369194G>A" "" "pathogenic (recessive)" "" "0000759978" "0" "50" "10" "55587206" "55587214" "del" "0" "00000" "PCDH15_000412" "g.55587206_55587214del" "" "{PMID:Tiwari 2016:27353947}" "" "NM_001142763.1:c.4329_4337del" "" "Germline" "" "" "0" "" "" "g.53827446_53827454del" "" "VUS" "" "0000760067" "0" "50" "10" "55566702" "55566702" "subst" "0.00262362" "00000" "PCDH15_000308" "g.55566702C>T" "" "{PMID:Tiwari 2016:27353947}" "" "NM_001142763.1:c.*14916G>A" "" "Germline" "" "" "0" "" "" "g.53806942C>T" "" "VUS" "" "0000760248" "0" "50" "10" "55582115" "55582124" "del" "0" "00000" "PCDH15_000411" "g.55582115_55582124del" "" "{PMID:Ellingford 2016:27208204}" "" "NM_001142763.1:5385_5394delTCCTCTTCCT" "" "Germline" "" "" "0" "" "" "g.53822355_53822364del" "" "VUS" "" "0000760470" "0" "50" "10" "55581921" "55581921" "subst" "1.21873E-5" "00000" "PCDH15_000410" "g.55581921G>T" "" "{PMID:Ellingford 2016:27208204}" "" "NM_001142763.15586C>A" "" "Germline" "" "" "0" "" "" "g.53822161G>T" "" "VUS" "" "0000765231" "1" "90" "10" "56128953" "56128953" "subst" "8.14458E-6" "00000" "PCDH15_000045" "g.56128953C>T" "" "{PMID:Neuhaus 2017:28944237}" "" "" "" "Germline" "yes" "rs137853003" "0" "" "" "g.54369193C>T" "" "pathogenic" "" "0000765232" "3" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Neuhaus 2017:28944237}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000765348" "2" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Neuhaus 2017:28944237}" "" "del ex1-3" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000783895" "1" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wang 2015:26047050}" "" "5308_5313del (A1770_P1771del)" "" "Germline" "" "" "0" "" "" "g.53822414_53822419del" "" "VUS" "" "0000783981" "2" "50" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wang 2015:26047050}" "" "2899C>T (R967C)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000783984" "3" "90" "10" "0" "0" "" "0" "00006" "CYP2C9_001038" "g.?" "" "{PMID:Chen 2015:26011067}" "" "OTTHUMT 00000291342:c.1238delT" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000784001" "0" "10" "10" "55582674" "55582674" "subst" "0.00203979" "00006" "PCDH15_000270" "g.55582674C>A" "18/314 case chromosomes" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "rs148718874" "0" "" "" "" "" "benign" "" "0000784002" "1" "50" "10" "55913053" "55913053" "subst" "0.000142426" "00006" "PCDH15_000176" "g.55913053G>A" "1/314 case chromosomes" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000784166" "0" "50" "10" "55582674" "55582674" "subst" "0.00203979" "00000" "PCDH15_000270" "g.55582674C>A" "18/314" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "rs148718874" "0" "" "" "g.53822914C>A" "" "VUS" "" "0000784167" "0" "50" "10" "55955553" "55955553" "subst" "0.000231497" "00000" "PCDH15_000413" "g.55955553T>G" "1/314" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "rs199786639" "0" "" "" "g.54195793T>G" "" "VUS" "" "0000784662" "3" "50" "10" "55582674" "55582674" "subst" "0.00203979" "00000" "PCDH15_000270" "g.55582674C>A" "18/314 case chromosomes" "{PMID:Xu 2015:25999675}" "" "" "40/1266 control chromosomes" "Germline" "" "rs148718874" "0" "" "" "g.53822914C>A" "" "VUS" "" "0000784663" "3" "50" "10" "55721637" "55721637" "subst" "0.000874866" "00000" "PCDH15_000170" "g.55721637G>A" "6/314 case chromosomes" "{PMID:Xu 2015:25999675}" "" "" "42/1266 control chromosomes" "Germline" "" "rs201816080" "0" "" "" "g.53961877G>A" "" "VUS" "" "0000785520" "1" "50" "10" "55755509" "55755509" "subst" "0.000171255" "00006" "PCDH15_000382" "g.55755509G>A" "" "{PMID:Kikuchi 2015:25692141}" "" "" "" "Germline" "no" "" "0" "" "" "" "" "VUS" "" "0000788381" "0" "50" "10" "55943311" "55943311" "subst" "0.000109693" "00000" "PCDH15_000040" "g.55943311C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G1483A" "" "Germline" "" "rs187727835" "0" "" "" "g.54183551C>T" "" "VUS" "" "0000788468" "0" "50" "10" "55582297" "55582297" "subst" "2.44628E-5" "00000" "PCDH15_000414" "g.55582297A>T" "" "{PMID:Katagiri 2014:25268133}" "" "T5189A" "" "Germline" "" "" "0" "" "" "g.53822537A>T" "" "VUS" "" "0000790737" "3" "70" "10" "56408524" "56572560" "del" "0" "00000" "PCDH15_000415" "g.56408524_56572560del" "" "{PMID:Coppieters 2014:24625443}" "" "celetion ex1-2" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000794017" "0" "90" "10" "55582619" "55582620" "ins" "0" "00000" "PCDH15_000417" "g.55582619_55582620insTGTC" "" "{PMID:Nishiguchi-2012:22848652}" "" "c.4866_4867insGACA" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000794020" "0" "90" "10" "55582221" "55582222" "ins" "0" "00000" "PCDH15_000416" "g.55582221_55582222insAGAC" "" "{PMID:Nishiguchi-2012:22848652}" "" "c.5264_5265insGTCT" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000794147" "0" "70" "1" "22154919" "22154919" "subst" "0" "00000" "PCDH15_000001" "g.22154919C>T" "" "{PMID:Wan 2018:30245926}" "" "c.12238G>A; p.Val4080Met" "Known high myopia gene; heterozygous variant" "Unknown" "?" "" "0" "" "" "g.21828426C>T" "" "likely pathogenic" "" "0000794341" "3" "90" "10" "55892690" "55892691" "dup" "0" "00000" "PCDH15_000418" "g.55892690_55892691dup" "" "{PMID:Wang 2018:30029497}" "" "NM_033056.3:c.1863_1864dup, NP_149045.3:p.(Ser622IlefsTer9), NC_000010.10:g.55892690_55892691dup" "" "Germline" "?" "" "0" "" "" "g.54132930_54132931dup" "" "pathogenic" "ACMG" "0000794863" "21" "50" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "erroneous transcript indicated: NM_001142763, c.733C>T, p.Arg245Ter" "" "Germline" "?" "" "0" "" "" "g.54317414G>A" "" "VUS" "" "0000795861" "0" "70" "10" "56287620" "56287620" "subst" "0" "00000" "PCDH15_000419" "g.56287620C>A" "" "{PMID:Perez-Carro 2018:29912909}" "" "c.124G>T, p.(Gly42*) (NM_001142763.1)" "" "Germline" "" "" "0" "" "" "g.54527860C>A" "" "likely pathogenic" "" "0000797556" "0" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "CACNA1F c.244C>T, p.(Arg82*), pCDH15 c.(3983+1_3984-1) _(4367+1_4368-1)del" "" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG" "0000798039" "0" "70" "10" "55581640" "55581641" "del" "0" "00000" "PCDH15_000420" "g.55581640_55581641del" "" "{PMID:Jespersgaar 2019:30718709}" "" "PCDH15 c.5847_5848del, p.(His1949Glnfs*14)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.53821880_53821881del" "" "likely pathogenic" "ACMG" "0000798040" "0" "70" "10" "56106125" "56106125" "subst" "2.0336E-5" "00000" "PCDH15_000421" "g.56106125C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "PCDH15 c.594G>A, p.(Pro198Pro)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.54346365C>T" "" "likely pathogenic" "ACMG" "0000804450" "0" "30" "10" "55566501" "55566501" "subst" "0" "01943" "PCDH15_000422" "g.55566501T>G" "" "" "" "PCDH15(NM_001354429.1):c.4995A>C (p.P1665=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804451" "0" "30" "10" "55568989" "55568989" "subst" "7.32487E-5" "02330" "PCDH15_000423" "g.55568989A>G" "" "" "" "PCDH15(NM_001142769.3):c.4836T>C (p.T1612=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804452" "0" "50" "10" "55581760" "55581760" "subst" "0.000138168" "01943" "PCDH15_000204" "g.55581760C>T" "" "" "" "PCDH15(NM_001142763.1):c.5747G>A (p.R1916H), PCDH15(NM_001142763.2):c.5747G>A (p.R1916H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804453" "0" "50" "10" "55581868" "55581868" "subst" "2.03095E-5" "01943" "PCDH15_000424" "g.55581868G>C" "" "" "" "PCDH15(NM_001142763.1):c.5639C>G (p.T1880R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804454" "0" "30" "10" "55581929" "55581929" "subst" "0.00067841" "01943" "PCDH15_000055" "g.55581929T>G" "" "" "" "PCDH15(NM_001142763.1):c.5578A>C (p.M1860L), PCDH15(NM_001142763.2):c.5578A>C (p.M1860L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804455" "0" "30" "10" "55582205" "55582213" "del" "0" "01943" "PCDH15_000322" "g.55582205_55582213del" "" "" "" "PCDH15(NM_001142763.1):c.5299_5307delCCTGCTCCT (p.P1767_P1769del), PCDH15(NM_001142763.2):c.5299_5307delCCTGCTCCT (p.P1767_P1769del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804456" "0" "30" "10" "55591197" "55591197" "subst" "0.000207105" "01943" "PCDH15_000425" "g.55591197C>T" "" "" "" "PCDH15(NM_001354429.1):c.4080G>A (p.V1360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804457" "0" "50" "10" "55719513" "55719513" "subst" "0" "01943" "PCDH15_000426" "g.55719513C>T" "" "" "" "PCDH15(NM_001354429.1):c.3101G>A (p.R1034H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804458" "0" "30" "10" "55755523" "55755523" "subst" "0" "02330" "PCDH15_000427" "g.55755523A>G" "" "" "" "PCDH15(NM_001354429.2):c.2754T>C (p.D918=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804459" "0" "30" "10" "55943305" "55943305" "subst" "0" "01943" "PCDH15_000428" "g.55943305T>C" "" "" "" "PCDH15(NM_001354429.1):c.1489A>G (p.I497V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000813849" "3" "70" "10" "55849814" "55849814" "subst" "0" "00000" "PCDH15_000023" "g.55849814G>A" "" "{PMID:Jiman 2020:31836858}" "" "PCDH15;NM_001142771.1;c.[1942C>T];[1942C>T];p.[(Arg648*)];[(Arg648*)]" "different transcript: NM_001142771.1(PCDH15):c.1942C>T, p.(Arg648*); homozygous" "Unknown" "?" "" "0" "" "" "g.54090054G>A" "" "likely pathogenic" "" "0000816215" "0" "70" "10" "55912609" "55913303" "del" "0" "00000" "PCDH15_000429" "g.55912609_55913303del" "" "{PMID:Zampaglione 2020:32037395}" "" "PCDH15 chr10:55912609_55913303del" "range 89-10633 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.54152849_54153543del" "" "likely pathogenic" "" "0000816796" "3" "70" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Jauregui 2020:32098976}" "" "PCDH15 c.733C>T, p.R245X" "homozygous" "Unknown" "?" "" "0" "" "" "g.54317414G>A" "" "likely pathogenic" "" "0000818934" "0" "70" "10" "55826516" "56424023" "del" "0" "00000" "PCDH15_000430" "g.(55782958_55826516)_(56424023_?)del" "" "{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}" "" "del ex2_18" "" "Germline" "" "" "0" "" "" "g.(54023198_54066756)_(54664263_?)del" "" "likely pathogenic" "" "0000818935" "0" "70" "10" "55780079" "55780079" "subst" "3.65827E-5" "00000" "PCDH15_000385" "g.55780079G>A" "" "{PMID:Ellingsford 2018:29074561}" "" "NM_001142763.1:c.2639C>T p.(Ser880Leu)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000819322" "1" "70" "10" "55721550" "55721550" "subst" "2.03494E-5" "00000" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1: c.2971C>T/p.R991*, variant 2 :Deletion exon 3-32" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.53961790G>A" "" "likely pathogenic" "" "0000819374" "1" "70" "10" "55616950" "55616953" "del" "0" "00000" "PCDH15_000162" "g.55616950_55616953del" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1: c.3791_3794del/p.I1264fs*, variant 2 :Deletion exon 2" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.53857190_53857193del" "" "likely pathogenic" "" "0000819383" "1" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1 :Duplication exon 3-32, variant 2 :Duplication exon 3-32" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000819460" "1" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1 :Deletion exon 4, variant 2 :Deletion exon 4" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000819461" "1" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1 :Deletion exon 4, variant 2 :Deletion exon 4" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820613" "1" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1: c.2971C>T/p.R991*, variant 2 :Deletion exon 3-32" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820627" "1" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "PCDH15, variant 1: c.3791_3794del/p.I1264fs*, variant 2 :Deletion exon 2" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000821467" "0" "70" "10" "55829578" "56723036" "del" "0" "00000" "CYP2C9_001038" "g.55829578_56723036del" "" "{PMID:Turro 2020:32581362}" "" "chr10:g.55829578_56723036del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" "" "0000821648" "3" "70" "10" "56104359" "56108448" "del" "0" "00000" "CYP2C9_001038" "g.56104359_56108448del" "" "{PMID:Turro 2020:32581362}" "" "chr10:g.56104359_56108448del" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" "" "0000822956" "3" "70" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Méjécase 2020:32783370}" "" "PCDH15 Deletion of the first three coding exons" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000823168" "21" "70" "10" "55782816" "55782818" "del" "0" "00000" "PCDH15_000183" "g.55782816_55782818del" "" "{PMID:Zheng 2020:32835555}" "" "PCDH15 c.2367_2369delTGT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.54023056_54023058del" "" "likely pathogenic" "" "0000825883" "0" "70" "10" "55581762" "55581765" "del" "2.84451E-5" "00000" "PCDH15_000431" "g.55581762_55581765del" "" "{PMID:Liu-2020:33090715}" "" "c.5721_5724delTCTA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" "" "0000825885" "0" "70" "10" "55581769" "55581769" "dup" "4.06382E-6" "00000" "PCDH15_000432" "g.55581769dup" "" "{PMID:Liu-2020:33090715}" "" "c.5717dupA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" "" "0000825978" "0" "70" "10" "56077066" "56077066" "subst" "1.62573E-5" "00000" "PCDH15_000433" "g.56077066T>C" "" "{PMID:Liu-2020:33090715}" "" "c.841A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825979" "0" "70" "10" "56287583" "56287583" "subst" "8.97871E-5" "00000" "PCDH15_000436" "g.56287583T>C" "" "{PMID:Liu-2020:33090715}" "" "c.146A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826010" "0" "70" "10" "55582674" "55582674" "subst" "0.00203979" "00000" "PCDH15_000270" "g.55582674C>A" "" "{PMID:Liu-2020:33090715}" "" "c.4812G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826011" "0" "70" "10" "55617017" "55617017" "subst" "0.000366026" "00000" "PCDH15_000172" "g.55617017C>T" "" "{PMID:Liu-2020:33090715}" "" "c.3724G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826450" "0" "50" "10" "56077174" "56077174" "subst" "0.000207462" "00000" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Khalaileh-2018:29490346}" "" "c.733C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000826492" "3" "30" "10" "55721636" "55721636" "subst" "0.00271354" "00000" "PCDH15_000343" "g.55721636C>A" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.2885G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000827479" "0" "90" "10" "56106163" "56106163" "subst" "0" "00000" "PCDH15_000434" "g.56106163G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.556C>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000827480" "0" "70" "10" "56138552" "56138552" "subst" "0" "00000" "PCDH15_000435" "g.56138552A>C" "" "{PMID:Colombo-2020:33576794}" "" "c.308T>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000827481" "3" "70" "10" "56128953" "56128953" "subst" "8.14458E-6" "00000" "PCDH15_000045" "g.56128953C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.401G>A" "" "Germline" "" "rs767966376" "0" "" "" "" "" "likely pathogenic" "" "0000827482" "3" "50" "10" "55582194" "55582199" "del" "0" "00000" "PCDH15_000216" "g.55582194_55582199del" "" "{PMID:Colombo-2020:33576794}" "" "c.5287_5292del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000828797" "1" "50" "10" "55721637" "55721637" "subst" "0.000874866" "00000" "PCDH15_000170" "g.55721637G>A" "" "{PMID:Chen 2021:43360855}" "" "PCDH15 c.[2899C>T];[2899C>T], V1: c.2899C>T, (p.Arg967Cys)" "different transcript: ENST00000264448.6(ALMS1):c.10825_10826del, (p.Arg3609AlafsTer6); homozygous" "Unknown" "?" "" "0" "" "" "g.53961877G>A" "" "VUS" "ACMG" "0000828900" "0" "70" "10" "55582898" "55582899" "ins" "0" "00000" "PCDH15_000437" "g.55582898_55582899insCTCT" "" "{PMID:Chen 2021:43360855}" "" "PCDH15 c.[4588_4589insGAGA];[?], V1: c.4588_4589insGAGA, (p.Asn1530ArgfsTer8)" "single heterozygous variant in a recessive disease: a variant on the other allele is expected but not yet identified" "Unknown" "?" "" "0" "" "" "g.53823138_53823139insCTCT" "" "likely pathogenic" "ACMG" "0000829002" "2" "50" "10" "55582205" "55582210" "del" "0" "00000" "PCDH15_000216" "g.55582205_55582210del" "" "{PMID:Chen 2021:43360855}" "" "PCDH15 c.[2899C>T];[2899C>T], V2: c.5308_5313delGCTCCT, (p.Ala1770_Pro1771del)" "different transcript: ENST00000264448.6(ALMS1):c.10825_10826del, (p.Arg3609AlafsTer6), error in genomic HGVS annotation; heterozygous" "Unknown" "?" "" "0" "" "" "g.53822445_53822450del" "" "VUS" "ACMG" "0000829478" "0" "70" "10" "55582750" "55582753" "del" "8.12618E-6" "00000" "PCDH15_000438" "g.55582750_55582753del" "" "{PMID:Wafa-2021:33089500}" "" "c.4733_4736delTCAG;p.V1578AfsX6" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829479" "0" "70" "10" "55912906" "55912907" "ins" "0" "00000" "PCDH15_000403" "g.55912906_55912907insT" "" "{PMID:Wafa-2021:33089500}" "" "c.1737_1738insA,p.A580SfsX9" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829507" "0" "50" "10" "56288165" "56288165" "subst" "0" "00000" "PCDH15_000440" "g.56288165G>A" "" "{PMID:Wafa-2021:33089500}" "" "c.92-528C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000829508" "0" "70" "10" "55955444" "55955444" "subst" "0.238381" "00000" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Wafa-2021:33089500}" "" "c.1304A>C,p.D435A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829537" "3" "70" "10" "0" "0" "del" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wafa-2021:33089500}" "" "p.R245*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829538" "0" "70" "10" "0" "0" "del" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wafa-2021:33089500}" "" "p.R245*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829539" "0" "70" "10" "0" "0" "del" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wafa-2021:33089500}" "" "p.R929*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829540" "0" "70" "10" "0" "0" "del" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wafa-2021:33089500}" "" "p.R245*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829541" "0" "70" "10" "0" "0" "del" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Wafa-2021:33089500}" "" "p.R929*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000829706" "1" "90" "10" "55721550" "55721550" "subst" "2.03494E-5" "00006" "PCDH15_000037" "g.55721550G>A" "" "{PMID:Ellingford 2016:26872967}" "" "" "" "Germline" "" "" "0" "" "" "g.53961790G>A" "" "pathogenic" "" "0000829727" "2" "70" "10" "56094632" "56749853" "del" "0" "00006" "PCDH15_000439" "g.56094632_56749853del" "" "{PMID:Ellingford 2016:26872967}" "" "c.-189197_c.610-5166del" "" "Germline" "" "" "0" "" "" "g.54334872_54990093del" "" "likely pathogenic" "" "0000847531" "3" "70" "10" "55955444" "55955444" "subst" "0.238381" "00000" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Saleha 2016:27275418}" "" "PCDH15 c.1304A>C p.435D>A" "homozygous" "Germline" "yes" "" "0" "" "" "g.54195684T>G" "" "likely pathogenic" "" "0000847532" "3" "70" "10" "55955444" "55955444" "subst" "0.238381" "00000" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Saleha 2016:27275418}" "" "PCDH15 c.1304A>C p.435D>A" "homozygous" "Germline" "yes" "" "0" "" "" "g.54195684T>G" "" "likely pathogenic" "" "0000847533" "3" "70" "10" "55955444" "55955444" "subst" "0.238381" "00000" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Saleha 2016:27275418}" "" "PCDH15 c.1304A>C p.435D>A" "homozygous" "Germline" "yes" "" "0" "" "" "g.54195684T>G" "" "likely pathogenic" "" "0000847534" "3" "70" "10" "55955444" "55955444" "subst" "0.238381" "00000" "PCDH15_000073" "g.55955444T>G" "" "{PMID:Saleha 2016:27275418}" "" "PCDH15 c.1304A>C p.435D>A" "homozygous" "Germline" "yes" "" "0" "" "" "g.54195684T>G" "" "likely pathogenic" "" "0000852498" "0" "50" "10" "55569258" "55569258" "subst" "8.1656E-6" "01943" "PCDH15_000442" "g.55569258T>C" "" "" "" "PCDH15(NM_001142769.2):c.4567A>G (p.S1523G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852499" "0" "30" "10" "55582758" "55582758" "subst" "0" "01943" "PCDH15_000444" "g.55582758C>T" "" "" "" "PCDH15(NM_001142763.1):c.4749G>A (p.Q1583=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852500" "0" "50" "10" "55582805" "55582808" "dup" "0" "01943" "PCDH15_000445" "g.55582805_55582808dup" "" "" "" "PCDH15(NM_001142763.1):c.4702_4705dupAAGT (p.S1569*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852501" "0" "30" "10" "55591068" "55591068" "subst" "0" "01943" "PCDH15_000446" "g.55591068T>A" "" "" "" "PCDH15(NM_001354429.1):c.4202+7A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852502" "0" "30" "10" "55600100" "55600100" "subst" "8.12236E-6" "01943" "PCDH15_000447" "g.55600100G>A" "" "" "" "PCDH15(NM_001354429.1):c.3963C>T (p.I1321=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852503" "0" "50" "10" "55721603" "55721603" "subst" "0" "01943" "PCDH15_000448" "g.55721603G>T" "" "" "" "PCDH15(NM_001354429.1):c.2918C>A (p.P973H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852504" "0" "30" "10" "55721636" "55721636" "subst" "0.00271354" "02327" "PCDH15_000343" "g.55721636C>A" "" "" "" "PCDH15(NM_001142771.1):c.2900G>T (p.R967L), PCDH15(NM_001142771.2):c.2900G>T (p.R967L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852505" "0" "50" "10" "55780140" "55780140" "subst" "0.000406402" "02327" "PCDH15_000346" "g.55780140G>A" "" "" "" "PCDH15(NM_001142771.1):c.2578C>T (p.R860W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852506" "0" "30" "10" "55782743" "55782743" "subst" "0.000686724" "02330" "PCDH15_000230" "g.55782743A>G" "" "" "" "PCDH15(NM_001142771.1):c.2450T>C (p.I817T), PCDH15(NM_001354429.2):c.2435T>C (p.I812T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852507" "0" "30" "10" "55826535" "55826535" "subst" "2.44119E-5" "01943" "PCDH15_000449" "g.55826535G>A" "" "" "" "PCDH15(NM_001354429.1):c.2202C>T (p.A734=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852508" "0" "50" "10" "55945028" "55945028" "subst" "1.62681E-5" "01943" "PCDH15_000450" "g.55945028T>C" "" "" "" "PCDH15(NM_001354429.1):c.1306A>G (p.T436A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852509" "0" "90" "10" "56424016" "56424016" "subst" "2.0555E-5" "01943" "PCDH15_000053" "g.56424016G>A" "" "" "" "PCDH15(NM_001354429.1):c.7C>T (p.R3*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000861922" "0" "30" "10" "55568572" "55568572" "subst" "0" "01943" "PCDH15_000441" "g.55568572A>G" "" "" "" "PCDH15(NM_001142769.2):c.5253T>C (p.S1751=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861924" "0" "30" "10" "55581951" "55581951" "subst" "0" "01943" "PCDH15_000443" "g.55581951A>G" "" "" "" "PCDH15(NM_001142763.1):c.5556T>C (p.G1852=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861925" "0" "50" "10" "56138547" "56138547" "subst" "0" "01943" "PCDH15_000451" "g.56138547T>C" "" "" "" "PCDH15(NM_001354429.1):c.313A>G (p.R105G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861926" "0" "30" "10" "56423960" "56423960" "subst" "0" "01943" "PCDH15_000452" "g.56423960A>G" "" "" "" "PCDH15(NM_001354429.1):c.63T>C (p.F21=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000872663" "21" "70" "10" "56128876" "56129036" "del" "0" "01741" "PCDH15_000453" "g.(?_56128876)_(56129036_?)del" "" "" "" "56129036_56128876del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000889158" "0" "30" "10" "55566702" "55566702" "subst" "0.00262362" "02330" "PCDH15_000308" "g.55566702C>T" "" "" "" "PCDH15(NM_001142771.1):c.4686G>A (p.T1562=), PCDH15(NM_001354429.2):c.4794G>A (p.T1598=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889159" "0" "50" "10" "55568546" "55568546" "dup" "0" "02327" "PCDH15_000454" "g.55568546dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000889160" "0" "30" "10" "55582674" "55582674" "subst" "0.00203979" "02330" "PCDH15_000270" "g.55582674C>A" "" "" "" "PCDH15(NM_001142763.1):c.4833G>T (p.R1611S), PCDH15(NM_033056.4):c.4812G>T (p.R1604S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889161" "0" "30" "10" "55698624" "55698624" "subst" "1.22E-5" "02330" "PCDH15_000339" "g.55698624T>C" "" "" "" "PCDH15(NM_001142771.1):c.3339A>G (p.Q1113=), PCDH15(NM_001354429.2):c.3324A>G (p.Q1108=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889162" "0" "30" "10" "55780165" "55780165" "subst" "4.06656E-5" "02330" "PCDH15_000456" "g.55780165G>A" "" "" "" "PCDH15(NM_001354429.2):c.2538C>T (p.V846=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889163" "0" "30" "10" "55996665" "55996665" "subst" "0.000142175" "02330" "PCDH15_000072" "g.55996665C>T" "" "" "" "PCDH15(NM_001354429.2):c.903G>A (p.T301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896506" "1" "50" "10" "55721637" "55721637" "subst" "0.000874866" "00000" "PCDH15_000170" "g.55721637G>A" "Taiwan Biobank: 0.01751; GnomAD_exome_East: 0.0118; GnomAD_All: 0.000921" "{PMID:Chen 2021:33608557}" "" "PCDH15 c.[2899C>T];[2899C>T]; p.(Arg962Cys)" "different transcript NM_001142763.1:c.2899C>T, NM_001142763.1(PCDH15):c.2899C>T; heterozygous" "Germline" "yes" "" "0" "" "" "g.53961877G>A" "" "VUS" "" "0000896507" "2" "50" "10" "55582205" "55582210" "del" "0" "00000" "PCDH15_000216" "g.55582205_55582210del" "Taiwan Biobank: 0.008165; GnomAD_exome_East: 0.00503; GnomAD_All: 0.00103" "{PMID:Chen 2021:33608557}" "" "PCDH15 c.[2899C>T];[2899C>T]; p.(Ala1763_Pro1764del)" "different transcript NM_001142763.1:c.5308_5313del, p.(Ala1770_Pro1771del); heterozygous" "Germline" "yes" "" "0" "" "" "g.53822445_53822450del" "" "VUS" "" "0000896633" "0" "70" "10" "55582919" "55582920" "ins" "0" "00000" "PCDH15_000455" "g.55582919_55582920insCTCT" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "PCDH15 c.[4588_4589insGAGA];[?]; p.(Asn1530ArgfsTer8)" "different transcript, error in annotation, should be c.4589_4590insAGAG, p.(Ser1530Argfs*5); heterozygous; single variant in a recessive gene, no second allele found" "Germline" "yes" "" "0" "" "" "g.53823159_53823160insCTCT" "" "likely pathogenic" "" "0000913284" "0" "70" "10" "55569099" "55569099" "subst" "0" "02329" "PCDH15_000298" "g.55569099G>A" "" "" "" "PCDH15(NM_001142769.3):c.4726C>T (p.Q1576*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000913285" "0" "30" "10" "55782799" "55782799" "subst" "2.845E-5" "02330" "PCDH15_000457" "g.55782799A>G" "" "" "" "PCDH15(NM_001354429.2):c.2379T>C (p.D793=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000917865" "0" "50" "10" "55971342" "55971342" "subst" "0" "00006" "PCDH15_000458" "g.55971342C>T" "" "{PMID:Velde 2022:35226187}, {DOI:Velde 2022: 10.1007/s00439-022-02441-0}" "" "NM_001142764.2:c.1098+2354G>A" "" "Germline" "" "" "0" "" "" "g.54211582C>T" "" "VUS" "" "0000925162" "0" "50" "10" "55996619" "55996619" "subst" "0.000182801" "02327" "PCDH15_000459" "g.55996619A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929683" "0" "70" "10" "55587280" "55587280" "subst" "0" "02327" "PCDH15_000460" "g.55587280G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000944158" "3" "90" "10" "55892634" "55943203" "del" "0" "00006" "PCDH15_000461" "g.(55913054_55943203)_(55849824_55892634)del" "" "{PMID:Richard 2019: 30303587}" "" "del ex14-15" "" "Germline" "" "" "0" "" "" "g.(54153294_54183443)_(54090064_54132874)del" "" "pathogenic (recessive)" "ACMG" "0000944159" "3" "90" "10" "56128954" "56128954" "subst" "0" "00006" "PCDH15_000058" "g.56128954G>C" "" "{PMID:Richard 2019: 30303587}" "" "" "" "Germline" "" "" "0" "" "" "g.54369194G>C" "" "pathogenic (recessive)" "" "0000944160" "3" "70" "10" "56077119" "56077119" "subst" "0" "00006" "PCDH15_000463" "g.56077119G>T" "" "{PMID:Richard 2019: 30303587}" "" "" "" "Germline" "" "" "0" "" "" "g.54317359G>T" "" "likely pathogenic (recessive)" "ACMG" "0000944161" "3" "90" "10" "55912907" "55912907" "subst" "0" "00006" "PCDH15_000462" "g.55912907G>T" "" "{PMID:Richard 2019: 30303587}" "" "" "" "Germline" "" "" "0" "" "" "g.54153147G>T" "" "pathogenic (recessive)" "" "0000946832" "21" "70" "10" "55973787" "55973787" "subst" "4.06375E-5" "00006" "PCDH15_000407" "g.55973787C>T" "" "{PMID:Redfield 2023:37873491}, {DOI:Redfield 2023:10.1101/2023.10.08.23296081}" "" "" "" "Germline" "no" "" "0" "" "" "g.54214027C>T" "" "VUS" "" "0000946833" "21" "70" "10" "55721615" "55721615" "subst" "0" "00006" "PCDH15_000464" "g.55721615T>A" "" "{PMID:Redfield 2023:37873491}, {DOI:Redfield 2023:10.1101/2023.10.08.23296081}" "" "NM_001142769.3:c.2906A>T (Asp969Val)" "variant description reported can not be correct" "Germline" "no" "" "0" "" "" "g.53961855T>A" "" "VUS" "" "0000949405" "0" "50" "10" "55582765" "55582765" "subst" "0" "02327" "PCDH15_000465" "g.55582765C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000958422" "0" "90" "10" "56128988" "56128988" "del" "0" "00006" "PCDH15_000471" "g.56128988del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.54369228del" "" "pathogenic (recessive)" "ACMG" "0000958452" "0" "70" "10" "55566571" "55566571" "dup" "0" "00006" "PCDH15_000466" "g.55566571dup" "" "{PMID:Weisschuh 2024:37734845}" "" "NM_001142772.2:c.4802dup" "ACMG PM2, PVS1_STRONG" "Germline" "" "" "0" "" "" "g.53806811dup" "" "likely pathogenic (recessive)" "ACMG" "0000958745" "0" "90" "10" "55591150" "55591150" "dup" "0" "00006" "PCDH15_000187" "g.55591150dup" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.53831390dup" "1073474" "pathogenic (recessive)" "ACMG" "0000958749" "0" "90" "10" "55849743" "55849743" "subst" "8.15774E-6" "00006" "PCDH15_000469" "g.55849743C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.54089983C>T" "" "pathogenic (recessive)" "ACMG" "0000958750" "3" "90" "10" "55826546" "55826546" "subst" "0" "00006" "PCDH15_000367" "g.55826546C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.54066786C>A" "" "pathogenic (recessive)" "ACMG" "0000958755" "3" "90" "10" "56077174" "56077174" "subst" "0.000207462" "00006" "PCDH15_000039" "g.56077174G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.54317414G>A" "4933" "pathogenic (recessive)" "ACMG" "0000959199" "0" "70" "10" "55973806" "55978964" "del" "0" "00006" "PCDH15_000470" "g.55973806_55978964del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.54214046_54219204del" "" "likely pathogenic (recessive)" "ACMG" "0000959201" "0" "90" "10" "55600079" "55600079" "subst" "1.21839E-5" "00006" "PCDH15_000468" "g.55600079C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.53840319C>A" "370764" "pathogenic (recessive)" "ACMG" "0000959236" "0" "50" "10" "55780122" "55780122" "subst" "0.000674572" "00006" "PCDH15_000345" "g.55780122C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, BP4" "Germline" "" "" "0" "" "" "g.54020362C>T" "" "VUS" "ACMG" "0000959237" "0" "50" "10" "55582034" "55582034" "subst" "0" "00006" "PCDH15_000467" "g.55582034G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, BP4" "Germline" "" "" "0" "" "" "g.53822274G>T" "" "VUS" "ACMG" "0000959275" "0" "90" "10" "55582797" "55582842" "dup" "0" "00006" "PCDH15_000387" "g.55582797_55582842dup" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.53823037_53823082dup" "" "pathogenic (recessive)" "ACMG" "0000959375" "0" "70" "10" "55582760" "55582763" "del" "0" "00006" "PCDH15_000438" "g.55582760_55582763del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG" "Germline" "" "" "0" "" "" "g.53823000_53823003del" "" "likely pathogenic (recessive)" "ACMG" "0000965748" "0" "50" "10" "55582111" "55582116" "del" "2.02573E-5" "02327" "PCDH15_000472" "g.55582111_55582116del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000965749" "0" "50" "10" "55587195" "55587195" "subst" "4.11472E-6" "02327" "PCDH15_000473" "g.55587195G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000965750" "0" "30" "10" "55587209" "55587214" "dup" "0" "02330" "PCDH15_000474" "g.55587209_55587214dup" "" "" "" "PCDH15(NM_001384140.1):c.4317_4322dupGCCGCC (p.P1442_P1443dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965752" "0" "70" "10" "55702463" "55702463" "subst" "0" "02327" "PCDH15_000475" "g.55702463T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000965753" "0" "90" "10" "55719491" "55719491" "subst" "0" "02327" "PCDH15_000476" "g.55719491C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000965757" "0" "50" "10" "56287598" "56287598" "subst" "5.28971E-5" "02327" "PCDH15_000477" "g.56287598A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979069" "0" "30" "10" "55570347" "55570347" "subst" "0.00773693" "01804" "PCDH15_000380" "g.55570347C>T" "" "" "" "PCDH15(NM_001384140.1):c.4640G>A (p.(Gly1547Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979070" "0" "30" "10" "55779943" "55779943" "subst" "0.000261314" "01804" "PCDH15_000344" "g.55779943A>G" "" "" "" "PCDH15(NM_001142771.1):c.2766+9T>C, PCDH15(NM_001142771.2):c.2766+9T>C, PCDH15(NM_001384140.1):c.2751+9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000985484" "21" "70" "10" "55826588" "55826588" "del" "0" "02230" "PCDH15_000478" "g.55826588del" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.54066828del" "" "likely pathogenic (recessive)" "" "0000985495" "11" "70" "10" "55613485" "55792654" "del" "0" "02230" "PCDH15_000479" "g.55613485_55792654del" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.53853725_54032894del" "" "likely pathogenic (recessive)" "" "0001014627" "0" "30" "10" "55568589" "55568589" "subst" "0.000575206" "02330" "PCDH15_000294" "g.55568589C>T" "" "" "" "PCDH15(NM_001142769.2):c.5236G>A (p.G1746S), PCDH15(NM_001142769.3):c.5236G>A (p.G1746S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037921" "0" "70" "10" "55591150" "55591150" "subst" "1.21827E-5" "02327" "PCDH15_000201" "g.55591150G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001037922" "0" "50" "10" "55849744" "55849744" "subst" "6.11785E-5" "01804" "PCDH15_000480" "g.55849744G>A" "" "" "" "PCDH15(NM_001384140.1):c.1997C>T (p.(Thr666Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044616" "11" "90" "10" "55626397" "55626397" "subst" "4.07232E-6" "04847" "PCDH15_000259" "g.55626397C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.53866637C>T" "" "pathogenic (paternal)" "ACMG" "0001045523" "0" "70" "10" "55755430" "55755434" "dup" "0" "04656" "PCDH15_000481" "g.55755430_55755434dup" "" "" "" "g.55755429C>CATAAA" "" "Germline" "yes" "" "0" "" "" "g.53995670_53995674dup" "" "pathogenic (recessive)" "ACMG" "0001065227" "0" "50" "10" "55944995" "55944995" "subst" "0.000203214" "02327" "PCDH15_000482" "g.55944995C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PCDH15 ## Count = 1987 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000089977" "00025927" "50" "2726" "0" "2726" "0" "c.2726T>A" "r.(?)" "p.(Ile909Asn)" "" "0000089977" "00015744" "50" "2726" "0" "2726" "0" "c.2726T>A" "r.(?)" "p.(Ile909Asn)" "" "0000089978" "00025927" "50" "1830" "0" "1833" "0" "c.1830_1833del" "r.(?)" "p.(Asn610LysfsTer9)" "" "0000089978" "00015744" "50" "1830" "0" "1833" "0" "c.1830_1833del" "r.(?)" "p.(Asn610Lysfs*9)" "" "0000091209" "00025927" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000091209" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000128993" "00025927" "70" "3374" "-2" "3374" "-2" "c.3374-2A>G" "r.spl" "p.?" "" "0000128993" "00015744" "70" "3374" "-2" "3374" "-2" "c.3374-2A>G" "r.spl" "p.?" "25i" "0000128994" "00025927" "70" "4127" "0" "4127" "0" "c.4127C>A" "r.(?)" "p.(Ala1376Asp)" "" "0000128994" "00015744" "70" "4127" "0" "4127" "0" "c.4127C>A" "r.(?)" "p.(Ala1376Asp)" "30" "0000130232" "00025927" "70" "705" "2" "705" "2" "c.705+2T>C" "r.spl?" "p.?" "" "0000130232" "00015744" "70" "705" "2" "705" "2" "c.705+2T>C" "r.spl?" "p.?" "" "0000246875" "00015744" "10" "4884" "0" "4884" "0" "c.4884T>C" "r.(?)" "p.(Thr1628=)" "" "0000246893" "00015744" "50" "3857" "0" "3857" "0" "c.3857T>A" "r.(?)" "p.(Val1286Glu)" "" "0000246925" "00015744" "10" "3010" "-18" "3010" "-18" "c.3010-18T>C" "r.(=)" "p.(=)" "" "0000248897" "00015744" "10" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000253356" "00015744" "10" "4884" "0" "4884" "0" "c.4884T>C" "r.(?)" "p.(Thr1628=)" "" "0000254576" "00015744" "30" "2435" "0" "2435" "0" "c.2435T>C" "r.(?)" "p.(Ile812Thr)" "" "0000254663" "00015744" "30" "5432" "0" "5432" "0" "c.5432T>C" "r.(?)" "p.(Leu1811Pro)" "" "0000254980" "00015744" "30" "5353" "0" "5353" "0" "c.5353T>C" "r.(?)" "p.(Ser1785Pro)" "" "0000255120" "00015744" "30" "4733" "0" "4733" "0" "c.4733T>C" "r.(?)" "p.(Val1578Ala)" "" "0000255692" "00015744" "90" "2868" "2" "2868" "2" "c.2868+2T>C" "r.spl?" "p.?" "" "0000255832" "00015744" "50" "3857" "0" "3857" "0" "c.3857T>A" "r.(?)" "p.(Val1286Glu)" "" "0000255868" "00015744" "50" "4560" "0" "4560" "0" "c.4560T>A" "r.(?)" "p.(Asp1520Glu)" "" "0000293442" "00015744" "10" "21163" "0" "21163" "0" "c.*15295A>C" "r.(=)" "p.(=)" "" "0000293443" "00015744" "10" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Leu347Phe)" "" "0000293444" "00015744" "10" "92" "-493" "92" "-493" "c.92-493A>T" "r.(=)" "p.(=)" "" "0000293445" "00015744" "10" "92" "-10" "92" "-10" "c.92-10C>T" "r.(=)" "p.(=)" "" "0000293446" "00015744" "10" "1590" "15" "1590" "15" "c.1590+15A>G" "r.(=)" "p.(=)" "" "0000293447" "00015744" "10" "1590" "17" "1590" "21" "c.1590+17_1590+21del" "r.(=)" "p.(=)" "" "0000293448" "00015744" "30" "1590" "20" "1590" "20" "c.1590+20A>C" "r.(=)" "p.(=)" "" "0000293449" "00015744" "10" "1702" "0" "1702" "0" "c.1702G>A" "r.(?)" "p.(Ala568Thr)" "" "0000293450" "00015744" "50" "1888" "0" "1888" "0" "c.1888A>G" "r.(?)" "p.(Arg630Gly)" "" "0000293451" "00015744" "10" "1929" "0" "1929" "0" "c.1929A>C" "r.(?)" "p.(Arg643=)" "" "0000293452" "00015744" "50" "2093" "0" "2093" "0" "c.2093C>T" "r.(?)" "p.(Thr698Ile)" "" "0000293453" "00015744" "30" "2370" "0" "2370" "0" "c.2370G>A" "r.(?)" "p.(Val790=)" "" "0000293454" "00015744" "10" "2625" "0" "2625" "0" "c.2625G>A" "r.(?)" "p.(Ser875=)" "" "0000293455" "00015744" "30" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000293456" "00015744" "10" "2885" "0" "2885" "0" "c.2885G>A" "r.(?)" "p.(Arg962His)" "" "0000293457" "00015744" "50" "2998" "0" "2998" "0" "c.2998A>G" "r.(?)" "p.(Thr1000Ala)" "" "0000293458" "00015744" "10" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(Val1006=)" "" "0000293459" "00015744" "50" "3076" "0" "3076" "0" "c.3076G>C" "r.(?)" "p.(Val1026Leu)" "" "0000293460" "00015744" "50" "3455" "0" "3455" "0" "c.3455G>A" "r.(?)" "p.(Gly1152Asp)" "" "0000293462" "00015744" "10" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "" "0000293463" "00015744" "10" "3717" "8" "3717" "8" "c.3717+8G>C" "r.(=)" "p.(=)" "" "0000293464" "00015744" "10" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "" "0000293465" "00015744" "10" "4275" "0" "4275" "0" "c.4275A>T" "r.(?)" "p.(Ala1425=)" "" "0000293467" "00015744" "50" "4465" "0" "4481" "0" "c.4465_4481del" "r.(?)" "p.(Thr1489ValfsTer9)" "" "0000293468" "00015744" "10" "18237" "0" "18237" "0" "c.*12369G>A" "r.(=)" "p.(=)" "" "0000293469" "00015744" "10" "18223" "0" "18223" "0" "c.*12355A>C" "r.(=)" "p.(=)" "" "0000293470" "00015744" "10" "20815" "0" "20815" "0" "c.*14947C>T" "r.(=)" "p.(=)" "" "0000293471" "00015744" "30" "4717" "0" "4717" "0" "c.4717C>G" "r.(?)" "p.(Leu1573Val)" "" "0000293473" "00015744" "10" "18608" "0" "18608" "0" "c.*12740A>C" "r.(=)" "p.(=)" "" "0000293474" "00015744" "10" "5068" "0" "5068" "0" "c.5068A>G" "r.(?)" "p.(Ile1690Val)" "" "0000293475" "00015744" "30" "5254" "0" "5256" "0" "c.5254_5256del" "r.(?)" "p.(Pro1752del)" "" "0000293476" "00015744" "10" "18956" "0" "18956" "0" "c.*13088A>G" "r.(=)" "p.(=)" "" "0000293477" "00015744" "30" "5275" "0" "5280" "0" "c.5275_5280del" "r.(?)" "p.(Pro1759_Pro1760del)" "" "0000293478" "00015744" "30" "5398" "0" "5398" "0" "c.5398G>A" "r.(?)" "p.(Val1800Ile)" "" "0000293479" "00015744" "10" "5414" "0" "5414" "0" "c.5414C>T" "r.(?)" "p.(Pro1805Leu)" "" "0000293480" "00015744" "10" "5557" "0" "5557" "0" "c.5557A>C" "r.(?)" "p.(Met1853Leu)" "" "0000293481" "00015744" "10" "5565" "0" "5565" "0" "c.5565C>T" "r.(?)" "p.(Ala1855=)" "" "0000293482" "00015744" "30" "5726" "0" "5726" "0" "c.5726G>A" "r.(?)" "p.(Arg1909His)" "" "0000296783" "00015744" "10" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "" "0000296784" "00015744" "10" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000296785" "00015744" "10" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "" "0000296786" "00015744" "10" "92" "-57666" "92" "-57666" "c.92-57666A>G" "r.(=)" "p.(=)" "" "0000305080" "00015744" "50" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Lys)" "" "0000305081" "00015744" "30" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Leu347Phe)" "" "0000305082" "00015744" "50" "1205" "0" "1205" "0" "c.1205G>C" "r.(?)" "p.(Gly402Ala)" "" "0000305083" "00015744" "30" "1362" "0" "1362" "0" "c.1362C>T" "r.(?)" "p.(Val454=)" "" "0000305084" "00015744" "30" "1434" "0" "1434" "0" "c.1434C>T" "r.(?)" "p.(Thr478=)" "" "0000305085" "00015744" "10" "1702" "0" "1702" "0" "c.1702G>A" "r.(?)" "p.(Ala568Thr)" "" "0000305086" "00015744" "30" "1935" "0" "1935" "0" "c.1935A>T" "r.(?)" "p.(Gly645=)" "" "0000305087" "00015744" "50" "2290" "0" "2290" "0" "c.2290C>T" "r.(?)" "p.(Arg764Cys)" "" "0000305088" "00015744" "50" "2354" "0" "2354" "0" "c.2354A>G" "r.(?)" "p.(Tyr785Cys)" "" "0000305089" "00015744" "30" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(Val81=)" "" "0000305090" "00015744" "30" "2625" "0" "2625" "0" "c.2625G>A" "r.(?)" "p.(Ser875=)" "" "0000305091" "00015744" "30" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000305092" "00015744" "30" "2885" "0" "2885" "0" "c.2885G>A" "r.(?)" "p.(Arg962His)" "" "0000305093" "00015744" "30" "290" "0" "290" "0" "c.290A>G" "r.(?)" "p.(Asn97Ser)" "" "0000305094" "00015744" "50" "3317" "0" "3317" "0" "c.3317G>C" "r.(?)" "p.(Arg1106Pro)" "" "0000305095" "00015744" "50" "3374" "-2" "3374" "-2" "c.3374-2A>G" "r.spl?" "p.?" "" "0000305096" "00015744" "50" "3448" "0" "3448" "0" "c.3448A>G" "r.(?)" "p.(Ile1150Val)" "" "0000305097" "00015744" "30" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "" "0000305098" "00015744" "30" "3717" "8" "3717" "8" "c.3717+8G>C" "r.(=)" "p.(=)" "" "0000305099" "00015744" "30" "4498" "0" "4498" "0" "c.4498G>A" "r.(?)" "p.(Gly1500Arg)" "" "0000305100" "00015744" "30" "18257" "0" "18257" "0" "c.*12389C>T" "r.(=)" "p.(=)" "" "0000305101" "00015744" "10" "18223" "0" "18223" "0" "c.*12355A>C" "r.(=)" "p.(=)" "" "0000305102" "00015744" "30" "20784" "0" "20784" "0" "c.*14916G>A" "r.(=)" "p.(=)" "" "0000305103" "00015744" "30" "4717" "0" "4717" "0" "c.4717C>G" "r.(?)" "p.(Leu1573Val)" "" "0000305104" "00015744" "10" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000305105" "00015744" "30" "475" "-3" "475" "-3" "c.475-3C>T" "r.spl?" "p.?" "" "0000305106" "00015744" "50" "4892" "0" "4892" "0" "c.4892C>A" "r.(?)" "p.(Ala1631Glu)" "" "0000305107" "00015744" "90" "4907" "0" "4908" "0" "c.4907_4908del" "r.(?)" "p.(Lys1636ArgfsTer7)" "" "0000305108" "00015744" "30" "18610" "0" "18610" "0" "c.*12742C>T" "r.(=)" "p.(=)" "" "0000305109" "00015744" "30" "18897" "0" "18897" "0" "c.*13029G>A" "r.(=)" "p.(=)" "" "0000305110" "00015744" "30" "5254" "0" "5256" "0" "c.5254_5256del" "r.(?)" "p.(Pro1752del)" "" "0000305111" "00015744" "30" "5263" "0" "5263" "0" "c.5263C>T" "r.(?)" "p.(Pro1755Ser)" "" "0000305112" "00015744" "30" "18959" "0" "18959" "0" "c.*13091G>A" "r.(=)" "p.(=)" "" "0000305113" "00015744" "50" "5287" "0" "5292" "0" "c.5287_5292del" "r.(?)" "p.(Ala1763_Pro1764del)" "" "0000305115" "00015744" "10" "5359" "0" "5359" "0" "c.5359C>T" "r.(?)" "p.(Pro1787Ser)" "" "0000305116" "00015744" "30" "5397" "0" "5397" "0" "c.5397C>T" "r.(?)" "p.(Ser1799=)" "" "0000305117" "00015744" "30" "5398" "0" "5398" "0" "c.5398G>A" "r.(?)" "p.(Val1800Ile)" "" "0000305118" "00015744" "30" "5565" "0" "5565" "0" "c.5565C>T" "r.(?)" "p.(Ala1855=)" "" "0000305119" "00015744" "50" "5591" "0" "5591" "0" "c.5591A>G" "r.(?)" "p.(Gln1864Arg)" "" "0000305120" "00015744" "50" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Pro198Leu)" "" "0000305121" "00015744" "30" "876" "9" "876" "9" "c.876+9A>C" "r.(=)" "p.(=)" "" "0000321537" "00015744" "50" "5296" "0" "5304" "0" "c.5296_5304dup" "r.(?)" "p.(Ala1766_Pro1768dup)" "" "0000321538" "00015744" "50" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "" "0000338393" "00015744" "10" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "" "0000338394" "00015744" "50" "3717" "5" "3717" "5" "c.3717+5G>A" "r.spl?" "p.?" "" "0000338397" "00015744" "90" "2868" "2" "2868" "2" "c.2868+2T>C" "r.spl?" "p.?" "" "0000338398" "00015744" "10" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "" "0000338399" "00015744" "10" "157" "3" "157" "3" "c.157+3A>G" "r.spl?" "p.?" "" "0000341417" "00015744" "50" "1135" "0" "1135" "0" "c.1135G>T" "r.(?)" "p.(Ala379Ser)" "" "0000341966" "00015744" "50" "18221" "0" "18224" "0" "c.*12353_*12356del" "r.(=)" "p.(=)" "" "0000342395" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000343491" "00015744" "10" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000344544" "00015744" "30" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "" "0000344581" "00015744" "70" "18387" "0" "18387" "0" "c.*12519C>T" "r.(=)" "p.(=)" "" "0000345661" "00015744" "50" "3521" "0" "3521" "0" "c.3521G>A" "r.(?)" "p.(Gly1174Asp)" "" "0000345702" "00015744" "50" "4036" "0" "4036" "0" "c.4036G>A" "r.(?)" "p.(Gly1346Arg)" "" "0000346744" "00015744" "50" "128" "0" "128" "0" "c.128T>C" "r.(?)" "p.(Ile43Thr)" "" "0000348246" "00015744" "10" "5359" "0" "5359" "0" "c.5359C>T" "r.(?)" "p.(Pro1787Ser)" "" "0000348357" "00015744" "50" "875" "0" "875" "0" "c.875C>T" "r.(?)" "p.(Pro292Leu)" "" "0000350222" "00015744" "90" "2922" "0" "2922" "0" "c.2922C>A" "r.(?)" "p.(Tyr974Ter)" "" "0000351284" "00015744" "90" "3374" "-2" "3374" "-2" "c.3374-2A>G" "r.spl?" "p.?" "" "0000358303" "00025927" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000358303" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374256" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374256" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374257" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374257" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374258" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374258" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374259" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374259" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374260" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374260" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374261" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374261" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374262" "00025927" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(?)" "p.(=)" "" "0000374262" "00015744" "11" "92" "-52" "92" "-52" "c.92-52T>G" "r.(=)" "p.(=)" "2i" "0000374266" "00025927" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(?)" "p.(=)" "" "0000374266" "00015744" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(=)" "p.(=)" "4i" "0000374267" "00025927" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(?)" "p.(=)" "" "0000374267" "00015744" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(=)" "p.(=)" "4i" "0000374268" "00025927" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(?)" "p.(=)" "" "0000374268" "00015744" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(=)" "p.(=)" "4i" "0000374269" "00025927" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(?)" "p.(=)" "" "0000374269" "00015744" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(=)" "p.(=)" "4i" "0000374270" "00025927" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(?)" "p.(=)" "" "0000374270" "00015744" "11" "319" "-31" "319" "-31" "c.319-31T>C" "r.(=)" "p.(=)" "4i" "0000374271" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374271" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374272" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374272" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374273" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374273" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374274" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374274" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374275" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374275" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374276" "00025927" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "" "0000374276" "00015744" "75" "1583" "0" "1583" "0" "c.1583T>A" "r.(?)" "p.(Val528Asp)" "13" "0000374279" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374279" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374280" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374280" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374281" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374281" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374282" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374282" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374283" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374283" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374284" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374284" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374285" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374285" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374286" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374286" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374287" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374287" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374288" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000374288" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000374289" "00025927" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(?)" "p.(=)" "" "0000374289" "00015744" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(=)" "p.(=)" "27i" "0000374290" "00025927" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(?)" "p.(=)" "" "0000374290" "00015744" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(=)" "p.(=)" "27i" "0000374291" "00025927" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(?)" "p.(=)" "" "0000374291" "00015744" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(=)" "p.(=)" "27i" "0000374292" "00025927" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(?)" "p.(=)" "" "0000374292" "00015744" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(=)" "p.(=)" "27i" "0000374293" "00025927" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(?)" "p.(=)" "" "0000374293" "00015744" "11" "3718" "-19" "3718" "-19" "c.3718-19C>A" "r.(=)" "p.(=)" "27i" "0000374294" "00025927" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(Val1006=)" "" "0000374294" "00015744" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(=)" "23" "0000374295" "00025927" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(Val1006=)" "" "0000374295" "00015744" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(=)" "23" "0000374296" "00025927" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(Val1006=)" "" "0000374296" "00015744" "11" "3018" "0" "3018" "0" "c.3018G>T" "r.(?)" "p.(=)" "23" "0000374297" "00025927" "11" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "" "0000374297" "00015744" "11" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "15" "0000374298" "00025927" "99" "423" "0" "431" "0" "c.423_431dup" "r.(?)" "p.(Asp142_Ser144dup)" "" "0000374298" "00015744" "99" "423" "0" "431" "0" "c.423_431dup" "r.(?)" "p.(Ser144Leufs*16)" "5" "0000374299" "00015744" "99" "92" "-1" "474" "1" "c.(91+1_92-1)_(474+1_475-1)del" "r.?" "p.?" "2i_5i" "0000374300" "00025927" "11" "4212" "-54" "4212" "-54" "c.4212-54T>C" "r.(?)" "p.(=)" "" "0000374300" "00015744" "11" "4212" "-54" "4212" "-54" "c.4212-54T>C" "r.(=)" "p.(=)" "31i" "0000374301" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374301" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374302" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374302" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374303" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374303" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374304" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374304" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374305" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374305" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374306" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374306" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374307" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374307" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374308" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374308" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374309" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374309" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374310" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374310" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374311" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374311" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374312" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374312" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374313" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374313" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374314" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374314" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374315" "00025927" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(?)" "p.(=)" "" "0000374315" "00015744" "11" "3374" "-68" "3374" "-68" "c.3374-68T>G" "r.(=)" "p.(=)" "25i" "0000374318" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374318" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374319" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374319" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374320" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374320" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374321" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374321" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374322" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374322" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374323" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374323" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374324" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374324" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374325" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374325" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374326" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374326" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374327" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374327" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374328" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374328" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374329" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374329" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374330" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374330" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374331" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374331" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374332" "00025927" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(?)" "p.(=)" "" "0000374332" "00015744" "11" "3374" "-72" "3374" "-72" "c.3374-72A>G" "r.(=)" "p.(=)" "25i" "0000374339" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374339" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374340" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374340" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374341" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374341" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374342" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374342" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374343" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374343" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374344" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374344" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374345" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374345" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374346" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374346" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374347" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374347" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374348" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374348" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374349" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374349" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374350" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374350" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374351" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374351" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374352" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374352" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374353" "00025927" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(?)" "p.(=)" "" "0000374353" "00015744" "11" "3010" "-48" "3010" "-48" "c.3010-48G>A" "r.(=)" "p.(=)" "22i" "0000374360" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374360" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374361" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374361" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374362" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374362" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374363" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374363" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374364" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374364" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374365" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374365" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374366" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374366" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374367" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374367" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374368" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374368" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374369" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374369" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374370" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374370" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374371" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374371" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374372" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374372" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374373" "00025927" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(?)" "p.(=)" "" "0000374373" "00015744" "11" "2751" "37" "2751" "37" "c.2751+37C>T" "r.(=)" "p.(=)" "20i" "0000374377" "00025927" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(?)" "p.(=)" "" "0000374377" "00015744" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(=)" "p.(=)" "15i" "0000374378" "00025927" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(?)" "p.(=)" "" "0000374378" "00015744" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(=)" "p.(=)" "15i" "0000374379" "00025927" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(?)" "p.(=)" "" "0000374379" "00015744" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(=)" "p.(=)" "15i" "0000374380" "00025927" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(?)" "p.(=)" "" "0000374380" "00015744" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(=)" "p.(=)" "15i" "0000374381" "00025927" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(?)" "p.(=)" "" "0000374381" "00015744" "11" "1917" "33" "1917" "34" "c.1917+33_1917+34dup" "r.(=)" "p.(=)" "15i" "0000374382" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374382" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374383" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374383" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374384" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374384" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374385" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374385" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374386" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374386" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374387" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374387" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374388" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374388" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374389" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374389" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374390" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374390" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374391" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374391" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374392" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374392" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374393" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374393" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374394" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374394" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374395" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374395" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374396" "00025927" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(?)" "p.(=)" "" "0000374396" "00015744" "11" "1590" "20" "1590" "20" "c.1590+20A>G" "r.(=)" "p.(=)" "13i" "0000374404" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374404" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374405" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374405" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374406" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374406" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374407" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374407" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374408" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374408" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374409" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374409" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374410" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374410" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374411" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374411" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374412" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374412" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374413" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374413" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374414" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374414" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374415" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374415" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374416" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374416" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374417" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374417" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374418" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374418" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374419" "00025927" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(?)" "p.(=)" "" "0000374419" "00015744" "11" "986" "-81" "986" "-81" "c.986-81C>T" "r.(=)" "p.(=)" "9i" "0000374427" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374427" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374428" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374428" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374429" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374429" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374430" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374430" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374431" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374431" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374432" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374432" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374433" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374433" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374434" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374434" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374435" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374435" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374436" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374436" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374437" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374437" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374438" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374438" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374439" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374439" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374440" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374440" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374441" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374441" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374442" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374442" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374443" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374443" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374444" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374444" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374445" "00025927" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(?)" "p.(=)" "" "0000374445" "00015744" "11" "877" "-70" "877" "-70" "c.877-70G>A" "r.(=)" "p.(=)" "8i" "0000374453" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374453" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374454" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374454" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374455" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374455" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374456" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374456" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374457" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374457" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374458" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374458" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374459" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374459" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374460" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374460" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374461" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374461" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374462" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374462" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374463" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374463" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374464" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374464" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374465" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374465" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374466" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374466" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374467" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374467" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374468" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374468" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374469" "00025927" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(?)" "p.(=)" "" "0000374469" "00015744" "11" "876" "56" "876" "56" "c.876+56T>G" "r.(=)" "p.(=)" "8i" "0000374477" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374477" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374478" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374478" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374479" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374479" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374480" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374480" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374481" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374481" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374482" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374482" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374483" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374483" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374484" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374484" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374485" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374485" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374486" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374486" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374487" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374487" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374488" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374488" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374489" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374489" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374490" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374490" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374491" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374491" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374492" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374492" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374493" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374493" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374494" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374494" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374495" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374495" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374496" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374496" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374497" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374497" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374498" "00025927" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(?)" "p.(=)" "" "0000374498" "00015744" "11" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "7i" "0000374506" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374506" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374507" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374507" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374508" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374508" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374509" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374509" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374510" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374510" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374511" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374511" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374512" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374512" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374513" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374513" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374514" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374514" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374515" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374515" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374516" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374516" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374517" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374517" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374518" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374518" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374519" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374519" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374520" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374520" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374521" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374521" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374522" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374522" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374523" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374523" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374524" "00025927" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(?)" "p.(=)" "" "0000374524" "00015744" "11" "705" "93" "705" "93" "c.705+93C>T" "r.(=)" "p.(=)" "7i" "0000374532" "00025927" "99" "3121" "0" "3121" "0" "c.3121A>T" "r.(?)" "p.(Arg1041Ter)" "" "0000374532" "00015744" "99" "3121" "0" "3121" "0" "c.3121A>T" "r.(?)" "p.(Arg1041*)" "23" "0000374533" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374533" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374534" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374534" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374535" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374535" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374536" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374536" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374537" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374537" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374538" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374538" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374539" "00025927" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000374539" "00015744" "99" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "16" "0000374540" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374540" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374541" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374541" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374542" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374542" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374543" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374543" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374544" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374544" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374545" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374545" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374546" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374546" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374547" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374547" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374548" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374548" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374549" "00025927" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(?)" "p.(=)" "" "0000374549" "00015744" "11" "3717" "35" "3717" "35" "c.3717+35T>C" "r.(=)" "p.(=)" "27i" "0000374552" "00025927" "99" "868" "0" "868" "0" "c.868A>T" "r.(?)" "p.(Arg290Ter)" "" "0000374552" "00015744" "99" "868" "0" "868" "0" "c.868A>T" "r.(?)" "p.(Arg290*)" "8" "0000374553" "00015744" "99" "706" "-1" "876" "1" "c.(705+1_706-1)_(876+1_877-1)del" "r.spl?" "p.?" "7i_8i" "0000374554" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374554" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374555" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374555" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374556" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374556" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374557" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374557" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374558" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374558" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374559" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374559" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374560" "00025927" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(?)" "p.(=)" "" "0000374560" "00015744" "11" "3984" "-20" "3984" "-20" "c.3984-20C>T" "r.(=)" "p.(=)" "29i" "0000374562" "00025927" "11" "2220" "47" "2220" "47" "c.2220+47T>C" "r.(?)" "p.(=)" "" "0000374562" "00015744" "11" "2220" "47" "2220" "47" "c.2220+47T>C" "r.(=)" "p.(=)" "18i" "0000374563" "00025927" "11" "2220" "47" "2220" "47" "c.2220+47T>C" "r.(?)" "p.(=)" "" "0000374563" "00015744" "11" "2220" "47" "2220" "47" "c.2220+47T>C" "r.(=)" "p.(=)" "18i" "0000374565" "00025927" "99" "1036" "0" "1036" "0" "c.1036G>T" "r.(?)" "p.(Glu346Ter)" "" "0000374565" "00015744" "99" "1036" "0" "1036" "0" "c.1036G>T" "r.(?)" "p.(Glu346*)" "10" "0000374566" "00025927" "99" "866" "0" "876" "0" "c.866_876del" "r.(?)" "p.(Leu289Ter)" "" "0000374566" "00015744" "99" "866" "0" "876" "0" "c.866_876del" "r.(?)" "p.(Leu289*)" "8" "0000374567" "00025927" "11" "3123" "-69" "3123" "-69" "c.3123-69T>G" "r.(=)" "p.?" "" "0000374567" "00015744" "11" "3123" "-69" "3123" "-69" "c.3123-69T>G" "r.(=)" "p.(=)" "23i" "0000374568" "00025927" "11" "2868" "69" "2868" "69" "c.2868+69G>A" "r.(?)" "p.(=)" "" "0000374568" "00015744" "11" "2868" "69" "2868" "69" "c.2868+69G>A" "r.(=)" "p.(=)" "21i" "0000374569" "00025927" "11" "2868" "69" "2868" "69" "c.2868+69G>A" "r.(?)" "p.(=)" "" "0000374569" "00015744" "11" "2868" "69" "2868" "69" "c.2868+69G>A" "r.(=)" "p.(=)" "21i" "0000374571" "00015744" "99" "0" "0" "0" "0" "c.-395_(-29+1_-28-1){0}" "r.0?" "p.0?" "_1_1i" "0000374575" "00025927" "11" "3435" "0" "3435" "0" "c.3435G>A" "r.(?)" "p.(Gln1145=)" "" "0000374575" "00015744" "11" "3435" "0" "3435" "0" "c.3435G>A" "r.(?)" "p.(=)" "26" "0000374576" "00025927" "11" "3435" "0" "3435" "0" "c.3435G>A" "r.(?)" "p.(Gln1145=)" "" "0000374576" "00015744" "11" "3435" "0" "3435" "0" "c.3435G>A" "r.(?)" "p.(=)" "26" "0000374577" "00025927" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(Pro320=)" "" "0000374577" "00015744" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(=)" "9" "0000374578" "00025927" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(Pro320=)" "" "0000374578" "00015744" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(=)" "9" "0000374579" "00025927" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(Pro320=)" "" "0000374579" "00015744" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(=)" "9" "0000374580" "00025927" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(Pro320=)" "" "0000374580" "00015744" "11" "960" "0" "960" "0" "c.960A>G" "r.(?)" "p.(=)" "9" "0000374581" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374581" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374582" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374582" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374583" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374583" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374584" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374584" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374585" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374585" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374586" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374586" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374587" "00025927" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(?)" "p.(=)" "" "0000374587" "00015744" "11" "475" "-3" "475" "-3" "c.475-3C>T" "r.(=)" "p.(=)" "5i" "0000374588" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374588" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374589" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374589" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374590" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374590" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374591" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374591" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374592" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374592" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374593" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374593" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374594" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374594" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374595" "00025927" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000374595" "00015744" "99" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "22" "0000374598" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374598" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374599" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374599" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374600" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374600" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374601" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374601" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374602" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374602" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374603" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374603" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374604" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374604" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374605" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374605" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374606" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374606" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374607" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374607" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374608" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374608" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374609" "00025927" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "" "0000374609" "00015744" "11" "2786" "0" "2786" "0" "c.2786G>A" "r.(?)" "p.(Arg929Gln)" "21" "0000374610" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374610" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374611" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374611" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374612" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374612" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374613" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374613" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374614" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374614" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374615" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374615" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374616" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374616" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374617" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374617" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374618" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374618" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374619" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374619" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374620" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374620" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374621" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374621" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374622" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374622" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374623" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374623" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374624" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374624" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374625" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374625" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374626" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374626" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374627" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374627" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374628" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374628" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374629" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374629" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374630" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374630" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374631" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374631" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374632" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374632" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374633" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374633" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374634" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374634" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374635" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374635" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374636" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374636" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374637" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374637" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374638" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374638" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374639" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374639" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374640" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374640" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374641" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374641" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374642" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374642" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374643" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374643" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374644" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374644" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374645" "00025927" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000374645" "00015744" "99" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "8" "0000374646" "00025927" "35" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "" "0000374646" "00015744" "35" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "13" "0000374647" "00025927" "11" "4368" "-2646" "4368" "-2646" "c.4368-2646A>G" "r.(?)" "p.(=)" "" "0000374647" "00015744" "11" "4850" "0" "4850" "0" "c.4850A>G" "r.(?)" "p.(Asn1617Ser)" "33" "0000374648" "00025927" "11" "4368" "-2646" "4368" "-2646" "c.4368-2646A>G" "r.(?)" "p.(=)" "" "0000374648" "00015744" "11" "4850" "0" "4850" "0" "c.4850A>G" "r.(?)" "p.(Asn1617Ser)" "33" "0000374649" "00025927" "11" "4368" "-2646" "4368" "-2646" "c.4368-2646A>G" "r.(?)" "p.(=)" "" "0000374649" "00015744" "11" "4850" "0" "4850" "0" "c.4850A>G" "r.(?)" "p.(Asn1617Ser)" "33" "0000374650" "00025927" "11" "4368" "-2646" "4368" "-2646" "c.4368-2646A>G" "r.(?)" "p.(=)" "" "0000374650" "00015744" "11" "4850" "0" "4850" "0" "c.4850A>G" "r.(?)" "p.(Asn1617Ser)" "33" "0000374651" "00025927" "11" "4368" "-2646" "4368" "-2646" "c.4368-2646A>G" "r.(?)" "p.(=)" "" "0000374651" "00015744" "11" "4850" "0" "4850" "0" "c.4850A>G" "r.(?)" "p.(Asn1617Ser)" "33" "0000374652" "00025927" "35" "521" "0" "521" "0" "c.521A>G" "r.(?)" "p.(Asn174Ser)" "" "0000374652" "00015744" "35" "521" "0" "521" "0" "c.521A>G" "r.(?)" "p.(Asn174Ser)" "6" "0000374653" "00025927" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "" "0000374653" "00015744" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "29" "0000374654" "00025927" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "" "0000374654" "00015744" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "29" "0000374655" "00025927" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "" "0000374655" "00015744" "35" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "29" "0000374656" "00025927" "75" "3076" "0" "3076" "0" "c.3076G>C" "r.(?)" "p.(Val1026Leu)" "" "0000374656" "00015744" "75" "3076" "0" "3076" "0" "c.3076G>C" "r.(?)" "p.(Val1026Leu)" "23" "0000374657" "00025927" "75" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "" "0000374657" "00015744" "75" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "5" "0000374658" "00025927" "99" "2782" "0" "2782" "0" "c.2782A>T" "r.(?)" "p.(Lys928Ter)" "" "0000374658" "00015744" "99" "2782" "0" "2782" "0" "c.2782A>T" "r.(?)" "p.(Lys928*)" "21" "0000374660" "00025927" "75" "4291" "0" "4291" "0" "c.4291C>T" "r.(?)" "p.(Pro1431Ser)" "" "0000374660" "00015744" "75" "4291" "0" "4291" "0" "c.4291C>T" "r.(?)" "p.(Pro1431Ser)" "32" "0000374661" "00025927" "75" "4301" "0" "4301" "0" "c.4301C>T" "r.(?)" "p.(Ala1434Val)" "" "0000374661" "00015744" "75" "4301" "0" "4301" "0" "c.4301C>T" "r.(?)" "p.(Ala1434Val)" "32" "0000374662" "00025927" "75" "4301" "0" "4301" "0" "c.4301C>T" "r.(?)" "p.(Ala1434Val)" "" "0000374662" "00015744" "75" "4301" "0" "4301" "0" "c.4301C>T" "r.(?)" "p.(Ala1434Val)" "32" "0000374664" "00025927" "75" "4328" "0" "4328" "0" "c.4328C>T" "r.(?)" "p.(Pro1443Leu)" "" "0000374664" "00015744" "75" "4328" "0" "4328" "0" "c.4328C>T" "r.(?)" "p.(Pro1443Leu)" "32" "0000374665" "00025927" "75" "4328" "0" "4328" "0" "c.4328C>T" "r.(?)" "p.(Pro1443Leu)" "" "0000374665" "00015744" "75" "4328" "0" "4328" "0" "c.4328C>T" "r.(?)" "p.(Pro1443Leu)" "32" "0000374666" "00025927" "99" "1737" "0" "1737" "0" "c.1737C>G" "r.(?)" "p.(Tyr579Ter)" "" "0000374666" "00015744" "99" "1737" "0" "1737" "0" "c.1737C>G" "r.(?)" "p.(Tyr579*)" "14" "0000374667" "00025927" "73" "2868" "5" "2868" "5" "c.2868+5G>A" "r.spl?" "p.?" "" "0000374667" "00015744" "73" "2868" "5" "2868" "5" "c.2868+5G>A" "r.(?)" "p.(?)" "21i" "0000374668" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374668" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374669" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374669" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374670" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374670" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374671" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374671" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374672" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374672" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374673" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374673" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374674" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374674" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374675" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374675" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374676" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374676" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374677" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374677" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374678" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374678" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374679" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374679" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374680" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374680" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374681" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374681" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374682" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374682" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374683" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374683" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374684" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374684" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374685" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374685" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374686" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374686" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374687" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374687" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374688" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374688" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374689" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374689" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374690" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374690" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374691" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374691" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374692" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374692" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374693" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374693" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374694" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374694" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374695" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374695" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374696" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374696" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374697" "00025927" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000374697" "00015744" "99" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3*)" "2" "0000374700" "00025927" "99" "4323" "0" "4328" "0" "c.4323_4328del" "r.(?)" "p.(Pro1442_Pro1443del)" "" "0000374700" "00015744" "99" "4323" "0" "4328" "0" "c.4323_4328del" "r.(?)" "p.(Pro1442_Pro1443del)" "32" "0000374701" "00025927" "11" "4368" "-1939" "4368" "-1939" "c.4368-1939A>C" "r.(?)" "p.(=)" "" "0000374701" "00015744" "11" "5557" "0" "5557" "0" "c.5557A>C" "r.(?)" "p.(Met1853Leu)" "33" "0000374702" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374702" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374703" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374703" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374704" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374704" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374705" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374705" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374706" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374706" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374707" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374707" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374708" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374708" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374709" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374709" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374710" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374710" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374711" "00025927" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.spl" "p.?" "" "0000374711" "00015744" "99" "3718" "-2" "3718" "-2" "c.3718-2A>G" "r.(?)" "p.(?)" "27i" "0000374712" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374712" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374713" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374713" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374714" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374714" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374715" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374715" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374716" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374716" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374717" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374717" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374718" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374718" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374719" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374719" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374720" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374720" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374721" "00025927" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000374721" "00015744" "99" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "8" "0000374722" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374722" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374723" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374723" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374724" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374724" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374725" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374725" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374726" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374726" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374727" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374727" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374728" "00025927" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374728" "00015744" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374729" "00025927" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374729" "00015744" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374730" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374730" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374731" "00025927" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374731" "00015744" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374732" "00025927" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374732" "00015744" "95" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374733" "00025927" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374733" "00015744" "99" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374734" "00025927" "75" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000374734" "00015744" "75" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "5" "0000374735" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374735" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374736" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374736" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374737" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374737" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374738" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374738" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374739" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374739" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374740" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374740" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374741" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374741" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374742" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374742" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374743" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374743" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374744" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374744" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374745" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374745" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374746" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.spl" "p.?" "" "0000374746" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>T" "r.(?)" "p.(?)" "27i" "0000374747" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374747" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374748" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374748" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374749" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374749" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374750" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374750" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374751" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374751" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374752" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374752" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374753" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374753" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374754" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374754" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374755" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374755" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374756" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374756" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374757" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374757" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374758" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374758" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374759" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374759" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374760" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374760" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374761" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374761" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374762" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374762" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374763" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374763" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374764" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374764" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374765" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374765" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374766" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374766" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374767" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374767" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374768" "00025927" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419PhefsTer49)" "" "0000374768" "00015744" "99" "4257" "0" "4257" "0" "c.4257del" "r.(?)" "p.(Leu1419Phefs*64)" "32" "0000374769" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374769" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374770" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374770" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374771" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374771" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374772" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374772" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374773" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374773" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374774" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374774" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374775" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374775" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374776" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374776" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374777" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374777" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374778" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374778" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374779" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374779" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374780" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374780" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374781" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374781" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374782" "00025927" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684Ter)" "" "0000374782" "00015744" "99" "2052" "0" "2052" "0" "c.2052C>A" "r.(?)" "p.(Tyr684*)" "17" "0000374783" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374783" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374784" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374784" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374785" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374785" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374786" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374786" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374787" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374787" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374788" "00025927" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647Ter)" "" "0000374788" "00015744" "99" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ser647*)" "16" "0000374789" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374789" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374790" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374790" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374791" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374791" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374792" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374792" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374793" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374793" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374794" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374794" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374795" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374795" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374796" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374796" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374797" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374797" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374798" "00025927" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "" "0000374798" "00015744" "95" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Asp178Gly)" "6" "0000374799" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374799" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374800" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374800" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374801" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374801" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374802" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374802" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374803" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374803" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374804" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374804" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374805" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374805" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374806" "00025927" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829LysfsTer13)" "" "0000374806" "00015744" "99" "2484" "0" "2484" "0" "c.2484del" "r.(?)" "p.(Glu829Lysfs*13)" "19" "0000374807" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374807" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374808" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374808" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374809" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374809" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374810" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374810" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374811" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374811" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374812" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374812" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374813" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374813" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374814" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374814" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374815" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374815" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374816" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374816" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374817" "00025927" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363TrpfsTer58)" "" "0000374817" "00015744" "99" "1088" "0" "1088" "0" "c.1088del" "r.(?)" "p.(Leu363Trpfs*58)" "10" "0000374818" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374818" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374819" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374819" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374820" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374820" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374821" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374821" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374822" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374822" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374823" "00025927" "15" "4368" "-1895" "4368" "-1893" "c.4368-1895_4368-1893del" "r.(?)" "p.(=)" "" "0000374823" "00015744" "15" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "33" "0000374824" "00025927" "35" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "" "0000374824" "00015744" "35" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "30" "0000374825" "00025927" "99" "2785" "0" "2785" "0" "c.2785C>T" "r.(?)" "p.(Arg929Ter)" "" "0000374825" "00015744" "99" "2785" "0" "2785" "0" "c.2785C>T" "r.(?)" "p.(Arg929*)" "21" "0000374826" "00025927" "99" "996" "0" "999" "0" "c.996_999del" "r.(?)" "p.(Glu332AspfsTer21)" "" "0000374826" "00015744" "99" "996" "0" "999" "0" "c.996_999del" "r.(?)" "p.(Glu332Aspfs*21)" "10" "0000374827" "00025927" "99" "16" "0" "16" "0" "c.16del" "r.(?)" "p.(Tyr6IlefsTer6)" "" "0000374827" "00015744" "99" "16" "0" "16" "0" "c.16del" "r.(?)" "p.(Tyr6Ilefs*6)" "2" "0000374828" "00025927" "11" "157" "3" "157" "3" "c.157+3A>G" "r.spl?" "p.?" "" "0000374828" "00015744" "11" "157" "3" "157" "3" "c.157+3A>G" "r.(=)" "p.(=)" "3i" "0000374829" "00025927" "11" "157" "3" "157" "3" "c.157+3A>G" "r.spl?" "p.?" "" "0000374829" "00015744" "11" "157" "3" "157" "3" "c.157+3A>G" "r.(=)" "p.(=)" "3i" "0000374830" "00025927" "11" "157" "3" "157" "3" "c.157+3A>G" "r.spl?" "p.?" "" "0000374830" "00015744" "11" "157" "3" "157" "3" "c.157+3A>G" "r.(=)" "p.(=)" "3i" "0000374833" "00025927" "11" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Thr301=)" "" "0000374833" "00015744" "11" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(=)" "9" "0000374834" "00025927" "11" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Thr301=)" "" "0000374834" "00015744" "11" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(=)" "9" "0000374835" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374835" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374836" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374836" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374837" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374837" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374838" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374838" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374839" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374839" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374840" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374840" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374841" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374841" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374842" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374842" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374843" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374843" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374844" "00025927" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000374844" "00015744" "11" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000374845" "00025927" "11" "1917" "33" "1917" "33" "c.1917+33dup" "r.(?)" "p.(=)" "" "0000374845" "00015744" "11" "1917" "33" "1917" "33" "c.1917+33dup" "r.(=)" "p.(=)" "15i" "0000374846" "00025927" "11" "1917" "33" "1917" "33" "c.1917+33dup" "r.(?)" "p.(=)" "" "0000374846" "00015744" "11" "1917" "33" "1917" "33" "c.1917+33dup" "r.(=)" "p.(=)" "15i" "0000374847" "00025927" "11" "2221" "-34" "2221" "-34" "c.2221-34G>A" "r.(?)" "p.(=)" "" "0000374847" "00015744" "11" "2221" "-34" "2221" "-34" "c.2221-34G>A" "r.(=)" "p.(=)" "18i" "0000374848" "00025927" "11" "2221" "-34" "2221" "-34" "c.2221-34G>A" "r.(?)" "p.(=)" "" "0000374848" "00015744" "11" "2221" "-34" "2221" "-34" "c.2221-34G>A" "r.(=)" "p.(=)" "18i" "0000374851" "00025927" "11" "2751" "43" "2751" "43" "c.2751+43C>G" "r.(?)" "p.(=)" "" "0000374851" "00015744" "11" "2751" "43" "2751" "43" "c.2751+43C>G" "r.(=)" "p.(=)" "20i" "0000374852" "00025927" "11" "2751" "43" "2751" "43" "c.2751+43C>G" "r.(?)" "p.(=)" "" "0000374852" "00015744" "11" "2751" "43" "2751" "43" "c.2751+43C>G" "r.(=)" "p.(=)" "20i" "0000374855" "00025927" "99" "3316" "0" "3316" "0" "c.3316C>T" "r.(?)" "p.(Arg1106Ter)" "" "0000374855" "00015744" "99" "3316" "0" "3316" "0" "c.3316C>T" "r.(?)" "p.(Arg1106*)" "25" "0000374856" "00025927" "99" "3316" "0" "3316" "0" "c.3316C>T" "r.(?)" "p.(Arg1106Ter)" "" "0000374856" "00015744" "99" "3316" "0" "3316" "0" "c.3316C>T" "r.(?)" "p.(Arg1106*)" "25" "0000374858" "00025927" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(?)" "p.(=)" "" "0000374858" "00015744" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(=)" "p.(=)" "7i" "0000374859" "00025927" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(?)" "p.(=)" "" "0000374859" "00015744" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(=)" "p.(=)" "7i" "0000374860" "00025927" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(?)" "p.(=)" "" "0000374860" "00015744" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(=)" "p.(=)" "7i" "0000374861" "00025927" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(?)" "p.(=)" "" "0000374861" "00015744" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(=)" "p.(=)" "7i" "0000374862" "00025927" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(?)" "p.(=)" "" "0000374862" "00015744" "11" "705" "133" "705" "133" "c.705+133T>C" "r.(=)" "p.(=)" "7i" "0000374870" "00025927" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(?)" "p.(=)" "" "0000374870" "00015744" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(=)" "p.(=)" "9i" "0000374871" "00025927" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(?)" "p.(=)" "" "0000374871" "00015744" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(=)" "p.(=)" "9i" "0000374872" "00025927" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(?)" "p.(=)" "" "0000374872" "00015744" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(=)" "p.(=)" "9i" "0000374873" "00025927" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(?)" "p.(=)" "" "0000374873" "00015744" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(=)" "p.(=)" "9i" "0000374874" "00025927" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(?)" "p.(=)" "" "0000374874" "00015744" "11" "985" "175" "985" "175" "c.985+175T>A" "r.(=)" "p.(=)" "9i" "0000374882" "00025927" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(?)" "p.(=)" "" "0000374882" "00015744" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(=)" "p.(=)" "10i" "0000374883" "00025927" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(?)" "p.(=)" "" "0000374883" "00015744" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(=)" "p.(=)" "10i" "0000374884" "00025927" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(?)" "p.(=)" "" "0000374884" "00015744" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(=)" "p.(=)" "10i" "0000374885" "00025927" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(?)" "p.(=)" "" "0000374885" "00015744" "11" "1098" "107" "1098" "107" "c.1098+107G>A" "r.(=)" "p.(=)" "10i" "0000374892" "00025927" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(?)" "p.(=)" "" "0000374892" "00015744" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(=)" "p.(=)" "17i" "0000374893" "00025927" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(?)" "p.(=)" "" "0000374893" "00015744" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(=)" "p.(=)" "17i" "0000374894" "00025927" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(?)" "p.(=)" "" "0000374894" "00015744" "11" "2091" "141" "2091" "141" "c.2091+141T>C" "r.(=)" "p.(=)" "17i" "0000374902" "00025927" "11" "2868" "172" "2868" "172" "c.2868+172G>A" "r.(?)" "p.(=)" "" "0000374902" "00015744" "11" "2868" "172" "2868" "172" "c.2868+172G>A" "r.(=)" "p.(=)" "21i" "0000374903" "00025927" "11" "2868" "172" "2868" "172" "c.2868+172G>A" "r.(?)" "p.(=)" "" "0000374903" "00015744" "11" "2868" "172" "2868" "172" "c.2868+172G>A" "r.(=)" "p.(=)" "21i" "0000374906" "00025927" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(?)" "p.(=)" "" "0000374906" "00015744" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(=)" "p.(=)" "21i" "0000374907" "00025927" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(?)" "p.(=)" "" "0000374907" "00015744" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(=)" "p.(=)" "21i" "0000374908" "00025927" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(?)" "p.(=)" "" "0000374908" "00015744" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(=)" "p.(=)" "21i" "0000374909" "00025927" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(?)" "p.(=)" "" "0000374909" "00015744" "11" "2869" "-109" "2869" "-109" "c.2869-109T>C" "r.(=)" "p.(=)" "21i" "0000374910" "00025927" "99" "92" "-13779" "157" "41368" "c.92-13779_157+41368del" "r.?" "p.(Asp31_Asn52del)" "2i_3i" "0000374910" "00015744" "99" "92" "-13779" "157" "41368" "c.92-13779_157+41368del" "r.?" "p.(Asp31_Asn52del)" "2i_3i" "0000374911" "00025927" "99" "158" "-52781" "475" "-3295" "c.158-52781_475-3295dup" "r.?" "p.(Thr199Valfs*8)" "" "0000374911" "00015744" "99" "158" "-52781" "475" "-3295" "c.158-52781_475-3295dup" "r.?" "p.(Thr199Valfs*8)" "4_5" "0000374912" "00025927" "99" "158" "-52781" "475" "-3295" "c.158-52781_475-3295dup" "r.?" "p.(Thr199Valfs*8)" "3i_5i" "0000374912" "00015744" "99" "158" "-52781" "475" "-3295" "c.158-52781_475-3295dup" "r.?" "p.(Thr199Valfs*8)" "3i_5i" "0000374914" "00015744" "99" "92" "-1" "157" "1" "c.92-?_157+?del" "r.(?)" "p.(Asp31_Asn52del)" "3" "0000374915" "00025927" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(?)" "p.(=)" "" "0000374915" "00015744" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(=)" "p.(=)" "32i" "0000374916" "00025927" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(?)" "p.(=)" "" "0000374916" "00015744" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(=)" "p.(=)" "32i" "0000374917" "00025927" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(?)" "p.(=)" "" "0000374917" "00015744" "11" "4367" "119" "4367" "119" "c.4367+119T>C" "r.(=)" "p.(=)" "32i" "0000374921" "00025927" "75" "407" "0" "407" "0" "c.407T>C" "r.(?)" "p.(Val136Ala)" "" "0000374921" "00015744" "75" "407" "0" "407" "0" "c.407T>C" "r.(?)" "p.(Val136Ala)" "5" "0000374922" "00015744" "99" "3807" "-1" "4367" "1" "c.3807-?_4367+?del" "r.(?)" "p.(Glu1269_Leu1457delinsAsp)" "28i_32i" "0000374925" "00025927" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "" "0000374925" "00015744" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "11" "0000374926" "00025927" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "" "0000374926" "00015744" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "11" "0000374927" "00025927" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "" "0000374927" "00015744" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "11" "0000374928" "00025927" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "" "0000374928" "00015744" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "11" "0000374929" "00025927" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "" "0000374929" "00015744" "11" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Gly380Ser)" "11" "0000374930" "00025927" "11" "1263" "0" "1263" "0" "c.1263T>C" "r.(?)" "p.(Thr421=)" "" "0000374930" "00015744" "11" "1263" "0" "1263" "0" "c.1263T>C" "r.(?)" "p.(=)" "11" "0000374931" "00025927" "11" "1263" "0" "1263" "0" "c.1263T>C" "r.(?)" "p.(Thr421=)" "" "0000374931" "00015744" "11" "1263" "0" "1263" "0" "c.1263T>C" "r.(?)" "p.(=)" "11" "0000374934" "00025927" "15" "1591" "-68" "1591" "-68" "c.1591-68G>A" "r.(?)" "p.(=)" "" "0000374934" "00015744" "15" "1591" "-68" "1591" "-68" "c.1591-68G>A" "r.(=)" "p.(=)" "13i" "0000374935" "00025927" "15" "1591" "-68" "1591" "-68" "c.1591-68G>A" "r.(?)" "p.(=)" "" "0000374935" "00015744" "15" "1591" "-68" "1591" "-68" "c.1591-68G>A" "r.(=)" "p.(=)" "13i" "0000374936" "00025927" "99" "3373" "1" "3373" "1" "c.3373+1G>A" "r.spl" "p.?" "" "0000374936" "00015744" "99" "3373" "1" "3373" "1" "c.3373+1G>A" "r.(?)" "p.(?)" "25i" "0000374937" "00025927" "99" "3373" "1" "3373" "1" "c.3373+1G>A" "r.spl" "p.?" "" "0000374937" "00015744" "99" "3373" "1" "3373" "1" "c.3373+1G>A" "r.(?)" "p.(?)" "25i" "0000374938" "00015744" "11" "2092" "-1" "3501" "1" "c.2092-?_3501+?del" "r.(?)" "p.(Thr698_Lys1167del)" "17i_26i" "0000374939" "00025927" "35" "1343" "0" "1343" "0" "c.1343A>G" "r.(?)" "p.(Tyr448Cys)" "" "0000374939" "00015744" "35" "1343" "0" "1343" "0" "c.1343A>G" "r.(?)" "p.(Tyr448Cys)" "12" "0000374940" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374940" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374941" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374941" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374942" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374942" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374943" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374943" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374944" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374944" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374945" "00025927" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.spl" "p.?" "" "0000374945" "00015744" "99" "2091" "1" "2091" "1" "c.2091+1G>T" "r.(?)" "p.(?)" "17i" "0000374950" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374950" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374951" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374951" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374952" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374952" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374953" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374953" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374954" "00025927" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(?)" "p.(=)" "" "0000374954" "00015744" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(=)" "p.(=)" "21i" "0000374955" "00025927" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(?)" "p.(=)" "" "0000374955" "00015744" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(=)" "p.(=)" "21i" "0000374956" "00025927" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(?)" "p.(=)" "" "0000374956" "00015744" "11" "2868" "106" "2868" "106" "c.2868+106A>G" "r.(=)" "p.(=)" "21i" "0000374957" "00025927" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(?)" "p.(=)" "" "0000374957" "00015744" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(=)" "p.(=)" "24i" "0000374958" "00025927" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(?)" "p.(=)" "" "0000374958" "00015744" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(=)" "p.(=)" "24i" "0000374959" "00025927" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(?)" "p.(=)" "" "0000374959" "00015744" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(=)" "p.(=)" "24i" "0000374960" "00025927" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(?)" "p.(=)" "" "0000374960" "00015744" "11" "3233" "-55" "3233" "-55" "c.3233-55T>C" "r.(=)" "p.(=)" "24i" "0000374961" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374961" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374962" "00025927" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(?)" "p.(=)" "" "0000374962" "00015744" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(=)" "p.(=)" "18i" "0000374963" "00025927" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(?)" "p.(=)" "" "0000374963" "00015744" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(=)" "p.(=)" "18i" "0000374964" "00025927" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(?)" "p.(=)" "" "0000374964" "00015744" "11" "2221" "-35" "2221" "-35" "c.2221-35C>G" "r.(=)" "p.(=)" "18i" "0000374965" "00025927" "15" "319" "-20" "319" "-20" "c.319-20A>T" "r.(?)" "p.(=)" "" "0000374965" "00015744" "15" "319" "-20" "319" "-20" "c.319-20A>T" "r.(=)" "p.(=)" "4i" "0000374966" "00025927" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(Ser875=)" "" "0000374966" "00015744" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(=)" "20" "0000374967" "00025927" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(Ser875=)" "" "0000374967" "00015744" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(=)" "20" "0000374968" "00025927" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(Ser875=)" "" "0000374968" "00015744" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(=)" "20" "0000374969" "00025927" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(Ser875=)" "" "0000374969" "00015744" "15" "2625" "0" "2625" "0" "c.2625G>C" "r.(?)" "p.(=)" "20" "0000374970" "00025927" "15" "3983" "12" "3983" "12" "c.3983+12T>C" "r.(?)" "p.(=)" "" "0000374970" "00015744" "15" "3983" "12" "3983" "12" "c.3983+12T>C" "r.(=)" "p.(=)" "29i" "0000374971" "00025927" "15" "3983" "12" "3983" "12" "c.3983+12T>C" "r.(?)" "p.(=)" "" "0000374971" "00015744" "15" "3983" "12" "3983" "12" "c.3983+12T>C" "r.(=)" "p.(=)" "29i" "0000374972" "00025927" "11" "4368" "-3270" "4368" "-3269" "c.4368-3270_4368-3269insACAG" "r.(?)" "p.(=)" "" "0000374972" "00015744" "11" "4368" "-142" "4368" "-141" "c.4368-142_4368-141insACAG" "r.(=)" "p.(=)" "32i" "0000374973" "00025927" "15" "4368" "-1789" "4368" "-1789" "c.4368-1789A>G" "r.(?)" "p.(=)" "" "0000374973" "00015744" "15" "5707" "0" "5707" "0" "c.5707A>G" "r.(?)" "p.(Ile1903Val)" "33" "0000374974" "00025927" "15" "4368" "-1789" "4368" "-1789" "c.4368-1789A>G" "r.(?)" "p.(=)" "" "0000374974" "00015744" "15" "5707" "0" "5707" "0" "c.5707A>G" "r.(?)" "p.(Ile1903Val)" "33" "0000374975" "00025927" "15" "877" "-80" "877" "-80" "c.877-80C>A" "r.(?)" "p.(=)" "" "0000374975" "00015744" "15" "877" "-80" "877" "-80" "c.877-80C>A" "r.(=)" "p.(=)" "8i" "0000374976" "00025927" "15" "877" "-80" "877" "-80" "c.877-80C>A" "r.(?)" "p.(=)" "" "0000374976" "00015744" "15" "877" "-80" "877" "-80" "c.877-80C>A" "r.(=)" "p.(=)" "8i" "0000374977" "00025927" "15" "2221" "-82" "2221" "-82" "c.2221-82T>C" "r.(?)" "p.(=)" "" "0000374977" "00015744" "15" "2221" "-82" "2221" "-82" "c.2221-82T>C" "r.(=)" "p.(=)" "18i" "0000374978" "00025927" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(?)" "p.(=)" "" "0000374978" "00015744" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(=)" "p.(=)" "17i" "0000374979" "00025927" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(?)" "p.(=)" "" "0000374979" "00015744" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(=)" "p.(=)" "17i" "0000374980" "00025927" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(?)" "p.(=)" "" "0000374980" "00015744" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(=)" "p.(=)" "17i" "0000374981" "00025927" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(?)" "p.(=)" "" "0000374981" "00015744" "11" "2091" "70" "2091" "70" "c.2091+70A>G" "r.(=)" "p.(=)" "17i" "0000374982" "00025927" "15" "4368" "-2522" "4368" "-2522" "c.4368-2522A>C" "r.(?)" "p.(=)" "" "0000374982" "00015744" "15" "4974" "0" "4974" "0" "c.4974A>C" "r.(?)" "p.(=)" "33" "0000374983" "00025927" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(?)" "p.(=)" "" "0000374983" "00015744" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(=)" "p.(=)" "8i" "0000374984" "00025927" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(?)" "p.(=)" "" "0000374984" "00015744" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(=)" "p.(=)" "8i" "0000374985" "00025927" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(?)" "p.(=)" "" "0000374985" "00015744" "11" "876" "134" "876" "134" "c.876+134G>A" "r.(=)" "p.(=)" "8i" "0000374986" "00025927" "35" "4368" "-2233" "4368" "-2233" "c.4368-2233C>T" "r.(?)" "p.(=)" "" "0000374986" "00015744" "35" "5263" "0" "5263" "0" "c.5263C>T" "r.(?)" "p.(Pro1755Ser)" "33" "0000374987" "00025927" "15" "91" "102" "91" "102" "c.91+102T>C" "r.(?)" "p.(=)" "" "0000374987" "00015744" "15" "91" "102" "91" "102" "c.91+102T>C" "r.(=)" "p.(=)" "2i" "0000374988" "00025927" "15" "4368" "-1519" "4368" "-1519" "c.4368-1519A>G" "r.(?)" "p.(=)" "" "0000374988" "00015744" "15" "5977" "0" "5977" "0" "c.*109A>G" "r.(?)" "p.(?)" "33" "0000374989" "00025927" "15" "4368" "-1560" "4368" "-1560" "c.4368-1560T>C" "r.(?)" "p.(=)" "" "0000374989" "00015744" "15" "5936" "0" "5936" "0" "c.*68T>C" "r.(?)" "p.(?)" "33" "0000374990" "00025927" "15" "2092" "-95" "2092" "-95" "c.2092-95T>C" "r.(?)" "p.(=)" "" "0000374990" "00015744" "15" "2092" "-95" "2092" "-95" "c.2092-95T>C" "r.(=)" "p.(=)" "17i" "0000374991" "00025927" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(?)" "p.(=)" "" "0000374991" "00015744" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "26i" "0000374992" "00025927" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(?)" "p.(=)" "" "0000374992" "00015744" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "26i" "0000374993" "00025927" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(?)" "p.(=)" "" "0000374993" "00015744" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "26i" "0000374994" "00025927" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(?)" "p.(=)" "" "0000374994" "00015744" "11" "3502" "-8" "3502" "-8" "c.3502-8C>T" "r.(=)" "p.(=)" "26i" "0000374995" "00025927" "15" "4203" "-204" "4203" "-204" "c.4203-204G>A" "r.(?)" "p.(=)" "" "0000374995" "00015744" "15" "4203" "-204" "4203" "-204" "c.4203-204G>A" "r.(=)" "p.(=)" "30i" "0000374996" "00025927" "99" "2825" "0" "2825" "0" "c.2825del" "r.(?)" "p.(Gly942ValfsTer22)" "" "0000374996" "00015744" "99" "2825" "0" "2825" "0" "c.2825del" "r.(?)" "p.(Gly942Valfs*22)" "21" "0000374997" "00025927" "99" "2825" "0" "2825" "0" "c.2825del" "r.(?)" "p.(Gly942ValfsTer22)" "" "0000374997" "00015744" "99" "2825" "0" "2825" "0" "c.2825del" "r.(?)" "p.(Gly942Valfs*22)" "21" "0000374998" "00025927" "35" "4368" "-2127" "4368" "-2122" "c.4368-2127_4368-2122dup" "r.(?)" "p.(=)" "" "0000374998" "00015744" "35" "5369" "0" "5374" "0" "c.5369_5374dup" "r.(?)" "p.(Leu1790_Pro1791dup)" "33" "0000375001" "00025927" "15" "877" "-64" "877" "-64" "c.877-64G>A" "r.(?)" "p.(=)" "" "0000375001" "00015744" "15" "877" "-64" "877" "-64" "c.877-64G>A" "r.(=)" "p.(=)" "8i" "0000375002" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>A" "r.spl" "p.?" "" "0000375002" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>A" "r.(?)" "p.(?)" "27i" "0000375003" "00025927" "99" "3717" "1" "3717" "1" "c.3717+1G>A" "r.spl" "p.?" "" "0000375003" "00015744" "99" "3717" "1" "3717" "1" "c.3717+1G>A" "r.(?)" "p.(?)" "27i" "0000375004" "00025927" "15" "2526" "62" "2526" "62" "c.2526+62G>A" "r.(?)" "p.(=)" "" "0000375004" "00015744" "15" "2526" "62" "2526" "62" "c.2526+62G>A" "r.(=)" "p.(=)" "19i" "0000375005" "00025927" "11" "4368" "-2242" "4368" "-2240" "c.4368-2242_4368-2240del" "r.(?)" "p.(=)" "" "0000375005" "00015744" "11" "5254" "0" "5256" "0" "c.5254_5256del" "r.(?)" "p.(Pro1752del)" "33" "0000375006" "00025927" "15" "475" "-45" "475" "-45" "c.475-45G>A" "r.(?)" "p.(=)" "" "0000375006" "00015744" "15" "475" "-45" "475" "-45" "c.475-45G>A" "r.(=)" "p.(=)" "5i" "0000375007" "00025927" "99" "3501" "2" "3501" "2" "c.3501+2T>C" "r.spl" "p.?" "" "0000375007" "00015744" "99" "3501" "2" "3501" "2" "c.3501+2T>C" "r.(?)" "p.(?)" "26i" "0000375008" "00025927" "99" "3501" "2" "3501" "2" "c.3501+2T>C" "r.spl" "p.?" "" "0000375008" "00015744" "99" "3501" "2" "3501" "2" "c.3501+2T>C" "r.(?)" "p.(?)" "26i" "0000375009" "00025927" "15" "4368" "-2098" "4368" "-2098" "c.4368-2098G>A" "r.(?)" "p.(=)" "" "0000375009" "00015744" "15" "5398" "0" "5398" "0" "c.5398G>A" "r.(?)" "p.(Val1800Ile)" "33" "0000375010" "00025927" "15" "877" "-29" "877" "-29" "c.877-29G>T" "r.(?)" "p.(=)" "" "0000375010" "00015744" "15" "877" "-29" "877" "-29" "c.877-29G>T" "r.(=)" "p.(=)" "8i" "0000375013" "00025927" "15" "1440" "31" "1440" "31" "c.1440+31T>C" "r.(?)" "p.(=)" "" "0000375013" "00015744" "15" "1440" "31" "1440" "31" "c.1440+31T>C" "r.(=)" "p.(=)" "12i" "0000375014" "00025927" "15" "2092" "-120" "2092" "-120" "c.2092-120C>T" "r.(?)" "p.(=)" "" "0000375014" "00015744" "15" "2092" "-120" "2092" "-120" "c.2092-120C>T" "r.(=)" "p.(=)" "17i" "0000375015" "00025927" "15" "876" "115" "876" "115" "c.876+115T>C" "r.(?)" "p.(=)" "" "0000375015" "00015744" "15" "876" "115" "876" "115" "c.876+115T>C" "r.(=)" "p.(=)" "8i" "0000375016" "00025927" "15" "876" "115" "876" "115" "c.876+115T>C" "r.(?)" "p.(=)" "" "0000375016" "00015744" "15" "876" "115" "876" "115" "c.876+115T>C" "r.(=)" "p.(=)" "8i" "0000375017" "00025927" "15" "3232" "252" "3232" "252" "c.3232+252C>T" "r.(?)" "p.(=)" "" "0000375017" "00015744" "15" "3232" "252" "3232" "252" "c.3232+252C>T" "r.(=)" "p.(=)" "24i" "0000375018" "00025927" "15" "3806" "158" "3806" "158" "c.3806+158C>T" "r.(?)" "p.?" "" "0000375018" "00015744" "15" "3806" "158" "3806" "158" "c.3806+158C>T" "r.(=)" "p.(=)" "28i" "0000375019" "00025927" "15" "4368" "-2137" "4368" "-2137" "c.4368-2137C>T" "r.(?)" "p.(=)" "" "0000375019" "00015744" "15" "5359" "0" "5359" "0" "c.5359C>T" "r.(?)" "p.(Pro1787Ser)" "33" "0000375020" "00025927" "15" "1997" "131" "1997" "131" "c.1997+131A>G" "r.(?)" "p.(=)" "" "0000375020" "00015744" "15" "1997" "131" "1997" "131" "c.1997+131A>G" "r.(=)" "p.(=)" "16i" "0000375021" "00025927" "15" "1998" "-45" "1998" "-45" "c.1998-45A>G" "r.(?)" "p.(=)" "" "0000375021" "00015744" "15" "1998" "-45" "1998" "-45" "c.1998-45A>G" "r.(=)" "p.(=)" "16i" "0000375022" "00025927" "15" "2752" "-230" "2752" "-230" "c.2752-230C>A" "r.(?)" "p.(=)" "" "0000375022" "00015744" "15" "2752" "-230" "2752" "-230" "c.2752-230C>A" "r.(=)" "p.(=)" "20i" "0000375023" "00025927" "15" "3795" "0" "3795" "0" "c.3795A>G" "r.(?)" "p.(Glu1265=)" "" "0000375023" "00015744" "15" "3795" "0" "3795" "0" "c.3795A>G" "r.(?)" "p.(Glu1265Asp)" "28" "0000375024" "00025927" "15" "4368" "-1946" "4368" "-1946" "c.4368-1946C>A" "r.(?)" "p.(=)" "" "0000375024" "00015744" "15" "5550" "0" "5550" "0" "c.5550C>A" "r.(?)" "p.(=)" "33" "0000375025" "00025927" "15" "1099" "-56" "1099" "-56" "c.1099-56C>A" "r.(?)" "p.(=)" "" "0000375025" "00015744" "15" "1099" "-56" "1099" "-56" "c.1099-56C>A" "r.(=)" "p.(=)" "10i" "0000375026" "00025927" "15" "3374" "-4" "3374" "-4" "c.3374-4C>T" "r.(?)" "p.(=)" "" "0000375026" "00015744" "15" "3374" "-4" "3374" "-4" "c.3374-4C>T" "r.(?)" "p.(?)" "25i" "0000375029" "00025927" "75" "4368" "-2945" "4368" "-2944" "c.4368-2945_4368-2944insTTG" "r.(?)" "p.(=)" "" "0000375029" "00015744" "75" "4551" "0" "4552" "0" "c.4551_4552insTTG" "r.(?)" "p.(Ser1517_Asp1518insLeu)" "33" "0000375030" "00025927" "99" "3717" "2" "3717" "2" "c.3717+2dup" "r.spl" "p.?" "" "0000375030" "00015744" "99" "3717" "2" "3717" "2" "c.3717+2dup" "r.spl" "p.?" "27i" "0000375031" "00025927" "99" "3717" "2" "3717" "2" "c.3717+2dup" "r.spl" "p.?" "" "0000375031" "00015744" "99" "3717" "2" "3717" "2" "c.3717+2dup" "r.spl?" "p.?" "27i" "0000375033" "00025927" "99" "1304" "0" "1305" "0" "c.1304_1305insC" "r.(?)" "p.(Thr436TyrfsTer12)" "" "0000375033" "00015744" "99" "1304" "0" "1305" "0" "c.1304_1305insC" "r.(?)" "p.(Thr436Tyrfs*12)" "11" "0000375034" "00025927" "35" "1205" "0" "1205" "0" "c.1205G>C" "r.(?)" "p.(Gly402Ala)" "" "0000375034" "00015744" "35" "1205" "0" "1205" "0" "c.1205G>C" "r.(=)" "p.(Gly402Ala)" "11" "0000375035" "00025927" "75" "875" "0" "875" "0" "c.875C>G" "r.(?)" "p.(Pro292Arg)" "" "0000375035" "00015744" "75" "875" "0" "875" "0" "c.875C>G" "r.(?)" "p.(Pro292Arg)" "8" "0000375036" "00025927" "15" "55" "0" "55" "0" "c.55T>A" "r.(?)" "p.(Ser19Thr)" "" "0000375036" "00015744" "15" "55" "0" "55" "0" "c.55T>A" "r.(?)" "p.(Ser19Thr)" "2" "0000375047" "00025927" "99" "3791" "0" "3794" "0" "c.3791_3794del" "r.(?)" "p.(Ile1264LysfsTer21)" "" "0000375047" "00015744" "99" "3791" "0" "3794" "0" "c.3791_3794del" "r.(?)" "p.(Ile1264Lysfs*21)" "28" "0000375048" "00015744" "99" "-28" "-1" "91" "1" "c.-28-?_91+?del" "r.(?)" "p.(?)" "1i_2i" "0000375049" "00025927" "75" "1286" "0" "1286" "0" "c.1286T>C" "r.(?)" "p.(Leu429Pro)" "" "0000375049" "00015744" "75" "1286" "0" "1286" "0" "c.1286T>C" "r.(?)" "p.(Leu429Pro)" "11" "0000375050" "00025927" "75" "1286" "0" "1286" "0" "c.1286T>C" "r.(?)" "p.(Leu429Pro)" "" "0000375050" "00015744" "75" "1286" "0" "1286" "0" "c.1286T>C" "r.(?)" "p.(Leu429Pro)" "11" "0000375051" "00025927" "75" "3862" "0" "3862" "0" "c.3862T>C" "r.(?)" "p.(Ser1288Pro)" "" "0000375051" "00015744" "75" "3862" "0" "3862" "0" "c.3862T>C" "r.(?)" "p.(Ser1288Pro)" "29" "0000375052" "00025927" "75" "4118" "0" "4118" "0" "c.4118C>T" "r.(?)" "p.(Thr1373Ile)" "" "0000375052" "00015744" "75" "4118" "0" "4118" "0" "c.4118C>T" "r.(?)" "p.(Thr1373Ile)" "30" "0000375053" "00025927" "75" "4118" "0" "4118" "0" "c.4118C>T" "r.(?)" "p.(Thr1373Ile)" "" "0000375053" "00015744" "75" "4118" "0" "4118" "0" "c.4118C>T" "r.(?)" "p.(Thr1373Ile)" "30" "0000375054" "00025927" "99" "1438" "0" "1438" "0" "c.1438del" "r.(?)" "p.(Ser480ArgfsTer2)" "" "0000375054" "00015744" "99" "1438" "0" "1438" "0" "c.1438del" "r.(?)" "p.(Ser480Argfs*2)" "12" "0000375055" "00025927" "35" "833" "0" "833" "0" "c.833G>A" "r.(?)" "p.(Arg278His)" "" "0000375055" "00015744" "35" "833" "0" "833" "0" "c.833G>A" "r.(=)" "p.(Arg278His)" "8" "0000375056" "00025927" "35" "833" "0" "833" "0" "c.833G>A" "r.(?)" "p.(Arg278His)" "" "0000375056" "00015744" "35" "833" "0" "833" "0" "c.833G>A" "r.(=)" "p.(Arg278His)" "8" "0000375057" "00025927" "35" "833" "0" "833" "0" "c.833G>A" "r.(?)" "p.(Arg278His)" "" "0000375057" "00015744" "35" "833" "0" "833" "0" "c.833G>A" "r.(=)" "p.(Arg278His)" "8" "0000375058" "00025927" "99" "3337" "0" "3337" "0" "c.3337G>T" "r.(?)" "p.(Glu1113Ter)" "" "0000375058" "00015744" "99" "3337" "0" "3337" "0" "c.3337G>T" "r.(?)" "p.(Glu1113*)" "25" "0000375059" "00025927" "99" "3337" "0" "3337" "0" "c.3337G>T" "r.(?)" "p.(Glu1113Ter)" "" "0000375059" "00015744" "99" "3337" "0" "3337" "0" "c.3337G>T" "r.(?)" "p.(Glu1113*)" "25" "0000375060" "00025927" "35" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000375060" "00015744" "35" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "22" "0000375061" "00025927" "99" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Ter)" "" "0000375061" "00015744" "99" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336*)" "10" "0000375062" "00025927" "99" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Ter)" "" "0000375062" "00015744" "99" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336*)" "10" "0000375063" "00025927" "75" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(Val1242Met)" "" "0000375063" "00015744" "75" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(Val1242Met)" "28" "0000375064" "00025927" "99" "158" "-1" "158" "-1" "c.158-1G>A" "r.spl" "p.?" "" "0000375064" "00015744" "99" "158" "-1" "158" "-1" "c.158-1G>A" "r.(?)" "p.(?)" "3i" "0000375066" "00025927" "11" "4671" "1344" "4671" "1344" "c.4671+1344A>C" "r.(?)" "p.(=)" "" "0000375066" "00015744" "11" "18514" "0" "18514" "0" "c.*12646A>C" "r.(=)" "p.(=)" "36" "0000375067" "00025927" "11" "92" "-57666" "92" "-57666" "c.92-57666A>G" "r.(?)" "p.(=)" "" "0000375067" "00015744" "11" "92" "-57666" "92" "-57666" "c.92-57666A>G" "r.(=)" "p.(=)" "2i" "0000375068" "00025927" "11" "92" "-57666" "92" "-57666" "c.92-57666A>G" "r.(?)" "p.(=)" "" "0000375068" "00015744" "11" "92" "-57666" "92" "-57666" "c.92-57666A>G" "r.(=)" "p.(=)" "2i" "0000375069" "00025927" "11" "1591" "0" "1591" "0" "c.1591C>T" "r.spl?" "p.(Leu531Phe)" "" "0000375069" "00015744" "11" "1591" "0" "1591" "0" "c.1591C>T" "r.spl?" "p.(Leu531Phe)" "14" "0000375070" "00015744" "99" "2869" "-1" "3122" "1" "c.2869-?_3122+?dup" "r.(?)" "p.(?)" "22_23" "0000375071" "00015744" "99" "2869" "-1" "3122" "1" "c.2869-?_3122+?dup" "r.(?)" "p.(?)" "22_23" "0000375072" "00025927" "99" "3513" "0" "3513" "0" "c.3513del" "r.(?)" "p.(Asp1172IlefsTer13)" "" "0000375072" "00015744" "99" "3513" "0" "3513" "0" "c.3513del" "r.(?)" "p.(Asp1172Ilefs*13)" "27" "0000375073" "00025927" "99" "3513" "0" "3513" "0" "c.3513del" "r.(?)" "p.(Asp1172IlefsTer13)" "" "0000375073" "00015744" "99" "3513" "0" "3513" "0" "c.3513del" "r.(?)" "p.(Asp1172Ilefs*13)" "27" "0000375074" "00025927" "15" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Lys)" "" "0000375074" "00015744" "15" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Lys)" "10" "0000375075" "00025927" "15" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Lys)" "" "0000375075" "00015744" "15" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Lys)" "10" "0000375076" "00025927" "99" "1063" "0" "1063" "0" "c.1063del" "r.(?)" "p.(Arg355GlufsTer66)" "" "0000375076" "00015744" "99" "1063" "0" "1063" "0" "c.1063del" "r.(?)" "p.(Arg355Glufs*66)" "10" "0000375077" "00025927" "99" "1063" "0" "1063" "0" "c.1063del" "r.(?)" "p.(Arg355GlufsTer66)" "" "0000375077" "00015744" "99" "1063" "0" "1063" "0" "c.1063del" "r.(?)" "p.(Arg355Glufs*66)" "10" "0000375078" "00025927" "99" "4202" "1" "4202" "1" "c.4202+1G>T" "r.spl" "p.?" "" "0000375078" "00015744" "99" "4202" "1" "4202" "1" "c.4202+1G>T" "r.(?)" "p.(?)" "30i" "0000375079" "00025927" "99" "3231" "0" "3231" "0" "c.3231dup" "r.(?)" "p.(Asp1078ArgfsTer6)" "" "0000375079" "00015744" "99" "3231" "0" "3231" "0" "c.3231dup" "r.(?)" "p.(Asp1078Argfs*6)" "24" "0000375080" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375080" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375081" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375081" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375082" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375082" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375083" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375083" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375084" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375084" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375085" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375085" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375086" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375086" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375087" "00025927" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000375087" "00015744" "75" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "19" "0000375088" "00025927" "99" "1865" "0" "1866" "0" "c.1865_1866insTA" "r.(?)" "p.(Leu623ThrfsTer8)" "" "0000375088" "00015744" "99" "1865" "0" "1866" "0" "c.1865_1866insTA" "r.(?)" "p.(Leu623Thrfs*8)" "15" "0000375089" "00025927" "99" "2959" "0" "2959" "0" "c.2959A>T" "r.(?)" "p.(Arg987Ter)" "" "0000375089" "00015744" "99" "2959" "0" "2959" "0" "c.2959A>T" "r.(?)" "p.(Arg987*)" "22" "0000375090" "00025927" "99" "92" "-2" "92" "-2" "c.92-2A>G" "r.spl" "p.?" "" "0000375090" "00015744" "99" "92" "-2" "92" "-2" "c.92-2A>G" "r.(?)" "p.(?)" "2i" "0000375091" "00025927" "75" "4128" "0" "4128" "0" "c.4128dup" "r.(?)" "p.(Leu1378ValfsTer26)" "" "0000375091" "00015744" "75" "4128" "0" "4128" "0" "c.4128dup" "r.(?)" "p.(Leu1378Valfs*26)" "30" "0000375092" "00015744" "99" "1099" "-1" "1305" "1" "c.1099-?_1305+?del" "r.(?)" "p.(?)" "11" "0000375093" "00025927" "99" "1950" "0" "1950" "0" "c.1950T>G" "r.(?)" "p.(Tyr650Ter)" "" "0000375093" "00015744" "99" "1950" "0" "1950" "0" "c.1950T>G" "r.(?)" "p.(Tyr650*)" "16" "0000375094" "00015744" "99" "-395" "-1" "91" "1" "c.-395-?_91+?del" "r.(?)" "p.(?)" "1_2" "0000375095" "00015744" "99" "-395" "-1" "91" "1" "c.-395-?_91+?del" "r.(?)" "p.(?)" "1_2" "0000375096" "00015744" "99" "-395" "-1" "91" "1" "c.-395-?_91+?del" "r.(?)" "p.(?)" "1_2" "0000375097" "00015744" "99" "-395" "-1" "91" "1" "c.-395-?_91+?del" "r.(?)" "p.(?)" "1_2" "0000375098" "00025927" "99" "4672" "-1564" "4672" "-1564" "c.4672-1564T>C" "r.(?)" "p.(=)" "" "0000375098" "00015744" "99" "19032" "0" "19032" "0" "c.*13164T>C" "r.(=)" "p.(=)" "39" "0000375099" "00015744" "99" "1785" "-1" "2220" "1" "c.1785-?_2220+?del" "r.(?)" "p.(?)" "15_18" "0000375100" "00025927" "99" "876" "29089" "1590" "3491" "c.876+29089_1590+3491del" "r.(?)" "p.(Glu293_Gln530del)" "" "0000375100" "00015744" "99" "876" "29089" "1590" "3491" "c.876+29089_1590+3491del" "r.(?)" "p.(Glu293_Gln530del)" "9i_14i" "0000375101" "00025927" "99" "876" "29089" "1590" "3491" "c.876+29089_1590+3491del" "r.(?)" "p.(Glu293_Gln530del)" "" "0000375101" "00015744" "99" "876" "29089" "1590" "3491" "c.876+29089_1590+3491del" "r.(?)" "p.(Glu293_Gln530del)" "9i_14i" "0000375102" "00025927" "99" "3901" "0" "3901" "0" "c.3901G>T" "r.(?)" "p.(Glu1301Ter)" "" "0000375102" "00015744" "99" "3901" "0" "3901" "0" "c.3901G>T" "r.(?)" "p.(Glu1301*)" "27" "0000375103" "00015744" "90" "158" "-1" "318" "1" "c.(157+1_158-1)_(318+1_319-1)del" "r.?" "p.?" "3i_4i" "0000458829" "00025927" "50" "1181" "0" "1181" "0" "c.1181A>G" "r.(?)" "p.(Tyr394Cys)" "" "0000458829" "00015744" "50" "1181" "0" "1181" "0" "c.1181A>G" "r.(?)" "p.(Tyr394Cys)" "" "0000540034" "00015744" "30" "20940" "0" "20940" "0" "c.*15072A>G" "r.(=)" "p.(=)" "" "0000540035" "00015744" "50" "20902" "0" "20902" "0" "c.*15034dup" "r.(?)" "p.(=)" "" "0000540036" "00015744" "70" "20902" "0" "20902" "0" "c.*15034dup" "r.(?)" "p.(=)" "" "0000540037" "00015744" "50" "19018" "0" "19018" "0" "c.*13150A>G" "r.(=)" "p.(=)" "" "0000540038" "00015744" "10" "18608" "0" "18608" "0" "c.*12740A>C" "r.(=)" "p.(=)" "" "0000540039" "00015744" "50" "18525" "0" "18525" "0" "c.*12657A>G" "r.(=)" "p.(=)" "" "0000540040" "00015744" "30" "18515" "0" "18515" "0" "c.*12647G>C" "r.(=)" "p.(=)" "" "0000540041" "00015744" "30" "18515" "0" "18515" "0" "c.*12647G>C" "r.(=)" "p.(=)" "" "0000540042" "00015744" "10" "18514" "0" "18514" "0" "c.*12646A>C" "r.(=)" "p.(=)" "" "0000540043" "00015744" "50" "18376" "0" "18402" "0" "c.*12508_*12534del" "r.(=)" "p.(=)" "" "0000540045" "00015744" "50" "17088" "0" "17088" "0" "c.*11220G>A" "r.(=)" "p.(=)" "" "0000540046" "00015744" "30" "5755" "0" "5755" "0" "c.5755T>A" "r.(?)" "p.(Cys1919Ser)" "" "0000540047" "00015744" "10" "5603" "0" "5603" "0" "c.5603C>T" "r.(?)" "p.(Thr1868Met)" "" "0000540048" "00015744" "30" "5603" "0" "5603" "0" "c.5603C>T" "r.(?)" "p.(Thr1868Met)" "" "0000540049" "00015744" "10" "5601" "0" "5603" "0" "c.5601_5603del" "r.(?)" "p.(Thr1869del)" "" "0000540050" "00015744" "50" "5573" "0" "5576" "0" "c.5573_5576dup" "r.(?)" "p.(Lys1859AsnfsTer2)" "" "0000540051" "00015744" "10" "5550" "0" "5550" "0" "c.5550C>A" "r.(?)" "p.(Thr1850=)" "" "0000540052" "00015744" "30" "5439" "0" "5439" "0" "c.5439A>C" "r.(?)" "p.(Pro1813=)" "" "0000540054" "00015744" "50" "5296" "0" "5304" "0" "c.5296_5304dup" "r.(?)" "p.(Ala1766_Pro1768dup)" "" "0000540055" "00015744" "50" "5294" "0" "5302" "0" "c.5294_5302del" "r.(?)" "p.(Leu1765_Pro1767del)" "" "0000540056" "00015744" "10" "5287" "0" "5292" "0" "c.5287_5292del" "r.(?)" "p.(Ala1763_Pro1764del)" "" "0000540057" "00015744" "30" "5278" "0" "5286" "0" "c.5278_5286del" "r.(?)" "p.(Pro1760_Pro1762del)" "" "0000540058" "00015744" "50" "5257" "0" "5277" "0" "c.5257_5277del" "r.(?)" "p.(Ile1753_Pro1759del)" "" "0000540059" "00015744" "10" "4974" "0" "4974" "0" "c.4974A>C" "r.(?)" "p.(Ser1658=)" "" "0000540060" "00015744" "30" "4974" "0" "4974" "0" "c.4974A>C" "r.(?)" "p.(Ser1658=)" "" "0000540061" "00015744" "30" "4939" "0" "4939" "0" "c.4939A>G" "r.(?)" "p.(Ile1647Val)" "" "0000540062" "00015744" "30" "4892" "0" "4892" "0" "c.4892C>A" "r.(?)" "p.(Ala1631Glu)" "" "0000540063" "00015744" "10" "4831" "0" "4834" "0" "c.4831_4834dup" "r.(?)" "p.(Thr1612LysfsTer11)" "" "0000540064" "00015744" "30" "4810" "0" "4810" "0" "c.4810A>G" "r.(?)" "p.(Arg1604Gly)" "" "0000540065" "00015744" "50" "4775" "0" "4775" "0" "c.4775C>A" "r.(?)" "p.(Pro1592Gln)" "" "0000540066" "00015744" "30" "4774" "0" "4774" "0" "c.4774C>T" "r.(?)" "p.(Pro1592Ser)" "" "0000540067" "00015744" "30" "4592" "0" "4592" "0" "c.4592A>G" "r.(?)" "p.(Glu1531Gly)" "" "0000540068" "00015744" "50" "4410" "0" "4420" "0" "c.4410_4420del" "r.(?)" "p.(Asn1470LysfsTer18)" "" "0000540069" "00015744" "30" "4320" "0" "4322" "0" "c.4320_4322dup" "r.(?)" "p.(Pro1443dup)" "" "0000540070" "00015744" "70" "4211" "2" "4211" "2" "c.4211+2T>G" "r.spl?" "p.?" "" "0000540071" "00015744" "10" "4024" "0" "4024" "0" "c.4024C>A" "r.(?)" "p.(Gln1342Lys)" "" "0000540072" "00015744" "10" "3983" "12" "3983" "12" "c.3983+12T>C" "r.(=)" "p.(=)" "" "0000540073" "00015744" "50" "3911" "0" "3911" "0" "c.3911C>G" "r.(?)" "p.(Thr1304Ser)" "" "0000540074" "00015744" "50" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "" "0000540075" "00015744" "70" "3817" "0" "3817" "0" "c.3817C>A" "r.(?)" "p.(Arg1273Ser)" "" "0000540076" "00015744" "30" "3807" "-6" "3807" "-6" "c.3807-6T>G" "r.(=)" "p.(=)" "" "0000540078" "00015744" "10" "3532" "0" "3532" "0" "c.3532G>A" "r.(?)" "p.(Val1178Ile)" "" "0000540079" "00015744" "10" "3532" "0" "3532" "0" "c.3532G>A" "r.(?)" "p.(Val1178Ile)" "" "0000540080" "00015744" "10" "3502" "-10" "3502" "-10" "c.3502-10dup" "r.(=)" "p.(=)" "" "0000540081" "00015744" "10" "3502" "-14" "3502" "-14" "c.3502-14del" "r.(=)" "p.(=)" "" "0000540082" "00015744" "10" "3373" "12" "3373" "12" "c.3373+12T>G" "r.(=)" "p.(=)" "" "0000540083" "00015744" "30" "3324" "0" "3324" "0" "c.3324A>G" "r.(?)" "p.(Gln1108=)" "" "0000540084" "00015744" "30" "3232" "3" "3232" "3" "c.3232+3G>T" "r.spl?" "p.?" "" "0000540085" "00015744" "50" "2990" "0" "2990" "0" "c.2990A>G" "r.(?)" "p.(Glu997Gly)" "" "0000540087" "00015744" "10" "2885" "0" "2885" "0" "c.2885G>T" "r.(?)" "p.(Arg962Leu)" "" "0000540088" "00015744" "30" "2885" "0" "2885" "0" "c.2885G>T" "r.(?)" "p.(Arg962Leu)" "" "0000540089" "00015744" "30" "2751" "9" "2751" "9" "c.2751+9T>C" "r.(=)" "p.(=)" "" "0000540090" "00015744" "30" "2751" "9" "2751" "9" "c.2751+9T>C" "r.(=)" "p.(=)" "" "0000540091" "00015744" "50" "2581" "0" "2581" "0" "c.2581G>A" "r.(?)" "p.(Val861Met)" "" "0000540092" "00015744" "50" "2581" "0" "2581" "0" "c.2581G>A" "r.(?)" "p.(Val861Met)" "" "0000540093" "00015744" "50" "2563" "0" "2563" "0" "c.2563C>T" "r.(?)" "p.(Arg855Trp)" "" "0000540094" "00015744" "50" "2446" "0" "2446" "0" "c.2446A>G" "r.(?)" "p.(Ser816Gly)" "" "0000540095" "00015744" "50" "2386" "0" "2386" "0" "c.2386G>A" "r.(?)" "p.(Val796Ile)" "" "0000540096" "00015744" "30" "2325" "0" "2325" "0" "c.2325G>A" "r.(?)" "p.(Val775=)" "" "0000540097" "00015744" "50" "2214" "0" "2214" "0" "c.2214A>C" "r.(?)" "p.(Gln738His)" "" "0000540098" "00015744" "50" "2194" "0" "2194" "0" "c.2194G>A" "r.(?)" "p.(Ala732Thr)" "" "0000540099" "00015744" "30" "1998" "0" "1998" "0" "c.1998C>T" "r.(?)" "p.(Thr666=)" "" "0000540100" "00015744" "10" "1998" "-13" "1998" "-10" "c.1998-13_1998-10del" "r.(=)" "p.(=)" "" "0000540101" "00015744" "10" "1917" "12" "1917" "13" "c.1917+12_1917+13dup" "r.(=)" "p.(=)" "" "0000540102" "00015744" "30" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Val634Ile)" "" "0000540103" "00015744" "50" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Val634Ile)" "" "0000540104" "00015744" "50" "1826" "0" "1826" "0" "c.1826A>G" "r.(?)" "p.(Asn609Ser)" "" "0000540105" "00015744" "30" "1653" "0" "1653" "0" "c.1653G>A" "r.(?)" "p.(Gly551=)" "" "0000540106" "00015744" "50" "1494" "0" "1494" "0" "c.1494A>G" "r.(?)" "p.(Gln498=)" "" "0000540107" "00015744" "30" "1440" "7" "1440" "7" "c.1440+7A>C" "r.(=)" "p.(=)" "" "0000540108" "00015744" "10" "1362" "0" "1362" "0" "c.1362C>T" "r.(?)" "p.(Val454=)" "" "0000540109" "00015744" "10" "1306" "-6" "1306" "-6" "c.1306-6dup" "r.(=)" "p.(=)" "" "0000540110" "00015744" "50" "1282" "0" "1282" "0" "c.1282G>C" "r.(?)" "p.(Ala428Pro)" "" "0000540111" "00015744" "90" "1209" "0" "1209" "0" "c.1209T>G" "r.(?)" "p.(Tyr403Ter)" "" "0000540112" "00015744" "10" "706" "-8" "706" "-8" "c.706-8C>T" "r.(=)" "p.(=)" "" "0000540113" "00015744" "50" "563" "0" "563" "0" "c.563A>C" "r.(?)" "p.(Glu188Ala)" "" "0000540114" "00015744" "50" "458" "0" "458" "0" "c.458A>G" "r.(?)" "p.(Tyr153Cys)" "" "0000540115" "00015744" "10" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000540116" "00015744" "10" "-5" "0" "-5" "0" "c.-5A>G" "r.(?)" "p.(=)" "" "0000600841" "00025927" "99" "2092" "-2569" "3502" "-14202" "c.2092-2569_3502-14202delinsCAC" "r.?" "p.?" "" "0000600841" "00015744" "99" "2092" "-2569" "3502" "-14202" "c.2092-2569_3502-14202delinsCAC" "r.?" "p.?" "18-26" "0000600842" "00025927" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "" "0000600842" "00015744" "11" "55" "0" "55" "0" "c.55T>G" "r.(?)" "p.(Ser19Ala)" "2" "0000600843" "00015744" "90" "0" "" "0" "" "c.1590+?::[NR_108046.1:n.271-?];[NM_001080512.1:c.2794+?]::c.1590+?" "r.-395_1590::[NR_108046.1:r.271_659],[NM_001080512.1:r.1_2794]::r.1591_*758" "p.?" "20i" "0000602994" "00025927" "90" "2191" "0" "2191" "0" "c.2191G>T" "r.(?)" "p.(Glu731Ter)" "" "0000602994" "00015744" "90" "2191" "0" "2191" "0" "c.2191G>T" "r.(?)" "p.(Glu731*)" "" "0000612500" "00015744" "50" "20902" "0" "20902" "0" "c.*15034dup" "r.(?)" "p.(=)" "" "0000612501" "00015744" "30" "20815" "0" "20815" "0" "c.*14947C>T" "r.(=)" "p.(=)" "" "0000612502" "00015744" "50" "5351" "0" "5351" "0" "c.5351C>A" "r.(?)" "p.(Pro1784His)" "" "0000612503" "00015744" "30" "5206" "0" "5206" "0" "c.5206C>T" "r.(?)" "p.(His1736Tyr)" "" "0000612504" "00015744" "50" "5073" "0" "5073" "0" "c.5073T>G" "r.(?)" "p.(Ser1691Arg)" "" "0000612505" "00015744" "50" "3754" "0" "3754" "0" "c.3754G>C" "r.(?)" "p.(Val1252Leu)" "" "0000612506" "00015744" "50" "3718" "-3" "3718" "-3" "c.3718-3C>G" "r.spl?" "p.?" "" "0000612507" "00015744" "50" "3555" "0" "3555" "0" "c.3555A>G" "r.(?)" "p.(Ile1185Met)" "" "0000612508" "00015744" "30" "3183" "0" "3183" "0" "c.3183T>A" "r.(?)" "p.(Ala1061=)" "" "0000612509" "00015744" "50" "1799" "0" "1799" "0" "c.1799C>G" "r.(?)" "p.(Thr600Ser)" "" "0000612510" "00015744" "90" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000622389" "00015744" "50" "4320" "0" "4322" "0" "c.4320_4322dup" "r.(?)" "p.(Pro1443dup)" "" "0000622390" "00015744" "50" "4132" "0" "4132" "0" "c.4132T>A" "r.(?)" "p.(Leu1378Met)" "" "0000622391" "00015744" "50" "3194" "0" "3194" "0" "c.3194A>G" "r.(?)" "p.(Gln1065Arg)" "" "0000622392" "00015744" "90" "3010" "-3" "3010" "-2" "c.3010-3_3010-2del" "r.spl?" "p.?" "" "0000647916" "00025927" "10" "5124" "0" "5124" "0" "c.5124G>A" "r.(?)" "p.(Lys1708=)" "" "0000647916" "00015744" "10" "21048" "0" "21048" "0" "c.*15180G>A" "r.(=)" "p.(=)" "" "0000647917" "00025927" "10" "5124" "0" "5124" "0" "c.5124G>A" "r.(?)" "p.(Lys1708=)" "" "0000647917" "00015744" "10" "17139" "0" "17139" "0" "c.*11271G>A" "r.(=)" "p.(=)" "" "0000647918" "00025927" "30" "3451" "0" "3451" "0" "c.3451G>A" "r.(?)" "p.(Gly1151Arg)" "" "0000647918" "00015744" "30" "3451" "0" "3451" "0" "c.3451G>A" "r.(?)" "p.(Gly1151Arg)" "" "0000647919" "00025927" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000647919" "00015744" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000647920" "00025927" "50" "2768" "0" "2768" "0" "c.2768C>T" "r.(?)" "p.(Pro923Leu)" "" "0000647920" "00015744" "50" "2768" "0" "2768" "0" "c.2768C>T" "r.(?)" "p.(Pro923Leu)" "" "0000647921" "00025927" "50" "2581" "0" "2581" "0" "c.2581G>A" "r.(?)" "p.(Val861Met)" "" "0000647921" "00015744" "50" "2581" "0" "2581" "0" "c.2581G>A" "" "p.(Val861Met)" "" "0000647922" "00025927" "50" "2563" "0" "2563" "0" "c.2563C>T" "r.(?)" "p.(Arg855Trp)" "" "0000647922" "00015744" "50" "2563" "0" "2563" "0" "c.2563C>T" "r.(?)" "p.(Arg855Trp)" "" "0000647923" "00025927" "50" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "" "0000647923" "00015744" "50" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "" "0000647924" "00025927" "50" "546" "0" "546" "0" "c.546A>G" "r.(?)" "p.(Gly182=)" "" "0000647924" "00015744" "50" "546" "0" "546" "0" "c.546A>G" "r.(=)" "p.(=)" "" "0000656499" "00015744" "30" "18473" "0" "18473" "0" "c.*12605G>A" "r.(=)" "p.(=)" "" "0000656500" "00015744" "10" "5550" "0" "5550" "0" "c.5550C>A" "r.(?)" "p.(Thr1850=)" "" "0000656501" "00015744" "30" "2624" "0" "2624" "0" "c.2624C>T" "r.(?)" "p.(Ser875Leu)" "" "0000656502" "00015744" "30" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245Gln)" "" "0000669065" "00025927" "50" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "" "0000669065" "00015744" "50" "1910" "0" "1910" "0" "c.1910A>G" "r.(?)" "p.(Asn637Ser)" "" "0000678848" "00015744" "50" "4644" "0" "4689" "0" "c.4644_4689dup" "r.(?)" "p.(Arg1564CysfsTer13)" "" "0000678849" "00015744" "50" "2813" "0" "2813" "0" "c.2813A>G" "r.(?)" "p.(Asp938Gly)" "" "0000684546" "00025927" "70" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000684546" "00015744" "70" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000684778" "00025927" "30" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000684778" "00015744" "30" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000684779" "00025927" "30" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000684779" "00015744" "30" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000684839" "00025927" "90" "3661" "0" "3661" "0" "c.3661C>T" "r.(?)" "p.(Gln1221Ter)" "" "0000684839" "00015744" "90" "3661" "0" "3661" "0" "c.3661C>T" "r.(?)" "p.(Gln1221*)" "" "0000685338" "00025927" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000685338" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000685685" "00025927" "90" "1737" "0" "1737" "0" "c.1737C>G" "r.(?)" "p.(Tyr579Ter)" "" "0000685685" "00015744" "90" "1737" "0" "1737" "0" "c.1737C>G" "r.(?)" "p.(Tyr579*)" "" "0000690725" "00015744" "50" "5269" "0" "5280" "0" "c.5269_5280del" "r.(?)" "p.(Ser1757_Pro1760del)" "" "0000690726" "00015744" "30" "5044" "0" "5044" "0" "c.5044G>A" "r.(?)" "p.(Glu1682Lys)" "" "0000690727" "00015744" "30" "4552" "0" "4552" "0" "c.4552G>A" "r.(?)" "p.(Asp1518Asn)" "" "0000690728" "00015744" "50" "4323" "0" "4328" "0" "c.4323_4328dup" "r.(?)" "p.(Pro1442_Pro1443dup)" "" "0000708851" "00025927" "50" "2305" "0" "2305" "0" "c.2305G>A" "r.(?)" "p.(Gly769Arg)" "" "0000708851" "00015744" "50" "2305" "0" "2305" "0" "c.2305G>A" "r.(?)" "p.(Gly769Arg)" "" "0000722842" "00015744" "90" "20914" "0" "20914" "0" "c.*15046dup" "r.(?)" "p.(=)" "" "0000722843" "00015744" "50" "18505" "0" "18505" "0" "c.*12637del" "r.(?)" "p.(=)" "" "0000722844" "00015744" "50" "18241" "0" "18243" "0" "c.*12373_*12375del" "r.(=)" "p.(=)" "" "0000722845" "00015744" "50" "5279" "0" "5293" "0" "c.5279_5293del" "r.(?)" "p.(Pro1760_Pro1764del)" "" "0000722846" "00015744" "30" "3450" "0" "3450" "0" "c.3450C>A" "r.(?)" "p.(Ile1150=)" "" "0000722847" "00015744" "50" "1440" "0" "1440" "0" "c.1440G>A" "r.(?)" "p.(Ser480=)" "" "0000722848" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000722849" "00015744" "30" "92" "-10" "92" "-10" "c.92-10C>T" "r.(=)" "p.(=)" "" "0000729807" "00025927" "90" "4368" "-2928" "4368" "-2928" "c.4368-2928del" "r.(?)" "p.(=)" "" "0000729807" "00015744" "90" "4568" "0" "4568" "0" "c.4568del" "r.(?)" "p.(Ser1523Metfs*11)" "" "0000729808" "00025927" "90" "4368" "-2928" "4368" "-2928" "c.4368-2928del" "r.(?)" "p.(=)" "" "0000729808" "00015744" "90" "4568" "0" "4568" "0" "c.4568del" "r.(?)" "p.(Ser1523Metfs*11)" "" "0000730122" "00025927" "90" "3232" "1" "3232" "1" "c.3232+1G>A" "r.spl" "p.?" "" "0000730122" "00015744" "90" "3232" "1" "3232" "1" "c.3232+1G>A" "r.spl" "p.?" "" "0000730123" "00025927" "90" "189" "0" "194" "0" "c.189_194delinsGGACAACA" "r.(?)" "p.(Gly64AspfsTer11)" "" "0000730123" "00015744" "90" "189" "0" "194" "0" "c.189_194delinsGGACAACA" "r.(?)" "p.(Gly64Aspfs*11)" "" "0000730124" "00025927" "70" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Leu531Phe)" "" "0000730124" "00015744" "70" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Leu531Phe)" "" "0000730125" "00025927" "90" "1198" "0" "1198" "0" "c.1198delinsAGA" "r.(?)" "p.(Tyr400ArgfsTer22)" "" "0000730125" "00015744" "90" "1198" "0" "1198" "0" "c.1198delinsAGA" "r.(?)" "p.(Tyr400Argfs*22)" "" "0000730139" "00025927" "70" "1134" "0" "1134" "0" "c.1134T>G" "r.(?)" "p.(Phe378Leu)" "" "0000730139" "00015744" "70" "1134" "0" "1134" "0" "c.1134T>G" "r.(?)" "p.(Phe378Leu)" "" "0000730215" "00025927" "50" "3451" "0" "3451" "0" "c.3451G>A" "r.(?)" "p.(Gly1151Arg)" "" "0000730215" "00015744" "50" "3451" "0" "3451" "0" "c.3451G>A" "r.(?)" "p.(Gly1151Arg)" "" "0000730218" "00025927" "50" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336Gln)" "" "0000730218" "00015744" "50" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336Gln)" "" "0000730226" "00025927" "90" "1737" "0" "1738" "0" "c.1737_1738insA" "r.(?)" "p.(Ala580SerfsTer9)" "" "0000730226" "00015744" "90" "1737" "0" "1738" "0" "c.1737_1738insA" "r.(?)" "p.(Ala580Serfs*9)" "" "0000730254" "00025927" "70" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000730254" "00015744" "70" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000730261" "00025927" "90" "189" "0" "194" "0" "c.189_194delinsGGACAACA" "r.(?)" "p.(Gly64AspfsTer11)" "" "0000730261" "00015744" "90" "189" "0" "194" "0" "c.189_194delinsGGACAACA" "r.(?)" "p.(Gly64Aspfs*11)" "" "0000730298" "00025927" "90" "3441" "0" "3441" "0" "c.3441dup" "r.(?)" "p.(Phe1148IlefsTer8)" "" "0000730298" "00015744" "90" "3441" "0" "3441" "0" "c.3441dup" "r.(?)" "p.(Phe1148Ilefs*8)" "" "0000730308" "00025927" "50" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000730308" "00015744" "50" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000732466" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000732497" "00015744" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000732507" "00015744" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000732881" "00025927" "70" "706" "-3" "717" "0" "c.706-3_717del" "r.spl" "p.?" "" "0000732881" "00015744" "70" "706" "-3" "717" "0" "c.706-3_717del" "r.spl" "p.?" "" "0000733248" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733248" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733249" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733249" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733250" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733250" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733251" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733251" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733252" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733252" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733253" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733253" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733254" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000733254" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000733662" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000735994" "00025927" "50" "4368" "-2200" "4368" "-2192" "c.4368-2200_4368-2192dup" "r.(?)" "p.(=)" "" "0000735994" "00015744" "50" "5296" "0" "5304" "0" "c.5296_5304dup" "r.(?)" "p.(Ala1766_Pro1768dup)" "35" "0000736844" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000736845" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000736846" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000736847" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000759737" "00025927" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134Ter)" "" "0000759737" "00015744" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134Ter)" "" "0000759978" "00025927" "50" "4314" "0" "4322" "0" "c.4314_4322del" "r.(?)" "p.(Pro1441_Pro1443del)" "" "0000759978" "00015744" "50" "4306" "0" "4314" "0" "c.4306_4314del" "r.(?)" "p.(Pro1441_Pro1443del)" "" "0000760067" "00025927" "50" "4860" "0" "4860" "0" "c.4860G>A" "r.(?)" "p.(Thr1620=)" "" "0000760067" "00015744" "50" "20784" "0" "20784" "0" "c.*14916G>A" "r.(=)" "p.(=)" "" "0000760248" "00025927" "50" "4368" "-2132" "4368" "-2123" "c.4368-2132_4368-2123del" "r.(?)" "p.(=)" "" "0000760248" "00015744" "50" "5364" "0" "5373" "0" "c.5364_5373del" "r.(?)" "p.(Pro1789LeufsTer52)" "" "0000760470" "00025927" "50" "4368" "-1931" "4368" "-1931" "c.4368-1931C>A" "r.(?)" "p.(=)" "" "0000760470" "00015744" "50" "5586" "0" "5586" "0" "c.5586C>A" "r.(?)" "p.(Ala1862=)" "" "0000765231" "00025927" "90" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "" "0000765231" "00015744" "90" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "" "0000765232" "00015744" "90" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000765348" "00015744" "90" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000783895" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000783981" "00015744" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000783984" "00015744" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000784001" "00025927" "10" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000784001" "00015744" "10" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000784002" "00025927" "50" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Leu531Phe)" "" "0000784002" "00015744" "50" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Leu531Phe)" "" "0000784166" "00025927" "50" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000784166" "00015744" "50" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000784167" "00025927" "50" "1195" "0" "1195" "0" "c.1195A>C" "r.(?)" "p.(Ser399Arg)" "" "0000784167" "00015744" "50" "1195" "0" "1195" "0" "c.1195A>C" "r.(?)" "p.(Ser399Arg)" "" "0000784662" "00025927" "50" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000784662" "00015744" "50" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000784663" "00025927" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000784663" "00015744" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000785520" "00025927" "50" "2768" "0" "2768" "0" "c.2768C>T" "r.(?)" "p.(Pro923Leu)" "" "0000785520" "00015744" "50" "2768" "0" "2768" "0" "c.2768C>T" "r.(?)" "p.(Pro923Leu)" "" "0000788381" "00025927" "50" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "" "0000788381" "00015744" "50" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "13" "0000788468" "00025927" "50" "4368" "-2307" "4368" "-2307" "c.4368-2307T>A" "r.(?)" "p.(=)" "" "0000788468" "00015744" "50" "5189" "0" "5189" "0" "c.5189T>A" "r.(?)" "p.(Ile1730Asn)" "33" "0000790737" "00015744" "70" "0" "0" "0" "0" "c.-395_91+15408{0}" "r.0?" "p.0?" "_1_2i" "0000794017" "00025927" "90" "4368" "-2630" "4368" "-2629" "c.4368-2630_4368-2629insGACA" "r.(?)" "p.(=)" "" "0000794017" "00015744" "90" "4866" "0" "4867" "0" "c.4866_4867insGACA" "r.(?)" "p.(Asn1623Aspfs*8)" "31" "0000794020" "00025927" "90" "4368" "-2232" "4368" "-2231" "c.4368-2232_4368-2231insGTCT" "r.(?)" "p.(=)" "" "0000794020" "00015744" "90" "5264" "0" "5265" "0" "c.5264_5265insGTCT" "r.(?)" "p.(Pro1756Serfs*16)" "31" "0000794147" "00015744" "70" "1066" "0" "1067" "0" "c.1066_1067del" "r.(?)" "p.(Asp356Leufs*6)" "" "0000794341" "00025927" "90" "1863" "0" "1864" "0" "c.1863_1864dup" "r.(?)" "p.(Ser622IlefsTer9)" "" "0000794341" "00015744" "90" "1863" "0" "1864" "0" "c.1863_1864dup" "r.(?)" "p.(Ser622Ilefs*9)" "15" "0000794863" "00025927" "50" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000794863" "00015744" "50" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000795861" "00025927" "70" "109" "0" "109" "0" "c.109G>T" "r.(?)" "p.(Gly37Ter)" "" "0000795861" "00015744" "70" "109" "0" "109" "0" "c.109G>T" "r.(?)" "p.(Gly37*)" "3" "0000797556" "00015744" "70" "3984" "-1" "4367" "1" "c.(3983+1_3984-1)_(4367+1_4368-1)del" "r.(?)" "p.(?)" "" "0000798039" "00025927" "70" "4368" "-1649" "4368" "-1648" "c.4368-1649_4368-1648del" "r.(?)" "p.(=)" "" "0000798039" "00015744" "70" "5847" "0" "5848" "0" "c.5847_5848del" "r.(?)" "p.(His1949Glnfs*14)" "" "0000798040" "00025927" "70" "594" "0" "594" "0" "c.594G>A" "r.(?)" "p.(Pro198=)" "" "0000798040" "00015744" "70" "594" "0" "594" "0" "c.594G>A" "r.(?)" "p.(Pro198=)" "" "0000804450" "00015744" "30" "20985" "0" "20985" "0" "c.*15117A>C" "r.(=)" "p.(=)" "" "0000804451" "00015744" "30" "18497" "0" "18497" "0" "c.*12629T>C" "r.(=)" "p.(=)" "" "0000804452" "00015744" "50" "5726" "0" "5726" "0" "c.5726G>A" "r.(?)" "p.(Arg1909His)" "" "0000804453" "00015744" "50" "5618" "0" "5618" "0" "c.5618C>G" "r.(?)" "p.(Thr1873Arg)" "" "0000804454" "00015744" "30" "5557" "0" "5557" "0" "c.5557A>C" "r.(?)" "p.(Met1853Leu)" "" "0000804455" "00015744" "30" "5278" "0" "5286" "0" "c.5278_5286del" "r.(?)" "p.(Pro1760_Pro1762del)" "" "0000804456" "00015744" "30" "4080" "0" "4080" "0" "c.4080G>A" "r.(?)" "p.(Val1360=)" "" "0000804457" "00015744" "50" "3101" "0" "3101" "0" "c.3101G>A" "r.(?)" "p.(Arg1034His)" "" "0000804458" "00015744" "30" "2754" "0" "2754" "0" "c.2754T>C" "r.(?)" "p.(Asp918=)" "" "0000804459" "00015744" "30" "1489" "0" "1489" "0" "c.1489A>G" "r.(?)" "p.(Ile497Val)" "" "0000813849" "00025927" "70" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643Ter)" "" "0000813849" "00015744" "70" "1927" "0" "1927" "0" "c.1927C>T" "r.(?)" "p.(Arg643*)" "" "0000816215" "00025927" "70" "1591" "-250" "1784" "251" "c.1591-250_1784+251del" "r.spl" "p.?" "" "0000816215" "00015744" "70" "1591" "-250" "1784" "251" "c.1591-250_1784+251del" "r.spl" "p.(?)" "" "0000816796" "00025927" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000816796" "00015744" "70" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245*)" "" "0000818934" "00015744" "70" "-28" "-1" "2220" "1" "c.(?_-28-1)_(2220+1_2221-1)del" "r.0?" "p.0?" "_2_18i" "0000818935" "00025927" "70" "2624" "0" "2624" "0" "c.2624C>T" "r.(?)" "p.(Ser875Leu)" "" "0000818935" "00015744" "70" "2624" "0" "2624" "0" "c.2624C>T" "r.(?)" "p.(Ser880Leu)" "19" "0000819322" "00025927" "70" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991Ter)" "" "0000819322" "00015744" "70" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "" "0000819374" "00025927" "70" "3791" "0" "3794" "0" "c.3791_3794del" "r.(?)" "p.(Ile1264LysfsTer21)" "" "0000819374" "00015744" "70" "3791" "0" "3794" "0" "c.3791_3794del" "r.(?)" "p.(Ile1264Lysfs*21)" "" "0000819383" "00015744" "70" "92" "-1" "4367" "1" "c.(91+1_92-1)_(4367+1_4368-1)dup" "r.spl" "p.(?)" "" "0000819460" "00015744" "70" "158" "-1" "318" "1" "c.(157+1_158-1)_(318+1_319-1)del" "r.spl" "p.(?)" "" "0000819461" "00015744" "70" "158" "-1" "318" "1" "c.(157+1_158-1)_(318+1_319-1)del" "r.spl" "p.(?)" "" "0000820613" "00015744" "70" "92" "-1" "4367" "1" "c.(91+1_92-1)_(4367+1_4368-1)del" "r.spl" "p.(?)" "" "0000820627" "00015744" "70" "-28" "-1" "91" "1" "c.(-29+1_-28-1)_(91+1_92-1)del" "r.spl" "p.(?)" "" "0000821467" "00015744" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000821648" "00015744" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000822956" "00015744" "70" "0" "0" "0" "0" "c.?" "r.spl" "p.(?)" "" "0000823168" "00025927" "70" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000823168" "00015744" "70" "2367" "0" "2369" "0" "c.2367_2369del" "r.(?)" "p.(Val790del)" "" "0000825883" "00025927" "70" "4368" "-1775" "4368" "-1772" "c.4368-1775_4368-1772del" "r.(?)" "p.(=)" "" "0000825883" "00015744" "70" "5721" "0" "5724" "0" "c.5721_5724del" "r.(?)" "p.(Gln1907Hisfs*22)" "31" "0000825885" "00025927" "70" "4368" "-1779" "4368" "-1779" "c.4368-1779dup" "r.(?)" "p.(=)" "" "0000825885" "00015744" "70" "5717" "0" "5717" "0" "c.5717dup" "r.(?)" "p.(Gln1907Thrfs*17)" "31" "0000825978" "00025927" "70" "841" "0" "841" "0" "c.841A>G" "r.(?)" "p.(Thr281Ala)" "" "0000825978" "00015744" "70" "841" "0" "841" "0" "c.841A>G" "r.?" "p.(Thr281Ala)" "8" "0000825979" "00025927" "70" "146" "0" "146" "0" "c.146A>G" "r.(?)" "p.(Glu49Gly)" "" "0000825979" "00015744" "70" "146" "0" "146" "0" "c.146A>G" "r.(?)" "p.(Glu49Gly)" "3" "0000826010" "00025927" "70" "4368" "-2684" "4368" "-2684" "c.4368-2684G>T" "r.(?)" "p.(=)" "" "0000826010" "00015744" "70" "4812" "0" "4812" "0" "c.4812G>T" "r.?" "p.(Arg1604Ser)" "31" "0000826011" "00025927" "70" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(Val1242Met)" "" "0000826011" "00015744" "70" "3724" "0" "3724" "0" "c.3724G>A" "r.?" "p.(Val1242Met)" "28" "0000826450" "00025927" "50" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000826450" "00015744" "50" "733" "0" "733" "0" "c.733C>T" "r.?" "p.(Arg245*)" "7" "0000826492" "00025927" "30" "2885" "0" "2885" "0" "c.2885G>T" "r.(?)" "p.(Arg962Leu)" "" "0000826492" "00015744" "30" "2885" "0" "2885" "0" "c.2885G>T" "r.?" "p.(Arg962Leu)" "21" "0000827479" "00025927" "90" "556" "0" "556" "0" "c.556C>T" "r.(?)" "p.(Gln186Ter)" "" "0000827479" "00015744" "90" "556" "0" "556" "0" "c.556C>T" "r.(?)" "p.(Gln186*)" "6" "0000827480" "00025927" "70" "308" "0" "308" "0" "c.308T>G" "r.(?)" "p.(Leu103Arg)" "" "0000827480" "00015744" "70" "308" "0" "308" "0" "c.308T>G" "r.(?)" "p.(Leu103Arg)" "4" "0000827481" "00025927" "70" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "" "0000827481" "00015744" "70" "401" "0" "401" "0" "c.401G>A" "r.(?)" "p.(Arg134Gln)" "5" "0000827482" "00025927" "50" "4368" "-2209" "4368" "-2204" "c.4368-2209_4368-2204del" "r.(?)" "p.(=)" "" "0000827482" "00015744" "50" "5287" "0" "5292" "0" "c.5287_5292del" "r.(?)" "p.(Ser1763_Gly1764del)" "31" "0000828797" "00025927" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000828797" "00015744" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000828900" "00025927" "70" "4368" "-2908" "4368" "-2907" "c.4368-2908_4368-2907insGAGA" "r.(?)" "p.(=)" "" "0000828900" "00015744" "70" "4587" "0" "4588" "0" "c.4587_4588insAGAG" "r.(?)" "p.(Lys1530Argfs*33)" "" "0000829002" "00025927" "50" "4368" "-2209" "4368" "-2204" "c.4368-2209_4368-2204del" "r.(?)" "p.(=)" "" "0000829002" "00015744" "50" "5287" "0" "5292" "0" "c.5287_5292del" "r.(?)" "p.(Ala1763_Pro1764del)" "" "0000829478" "00025927" "70" "4368" "-2763" "4368" "-2760" "c.4368-2763_4368-2760del" "r.(?)" "p.(=)" "" "0000829478" "00015744" "70" "4733" "0" "4736" "0" "c.4733_4736del" "r.(?)" "p.(Arg1579Valfs*14)" "31" "0000829479" "00025927" "70" "1737" "0" "1738" "0" "c.1737_1738insA" "r.(?)" "p.(Ala580SerfsTer9)" "" "0000829479" "00015744" "70" "1737" "0" "1738" "0" "c.1737_1738insA" "r.(?)" "p.(Pro580Thrfs*6)" "14" "0000829507" "00025927" "50" "92" "-528" "92" "-528" "c.92-528C>T" "r.(?)" "p.(=)" "" "0000829507" "00015744" "50" "92" "-528" "92" "-528" "c.92-528C>T" "r.(=)" "p.(=)" "2i" "0000829508" "00025927" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000829508" "00015744" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Glu435Ala)" "11" "0000829537" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2" "0000829538" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2" "0000829539" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2" "0000829540" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2" "0000829541" "00015744" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2" "0000829706" "00025927" "90" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "" "0000829706" "00015744" "90" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Arg991*)" "" "0000829727" "00015744" "70" "-189197" "0" "610" "-5166" "c.-189197_610-5166del" "r.?" "p.?" "" "0000847531" "00025927" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000847531" "00015744" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000847532" "00025927" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000847532" "00015744" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000847533" "00025927" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000847533" "00015744" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000847534" "00025927" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "" "0000847534" "00015744" "70" "1304" "0" "1304" "0" "c.1304A>C" "r.(?)" "p.(Asp435Ala)" "11" "0000852498" "00025927" "50" "4671" "1058" "4671" "1058" "c.4671+1058A>G" "r.(=)" "p.(=)" "" "0000852498" "00015744" "50" "18228" "0" "18228" "0" "c.*12360A>G" "r.(=)" "p.(=)" "" "0000852499" "00025927" "30" "4368" "-2768" "4368" "-2768" "c.4368-2768G>A" "r.(=)" "p.(=)" "" "0000852499" "00015744" "30" "4728" "0" "4728" "0" "c.4728G>A" "r.(?)" "p.(Gln1576=)" "" "0000852500" "00025927" "50" "4368" "-2815" "4368" "-2812" "c.4368-2815_4368-2812dup" "r.(=)" "p.(=)" "" "0000852500" "00015744" "50" "4681" "0" "4684" "0" "c.4681_4684dup" "r.(?)" "p.(Ser1562*)" "" "0000852501" "00025927" "30" "4202" "7" "4202" "7" "c.4202+7A>T" "r.(=)" "p.(=)" "" "0000852501" "00015744" "30" "4202" "7" "4202" "7" "c.4202+7A>T" "r.(=)" "p.(=)" "" "0000852502" "00025927" "30" "3963" "0" "3963" "0" "c.3963C>T" "r.(?)" "p.(Ile1321=)" "" "0000852502" "00015744" "30" "3963" "0" "3963" "0" "c.3963C>T" "r.(?)" "p.(Ile1321=)" "" "0000852503" "00025927" "50" "2918" "0" "2918" "0" "c.2918C>A" "r.(?)" "p.(Pro973His)" "" "0000852503" "00015744" "50" "2918" "0" "2918" "0" "c.2918C>A" "r.(?)" "p.(Pro973His)" "" "0000852504" "00015744" "30" "2885" "0" "2885" "0" "c.2885G>T" "r.(?)" "p.(Arg962Leu)" "" "0000852505" "00015744" "50" "2563" "0" "2563" "0" "c.2563C>T" "r.(?)" "p.(Arg855Trp)" "" "0000852506" "00015744" "30" "2435" "0" "2435" "0" "c.2435T>C" "r.(?)" "p.(Ile812Thr)" "" "0000852507" "00025927" "30" "2202" "0" "2202" "0" "c.2202C>T" "r.(?)" "p.(Ala734=)" "" "0000852507" "00015744" "30" "2202" "0" "2202" "0" "c.2202C>T" "r.(?)" "p.(Ala734=)" "" "0000852508" "00025927" "50" "1306" "0" "1306" "0" "c.1306A>G" "r.(?)" "p.(Thr436Ala)" "" "0000852508" "00015744" "50" "1306" "0" "1306" "0" "c.1306A>G" "r.(?)" "p.(Thr436Ala)" "" "0000852509" "00015744" "90" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Arg3Ter)" "" "0000861922" "00025927" "30" "4672" "-1682" "4672" "-1682" "c.4672-1682T>C" "r.(=)" "p.(=)" "" "0000861922" "00015744" "30" "18914" "0" "18914" "0" "c.*13046T>C" "r.(=)" "p.(=)" "" "0000861924" "00025927" "30" "4368" "-1961" "4368" "-1961" "c.4368-1961T>C" "r.(=)" "p.(=)" "" "0000861924" "00015744" "30" "5535" "0" "5535" "0" "c.5535T>C" "r.(?)" "p.(Gly1845=)" "" "0000861925" "00025927" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Arg105Gly)" "" "0000861925" "00015744" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Arg105Gly)" "" "0000861926" "00025927" "30" "63" "0" "63" "0" "c.63T>C" "r.(?)" "p.(Phe21=)" "" "0000861926" "00015744" "30" "63" "0" "63" "0" "c.63T>C" "r.(?)" "p.(Phe21=)" "" "0000872663" "00015744" "90" "319" "-1" "474" "1" "c.(?_319-1)_(474+1_?)del" "r.spl" "p.?" "" "0000889158" "00015744" "30" "20784" "0" "20784" "0" "c.*14916G>A" "r.(=)" "p.(=)" "" "0000889159" "00025927" "50" "4672" "-1653" "4672" "-1653" "c.4672-1653dup" "r.(=)" "p.(=)" "" "0000889159" "00015744" "50" "18943" "0" "18943" "0" "c.*13075dup" "r.(?)" "p.(=)" "" "0000889160" "00015744" "30" "4812" "0" "4812" "0" "c.4812G>T" "r.(?)" "p.(Arg1604Ser)" "" "0000889161" "00015744" "30" "3324" "0" "3324" "0" "c.3324A>G" "r.(?)" "p.(Gln1108=)" "" "0000889162" "00025927" "30" "2538" "0" "2538" "0" "c.2538C>T" "r.(?)" "p.(Val846=)" "" "0000889162" "00015744" "30" "2538" "0" "2538" "0" "c.2538C>T" "r.(?)" "p.(Val846=)" "" "0000889163" "00025927" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Thr301=)" "" "0000889163" "00015744" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Thr301=)" "" "0000896506" "00025927" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000896506" "00015744" "50" "2884" "0" "2884" "0" "c.2884C>T" "r.(?)" "p.(Arg962Cys)" "" "0000896507" "00025927" "50" "4368" "-2209" "4368" "-2204" "c.4368-2209_4368-2204del" "r.(?)" "p.(=)" "" "0000896507" "00015744" "50" "5287" "0" "5292" "0" "c.5287_5292del" "r.(?)" "p.(Ala1763_Pro1764del)" "" "0000896633" "00025927" "70" "4368" "-2928" "4368" "-2927" "c.4368-2928_4368-2927insAGAG" "r.(?)" "p.(=)" "" "0000896633" "00015744" "70" "4568" "0" "4569" "0" "c.4568_4569insAGAG" "r.(?)" "p.(Ser1523ArgfsTer5)" "" "0000913284" "00015744" "70" "18387" "0" "18387" "0" "c.*12519C>T" "r.(=)" "p.(=)" "" "0000913285" "00025927" "30" "2379" "0" "2379" "0" "c.2379T>C" "r.(?)" "p.(Asp793=)" "" "0000913285" "00015744" "30" "2379" "0" "2379" "0" "c.2379T>C" "r.(?)" "p.(Asp793=)" "" "0000917865" "00025927" "50" "1098" "2354" "1098" "2354" "c.1098+2354G>A" "r.(?)" "p.(=)" "" "0000917865" "00015744" "50" "1098" "2354" "1098" "2354" "c.1098+2354G>A" "r.(?)" "p.(=)" "" "0000925162" "00025927" "50" "949" "0" "949" "0" "c.949T>A" "r.(?)" "p.(Ser317Thr)" "" "0000925162" "00015744" "50" "949" "0" "949" "0" "c.949T>A" "r.(?)" "p.(Ser317Thr)" "" "0000929683" "00025927" "70" "4240" "0" "4240" "0" "c.4240C>T" "r.(?)" "p.(Arg1414*)" "" "0000929683" "00015744" "70" "4240" "0" "4240" "0" "c.4240C>T" "r.(?)" "p.(Arg1414*)" "" "0000944158" "00015744" "90" "1591" "-1" "1917" "1" "c.(1590+1_1591-1)_(1917+1_1918-1)del" "r.?" "p.?" "" "0000944159" "00025927" "90" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000944159" "00015744" "90" "400" "0" "400" "0" "c.400C>G" "r.(?)" "p.(Arg134Gly)" "" "0000944160" "00025927" "70" "788" "0" "788" "0" "c.788C>A" "r.(?)" "p.(Pro263Gln)" "" "0000944160" "00015744" "70" "788" "0" "788" "0" "c.788C>A" "r.(?)" "p.(Pro263Gln)" "" "0000944161" "00025927" "90" "1737" "0" "1737" "0" "c.1737C>A" "r.(?)" "p.(Tyr579Ter)" "" "0000944161" "00015744" "90" "1737" "0" "1737" "0" "c.1737C>A" "p.(Tyr584*)" "p.(Tyr579Ter)" "" "0000946832" "00025927" "70" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336Gln)" "" "0000946832" "00015744" "70" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336Gln)" "" "0000946833" "00025927" "70" "2906" "0" "2906" "0" "c.2906A>T" "r.(?)" "p.(Asp969Val)" "" "0000946833" "00015744" "70" "2906" "0" "2906" "0" "c.2906A>T" "r.(?)" "p.(Asp969Val)" "" "0000949405" "00025927" "50" "4368" "-2775" "4368" "-2775" "c.4368-2775G>A" "r.(=)" "p.(=)" "" "0000949405" "00015744" "50" "4721" "0" "4721" "0" "c.4721G>A" "r.(?)" "p.(Trp1574*)" "" "0000958422" "00025927" "90" "366" "0" "366" "0" "c.366del" "r.(?)" "p.(Asn122LysfsTer14)" "" "0000958422" "00015744" "90" "366" "0" "366" "0" "c.366del" "r.(?)" "p.(Asn122LysfsTer14)" "" "0000958452" "00025927" "70" "4991" "0" "4991" "0" "c.4991dup" "r.(?)" "p.(Met1664IlefsTer18)" "" "0000958452" "00015744" "70" "4817" "0" "4817" "0" "c.4817dup" "r.(?)" "p.(Met1601IlefsTer18)" "" "0000958745" "00025927" "90" "4128" "0" "4128" "0" "c.4128dup" "r.(?)" "p.(Leu1378ValfsTer26)" "" "0000958745" "00015744" "90" "4128" "0" "4128" "0" "c.4128dup" "r.(?)" "p.(Leu1378ValfsTer26)" "" "0000958749" "00025927" "90" "1997" "1" "1997" "1" "c.1997+1G>A" "r.spl" "p.?" "" "0000958749" "00015744" "90" "1997" "1" "1997" "1" "c.1997+1G>A" "r.spl" "p.?" "" "0000958750" "00025927" "90" "2191" "0" "2191" "0" "c.2191G>T" "r.(?)" "p.(Glu731Ter)" "" "0000958750" "00015744" "90" "2191" "0" "2191" "0" "c.2191G>T" "r.(?)" "p.(Glu731Ter)" "" "0000958755" "00025927" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000958755" "00015744" "90" "733" "0" "733" "0" "c.733C>T" "r.(?)" "p.(Arg245Ter)" "" "0000959199" "00025927" "70" "986" "-5151" "993" "0" "c.986-5151_993del" "r.spl" "p.?" "" "0000959199" "00015744" "70" "986" "-5151" "993" "0" "c.986-5151_993del" "r.spl" "p.?" "" "0000959201" "00025927" "90" "3983" "1" "3983" "1" "c.3983+1G>T" "r.spl" "p.?" "" "0000959201" "00015744" "90" "3983" "1" "3983" "1" "c.3983+1G>T" "r.spl" "p.?" "" "0000959236" "00025927" "50" "2581" "0" "2581" "0" "c.2581G>A" "r.(?)" "p.(Val861Met)" "" "0000959236" "00015744" "50" "2581" "0" "2581" "0" "c.2581G>A" "r.(?)" "p.(Val861Met)" "" "0000959237" "00025927" "50" "4368" "-2044" "4368" "-2044" "c.4368-2044C>A" "r.(?)" "p.(=)" "" "0000959237" "00015744" "50" "5452" "0" "5452" "0" "c.5452C>A" "r.(?)" "p.(Leu1818Ile)" "" "0000959275" "00025927" "90" "4368" "-2852" "4368" "-2807" "c.4368-2852_4368-2807dup" "r.(?)" "p.(=)" "" "0000959275" "00015744" "90" "4644" "0" "4689" "0" "c.4644_4689dup" "r.(?)" "p.(Arg1564CysfsTer13)" "" "0000959375" "00025927" "70" "4368" "-2763" "4368" "-2760" "c.4368-2763_4368-2760del" "r.(?)" "p.(=)" "" "0000959375" "00015744" "70" "4733" "0" "4736" "0" "c.4733_4736del" "r.(?)" "p.(Val1578AlafsTer6)" "" "0000965748" "00025927" "50" "4368" "-2122" "4368" "-2117" "c.4368-2122_4368-2117del" "r.(=)" "p.(=)" "" "0000965748" "00015744" "50" "5374" "0" "5379" "0" "c.5374_5379del" "r.(?)" "p.(Pro1792_Pro1793del)" "" "0000965749" "00025927" "50" "4325" "0" "4325" "0" "c.4325C>T" "r.(?)" "p.(Pro1442Leu)" "" "0000965749" "00015744" "50" "4325" "0" "4325" "0" "c.4325C>T" "r.(?)" "p.(Pro1442Leu)" "" "0000965750" "00025927" "30" "4317" "0" "4322" "0" "c.4317_4322dup" "r.(?)" "p.(Pro1442_Pro1443dup)" "" "0000965750" "00015744" "30" "4317" "0" "4322" "0" "c.4317_4322dup" "r.(?)" "p.(Pro1442_Pro1443dup)" "" "0000965752" "00025927" "70" "3123" "-1728" "3123" "-1728" "c.3123-1728A>G" "r.(=)" "p.(=)" "" "0000965752" "00015744" "70" "3123" "-1728" "3123" "-1728" "c.3123-1728A>G" "r.(=)" "p.(=)" "" "0000965753" "00025927" "90" "3122" "1" "3122" "1" "c.3122+1G>A" "r.spl?" "p.?" "" "0000965753" "00015744" "90" "3122" "1" "3122" "1" "c.3122+1G>A" "r.spl?" "p.?" "" "0000965757" "00025927" "50" "131" "0" "131" "0" "c.131T>C" "r.(?)" "p.(Val44Ala)" "" "0000965757" "00015744" "50" "131" "0" "131" "0" "c.131T>C" "r.(?)" "p.(Val44Ala)" "" "0000979069" "00025927" "30" "4640" "0" "4640" "0" "c.4640G>A" "r.(?)" "p.(Gly1547Asp)" "" "0000979069" "00015744" "30" "17139" "0" "17139" "0" "c.*11271G>A" "r.(=)" "p.(=)" "" "0000979070" "00015744" "30" "2751" "9" "2751" "9" "c.2751+9T>C" "r.(=)" "p.(=)" "" "0000985484" "00025927" "70" "2151" "0" "2151" "0" "c.2151del" "r.(?)" "p.(Phe717LeufsTer23)" "" "0000985484" "00015744" "70" "2149" "0" "2149" "0" "c.2149del" "r.(?)" "p.(Phe717Leufs*23)" "" "0000985495" "00025927" "70" "2221" "-9695" "3806" "3452" "c.2221-9695_3806+3452del" "r.?" "p.?" "" "0000985495" "00015744" "70" "2221" "-9695" "3806" "3452" "c.2221-9695_3806+3452del" "r.?" "p.?" "" "0001014627" "00015744" "30" "18897" "0" "18897" "0" "c.*13029G>A" "r.(=)" "p.(=)" "" "0001037921" "00025927" "70" "4127" "0" "4127" "0" "c.4127C>A" "r.(?)" "p.(Ala1376Asp)" "" "0001037921" "00015744" "70" "4127" "0" "4127" "0" "c.4127C>A" "r.(?)" "p.(Ala1376Asp)" "" "0001037922" "00025927" "50" "1997" "0" "1997" "0" "c.1997C>T" "r.(?)" "p.(Thr666Ile)" "" "0001037922" "00015744" "50" "1997" "0" "1997" "0" "c.1997C>T" "r.(?)" "p.(Thr666Ile)" "" "0001044616" "00015744" "90" "3717" "5" "3717" "5" "c.3717+5G>A" "r.3717_3718ins[GTAAA;3717+6_3717+51]" "p.Val1240_Ser1241insAsnArgTer" "27i" "0001045523" "00015744" "70" "2843" "0" "2847" "0" "c.2843_2847dup" "r.(2843_2847dup)" "p.(Ala950PhefsTer16)" "" "0001065227" "00025927" "50" "1339" "0" "1339" "0" "c.1339G>A" "r.(?)" "p.(Asp447Asn)" "" "0001065227" "00015744" "50" "1339" "0" "1339" "0" "c.1339G>A" "r.(?)" "p.(Asp447Asn)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 866 "{{screeningid}}" "{{variantid}}" "0000059160" "0000089977" "0000059160" "0000089978" "0000060223" "0000091209" "0000080110" "0000128993" "0000080110" "0000128994" "0000081146" "0000130232" "0000156381" "0000358303" "0000166633" "0000374652" "0000167010" "0000374262" "0000167010" "0000374270" "0000167011" "0000374271" "0000167012" "0000374272" "0000167013" "0000374273" "0000167014" "0000374275" "0000167014" "0000374276" "0000167014" "0000374280" "0000167014" "0000374281" "0000167014" "0000374290" "0000167014" "0000374291" "0000167015" "0000374274" "0000167016" "0000374289" "0000167016" "0000374294" "0000167016" "0000374297" "0000167016" "0000374298" "0000167016" "0000374299" "0000167016" "0000374300" "0000167016" "0000374301" "0000167016" "0000374318" "0000167016" "0000374339" "0000167016" "0000374360" "0000167016" "0000374361" "0000167016" "0000374379" "0000167016" "0000374382" "0000167016" "0000374383" "0000167016" "0000374404" "0000167016" "0000374427" "0000167016" "0000374428" "0000167016" "0000374453" "0000167016" "0000374477" "0000167016" "0000374478" "0000167016" "0000374508" "0000167016" "0000374509" "0000167017" "0000374279" "0000167017" "0000374302" "0000167017" "0000374303" "0000167017" "0000374319" "0000167017" "0000374320" "0000167017" "0000374362" "0000167017" "0000374363" "0000167017" "0000374377" "0000167017" "0000374380" "0000167017" "0000374384" "0000167017" "0000374385" "0000167017" "0000374405" "0000167017" "0000374406" "0000167017" "0000374429" "0000167017" "0000374430" "0000167017" "0000374454" "0000167017" "0000374455" "0000167017" "0000374479" "0000167017" "0000374480" "0000167017" "0000374510" "0000167017" "0000374511" "0000167017" "0000374532" "0000167017" "0000374539" "0000167017" "0000374540" "0000167017" "0000374541" "0000167018" "0000374304" "0000167018" "0000374305" "0000167018" "0000374321" "0000167018" "0000374322" "0000167018" "0000374340" "0000167018" "0000374341" "0000167018" "0000374364" "0000167018" "0000374365" "0000167018" "0000374386" "0000167018" "0000374387" "0000167018" "0000374407" "0000167018" "0000374408" "0000167018" "0000374431" "0000167018" "0000374432" "0000167018" "0000374456" "0000167018" "0000374481" "0000167018" "0000374512" "0000167018" "0000374542" "0000167018" "0000374552" "0000167018" "0000374553" "0000167018" "0000374554" "0000167018" "0000374562" "0000167019" "0000374266" "0000167019" "0000374306" "0000167019" "0000374323" "0000167019" "0000374366" "0000167019" "0000374367" "0000167019" "0000374378" "0000167019" "0000374381" "0000167019" "0000374388" "0000167019" "0000374409" "0000167019" "0000374410" "0000167019" "0000374433" "0000167019" "0000374434" "0000167019" "0000374457" "0000167019" "0000374482" "0000167019" "0000374483" "0000167019" "0000374513" "0000167019" "0000374543" "0000167019" "0000374555" "0000167019" "0000374563" "0000167019" "0000374565" "0000167019" "0000374566" "0000167019" "0000374567" "0000167019" "0000374568" "0000167020" "0000374307" "0000167020" "0000374308" "0000167020" "0000374324" "0000167020" "0000374325" "0000167020" "0000374342" "0000167020" "0000374343" "0000167020" "0000374368" "0000167020" "0000374369" "0000167020" "0000374435" "0000167020" "0000374436" "0000167020" "0000374458" "0000167020" "0000374459" "0000167020" "0000374484" "0000167020" "0000374485" "0000167020" "0000374506" "0000167020" "0000374514" "0000167020" "0000374544" "0000167020" "0000374545" "0000167020" "0000374571" "0000167020" "0000374575" "0000167020" "0000374576" "0000167020" "0000374577" "0000167020" "0000374578" "0000167020" "0000374581" "0000167020" "0000374582" "0000167021" "0000374309" "0000167021" "0000374310" "0000167021" "0000374326" "0000167021" "0000374327" "0000167021" "0000374344" "0000167021" "0000374345" "0000167021" "0000374389" "0000167021" "0000374390" "0000167021" "0000374411" "0000167021" "0000374412" "0000167021" "0000374437" "0000167021" "0000374438" "0000167021" "0000374460" "0000167021" "0000374461" "0000167021" "0000374486" "0000167021" "0000374487" "0000167021" "0000374507" "0000167021" "0000374515" "0000167021" "0000374588" "0000167021" "0000374589" "0000167021" "0000374598" "0000167021" "0000374599" "0000167022" "0000374631" "0000167022" "0000374635" "0000167023" "0000374632" "0000167023" "0000374636" "0000167024" "0000374633" "0000167024" "0000374637" "0000167025" "0000374634" "0000167025" "0000374638" "0000167026" "0000374646" "0000167027" "0000374651" "0000167028" "0000374641" "0000167028" "0000374910" "0000167029" "0000374654" "0000167030" "0000374656" "0000167031" "0000374657" "0000167031" "0000374911" "0000167032" "0000374658" "0000167033" "0000374660" "0000167034" "0000374661" "0000167036" "0000374664" "0000167036" "0000374665" "0000167037" "0000374662" "0000167038" "0000374666" "0000167038" "0000374667" "0000167039" "0000374690" "0000167039" "0000374693" "0000167040" "0000374691" "0000167040" "0000375031" "0000167041" "0000374692" "0000167041" "0000374694" "0000167042" "0000374700" "0000167043" "0000374610" "0000167043" "0000374621" "0000167044" "0000374611" "0000167044" "0000374622" "0000167045" "0000374612" "0000167045" "0000374623" "0000167046" "0000374613" "0000167046" "0000374624" "0000167047" "0000374614" "0000167047" "0000374625" "0000167048" "0000374615" "0000167048" "0000374626" "0000167049" "0000374616" "0000167049" "0000374627" "0000167050" "0000374617" "0000167050" "0000374628" "0000167051" "0000374618" "0000167051" "0000374629" "0000167052" "0000374619" "0000167052" "0000374630" "0000167053" "0000374620" "0000167053" "0000374701" "0000167054" "0000374668" "0000167054" "0000374671" "0000167055" "0000374669" "0000167055" "0000374672" "0000167056" "0000374670" "0000167056" "0000374673" "0000167057" "0000374702" "0000167057" "0000374707" "0000167058" "0000374703" "0000167058" "0000374708" "0000167059" "0000374704" "0000167059" "0000374709" "0000167060" "0000374705" "0000167060" "0000374710" "0000167061" "0000374706" "0000167061" "0000374711" "0000167062" "0000374712" "0000167062" "0000374717" "0000167063" "0000374713" "0000167063" "0000374718" "0000167064" "0000374714" "0000167064" "0000374719" "0000167065" "0000374715" "0000167065" "0000374720" "0000167066" "0000374716" "0000167066" "0000374721" "0000167067" "0000374722" "0000167067" "0000374725" "0000167068" "0000374723" "0000167068" "0000374726" "0000167069" "0000374724" "0000167069" "0000374727" "0000167070" "0000374533" "0000167070" "0000374536" "0000167071" "0000374534" "0000167071" "0000374537" "0000167072" "0000374535" "0000167072" "0000374538" "0000167073" "0000374735" "0000167073" "0000374741" "0000167074" "0000374736" "0000167074" "0000374742" "0000167075" "0000374737" "0000167075" "0000374743" "0000167076" "0000374738" "0000167076" "0000374744" "0000167077" "0000374739" "0000167077" "0000374745" "0000167078" "0000374740" "0000167078" "0000374746" "0000167079" "0000374684" "0000167079" "0000374687" "0000167080" "0000374685" "0000167080" "0000374688" "0000167081" "0000374686" "0000167081" "0000374689" "0000167082" "0000374728" "0000167082" "0000374731" "0000167083" "0000374729" "0000167083" "0000374732" "0000167084" "0000374730" "0000167084" "0000374733" "0000167085" "0000374747" "0000167085" "0000374758" "0000167086" "0000374748" "0000167086" "0000374759" "0000167087" "0000374749" "0000167087" "0000374760" "0000167088" "0000374750" "0000167088" "0000374761" "0000167089" "0000374751" "0000167089" "0000374762" "0000167090" "0000374752" "0000167090" "0000374763" "0000167091" "0000374753" "0000167091" "0000374764" "0000167092" "0000374754" "0000167092" "0000374765" "0000167093" "0000374755" "0000167093" "0000374766" "0000167094" "0000374756" "0000167094" "0000374767" "0000167095" "0000374757" "0000167095" "0000374768" "0000167096" "0000374769" "0000167096" "0000374776" "0000167097" "0000374770" "0000167097" "0000374777" "0000167098" "0000374771" "0000167098" "0000374778" "0000167099" "0000374772" "0000167099" "0000374779" "0000167100" "0000374773" "0000167100" "0000374780" "0000167101" "0000374774" "0000167101" "0000374781" "0000167102" "0000374775" "0000167102" "0000374782" "0000167103" "0000374783" "0000167103" "0000374786" "0000167104" "0000374784" "0000167104" "0000374787" "0000167105" "0000374785" "0000167105" "0000374788" "0000167106" "0000374789" "0000167106" "0000374794" "0000167107" "0000374790" "0000167107" "0000374795" "0000167108" "0000374791" "0000167108" "0000374796" "0000167109" "0000374792" "0000167109" "0000374797" "0000167110" "0000374793" "0000167110" "0000374798" "0000167111" "0000374799" "0000167111" "0000374803" "0000167112" "0000374800" "0000167112" "0000374804" "0000167113" "0000374801" "0000167113" "0000374805" "0000167114" "0000374802" "0000167114" "0000374806" "0000167115" "0000374807" "0000167115" "0000374809" "0000167116" "0000374808" "0000167116" "0000374810" "0000167117" "0000374674" "0000167117" "0000374679" "0000167118" "0000374675" "0000167118" "0000374680" "0000167119" "0000374676" "0000167119" "0000374681" "0000167120" "0000374677" "0000167120" "0000374682" "0000167121" "0000374678" "0000167121" "0000374683" "0000167122" "0000374819" "0000167122" "0000374824" "0000167123" "0000374825" "0000167124" "0000374826" "0000167125" "0000374820" "0000167126" "0000374818" "0000167127" "0000374827" "0000167128" "0000374639" "0000167128" "0000374640" "0000167129" "0000374256" "0000167129" "0000374257" "0000167129" "0000374346" "0000167129" "0000374347" "0000167129" "0000374462" "0000167129" "0000374463" "0000167129" "0000374488" "0000167129" "0000374489" "0000167129" "0000374516" "0000167129" "0000374517" "0000167129" "0000374556" "0000167129" "0000374557" "0000167129" "0000374828" "0000167129" "0000374829" "0000167129" "0000374833" "0000167129" "0000374834" "0000167129" "0000374835" "0000167129" "0000374836" "0000167129" "0000374845" "0000167129" "0000374846" "0000167129" "0000374847" "0000167129" "0000374848" "0000167129" "0000374851" "0000167129" "0000374852" "0000167129" "0000374855" "0000167129" "0000374856" "0000167346" "0000374258" "0000167346" "0000374259" "0000167346" "0000374282" "0000167346" "0000374283" "0000167346" "0000374311" "0000167346" "0000374312" "0000167346" "0000374328" "0000167346" "0000374329" "0000167346" "0000374348" "0000167346" "0000374349" "0000167346" "0000374391" "0000167346" "0000374392" "0000167346" "0000374413" "0000167346" "0000374414" "0000167346" "0000374439" "0000167346" "0000374440" "0000167346" "0000374464" "0000167346" "0000374465" "0000167346" "0000374491" "0000167346" "0000374492" "0000167346" "0000374518" "0000167346" "0000374519" "0000167346" "0000374590" "0000167346" "0000374591" "0000167346" "0000374600" "0000167346" "0000374601" "0000167346" "0000374902" "0000167346" "0000374903" "0000167346" "0000374906" "0000167346" "0000374907" "0000167349" "0000374912" "0000167353" "0000374260" "0000167353" "0000374267" "0000167353" "0000374350" "0000167353" "0000374370" "0000167353" "0000374415" "0000167353" "0000374441" "0000167353" "0000374493" "0000167353" "0000374520" "0000167353" "0000374558" "0000167353" "0000374559" "0000167353" "0000374602" "0000167353" "0000374695" "0000167353" "0000374858" "0000167353" "0000374870" "0000167353" "0000374882" "0000167353" "0000374892" "0000167353" "0000374914" "0000167353" "0000374915" "0000167353" "0000374916" "0000167354" "0000374268" "0000167354" "0000374269" "0000167354" "0000374490" "0000167354" "0000374494" "0000167354" "0000374546" "0000167354" "0000374569" "0000167354" "0000374883" "0000167354" "0000374921" "0000167354" "0000374922" "0000167355" "0000374284" "0000167355" "0000374285" "0000167355" "0000374313" "0000167355" "0000374314" "0000167355" "0000374330" "0000167355" "0000374331" "0000167355" "0000374351" "0000167355" "0000374352" "0000167355" "0000374371" "0000167355" "0000374372" "0000167355" "0000374393" "0000167355" "0000374394" "0000167355" "0000374416" "0000167355" "0000374417" "0000167355" "0000374442" "0000167355" "0000374443" "0000167355" "0000374495" "0000167355" "0000374496" "0000167355" "0000374521" "0000167355" "0000374522" "0000167355" "0000374547" "0000167355" "0000374548" "0000167355" "0000374859" "0000167355" "0000374860" "0000167355" "0000374871" "0000167355" "0000374872" "0000167355" "0000374893" "0000167355" "0000374894" "0000167355" "0000374908" "0000167355" "0000374909" "0000167355" "0000374925" "0000167355" "0000374926" "0000167355" "0000374930" "0000167355" "0000374931" "0000167355" "0000374934" "0000167355" "0000374935" "0000167355" "0000374936" "0000167355" "0000374937" "0000167356" "0000374261" "0000167356" "0000374286" "0000167356" "0000374315" "0000167356" "0000374332" "0000167356" "0000374353" "0000167356" "0000374373" "0000167356" "0000374395" "0000167356" "0000374396" "0000167356" "0000374418" "0000167356" "0000374419" "0000167356" "0000374444" "0000167356" "0000374445" "0000167356" "0000374466" "0000167356" "0000374467" "0000167356" "0000374497" "0000167356" "0000374498" "0000167356" "0000374523" "0000167356" "0000374524" "0000167356" "0000374549" "0000167356" "0000374560" "0000167356" "0000374861" "0000167356" "0000374862" "0000167356" "0000374873" "0000167356" "0000374874" "0000167356" "0000374884" "0000167356" "0000374885" "0000167356" "0000374917" "0000167356" "0000374938" "0000167377" "0000374939" "0000167389" "0000374940" "0000167389" "0000374943" "0000167390" "0000374941" "0000167390" "0000374944" "0000167391" "0000374942" "0000167391" "0000374945" "0000167404" "0000374592" "0000167404" "0000374593" "0000167405" "0000374653" "0000167445" "0000374821" "0000167447" "0000374822" "0000167469" "0000374295" "0000167469" "0000374951" "0000167472" "0000374955" "0000167472" "0000374958" "0000167473" "0000374961" "0000167474" "0000374962" "0000167475" "0000374956" "0000167476" "0000374583" "0000167479" "0000374965" "0000167481" "0000374967" "0000167482" "0000374963" "0000167482" "0000374968" "0000167486" "0000374970" "0000167490" "0000374972" "0000167494" "0000374830" "0000167495" "0000374973" "0000167495" "0000374975" "0000167495" "0000374976" "0000167496" "0000374977" "0000167497" "0000374971" "0000167501" "0000374927" "0000167501" "0000374928" "0000167507" "0000374647" "0000167508" "0000374957" "0000167517" "0000374978" "0000167518" "0000374982" "0000167519" "0000374983" "0000167521" "0000374979" "0000167525" "0000374986" "0000167525" "0000374987" "0000167532" "0000374988" "0000167532" "0000374989" "0000167533" "0000374990" "0000167534" "0000374584" "0000167539" "0000374648" "0000167539" "0000374991" "0000167540" "0000374585" "0000167540" "0000374952" "0000167542" "0000374995" "0000167546" "0000374296" "0000167546" "0000374954" "0000167547" "0000374996" "0000167547" "0000374997" "0000167549" "0000374998" "0000167551" "0000374984" "0000167551" "0000374985" "0000167551" "0000375001" "0000167552" "0000375002" "0000167554" "0000374969" "0000167554" "0000375004" "0000167556" "0000374992" "0000167558" "0000375005" "0000167560" "0000374649" "0000167563" "0000374980" "0000167569" "0000374993" "0000167570" "0000375006" "0000167572" "0000374587" "0000167573" "0000374468" "0000167573" "0000374469" "0000167573" "0000374579" "0000167573" "0000374580" "0000167573" "0000374603" "0000167573" "0000374604" "0000167573" "0000374837" "0000167573" "0000374838" "0000167573" "0000375007" "0000167573" "0000375008" "0000167574" "0000375009" "0000167574" "0000375010" "0000167581" "0000374974" "0000167581" "0000375013" "0000167581" "0000375014" "0000167581" "0000375015" "0000167581" "0000375016" "0000167583" "0000374966" "0000167592" "0000374950" "0000167606" "0000374959" "0000167612" "0000374650" "0000167613" "0000374586" "0000167614" "0000374994" "0000167618" "0000375017" "0000167619" "0000375018" "0000167625" "0000374960" "0000167625" "0000375019" "0000167627" "0000374981" "0000167629" "0000375020" "0000167629" "0000375021" "0000167629" "0000375022" "0000167629" "0000375023" "0000167629" "0000375024" "0000167631" "0000375025" "0000167633" "0000374964" "0000167637" "0000374953" "0000167773" "0000374292" "0000167773" "0000374293" "0000167786" "0000375026" "0000167786" "0000375029" "0000167929" "0000375030" "0000167930" "0000375033" "0000168018" "0000375034" "0000168019" "0000375035" "0000168019" "0000375036" "0000168026" "0000375047" "0000168026" "0000375048" "0000168033" "0000375049" "0000168033" "0000375050" "0000168034" "0000375051" "0000168034" "0000375053" "0000168035" "0000375052" "0000168035" "0000375054" "0000168117" "0000374734" "0000168160" "0000375055" "0000168161" "0000375056" "0000168162" "0000375057" "0000168180" "0000375058" "0000168180" "0000375059" "0000168181" "0000374594" "0000168181" "0000374595" "0000168182" "0000375060" "0000168183" "0000375061" "0000168184" "0000375063" "0000168185" "0000375064" "0000168320" "0000374287" "0000168320" "0000374605" "0000168320" "0000374606" "0000168320" "0000374839" "0000168320" "0000374840" "0000168320" "0000374929" "0000168320" "0000375066" "0000168320" "0000375067" "0000168320" "0000375068" "0000168321" "0000374607" "0000168321" "0000374608" "0000168321" "0000374841" "0000168321" "0000374842" "0000168322" "0000374288" "0000168322" "0000374609" "0000168322" "0000374843" "0000168322" "0000374844" "0000168322" "0000375069" "0000168527" "0000375070" "0000168527" "0000375071" "0000168530" "0000375072" "0000168530" "0000375073" "0000168547" "0000375075" "0000168548" "0000375074" "0000168552" "0000374823" "0000168563" "0000374655" "0000168564" "0000374642" "0000168564" "0000374643" "0000168582" "0000375076" "0000168582" "0000375077" "0000168585" "0000375078" "0000168585" "0000375079" "0000168610" "0000375080" "0000168610" "0000375084" "0000168611" "0000375081" "0000168611" "0000375085" "0000168612" "0000375082" "0000168612" "0000375086" "0000168613" "0000375083" "0000168613" "0000375087" "0000168642" "0000375088" "0000168642" "0000375089" "0000168686" "0000374811" "0000168686" "0000374815" "0000168687" "0000374812" "0000168687" "0000374816" "0000168688" "0000374813" "0000168688" "0000374817" "0000168689" "0000374814" "0000168689" "0000375003" "0000168690" "0000374696" "0000168690" "0000374697" "0000168691" "0000374644" "0000168691" "0000374645" "0000168692" "0000375062" "0000168692" "0000375090" "0000168693" "0000375091" "0000168693" "0000375092" "0000168694" "0000375093" "0000168694" "0000375096" "0000168695" "0000375094" "0000168695" "0000375097" "0000168696" "0000375095" "0000168696" "0000375098" "0000168697" "0000375099" "0000168732" "0000375100" "0000168732" "0000375101" "0000168913" "0000375102" "0000168913" "0000375103" "0000226531" "0000458829" "0000268165" "0000600841" "0000268165" "0000600842" "0000268165" "0000600843" "0000270254" "0000602994" "0000291227" "0000647916" "0000291228" "0000647917" "0000291229" "0000647918" "0000291230" "0000647919" "0000291231" "0000647920" "0000291232" "0000647921" "0000291233" "0000647922" "0000291234" "0000647923" "0000291235" "0000647924" "0000305377" "0000669065" "0000309673" "0000684546" "0000309876" "0000684778" "0000309877" "0000684779" "0000309936" "0000684839" "0000310427" "0000685338" "0000310737" "0000685685" "0000332528" "0000729807" "0000332529" "0000729808" "0000332834" "0000730122" "0000332834" "0000730226" "0000332835" "0000730123" "0000332835" "0000730261" "0000332836" "0000730124" "0000332837" "0000730125" "0000332837" "0000730298" "0000332838" "0000730218" "0000332838" "0000730308" "0000332851" "0000730139" "0000332851" "0000730254" "0000332927" "0000730215" "0000334580" "0000732466" "0000334586" "0000732497" "0000334589" "0000732507" "0000334874" "0000732881" "0000335239" "0000733248" "0000335240" "0000733249" "0000335241" "0000733250" "0000335242" "0000733251" "0000335243" "0000733252" "0000335244" "0000733253" "0000335245" "0000733254" "0000335245" "0000733662" "0000336569" "0000735994" "0000337214" "0000736844" "0000337215" "0000736845" "0000337216" "0000736846" "0000337217" "0000736847" "0000360059" "0000759737" "0000360186" "0000759978" "0000360209" "0000760067" "0000360356" "0000760248" "0000360356" "0000760470" "0000362654" "0000784166" "0000362654" "0000784167" "0000364451" "0000765231" "0000364451" "0000765348" "0000364452" "0000765232" "0000373746" "0000783895" "0000373746" "0000783981" "0000373750" "0000783984" "0000373756" "0000784001" "0000373756" "0000784002" "0000373915" "0000784662" "0000373915" "0000784663" "0000374699" "0000785520" "0000376610" "0000788381" "0000376625" "0000788468" "0000378068" "0000790737" "0000380819" "0000794017" "0000380822" "0000794020" "0000380907" "0000794147" "0000381052" "0000794341" "0000381417" "0000794863" "0000382075" "0000795861" "0000383457" "0000797556" "0000383784" "0000798039" "0000383785" "0000798040" "0000386365" "0000813849" "0000388057" "0000816215" "0000388336" "0000816796" "0000389714" "0000818934" "0000389714" "0000818935" "0000389977" "0000819322" "0000389977" "0000820613" "0000390029" "0000819374" "0000390029" "0000820627" "0000390038" "0000819383" "0000390115" "0000819460" "0000390116" "0000819461" "0000391717" "0000821467" "0000391717" "0000821648" "0000392613" "0000822956" "0000392735" "0000823168" "0000394833" "0000825883" "0000394833" "0000825885" "0000394897" "0000825978" "0000394897" "0000825979" "0000394919" "0000826010" "0000394919" "0000826011" "0000395212" "0000826450" "0000395236" "0000826492" "0000395959" "0000827479" "0000395959" "0000827480" "0000395960" "0000827481" "0000395960" "0000827482" "0000397051" "0000828797" "0000397051" "0000829002" "0000397154" "0000828900" "0000397480" "0000829478" "0000397481" "0000829479" "0000397509" "0000829507" "0000397510" "0000829508" "0000397533" "0000829537" "0000397534" "0000829538" "0000397534" "0000829539" "0000397535" "0000829540" "0000397535" "0000829541" "0000397658" "0000829706" "0000397658" "0000829727" "0000410255" "0000847531" "0000410256" "0000847532" "0000410257" "0000847533" "0000410258" "0000847534" "0000414942" "0000872663" "0000421737" "0000896506" "0000421737" "0000896507" "0000421825" "0000896633" "0000432338" "0000917865" "0000442831" "0000944158" "0000442832" "0000944159" "0000442833" "0000944160" "0000442834" "0000944161" "0000444896" "0000946832" "0000444896" "0000946833" "0000448536" "0000958422" "0000448578" "0000958452" "0000448978" "0000958745" "0000448978" "0000959199" "0000448982" "0000958749" "0000448982" "0000959201" "0000448983" "0000958750" "0000448988" "0000958755" "0000449015" "0000959236" "0000449015" "0000959237" "0000449074" "0000959275" "0000449171" "0000959375" "0000451579" "0000985484" "0000451579" "0000985495" "0000466968" "0001044616" "0000467641" "0001045523"