### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = PDE6B)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"PDE6B" "phosphodiesterase 6B, cGMP-specific, rod, beta" "4" "p16.3" "unknown" "NG_009839.1" "UD_132119059682" "" "http://www.LOVD.nl/PDE6B" "" "1" "8786" "5158" "180072" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/PDE6B_NM_000283.3_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2015-02-28 12:23:43" "00006" "2025-11-25 19:19:10"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00015884" "PDE6B" "transcript variant 1" "001" "NM_000283.3" "" "NP_000274.2" "" "" "" "-53" "3350" "2565" "619363" "664681" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 11
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59"
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00325" "SPG" "paraplegia, spastic (SPG)" "" "" "" "" "" "00006" "2014-02-15 22:29:17" "00006" "2016-11-28 13:01:43"
"01471" "CSNBAD2" "blindness, night, stationary, congenital, autosomal dominant, type 2 (CSNBAD-2)" "AD" "163500" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03440" "RP40" "retinitis pigmentosa, type 40 (RP40)" "AR" "613801" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00"
"05130" "CSNB" "blindness, night, stationary, congenital (CSNB)" "" "" "" "" "" "00006" "2016-02-03 23:24:36" "" ""
"05414" "USH2" "Usher syndrome, type II (USH-2)" "" "" "" "" "" "00006" "2018-04-02 14:40:34" "00006" "2021-12-11 13:56:28"
"05460" "USH1B" "Usher syndrome, type Ib (USH-1B)" "AR" "276900" "" "autosomal recessive" "" "00006" "2018-07-17 16:02:34" "00006" "2021-12-10 21:51:32"
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"PDE6B" "01471"
"PDE6B" "03440"
## Individuals ## Do not remove or alter this header ##
## Count = 501
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00001808" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00033095" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033096" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "M" "no" "" "" "0" "" "" "" ""
"00033106" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033109" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "F" "no" "" "" "0" "" "" "" ""
"00033112" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033115" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033122" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033126" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" ""
"00033128" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033130" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033131" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033136" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033138" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033142" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033144" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033146" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033602" "" "" "" "1" "" "00130" "{PMID:Neveling 2013:24123792}" "" "" "" "" "" "0" "" "" "" ""
"00050680" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected sibling(s)" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" ""
"00052838" "" "" "" "1" "" "01424" "?" "" "?" "?" "" "" "0" "" "" "?" ""
"00100093" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "Pakistani" "61161"
"00100100" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61183"
"00105046" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2016:28005958}" "" "F" "" "" "" "0" "" "" "" "39ORGrp"
"00155521" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Arab-Muslim" ""
"00166423" "" "" "" "1" "" "00110" "{PMID:Hmani-Aifa 2009:18854872}" "Proband - severe RP - the patient also carries the c.2419T>A variant (homozygous) in the PDE6B gene." "F" "" "Tunisia" "" "0" "" "" "" ""
"00168741" "" "" "" "1" "" "02416" "{PMID:Goldenberg-Cohen 2013:23882135}" "Proband" "M" "" "Israel" "" "0" "" "" "" "?"
"00173892" "" "" "" "1" "" "02449" "{PMID:Wang 2014b:25097241}" "" "F" "" "United States" "" "0" "" "" "" "31"
"00232481" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232482" "" "" "" "47" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232483" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232484" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232485" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232486" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232487" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232488" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232489" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232490" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232491" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232492" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232493" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232494" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232495" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232496" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232497" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232498" "" "" "" "15" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232499" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232500" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232501" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1187 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232502" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1189 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232503" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1189 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232504" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232505" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232506" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232507" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232508" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232509" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232510" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232511" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232512" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232513" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232514" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232515" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232516" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232517" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232518" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232519" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232520" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232521" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232522" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232523" "" "" "" "6" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232524" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00232525" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233663" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233664" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1200 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233665" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233666" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00246594" "" "" "" "1" "" "00006" "{PMID:Gal 1994:8075643}" "multi-generation family" "" "no" "Denmark" "" "0" "" "" "" ""
"00246595" "" "" "" "1" "" "00006" "{PMID:Manes 2014:24760071}" "3-generation family, 4 affected (F, 3M)" "F;M" "no" "" "" "0" "" "" "" "family"
"00269966" "" "" "" "2" "" "01848" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "family, 2 affected" "" "" "Italy" "" "0" "" "" "" "Fam31P35"
"00269967" "" "" "" "1" "" "01848" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Italy" "" "0" "" "" "" "FAM3P4"
"00293639" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00293641" "" "" "" "29" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00293654" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00300601" "" "" "00269966" "1" "" "01848" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Italy" "" "0" "" "" "" "Fam31P36"
"00308532" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308533" "" "" "" "2" "" "00004" "{PMID:Holtan 2020:31429209}" "2 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308534" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308535" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308619" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" ""
"00308647" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" ""
"00308648" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" ""
"00308649" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" ""
"00309292" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00309293" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00309294" "" "" "" "8" "" "00004" "{PMID:Sharon 2019:31456290}" "8 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00309817" "" "" "" "1" "" "00006" "{PMID:Bocquet 2013:24339724}" "2-generation family, 1 affected" "F" "yes" "France" "" "0" "" "" "" "PB74"
"00325508" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "3865"
"00327965" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240274"
"00327987" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001022"
"00328074" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G004720"
"00328080" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G004997"
"00328150" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G006001"
"00328177" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G007672"
"00328187" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G007686"
"00328341" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000378"
"00328493" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15011627"
"00331282" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "F" "" "Japan" "" "0" "" "" "" "Pat36"
"00331626" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "family" "" "no" "China" "" "0" "" "" "" "19691"
"00332179" "" "" "00332178" "1" "" "00006" "{PMID:de CastrojalopezMiro 2018:29367200}" "affected female" "F" "" "" "" "0" "" "" "" "Fam8NCEPatIv3"
"00332524" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "F" "" "United States" "" "0" "" "" "" "Pat1"
"00332527" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "M" "" "United States" "" "0" "" "" "" "Pat5"
"00333354" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat12"
"00333365" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat7"
"00333642" "" "" "" "3" "" "00000" "{PMID:Stone 2017:28559085}" "family, 3 affected" "F" "" "(United States)" "" "0" "" "" "" "479"
"00333851" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "49"
"00333911" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "278"
"00333912" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "279"
"00333913" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "280"
"00333975" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "439"
"00333976" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "440"
"00334470" "" "" "" "1" "" "00000" "{PMID:Habibi 2016:27874104}" "family" "" "" "Tunisia" "" "0" "" "" "" "F10"
"00334567" "" "" "" "1" "" "00000" "{PMID:Vincent 2017:28488341}" "patient, no family history" "F" "no" "New Zealand" "" "0" "" "" "Maori" "342"
"00334568" "" "" "" "1" "" "00000" "{PMID:Vincent 2017:28488341}" "patient, no family history" "F" "no" "New Zealand" "" "0" "" "" "Maori" "237"
"00334569" "" "" "" "1" "" "00000" "{PMID:Vincent 2017:28488341}" "patient, no family history" "M" "no" "New Zealand" "" "0" "" "" "Maori" "354"
"00334570" "" "" "" "1" "" "00000" "{PMID:Vincent 2017:28488341}" "patient, no family history" "M" "no" "New Zealand" "" "0" "" "" "Maori" "520"
"00335135" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "family" "" "no" "Netherlands" "" "0" "" "" "" "4785"
"00335136" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "6488"
"00335137" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "811"
"00335138" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "yes" "Netherlands" "" "0" "" "" "" "3334"
"00335139" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "787"
"00335140" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "3388"
"00335222" "" "" "" "2" "" "00000" "{PMID:Riera 2017:28181551}" "family, several affected" "" "" "Spain" "" "0" "" "" "" "Fi15/26"
"00335230" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/22"
"00335278" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "family" "" "" "Spain" "" "0" "" "" "" "Pat23"
"00335279" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat81"
"00335306" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat35"
"00335307" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat112"
"00335424" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP036"
"00335458" "" "" "" "1" "" "00000" "{PMID:Biswas 2017:28130426}" "" "" "" "United States" "" "0" "" "" "" "RF.M.0711"
"00335490" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD008"
"00335491" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD013"
"00335952" "" "" "" "1" "" "00000" "{PMID:Roberts 2016:27898983}" "family, see paper" "" "" "South Africa" "" "0" "" "" "Shangaan" "RP397"
"00358789" "" "" "" "1" "" "00000" "{PMID:Zhang 2016:27596865}" "family" "F" "" "United States" "" "0" "" "" "Hispanic" "BLM022"
"00358800" "" "" "" "1" "" "00000" "{PMID:Zhang 2016:27596865}" "simplex case" "F" "" "United States" "" "0" "" "" "Hispanic" "BLM097"
"00358957" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71918"
"00358961" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case24058"
"00358977" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case25939"
"00358981" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71718"
"00359137" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12007088"
"00362231" "" "" "" "1" "" "04043" "Fadaie 2021, submitted" "" "F" "" "Netherlands" "" "0" "" "" "" "?"
"00362908" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP75"
"00363438" "" "" "" "5" "" "00000" "{PMID:Ge 2015:26667666}" "2-generation family, affected mother/4 children (3F, 2M)" "F;M" "" "United States" "" "0" "" "" "" "3H5+K.42"
"00363445" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "59H+2.32"
"00363461" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "3U3+6.63"
"00363462" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "UGQ+Q.72"
"00363463" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "MK+W.33"
"00363518" "" "" "" "5" "" "00000" "{PMID:Beheshtian 2015:26497376}" "6-generation family, 5 affected (4F, M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "Iran" "" "0" "" "" "" "9200031/I-39300"
"00363639" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG0150"
"00363751" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "14DG1966"
"00372088" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "sporadic case" "" "" "Korea" "" "0" "" "" "" "436"
"00372090" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "sporadic case" "" "" "Korea" "" "0" "" "" "" "445"
"00372624" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP209"
"00372629" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP042"
"00372646" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP339"
"00372648" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP379"
"00372654" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "M" "" "China" "" "0" "" "" "" "RP337"
"00372666" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP016"
"00372667" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP022"
"00372668" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP397"
"00372669" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP281"
"00372706" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP059"
"00372715" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP252"
"00372718" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP273"
"00373372" "" "" "" "1" "" "00000" "{PMID:Van Huet 2015:25999674}" "" "" "" "Netherlands" "" "0" "" "" "" ""
"00373373" "" "" "" "1" "" "00000" "{PMID:Van Huet 2015:25999674}" "" "" "" "Netherlands" "" "0" "" "" "" ""
"00373835" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "simplex case" "" "" "Northern Ireland" "" "0" "" "" "" "Rp182"
"00373859" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "family" "" "" "Northern Ireland" "" "0" "" "" "" "Rp114"
"00373860" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "family" "" "" "Northern Ireland" "" "0" "" "" "" "Rp289"
"00374925" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "M" "" "China" "" "0" "" "" "" "S7-1"
"00374929" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "M" "" "China" "" "0" "" "" "" "W84-1"
"00374932" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "W67-1"
"00374969" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "M" "" "China" "" "0" "" "" "" "W129-1"
"00374970" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "F8-1"
"00374977" "" "" "" "4" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "2-generation family, 4 affect sibs (F, 3M)" "F" "" "Spain" "" "0" "" "" "" "RP-1712PatII2"
"00374978" "" "" "00374977" "1" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "brother" "M" "" "Spain" "" "0" "" "" "" "RP-1712PatII4"
"00374980" "" "" "00374977" "1" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "brother" "M" "" "Spain" "" "0" "" "" "" "RP-1712PatII6"
"00375276" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K1820"
"00375277" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "simplex case" "" "" "Japan" "" "0" "" "" "" "K1967"
"00375278" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "simplex case" "" "" "Japan" "" "0" "" "" "" "K2042"
"00375279" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6188"
"00375301" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K2120"
"00375337" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6417"
"00376169" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376171" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376172" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376173" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376181" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376184" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376186" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" ""
"00376513" "" "" "" "1" "" "00000" "{PMID:Singh 2009:19339744}" "" "" "yes" "" "" "0" "" "" "Indian" ""
"00376530" "" "" "" "1" "" "00000" "{PMID:Zeitz-2009:19578023}" "" "" "" "" "" "0" "" "" "" ""
"00376761" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "23"
"00376762" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "24"
"00376764" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "26"
"00376772" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "36"
"00376773" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "37"
"00376777" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "42"
"00376779" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "45"
"00376785" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "52"
"00376786" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "53"
"00376787" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "54"
"00376796" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "63"
"00376868" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "" "Morocco" "" "0" "" "" "" "Fam18"
"00377204" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "287"
"00377244" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "357"
"00377544" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family S132" "F" "no" "Japan" "" "0" "" "" "Asian" "S132"
"00377820" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00378053" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SS_0031"
"00379388" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" ""
"00379399" "" "" "" "1" "" "00000" "{PMID:Simpson-2011:21147909}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00379525" "" "" "" "1" "" "00000" "{PMID:Foote-2019:10480356}" "" "M" "" "United States" "" "0" "" "" "" ""
"00379674" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0064"
"00379765" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0113"
"00379854" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016060108"
"00379855" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016101001"
"00379856" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016111417"
"00379857" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016111420"
"00379858" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016121902"
"00380251" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "M" "" "China" "" "0" "" "" "" ""
"00380252" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "F" "" "China" "" "0" "" "" "" ""
"00380253" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "F" "" "China" "" "0" "" "" "" ""
"00380254" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "F" "" "China" "" "0" "" "" "" ""
"00380258" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "" "" "China" "" "0" "" "" "" ""
"00380310" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" ""
"00380371" "" "" "" "1" "" "00000" "{PMID:Bocquet-2013:23350551}" "" "" "yes" "France" "" "0" "" "" "" ""
"00380995" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" ""
"00381081" "" "" "" "2" "" "00000" "{PMID:Fu-2013:23661369}" "" "F" "" "China" "" "0" "" "" "Chinese" ""
"00381082" "" "" "" "2" "" "00000" "{PMID:Fu-2013:23661369}" "" "F" "" "China" "" "0" "" "" "Chinese" ""
"00381083" "" "" "" "2" "" "00000" "{PMID:Fu-2013:23661369}" "" "F" "" "China" "" "0" "" "" "Chinese" ""
"00381161" "" "" "" "1" "" "00008" "{PMID:Nishiguchi-2013:24043777}" "" "F" "yes" "" "" "0" "" "" "Japanese" ""
"00381167" "" "" "" "1" "" "00008" "{PMID:Neveling-2013:24123792}" "" "" "" "" "" "0" "" "" "" ""
"00381603" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Iran" "" "0" "" "" "" ""
"00381604" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Germany" "" "0" "" "" "" ""
"00381621" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" ""
"00381629" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Germany" "" "0" "" "" "" ""
"00381636" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" ""
"00381654" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "?" "Saudi Arabia" "" "0" "" "" "" ""
"00381716" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" ""
"00381872" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "22"
"00381873" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "23"
"00381874" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "24"
"00382137" "" "" "" "1" "" "00000" "{PMID:Patel 2019:30653986}" "" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "261"
"00382340" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "169"
"00382341" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "170"
"00382342" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "171"
"00382343" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "172"
"00382344" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "173"
"00382345" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "174"
"00382347" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "176"
"00382553" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "415"
"00382573" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "435"
"00382574" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "436"
"00382790" "" "" "" "1" "" "00000" "{PMID:Azam-2011:21987686}" "" "" "yes" "Pakistan" "" "0" "" "" "pakistani" ""
"00383493" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00383494" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00383495" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00383761" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18070019_A"
"00383781" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18081694_A"
"00383782" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18081696_A"
"00383906" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0054"
"00383962" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1057"
"00384203" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066867"
"00384635" "" "" "" "1" "" "00000" "{PMID:Ehrenberg 2019:31814694}" "" "F" "yes" "Israel" "" "0" "" "" "" "Family 13 patient 1"
"00384768" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00385060" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19994"
"00385061" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19994"
"00385100" "" "" "" "1" "" "00000" "{PMID:Chakrabarty 2020:31639430}" "" "M" "" "India" "" "0" "" "" "" "II:1"
"00385101" "" "" "" "1" "" "00000" "{PMID:Chakrabarty 2020:31639430}" "" "M" "" "India" "" "0" "" "" "" "II:2"
"00385731" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "yes" "China" "" "0" "" "" "" "152"
"00385960" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "novel" "" "" "" "" "0" "" "" "" ""
"00385961" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "" "" "" "" "" "0" "" "" "" ""
"00385964" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "" "" "" "" "" "0" "" "" "" ""
"00385965" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "" "" "" "" "" "0" "" "" "" ""
"00386172" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-284"
"00386256" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-226, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-551"
"00386292" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RP-191"
"00386301" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RP-44"
"00386612" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-040"
"00386641" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-172"
"00386653" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-206"
"00386727" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2862_004447"
"00386808" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2966_004551"
"00386811" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI307_717"
"00386877" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-1066"
"00386905" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI660_001336"
"00387066" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "92"
"00387067" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "93"
"00387068" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "Asian" "94"
"00387069" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "95"
"00387070" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "96"
"00387071" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "97"
"00387072" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Other" "98"
"00388471" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14016924"
"00388762" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 26, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "46"
"00388763" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 26, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "47"
"00389075" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 120, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "359"
"00389231" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 171, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "515"
"00389294" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 209, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "578"
"00389362" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 232, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "646"
"00389418" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 260, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "702"
"00389419" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 260, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "703"
"00389545" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 341, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "829"
"00389640" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 395, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "924"
"00389782" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 672, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1066"
"00389845" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 774, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1129"
"00389847" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 778, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1131"
"00389853" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 786, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1137"
"00389875" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 823, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1159"
"00389936" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 960, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1220"
"00389968" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1035, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1252"
"00389978" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1056, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1262"
"00390333" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001022"
"00390334" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G004720"
"00390335" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G004997"
"00390336" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006001"
"00390337" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G007672"
"00390338" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G007686"
"00390339" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000378"
"00390757" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" ""
"00390774" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" ""
"00392570" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "11"
"00392606" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "67"
"00392607" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "69"
"00392620" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "88"
"00392630" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "106"
"00392677" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "172"
"00392678" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "173"
"00393489" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393579" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393580" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393614" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393712" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393796" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393810" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393838" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00394326" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "RP8"
"00394617" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394618" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394619" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "yes" "" "" "0" "" "" "" ""
"00394620" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" ""
"00394621" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" ""
"00395576" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1021"
"00395796" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F248"
"00396414" "" "" "" "1" "" "00006" "{PMID:Ellingford 2016:26872967}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "11001193"
"00396497" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" ""
"00396508" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" ""
"00396515" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" ""
"00396520" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" ""
"00396550" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" ""
"00396566" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" ""
"00396572" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" ""
"00398810" "" "" "" "1" "" "00000" "{PMID:Gao 1996:8698075}" "" "" "" "" "" "0" "" "" "" "?"
"00398821" "" "" "" "1" "" "00000" "{PMID:Danciger 1995:8595886}" "" "F" "" "" "" "0" "" "" "" "Family 12_II:1"
"00398822" "" "" "" "1" "" "00000" "{PMID:Danciger 1995:8595886}" "" "M" "" "" "" "0" "" "" "" "Family 12_II:2"
"00398823" "" "" "" "1" "" "00000" "{PMID:Danciger 1995:8595886}" "" "F" "" "" "" "0" "" "" "" "Family 27_II:1"
"00398824" "" "" "" "1" "" "00000" "{PMID:Danciger 1995:8595886}" "" "M" "" "" "" "0" "" "" "" "Family 27_II:2"
"00398827" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "LCA120-28043"
"00398828" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP260-25423" "M" "" "" "" "0" "" "" "" "ARRP260-25421"
"00398829" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP260-25421" "M" "" "" "" "0" "" "" "" "ARRP260-25423"
"00398830" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP1056-29774"
"00398831" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "ARRP395-30213"
"00398832" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP759-19456"
"00398833" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "ARRP411-30491"
"00398834" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "ARRP75-5835"
"00398835" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP1035-29494"
"00398836" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP612-17465"
"00398837" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP774-22406"
"00398838" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP26-18556" "M" "" "" "" "0" "" "" "" "ARRP26-21885"
"00398839" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP823-26156"
"00398840" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP786-22723"
"00398841" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP778-22500"
"00398842" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP1168-0"
"00398843" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP209-22048" "F" "" "" "" "0" "" "" "" "ARRP209-23862"
"00398844" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP26-21885" "F" "" "" "" "0" "" "" "" "ARRP26-18556"
"00398845" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP672-19402"
"00398846" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "sibling of ARRP209-23862" "M" "" "" "" "0" "" "" "" "ARRP209-22048"
"00398847" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "ARRP171-15079"
"00398848" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "F" "" "" "" "0" "" "" "" "SRP960-28509"
"00398849" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP341-24713"
"00398850" "" "" "" "1" "" "00000" "{PMID:Kuehlewein 2021:33673512}" "" "M" "" "" "" "0" "" "" "" "SRP754-21728"
"00398861" "" "" "" "1" "" "00000" "{PMID:Jacobson 2007:17446517}" "" "F" "" "" "" "0" "" "" "" "?"
"00398877" "" "" "" "1" "" "00000" "{PMID:Tsang 2008:18723146}" "" "M" "" "" "" "0" "" "" "" "II-8"
"00398878" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_22"
"00398879" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "F" "yes" "Pakistan" "" "0" "" "" "" "A_10"
"00398880" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "F" "yes" "Pakistan" "" "0" "" "" "" "A_11"
"00398881" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_12"
"00398882" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_13"
"00398883" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_14"
"00398884" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_15"
"00398885" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_16"
"00398886" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP161" "M" "yes" "Pakistan" "" "0" "" "" "" "A_17"
"00398887" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "M" "yes" "Pakistan" "" "0" "" "" "" "B_7"
"00398888" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "M" "yes" "Pakistan" "" "0" "" "" "" "B_8"
"00398889" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "M" "yes" "Pakistan" "" "0" "" "" "" "B_12"
"00398890" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "M" "yes" "Pakistan" "" "0" "" "" "" "B_13"
"00398891" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "M" "yes" "Pakistan" "" "0" "" "" "" "B_14"
"00398892" "" "" "" "1" "" "00000" "{PMID:Ali 2011:21655355}" "Family PKRP183" "F" "yes" "Pakistan" "" "0" "" "" "" "B_15"
"00398893" "" "" "" "1" "" "00000" "{PMID:Shen 2014:24828262}" "Proband" "M" "yes" "United States" "" "0" "" "" "Egyptian Sephardic Jewish" "II:2"
"00398894" "" "" "" "1" "" "00000" "{PMID:Shen 2014:24828262}" "Brother of II:2" "M" "yes" "United States" "" "0" "" "" "Egyptian Sephardic Jewish" "II:4"
"00398895" "" "" "" "1" "" "00000" "{PMID:Shen 2014:24828262}" "Maternal cousin of proband II:2" "M" "yes" "United States" "" "0" "" "" "Egyptian Sephardic Jewish" "II:6"
"00398896" "" "" "" "1" "" "00000" "{PMID:Gonzalez-delPozo 2015:25823529}" "family S-23, proband" "F" "yes" "Spain" "" "0" "" "" "" "II:3"
"00398897" "" "" "" "1" "" "00000" "{PMID:Gonzalez-delPozo 2015:25823529}" "family S-23, brother of proband II:3" "M" "yes" "Spain" "" "0" "" "" "" "II:4"
"00398966" "" "" "" "1" "" "00000" "{PMID:Kuniyoshi 2015:25827439}" "" "F" "" "" "" "0" "" "" "" "kinki-1016"
"00398967" "" "" "" "1" "" "00000" "{PMID:Kuniyoshi 2015:25827439}" "" "M" "" "" "" "0" "" "" "" "kinki-1030"
"00398968" "" "" "" "1" "" "00000" "{PMID:Palmowski 2019:30646425}" "" "M" "no" "" "" "0" "" "" "white" "1"
"00398969" "" "" "" "1" "" "00000" "{PMID:Palmowski 2019:30646425}" "" "F" "no" "" "" "0" "" "" "white" "2"
"00398970" "" "" "" "1" "" "00000" "{PMID:Palmowski 2019:30646425}" "" "M" "no" "" "" "0" "" "" "white" "3"
"00398971" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family A" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "A_1"
"00398972" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family B" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "B_1"
"00398973" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family C" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "C_1"
"00398974" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family C" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "C_2"
"00398975" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family D" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "D_1"
"00398976" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family E" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "E_1"
"00398977" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family E" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "E_2"
"00398978" "" "" "" "1" "" "00000" "{PMID:Tatour 2019:30820151}" "Family F" "M" "" "Israel" "" "0" "" "" "Caucasus Jewish" "F_1"
"00399180" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F103" "" "" "" "" "0" "" "" "" "CIC001 33"
"00399181" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F144" "" "" "" "" "0" "" "" "" "CIC001 95"
"00399182" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F652" "" "" "" "" "0" "" "" "" "CIC010 71"
"00399183" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F798" "" "" "" "" "0" "" "" "" "CIC013 18"
"00399184" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1084" "" "" "" "" "0" "" "" "" "CIC028 66"
"00399185" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1300" "" "" "" "" "0" "" "" "" "CIC031 34"
"00399186" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1372" "" "" "" "" "0" "" "" "" "CIC032 45"
"00399187" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1385" "" "" "" "" "0" "" "" "" "CIC032 78"
"00399188" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1709, index" "" "" "" "" "0" "" "" "" "CIC037 81"
"00399189" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1709, brother" "M" "" "" "" "0" "" "" "" "CIC040 06"
"00399190" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1709, sister" "F" "" "" "" "0" "" "" "" "CIC050 60"
"00399191" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1784" "" "" "" "" "0" "" "" "" "CIC039 05"
"00399192" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1808, index" "" "" "" "" "0" "" "" "" "CIC039 38"
"00399193" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1808, sister" "F" "" "" "" "0" "" "" "" "CIC042 37"
"00399194" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1933" "" "" "" "" "0" "" "" "" "CIC041 17"
"00399195" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F1946" "" "" "" "" "0" "" "" "" "CIC041 21"
"00399196" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2056" "" "" "" "" "0" "" "" "" "CIC042 91"
"00399197" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3440, index" "" "" "" "" "0" "" "" "" "CIC064 59"
"00399198" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3440, sister" "" "" "" "" "0" "" "" "" "CIC064 60"
"00399199" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2571, index" "" "" "" "" "0" "" "" "" "CIC050 98"
"00399200" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2571, sister" "" "" "" "" "0" "" "" "" "CIC052 14"
"00399201" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2712" "" "" "" "" "0" "" "" "" "CIC053 51"
"00399202" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2719" "" "" "" "" "0" "" "" "" "CIC053 69"
"00399203" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2719, sister" "" "" "" "" "0" "" "" "" "CIC064 70"
"00399204" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2719, affected nephew" "" "" "" "" "0" "" "" "" "CIC064 72"
"00399205" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F2719, affected nephew" "" "" "" "" "0" "" "" "" "CIC064 68"
"00399206" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3289" "" "" "" "" "0" "" "" "" "CIC062 32"
"00399207" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3435" "" "" "" "" "0" "" "" "" "CIC064 51"
"00399208" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3440, index" "" "" "" "" "0" "" "" "" "CIC064 59"
"00399209" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3440, sister" "" "" "" "" "0" "" "" "" "CIC064 60"
"00399210" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3797" "" "" "" "" "0" "" "" "" "CIC069 28"
"00399211" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F4102" "" "" "" "" "0" "" "" "" "CIC074 27"
"00399212" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F4491, index" "" "" "" "" "0" "" "" "" "CIC080 50"
"00399213" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F4491, sister" "" "" "" "" "0" "" "" "" "CIC095 97"
"00399214" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F4993" "" "" "" "" "0" "" "" "" "CIC087 86"
"00399215" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F4999" "" "" "" "" "0" "" "" "" "CIC087 95"
"00399216" "" "" "" "1" "" "00000" "{PMID:Khateb 2019:30998820}" "Family F3037" "" "" "" "" "0" "" "" "" "CIC058 22"
"00403260" "" "" "" "1" "" "00000" "{PMID:Men-2017:29062221}" "" "M" "" "(United States)" "" "0" "" "" "" "Patient 1"
"00408060" "" "" "" "1" "" "00000" "{PMID:Chebil 2016:26868535}" "2 patients, 1 family" "?" "" "France" "" "0" "" "" "Tunisia" "Family ?"
"00411342" "" "" "" "1" "" "04333" "{PMID:Sharon 2020:31456290}, {PMID:Ben Yosef 2023:37287645}" "family, 1 affected" "F" "" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam15"
"00411343" "" "" "" "1" "" "04333" "{PMID:Ben Yosef 2023:37287645}" "family, 1 affected" "M" "yes" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam16"
"00412655" "" "" "" "4" "" "04345" "" "" "F" "yes" "Pakistan" "" "0" "" "" "South Asian" "patient"
"00420547" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F248"
"00429495" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429511" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429514" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429516" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429530" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429538" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429564" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429619" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429625" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429631" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429697" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429700" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429716" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429730" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429824" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429837" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429843" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429848" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429926" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429958" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00430094" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00430130" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430140" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00446982" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-411"
"00447000" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-455"
"00447136" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "LCA-5"
"00447138" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "LCA-129"
"00447316" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1246"
"00447512" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-470"
"00447705" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1157"
"00447726" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "UD-106"
"00461112" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat47"
"00470030" "" "" "" "1" "" "00006" "{PMID:Lecca 2024:38840272}" "2-generation family, 1 affected, unaffected parents" "M" "yes" "Italy" "" "0" "" "" "" "FamQPat26"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 500
"{{individualid}}" "{{diseaseid}}"
"00001808" "00112"
"00033095" "04214"
"00033096" "04214"
"00033106" "04214"
"00033109" "04214"
"00033112" "04214"
"00033115" "04214"
"00033122" "04214"
"00033126" "04214"
"00033128" "04214"
"00033130" "04214"
"00033131" "04214"
"00033136" "04214"
"00033138" "04214"
"00033142" "04214"
"00033144" "04214"
"00033146" "04214"
"00033602" "04214"
"00050680" "00198"
"00052838" "04214"
"00100093" "04214"
"00100100" "04214"
"00105046" "04214"
"00155521" "04214"
"00166423" "05414"
"00168741" "05460"
"00173892" "00058"
"00232481" "04214"
"00232482" "04214"
"00232483" "04214"
"00232484" "04214"
"00232485" "04214"
"00232486" "04214"
"00232487" "04214"
"00232488" "04214"
"00232489" "04214"
"00232490" "04214"
"00232491" "04214"
"00232492" "04214"
"00232493" "04214"
"00232494" "04214"
"00232495" "04214"
"00232496" "04214"
"00232497" "04214"
"00232498" "04214"
"00232499" "04214"
"00232500" "04214"
"00232501" "04214"
"00232502" "04214"
"00232503" "04214"
"00232504" "04214"
"00232505" "04214"
"00232506" "04214"
"00232507" "04214"
"00232508" "04214"
"00232509" "04214"
"00232510" "04214"
"00232511" "04214"
"00232512" "04214"
"00232513" "04214"
"00232514" "04214"
"00232515" "04214"
"00232516" "04214"
"00232517" "04214"
"00232518" "04214"
"00232519" "04214"
"00232520" "04214"
"00232521" "04214"
"00232522" "04214"
"00232523" "04214"
"00232524" "04214"
"00232525" "04214"
"00233663" "04214"
"00233664" "04214"
"00233665" "04214"
"00233666" "04214"
"00246594" "05130"
"00246595" "05130"
"00269966" "04214"
"00269967" "04214"
"00293639" "00198"
"00293641" "00198"
"00293654" "00198"
"00300601" "04214"
"00308532" "04214"
"00308533" "04214"
"00308534" "04214"
"00308535" "04214"
"00308619" "04214"
"00308647" "04214"
"00308648" "04214"
"00308649" "04214"
"00309292" "04214"
"00309293" "04214"
"00309294" "04214"
"00309817" "04214"
"00325508" "04214"
"00327965" "04214"
"00327987" "04214"
"00328074" "04214"
"00328080" "04214"
"00328150" "04214"
"00328177" "04214"
"00328187" "04214"
"00328341" "04214"
"00328493" "04214"
"00331282" "04214"
"00331626" "05086"
"00332179" "00198"
"00332524" "04214"
"00332527" "04214"
"00333354" "04214"
"00333365" "04214"
"00333642" "04214"
"00333851" "04214"
"00333911" "04214"
"00333912" "04214"
"00333913" "04214"
"00333975" "04214"
"00333976" "04214"
"00334470" "04214"
"00334567" "04214"
"00334568" "04214"
"00334569" "04214"
"00334570" "04214"
"00335135" "00198"
"00335136" "00198"
"00335137" "00198"
"00335138" "00198"
"00335139" "00198"
"00335140" "00198"
"00335222" "04214"
"00335230" "04214"
"00335278" "04214"
"00335279" "04214"
"00335306" "04214"
"00335307" "04214"
"00335424" "04214"
"00335458" "04214"
"00335490" "04214"
"00335491" "04214"
"00335952" "04214"
"00358789" "04214"
"00358800" "04214"
"00358957" "04214"
"00358961" "04214"
"00358977" "04214"
"00358981" "04214"
"00359137" "04214"
"00362231" "04214"
"00362908" "04214"
"00363438" "04214"
"00363445" "04214"
"00363461" "04214"
"00363462" "04214"
"00363463" "04214"
"00363518" "04214"
"00363639" "04214"
"00363751" "04214"
"00372088" "04214"
"00372090" "04214"
"00372624" "04214"
"00372629" "04214"
"00372646" "04214"
"00372648" "04214"
"00372654" "04214"
"00372666" "04214"
"00372667" "04214"
"00372668" "04214"
"00372669" "04214"
"00372706" "04214"
"00372715" "04214"
"00372718" "04214"
"00373372" "04214"
"00373373" "04214"
"00373835" "04214"
"00373859" "04214"
"00373860" "04214"
"00374925" "04214"
"00374929" "04214"
"00374932" "04214"
"00374969" "04214"
"00374970" "04214"
"00374977" "04214"
"00374978" "04214"
"00374980" "04214"
"00375276" "04214"
"00375277" "04214"
"00375278" "04214"
"00375279" "04214"
"00375301" "04214"
"00375337" "04214"
"00376169" "04214"
"00376171" "04214"
"00376172" "04214"
"00376173" "04214"
"00376181" "04214"
"00376184" "04214"
"00376186" "04214"
"00376513" "04214"
"00376530" "04214"
"00376761" "04214"
"00376762" "04214"
"00376764" "04214"
"00376772" "04214"
"00376773" "04214"
"00376777" "04214"
"00376779" "04214"
"00376785" "04214"
"00376786" "04214"
"00376787" "04214"
"00376796" "04214"
"00376868" "04214"
"00377204" "04214"
"00377244" "04214"
"00377544" "04214"
"00377820" "04214"
"00378053" "00112"
"00379388" "04214"
"00379399" "04214"
"00379525" "04214"
"00379674" "00112"
"00379765" "00112"
"00379854" "04214"
"00379855" "04214"
"00379856" "04214"
"00379857" "04214"
"00379858" "04214"
"00380251" "04214"
"00380252" "04214"
"00380253" "04214"
"00380254" "04214"
"00380258" "04214"
"00380310" "04214"
"00380371" "04214"
"00380995" "04214"
"00381081" "04214"
"00381082" "04214"
"00381083" "04214"
"00381161" "04214"
"00381167" "04214"
"00381603" "04214"
"00381604" "04214"
"00381621" "04214"
"00381629" "04214"
"00381636" "04214"
"00381654" "04214"
"00381716" "04214"
"00381872" "04214"
"00381873" "04214"
"00381874" "04214"
"00382137" "03440"
"00382340" "04214"
"00382341" "04214"
"00382342" "04214"
"00382343" "04214"
"00382344" "04214"
"00382345" "04214"
"00382347" "04214"
"00382553" "04214"
"00382573" "04214"
"00382574" "04214"
"00382790" "04214"
"00383493" "04214"
"00383494" "04214"
"00383495" "04214"
"00383761" "04214"
"00383781" "04214"
"00383782" "04214"
"00383906" "04214"
"00383962" "04214"
"00384203" "04214"
"00384635" "00198"
"00384768" "04214"
"00385060" "04214"
"00385061" "04214"
"00385100" "04214"
"00385101" "04214"
"00385731" "04214"
"00385960" "04214"
"00385961" "04214"
"00385964" "04214"
"00385965" "04214"
"00386172" "04214"
"00386256" "04214"
"00386292" "04214"
"00386301" "04214"
"00386612" "04214"
"00386641" "04214"
"00386653" "04214"
"00386727" "04214"
"00386808" "04214"
"00386811" "04214"
"00386877" "04214"
"00386905" "04214"
"00387066" "04214"
"00387067" "04214"
"00387068" "04214"
"00387069" "04214"
"00387070" "04214"
"00387071" "04214"
"00387072" "04214"
"00388471" "04214"
"00388762" "04214"
"00388763" "04214"
"00389075" "04214"
"00389231" "04214"
"00389294" "04214"
"00389362" "04214"
"00389418" "04214"
"00389419" "04214"
"00389545" "04214"
"00389640" "04214"
"00389782" "04214"
"00389845" "04214"
"00389847" "04214"
"00389853" "04214"
"00389875" "04214"
"00389936" "04214"
"00389968" "04214"
"00389978" "04214"
"00390333" "04214"
"00390334" "04214"
"00390335" "04214"
"00390336" "04214"
"00390337" "04214"
"00390338" "04214"
"00390339" "04214"
"00390757" "04214"
"00390774" "04214"
"00392570" "04214"
"00392606" "04214"
"00392607" "04214"
"00392620" "04214"
"00392630" "04214"
"00392677" "04214"
"00392678" "04214"
"00393489" "04214"
"00393579" "04214"
"00393580" "04214"
"00393614" "04214"
"00393712" "04214"
"00393796" "04214"
"00393810" "04214"
"00393838" "04214"
"00394326" "04214"
"00394617" "04214"
"00394618" "04214"
"00394619" "04214"
"00394620" "04214"
"00394621" "04214"
"00395576" "04214"
"00395796" "04214"
"00396414" "04214"
"00396497" "04214"
"00396508" "04214"
"00396515" "04214"
"00396520" "04214"
"00396550" "04214"
"00396566" "04214"
"00396572" "04214"
"00398810" "04214"
"00398821" "04214"
"00398822" "04214"
"00398823" "04214"
"00398824" "04214"
"00398827" "04214"
"00398828" "04214"
"00398829" "04214"
"00398830" "04214"
"00398831" "04214"
"00398832" "04214"
"00398833" "04214"
"00398834" "04214"
"00398835" "04214"
"00398836" "04214"
"00398837" "04214"
"00398838" "04214"
"00398839" "04214"
"00398840" "04214"
"00398841" "04214"
"00398842" "04214"
"00398843" "04214"
"00398844" "04214"
"00398845" "04214"
"00398846" "04214"
"00398847" "04214"
"00398848" "04214"
"00398849" "04214"
"00398850" "04214"
"00398861" "04214"
"00398877" "04214"
"00398878" "04214"
"00398879" "04214"
"00398880" "04214"
"00398881" "04214"
"00398882" "04214"
"00398883" "04214"
"00398884" "04214"
"00398885" "04214"
"00398886" "04214"
"00398887" "04214"
"00398888" "04214"
"00398889" "04214"
"00398890" "04214"
"00398891" "04214"
"00398892" "04214"
"00398893" "04214"
"00398894" "04214"
"00398895" "04214"
"00398896" "04214"
"00398966" "04214"
"00398967" "04214"
"00398968" "04214"
"00398969" "04214"
"00398970" "04214"
"00398971" "04214"
"00398972" "04214"
"00398973" "04214"
"00398974" "04214"
"00398975" "04214"
"00398976" "04214"
"00398977" "04214"
"00398978" "04214"
"00399180" "04214"
"00399181" "04214"
"00399182" "04214"
"00399183" "04214"
"00399184" "04214"
"00399185" "04214"
"00399186" "04214"
"00399187" "04214"
"00399188" "04214"
"00399189" "04214"
"00399190" "04214"
"00399191" "04214"
"00399192" "04214"
"00399193" "04214"
"00399194" "04214"
"00399195" "04214"
"00399196" "04214"
"00399197" "04214"
"00399198" "04214"
"00399199" "04214"
"00399200" "04214"
"00399201" "04214"
"00399202" "04214"
"00399203" "04214"
"00399204" "04214"
"00399205" "04214"
"00399206" "04214"
"00399207" "04214"
"00399208" "04214"
"00399209" "04214"
"00399210" "04214"
"00399211" "04214"
"00399212" "04214"
"00399213" "04214"
"00399214" "04214"
"00399215" "04214"
"00399216" "04214"
"00403260" "04214"
"00408060" "04214"
"00411342" "03440"
"00411343" "03440"
"00412655" "03440"
"00420547" "04214"
"00429495" "00112"
"00429511" "00112"
"00429514" "00112"
"00429516" "00112"
"00429530" "00112"
"00429538" "00112"
"00429564" "00112"
"00429619" "00112"
"00429625" "00112"
"00429631" "00112"
"00429697" "00112"
"00429700" "00112"
"00429716" "00112"
"00429730" "00112"
"00429824" "00112"
"00429837" "00112"
"00429843" "00112"
"00429848" "00112"
"00429926" "00112"
"00429958" "00112"
"00430094" "00112"
"00430130" "00112"
"00430140" "00112"
"00446982" "00198"
"00447000" "00198"
"00447136" "00198"
"00447138" "00198"
"00447316" "00198"
"00447512" "00198"
"00447705" "00198"
"00447726" "00198"
"00461112" "04214"
"00470030" "00325"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00058, 00112, 00198, 00325, 01471, 03440, 04214, 05086, 05130, 05414, 05460
## Count = 446
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000026524" "04214" "00033095" "00229" "Unknown" "6y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026525" "04214" "00033096" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026535" "04214" "00033106" "00229" "Unknown" "68y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026538" "04214" "00033109" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026541" "04214" "00033112" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026544" "04214" "00033115" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026551" "04214" "00033122" "00229" "Unknown" "27y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026555" "04214" "00033126" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026557" "04214" "00033128" "00229" "Unknown" "12y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026559" "04214" "00033130" "00229" "Unknown" "4y" "Wilm\'s tumor" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026560" "04214" "00033131" "00229" "Unknown" "10y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026565" "04214" "00033136" "00229" "Unknown" "0d" "congenital stationary night blindness" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026567" "04214" "00033138" "00229" "Unknown" "" "hypertension" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026571" "04214" "00033142" "00229" "Unknown" "10y" "age-related mild hearing loss, psoriasis" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026573" "04214" "00033144" "00229" "Unknown" "7y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026575" "04214" "00033146" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000027031" "04214" "00033602" "00130" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000037292" "00198" "00050680" "00006" "Unknown" "" "intrauterine growth retardation, febrile seizures, feeding difficulties in infancy, microcephaly, global developmental delay, deeply set eye, flat nose, shoulder dimples, skin dimples, macrotia, inverted nipples, pes planus, 2-3 toe syndactyly" "" "" "" "" "" "" "" "" "" "" ""
"0000039415" "04214" "00052838" "01424" "Unknown" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000078332" "04214" "00100093" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000078337" "04214" "00100100" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000082937" "04214" "00105046" "01244" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000128021" "04214" "00155521" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000131287" "05414" "00166423" "00110" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000133601" "05460" "00168741" "02416" "Unknown" "" "" "" "" "" "" "" "" "" "" "USH-1B" "Usher type I" ""
"0000138745" "00058" "00173892" "02449" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conr-rod dystrophy" ""
"0000186451" "05130" "00246594" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CSNBAD-2" "congenital stationary night blindness" ""
"0000186452" "05130" "00246595" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CSNBAD-2" "congenital stationary night blindness" ""
"0000207761" "04214" "00269966" "01848" "Familial, autosomal recessive" "41y" "Pericentral RP, night blindness, constricted with ring scotoma" "19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000207762" "04214" "00269967" "01848" "Familial, autosomal recessive" "52y" "Pericentral RP, night blindness, narrowing of visual field, constricted with ring scotoma" "49y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000227912" "04214" "00300601" "01848" "Familial, autosomal recessive" "43y" "RP, night blindness, constricted with ring scotoma" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000233960" "04214" "00308532" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233961" "04214" "00308533" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233962" "04214" "00308534" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233963" "04214" "00308535" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234047" "04214" "00308619" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234075" "04214" "00308647" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234076" "04214" "00308648" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234077" "04214" "00308649" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234612" "04214" "00309292" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234613" "04214" "00309293" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234614" "04214" "00309294" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000235131" "04214" "00309817" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000243995" "04214" "00325508" "00006" "Unknown" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000246192" "04214" "00327965" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246214" "04214" "00327987" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246301" "04214" "00328074" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246307" "04214" "00328080" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246377" "04214" "00328150" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246404" "04214" "00328177" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246414" "04214" "00328187" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246568" "04214" "00328341" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246719" "04214" "00328493" "00000" "Familial, autosomal recessive" "8y" "retinal dystrophy (HP:0000556)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000249476" "04214" "00331282" "00000" "Familial, autosomal recessive" "64y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000249818" "05086" "00331626" "00000" "Familial, autosomal recessive" "45y" "" "25y" "" "" "" "" "" "" "" "" "Usher syndrome, type II" ""
"0000250367" "00198" "00332179" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" ""
"0000250712" "04214" "00332524" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" ""
"0000250715" "04214" "00332527" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" ""
"0000251541" "04214" "00333354" "00000" "Familial, autosomal recessive" "35y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251552" "04214" "00333365" "00000" "Unknown" "59y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251826" "04214" "00333642" "00000" "Familial, autosomal dominant" "37y" "clinical category IA2fii" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" ""
"0000252036" "04214" "00333851" "00000" "Familial, autosomal recessive" "39y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252096" "04214" "00333911" "00000" "Familial, autosomal recessive" "41y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252097" "04214" "00333912" "00000" "Familial, autosomal recessive" "26y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252098" "04214" "00333913" "00000" "Familial, autosomal recessive" "44y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252160" "04214" "00333975" "00000" "Familial, autosomal recessive" "7y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" ""
"0000252161" "04214" "00333976" "00000" "Familial, autosomal recessive" "58y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" ""
"0000252559" "04214" "00334470" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252607" "04214" "00334567" "00000" "Familial, autosomal recessive" "54y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000252608" "04214" "00334568" "00000" "Familial, autosomal recessive" "22y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000252609" "04214" "00334569" "00000" "Familial, autosomal recessive" "55y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000252610" "04214" "00334570" "00000" "Familial, autosomal recessive" "66y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000252850" "00198" "00335135" "00000" "Familial, autosomal recessive" "" "18y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252851" "00198" "00335136" "00000" "Unknown" "" "22y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252852" "00198" "00335137" "00000" "Unknown" "" "34y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252853" "00198" "00335138" "00000" "Unknown" "" "24y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252854" "00198" "00335139" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252855" "00198" "00335140" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252937" "04214" "00335222" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252945" "04214" "00335230" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252993" "04214" "00335278" "02485" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252994" "04214" "00335279" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253021" "04214" "00335306" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253022" "04214" "00335307" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253370" "04214" "00335424" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253403" "04214" "00335458" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000253435" "04214" "00335490" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253436" "04214" "00335491" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253853" "04214" "00335952" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000254004" "04214" "00358789" "00000" "Familial, autosomal recessive" "15y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254015" "04214" "00358800" "00000" "Unknown" "42y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254255" "04214" "00358957" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254259" "04214" "00358961" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254275" "04214" "00358977" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254279" "04214" "00358981" "00000" "Familial" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000254434" "04214" "00359137" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" ""
"0000257645" "04214" "00362231" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258274" "04214" "00362908" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258799" "04214" "00363438" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258806" "04214" "00363445" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258822" "04214" "00363461" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258823" "04214" "00363462" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258824" "04214" "00363463" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258867" "04214" "00363518" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258989" "04214" "00363639" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000259101" "04214" "00363751" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" ""
"0000267417" "04214" "00372088" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267419" "04214" "00372090" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267903" "04214" "00372624" "00000" "Isolated (sporadic)" "41y" "see paper; ..." "31y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267908" "04214" "00372629" "00000" "Familial, autosomal dominant" "26y" "see paper; ..." "9y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267925" "04214" "00372646" "00000" "Familial, autosomal dominant" "22y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267927" "04214" "00372648" "00000" "Familial, autosomal dominant" "65y" "see paper; ..." "64y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267933" "04214" "00372654" "00000" "Familial, autosomal recessive" "24y" "see paper; ..." "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267945" "04214" "00372666" "00000" "Familial, autosomal recessive" "28y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267946" "04214" "00372667" "00000" "Familial, autosomal recessive" "38y" "see paper; ..." "7y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267947" "04214" "00372668" "00000" "Familial, autosomal recessive" "6y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267948" "04214" "00372669" "00000" "Familial, autosomal recessive" "16y" "see paper; ..." "6y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267985" "04214" "00372706" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267994" "04214" "00372715" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267997" "04214" "00372718" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000268648" "04214" "00373372" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000268649" "04214" "00373373" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269044" "04214" "00373835" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269068" "04214" "00373859" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269069" "04214" "00373860" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270135" "04214" "00374925" "00000" "Isolated (sporadic)" "50y" "best corrected visual acuity light perception/0.1" "10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270139" "04214" "00374929" "00000" "Isolated (sporadic)" "32y" "best corrected visual acuity 0.5/0.3" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270142" "04214" "00374932" "00000" "Isolated (sporadic)" "37y" "best corrected visual acuity 0.8/0.6" "10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270179" "04214" "00374969" "00000" "Isolated (sporadic)" "10y" "best corrected visual acuity 0.2/0.3" "5y" "" "" "" "" "" "" "" "" "congenital stationary night blindness" ""
"0000270180" "04214" "00374970" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity 0.2/0.15" "5y" "" "" "" "" "" "" "" "" "congenital stationary night blindness" ""
"0000270187" "04214" "00374977" "00000" "Familial, autosomal recessive" "65y" "7y-night blindenss, diminished visual acuity and visual field; best corrected visual acuity 0.4/count fingers 1m; pale optic disc, retina vessels attenuation and bone spicule pigmentation covering the entire retina; cataract, ocular hypertension" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270188" "04214" "00374978" "00000" "Familial, autosomal recessive" "67y" "7y-night blindenss, diminished visual acuity and visual field; best corrected visual acuity 0.6/count fingers; pale optic disc; cataract (21y), glaucoma" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270190" "04214" "00374980" "00000" "Familial, autosomal recessive" "54y" "9y-night blindenss, diminished visual acuity and visual field; best corrected visual acuity 0.3/0.25; pale optic disc, dispersed bone spicule pigmentation; cataract (25y)" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270490" "04214" "00375276" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270491" "04214" "00375277" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270492" "04214" "00375278" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270493" "04214" "00375279" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270515" "04214" "00375301" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270551" "04214" "00375337" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271379" "04214" "00376169" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" ""
"0000271381" "04214" "00376171" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" ""
"0000271382" "04214" "00376172" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" ""
"0000271383" "04214" "00376173" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" ""
"0000271391" "04214" "00376181" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" ""
"0000271394" "04214" "00376184" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex renitis pigmentosa" ""
"0000271396" "04214" "00376186" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex renitis pigmentosa" ""
"0000271720" "04214" "00376513" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271737" "04214" "00376530" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" ""
"0000271972" "04214" "00376761" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271973" "04214" "00376762" "00000" "Familial, autosomal recessive" "21y" "" "" "" "" "" "" "" "" "" "" "Nyctalopia, reduced peripheral vision" ""
"0000271975" "04214" "00376764" "00000" "Familial, autosomal recessive" "9y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome type II" ""
"0000271983" "04214" "00376772" "00000" "Familial, autosomal dominant" "29y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271984" "04214" "00376773" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271988" "04214" "00376777" "00000" "Familial, autosomal dominant" "19y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271990" "04214" "00376779" "00000" "Familial, autosomal dominant" "14y" "" "" "" "" "" "" "" "" "" "" "Retinal dystrophy" ""
"0000271996" "04214" "00376785" "00000" "Familial, X-linked" "18y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271997" "04214" "00376786" "00000" "Familial, X-linked" "44y" "" "" "" "" "" "" "" "" "" "" "Rod-cone dystrophy" ""
"0000271998" "04214" "00376787" "00000" "Unknown" "24y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272007" "04214" "00376796" "00000" "Unknown" "67y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272079" "04214" "00376868" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272362" "04214" "00377204" "00000" "Familial, autosomal recessive" "34y" "see paper" "8y" "10y" "" "" "" "" "" "" "retinitis pigmentosa, type 40 (RP40)" "retinal disease" ""
"0000272402" "04214" "00377244" "00000" "Familial, autosomal recessive" "41y" "see paper" "4y" "4y" "" "" "" "" "" "" "retinitis pigmentosa, type 40 (RP40)" "retinal disease" ""
"0000272694" "04214" "00377544" "00000" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000272966" "04214" "00377820" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" ""
"0000273195" "00112" "00378053" "03508" "Familial, autosomal recessive" "" "HP:0001141, HP:0000662, HP:0000613, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273261" "04214" "00379388" "00000" "Unknown" "47y" "" "16y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273272" "04214" "00379399" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273398" "04214" "00379525" "00000" "Familial" "34y" "" "" "" "" "" "" "" "" "" "" "Simplex retinitis pigmentosa" ""
"0000273518" "00112" "00379674" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0003745,\tHP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273619" "00112" "00379765" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0000365,\tHP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273708" "04214" "00379854" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000273709" "04214" "00379855" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000273710" "04214" "00379856" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy" ""
"0000273711" "04214" "00379857" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000273712" "04214" "00379858" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000274102" "04214" "00380251" "00000" "Familial, autosomal recessive" "51y" "cataract surgery in the RE and had foveal atrophy in both eyes" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000274103" "04214" "00380252" "00000" "Familial, autosomal recessive" "26y" "CME in the LE" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000274104" "04214" "00380253" "00000" "Familial, autosomal recessive" "28y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000274105" "04214" "00380254" "00000" "Familial, autosomal recessive" "32y" "Mild cataract, particularly anterior subcapsular opacity" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000274109" "04214" "00380258" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000274161" "04214" "00380310" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy (CD)" ""
"0000274222" "04214" "00380371" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000274846" "04214" "00380995" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000274932" "04214" "00381081" "00000" "Familial, autosomal recessive" "48y" "Emmetropia" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" ""
"0000274933" "04214" "00381082" "00000" "Familial, autosomal recessive" "53y" "Emmetropia" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" ""
"0000274934" "04214" "00381083" "00000" "Familial, autosomal recessive" "60y" "Dense cataracts" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" ""
"0000275012" "04214" "00381161" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (ARRP)" ""
"0000275018" "04214" "00381167" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000275445" "04214" "00381603" "00000" "Isolated (sporadic)" "" "" "30y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275446" "04214" "00381604" "00000" "Isolated (sporadic)" "" "" "36y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275463" "04214" "00381621" "00000" "Isolated (sporadic)" "" "" "43y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275471" "04214" "00381629" "00000" "Isolated (sporadic)" "" "" "47y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275478" "04214" "00381636" "00000" "Isolated (sporadic)" "" "" "45y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275496" "04214" "00381654" "00000" "Familial, autosomal recessive" "" "" "1y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275558" "04214" "00381716" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000275714" "04214" "00381872" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275715" "04214" "00381873" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275716" "04214" "00381874" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275979" "03440" "00382137" "00000" "Familial, autosomal recessive" "" "retinal dystrophy; MIM, 613801 or 163500" "" "" "" "" "" "" "" "" "" "MIM, 613801 or 163500" ""
"0000276189" "04214" "00382340" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276190" "04214" "00382341" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276191" "04214" "00382342" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276192" "04214" "00382343" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276193" "04214" "00382344" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" ""
"0000276194" "04214" "00382345" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276196" "04214" "00382347" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276402" "04214" "00382553" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000276422" "04214" "00382573" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276423" "04214" "00382574" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Cone dystrophy" ""
"0000276646" "04214" "00382790" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277278" "04214" "00383493" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277279" "04214" "00383494" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277280" "04214" "00383495" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277546" "04214" "00383761" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277566" "04214" "00383781" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277567" "04214" "00383782" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277691" "04214" "00383906" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277747" "04214" "00383962" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277988" "04214" "00384203" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000278425" "00198" "00384635" "00000" "Familial, autosomal recessive" "" "Usher syndrome and addtional retinitis pigmentosa" "" "" "" "" "" "" "" "" "Mixed" "Usher syndrome" ""
"0000278551" "04214" "00384768" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278844" "04214" "00385060" "00000" "Isolated (sporadic)" "34y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.5/0.7" "1y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000278845" "04214" "00385061" "00000" "Isolated (sporadic)" "34y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.5/0.7" "1y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000278883" "04214" "00385100" "00000" "Familial, autosomal recessive" "" "Abnormal male genitals" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl syndrome" ""
"0000278884" "04214" "00385101" "00000" "Familial, autosomal recessive" "" "Abnormal male genitals" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl syndrome" ""
"0000279544" "04214" "00385731" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000279761" "04214" "00385960" "00000" "Familial" "" "" "14y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000279762" "04214" "00385961" "00000" "Familial" "" "" "14y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000279765" "04214" "00385964" "00000" "Familial" "" "" "18y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000279766" "04214" "00385965" "00000" "Familial" "" "" "18y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000279975" "04214" "00386172" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000280059" "04214" "00386256" "00000" "Familial, autosomal recessive" "61y" "" "" "40y" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000280095" "04214" "00386292" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000280104" "04214" "00386301" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000280412" "04214" "00386612" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280441" "04214" "00386641" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280453" "04214" "00386653" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280527" "04214" "00386727" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280608" "04214" "00386808" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280611" "04214" "00386811" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280677" "04214" "00386877" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280705" "04214" "00386905" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280844" "04214" "00387066" "00000" "Familial, autosomal recessive" "15y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280845" "04214" "00387067" "00000" "Familial, autosomal recessive" "81y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280846" "04214" "00387068" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280847" "04214" "00387069" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280848" "04214" "00387070" "00000" "Familial, autosomal recessive" "47y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280849" "04214" "00387071" "00000" "Familial, autosomal recessive" "34y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000280850" "04214" "00387072" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" ""
"0000282023" "04214" "00388471" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy or retinitis pigmentosa (RCD/RP)" ""
"0000282303" "04214" "00388762" "00000" "Familial, autosomal recessive" "54y" "age at genetic diagnosis mentioned" "" "47y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282304" "04214" "00388763" "00000" "Familial, autosomal recessive" "46y" "age at genetic diagnosis mentioned" "" "39y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282616" "04214" "00389075" "00000" "Familial, autosomal recessive" "20y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000282772" "04214" "00389231" "00000" "Familial, autosomal recessive" "61y" "age at genetic diagnosis mentioned" "" "55y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282835" "04214" "00389294" "00000" "Familial, autosomal recessive" "53y" "age at genetic diagnosis mentioned" "" "47y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282903" "04214" "00389362" "00000" "Familial, autosomal recessive" "48y" "age at genetic diagnosis mentioned" "" "42y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282959" "04214" "00389418" "00000" "Familial, autosomal recessive" "13y" "age at genetic diagnosis mentioned" "" "7y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000282960" "04214" "00389419" "00000" "Familial, autosomal recessive" "24y" "age at genetic diagnosis mentioned" "" "19y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000283086" "04214" "00389545" "00000" "Isolated (sporadic)" "58y" "age at genetic diagnosis mentioned" "" "52y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283181" "04214" "00389640" "00000" "Familial, autosomal recessive" "17y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000283323" "04214" "00389782" "00000" "Isolated (sporadic)" "55y" "age at genetic diagnosis mentioned" "" "50y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283386" "04214" "00389845" "00000" "Isolated (sporadic)" "45y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283388" "04214" "00389847" "00000" "Isolated (sporadic)" "49y" "age at genetic diagnosis mentioned" "" "46y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283394" "04214" "00389853" "00000" "Isolated (sporadic)" "44y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283416" "04214" "00389875" "00000" "Isolated (sporadic)" "39y" "age at genetic diagnosis mentioned" "" "35y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283477" "04214" "00389936" "00000" "Isolated (sporadic)" "61y" "age at genetic diagnosis mentioned" "" "58y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283509" "04214" "00389968" "00000" "Isolated (sporadic)" "30y" "age at genetic diagnosis mentioned" "" "29y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283519" "04214" "00389978" "00000" "Isolated (sporadic)" "14y" "age at genetic diagnosis mentioned" "" "13y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" ""
"0000283871" "04214" "00390333" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" ""
"0000283872" "04214" "00390334" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283873" "04214" "00390335" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" ""
"0000283874" "04214" "00390336" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283875" "04214" "00390337" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283876" "04214" "00390338" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283877" "04214" "00390339" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000284245" "04214" "00390757" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000284262" "04214" "00390774" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000285817" "04214" "00392570" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285853" "04214" "00392606" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285854" "04214" "00392607" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285867" "04214" "00392620" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285877" "04214" "00392630" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285924" "04214" "00392677" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285925" "04214" "00392678" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000286695" "04214" "00393489" "00000" "Isolated (sporadic)" "42y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000286785" "04214" "00393579" "00000" "Isolated (sporadic)" "38y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" ""
"0000286786" "04214" "00393580" "00000" "Isolated (sporadic)" "46y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" ""
"0000286820" "04214" "00393614" "00000" "Isolated (sporadic)" "47y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" ""
"0000286918" "04214" "00393712" "00000" "Isolated (sporadic)" "20y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" ""
"0000287002" "04214" "00393796" "00000" "Isolated (sporadic)" "55y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" ""
"0000287016" "04214" "00393810" "00000" "Isolated (sporadic)" "55y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000287044" "04214" "00393838" "00000" "Familial, autosomal recessive" "41y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" ""
"0000287530" "04214" "00394326" "00000" "Familial, autosomal recessive" "" "Early-onset RP" "" "12y" "" "" "" "" "" "" "retinits pigmentosa" "" ""
"0000287820" "04214" "00394617" "00000" "Familial, autosomal recessive" "45y" "" "1y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287821" "04214" "00394618" "00000" "Familial, autosomal recessive" "59y" "" "49y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287822" "04214" "00394619" "00000" "Familial, autosomal recessive" "51y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287823" "04214" "00394620" "00000" "Familial, autosomal recessive" "65y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287824" "04214" "00394621" "00000" "Familial, autosomal recessive" "69y" "" "5y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000288774" "04214" "00395576" "00000" "Familial, autosomal recessive" "" "cataract, rod-cone dystrophy, macroscopic hematuria, hypertension, glomerulonephritis" "" "" "" "" "" "" "" "" "Early onset retinitis pigmentosa, glomerulonephritis" "Senior-Loken-like syndrome" ""
"0000288958" "04214" "00395796" "00000" "Unknown" "44y8m" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000289576" "04214" "00396414" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000289658" "04214" "00396497" "00000" "Familial, autosomal recessive" "59y" "night blindness" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289669" "04214" "00396508" "00000" "Isolated (sporadic)" "63y" "" "53y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289676" "04214" "00396515" "00000" "Familial, autosomal recessive" "60y" "night blindness" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289681" "04214" "00396520" "00000" "Unknown" "53y" "night blindness" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289711" "04214" "00396550" "00000" "Isolated (sporadic)" "24y" "night blindness" "12y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289727" "04214" "00396566" "00000" "Isolated (sporadic)" "39y" "night blindness" "12y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000289733" "04214" "00396572" "00000" "Isolated (sporadic)" "31y" "decreased visual acuity combined with left eye interstitial keratitis" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000291894" "04214" "00398810" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291915" "04214" "00398821" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291916" "04214" "00398822" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291917" "04214" "00398823" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291918" "04214" "00398824" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291922" "04214" "00398827" "00000" "Familial, autosomal recessive" "7y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.1, (kinetic) visual field (III4e, square degrees):7636/7651, (kinetic) visual field (I4e, square degrees):2764/2345" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291923" "04214" "00398828" "00000" "Familial, autosomal recessive" "7y" "best-corrected visual acuity (logMAR) right/left eye: 0.2/0.1, (kinetic) visual field (III4e, square degrees):14359/9883, (kinetic) visual field (I4e, square degrees):420/672" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291924" "04214" "00398829" "00000" "Familial, autosomal recessive" "12y" "best-corrected visual acuity (logMAR) right/left eye: 0.2/0.1, (kinetic) visual field (III4e, square degrees):1325/1545, (kinetic) visual field (I4e, square degrees):390/417" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291925" "04214" "00398830" "00000" "Familial, autosomal recessive" "13y" "best-corrected visual acuity (logMAR) right/left eye: 0.0/-0.1, (kinetic) visual field (III4e, square degrees):9051/8358, (kinetic) visual field (I4e, square degrees):430/413" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291926" "04214" "00398831" "00000" "Familial, autosomal recessive" "16y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.2, (kinetic) visual field (III4e, square degrees):not performed/not performed, (kinetic) visual field (I4e, square degrees):2054/1502" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291927" "04214" "00398832" "00000" "Familial, autosomal recessive" "20y" "best-corrected visual acuity (logMAR) right/left eye: 0.2/0.4, (kinetic) visual field (III4e, square degrees):1376/13149, (kinetic) visual field (I4e, square degrees):1395/1221" "<30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291928" "04214" "00398833" "00000" "Familial, autosomal recessive" "25y" "best-corrected visual acuity (logMAR) right/left eye: 0.0/0.0, (kinetic) visual field (III4e, square degrees):412/493, (kinetic) visual field (I4e, square degrees):131/162" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291929" "04214" "00398834" "00000" "Familial, autosomal recessive" "28y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.6, (kinetic) visual field (III4e, square degrees):1249/1801, (kinetic) visual field (I4e, square degrees):323/204" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291930" "04214" "00398835" "00000" "Familial, autosomal recessive" "29y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.3, (kinetic) visual field (III4e, square degrees):6354/10143, (kinetic) visual field (I4e, square degrees):297/225" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291931" "04214" "00398836" "00000" "Familial, autosomal recessive" "29y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.3, (kinetic) visual field (III4e, square degrees):11137/9484, (kinetic) visual field (I4e, square degrees):5025/5129" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291932" "04214" "00398837" "00000" "Familial, autosomal recessive" "32y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.2, (kinetic) visual field (III4e, square degrees):416/440, (kinetic) visual field (I4e, square degrees):218/277" "0m" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291933" "04214" "00398838" "00000" "Familial, autosomal recessive" "35y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.3, (kinetic) visual field (III4e, square degrees):349/427, (kinetic) visual field (I4e, square degrees):172/33" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291934" "04214" "00398839" "00000" "Familial, autosomal recessive" "35y" "best-corrected visual acuity (logMAR) right/left eye: 0.2/0.2, (kinetic) visual field (III4e, square degrees):484/420, (kinetic) visual field (I4e, square degrees):36/18" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291935" "04214" "00398840" "00000" "Familial, autosomal recessive" "36y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.0, (kinetic) visual field (III4e, square degrees):709/588, (kinetic) visual field (I4e, square degrees):264/53" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291936" "04214" "00398841" "00000" "Familial, autosomal recessive" "36y" "best-corrected visual acuity (logMAR) right/left eye: 0.0/0.0, (kinetic) visual field (III4e, square degrees):4388/7223, (kinetic) visual field (I4e, square degrees):345/398" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291937" "04214" "00398842" "00000" "Familial, autosomal recessive" "37y" "best-corrected visual acuity (logMAR) right/left eye: 1, (kinetic) visual field (III4e, square degrees):8785/7893, (kinetic) visual field (I4e, square degrees):not performed/not performed" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291938" "04214" "00398843" "00000" "Familial, autosomal recessive" "42y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.6, (kinetic) visual field (III4e, square degrees):228/239, (kinetic) visual field (I4e, square degrees):88/66" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291939" "04214" "00398844" "00000" "Familial, autosomal recessive" "43y" "best-corrected visual acuity (logMAR) right/left eye: 0.2/0.7, (kinetic) visual field (III4e, square degrees):1586/1579, (kinetic) visual field (I4e, square degrees):341/398" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291940" "04214" "00398845" "00000" "Familial, autosomal recessive" "45y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.1, (kinetic) visual field (III4e, square degrees):2451/2259, (kinetic) visual field (I4e, square degrees):384/272" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291941" "04214" "00398846" "00000" "Familial, autosomal recessive" "45y" "best-corrected visual acuity (logMAR) right/left eye: 0.3/0.1, (kinetic) visual field (III4e, square degrees):9/3/2022, (kinetic) visual field (I4e, square degrees):not performed/not performed" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291942" "04214" "00398847" "00000" "Familial, autosomal recessive" "46y" "best-corrected visual acuity (logMAR) right/left eye: 1.2/1.2, (kinetic) visual field (III4e, square degrees):96/226, (kinetic) visual field (I4e, square degrees):8/no data" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291943" "04214" "00398848" "00000" "Familial, autosomal recessive" "48y" "best-corrected visual acuity (logMAR) right/left eye: 0.1/0.1, (kinetic) visual field (III4e, square degrees):208/287, (kinetic) visual field (I4e, square degrees):49/37" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291944" "04214" "00398849" "00000" "Familial, autosomal recessive" "52y" "best-corrected visual acuity (logMAR) right/left eye: 0.6/0.4, (kinetic) visual field (III4e, square degrees):54/34, (kinetic) visual field (I4e, square degrees):not performed/not performed" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291945" "04214" "00398850" "00000" "Familial, autosomal recessive" "52y" "best-corrected visual acuity (logMAR) right/left eye: 1.0/0.6, (kinetic) visual field (III4e, square degrees):269/185, (kinetic) visual field (I4e, square degrees):40/23" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291959" "04214" "00398861" "00000" "Familial, autosomal recessive" "25y" "optical coherence tomography: cystoid oedema, which was also evident on ophthalmoscopy, and epiretinal membrane; no rod function and detectable cone function in the central field only; 34y best-corrected visual acuity remained 20/30, but visual fields had decreased to only a central island" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291965" "04214" "00398877" "00000" "Familial, autosomal recessive" "81y" "best corrected visual acuity right/left eye: 20/200 / 20/30 vision in her left eye; pseudophakia in both eyes with posterior intraocular lens; funduscopy: atrophic retinal pigment epithelium in both maculae with pale optic nerves and intraretinal pigment migration in the mid-periphery of both eyes; fundus autofluorescence: severe loss of retinal pigment epithelium function in both eyes, except a central foveal island in the left eye" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291967" "04214" "00398878" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291968" "04214" "00398879" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291969" "04214" "00398880" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291970" "04214" "00398881" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291971" "04214" "00398882" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291972" "04214" "00398883" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291973" "04214" "00398884" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291974" "04214" "00398885" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291975" "04214" "00398886" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291976" "04214" "00398887" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291977" "04214" "00398888" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291978" "04214" "00398889" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291979" "04214" "00398890" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291980" "04214" "00398891" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291981" "04214" "00398892" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291982" "04214" "00398893" "00000" "Familial, autosomal recessive" "22y" "best corrected visual acuity first visit: 20/60 both eyes; follow up 20/30 both eyes" "9y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291983" "04214" "00398894" "00000" "Familial, autosomal recessive" "14y" "best corrected visual acuity first visit: 20/30 both eyes; 20/20 right eye 20/25 left eye" "10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291984" "04214" "00398895" "00000" "Familial, autosomal recessive" "21y" "best corrected visual acuity first visit: 20/80 right eye 20/60^-1 left eye 20/25^+2 both eyes" "9y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291985" "04214" "00398896" "00000" "Familial, autosomal recessive" "28y" "progressive visual field constriction and decreased visual acuity by the age of 28 (right eye:1/3 , left eye OS:1/2); Funduscoupy: pale optic nerve disc, narrowed blood vessels, and bone spicule pigmentation in the periphery; electroretinogram: responses not detectable" "4y" "" "night blindnes" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000291986" "04214" "00398896" "00000" "Familial, autosomal recessive" "" "phenotype similar to proband II:3" "" "" "night blindnes" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292055" "04214" "00398966" "00000" "Familial, autosomal recessive" "48y" "optical coherence tomography: cystoid oedema, which was also evident on ophthalmoscopy; bilateral vitreomacular traction; extensive epiretinal membranes; no rod function and detectable cone function in the central field only; 34y best-corrected visual acuity remained 20/30, but visual fields had decreased to only a central island; best corrected visual acuity: 20/100 each eye. Cataract extraction in the right eye had improved his vision from 20/200 to 20/100; posterior intraocular lens; posterior subcapsular cataract left eye; non-nummular intraretinal pigmentation from the arcades to the mid-peripheral retina" "" "" "night vision problems" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292056" "04214" "00398967" "00000" "Familial, autosomal recessive" "44y" "night blindness from childhood; visual field disturbances in mid-thirties best-corrected visual acuity right/left eye: 0.5 with +0.75 DS and -1.25 DC ax 180deg in the right eye and 0.02 with +1.0 DS with -2.25 DC ax 10deg in the left eye; intraocular lens in both eyes; diffuse retinal degeneration with numerous bone spicule pigments in the midperiphery; retinal vessels severely attenuated; optic discs were waxy-pale in both eyes; constricted visual fields" "" "" "night vision problems" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292057" "04214" "00398968" "00000" "Familial, autosomal recessive" "30y" "best-corrected visual acuity: 0.4 both eyes; bone spicules in the mid-periphery, constricted arterial vessels, visual field (III/4e) constricted to 10–20deg centrally; full-field electroretinogram: no reproducible potentials in the scotopic ERG or the photopic ERG of both eyes; multifocal ERG showed only residual responses in the center of the left e" "" "22y" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292058" "04214" "00398969" "00000" "Familial, autosomal recessive" "54y" "36y cataract surgery; 40y bilateral macular edema; best-corrected visual acuity right/left eye: 0.8/1; retina - pale optic nerve, reduced caliber of the retinal arteries, and pigment spiculae in the mid-periphery of the retina; Goldman visual fields: normal external limits with a V/4e stimulus, a complete dissociations of isopters V4e and I4e, complete annular scotoma at 40deg; full-field electroretinogram 41y: not recordable; autofluorescence) imaging showed a hyperautofluorescent fovea surrounded by a 10° normal autofluorescence: hyperautofluorescent ring extending to the vascular arcade and a hypoautofluorescent lesion corresponding to the bone spicule pigmentation in the mid-periphery; optical coherence tomography: residual macular edema in a full thickness disorganized retin" "" "14y" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292059" "04214" "00398970" "00000" "Familial, autosomal recessive" "46y" "mild mottling of the macular RPE, a moderate bone spicule pigmentary retinopathy; autofluorescence: a paramacular autofluorescence ring, followed by a diffuse hyperautofluorescent zone reaching to the vascular arcade; confluent hypoautofluorescent nummular lesions were concentrated in the mid-periphery of the retina. optical coherence tomography: loss of the IS/OS lamina with multiple small hyperreflective debris at the level of the inner retina" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292060" "04214" "00398971" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292061" "04214" "00398972" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292062" "04214" "00398973" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292063" "04214" "00398974" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292064" "04214" "00398975" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292065" "04214" "00398976" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292066" "04214" "00398977" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292067" "04214" "00398978" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292268" "04214" "00399180" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292269" "04214" "00399181" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292270" "04214" "00399182" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292271" "04214" "00399183" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292272" "04214" "00399184" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292273" "04214" "00399185" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292274" "04214" "00399186" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292275" "04214" "00399187" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292276" "04214" "00399188" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292277" "04214" "00399189" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292278" "04214" "00399190" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292279" "04214" "00399191" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292280" "04214" "00399192" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292281" "04214" "00399193" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292282" "04214" "00399194" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292283" "04214" "00399195" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292284" "04214" "00399196" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292285" "04214" "00399197" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292286" "04214" "00399198" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292287" "04214" "00399199" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292288" "04214" "00399200" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292289" "04214" "00399201" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292290" "04214" "00399202" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292291" "04214" "00399203" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292292" "04214" "00399204" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292293" "04214" "00399205" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292294" "04214" "00399206" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292295" "04214" "00399207" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292296" "04214" "00399208" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292297" "04214" "00399209" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292298" "04214" "00399210" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292299" "04214" "00399211" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292300" "04214" "00399212" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292301" "04214" "00399213" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292302" "04214" "00399214" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292303" "04214" "00399215" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000292304" "04214" "00399216" "00000" "Familial, autosomal recessive" "" "see paper supplemental data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000296002" "04214" "00403260" "00000" "Familial, X-linked" "3m" "nystagmus, normal visual attention, and a normal fundus exam. ERG responses were severely decreased" "" "" "" "" "" "" "" "" "congenital stationary night blindness (CSNB2)" "Leber congenital amaurosis (LCA)" ""
"0000300189" "04214" "00408060" "00000" "Familial, autosomal recessive" "" "onset: 1st decade; photophobia: no; nystagmus: no; decline in visual acuity: 2nd decade; myopia keratoconus: no; cataract: no; papillary pallor: severe; peripapillary atrophy: yes; white flecks: yes; pigment mottling: no; vessel attenuation: no; bone spicules: average and extreme in the periphery; chorioretinal atrophy: diffuse; optical coherence tomography: macular cystic oedema; visual field: concentric narrowing" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000304647" "03440" "00412655" "04345" "Familial, autosomal recessive" "" "Retinitis pigmentosa" "" "" "" "khadim" "" "" "" "" "Retinitis pigmentosa" "Retinal dystrophy" ""
"0000311795" "04214" "00420547" "00000" "Familial, autosomal recessive" "44y8m" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000320367" "00112" "00429495" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320383" "00112" "00429511" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320386" "00112" "00429514" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320388" "00112" "00429516" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320402" "00112" "00429530" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320410" "00112" "00429538" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320436" "00112" "00429564" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320491" "00112" "00429619" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320497" "00112" "00429625" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320503" "00112" "00429631" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320569" "00112" "00429697" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320572" "00112" "00429700" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320588" "00112" "00429716" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320602" "00112" "00429730" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320696" "00112" "00429824" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320709" "00112" "00429837" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320715" "00112" "00429843" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320720" "00112" "00429848" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320798" "00112" "00429926" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320830" "00112" "00429958" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320966" "00112" "00430094" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000321002" "00112" "00430130" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000321012" "00112" "00430140" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000336181" "00198" "00446982" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" ""
"0000336199" "00198" "00447000" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" ""
"0000336335" "00198" "00447136" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000336337" "00198" "00447138" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000336515" "00198" "00447316" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" ""
"0000336711" "00198" "00447512" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" ""
"0000336904" "00198" "00447705" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" ""
"0000336925" "00198" "00447726" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "unclear diagnosis" ""
"0000348612" "04214" "00461112" "00006" "Familial, autosomal recessive" "" "" "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000355175" "00325" "00470030" "00006" "Familial, autosomal recessive" "32y10m" "see paper; ..., non-syndromic; bilateral cataract; retinitis pigmentosa, glaucoma" "20y" "" "" "" "" "" "" "" "" "bilateral cataract" ""
## Screenings ## Do not remove or alter this header ##
## Count = 501
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000001611" "00001808" "1" "00102" "00102" "2013-08-08 22:10:38" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033163" "00033095" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033164" "00033096" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033174" "00033106" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033177" "00033109" "1" "00229" "00229" "2012-02-04 14:49:23" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033180" "00033112" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033183" "00033115" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033190" "00033122" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033194" "00033126" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033196" "00033128" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033198" "00033130" "1" "00229" "00229" "2012-02-04 14:23:49" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033199" "00033131" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033204" "00033136" "1" "00229" "00229" "2012-02-04 14:49:23" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033206" "00033138" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033210" "00033142" "1" "00229" "00229" "2012-02-04 14:49:23" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033212" "00033144" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033214" "00033146" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033670" "00033602" "1" "00130" "00130" "2013-10-01 11:13:16" "00008" "2013-10-02 12:14:26" "SEQ" "DNA" "" ""
"0000050625" "00050680" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000052786" "00052838" "1" "01424" "01424" "2015-10-26 17:05:36" "00006" "2015-10-26 17:47:10" "PCR;SEQ;SEQ-NG-S" "DNA" "" ""
"0000100496" "00100093" "1" "01769" "01769" "2017-01-30 18:29:03" "" "" "SEQ" "DNA" "WBC" ""
"0000100504" "00100100" "1" "01769" "01769" "2017-01-30 19:15:17" "" "" "SEQ" "DNA" "WBC" ""
"0000105519" "00105046" "1" "01244" "00006" "2017-06-16 16:15:45" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000156386" "00155521" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000174782" "00173892" "1" "02449" "02449" "2018-04-11 18:11:48" "" "" "SEQ" "DNA" "" ""
"0000233580" "00232481" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233581" "00232482" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233582" "00232483" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233583" "00232484" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233584" "00232485" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233585" "00232486" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233586" "00232487" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233587" "00232488" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233588" "00232489" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233589" "00232490" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233590" "00232491" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233591" "00232492" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233592" "00232493" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233593" "00232494" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233594" "00232495" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233595" "00232496" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233596" "00232497" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233597" "00232498" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233598" "00232499" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233599" "00232500" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233600" "00232501" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233601" "00232502" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233602" "00232503" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233603" "00232504" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233604" "00232505" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233605" "00232506" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233606" "00232507" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233607" "00232508" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233608" "00232509" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233609" "00232510" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233610" "00232511" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233611" "00232512" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233612" "00232513" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233613" "00232514" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233614" "00232515" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233615" "00232516" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233616" "00232517" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233617" "00232518" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233618" "00232519" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233619" "00232520" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233620" "00232521" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233621" "00232522" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233622" "00232523" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233623" "00232524" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000233624" "00232525" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234762" "00233663" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234763" "00233664" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234764" "00233665" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234765" "00233666" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000247706" "00246594" "1" "00006" "00006" "2019-07-14 13:18:01" "" "" "SEQ" "DNA" "" ""
"0000247707" "00246595" "1" "00006" "00006" "2019-07-14 13:24:18" "" "" "SEQ" "DNA" "" ""
"0000271119" "00269966" "1" "01848" "01848" "2019-12-11 07:13:08" "" "" "SEQ-NG" "DNA" "" "Clinical exome sequencing"
"0000271120" "00269967" "1" "01848" "01848" "2019-12-11 07:30:16" "" "" "SEQ-NG" "DNA" "" "clinical exome sequencing"
"0000294807" "00293639" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000294809" "00293641" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000294822" "00293654" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000301722" "00300601" "1" "01848" "00006" "2020-05-03 17:19:36" "" "" "SEQ-NG" "DNA" "" ""
"0000309677" "00308532" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309678" "00308533" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309679" "00308534" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309680" "00308535" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309764" "00308619" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309792" "00308647" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel"
"0000309793" "00308648" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel"
"0000309794" "00308649" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel"
"0000310437" "00309292" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310438" "00309293" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310439" "00309294" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310962" "00309817" "1" "00006" "00006" "2020-09-03 19:48:29" "" "" "SEQ" "DNA" "" ""
"0000326719" "00325508" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000329180" "00327965" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES"
"0000329202" "00327987" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329289" "00328074" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329295" "00328080" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329365" "00328150" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS"
"0000329392" "00328177" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329402" "00328187" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329556" "00328341" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329708" "00328493" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000332502" "00331282" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel"
"0000332845" "00331626" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" ""
"0000333399" "00332179" "1" "00006" "00006" "2021-02-15 14:43:07" "" "" "SEQ" "DNA" "" "WES"
"0000333748" "00332524" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000333751" "00332527" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000334579" "00333354" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel"
"0000334590" "00333365" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel"
"0000334868" "00333642" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000335077" "00333851" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335137" "00333911" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335138" "00333912" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335139" "00333913" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335201" "00333975" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335202" "00333976" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335699" "00334470" "1" "00000" "00006" "2021-02-28 17:46:08" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000335796" "00334567" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "105-gene panel"
"0000335797" "00334568" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "105-gene panel"
"0000335798" "00334569" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "105-gene panel"
"0000335799" "00334570" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "105-gene panel"
"0000336364" "00335135" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336365" "00335136" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336366" "00335137" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336367" "00335138" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336368" "00335139" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336369" "00335140" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336451" "00335222" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel"
"0000336459" "00335230" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel"
"0000336507" "00335278" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336508" "00335279" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336535" "00335306" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336536" "00335307" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336653" "00335424" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel"
"0000336687" "00335458" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "WES"
"0000336719" "00335490" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel"
"0000336720" "00335491" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel"
"0000337182" "00335952" "1" "00000" "00006" "2021-03-09 16:40:10" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360019" "00358789" "1" "00000" "00006" "2021-03-12 09:26:03" "" "" "SEQ-NG" "DNA" "" "226-gene panel"
"0000360030" "00358800" "1" "00000" "00006" "2021-03-12 09:26:03" "" "" "SEQ-NG" "DNA" "" "226-gene panel"
"0000360194" "00358957" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360198" "00358961" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360214" "00358977" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360218" "00358981" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360375" "00359137" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000363460" "00362231" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" ""
"0000364136" "00362908" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364666" "00363438" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364673" "00363445" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364689" "00363461" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364690" "00363462" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364691" "00363463" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364746" "00363518" "1" "00000" "00006" "2021-04-29 12:09:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000364867" "00363639" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364979" "00363751" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373316" "00372088" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel"
"0000373318" "00372090" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel"
"0000373856" "00372624" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373861" "00372629" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373878" "00372646" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373880" "00372648" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373886" "00372654" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373898" "00372666" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373899" "00372667" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373900" "00372668" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373901" "00372669" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373938" "00372706" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373947" "00372715" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373950" "00372718" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000374607" "00373372" "1" "00000" "00006" "2021-05-14 10:24:46" "" "" "PE;SEQ" "DNA" "" "APEX"
"0000374608" "00373373" "1" "00000" "00006" "2021-05-14 10:24:46" "" "" "PE;SEQ" "DNA" "" "APEX"
"0000375067" "00373835" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel"
"0000375091" "00373859" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel"
"0000375092" "00373860" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel"
"0000376119" "00374925" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376123" "00374929" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376126" "00374932" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376163" "00374969" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376164" "00374970" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376171" "00374977" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" ""
"0000376172" "00374978" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" ""
"0000376174" "00374980" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" ""
"0000376473" "00375276" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000376474" "00375277" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000376475" "00375278" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000376476" "00375279" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000376498" "00375301" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000376534" "00375337" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel"
"0000377365" "00376169" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377367" "00376171" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377368" "00376172" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377369" "00376173" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377377" "00376181" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377380" "00376184" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377382" "00376186" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" ""
"0000377718" "00376513" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCRm;SEQ" "DNA" "blood" ""
"0000377735" "00376530" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "arraySEQ" "DNA" "" ""
"0000377967" "00376761" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377968" "00376762" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377970" "00376764" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377978" "00376772" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377979" "00376773" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377983" "00376777" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377985" "00376779" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377991" "00376785" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377992" "00376786" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377993" "00376787" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000378002" "00376796" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000378073" "00376868" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES"
"0000378409" "00377204" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000378449" "00377244" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000378747" "00377544" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing"
"0000379024" "00377820" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" ""
"0000379252" "00378053" "1" "03508" "03508" "2021-08-04 04:00:04" "" "" "SEQ-NG-I" "DNA" "" ""
"0000380588" "00379388" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" ""
"0000380597" "00379399" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "arraySEQ;PCR;SEQ" "DNA" "blood" ""
"0000380725" "00379525" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "?" "DNA" "blood" ""
"0000380874" "00379674" "1" "03508" "03508" "2021-08-06 09:19:29" "" "" "SEQ-NG-I" "DNA" "" ""
"0000380966" "00379765" "1" "03508" "03508" "2021-08-09 06:47:26" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381056" "00379854" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD"
"0000381057" "00379855" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "exome sequencing"
"0000381058" "00379856" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD"
"0000381059" "00379857" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD"
"0000381060" "00379858" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD"
"0000381465" "00380251" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "Found in 4 homozygous patients, 9 heterozygous patients and 2 heterozygous controls."
"0000381466" "00380252" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "Found in 4 homozygous patients, 9 heterozygous patients and 2 heterozygous controls."
"0000381467" "00380253" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "Found in 4 homozygous patients, 9 heterozygous patients and 2 heterozygous controls."
"0000381468" "00380254" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "Found in 4 homozygous patients, 9 heterozygous patients and 2 heterozygous controls."
"0000381472" "00380258" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" ""
"0000381524" "00380310" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "autozygome-guided sequencing"
"0000381585" "00380371" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" ""
"0000382209" "00380995" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay"
"0000382295" "00381081" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382296" "00381082" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382297" "00381083" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382376" "00381161" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382382" "00381167" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "Exome Sequencing"
"0000382819" "00381603" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382820" "00381604" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382837" "00381621" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382845" "00381629" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382852" "00381636" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382870" "00381654" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382932" "00381716" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" ""
"0000383088" "00381872" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383089" "00381873" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" ""
"0000383090" "00381874" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383353" "00382137" "1" "00000" "03840" "2021-09-07 10:12:12" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383554" "00382340" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383555" "00382341" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383556" "00382342" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383557" "00382343" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383558" "00382344" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383559" "00382345" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383561" "00382347" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383767" "00382553" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383787" "00382573" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383788" "00382574" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000384006" "00382790" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "arraySNP" "DNA" "" ""
"0000384718" "00383493" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper"
"0000384719" "00383494" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper"
"0000384720" "00383495" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper"
"0000384986" "00383761" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385006" "00383781" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385007" "00383782" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385131" "00383906" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" ""
"0000385187" "00383962" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385428" "00384203" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385863" "00384635" "1" "00000" "03840" "2021-10-04 12:47:36" "" "" "arraySNP;SEQ" "DNA" "blood" ""
"0000385994" "00384768" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" ""
"0000386289" "00385060" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386290" "00385061" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386329" "00385100" "1" "00000" "03840" "2021-10-07 09:30:13" "" "" "SEQ-NG-IT;SEQ" "DNA" "blood" "whole exome sequencing"
"0000386330" "00385101" "1" "00000" "03840" "2021-10-07 09:30:13" "" "" "SEQ-NG-IT;SEQ" "DNA" "blood" "whole exome sequencing"
"0000386959" "00385731" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 6 containing 386 genes"
"0000387188" "00385960" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" ""
"0000387189" "00385961" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" ""
"0000387192" "00385964" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" ""
"0000387193" "00385965" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" ""
"0000387401" "00386172" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387485" "00386256" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387521" "00386292" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387530" "00386301" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387840" "00386612" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000387869" "00386641" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000387881" "00386653" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000387955" "00386727" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388036" "00386808" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388039" "00386811" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388105" "00386877" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" ""
"0000388133" "00386905" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388292" "00387066" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388293" "00387067" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388294" "00387068" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388295" "00387069" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388296" "00387070" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388297" "00387071" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000388298" "00387072" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing"
"0000389712" "00388471" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing"
"0000390005" "00388762" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper"
"0000390006" "00388763" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000390318" "00389075" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390474" "00389231" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper"
"0000390537" "00389294" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper"
"0000390605" "00389362" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper"
"0000390661" "00389418" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000390662" "00389419" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper"
"0000390788" "00389545" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper"
"0000390883" "00389640" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper"
"0000391025" "00389782" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper"
"0000391088" "00389845" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper"
"0000391090" "00389847" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000391096" "00389853" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper"
"0000391118" "00389875" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper"
"0000391179" "00389936" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000391211" "00389968" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000391221" "00389978" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper"
"0000391574" "00390333" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391575" "00390334" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391576" "00390335" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391577" "00390336" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391578" "00390337" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391579" "00390338" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391580" "00390339" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391998" "00390757" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" ""
"0000392015" "00390774" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" ""
"0000393817" "00392570" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393853" "00392606" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393854" "00392607" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393867" "00392620" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393877" "00392630" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393924" "00392677" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393925" "00392678" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000394737" "00393489" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "WES"
"0000394827" "00393579" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394828" "00393580" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394862" "00393614" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394960" "00393712" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395044" "00393796" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395058" "00393810" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395086" "00393838" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395573" "00394326" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis"
"0000395864" "00394617" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000395865" "00394618" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000395866" "00394619" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000395867" "00394620" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000395868" "00394621" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000396814" "00395576" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "whole exome sequencing"
"0000397035" "00395796" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes"
"0000397655" "00396414" "1" "00006" "00006" "2021-12-15 14:29:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS"
"0000397740" "00396497" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397751" "00396508" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397758" "00396515" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397763" "00396520" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397793" "00396550" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397809" "00396566" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000397815" "00396572" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000400051" "00398810" "1" "00000" "03840" "2022-01-12 20:29:17" "" "" "DGGE" "DNA" "" "denaturing gradient gel electrophoresis"
"0000400062" "00398821" "1" "00000" "03840" "2022-01-13 15:07:49" "" "" "STR;SSCA;DGGE;SEQ" "DNA" "" ""
"0000400063" "00398822" "1" "00000" "03840" "2022-01-13 15:07:49" "" "" "STR;SSCA;DGGE;SEQ" "DNA" "" ""
"0000400064" "00398823" "1" "00000" "03840" "2022-01-13 15:07:49" "" "" "STR;SSCA;DGGE;SEQ" "DNA" "" ""
"0000400065" "00398824" "1" "00000" "03840" "2022-01-13 15:07:49" "" "" "STR;SSCA;DGGE;SEQ" "DNA" "" ""
"0000400066" "00398827" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400067" "00398828" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400068" "00398829" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400069" "00398830" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400070" "00398831" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400071" "00398832" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400072" "00398833" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400073" "00398834" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400074" "00398835" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400075" "00398836" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400076" "00398837" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400077" "00398838" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400078" "00398839" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400079" "00398840" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400080" "00398841" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400081" "00398842" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400082" "00398843" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400083" "00398844" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400084" "00398845" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400085" "00398846" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400086" "00398847" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400087" "00398848" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400088" "00398849" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400089" "00398850" "1" "00000" "03840" "2022-01-13 15:50:10" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400103" "00398861" "1" "00000" "03840" "2022-01-13 19:23:15" "" "" "?" "DNA" "" ""
"0000400119" "00398877" "1" "00000" "03840" "2022-01-14 11:01:01" "" "" "?" "DNA" "" ""
"0000400120" "00166423" "1" "03840" "03840" "2022-01-14 11:50:24" "" "" "SEQ;STR" "DNA" "" ""
"0000400122" "00398878" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400123" "00398879" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400124" "00398880" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400125" "00398881" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400126" "00398882" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400127" "00398883" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400128" "00398884" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400129" "00398885" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400130" "00398886" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400131" "00398887" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400132" "00398888" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400133" "00398889" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400134" "00398890" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400135" "00398891" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400136" "00398892" "1" "00000" "03840" "2022-01-14 13:58:20" "" "" "STR;SEQ" "DNA" "" ""
"0000400137" "00168741" "1" "03840" "03840" "2022-01-14 14:02:11" "" "" "SEQ" "DNA" "" ""
"0000400138" "00398893" "1" "00000" "03840" "2022-01-14 14:42:40" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400139" "00398894" "1" "00000" "03840" "2022-01-14 14:42:40" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400140" "00398895" "1" "00000" "03840" "2022-01-14 14:42:40" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400141" "00398896" "1" "00000" "03840" "2022-01-14 15:57:01" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400142" "00398897" "1" "00000" "03840" "2022-01-14 15:57:01" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000400211" "00398966" "1" "00000" "03840" "2022-01-14 19:21:38" "" "" "?" "DNA" "" ""
"0000400212" "00398967" "1" "00000" "03840" "2022-01-14 19:21:38" "" "" "?" "DNA" "" ""
"0000400213" "00398968" "1" "00000" "03840" "2022-01-14 20:11:33" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400214" "00398969" "1" "00000" "03840" "2022-01-14 20:11:33" "" "" "SEQ-NG;SEQ" "DNA" "" "Next-generation sequencing using an in-house developed capture chip (IROme)"
"0000400215" "00398970" "1" "00000" "03840" "2022-01-14 20:11:33" "" "" "SEQ-NG;SEQ" "DNA" "" "Next-generation sequencing using an in-house developed capture chip (IROme)"
"0000400216" "00398971" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400217" "00398972" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400218" "00398973" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400219" "00398974" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400220" "00398975" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400221" "00398976" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400222" "00398977" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400223" "00398978" "1" "00000" "03840" "2022-01-14 22:52:07" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000400423" "00399180" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400424" "00399181" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400425" "00399182" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400426" "00399183" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400427" "00399184" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400428" "00399185" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400429" "00399186" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400430" "00399187" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400431" "00399188" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400432" "00399189" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400433" "00399190" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400434" "00399191" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400435" "00399192" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400436" "00399193" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400437" "00399194" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400438" "00399195" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400439" "00399196" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400440" "00399197" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400441" "00399198" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400442" "00399199" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400443" "00399200" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400444" "00399201" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400445" "00399202" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400446" "00399203" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400447" "00399204" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400448" "00399205" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400449" "00399206" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400450" "00399207" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400451" "00399208" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400452" "00399209" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400453" "00399210" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400454" "00399211" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400455" "00399212" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400456" "00399213" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400457" "00399214" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400458" "00399215" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000400459" "00399216" "1" "00000" "03840" "2022-01-17 12:36:54" "" "" "SEQ-NG;SEQ" "DNA" "" "for techniques used for each patient see paper supplemental data"
"0000404501" "00403260" "1" "00000" "00008" "2022-02-18 11:06:34" "" "" "SEQ-NG" "DNA" "" ""
"0000409315" "00408060" "1" "00000" "03840" "2022-04-13 12:09:21" "" "" "arraySNP;SEQ" "DNA" "" ""
"0000412612" "00411342" "1" "04333" "04333" "2022-06-12 10:30:07" "" "" "SEQ-NG" "DNA" "" "MIPs"
"0000412613" "00411343" "1" "04333" "04333" "2022-06-12 10:35:41" "" "" "SEQ-NG" "DNA" "" "WES"
"0000413925" "00412655" "1" "04345" "04345" "2022-07-01 19:36:05" "" "" "SEQ-NG" "DNA" "Blood" ""
"0000421856" "00420547" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes"
"0000430908" "00429495" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430924" "00429511" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430927" "00429514" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430929" "00429516" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430943" "00429530" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430951" "00429538" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000430977" "00429564" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431032" "00429619" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431038" "00429625" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431044" "00429631" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431110" "00429697" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431113" "00429700" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431129" "00429716" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431143" "00429730" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431237" "00429824" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431250" "00429837" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431256" "00429843" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431261" "00429848" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431339" "00429926" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431371" "00429958" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431507" "00430094" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431543" "00430130" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431553" "00430140" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000448559" "00446982" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448577" "00447000" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448713" "00447136" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448715" "00447138" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448893" "00447316" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449089" "00447512" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449282" "00447705" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449303" "00447726" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000462744" "00461112" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000471698" "00470030" "1" "00006" "00006" "2025-11-25 19:19:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 471
"{{screeningid}}" "{{geneid}}"
"0000033163" "PDE6B"
"0000033163" "PRPH2"
"0000033163" "RGR"
"0000033163" "SNRNP200"
"0000033164" "AHI1"
"0000033164" "EYS"
"0000033164" "PDE6B"
"0000033174" "CRB1"
"0000033174" "PDE6B"
"0000033174" "SEMA4A"
"0000033177" "CACNA1F"
"0000033177" "EYS"
"0000033177" "GUCA1B"
"0000033177" "PDE6B"
"0000033180" "GUCA1B"
"0000033180" "PDE6B"
"0000033183" "INVS"
"0000033183" "PDE6B"
"0000033190" "PDE6B"
"0000033194" "CA4"
"0000033194" "PDE6B"
"0000033194" "TOPORS"
"0000033196" "PDE6B"
"0000033198" "ABCA4"
"0000033198" "GUCY2D"
"0000033198" "NPHP3"
"0000033198" "PDE6B"
"0000033198" "RP9"
"0000033199" "PDE6B"
"0000033204" "CACNA1F"
"0000033204" "PDE6B"
"0000033206" "GUCY2D"
"0000033206" "PDE6B"
"0000033206" "RP1"
"0000033206" "SEMA4A"
"0000033210" "CACNA1F"
"0000033210" "PDE6B"
"0000033212" "CRB1"
"0000033212" "PDE6B"
"0000033212" "SEMA4A"
"0000033214" "C2orf71"
"0000033214" "CACNA2D4"
"0000033214" "CRB1"
"0000033214" "PDE6B"
"0000033670" "PDE6B"
"0000052786" "PDE6B"
"0000052786" "RPE65"
"0000052786" "USH2A"
"0000100496" "PDE6B"
"0000100504" "PDE6B"
"0000105519" "PDE6B"
"0000105519" "USH2A"
"0000156386" "PDE6B"
"0000174782" "MERTK"
"0000233580" "PDE6B"
"0000233581" "PDE6B"
"0000233582" "PDE6B"
"0000233583" "PDE6B"
"0000233584" "PDE6B"
"0000233585" "PDE6B"
"0000233586" "PDE6B"
"0000233587" "PDE6B"
"0000233588" "PDE6B"
"0000233589" "PDE6B"
"0000233590" "PDE6B"
"0000233591" "PDE6B"
"0000233592" "PDE6B"
"0000233593" "PDE6B"
"0000233594" "PDE6B"
"0000233595" "PDE6B"
"0000233596" "PDE6B"
"0000233597" "PDE6B"
"0000233598" "PDE6B"
"0000233599" "PDE6B"
"0000233600" "PDE6B"
"0000233601" "PDE6B"
"0000233602" "PDE6B"
"0000233603" "PDE6B"
"0000233604" "PDE6B"
"0000233605" "PDE6B"
"0000233606" "PDE6B"
"0000233607" "PDE6B"
"0000233608" "PDE6B"
"0000233609" "PDE6B"
"0000233610" "PDE6B"
"0000233611" "PDE6B"
"0000233612" "PDE6B"
"0000233613" "PDE6B"
"0000233614" "PDE6B"
"0000233615" "PDE6B"
"0000233616" "PDE6B"
"0000233617" "PDE6B"
"0000233618" "PDE6B"
"0000233619" "PDE6B"
"0000233620" "PDE6B"
"0000233621" "PDE6B"
"0000233622" "PDE6B"
"0000233623" "PDE6B"
"0000233624" "PDE6B"
"0000234762" "PDE6B"
"0000234763" "PDE6B"
"0000234764" "PDE6B"
"0000234765" "PDE6B"
"0000247706" "PDE6B"
"0000247707" "PDE6B"
"0000301722" "PDE6B"
"0000309677" "PDE6B"
"0000309678" "PDE6B"
"0000309679" "PDE6B"
"0000309680" "PDE6B"
"0000309764" "PDE6B"
"0000309792" "PDE6B"
"0000309793" "PDE6B"
"0000309794" "PDE6B"
"0000310437" "PDE6B"
"0000310438" "PDE6B"
"0000310439" "PDE6B"
"0000310962" "PDE6B"
"0000326719" "PDE6B"
"0000329180" "PDE6B"
"0000329202" "PDE6B"
"0000329289" "PDE6B"
"0000329295" "PDE6B"
"0000329365" "PDE6B"
"0000329392" "PDE6B"
"0000329402" "PDE6B"
"0000329556" "PDE6B"
"0000329708" "PDE6B"
"0000332502" "PDE6B"
"0000332845" "CDH23"
"0000332845" "PDE6B"
"0000333748" "PDE6B"
"0000333751" "PDE6B"
"0000334579" "PDE6B"
"0000334868" "PDE6B"
"0000335077" "PDE6B"
"0000335137" "PDE6B"
"0000335138" "PDE6B"
"0000335139" "PDE6B"
"0000335201" "PDE6B"
"0000335202" "PDE6B"
"0000335699" "PDE6B"
"0000335796" "PDE6B"
"0000335797" "PDE6B"
"0000335798" "PDE6B"
"0000335799" "BEST1"
"0000335799" "PDE6B"
"0000336364" "PDE6B"
"0000336365" "PDE6B"
"0000336366" "PDE6B"
"0000336367" "PDE6B"
"0000336368" "PDE6B"
"0000336369" "PDE6B"
"0000336451" "PDE6B"
"0000336459" "PDE6B"
"0000336507" "PDE6B"
"0000336508" "PDE6B"
"0000336535" "PDE6B"
"0000336536" "PDE6B"
"0000336653" "PDE6B"
"0000336687" "PDE6B"
"0000336719" "PDE6B"
"0000336720" "PDE6B"
"0000337182" "PDE6B"
"0000360019" "PDE6B"
"0000360030" "PDE6B"
"0000363460" "PDE6B"
"0000364136" "PDE6B"
"0000364666" "PDE6B"
"0000364673" "PDE6B"
"0000364689" "PDE6B"
"0000364690" "PDE6B"
"0000364691" "PDE6B"
"0000364746" "PDE6B"
"0000364867" "PDE6B"
"0000364979" "PDE6B"
"0000373316" "PDE6B"
"0000373318" "PDE6B"
"0000375067" "PDE6B"
"0000375091" "PDE6B"
"0000375092" "PDE6B"
"0000376171" "PDE6B"
"0000376172" "PDE6B"
"0000376174" "PDE6B"
"0000376473" "PDE6B"
"0000376474" "PDE6B"
"0000376475" "PDE6B"
"0000376476" "PDE6B"
"0000376498" "PDE6B"
"0000376534" "PDE6B"
"0000377365" "PDE6B"
"0000377367" "PDE6B"
"0000377368" "PDE6B"
"0000377369" "PDE6B"
"0000377377" "PDE6B"
"0000377380" "PDE6B"
"0000377382" "PDE6B"
"0000377718" "PDE6B"
"0000377735" "PDE6B"
"0000378409" "PDE6B"
"0000378449" "PDE6B"
"0000379024" "PDE6B"
"0000380588" "PDE6B"
"0000380597" "PDE6B"
"0000380725" "PDE6B"
"0000381056" "PDE6B"
"0000381057" "PDE6B"
"0000381058" "PDE6B"
"0000381059" "PDE6B"
"0000381060" "PDE6B"
"0000381465" "PDE6B"
"0000381466" "PDE6B"
"0000381467" "PDE6B"
"0000381468" "PDE6B"
"0000381472" "PDE6B"
"0000381524" "PDE6B"
"0000381585" "PDE6B"
"0000382209" "PDE6B"
"0000382295" "PDE6B"
"0000382296" "PDE6B"
"0000382297" "PDE6B"
"0000382376" "PDE6B"
"0000382382" "PDE6B"
"0000382819" "PDE6B"
"0000382820" "PDE6B"
"0000382837" "CNGA1"
"0000382845" "PDE6B"
"0000382852" "PDE6B"
"0000382870" "LCA5"
"0000382932" "PDE6B"
"0000383088" "PDE6B"
"0000383089" "PDE6B"
"0000383090" "PDE6B"
"0000383353" "PDE6B"
"0000383554" "PDE6B"
"0000383555" "PDE6B"
"0000383556" "PDE6B"
"0000383557" "PDE6B"
"0000383558" "PDE6B"
"0000383559" "PDE6B"
"0000383561" "PDE6B"
"0000383767" "PDE6B"
"0000383787" "PDE6B"
"0000383788" "PDE6B"
"0000384006" "PDE6B"
"0000384718" "PDE6B"
"0000384719" "PDE6B"
"0000384720" "PDE6B"
"0000384986" "PDE6B"
"0000385006" "PDE6B"
"0000385007" "PDE6B"
"0000385131" "PDE6B"
"0000385187" "PDE6B"
"0000385428" "PDE6B"
"0000385863" "MYO7A"
"0000385994" "PDE6B"
"0000386289" "PDE6B"
"0000386290" "PDE6B"
"0000386329" "PDE6B"
"0000386330" "PDE6B"
"0000386959" "PDE6B"
"0000387188" "PDE6B"
"0000387189" "PDE6B"
"0000387192" "PDE6B"
"0000387193" "PDE6B"
"0000387401" "KIZ"
"0000387485" "USH2A"
"0000387521" "PDE6B"
"0000387530" "ABCA4"
"0000387840" "PDE6B"
"0000387869" "PDE6B"
"0000387881" "PDE6B"
"0000387955" "PDE6B"
"0000388036" "PDE6B"
"0000388039" "PDE6B"
"0000388105" "PDE6B"
"0000388133" "PDE6B"
"0000388292" "PDE6B"
"0000388293" "PDE6B"
"0000388294" "PDE6B"
"0000388295" "PDE6B"
"0000388296" "PDE6B"
"0000388297" "PDE6B"
"0000388298" "PDE6B"
"0000389712" "PDE6B"
"0000390005" "PDE6B"
"0000390006" "PDE6B"
"0000390318" "PDE6B"
"0000390474" "PDE6B"
"0000390537" "PDE6B"
"0000390605" "PDE6B"
"0000390661" "PDE6B"
"0000390662" "PDE6B"
"0000390788" "PDE6B"
"0000390883" "PDE6B"
"0000391025" "PDE6B"
"0000391088" "PDE6B"
"0000391090" "PDE6B"
"0000391096" "PDE6B"
"0000391118" "PDE6B"
"0000391179" "PDE6B"
"0000391211" "PDE6B"
"0000391221" "PDE6B"
"0000391574" "PDE6B"
"0000391575" "PDE6B"
"0000391576" "PDE6B"
"0000391577" "PDE6B"
"0000391578" "PDE6B"
"0000391579" "PDE6B"
"0000391580" "PDE6B"
"0000391998" "PDE6B"
"0000392015" "PDE6B"
"0000393817" "PDE6B"
"0000393853" "PDE6B"
"0000393854" "PDE6B"
"0000393867" "PDE6B"
"0000393877" "PDE6B"
"0000393924" "PDE6B"
"0000393925" "PDE6B"
"0000394737" "PDE6B"
"0000394827" "PDE6B"
"0000394828" "PDE6B"
"0000394862" "PDE6B"
"0000394960" "PDE6B"
"0000395044" "PDE6B"
"0000395058" "PDE6B"
"0000395086" "PDE6B"
"0000395573" "PDE6B"
"0000395864" "PDE6B"
"0000395865" "PDE6B"
"0000395866" "PDE6B"
"0000395867" "PDE6B"
"0000395868" "PDE6B"
"0000396814" "PDE6B"
"0000397035" "PDE6B"
"0000397740" "CNGA1"
"0000397751" "RHO"
"0000397758" "PDE6B"
"0000397763" "RPGR"
"0000397793" "RP1"
"0000397809" "RP1L1"
"0000397815" "EYS"
"0000400051" "PDE6B"
"0000400062" "PDE6B"
"0000400063" "PDE6B"
"0000400064" "PDE6B"
"0000400065" "PDE6B"
"0000400066" "PDE6B"
"0000400067" "PDE6B"
"0000400068" "PDE6B"
"0000400069" "PDE6B"
"0000400070" "PDE6B"
"0000400071" "PDE6B"
"0000400072" "PDE6B"
"0000400073" "PDE6B"
"0000400074" "PDE6B"
"0000400075" "PDE6B"
"0000400076" "PDE6B"
"0000400077" "PDE6B"
"0000400078" "PDE6B"
"0000400079" "PDE6B"
"0000400080" "PDE6B"
"0000400081" "PDE6B"
"0000400082" "PDE6B"
"0000400083" "PDE6B"
"0000400084" "PDE6B"
"0000400085" "PDE6B"
"0000400086" "PDE6B"
"0000400087" "PDE6B"
"0000400088" "PDE6B"
"0000400089" "PDE6B"
"0000400103" "PDE6B"
"0000400119" "PDE6B"
"0000400120" "PDE6B"
"0000400122" "PDE6B"
"0000400123" "PDE6B"
"0000400124" "PDE6B"
"0000400125" "PDE6B"
"0000400126" "PDE6B"
"0000400127" "PDE6B"
"0000400128" "PDE6B"
"0000400129" "PDE6B"
"0000400130" "PDE6B"
"0000400131" "PDE6B"
"0000400132" "PDE6B"
"0000400133" "PDE6B"
"0000400134" "PDE6B"
"0000400135" "PDE6B"
"0000400136" "PDE6B"
"0000400137" "PDE6B"
"0000400138" "PDE6B"
"0000400139" "PDE6B"
"0000400140" "PDE6B"
"0000400141" "PDE6B"
"0000400211" "PDE6B"
"0000400212" "PDE6B"
"0000400213" "PDE6B"
"0000400214" "PDE6B"
"0000400215" "PDE6B"
"0000400216" "PDE6B"
"0000400217" "PDE6B"
"0000400218" "PDE6B"
"0000400219" "PDE6B"
"0000400220" "PDE6B"
"0000400221" "PDE6B"
"0000400222" "PDE6B"
"0000400223" "PDE6B"
"0000400423" "PDE6B"
"0000400424" "PDE6B"
"0000400425" "PDE6B"
"0000400426" "PDE6B"
"0000400427" "PDE6B"
"0000400428" "PDE6B"
"0000400429" "PDE6B"
"0000400430" "PDE6B"
"0000400431" "PDE6B"
"0000400432" "PDE6B"
"0000400433" "PDE6B"
"0000400434" "PDE6B"
"0000400435" "PDE6B"
"0000400436" "PDE6B"
"0000400437" "PDE6B"
"0000400438" "PDE6B"
"0000400439" "PDE6B"
"0000400440" "PDE6B"
"0000400441" "PDE6B"
"0000400442" "PDE6B"
"0000400443" "PDE6B"
"0000400444" "PDE6B"
"0000400445" "PDE6B"
"0000400446" "PDE6B"
"0000400447" "PDE6B"
"0000400448" "PDE6B"
"0000400449" "PDE6B"
"0000400450" "PDE6B"
"0000400451" "PDE6B"
"0000400452" "PDE6B"
"0000400453" "PDE6B"
"0000400454" "PDE6B"
"0000400455" "PDE6B"
"0000400456" "PDE6B"
"0000400457" "PDE6B"
"0000400458" "PDE6B"
"0000400459" "PDE6B"
"0000404501" "CACNA1F"
"0000409315" "PDE6B"
"0000413925" "PDE6B"
"0000421856" "PDE6B"
"0000430908" "PDE6B"
"0000430924" "PDE6B"
"0000430927" "PDE6B"
"0000430929" "PDE6B"
"0000430943" "PDE6B"
"0000430951" "PDE6B"
"0000430977" "PDE6B"
"0000431032" "PDE6B"
"0000431038" "PDE6B"
"0000431044" "PDE6B"
"0000431110" "PDE6B"
"0000431113" "PDE6B"
"0000431129" "PDE6B"
"0000431143" "PDE6B"
"0000431237" "PDE6B"
"0000431250" "PDE6B"
"0000431256" "PDE6B"
"0000431261" "PDE6B"
"0000431339" "PDE6B"
"0000431371" "PDE6B"
"0000431507" "PDE6B"
"0000431543" "PDE6B"
"0000431553" "PDE6B"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 835
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000019516" "0" "90" "4" "650792" "650792" "subst" "0" "00102" "PDE6B_000018" "g.650792C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.657003C>T" "" "pathogenic" ""
"0000019517" "0" "70" "4" "661691" "661691" "subst" "0" "00102" "PDE6B_000019" "g.661691T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.667902T>C" "" "likely pathogenic" ""
"0000060124" "1" "90" "4" "649779" "649780" "ins" "0" "00229" "PDE6B_000001" "g.649779_649780insCG" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.655990_655991insCG" "" "pathogenic" ""
"0000060125" "1" "50" "4" "650021" "650021" "subst" "0.00382687" "00229" "PDE6B_000002" "g.650021G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant)" "Germline" "" "" "0" "" "" "g.656232G>A" "" "VUS" ""
"0000060126" "1" "50" "4" "650021" "650021" "subst" "0.00382687" "00229" "PDE6B_000002" "g.650021G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "no" "" "0" "" "" "g.656232G>A" "" "VUS" ""
"0000060127" "1" "70" "4" "650084" "650084" "subst" "3.65559E-5" "00229" "PDE6B_000003" "g.650084A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant); does not segregate with disease" "Germline" "" "" "0" "" "" "g.656295A>G" "" "likely pathogenic" ""
"0000060128" "1" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00229" "PDE6B_000003" "g.650084A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" ""
"0000060129" "2" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00229" "PDE6B_000003" "g.650084A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" ""
"0000060130" "1" "50" "4" "651287" "651299" "delins" "0" "00229" "PDE6B_000004" "g.651287_651299delinsTGGCAGGGGCAGGT" "" "{PMID:Neveling 2012:22334370}" "" "1401+4_1401+16delins14" "" "Germline" "yes" "" "0" "" "" "g.657498_657510delinsTGGCAGGGGCAGGT" "" "VUS" ""
"0000060131" "2" "50" "4" "651287" "651287" "subst" "9.00724E-5" "00229" "PDE6B_000005" "g.651287C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.657498C>T" "" "VUS" ""
"0000060132" "1" "90" "4" "656978" "656978" "subst" "8.13061E-6" "00229" "PDE6B_000006" "g.656978T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.663189T>C" "" "pathogenic" ""
"0000060133" "2" "90" "4" "656978" "656978" "subst" "8.13061E-6" "00229" "PDE6B_000006" "g.656978T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.663189T>C" "" "pathogenic" ""
"0000060134" "2" "90" "4" "657565" "657607" "delins" "0" "00229" "PDE6B_000007" "g.657565_657607delinsGG" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.663776_663818delinsGG" "" "pathogenic" ""
"0000060135" "2" "70" "4" "657565" "657607" "delins" "0" "00229" "PDE6B_000007" "g.657565_657607delinsGG" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "yes" "" "0" "" "" "g.663776_663818delinsGG" "" "likely pathogenic" ""
"0000060136" "2" "90" "4" "657565" "657607" "delins" "0" "00229" "PDE6B_000007" "g.657565_657607delinsGG" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.663776_663818delinsGG" "" "pathogenic" ""
"0000060137" "1" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00229" "PDE6B_000008" "g.660377G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "yes" "" "0" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000060138" "2" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00229" "PDE6B_000008" "g.660377G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "yes" "" "0" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000060139" "2" "70" "4" "661800" "661800" "subst" "8.1886E-6" "00229" "PDE6B_000009" "g.661800G>C" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion, disease-related variants in other gene" "Germline" "no" "" "0" "" "" "g.668011G>C" "" "likely pathogenic" ""
"0000060140" "1" "90" "4" "619714" "619714" "subst" "5.70293E-5" "00229" "PDE6B_000010" "g.619714G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.625925G>A" "" "pathogenic" ""
"0000060141" "1" "70" "4" "619418" "619418" "subst" "0" "00229" "PDE6B_000011" "g.619418G>T" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant); does not segregate with disease" "Germline" "" "" "0" "" "" "g.625629G>T" "" "likely pathogenic" ""
"0000060142" "1" "10" "4" "628493" "628493" "subst" "0.00913411" "00229" "PDE6B_000012" "g.628493G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign" "Germline" "no" "" "0" "" "" "g.634704G>A" "" "benign" ""
"0000060143" "1" "10" "4" "629702" "629702" "subst" "0.00442226" "00229" "PDE6B_000013" "g.629702T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "no" "" "0" "" "" "g.635913T>C" "" "benign" ""
"0000060144" "1" "10" "4" "629702" "629702" "subst" "0.00442226" "00229" "PDE6B_000013" "g.629702T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign" "Germline" "" "" "0" "" "" "g.635913T>C" "" "benign" ""
"0000060145" "1" "10" "4" "629702" "629702" "subst" "0.00442226" "00229" "PDE6B_000013" "g.629702T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign" "Germline" "yes" "" "0" "" "" "g.635913T>C" "" "benign" ""
"0000060146" "1" "10" "4" "629702" "629702" "subst" "0.00442226" "00229" "PDE6B_000013" "g.629702T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "no" "" "0" "" "" "g.635913T>C" "" "benign" ""
"0000060147" "1" "70" "4" "647730" "647730" "subst" "3.25111E-5" "00229" "PDE6B_000014" "g.647730C>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "no" "" "0" "" "" "g.653941C>A" "" "likely pathogenic" ""
"0000060148" "2" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00229" "PDE6B_000015" "g.647908C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000060149" "1" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00229" "PDE6B_000015" "g.647908C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000060150" "1" "70" "4" "650744" "650744" "subst" "0" "00130" "PDE6B_000016" "g.650744G>A" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.656955G>A" "" "likely pathogenic" ""
"0000060151" "2" "70" "4" "656915" "656915" "subst" "0" "00130" "PDE6B_000017" "g.656915A>G" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.663126A>G" "" "likely pathogenic" ""
"0000079605" "0" "90" "4" "71552" "3375637" "del" "0" "00006" "IDUA_000000" "g.71552_3375637del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic" ""
"0000082500" "1" "50" "4" "651199" "651199" "subst" "4.47373E-5" "01424" "PDE6B_000020" "g.651199C>G" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.657410C>G" "" "VUS" ""
"0000162795" "3" "90" "4" "655963" "655963" "subst" "0" "01769" "PDE6B_000022" "g.655963G>A" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "pathogenic" ""
"0000162802" "3" "90" "4" "650715" "650715" "subst" "0" "01769" "PDE6B_000021" "g.650715C>T" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "pathogenic" ""
"0000162803" "3" "90" "4" "650715" "650715" "subst" "0" "01769" "PDE6B_000021" "g.650715C>T" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "pathogenic" ""
"0000170966" "0" "70" "4" "648604" "648625" "dup" "0" "01244" "PDE6B_000023" "g.648604_648625dup" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "variant present in unaffected paternal grandmother, father and sister" "Germline" "no" "" "0" "" "" "g.654815_654836dup" "" "pathogenic" "ACMG"
"0000246279" "0" "70" "4" "650084" "650084" "subst" "3.65559E-5" "02330" "PDE6B_000003" "g.650084A>G" "" "" "" "PDE6B(NM_000283.4):c.1107+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656295A>G" "" "likely pathogenic" ""
"0000249054" "0" "10" "4" "663908" "663908" "subst" "0.616834" "02325" "PDE6B_000066" "g.663908A>G" "" "" "" "PDE6B(NM_000283.4):c.*12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.670119A>G" "" "benign" ""
"0000293603" "0" "10" "4" "649777" "649777" "subst" "1.22072E-5" "02330" "PDE6B_000038" "g.649777C>T" "" "" "" "PDE6B(NM_000283.4):c.1041C>T (p.Y347=, p.(Tyr347=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.655988C>T" "" "benign" ""
"0000293604" "0" "10" "4" "650021" "650021" "subst" "0.00382687" "02330" "PDE6B_000002" "g.650021G>A" "" "" "" "PDE6B(NM_000283.4):c.1060-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656232G>A" "" "benign" ""
"0000293605" "0" "50" "4" "650750" "650750" "subst" "3.25566E-5" "02330" "PDE6B_000068" "g.650750G>A" "" "" "" "PDE6B(NM_000283.4):c.1195G>A (p.A399T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656961G>A" "" "VUS" ""
"0000293606" "0" "10" "4" "619547" "619547" "subst" "0.00135744" "02330" "PDE6B_000028" "g.619547C>G" "" "" "" "PDE6B(NM_000283.4):c.132C>G (p.C44W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625758C>G" "" "benign" ""
"0000293607" "0" "10" "4" "651287" "651331" "del" "0" "02330" "PDE6B_000069" "g.651287_651331del" "" "" "" "PDE6B(NM_000283.3):c.1401+1_1401+45del (p.?), PDE6B(NM_000283.3):c.1401+4_1401+48del, PDE6B(NM_000283.4):c.1401+4_1401+48del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657498_657542del" "" "benign" ""
"0000293608" "0" "30" "4" "652751" "652751" "subst" "0.000248244" "02330" "PDE6B_000041" "g.652751C>T" "" "" "" "PDE6B(NM_000283.4):c.1412C>T (p.A471V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.658962C>T" "" "likely benign" ""
"0000293609" "0" "50" "4" "652765" "652765" "subst" "3.66196E-5" "02330" "PDE6B_000042" "g.652765G>A" "" "" "" "PDE6B(NM_000283.4):c.1426G>A (p.E476K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.658976G>A" "" "VUS" ""
"0000293610" "0" "70" "4" "654255" "654255" "subst" "0" "02330" "PDE6B_000043" "g.654255G>A" "" "" "" "PDE6B(NM_000283.4):c.1468-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.660466G>A" "" "likely pathogenic" ""
"0000293612" "0" "90" "4" "656978" "656978" "subst" "8.13061E-6" "02330" "PDE6B_000006" "g.656978T>C" "" "" "" "PDE6B(NM_000283.4):c.1920+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.663189T>C" "" "pathogenic" ""
"0000293613" "0" "70" "4" "658692" "658692" "subst" "1.62471E-5" "02330" "PDE6B_000045" "g.658692G>A" "" "" "" "PDE6B(NM_000283.4):c.2152G>A (p.D718N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.664903G>A" "" "likely pathogenic" ""
"0000293615" "0" "90" "4" "661785" "661802" "del" "0" "02330" "PDE6B_000073" "g.661785_661802del" "" "" "" "PDE6B(NM_000283.4):c.2489_2503+3delTGGCAGCCAAGAAAGGTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.667996_668013del" "" "pathogenic" ""
"0000293616" "0" "10" "4" "619685" "619685" "subst" "0.000951803" "02330" "PDE6B_000030" "g.619685C>T" "" "" "" "PDE6B(NM_000283.3):c.270C>T (p.D90=), PDE6B(NM_000283.4):c.270C>T (p.D90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625896C>T" "" "benign" ""
"0000293617" "0" "10" "4" "628612" "628612" "subst" "0.00534581" "02330" "PDE6B_000032" "g.628612C>T" "" "" "" "PDE6B(NM_000283.3):c.615C>T (p.D205=), PDE6B(NM_000283.4):c.615C>T (p.D205=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.634823C>T" "" "benign" ""
"0000293618" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "02330" "PDE6B_000034" "g.647723G>A" "" "" "" "PDE6B(NM_000283.3):c.794G>A (p.R265Q), PDE6B(NM_000283.4):c.794G>A (p.R265Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.653934G>A" "" "VUS" ""
"0000293619" "0" "10" "4" "647889" "647889" "subst" "0.00182114" "02330" "PDE6B_000035" "g.647889T>C" "" "" "" "PDE6B(NM_000283.4):c.873T>C (p.S291=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.654100T>C" "" "benign" ""
"0000293620" "0" "90" "4" "647908" "647908" "subst" "3.65922E-5" "02330" "PDE6B_000015" "g.647908C>T" "" "" "" "PDE6B(NM_000283.4):c.892C>T (p.Q298*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000293621" "0" "30" "4" "649712" "649712" "subst" "1.62812E-5" "02330" "PDE6B_000037" "g.649712C>T" "" "" "" "PDE6B(NM_000283.4):c.993-17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.655923C>T" "" "likely benign" ""
"0000296850" "0" "10" "4" "648643" "648643" "subst" "0.999821" "02325" "PDE6B_000036" "g.648643G>A" "" "" "" "PDE6B(NM_000283.4):c.958G>A (p.V320I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.654854G>A" "" "benign" ""
"0000305345" "0" "30" "4" "650057" "650057" "subst" "0.000523977" "01943" "PDE6B_000039" "g.650057C>T" "" "" "" "PDE6B(NM_000283.3):c.1083C>T (p.S361=), PDE6B(NM_000283.4):c.1083C>T (p.S361=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656268C>T" "" "likely benign" ""
"0000305347" "0" "90" "4" "619537" "619537" "subst" "0" "01943" "PDE6B_000026" "g.619537C>G" "" "" "" "PDE6B(NM_000283.3):c.122C>G (p.P41R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625748C>G" "" "pathogenic" ""
"0000305349" "0" "50" "4" "650808" "650808" "subst" "0.000227976" "01943" "PDE6B_000040" "g.650808T>C" "" "" "" "PDE6B(NM_000283.3):c.1253T>C (p.M418T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657019T>C" "" "VUS" ""
"0000305350" "0" "50" "4" "651199" "651199" "subst" "4.47373E-5" "01943" "PDE6B_000020" "g.651199C>G" "" "" "" "PDE6B(NM_000283.3):c.1317C>G (p.N439K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657410C>G" "" "VUS" ""
"0000305351" "0" "10" "4" "651287" "651331" "del" "0" "01943" "PDE6B_000069" "g.651287_651331del" "" "" "" "PDE6B(NM_000283.3):c.1401+1_1401+45del (p.?), PDE6B(NM_000283.3):c.1401+4_1401+48del, PDE6B(NM_000283.4):c.1401+4_1401+48del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657498_657542del" "" "benign" ""
"0000305352" "0" "30" "4" "652753" "652753" "subst" "0.000931879" "01943" "PDE6B_000070" "g.652753C>T" "" "" "" "PDE6B(NM_000283.3):c.1414C>T (p.R472C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.658964C>T" "" "likely benign" ""
"0000305353" "0" "90" "4" "660319" "660319" "subst" "4.06428E-6" "01943" "PDE6B_000046" "g.660319G>T" "" "" "" "PDE6B(NM_000283.3):c.2269-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.666530G>T" "" "pathogenic" ""
"0000305354" "0" "50" "4" "619660" "619660" "subst" "8.6402E-6" "01943" "PDE6B_000029" "g.619660G>A" "" "" "" "PDE6B(NM_000283.3):c.245G>A (p.R82H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625871G>A" "" "VUS" ""
"0000305355" "0" "30" "4" "661768" "661768" "subst" "4.07461E-6" "01943" "PDE6B_000072" "g.661768G>A" "" "" "" "PDE6B(NM_000283.3):c.2476G>A (p.E826K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.667979G>A" "" "likely benign" ""
"0000305356" "0" "70" "4" "661800" "661800" "subst" "8.1886E-6" "01943" "PDE6B_000009" "g.661800G>C" "" "" "" "PDE6B(NM_000283.3):c.2503+5G>C, PDE6B(NM_000283.4):c.2503+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.668011G>C" "" "likely pathogenic" ""
"0000305357" "0" "30" "4" "663857" "663857" "subst" "0.0116822" "01943" "PDE6B_000047" "g.663857C>T" "" "" "" "PDE6B(NM_000283.3):c.2526C>T (p.G842=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.670068C>T" "" "likely benign" ""
"0000305358" "0" "10" "4" "619685" "619685" "subst" "0.000951803" "01943" "PDE6B_000030" "g.619685C>T" "" "" "" "PDE6B(NM_000283.3):c.270C>T (p.D90=), PDE6B(NM_000283.4):c.270C>T (p.D90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625896C>T" "" "benign" ""
"0000305359" "0" "30" "4" "628493" "628493" "subst" "0.00913411" "01943" "PDE6B_000012" "g.628493G>A" "" "" "" "PDE6B(NM_000283.3):c.496G>A (p.E166K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.634704G>A" "" "likely benign" ""
"0000305360" "0" "30" "4" "628579" "628579" "subst" "4.06078E-6" "01943" "PDE6B_000031" "g.628579C>T" "" "" "" "PDE6B(NM_000283.3):c.582C>T (p.N194=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.634790C>T" "" "likely benign" ""
"0000305361" "0" "30" "4" "628612" "628612" "subst" "0.00534581" "01943" "PDE6B_000032" "g.628612C>T" "" "" "" "PDE6B(NM_000283.3):c.615C>T (p.D205=), PDE6B(NM_000283.4):c.615C>T (p.D205=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.634823C>T" "" "likely benign" ""
"0000305362" "0" "30" "4" "629702" "629702" "subst" "0.00442226" "01943" "PDE6B_000013" "g.629702T>C" "" "" "" "PDE6B(NM_000283.3):c.655T>C (p.Y219H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.635913T>C" "" "likely benign" ""
"0000305363" "0" "30" "4" "629768" "629768" "subst" "0.00242337" "01943" "PDE6B_000033" "g.629768C>T" "" "" "" "PDE6B(NM_000283.3):c.711+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.635979C>T" "" "likely benign" ""
"0000305364" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "01943" "PDE6B_000034" "g.647723G>A" "" "" "" "PDE6B(NM_000283.3):c.794G>A (p.R265Q), PDE6B(NM_000283.4):c.794G>A (p.R265Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.653934G>A" "" "VUS" ""
"0000329777" "0" "50" "4" "651287" "651331" "del" "0" "01804" "PDE6B_000069" "g.651287_651331del" "" "" "" "PDE6B(NM_000283.3):c.1401+1_1401+45del (p.?), PDE6B(NM_000283.3):c.1401+4_1401+48del, PDE6B(NM_000283.4):c.1401+4_1401+48del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657498_657542del" "" "VUS" ""
"0000329778" "0" "50" "4" "652789" "652789" "subst" "6.51174E-5" "01804" "PDE6B_000138" "g.652789G>A" "" "" "" "PDE6B(NM_000283.3):c.1450G>A (p.(Glu484Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.659000G>A" "" "VUS" ""
"0000338585" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "02327" "PDE6B_000063" "g.658734G>A" "" "" "" "PDE6B(NM_000283.3):c.2193+1G>A, PDE6B(NM_000283.4):c.2193+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000338592" "0" "70" "4" "661797" "661797" "subst" "4.09021E-6" "02327" "PDE6B_000065" "g.661797T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.668008T>C" "" "likely pathogenic" ""
"0000338596" "0" "10" "4" "663908" "663908" "subst" "0.616834" "02327" "PDE6B_000066" "g.663908A>G" "" "" "" "PDE6B(NM_000283.4):c.*12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.670119A>G" "" "benign" ""
"0000341659" "0" "70" "4" "619714" "619714" "subst" "5.70293E-5" "02327" "PDE6B_000010" "g.619714G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.625925G>A" "" "likely pathogenic" ""
"0000342474" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "02327" "PDE6B_000034" "g.647723G>A" "" "" "" "PDE6B(NM_000283.3):c.794G>A (p.R265Q), PDE6B(NM_000283.4):c.794G>A (p.R265Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.653934G>A" "" "VUS" ""
"0000343363" "0" "50" "4" "661655" "661655" "subst" "0.000101607" "02327" "PDE6B_000064" "g.661655G>A" "" "" "" "PDE6B(NM_000283.3):c.2363G>A (p.R788H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.667866G>A" "" "VUS" ""
"0000344038" "0" "90" "4" "647766" "647766" "del" "0" "02327" "PDE6B_000051" "g.647766del" "" "" "" "PDE6B(NM_000283.3):c.837delC (p.D279Efs*2), PDE6B(NM_000283.4):c.837delC (p.D279Efs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.653977del" "" "pathogenic" ""
"0000344096" "0" "50" "4" "651179" "651179" "subst" "4.06871E-5" "02327" "PDE6B_000056" "g.651179G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.657390G>A" "" "VUS" ""
"0000344148" "0" "50" "4" "656373" "656373" "subst" "5.69073E-5" "02327" "PDE6B_000058" "g.656373G>A" "" "" "" "PDE6B(NM_000283.4):c.1798G>A (p.D600N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.662584G>A" "" "VUS" ""
"0000344188" "0" "70" "4" "660377" "660377" "subst" "5.28275E-5" "02327" "PDE6B_000008" "g.660377G>A" "" "" "" "PDE6B(NM_000283.3):c.2326G>A (p.D776N, p.(Asp776Asn)), PDE6B(NM_000283.4):c.2326G>A (p.D776N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000344338" "0" "90" "4" "647739" "647739" "subst" "4.06355E-6" "02327" "PDE6B_000050" "g.647739C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.653950C>A" "" "pathogenic" ""
"0000344744" "0" "90" "4" "647908" "647908" "subst" "3.65922E-5" "02327" "PDE6B_000015" "g.647908C>T" "" "" "" "PDE6B(NM_000283.4):c.892C>T (p.Q298*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000347464" "0" "90" "4" "628580" "628580" "subst" "0" "02327" "PDE6B_000049" "g.628580A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.634791A>T" "" "pathogenic" ""
"0000349235" "0" "30" "4" "657671" "657671" "subst" "0" "02327" "PDE6B_000061" "g.657671C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.663882C>A" "" "likely benign" ""
"0000351322" "0" "90" "4" "650084" "650084" "subst" "3.65559E-5" "02327" "PDE6B_000003" "g.650084A>G" "" "" "" "PDE6B(NM_000283.4):c.1107+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656295A>G" "" "pathogenic" ""
"0000351323" "0" "50" "4" "650660" "650660" "subst" "0" "02327" "PDE6B_000055" "g.650660C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.656871C>A" "" "VUS" ""
"0000351327" "0" "90" "4" "656978" "656978" "subst" "8.13061E-6" "02327" "PDE6B_000006" "g.656978T>C" "" "" "" "PDE6B(NM_000283.4):c.1920+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.663189T>C" "" "pathogenic" ""
"0000351328" "0" "50" "4" "658015" "658015" "subst" "0" "02327" "PDE6B_000062" "g.658015G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.664226G>A" "" "VUS" ""
"0000358308" "3" "90" "4" "619843" "619843" "subst" "0" "01243" "PDE6B_000067" "g.619843C>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.626054C>A" "" "pathogenic" ""
"0000476288" "0" "10" "4" "619548" "619548" "subst" "3.26995E-5" "02591" "PDE6B_000074" "g.619548G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs138423108" "0" "" "" "g.625759G>A" "" "benign" ""
"0000476289" "0" "10" "4" "619560" "619560" "subst" "0.0027433" "02591" "PDE6B_000075" "g.619560G>T" "47/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs79826315" "0" "" "" "g.625771G>T" "" "benign" ""
"0000476290" "0" "50" "4" "619636" "619636" "subst" "0" "02591" "PDE6B_000076" "g.619636G>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.625847G>T" "" "VUS" ""
"0000476291" "0" "50" "4" "619660" "619660" "subst" "8.6402E-6" "02591" "PDE6B_000029" "g.619660G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs757048461" "0" "" "" "g.625871G>A" "" "VUS" ""
"0000476292" "0" "50" "4" "619722" "619722" "subst" "1.92821E-5" "02591" "PDE6B_000077" "g.619722G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs751477149" "0" "" "" "g.625933G>A" "" "VUS" ""
"0000476293" "0" "50" "4" "619794" "619794" "subst" "5.51561E-5" "02591" "PDE6B_000078" "g.619794G>A" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs766141814" "0" "" "" "g.626005G>A" "" "VUS" ""
"0000476294" "0" "50" "4" "619869" "619869" "subst" "0" "02591" "PDE6B_000079" "g.619869G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.626080G>C" "" "VUS" ""
"0000476295" "0" "50" "4" "628477" "628477" "subst" "0" "02591" "PDE6B_000080" "g.628477C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.634688C>G" "" "VUS" ""
"0000476296" "0" "50" "4" "628482" "628482" "subst" "1.62458E-5" "02591" "PDE6B_000081" "g.628482C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs772012465" "0" "" "" "g.634693C>T" "" "VUS" ""
"0000476297" "0" "10" "4" "628493" "628493" "subst" "0.00913411" "02591" "PDE6B_000012" "g.628493G>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs115775983" "0" "" "" "g.634704G>A" "" "benign" ""
"0000476298" "0" "50" "4" "628553" "628553" "subst" "5.2788E-5" "02591" "PDE6B_000082" "g.628553G>A" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs779085612" "0" "" "" "g.634764G>A" "" "VUS" ""
"0000476299" "0" "50" "4" "628589" "628589" "subst" "2.03047E-5" "02591" "PDE6B_000083" "g.628589G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs199690401" "0" "" "" "g.634800G>A" "" "VUS" ""
"0000476300" "0" "50" "4" "629697" "629697" "subst" "0" "02591" "PDE6B_000084" "g.629697C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.635908C>G" "" "VUS" ""
"0000476301" "0" "50" "4" "647714" "647714" "subst" "0" "02591" "PDE6B_000085" "g.647714A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.653925A>G" "" "VUS" ""
"0000476302" "3" "90" "4" "647715" "647715" "subst" "0" "02591" "PDE6B_000086" "g.647715C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.653926C>G" "" "pathogenic" ""
"0000476303" "3" "90" "4" "647740" "647740" "subst" "5.28253E-5" "02591" "PDE6B_000087" "g.647740G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs374156343" "0" "" "" "g.653951G>A" "" "pathogenic" ""
"0000476304" "0" "50" "4" "647744" "647744" "subst" "4.87666E-5" "02591" "PDE6B_000088" "g.647744G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs760089278" "0" "" "" "g.653955G>A" "" "VUS" ""
"0000476305" "0" "50" "4" "648652" "648652" "subst" "0.000280392" "02591" "PDE6B_000089" "g.648652G>A" "15/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs140224236" "0" "" "" "g.654863G>A" "" "VUS" ""
"0000476306" "0" "50" "4" "650040" "650040" "subst" "0" "02591" "PDE6B_000090" "g.650040A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.656251A>G" "" "VUS" ""
"0000476307" "0" "50" "4" "650797" "650797" "subst" "4.06987E-6" "02591" "PDE6B_000091" "g.650797C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs181236974" "0" "" "" "g.657008C>G" "" "VUS" ""
"0000476308" "0" "50" "4" "651150" "651150" "subst" "0" "02591" "PDE6B_000092" "g.651150A>C" "1/1187 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.657361A>C" "" "VUS" ""
"0000476309" "0" "50" "4" "651224" "651224" "subst" "1.62661E-5" "02591" "PDE6B_000093" "g.651224G>A" "2/1189 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs779139841" "0" "" "" "g.657435G>A" "" "VUS" ""
"0000476310" "0" "50" "4" "651233" "651233" "subst" "1.22004E-5" "02591" "PDE6B_000094" "g.651233A>G" "2/1189 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs375564041" "0" "" "" "g.657444A>G" "" "VUS" ""
"0000476311" "0" "50" "4" "652793" "652793" "subst" "0" "02591" "PDE6B_000095" "g.652793T>C" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.659004T>C" "" "VUS" ""
"0000476312" "0" "50" "4" "654329" "654329" "subst" "0" "02591" "PDE6B_000096" "g.654329T>C" "1/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.660540T>C" "" "VUS" ""
"0000476313" "0" "50" "4" "654357" "654357" "subst" "0" "02591" "PDE6B_000097" "g.654357G>T" "1/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.660568G>T" "" "VUS" ""
"0000476314" "3" "90" "4" "654364" "654364" "subst" "0" "02591" "PDE6B_000098" "g.654364G>A" "1/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236091" "0" "" "" "g.660575G>A" "" "pathogenic" ""
"0000476315" "0" "90" "4" "654392" "654392" "subst" "4.06891E-6" "02591" "PDE6B_000099" "g.654392T>A" "7/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236088" "0" "" "" "g.660603T>A" "" "pathogenic" ""
"0000476316" "0" "50" "4" "654394" "654394" "subst" "9.76777E-5" "02591" "PDE6B_000100" "g.654394C>T" "3/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs568331063" "0" "" "" "g.660605C>T" "" "VUS" ""
"0000476317" "0" "90" "4" "655977" "655977" "subst" "3.08578E-5" "02591" "PDE6B_000101" "g.655977C>T" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs121918581" "0" "" "" "g.662188C>T" "" "pathogenic" ""
"0000476318" "0" "50" "4" "656017" "656017" "subst" "0" "02591" "PDE6B_000102" "g.656017T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.662228T>C" "" "VUS" ""
"0000476319" "0" "50" "4" "656323" "656323" "subst" "8.13094E-6" "02591" "PDE6B_000103" "g.656323C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs377243929" "0" "" "" "g.662534C>T" "" "VUS" ""
"0000476320" "0" "50" "4" "656386" "656386" "subst" "0.00013008" "02591" "PDE6B_000104" "g.656386C>T" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs752738349" "0" "" "" "g.662597C>T" "" "VUS" ""
"0000476321" "3" "90" "4" "656978" "656978" "subst" "0" "02591" "PDE6B_000105" "g.656978T>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.663189T>G" "" "pathogenic" ""
"0000476322" "0" "50" "4" "657583" "657583" "subst" "2.04138E-5" "02591" "PDE6B_000106" "g.657583A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs768939011" "0" "" "" "g.663794A>G" "" "VUS" ""
"0000476323" "0" "90" "4" "657592" "657592" "subst" "2.04097E-5" "02591" "PDE6B_000107" "g.657592C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs373037737" "0" "" "" "g.663803C>T" "" "pathogenic" ""
"0000476324" "0" "90" "4" "657656" "657656" "dup" "0" "02591" "PDE6B_000108" "g.657656dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.663867dup" "" "pathogenic" ""
"0000476325" "0" "10" "4" "657979" "657979" "subst" "0.000215337" "02591" "PDE6B_000109" "g.657979T>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs149880099" "0" "" "" "g.664190T>A" "" "benign" ""
"0000476326" "0" "50" "4" "657995" "657995" "subst" "8.12982E-6" "02591" "PDE6B_000110" "g.657995G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs200397909" "0" "" "" "g.664206G>A" "" "VUS" ""
"0000476327" "0" "50" "4" "659108" "659108" "subst" "0" "02591" "PDE6B_000111" "g.659108A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.665319A>C" "" "VUS" ""
"0000476328" "0" "10" "4" "660344" "660344" "subst" "0.00039816" "02591" "PDE6B_000112" "g.660344G>C" "1/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs199521106" "0" "" "" "g.666555G>C" "" "benign" ""
"0000476329" "0" "50" "4" "660366" "660366" "subst" "0" "02591" "PDE6B_000113" "g.660366T>G" "1/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.666577T>G" "" "VUS" ""
"0000476330" "0" "50" "4" "661655" "661655" "subst" "0.000101607" "02591" "PDE6B_000064" "g.661655G>A" "6/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs777999727" "0" "" "" "g.667866G>A" "" "VUS" ""
"0000476331" "0" "50" "4" "661778" "661778" "subst" "0" "02591" "PDE6B_000114" "g.661778G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.667989G>C" "" "VUS" ""
"0000476332" "0" "50" "4" "663841" "663841" "subst" "0" "02591" "PDE6B_000115" "g.663841C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.670052C>G" "" "VUS" ""
"0000477470" "3" "10" "4" "619560" "619560" "subst" "0.0027433" "02591" "PDE6B_000075" "g.619560G>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs79826315" "0" "" "" "g.625771G>T" "" "benign" ""
"0000477471" "3" "90" "4" "654392" "654392" "subst" "4.06891E-6" "02591" "PDE6B_000099" "g.654392T>A" "7/1200 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236088" "0" "" "" "g.660603T>A" "" "pathogenic" ""
"0000477472" "3" "90" "4" "655977" "655977" "subst" "3.08578E-5" "02591" "PDE6B_000101" "g.655977C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs121918581" "0" "" "" "g.662188C>T" "" "pathogenic" ""
"0000477473" "3" "50" "4" "661655" "661655" "subst" "0.000101607" "02591" "PDE6B_000064" "g.661655G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs777999727" "0" "" "" "g.667866G>A" "" "VUS" ""
"0000500575" "1" "90" "4" "647701" "647701" "subst" "0" "00006" "PDE6B_000116" "g.647701C>A" "" "{PMID:Gal 1994:08075643}" "" "" "" "Germline" "yes" "rs121918582" "0" "" "" "g.653912C>A" "" "pathogenic (dominant)" ""
"0000500576" "11" "90" "4" "648604" "648625" "dup" "0" "00006" "PDE6B_000023" "g.648604_648625dup" "" "{PMID:Manes 2014:24760071}" "" "940_941insGCTTCTCAGGAAATTGTCTTCT" "" "Germline" "yes" "" "0" "" "" "g.654815_654836dup" "" "pathogenic (dominant)" ""
"0000522782" "0" "30" "4" "619438" "619438" "subst" "2.45572E-5" "01943" "PDE6B_000117" "g.619438C>T" "" "" "" "PDE6B(NM_000283.3):c.23C>T (p.A8V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625649C>T" "" "likely benign" ""
"0000522783" "0" "10" "4" "619441" "619441" "subst" "0.00139155" "02330" "PDE6B_000118" "g.619441G>A" "" "" "" "PDE6B(NM_000283.4):c.26G>A (p.R9Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625652G>A" "" "benign" ""
"0000522784" "0" "90" "4" "619535" "619536" "ins" "0" "01943" "PDE6B_000119" "g.619535_619536insGAGGA" "" "" "" "PDE6B(NM_000283.3):c.120_121insGAGGA (p.P41Efs*111)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625746_625747insGAGGA" "" "pathogenic" ""
"0000522785" "0" "90" "4" "619540" "619541" "ins" "0" "01943" "PDE6B_000120" "g.619540_619541insTGCGA" "" "" "" "PDE6B(NM_000283.3):c.125_126insTGCGA (p.D43Afs*109)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625751_625752insTGCGA" "" "pathogenic" ""
"0000522786" "0" "50" "4" "619635" "619635" "subst" "0.000541479" "02327" "PDE6B_000121" "g.619635C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625846C>T" "" "VUS" ""
"0000522787" "0" "70" "4" "619708" "619708" "subst" "0" "02330" "PDE6B_000122" "g.619708G>C" "" "" "" "PDE6B(NM_000283.4):c.293G>C (p.R98P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625919G>C" "" "likely pathogenic" ""
"0000522788" "0" "50" "4" "619713" "619713" "subst" "0.000249698" "01943" "PDE6B_000123" "g.619713C>T" "" "" "" "PDE6B(NM_000283.3):c.298C>T (p.R100C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625924C>T" "" "VUS" ""
"0000522789" "0" "50" "4" "619777" "619777" "subst" "0" "02330" "PDE6B_000124" "g.619777A>G" "" "" "" "PDE6B(NM_000283.4):c.362A>G (p.D121G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.625988A>G" "" "VUS" ""
"0000522977" "0" "50" "4" "647716" "647716" "subst" "3.65729E-5" "02330" "PDE6B_000125" "g.647716A>G" "" "" "" "PDE6B(NM_000283.4):c.787A>G (p.T263A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.653927A>G" "" "VUS" ""
"0000522978" "0" "30" "4" "647733" "647733" "subst" "0.00013409" "01943" "PDE6B_000126" "g.647733C>T" "" "" "" "PDE6B(NM_000283.3):c.804C>T (p.L268=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.653944C>T" "" "likely benign" ""
"0000522979" "0" "90" "4" "647766" "647766" "del" "0" "01943" "PDE6B_000051" "g.647766del" "" "" "" "PDE6B(NM_000283.3):c.837delC (p.D279Efs*2), PDE6B(NM_000283.4):c.837delC (p.D279Efs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.653977del" "" "pathogenic" ""
"0000522980" "0" "10" "4" "647792" "647792" "subst" "0.00082519" "02330" "PDE6B_000127" "g.647792C>T" "" "" "" "PDE6B(NM_000283.4):c.852+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.654003C>T" "" "benign" ""
"0000522981" "0" "30" "4" "647793" "647793" "subst" "0.000682966" "02330" "PDE6B_000128" "g.647793G>A" "" "" "" "PDE6B(NM_000283.4):c.852+12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.654004G>A" "" "likely benign" ""
"0000522983" "0" "70" "4" "647944" "647944" "subst" "0" "02330" "PDE6B_000130" "g.647944G>C" "" "" "" "PDE6B(NM_000283.4):c.927+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.654155G>C" "" "likely pathogenic" ""
"0000522984" "0" "90" "4" "649777" "649778" "dup" "0" "01943" "PDE6B_000053" "g.649777_649778dup" "" "" "" "PDE6B(NM_000283.3):c.1041_1042dupCG (p.V348Afs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.655988_655989dup" "" "pathogenic" ""
"0000522985" "0" "90" "4" "649777" "649777" "dup" "0" "01943" "PDE6B_000131" "g.649777dup" "" "" "" "PDE6B(NM_000283.3):c.1041dupC (p.V348Rfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.655988dup" "" "pathogenic" ""
"0000522986" "0" "30" "4" "649804" "649804" "subst" "0.00124814" "02330" "PDE6B_000132" "g.649804C>G" "" "" "" "PDE6B(NM_000283.4):c.1059+9C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.656015C>G" "" "likely benign" ""
"0000522987" "0" "90" "4" "650762" "650763" "del" "0" "02330" "PDE6B_000133" "g.650762_650763del" "" "" "" "PDE6B(NM_000283.4):c.1207_1208delAA (p.N403Qfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.656973_656974del" "" "pathogenic" ""
"0000522988" "0" "50" "4" "650765" "650765" "subst" "0" "01943" "PDE6B_000134" "g.650765A>G" "" "" "" "PDE6B(NM_000283.3):c.1210A>G (p.R404G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.656976A>G" "" "VUS" ""
"0000522989" "0" "30" "4" "650773" "650773" "subst" "0.00105364" "02330" "PDE6B_000135" "g.650773C>T" "" "" "" "PDE6B(NM_000283.4):c.1218C>T (p.D406=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.656984C>T" "" "likely benign" ""
"0000522990" "0" "30" "4" "650831" "650831" "subst" "5.7107E-5" "02330" "PDE6B_000136" "g.650831G>A" "" "" "" "PDE6B(NM_000283.4):c.1257+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.657042G>A" "" "likely benign" ""
"0000522991" "0" "30" "4" "651178" "651178" "subst" "0.000655137" "01943" "PDE6B_000137" "g.651178C>T" "" "" "" "PDE6B(NM_000283.3):c.1296C>T (p.T432=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.657389C>T" "" "likely benign" ""
"0000522998" "0" "10" "4" "652824" "652824" "subst" "0.00144425" "02330" "PDE6B_000139" "g.652824G>A" "" "" "" "PDE6B(NM_000283.4):c.1467+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.659035G>A" "" "benign" ""
"0000522999" "0" "10" "4" "654372" "654372" "subst" "6.10103E-5" "02330" "PDE6B_000140" "g.654372C>T" "" "" "" "PDE6B(NM_000283.4):c.1584C>T (p.G528=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.660583C>T" "" "benign" ""
"0000523000" "0" "10" "4" "654378" "654378" "subst" "3.66074E-5" "02330" "PDE6B_000141" "g.654378C>T" "" "" "" "PDE6B(NM_000283.4):c.1590C>T (p.V530=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.660589C>T" "" "benign" ""
"0000523001" "0" "90" "4" "655951" "655951" "del" "0" "01943" "PDE6B_000142" "g.655951del" "" "" "" "PDE6B(NM_000283.3):c.1643delG (p.S548Tfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.662162del" "" "pathogenic" ""
"0000523002" "0" "50" "4" "655963" "655963" "subst" "0" "02327" "PDE6B_000022" "g.655963G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.662174G>A" "" "VUS" ""
"0000523003" "0" "10" "4" "656044" "656067" "dup" "0" "02330" "PDE6B_000143" "g.656044_656067dup" "" "" "" "PDE6B(NM_000283.4):c.1722+12_1722+35dupCCAGAATCACCAGGGTTGTGCAGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.662255_662278dup" "" "benign" ""
"0000523004" "0" "30" "4" "656358" "656358" "subst" "8.942E-5" "01943" "PDE6B_000144" "g.656358C>T" "" "" "" "PDE6B(NM_000283.3):c.1783C>T (p.L595=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.662569C>T" "" "likely benign" ""
"0000523005" "0" "30" "4" "656907" "656907" "subst" "0" "01943" "PDE6B_000145" "g.656907T>C" "" "" "" "PDE6B(NM_000283.3):c.1851T>C (p.A617=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663118T>C" "" "likely benign" ""
"0000523006" "0" "90" "4" "656916" "656916" "del" "5.28009E-5" "01943" "PDE6B_000146" "g.656916del" "" "" "" "PDE6B(NM_000283.3):c.1860delC (p.H620Qfs*23), PDE6B(NM_000283.4):c.1860delC (p.H620Qfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663127del" "" "pathogenic" ""
"0000523007" "0" "30" "4" "657561" "657561" "subst" "0" "01943" "PDE6B_000147" "g.657561C>T" "" "" "" "PDE6B(NM_000283.3):c.1923C>T (p.T641=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663772C>T" "" "likely benign" ""
"0000523008" "0" "90" "4" "657565" "657586" "del" "0" "01943" "PDE6B_000148" "g.657565_657586del" "" "" "" "PDE6B(NM_000283.3):c.1927_1948delAACATCTACCAGAACCTGAACC (p.N643Gfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663776_663797del" "" "pathogenic" ""
"0000523009" "0" "90" "4" "657589" "657607" "del" "0" "01943" "PDE6B_000149" "g.657589_657607del" "" "" "" "PDE6B(NM_000283.3):c.1951_1969delCGGCAGCACGAGCACGTGA (p.R651Sfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663800_663818del" "" "pathogenic" ""
"0000523010" "0" "50" "4" "657634" "657634" "subst" "0.000118642" "02330" "PDE6B_000150" "g.657634G>A" "" "" "" "PDE6B(NM_000283.4):c.1996G>A (p.A666T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.663845G>A" "" "VUS" ""
"0000523011" "0" "70" "4" "660377" "660377" "subst" "5.28275E-5" "02330" "PDE6B_000008" "g.660377G>A" "" "" "" "PDE6B(NM_000283.3):c.2326G>A (p.D776N, p.(Asp776Asn)), PDE6B(NM_000283.4):c.2326G>A (p.D776N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000523012" "0" "50" "4" "660377" "660377" "subst" "5.28275E-5" "01943" "PDE6B_000008" "g.660377G>A" "" "" "" "PDE6B(NM_000283.3):c.2326G>A (p.D776N, p.(Asp776Asn)), PDE6B(NM_000283.4):c.2326G>A (p.D776N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.666588G>A" "" "VUS" ""
"0000523013" "0" "50" "4" "661655" "661655" "subst" "0.000101607" "01943" "PDE6B_000064" "g.661655G>A" "" "" "" "PDE6B(NM_000283.3):c.2363G>A (p.R788H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.667866G>A" "" "VUS" ""
"0000523014" "0" "10" "4" "661719" "661719" "subst" "8.12962E-6" "02330" "ATP5I_000001" "g.661719G>A" "" "" "" "PDE6B(NM_000283.4):c.2427G>A (p.A809=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.667930G>A" "" "benign" ""
"0000523015" "0" "50" "4" "661800" "661800" "subst" "8.1886E-6" "02327" "PDE6B_000009" "g.661800G>C" "" "" "" "PDE6B(NM_000283.3):c.2503+5G>C, PDE6B(NM_000283.4):c.2503+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.668011G>C" "" "VUS" ""
"0000609277" "0" "10" "4" "650654" "650654" "subst" "0.000849965" "02330" "PDE6B_000151" "g.650654C>T" "" "" "" "PDE6B(NM_000283.4):c.1108-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.656865C>T" "" "benign" ""
"0000609279" "0" "30" "4" "654375" "654375" "subst" "0" "01943" "PDE6B_000152" "g.654375G>A" "" "" "" "PDE6B(NM_000283.3):c.1587G>A (p.V529=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.660586G>A" "" "likely benign" ""
"0000621414" "0" "90" "4" "657975" "657975" "subst" "0" "01943" "PDE6B_000153" "g.657975C>G" "" "" "" "PDE6B(NM_000283.3):c.2094C>G (p.Y698*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.664186C>G" "" "pathogenic" ""
"0000621415" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "01943" "PDE6B_000063" "g.658734G>A" "" "" "" "PDE6B(NM_000283.3):c.2193+1G>A, PDE6B(NM_000283.4):c.2193+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.664945G>A" "" "pathogenic" ""
"0000624987" "3" "70" "4" "656373" "656373" "subst" "5.69073E-5" "01848" "PDE6B_000058" "g.656373G>A" "" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.662584G>A" "" "likely pathogenic (recessive)" "ACMG"
"0000624988" "0" "70" "4" "650084" "650084" "subst" "3.65559E-5" "01848" "PDE6B_000003" "g.650084A>G" "" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.656295A>G" "" "likely pathogenic (recessive)" "ACMG"
"0000624989" "0" "70" "4" "656373" "656373" "subst" "5.69073E-5" "01848" "PDE6B_000058" "g.656373G>A" "" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.662584G>A" "" "likely pathogenic (recessive)" "ACMG"
"0000651496" "1" "30" "4" "619560" "619560" "subst" "0.0027433" "03575" "PDE6B_000075" "g.619560G>T" "6/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs79826315}" "Germline" "" "rs79826315" "0" "" "" "g.625771G>T" "" "likely benign" ""
"0000651498" "1" "30" "4" "628493" "628493" "subst" "0.00913411" "03575" "PDE6B_000012" "g.628493G>A" "29/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "29 heterozygous, no homozygous; {DB:CLININrs115775983}" "Germline" "" "rs115775983" "0" "" "" "g.634704G>A" "" "likely benign" ""
"0000651511" "1" "30" "4" "647942" "647942" "subst" "5.70228E-5" "03575" "PDE6B_000154" "g.647942G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs145756948}" "Germline" "" "rs145756948" "0" "" "" "g.654153G>A" "" "likely benign" ""
"0000655168" "0" "90" "4" "648678" "648678" "del" "0" "02327" "PDE6B_000155" "g.648678del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.654889del" "" "pathogenic" ""
"0000655169" "0" "50" "4" "651252" "651252" "subst" "8.13617E-6" "02327" "PDE6B_000156" "g.651252A>G" "" "" "" "PDE6B(NM_000283.4):c.1370A>G (p.K457R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.657463A>G" "" "VUS" ""
"0000655170" "0" "50" "4" "651266" "651266" "subst" "0.00025641" "01943" "PDE6B_000157" "g.651266G>A" "" "" "" "PDE6B(NM_000283.3):c.1384G>A (p.E462K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.657477G>A" "" "VUS" ""
"0000655171" "0" "50" "4" "651288" "651288" "subst" "0.00146971" "01943" "PDE6B_000158" "g.651288G>A" "" "" "" "PDE6B(NM_000283.3):c.1401+5G>A, PDE6B(NM_000283.4):c.1401+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.657499G>A" "" "VUS" ""
"0000655174" "0" "50" "4" "656365" "656365" "subst" "0" "02327" "PDE6B_000159" "g.656365A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.662576A>G" "" "VUS" ""
"0000664772" "3" "90" "4" "656373" "656373" "subst" "5.69073E-5" "01848" "PDE6B_000058" "g.656373G>A" "" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.662584G>A" "" "pathogenic (recessive)" ""
"0000677305" "0" "30" "4" "647921" "647921" "subst" "0.000650846" "01943" "PDE6B_000160" "g.647921G>A" "" "" "" "PDE6B(NM_000283.3):c.905G>A (p.G302D), PDE6B(NM_000283.4):c.905G>A (p.G302D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000677306" "0" "50" "4" "656935" "656935" "subst" "4.06184E-5" "02330" "PDE6B_000161" "g.656935C>G" "" "" "" "PDE6B(NM_000283.4):c.1879C>G (p.R627G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000684550" "1" "70" "4" "628534" "628537" "del" "0" "00004" "PDE6B_000162" "g.628534_628537del" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.634745_634748del" "" "likely pathogenic" ""
"0000684551" "1" "70" "4" "629702" "629702" "subst" "0.00442226" "00004" "PDE6B_000013" "g.629702T>C" "2/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.635913T>C" "" "likely pathogenic" ""
"0000684552" "1" "70" "4" "654386" "654386" "subst" "0" "00004" "PDE6B_000165" "g.654386T>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.660597T>C" "" "likely pathogenic" ""
"0000684553" "1" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00004" "PDE6B_000101" "g.655977C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" ""
"0000684637" "3" "70" "4" "655987" "655987" "subst" "0" "00004" "PDE6B_000167" "g.655987G>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.662198G>A" "" "likely pathogenic (recessive)" ""
"0000684665" "3" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00004" "PDE6B_000101" "g.655977C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG"
"0000684666" "1" "90" "4" "647885" "647885" "subst" "0" "00004" "PDE6B_000163" "g.647885G>A" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG"
"0000684667" "1" "70" "4" "655944" "655949" "del" "0" "00004" "PDE6B_000166" "g.655944_655949del" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "c.1636_1641delTCCATC" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG"
"0000684701" "2" "70" "4" "661784" "661784" "subst" "3.26685E-5" "00004" "PDE6B_000169" "g.661784C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG"
"0000684702" "2" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00004" "PDE6B_000101" "g.655977C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG"
"0000685348" "0" "90" "4" "619843" "619843" "subst" "0" "00004" "PDE6B_000067" "g.619843C>A" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685349" "0" "90" "4" "652756" "652756" "del" "0" "00004" "PDE6B_000164" "g.652756del" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685350" "0" "90" "4" "657550" "657550" "subst" "0" "00004" "PDE6B_000168" "g.657550C>G" "8/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000686106" "3" "90" "4" "654356" "654356" "subst" "0" "00006" "PDE6B_000170" "g.654356T>G" "" "{PMID:Bocquet 2013:24339724}" "" "" "" "Germline" "" "" "0" "" "" "g.660567T>G" "" "pathogenic (recessive)" ""
"0000689324" "0" "50" "4" "649734" "649734" "subst" "0" "01943" "PDE6B_000171" "g.649734C>T" "" "" "" "PDE6B(NM_000283.3):c.998C>T (p.P333L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000689325" "0" "50" "4" "649785" "649785" "subst" "1.22085E-5" "01943" "PDE6B_000172" "g.649785A>C" "" "" "" "PDE6B(NM_000283.3):c.1049A>C (p.E350A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000689326" "0" "30" "4" "650669" "650669" "subst" "0" "01943" "PDE6B_000173" "g.650669G>C" "" "" "" "PDE6B(NM_000283.3):c.1114G>C (p.A372P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000689327" "0" "30" "4" "650672" "650672" "subst" "0" "01943" "PDE6B_000174" "g.650672C>G" "" "" "" "PDE6B(NM_000283.3):c.1117C>G (p.L373V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000689328" "0" "90" "4" "650678" "650690" "del" "0" "01943" "PDE6B_000175" "g.650678_650690del" "" "" "" "PDE6B(NM_000283.3):c.1123_1135delGACTCCGGGTGGC (p.D375Sfs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000689329" "0" "50" "4" "650774" "650774" "subst" "0.000126105" "01943" "PDE6B_000176" "g.650774G>A" "" "" "" "PDE6B(NM_000283.3):c.1219G>A (p.G407R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000689333" "0" "50" "4" "654285" "654285" "subst" "0.000223721" "01943" "PDE6B_000177" "g.654285T>G" "" "" "" "PDE6B(NM_000283.3):c.1497T>G (p.F499L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000710311" "1" "50" "4" "659056" "659056" "subst" "1.21957E-5" "00006" "PDE6B_000178" "g.659056G>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.665267G>A" "" "VUS" ""
"0000713303" "3" "90" "4" "654271" "654272" "ins" "0" "00000" "PDE6B_000182" "g.654271_654272insG" "" "{PMID:Carss 2017:28041643}" "" "4:654270A>AG ENST00000496514.1:c.1485dupG (Pro496AlafsTer5)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713325" "3" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Carss 2017:28041643}" "" "4:658734G>A ENST00000496514.1:c.2193+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713412" "0" "90" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Carss 2017:28041643}" "" "4:654368T>C ENST00000496514.1:c.1580T>C (Leu527Pro)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713418" "0" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Carss 2017:28041643}" "" "4:650084A>G ENST00000496514.1:c.1107+3A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713488" "0" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Carss 2017:28041643}" "" "4:647908C>T ENST00000496514.1:c.892C>T (Gln298Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713515" "0" "90" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Carss 2017:28041643}" "" "4:654368T>C ENST00000496514.1:c.1580T>C (Leu527Pro)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713525" "0" "90" "4" "647668" "647668" "subst" "1.21981E-5" "00000" "PDE6B_000180" "g.647668T>A" "" "{PMID:Carss 2017:28041643}" "" "4:647668T>A ENST00000496514.1:c.739T>A (Phe247Ile)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713679" "3" "90" "4" "619416" "619416" "subst" "2.86643E-5" "00000" "PDE6B_000179" "g.619416A>G" "" "{PMID:Carss 2017:28041643}" "" "4:619416A>G ENST00000496514.1:c.1A>G (Met1?)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713760" "0" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Carss 2017:28041643}" "" "4:655986C>T ENST00000496514.1:c.1678C>T (Arg560Cys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713764" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Carss 2017:28041643}" "" "4:658734G>A ENST00000496514.1:c.2193+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713805" "0" "90" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Carss 2017:28041643}" "" "4:657561CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA>TCTGGG ENST00000496514.1:c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG (Asn643GlyfsTer29)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713816" "0" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Carss 2017:28041643}" "" "4:655986C>T ENST00000496514.1:c.1678C>T (Arg560Cys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713824" "0" "90" "4" "654335" "654335" "subst" "0" "00000" "PDE6B_000183" "g.654335T>C" "" "{PMID:Carss 2017:28041643}" "" "4:654335T>C ENST00000496514.1:c.1547T>C (Leu516Pro)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000714065" "3" "70" "4" "647759" "647759" "subst" "0" "00000" "PDE6B_000181" "g.647759T>C" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.653970T>C" "" "likely pathogenic (recessive)" ""
"0000719970" "0" "50" "4" "649778" "649778" "subst" "8.13928E-6" "01943" "PDE6B_000186" "g.649778G>A" "" "" "" "PDE6B(NM_000283.3):c.1042G>A (p.V348M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000719973" "0" "50" "4" "661800" "661800" "subst" "8.1886E-6" "02329" "PDE6B_000009" "g.661800G>C" "" "" "" "PDE6B(NM_000283.3):c.2503+5G>C, PDE6B(NM_000283.4):c.2503+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000729757" "3" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs121918581" "0" "" "" "g.662188C>T" "" "pathogenic" ""
"0000730219" "1" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.662188C>T" "" "pathogenic" "ACMG"
"0000730242" "2" "70" "4" "656301" "656301" "subst" "4.06716E-6" "00000" "PDE6B_000187" "g.656301G>A" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.662512G>A" "" "likely pathogenic" "ACMG"
"0000730972" "21" "90" "4" "648604" "648625" "dup" "0" "00006" "PDE6B_000023" "g.648604_648625dup" "" "{PMID:de Castro-Miro 2018:29367200}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000731538" "1" "90" "4" "651255" "651255" "subst" "8.1367E-6" "00000" "PDE6B_000188" "g.651255G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.657466G>A" "" "pathogenic" ""
"0000731541" "1" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000731565" "2" "90" "4" "654341" "654341" "subst" "1.22001E-5" "00000" "PDE6B_000189" "g.654341A>T" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.660552A>T" "" "pathogenic" ""
"0000731566" "2" "90" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.625925G>A" "" "pathogenic" ""
"0000732435" "1" "90" "4" "619418" "619418" "subst" "0" "00000" "PDE6B_000011" "g.619418G>T" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.625629G>T" "" "pathogenic" ""
"0000732458" "2" "90" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.625939G>A" "" "pathogenic" ""
"0000732512" "0" "90" "4" "655961" "655961" "subst" "0" "00000" "PDE6B_000195" "g.655961C>T" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.662172C>T" "" "pathogenic" ""
"0000732875" "0" "70" "4" "647701" "647701" "subst" "0" "00000" "PDE6B_000116" "g.647701C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.653912C>A" "" "likely pathogenic" ""
"0000733086" "1" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000733146" "1" "70" "4" "656897" "656897" "dup" "0" "00000" "PDE6B_000196" "g.656897dup" "" "{PMID:Stone 2017:28559085}" "" "1839_1840insA" "" "Germline" "" "" "0" "" "" "g.663108dup" "" "likely pathogenic" ""
"0000733147" "1" "70" "4" "619824" "619824" "subst" "0" "00000" "PDE6B_000192" "g.619824G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.626035G>A" "" "likely pathogenic" ""
"0000733148" "3" "70" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Stone 2017:28559085}" "" "His620del1caC" "" "Germline" "" "" "0" "" "" "g.663127del" "" "likely pathogenic" ""
"0000733210" "1" "70" "4" "652805" "652805" "subst" "0" "00000" "PDE6B_000194" "g.652805T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.659016T>C" "" "likely pathogenic" ""
"0000733211" "1" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" ""
"0000733545" "2" "70" "4" "657926" "657926" "subst" "0" "00000" "PDE6B_000197" "g.657926T>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.664137T>A" "" "likely pathogenic" ""
"0000733591" "2" "70" "4" "661627" "661646" "del" "0" "00000" "PDE6B_000199" "g.661627_661646del" "" "{PMID:Stone 2017:28559085}" "" "IVS20-20del20aGACTTCTCGACTCCCCTCAG" "" "Germline" "" "" "0" "" "" "g.667838_667857del" "" "likely pathogenic" ""
"0000733592" "2" "70" "4" "658680" "658680" "subst" "4.0619E-6" "00000" "PDE6B_000198" "g.658680A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.664891A>T" "" "likely pathogenic" ""
"0000733638" "2" "70" "4" "619417" "619417" "subst" "0" "00000" "PDE6B_000190" "g.619417T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.625628T>C" "" "likely pathogenic" ""
"0000733639" "2" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Stone 2017:28559085}" "" "IVS18+1G>A" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" ""
"0000734417" "3" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Habibi 2016:27874104}" "" "" "" "Germline" "" "" "0" "" "" "g.655957A>G" "" "pathogenic (recessive)" ""
"0000734702" "3" "90" "4" "659047" "659047" "subst" "0" "00000" "PDE6B_000209" "g.659047G>C" "" "{PMID:Vincent 2017:28488341}" "" "" "" "Germline" "" "" "0" "" "" "g.665258G>C" "" "pathogenic (recessive)" ""
"0000734703" "3" "90" "4" "659047" "659047" "subst" "0" "00000" "PDE6B_000209" "g.659047G>C" "" "{PMID:Vincent 2017:28488341}" "" "" "" "Germline" "" "" "0" "" "" "g.665258G>C" "" "pathogenic (recessive)" ""
"0000734704" "3" "90" "4" "659047" "659047" "subst" "0" "00000" "PDE6B_000209" "g.659047G>C" "" "{PMID:Vincent 2017:28488341}" "" "" "" "Germline" "" "" "0" "" "" "g.665258G>C" "" "pathogenic (recessive)" ""
"0000734705" "3" "90" "4" "659047" "659047" "subst" "0" "00000" "PDE6B_000209" "g.659047G>C" "" "{PMID:Vincent 2017:28488341}" "" "" "" "Germline" "" "" "0" "" "" "g.665258G>C" "" "pathogenic (recessive)" ""
"0000735639" "0" "90" "4" "649777" "649778" "dup" "0" "00000" "PDE6B_000053" "g.649777_649778dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "yes" "" "0" "" "" "g.655988_655989dup" "" "pathogenic" ""
"0000735640" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000735641" "0" "90" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.666588G>A" "" "pathogenic" ""
"0000735642" "0" "70" "4" "661699" "661699" "subst" "4.06329E-6" "00000" "PDE6B_000210" "g.661699A>G" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.667910A>G" "" "likely pathogenic" ""
"0000735643" "0" "90" "4" "628580" "628580" "subst" "0" "00000" "PDE6B_000049" "g.628580A>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.634791A>T" "" "pathogenic" ""
"0000735644" "0" "90" "4" "647766" "647766" "del" "0" "00000" "PDE6B_000051" "g.647766del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.653977del" "" "pathogenic" ""
"0000735752" "0" "90" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "yes" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "pathogenic" ""
"0000735753" "0" "90" "4" "657561" "657609" "delins" "0" "00000" "PDE6B_000206" "g.657561_657609delinsTCTGGGTA" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.663772_663820delinsTCTGGGTA" "" "pathogenic" ""
"0000735754" "0" "90" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.666588G>A" "" "pathogenic" ""
"0000735755" "0" "70" "4" "661699" "661699" "subst" "4.06329E-6" "00000" "PDE6B_000210" "g.661699A>G" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.667910A>G" "" "likely pathogenic" ""
"0000735756" "0" "90" "4" "650083" "650083" "dup" "0" "00000" "PDE6B_000054" "g.650083dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.656294dup" "" "pathogenic" ""
"0000735757" "0" "90" "4" "647766" "647766" "del" "0" "00000" "PDE6B_000051" "g.647766del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.653977del" "" "pathogenic" ""
"0000735826" "3" "70" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "" "" "0" "" "" "g.663127del" "" "likely pathogenic" ""
"0000735834" "3" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.625925G>A" "" "likely pathogenic" ""
"0000735903" "3" "70" "4" "619800" "619800" "subst" "0" "02485" "PDE6B_000201" "g.619800G>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "yes" "" "0" "" "" "g.626011G>A" "" "likely pathogenic" ""
"0000735904" "3" "70" "4" "648670" "648670" "del" "0" "02485" "PDE6B_000203" "g.648670del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "c.984delG" "" "Germline" "" "" "0" "" "" "g.654881del" "" "likely pathogenic" ""
"0000735931" "0" "70" "4" "647683" "647683" "subst" "0" "02485" "PDE6B_000202" "g.647683G>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.653894G>A" "" "likely pathogenic" ""
"0000735932" "0" "70" "4" "619678" "619678" "subst" "0" "02485" "PDE6B_000200" "g.619678A>G" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.625889A>G" "" "likely pathogenic" ""
"0000736098" "1" "70" "4" "650774" "650774" "subst" "0.000126105" "00000" "PDE6B_000176" "g.650774G>A" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.656985G>A" "" "likely pathogenic" ""
"0000736139" "2" "70" "4" "656020" "656020" "subst" "0" "00000" "PDE6B_000205" "g.656020C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.662231C>T" "" "likely pathogenic" ""
"0000736177" "1" "90" "4" "657592" "657592" "subst" "2.04097E-5" "00000" "PDE6B_000107" "g.657592C>T" "" "{PMID:Biswas 2017:28130426}" "" "" "" "Germline" "" "rs373037737" "0" "" "" "g.663803C>T" "" "pathogenic" ""
"0000736209" "3" "90" "4" "658734" "658734" "del" "0" "00000" "PDE6B_000208" "g.658734del" "" "{PMID:Bernardis 2016:28127548}" "" "c.2193+1delG" "" "Germline" "" "" "0" "" "" "g.664945del" "" "pathogenic" ""
"0000736210" "1" "90" "4" "647723" "647723" "subst" "0.00109309" "00000" "PDE6B_000034" "g.647723G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.653934G>A" "" "pathogenic" ""
"0000736239" "2" "90" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Biswas 2017:28130426}" "" "" "" "Germline" "" "rs746552548" "0" "" "" "g.664208A>T" "" "pathogenic" ""
"0000736258" "2" "90" "4" "650653" "650653" "subst" "0.000392542" "00000" "PDE6B_000204" "g.650653G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.656864G>A" "" "pathogenic" ""
"0000736806" "3" "90" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Roberts 2016:27898983}" "" "1860delC" "" "Germline" "" "" "0" "" "" "g.663127del" "" "pathogenic (recessive)" ""
"0000759661" "3" "90" "4" "0" "0" "" "0" "00000" "TRAPPC11_000000" "g.?" "" "{PMID:Zhang 2016:27596865}" "" "NM_001145292:703delC (L235Wfs*33)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG"
"0000759672" "3" "70" "4" "629751" "629751" "subst" "0" "00000" "PDE6B_000211" "g.629751G>C" "" "{PMID:Zhang 2016:27596865}" "" "c.G704C" "" "Germline" "" "" "0" "" "" "g.635962G>C" "" "likely pathogenic" "ACMG"
"0000759941" "1" "90" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.653950C>A" "" "pathogenic (recessive)" ""
"0000759962" "2" "90" "4" "647740" "647740" "subst" "5.28253E-5" "00000" "PDE6B_000087" "g.647740G>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.653951G>A" "" "pathogenic (recessive)" ""
"0000760003" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "00000" "PDE6B_000034" "g.647723G>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.653934G>A" "" "VUS" ""
"0000760014" "0" "50" "4" "649846" "649846" "subst" "0" "00000" "PDE6B_000213" "g.649846G>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.656057G>A" "" "VUS" ""
"0000760102" "0" "50" "4" "629702" "629702" "subst" "0.00442226" "00000" "PDE6B_000013" "g.629702T>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.635913T>C" "" "VUS" ""
"0000760267" "0" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" ""
"0000760478" "0" "50" "4" "619706" "619706" "subst" "0" "00000" "PDE6B_000212" "g.619706C>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.625917C>A" "" "VUS" ""
"0000764115" "1" "90" "4" "628715" "664681" "del" "0" "04043" "PDE6B_000215" "g.628715_664681del" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.634926_670892del" "" "pathogenic (recessive)" ""
"0000764149" "2" "70" "4" "627690" "627690" "subst" "0" "04043" "PDE6B_000214" "g.627690C>G" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.633901C>G" "" "likely pathogenic (recessive)" ""
"0000764898" "3" "70" "4" "656007" "656007" "subst" "0" "00000" "PDE6B_000216" "g.656007C>T" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.662218C>T" "" "likely pathogenic (recessive)" ""
"0000765541" "1" "90" "4" "619588" "619588" "subst" "4.91485E-5" "00000" "PDE6B_000217" "g.619588C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.625799C>T" "" "pathogenic" ""
"0000765548" "1" "90" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.664208A>T" "" "pathogenic" ""
"0000765564" "1" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000765565" "1" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000765566" "3" "90" "4" "654328" "654328" "del" "1.62674E-5" "00000" "PDE6B_000221" "g.654328del" "" "{PMID:Ge 2015:26667666}" "" "1540delC" "" "Germline" "" "" "0" "" "" "g.660539del" "" "pathogenic" ""
"0000765586" "2" "90" "4" "661693" "661693" "subst" "2.03181E-5" "00000" "PDE6B_000223" "g.661693C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.667904C>T" "" "pathogenic" ""
"0000765589" "0" "90" "4" "619707" "619707" "subst" "0.000194872" "00000" "PDE6B_000218" "g.619707C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.625918C>T" "" "pathogenic" ""
"0000765590" "0" "90" "4" "657977" "657981" "dup" "0" "00000" "PDE6B_000222" "g.657977_657981dup" "" "{PMID:Ge 2015:26667666}" "" "2093_2094insCCTGT" "" "Germline" "" "" "0" "" "" "g.664188_664192dup" "" "pathogenic" ""
"0000765601" "2" "90" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.625925G>A" "" "pathogenic" ""
"0000765602" "2" "90" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.664208A>T" "" "pathogenic" ""
"0000765653" "3" "90" "4" "650033" "650033" "subst" "0" "00000" "PDE6B_000220" "g.650033G>T" "" "{PMID:Beheshtian 2015:26497376}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656244G>T" "" "pathogenic (recessive)" ""
"0000765809" "0" "70" "4" "648678" "648678" "subst" "8.12565E-6" "00000" "PDE6B_000219" "g.648678G>A" "" "{PMID:Patel 2016:26355662}" "" "NM_000283.3:c.922+1G>A" "" "Germline" "" "" "0" "" "" "g.654889G>A" "" "likely pathogenic" ""
"0000765921" "0" "70" "4" "648678" "648678" "subst" "8.12565E-6" "00000" "PDE6B_000219" "g.648678G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.654889G>A" "" "likely pathogenic" ""
"0000783288" "1" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Yoon 2015:26155838}" "" "832C>T" "" "Germline" "" "rs121918581" "0" "" "" "g.662188C>T" "" "likely pathogenic (recessive)" ""
"0000783290" "1" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Yoon 2015:26155838}" "" "832C>T" "" "Germline" "" "rs121918581" "0" "" "" "g.662188C>T" "" "likely pathogenic (recessive)" ""
"0000783291" "2" "70" "4" "647885" "647885" "subst" "0" "00000" "PDE6B_000163" "g.647885G>A" "" "{PMID:Yoon 2015:26155838}" "" "32G>A" "" "Germline" "" "" "0" "" "" "g.654096G>A" "" "likely pathogenic (recessive)" ""
"0000783294" "2" "70" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Yoon 2015:26155838}" "" "767T>A" "" "Germline" "" "" "0" "" "" "g.660603T>A" "" "likely pathogenic (recessive)" ""
"0000784211" "1" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.656899G>A" "" "pathogenic (recessive)" ""
"0000784212" "1" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.656899G>A" "" "pathogenic (recessive)" ""
"0000784213" "1" "90" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.625939G>A" "" "pathogenic (recessive)" ""
"0000784214" "1" "90" "4" "628607" "628607" "subst" "4.06177E-6" "00000" "PDE6B_000225" "g.628607G>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.634818G>T" "" "pathogenic (recessive)" ""
"0000784348" "0" "70" "4" "619839" "619839" "subst" "0" "00000" "PDE6B_000224" "g.619839G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.626050G>A" "" "likely pathogenic (recessive)" ""
"0000784352" "0" "70" "4" "647715" "647715" "subst" "0" "00000" "PDE6B_000227" "g.647715C>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.653926C>A" "" "likely pathogenic (recessive)" ""
"0000784371" "0" "70" "4" "629747" "629747" "subst" "5.28073E-5" "00000" "PDE6B_000226" "g.629747C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.635958C>T" "" "likely pathogenic (recessive)" ""
"0000784398" "0" "70" "4" "660344" "660344" "subst" "0.00039816" "00000" "PDE6B_000112" "g.660344G>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs199521106" "0" "" "" "g.666555G>C" "" "likely pathogenic (recessive)" ""
"0000784401" "0" "70" "4" "654394" "654394" "subst" "9.76777E-5" "00000" "PDE6B_000100" "g.654394C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.660605C>T" "" "likely pathogenic (recessive)" ""
"0000784407" "0" "70" "4" "658738" "658738" "subst" "9.34587E-5" "00000" "PDE6B_000233" "g.658738G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.664949G>A" "" "likely pathogenic (recessive)" ""
"0000784471" "0" "50" "4" "651131" "651131" "subst" "6.93645E-5" "00000" "PDE6B_000229" "g.651131C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.657342C>T" "" "VUS" ""
"0000784485" "0" "50" "4" "651289" "651290" "ins" "4.09433E-5" "00000" "PDE6B_000230" "g.651289_651290insT" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.657500_657501insT" "" "VUS" ""
"0000784580" "2" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.656899G>A" "" "pathogenic (recessive)" ""
"0000784581" "2" "90" "4" "657928" "657928" "subst" "0" "00000" "PDE6B_000232" "g.657928G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.664139G>A" "" "pathogenic (recessive)" ""
"0000784589" "0" "90" "4" "655922" "655922" "subst" "0" "00000" "PDE6B_000231" "g.655922G>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.662133G>C" "" "pathogenic (recessive)" ""
"0000784597" "0" "90" "4" "655922" "655922" "subst" "0" "00000" "PDE6B_000231" "g.655922G>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.662133G>C" "" "pathogenic (recessive)" ""
"0000785399" "1" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "pathogenic (recessive)" ""
"0000785400" "1" "90" "4" "650744" "650744" "subst" "0" "00000" "PDE6B_000016" "g.650744G>A" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.656955G>A" "" "pathogenic (recessive)" ""
"0000785407" "2" "90" "4" "657561" "657609" "delins" "0" "00000" "PDE6B_000206" "g.657561_657609delinsTCTGGGTA" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.663772_663820delinsTCTGGGTA" "" "pathogenic (recessive)" ""
"0000785408" "2" "90" "4" "656915" "656915" "subst" "0" "00000" "PDE6B_000017" "g.656915A>G" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.663126A>G" "" "pathogenic (recessive)" ""
"0000786334" "1" "90" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.664208A>T" "" "pathogenic" ""
"0000786358" "3" "90" "4" "654335" "654335" "subst" "0" "00000" "PDE6B_000183" "g.654335T>C" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.660546T>C" "" "pathogenic" ""
"0000786359" "1" "90" "4" "656951" "656951" "subst" "4.06197E-6" "00000" "PDE6B_000234" "g.656951T>C" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.663162T>C" "" "pathogenic" ""
"0000786383" "2" "90" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.625925G>A" "" "pathogenic" ""
"0000786396" "2" "90" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.664208A>T" "" "pathogenic" ""
"0000787652" "1" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" ""
"0000787656" "3" "70" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656899G>A" "" "likely pathogenic" ""
"0000787659" "1" "70" "4" "650774" "650774" "subst" "0.000126105" "00000" "PDE6B_000176" "g.650774G>A" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.656985G>A" "" "likely pathogenic" ""
"0000787696" "1" "70" "4" "655932" "655932" "subst" "0" "00000" "PDE6B_000236" "g.655932C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.662143C>T" "" "likely pathogenic" ""
"0000787697" "1" "70" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.662597C>T" "" "likely pathogenic" ""
"0000787710" "2" "70" "4" "619584" "619588" "del" "0" "00000" "PDE6B_000235" "g.619584_619588del" "" "0" "" "167_171del5bp" "" "Germline" "yes" "" "0" "" "" "g.625795_625799del" "" "likely pathogenic" ""
"0000787712" "2" "70" "4" "656020" "656020" "subst" "0" "00000" "PDE6B_000205" "g.656020C>T" "" "0" "" "" "" "Germline" "yes" "" "0" "" "" "g.662231C>T" "" "likely pathogenic" ""
"0000787739" "3" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "Q298*" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000787740" "3" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "Q298*" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000787741" "3" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "Q298*" "" "Germline" "" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000788081" "1" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.660603T>A" "" "pathogenic" ""
"0000788082" "3" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.660603T>A" "" "pathogenic" ""
"0000788083" "1" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.662188C>T" "" "pathogenic" ""
"0000788084" "3" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.662188C>T" "" "pathogenic" ""
"0000788106" "3" "90" "4" "649728" "649728" "subst" "0" "00000" "PDE6B_000237" "g.649728G>C" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.655939G>C" "" "pathogenic" ""
"0000788142" "3" "70" "4" "654364" "654364" "subst" "0" "00000" "PDE6B_000098" "g.654364G>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.660575G>A" "" "likely pathogenic" ""
"0000788161" "2" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.659018G>C" "" "pathogenic" ""
"0000788162" "2" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.660603T>A" "" "pathogenic" ""
"0000789682" "0" "90" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789685" "0" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789686" "0" "90" "4" "657650" "657650" "subst" "0" "00000" "PDE6B_000241" "g.657650T>C" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789687" "0" "90" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789688" "0" "90" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789696" "0" "90" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789699" "0" "90" "4" "629746" "629746" "subst" "0.000121872" "00000" "PDE6B_000239" "g.629746G>A" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789701" "0" "55" "4" "647938" "647938" "subst" "0" "00000" "PDE6B_000240" "g.647938G>A" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000790142" "0" "10" "4" "651314" "651314" "subst" "0" "00000" "PDE6B_000246" "g.651314C>A" "" "{PMID:Singh 2009:19339744}" "" "c.1401+31C>A" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000790143" "3" "10" "4" "658655" "658655" "subst" "2.03153E-5" "00000" "PDE6B_000249" "g.658655G>A" "" "{PMID:Singh 2009:19339744}" "" "c.2130?15G>A" "Other changes detected in the proband: rs10902758, rs28675771" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000790160" "0" "50" "4" "647701" "647701" "subst" "0" "00000" "PDE6B_000116" "g.647701C>A" "" "{PMID:Zeitz-2009:19578023}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790417" "3" "70" "4" "656888" "656888" "subst" "0" "00000" "PDE6B_000248" "g.656888G>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.663099G>C" "" "likely pathogenic" ""
"0000790418" "1" "70" "4" "647885" "647885" "subst" "0" "00000" "PDE6B_000163" "g.647885G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.654096G>A" "" "likely pathogenic" ""
"0000790429" "0" "70" "4" "648658" "648658" "subst" "1.21861E-5" "00000" "PDE6B_000244" "g.648658G>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.654869G>C" "" "likely pathogenic" ""
"0000790435" "1" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" ""
"0000790515" "2" "50" "4" "651162" "651162" "subst" "0" "00000" "PDE6B_000245" "g.651162G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.657373G>A" "" "VUS" ""
"0000790525" "0" "50" "4" "656380" "656380" "subst" "0.000162583" "00000" "PDE6B_000247" "g.656380G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.662591G>A" "" "VUS" ""
"0000790570" "0" "50" "4" "619560" "619560" "subst" "0.0027433" "00000" "PDE6B_000075" "g.619560G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs79826315" "0" "" "" "g.625771G>T" "" "VUS" ""
"0000790582" "0" "50" "4" "629768" "629768" "subst" "0.00242337" "00000" "PDE6B_000033" "g.629768C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs201100689" "0" "" "" "g.635979C>T" "" "VUS" ""
"0000790586" "2" "50" "4" "655932" "655932" "subst" "0" "00000" "PDE6B_000236" "g.655932C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.662143C>T" "" "VUS" ""
"0000790611" "0" "50" "4" "628479" "628479" "subst" "0.000186831" "00000" "PDE6B_000243" "g.628479G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.634690G>A" "" "VUS" ""
"0000790616" "0" "50" "4" "651287" "651331" "del" "0" "00000" "PDE6B_000069" "g.651287_651331del" "" "{PMID:Wang 2014:25097241}" "" "c.1401+4_+48del45" "" "Germline" "" "" "0" "" "" "g.657498_657542del" "" "VUS" ""
"0000790617" "0" "50" "4" "651287" "651331" "del" "0" "00000" "PDE6B_000069" "g.651287_651331del" "" "{PMID:Wang 2014:25097241}" "" "c.1401+4_+48del45" "" "Germline" "" "" "0" "" "" "g.657498_657542del" "" "VUS" ""
"0000790643" "0" "50" "4" "660395" "660395" "subst" "0.000345469" "00000" "PDE6B_000250" "g.660395G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs145124626" "0" "" "" "g.666606G>A" "" "VUS" ""
"0000790655" "0" "50" "4" "619636" "619636" "subst" "0" "00000" "PDE6B_000076" "g.619636G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.625847G>T" "" "VUS" ""
"0000790742" "3" "70" "4" "619536" "619540" "delins" "0" "00000" "PDE6B_000242" "g.619536_619540delinsN[15]" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.625747_625751delinsN[15]" "" "likely pathogenic" ""
"0000791164" "3" "50" "4" "650798" "650798" "subst" "1.22113E-5" "00000" "PDE6B_000251" "g.650798G>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.657009G>A" "" "VUS" "ACMG"
"0000791204" "3" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "0,00049 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" "ACMG"
"0000791637" "0" "50" "4" "655987" "655987" "subst" "0" "00000" "PDE6B_000167" "g.655987G>A" "" "{PMID:Hosono 2018:29844330}" "" "c.1679G>A" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "" "0" "" "" "g.662198G>A" "" "VUS" "ACMG"
"0000792052" "3" "90" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.810C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792053" "3" "90" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.810C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792386" "0" "70" "4" "654392" "654392" "subst" "4.06891E-6" "03508" "PDE6B_000099" "g.654392T>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG"
"0000792387" "0" "70" "4" "657949" "657949" "subst" "0" "03508" "PDE6B_000252" "g.657949C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG"
"0000793733" "3" "50" "4" "661691" "661691" "del" "0" "00000" "PDE6B_000254" "g.661691del" "" "{PMID:Collin-2011:21217109}" "" "c.2399del" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000793742" "3" "90" "4" "655993" "655993" "subst" "0" "00000" "PDE6B_000253" "g.655993G>A" "0.00% in 360 controls" "{PMID:Simpson-2011:21147909}" "" "c.1685G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000793895" "0" "50" "4" "655932" "655932" "subst" "0" "00000" "PDE6B_000236" "g.655932C>T" "" "{PMID:Foote-2019:10480356}" "" "c.1624C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000793896" "0" "50" "4" "658680" "658680" "subst" "4.0619E-6" "00000" "PDE6B_000198" "g.658680A>T" "" "{PMID:Foote-2019:10480356}" "" "c.2140A>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000794102" "0" "70" "4" "654392" "654392" "subst" "4.06891E-6" "03508" "PDE6B_000099" "g.654392T>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG"
"0000794103" "0" "70" "4" "661784" "661784" "subst" "3.26685E-5" "03508" "PDE6B_000169" "g.661784C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG"
"0000794220" "3" "70" "4" "655977" "655977" "subst" "3.08578E-5" "03508" "PDE6B_000101" "g.655977C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "ACMG"
"0000794348" "0" "70" "4" "629745" "629745" "subst" "3.24987E-5" "00000" "PDE6B_000256" "g.629745C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.698C>T, NP_000274.2:p.(Thr233Met), NC_000004.11:g.629745C>T" "" "Germline" "?" "" "0" "" "" "g.635956C>T" "" "likely pathogenic" "ACMG"
"0000794349" "0" "90" "4" "619635" "619635" "subst" "0.000541479" "00000" "PDE6B_000121" "g.619635C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.220C>T, NP_000274.2:p.(Arg74Cys), NC_000004.11:g.619635C>T" "" "Germline" "?" "" "0" "" "" "g.625846C>T" "" "pathogenic" "ACMG"
"0000794350" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.385G>A, NP_000274.2:p.(Glu129Lys), NC_000004.11:g.619800G>A" "" "Germline" "?" "" "0" "" "" "g.626011G>A" "" "likely pathogenic" "ACMG"
"0000794351" "0" "70" "4" "654401" "654403" "del" "0" "00000" "PDE6B_000257" "g.654401_654403del" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.1613_1614+1del, NP_000274.2:p.(Glu538del), NC_000004.11:g.654401_654403del" "" "Germline" "?" "" "0" "" "" "g.660612_660614del" "" "likely pathogenic" "ACMG"
"0000794352" "3" "70" "4" "659054" "659054" "subst" "4.06587E-6" "00000" "PDE6B_000258" "g.659054T>C" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.2204T>C, NP_000274.2:p.(Leu735Pro), NC_000004.11:g.659054T>C" "" "Germline" "?" "" "0" "" "" "g.665265T>C" "" "likely pathogenic" "ACMG"
"0000794353" "3" "70" "4" "619418" "619418" "dup" "0" "00000" "PDE6B_000255" "g.619418dup" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.3dup, NP_000274.2:p.(Met1?), NC_000004.11:g.619418dup" "" "Germline" "?" "" "0" "" "" "g.625629dup" "" "likely pathogenic" "ACMG"
"0000794354" "0" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.1467+1G>C, NP_000274.2:p.?, NC_000004.11:g.652807G>C" "" "Germline" "?" "" "0" "" "" "g.659018G>C" "" "pathogenic" "ACMG"
"0000794355" "0" "90" "4" "619635" "619635" "subst" "0.000541479" "00000" "PDE6B_000121" "g.619635C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000283.3:c.220C>T, NP_000274.2:p.(Arg74Cys), NC_000004.11:g.619635C>T" "" "Germline" "?" "" "0" "" "" "g.625846C>T" "" "pathogenic" "ACMG"
"0000794925" "3" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "13/336 cases; 2/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1669C>T" "9 Heterozygous carriers and 2 controls" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000794926" "0" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "13/336 cases; 2/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1669C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000794927" "0" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "13/336 cases; 2/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1669C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000794928" "0" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "13/336 cases; 2/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1669C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000794932" "0" "50" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "4/336 cases; 3/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1811C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000794985" "3" "50" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.810C>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000795063" "3" "90" "4" "654356" "654356" "subst" "0" "00000" "PDE6B_000170" "g.654356T>G" "" "{PMID:Bocquet-2013:23350551}" "" "c.1568T>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795923" "0" "70" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Schorderet-2013:23484092}" "" "p.PDE6B-H337R" "" "Unknown" "?" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796045" "3" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Fu-2013:23661369}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796046" "3" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Fu-2013:23661369}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796047" "3" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Fu-2013:23661369}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796161" "3" "90" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Nishiguchi-2013:24043777}" "" "IVS11+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796169" "0" "70" "4" "650744" "650744" "subst" "0" "00000" "PDE6B_000016" "g.650744G>A" "" "{PMID:Neveling-2013:24123792}" "" "c.1189G>A" "-" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796170" "0" "70" "4" "656915" "656915" "subst" "0" "00000" "PDE6B_000017" "g.656915A>G" "" "{PMID:Neveling-2013:24123792}" "" "c.1859A>G" "-" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796687" "3" "90" "4" "629716" "629716" "subst" "0" "00000" "PDE6B_000259" "g.629716T>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.669T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796689" "3" "90" "4" "656007" "656007" "subst" "0" "00000" "PDE6B_000216" "g.656007C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1699C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796722" "0" "70" "4" "629750" "629750" "subst" "2.03145E-5" "00000" "PDE6B_000260" "g.629750C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.703C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796739" "3" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2193+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796752" "0" "90" "4" "657928" "657928" "subst" "0" "00000" "PDE6B_000232" "g.657928G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2047G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796753" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2193+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796754" "0" "70" "4" "659099" "659099" "subst" "0" "00000" "PDE6B_000262" "g.659099T>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2249T>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796804" "0" "70" "4" "629751" "629751" "subst" "5.28198E-5" "00000" "PDE6B_000261" "g.629751G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.704G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796899" "0" "90" "4" "661691" "661691" "subst" "0" "00000" "PDE6B_000019" "g.661691T>C" "" "{PMID:Wang-2014:24154662}" "" "c.2399T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796900" "0" "90" "4" "650792" "650792" "subst" "0" "00000" "PDE6B_000018" "g.650792C>T" "" "{PMID:Wang-2014:24154662}" "" "c.1237C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000797080" "3" "70" "4" "619708" "619708" "subst" "0" "00000" "PDE6B_000122" "g.619708G>C" "" "{PMID:Birtel 2018:30543658}" "" "c.293G>C, p.Arg98Pro" "Homozygous" "Germline" "?" "" "0" "" "" "g.625919G>C" "" "likely pathogenic" "ACMG"
"0000797081" "3" "90" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.299G>A, p.Arg100His" "Homozygous" "Germline" "?" "rs555600300" "0" "" "" "g.625925G>A" "" "pathogenic" "ACMG"
"0000797082" "3" "70" "4" "619658" "619658" "del" "0" "00000" "PDE6B_000264" "g.619658del" "" "{PMID:Birtel 2018:30543658}" "" "c.243delG, p.Arg82Alafs*68" "Homozygous" "Germline" "?" "" "0" "" "" "g.625869del" "" "likely pathogenic" "ACMG"
"0000797414" "21" "70" "4" "661693" "661693" "subst" "2.03181E-5" "00000" "PDE6B_000223" "g.661693C>T" "" "{PMID:Patel 2019:30653986}" "" "c.2401C-->T, c.173C-->T; p.Gln801,* p.Ala58Val" "confirmed with Sanger sequencing; heterozygous" "Germline" "yes" "" "0" "" "" "g.667904C>T" "" "likely pathogenic" ""
"0000797456" "21" "70" "4" "619588" "619588" "subst" "4.91485E-5" "00000" "PDE6B_000217" "g.619588C>T" "" "{PMID:Patel 2019:30653986}" "" "c.2401C-->T, c.173C-->T; p.Gln801,* p.Ala58Val" "confirmed with Sanger sequencing; heterozygous" "Germline" "yes" "" "0" "" "" "g.625799C>T" "" "likely pathogenic" ""
"0000797718" "3" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.2193+1G>A, p.(?), c.2193+1G>A, p.(?)" "homozygous" "Germline" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000797719" "0" "70" "4" "654364" "654364" "subst" "0" "00000" "PDE6B_000098" "g.654364G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1576G>A, p.(Glu526Lys), c.1833-3C>G, p.(?)" "" "Germline" "?" "" "0" "" "" "g.660575G>A" "" "likely pathogenic" "ACMG"
"0000797720" "0" "50" "4" "656886" "656886" "subst" "0" "00000" "PDE6B_000269" "g.656886C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1576G>A, p.(Glu526Lys), c.1833-3C>G, p.(?)" "" "Germline" "?" "" "0" "" "" "g.663097C>G" "" "VUS" "ACMG"
"0000797721" "0" "70" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1654del, p.(Arg552Glyfs*23), c.1107+3A>G, p.(?)" "" "Germline" "?" "" "0" "" "" "g.656295A>G" "" "likely pathogenic" "ACMG"
"0000797722" "0" "70" "4" "655962" "655962" "del" "0" "00000" "PDE6B_000266" "g.655962del" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1654del, p.(Arg552Glyfs*23), c.1107+3A>G, p.(?)" "" "Germline" "?" "" "0" "" "" "g.662173del" "" "likely pathogenic" "ACMG"
"0000797723" "3" "70" "4" "619622" "619622" "dup" "0" "00000" "PDE6B_000263" "g.619622dup" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.207dup, p.(Ile70Hisfs*96), c.207dup, p.(Ile70Hisfs*96)" "homozygous" "Germline" "?" "" "0" "" "" "g.625833dup" "" "likely pathogenic" "ACMG"
"0000797724" "0" "70" "4" "619708" "619708" "subst" "0" "00000" "PDE6B_000265" "g.619708G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.293G>A, p.(Arg98His)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.625919G>A" "" "likely pathogenic" "ACMG"
"0000797725" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.385G>A, p.(Glu129Lys), c.2193+1G>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000797726" "0" "50" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.385G>A, p.(Glu129Lys), c.2193+1G>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.626011G>A" "" "VUS" "ACMG"
"0000797728" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1923_1969delinsTCTGGG, p.(Asn643Glyfs*29), c.2193+1G>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000797729" "0" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1923_1969delinsTCTGGG, p.(Asn643Glyfs*29), c.2193+1G>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" "ACMG"
"0000798017" "0" "70" "4" "651288" "651288" "subst" "0.00146971" "00000" "PDE6B_000158" "g.651288G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "IMPDH1 c.978G>C, p.(Gln326His),, pDE6B c.1401+5G>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.657499G>A" "" "likely pathogenic" "ACMG"
"0000798042" "3" "50" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.313G>A, p.(Glu105Lys), c.313G>A, p.(Glu105Lys)" "homozygous" "Germline" "?" "" "0" "" "" "g.625939G>A" "" "VUS" "ACMG"
"0000798043" "0" "70" "4" "655978" "655978" "subst" "0" "00000" "PDE6B_000267" "g.655978A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "PDE6B c.1670A>G, p.(His557Arg)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.662189A>G" "" "likely pathogenic" "ACMG"
"0000798423" "3" "50" "4" "656031" "656031" "subst" "0" "00000" "PDE6B_000268" "g.656031G>A" "" "{PMID:Azam-2011:21987686}" "" "c.1722+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000801689" "0" "10" "4" "647921" "647921" "subst" "0.000650846" "02330" "PDE6B_000160" "g.647921G>A" "" "" "" "PDE6B(NM_000283.3):c.905G>A (p.G302D), PDE6B(NM_000283.4):c.905G>A (p.G302D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000801690" "0" "30" "4" "650057" "650057" "subst" "0.000523977" "02330" "PDE6B_000039" "g.650057C>T" "" "" "" "PDE6B(NM_000283.3):c.1083C>T (p.S361=), PDE6B(NM_000283.4):c.1083C>T (p.S361=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000801691" "0" "50" "4" "651130" "651130" "subst" "4.89748E-5" "01943" "PDE6B_000270" "g.651130T>A" "" "" "" "PDE6B(NM_000283.3):c.1258-10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000801693" "0" "50" "4" "654298" "654298" "subst" "0" "01943" "PDE6B_000271" "g.654298T>C" "" "" "" "PDE6B(NM_000283.3):c.1510T>C (p.F504L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000801694" "0" "50" "4" "655932" "655932" "subst" "0" "02330" "PDE6B_000236" "g.655932C>T" "" "" "" "PDE6B(NM_000283.4):c.1624C>T (p.R542W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000801695" "0" "30" "4" "657978" "657978" "subst" "0" "01943" "PDE6B_000272" "g.657978G>C" "" "" "" "PDE6B(NM_000283.3):c.2097G>C (p.L699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000801696" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "02330" "PDE6B_000063" "g.658734G>A" "" "" "" "PDE6B(NM_000283.3):c.2193+1G>A, PDE6B(NM_000283.4):c.2193+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000811486" "0" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Kim 2019:31496144}" "" "PDE6B c.1669C>T, p.H557Y" "" "Germline" "?" "" "0" "" "" "g.662188C>T" "" "pathogenic" "ACMG"
"0000811487" "0" "90" "4" "647885" "647885" "subst" "0" "00000" "PDE6B_000163" "g.647885G>A" "" "{PMID:Kim 2019:31496144}" "" "PDE6B c.869G>A, p.W290XW" "" "Germline" "?" "" "0" "" "" "g.654096G>A" "" "pathogenic" "ACMG"
"0000811488" "0" "70" "4" "655944" "655949" "del" "0" "00000" "PDE6B_000166" "g.655944_655949del" "" "{PMID:Kim 2019:31496144}" "" "PDE6B c.1636_1641delTCCATC, p.S546_I547del" "error in protein variant annotation" "Germline" "?" "" "0" "" "" "g.662155_662160del" "" "likely pathogenic" "ACMG"
"0000811522" "0" "70" "4" "661784" "661784" "subst" "3.26685E-5" "00000" "PDE6B_000169" "g.661784C>T" "" "{PMID:Kim 2019:31496144}" "" "PDE6B c.2492C>T, p.A831AV" "" "Germline" "?" "" "0" "" "" "g.667995C>T" "" "likely pathogenic" "ACMG"
"0000811523" "0" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Kim 2019:31496144}" "" "PDE6B c.1669C>T, p.H557Y" "" "Germline" "?" "" "0" "" "" "g.662188C>T" "" "pathogenic" "ACMG"
"0000811827" "0" "70" "16" "619418" "619418" "dup" "0" "00000" "PDE6B_000255" "g.619418dup" "" "{PMID:Gao 2019:31054281}" "" "c.3dup, p.Ser2Glufs*4" "heterozygous" "Germline" "?" "" "0" "" "" "g.625629dup" "" "likely pathogenic" ""
"0000811847" "0" "70" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Gao 2019:31054281}" "" "c.313G>A, p.Glu105Lys" "heterozygous" "Germline" "?" "" "0" "" "" "g.625939G>A" "" "likely pathogenic" ""
"0000811848" "0" "70" "3" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Gao 2019:31054281}" "" "c.313G>A, p.Glu105Lys" "heterozygous" "Germline" "?" "" "0" "" "" "g.625939G>A" "" "likely pathogenic" ""
"0000811882" "0" "70" "1" "656386" "656386" "subst" "0" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Gao 2019:31054281}" "" "c.1811C>T, p.Thr604Ile" "heterozygous" "Germline" "?" "" "0" "" "" "g.662597C>T" "" "likely pathogenic" ""
"0000812009" "3" "70" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "PDE6B Ex.4 c.810C>A p.(Cys270*), Ex.4 c.810C>A p.(Cys270*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.653950C>A" "" "likely pathogenic" ""
"0000812094" "3" "70" "4" "654360" "654360" "del" "0" "00000" "PDE6B_000274" "g.654360del" "" "{PMID:Martin Merida 2019:30902645}" "" "PDE6B Ex.12 c.1572delC p.(Tyr525Thrfs*50), Ex.12 c.1572delC p.(Tyr525Thrfs*50)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.660571del" "" "likely pathogenic" ""
"0000812476" "3" "70" "4" "647711" "647713" "del" "0" "00000" "PDE6B_000273" "g.647711_647713del" "" "{PMID:Tayebi 2019:30820146}" "" "c.782_784del, p.(Phe261del)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.653922_653924del" "" "likely pathogenic" ""
"0000813029" "3" "70" "4" "652756" "652756" "del" "0" "00000" "PDE6B_000164" "g.652756del" "" "{PMID:Ehrenberg 2019:31814694}" "" "MYO7A (NM_000620; OMIM: 276903): c.2308delC; p.Asn769fsX4 (hom) (USH), PDE6B (NM_000283; OMIM: 180072): c.1417delC; p.Leu473fsX16 (hom) (RP)" "homozygous" "Germline" "yes" "" "0" "" "" "g.658967del" "" "likely pathogenic" ""
"0000813211" "0" "30" "4" "628612" "628612" "subst" "0.00534581" "00000" "PDE6B_000032" "g.628612C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.615C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000813696" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Xu 2020:31630094}" "" "PDE6B NM_000283: g.428G>A, c.385G>A, p.E129K" "" "Germline" "yes" "" "0" "" "" "g.626011G>A" "" "likely pathogenic" "ACMG"
"0000813697" "0" "90" "4" "619584" "619588" "del" "0" "00000" "PDE6B_000235" "g.619584_619588del" "" "{PMID:Xu 2020:31630094}" "" "PDE6B NM_000283: g.210_214delGCACG, c.167_171delGCACG, p.T57Afs107" "" "Germline" "yes" "" "0" "" "" "g.625795_625799del" "" "pathogenic" "ACMG"
"0000813798" "3" "90" "4" "619713" "619713" "subst" "0.000249698" "00000" "PDE6B_000123" "g.619713C>T" "" "{PMID:Chakrabarty 2020:31639430}" "" "c.298C>T , R100C" "Homozygous" "Germline" "yes" "" "0" "" "" "g.625924C>T" "" "pathogenic" ""
"0000813801" "3" "90" "4" "619713" "619713" "subst" "0.000249698" "00000" "PDE6B_000123" "g.619713C>T" "" "{PMID:Chakrabarty 2020:31639430}" "" "c.298C>T , R100C" "Homozygous" "Germline" "yes" "" "0" "" "" "g.625924C>T" "" "pathogenic" ""
"0000814782" "0" "50" "4" "629669" "629669" "subst" "0" "00000" "PDE6B_000275" "g.629669G>A" "" "{PMID:Dan 2020:31960602}" "" "PDE6B c.622G>A, p.(Val208Met)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.635880G>A" "" "VUS" "ACMG"
"0000814813" "0" "50" "4" "661727" "661727" "subst" "4.06488E-6" "00000" "PDE6B_000276" "g.661727A>T" "" "{PMID:Dan 2020:31960602}" "" "PDE6B c.2435A>T, p.(Asp812Val)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.667938A>T" "" "VUS" "ACMG"
"0000815067" "0" "90" "4" "0" "0" "" "0" "00000" "TRAPPC11_000000" "g.?" "" "{PMID:Shanks 2013:22968130}" "" "E55X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815068" "0" "90" "4" "658734" "658734" "" "0" "00000" "PDE6B_000279" "g.658734?" "" "{PMID:Shanks 2013:22968130}" "" "c.2193+1" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815071" "0" "90" "4" "0" "0" "" "0" "00000" "TRAPPC11_000000" "g.?" "" "{PMID:Shanks 2013:22968130}" "" "Q298X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815072" "0" "90" "4" "0" "0" "" "0" "00000" "TRAPPC11_000000" "g.?" "" "{PMID:Shanks 2013:22968130}" "" "c.2194-1" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815405" "0" "50" "4" "647689" "647689" "subst" "6.50322E-5" "00000" "PDE6B_000277" "g.647689G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "PDE6B:NM_000283 c.G760A, p.E254K" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.653900G>A" "" "VUS" "ACMG"
"0000815516" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "00000" "PDE6B_000034" "g.647723G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "PDE6B:NM_000283 c.G794A, p.R265Q" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.653934G>A" "" "VUS" "ACMG"
"0000815575" "0" "50" "4" "647722" "647722" "subst" "0" "00000" "PDE6B_000278" "g.647722C>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "PDE6B:NM_000283 c.C793G, p.R265G" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.653933C>G" "" "VUS" "ACMG"
"0000815630" "0" "50" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "PDE6B:NM_000283 c.G385A, p.E129K" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.626011G>A" "" "VUS" "ACMG"
"0000815631" "0" "70" "4" "661700" "661700" "subst" "0" "00000" "PDE6B_000280" "g.661700A>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "PDE6B:NM_000283 c.A2408G, p.N803S" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.667911A>G" "" "likely pathogenic" "ACMG"
"0000815998" "3" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.892C>T, p.Gln298Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000816027" "3" "50" "4" "647668" "647668" "subst" "1.21981E-5" "00000" "PDE6B_000180" "g.647668T>A" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.739T>A, p.Phe247Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.653879T>A" "" "VUS" ""
"0000816039" "0" "50" "4" "656020" "656020" "subst" "0" "00000" "PDE6B_000205" "g.656020C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.1712C>T, p.Thr571Met" "heterozygous" "Unknown" "?" "" "0" "" "" "g.662231C>T" "" "VUS" ""
"0000816113" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.2193+1G>A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000816194" "0" "50" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.1580T>C, p.Leu527Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.660579T>C" "" "VUS" ""
"0000816197" "0" "90" "4" "648678" "648678" "subst" "8.12565E-6" "00000" "PDE6B_000219" "g.648678G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.992+1G>A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.654889G>A" "" "pathogenic" ""
"0000816263" "0" "50" "4" "619019" "664928" "del" "0" "00000" "TRAPPC11_000000" "g.619019_664928del" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B chr4:619019_664928del" "whole gene deletion, unsolved" "Unknown" "?" "" "0" "" "" "" "" "VUS" ""
"0000816291" "0" "50" "4" "650774" "650774" "subst" "0.000126105" "00000" "PDE6B_000176" "g.650774G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "PDE6B c.1219G>A, p.Gly407Arg" "unsolved" "Unknown" "?" "" "0" "" "" "g.656985G>A" "" "VUS" ""
"0000816341" "0" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.892C>T, p.Gln298Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000816369" "0" "50" "4" "647668" "647668" "subst" "1.21981E-5" "00000" "PDE6B_000180" "g.647668T>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.739T>A, p.Phe247Ile" "heterozygous" "Unknown" "?" "" "0" "" "" "g.653879T>A" "" "VUS" ""
"0000816376" "0" "90" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1860del, p.His620GlnfsTer23" "heterozygous" "Unknown" "?" "" "0" "" "" "g.663127del" "" "pathogenic" ""
"0000816432" "0" "50" "4" "658733" "658733" "subst" "0" "00000" "PDE6B_000285" "g.658733G>C" "" "{PMID:Zampaglione 2020:32037395}" "" "c.2193G>C, p.Lys731Asn" "heterozygous" "Unknown" "?" "" "0" "" "" "g.664944G>C" "" "VUS" ""
"0000816494" "0" "90" "4" "657589" "657607" "del" "0" "00000" "PDE6B_000149" "g.657589_657607del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1951_1969del, p.Arg651SerfsTer3" "heterozygous" "Unknown" "?" "" "0" "" "" "g.663800_663818del" "" "pathogenic" ""
"0000816495" "0" "50" "4" "619459" "619459" "subst" "0" "00000" "PDE6B_000281" "g.619459A>C" "" "{PMID:Zampaglione 2020:32037395}" "" "c.44A>C, p.Asn15Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.625670A>C" "" "VUS" ""
"0000816498" "0" "90" "4" "657589" "657607" "del" "0" "00000" "PDE6B_000149" "g.657589_657607del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1951_1969del, p.Arg651SerfsTer3" "heterozygous" "Unknown" "?" "" "0" "" "" "g.663800_663818del" "" "pathogenic" ""
"0000816752" "3" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1923_1969ins6del47, p.(?)" "error in annotation, in ClinVar mutation annotated as c.1923_1969delinsTCTGGG, no protein change annotation, homozygous" "Unknown" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000816753" "3" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1923_1969ins6del47, p.(?)" "error in annotation, in ClinVar mutation annotated as c.1923_1969delinsTCTGGG, no protein change annotation, homozygous" "Unknown" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000816754" "1" "70" "4" "654276" "654276" "del" "0" "00000" "PDE6B_000283" "g.654276del" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1488delC, p.T497PfsX78" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.660487del" "" "likely pathogenic" ""
"0000816755" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1655G>A, p.R552Q" "homozygous" "Unknown" "?" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000816756" "3" "70" "4" "654328" "654328" "del" "1.62674E-5" "00000" "PDE6B_000221" "g.654328del" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1540delC, p.(?)" "homozygous" "Unknown" "?" "" "0" "" "" "g.660539del" "" "likely pathogenic" ""
"0000816757" "3" "70" "4" "657565" "657605" "del" "0" "00000" "PDE6B_000284" "g.657565_657605del" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1927_1967del41, p.(?)" "homozygous" "Unknown" "?" "" "0" "" "" "g.663776_663816del" "" "likely pathogenic" ""
"0000816758" "1" "70" "4" "647685" "647685" "del" "0" "00000" "PDE6B_000282" "g.647685del" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.756delC, p.D252EfsX29" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.653896del" "" "likely pathogenic" ""
"0000816843" "2" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.1669C>T, p.H557Y" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" ""
"0000816844" "2" "70" "4" "660383" "660383" "subst" "0.000130032" "00000" "PDE6B_000286" "g.660383G>A" "" "{PMID:Jauregui 2020:32098976}" "" "PDE6B c.2332G>A, p.V778M" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.666594G>A" "" "likely pathogenic" ""
"0000818930" "0" "70" "4" "619411" "663901" "del" "0" "00000" "PDE6B_000287" "g.(?_619411)_(663901_?)del" "" "{PMID:Ellingsford 2018:29074561}" "" "c.(?_-1)_(*1_?)del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000818931" "0" "70" "4" "656005" "656005" "subst" "0" "00000" "PDE6B_000288" "g.656005C>T" "" "{PMID:Ellingsford 2018:29074561}" "" "c.1697C>T p.(Ala566Val)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000819350" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.2003A>G/p.D668G" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" ""
"0000819351" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.2003A>G/p.D668G" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" ""
"0000819663" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.886G>T/p.E296*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" ""
"0000819819" "1" "70" "4" "656373" "656373" "subst" "5.69073E-5" "00000" "PDE6B_000058" "g.656373G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1798G>A/p.D600N, variant 2: c.1798G>A/p.D600N" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.662584G>A" "" "likely pathogenic" ""
"0000819882" "1" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.299G>A/p.R100H, variant 2: c.299G>A/p.R100H" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.625925G>A" "" "likely pathogenic" ""
"0000819950" "1" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.299G>A/p.R100H, variant 2: c.299G>A/p.R100H" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.625925G>A" "" "likely pathogenic" ""
"0000820006" "1" "70" "4" "619592" "619663" "dup" "0" "00000" "PDE6B_000289" "g.619592_619663dup" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.177_248dup/p.L83Cfs*19, variant 2: c.1401+2T>G/p.?" "error in annotation, this variant causes an in-frame and not frameshift duplicatio - protein change should be p.(Leu60_Leu83dup) and not p.(Leu83Cysfs*19), solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.625803_625874dup" "" "likely pathogenic" ""
"0000820007" "1" "70" "4" "619592" "619663" "dup" "0" "00000" "PDE6B_000289" "g.619592_619663dup" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.177_248dup/p.L83Cfs*19, variant 2: c.1401+2T>G/p.?" "error in annotation, this variant causes an in-frame and not frameshift duplicatio - protein change should be p.(Leu60_Leu83dup) and not p.(Leu83Cysfs*19), solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.625803_625874dup" "" "likely pathogenic" ""
"0000820133" "1" "70" "4" "656319" "656319" "subst" "0" "00000" "PDE6B_000293" "g.656319T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1744T>C/p.Y582H, variant 2: c.1744T>C/p.Y582H" "possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.662530T>C" "" "likely pathogenic" ""
"0000820228" "1" "70" "4" "656408" "656408" "subst" "0" "00000" "PDE6B_000294" "g.656408G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1832+1G>T/p.?, variant 2: c.1832+1G>T/p.?" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.662619G>T" "" "likely pathogenic" ""
"0000820370" "1" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.2326G>A/p.D776N, variant 2: c.2326G>A/p.D776N" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000820433" "1" "70" "4" "651272" "651272" "subst" "0" "00000" "PDE6B_000291" "g.651272C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1390C>T/p.Q464*, variant 2: c.1390C>T/p.Q464*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.657483C>T" "" "likely pathogenic" ""
"0000820435" "1" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1923_1969delinsTCTGGG/ p.N643Gfs*29, variant 2: c.2326G>A/p.D776N" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000820441" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.892C>T/p.Q298*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" ""
"0000820463" "1" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.2193+1G>A/p.?, variant 2: c.2193+1G>A/p.?" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" ""
"0000820524" "1" "70" "4" "619824" "619824" "subst" "0" "00000" "PDE6B_000192" "g.619824G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.409G>A/p.G137R, variant 2: c.928-9_940dup/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.626035G>A" "" "likely pathogenic" ""
"0000820556" "1" "70" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1107+3A>G/p.?, variant 2: c.1920+2T>C/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.656295A>G" "" "likely pathogenic" ""
"0000820566" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.892C>T/p.Q298*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" ""
"0000820621" "1" "70" "4" "657641" "657641" "subst" "0" "00000" "PDE6B_000295" "g.657641A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.2003A>G/p.D668G" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.663852A>G" "" "likely pathogenic" ""
"0000820622" "1" "70" "4" "657641" "657641" "subst" "0" "00000" "PDE6B_000295" "g.657641A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.2003A>G/p.D668G" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.663852A>G" "" "likely pathogenic" ""
"0000820691" "1" "70" "4" "647902" "647902" "subst" "0" "00000" "PDE6B_000290" "g.647902G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.892C>T/p.Q298*, variant 2: c.886G>T/p.E296*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.654113G>T" "" "likely pathogenic" ""
"0000820782" "1" "70" "4" "651285" "651285" "subst" "0" "00000" "PDE6B_000292" "g.651285T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.177_248dup/p.L83Cfs*19, variant 2: c.1401+2T>G/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.657496T>G" "" "likely pathogenic" ""
"0000820783" "1" "70" "4" "651285" "651285" "subst" "0" "00000" "PDE6B_000292" "g.651285T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.177_248dup/p.L83Cfs*19, variant 2: c.1401+2T>G/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.657496T>G" "" "likely pathogenic" ""
"0000820915" "1" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1923_1969delinsTCTGGG/ p.N643Gfs*29, variant 2: c.2326G>A/p.D776N" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.666588G>A" "" "likely pathogenic" ""
"0000820957" "1" "70" "4" "648604" "648625" "dup" "0" "00000" "PDE6B_000023" "g.648604_648625dup" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.409G>A/p.G137R, variant 2: c.928-9_940dup/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.654815_654836dup" "" "likely pathogenic" ""
"0000820974" "1" "70" "4" "656978" "656978" "subst" "8.13061E-6" "00000" "PDE6B_000006" "g.656978T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "PDE6B, variant 1: c.1107+3A>G/p.?, variant 2: c.1920+2T>C/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.663189T>C" "" "likely pathogenic" ""
"0000821323" "3" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.2193+1G>A," "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000821324" "0" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1580T>C, p.Leu527Pro" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" ""
"0000821325" "0" "70" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1107+3A>G," "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.656295A>G" "" "likely pathogenic" ""
"0000821326" "0" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG, p.Asn643GlyfsTer29" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000821327" "0" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1580T>C, p.Leu527Pro" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" ""
"0000821328" "0" "70" "4" "654335" "654335" "subst" "0" "00000" "PDE6B_000183" "g.654335T>C" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1547T>C, p.Leu516Pro" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.660546T>C" "" "likely pathogenic" ""
"0000821329" "3" "70" "4" "619416" "619416" "subst" "2.86643E-5" "00000" "PDE6B_000179" "g.619416A>G" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1A>G, p.Met1?" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.625627A>G" "" "likely pathogenic" ""
"0000821586" "0" "70" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1678C>T, p.Arg560Cys" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.662197C>T" "" "likely pathogenic" ""
"0000821587" "0" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.2193+1G>A," "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.664945G>A" "" "pathogenic" ""
"0000821588" "0" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.892C>T, p.Gln298Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" ""
"0000821589" "0" "70" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.1678C>T, p.Arg560Cys" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.662197C>T" "" "likely pathogenic" ""
"0000821590" "0" "70" "4" "647668" "647668" "subst" "1.21981E-5" "00000" "PDE6B_000180" "g.647668T>A" "" "{PMID:Turro 2020:32581362}" "" "PDE6B c.739T>A, p.Phe247Ile" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.653879T>A" "" "likely pathogenic" ""
"0000822110" "0" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Booij-2011:20801516}" "" "c.892C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000822117" "0" "70" "4" "629702" "629702" "subst" "0.00442226" "00000" "PDE6B_000013" "g.629702T>C" "" "{PMID:Booij-2011:20801516}" "" "c.655T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000824639" "0" "50" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1811T, p.T604I" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.662597C>T" "" "VUS" "ACMG"
"0000824675" "0" "50" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1811T, p.T604I" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.662597C>T" "" "VUS" "ACMG"
"0000824676" "0" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1669T, p.H557Y" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" "ACMG"
"0000824689" "0" "90" "4" "655932" "655932" "subst" "0" "00000" "PDE6B_000236" "g.655932C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1624T, p.R542W" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.662143C>T" "" "pathogenic" "ACMG"
"0000824699" "0" "50" "4" "656386" "656386" "subst" "0.00013008" "00000" "PDE6B_000104" "g.656386C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1811T, p.T604I" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.662597C>T" "" "VUS" "ACMG"
"0000824746" "0" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C1669T, p.H557Y" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" "ACMG"
"0000824747" "0" "70" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.T1604A, p.I535N" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.660603T>A" "" "likely pathogenic" "ACMG"
"0000824771" "0" "90" "4" "661687" "661687" "subst" "0" "00000" "PDE6B_000297" "g.661687C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C2395T, p.R799X" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.667898C>T" "" "pathogenic" "ACMG"
"0000824778" "0" "50" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.T1604A, p.I535N" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.660603T>A" "" "VUS" "ACMG"
"0000824808" "0" "50" "4" "619677" "619677" "subst" "9.05354E-6" "00000" "PDE6B_000296" "g.619677C>T" "" "{PMID:Ma 2021:33691693}" "" "PDE6B c.C262T, p.Q88X" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.625888C>T" "" "VUS" "ACMG"
"0000825738" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Liu-2020:33090715}" "" "c.385G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825739" "0" "70" "4" "654400" "654402" "del" "0" "00000" "PDE6B_000304" "g.654400_654402del" "" "{PMID:Liu-2020:33090715}" "" "c.1610_1612delAGG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825875" "3" "70" "4" "659054" "659054" "subst" "4.06587E-6" "00000" "PDE6B_000258" "g.659054T>C" "" "{PMID:Liu-2020:33090715}" "" "c.2204T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825876" "3" "70" "4" "619418" "619418" "dup" "0" "00000" "PDE6B_000255" "g.619418dup" "" "{PMID:Liu-2020:33090715}" "" "c.3dupG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825923" "0" "70" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Liu-2020:33090715}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825924" "0" "70" "4" "659054" "659054" "subst" "4.06587E-6" "00000" "PDE6B_000258" "g.659054T>C" "" "{PMID:Liu-2020:33090715}" "" "c.2204T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826079" "0" "70" "4" "647652" "647652" "subst" "0" "00000" "PDE6B_000299" "g.647652G>A" "" "{PMID:Liu-2020:33090715}" "" "c.723G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826080" "0" "70" "4" "649727" "649727" "subst" "0" "00000" "PDE6B_000301" "g.649727A>G" "" "{PMID:Liu-2020:33090715}" "" "c.993-2A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826209" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Liu-2020:33090715}" "" "c.385G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826210" "0" "70" "4" "648658" "648658" "subst" "0" "00000" "PDE6B_000300" "g.648658G>T" "" "{PMID:Liu-2020:33090715}" "" "c.973G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826232" "0" "70" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Liu-2020:33090715}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826233" "0" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Liu-2020:33090715}" "" "c.1655G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826274" "0" "70" "4" "652807" "652807" "subst" "8.14432E-6" "00000" "PDE6B_000238" "g.652807G>C" "" "{PMID:Liu-2020:33090715}" "" "c.1467+1G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826275" "0" "70" "4" "656008" "656008" "subst" "0" "00000" "PDE6B_000305" "g.656008A>G" "" "{PMID:Liu-2020:33090715}" "" "c.1700A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826944" "3" "70" "4" "655993" "655993" "subst" "0" "00000" "PDE6B_000253" "g.655993G>A" "" "{PMID:Thorsteinsson 2021:33851411}" "" "PDE6B c.1685G>A, p.Gly562Asp" "homozygous" "Unknown" "?" "" "0" "" "" "g.662204G>A" "" "likely pathogenic" ""
"0000827308" "0" "90" "4" "628613" "628613" "subst" "0" "00000" "PDE6B_000298" "g.628613G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.616G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000827309" "0" "50" "4" "652810" "652810" "del" "0" "00000" "PDE6B_000302" "g.652810del" "" "{PMID:Colombo-2020:33576794}" "" "c.1467+4del" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000827310" "0" "70" "4" "647689" "647689" "subst" "6.50322E-5" "00000" "PDE6B_000277" "g.647689G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.760G>A" "" "Germline" "yes" "rs146204075" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000827311" "0" "50" "4" "654320" "654320" "subst" "0" "00000" "PDE6B_000303" "g.654320G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1532G>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000827312" "3" "70" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.313G>A" "" "Germline" "" "rs398123299" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000827313" "3" "50" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Colombo-2020:33576794}" "" "c.1107+3A>G" "" "Germline" "" "rs370898371" "0" "" "" "" "" "VUS" ""
"0000827314" "3" "90" "4" "658734" "658734" "subst" "0" "00000" "PDE6B_000306" "g.658734G>C" "" "{PMID:Colombo-2020:33576794}" "" "c.2193+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000828498" "2" "70" "4" "619884" "619884" "subst" "0" "00000" "PDE6B_000307" "g.619884G>A" "" "{PMID:Perea-Romero 2021:34448047}" "" "PDE6B, gene that can display both dominant and recessive patterns of inheritance, c.468+1G>A, p.?, compound heterozygous" "" "Germline" "yes" "" "0" "" "" "g.626095G>A" "" "likely pathogenic" "ACMG"
"0000828499" "1" "70" "4" "656332" "656332" "subst" "0" "00000" "PDE6B_000308" "g.656332A>G" "" "{PMID:Perea-Romero 2021:34448047}" "" "PDE6B, gene that can display both dominant and recessive patterns of inheritance, c.1757A>G, p.Glu586Gly, compound heterozygous" "" "Germline" "yes" "" "0" "" "" "g.662543A>G" "" "likely pathogenic" "ACMG"
"0000828781" "0" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Chen 2021:43360855}" "" "PDE6B c.385G>A(;)1133G>A, V1: c.1133G>A, (p.Trp378Ter)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.656899G>A" "" "pathogenic" "ACMG"
"0000828986" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "" "{PMID:Chen 2021:43360855}" "" "PDE6B c.385G>A(;)1133G>A, V2: c.385G>A, (p.Glu129Lys)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.626011G>A" "" "likely pathogenic" "ACMG"
"0000829703" "1" "70" "4" "656932" "656932" "subst" "4.06167E-6" "00006" "PDE6B_000312" "g.656932G>T" "" "{PMID:Ellingford 2016:26872967}" "" "" "" "Germline" "" "" "0" "" "" "g.663143G>T" "" "likely pathogenic" ""
"0000829724" "2" "70" "4" "657561" "657607" "delins" "0" "00006" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Ellingford 2016:26872967}" "" "" "" "Germline" "" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000829820" "0" "90" "4" "656343" "656343" "del" "0" "00000" "PDE6B_000311" "g.656343del" "" "{PMID:Numa-2020:33247286}" "" "c.1768delA:p.M590fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829821" "0" "90" "4" "656978" "656978" "subst" "8.13061E-6" "00000" "PDE6B_000006" "g.656978T>C" "" "{PMID:Numa-2020:33247286}" "" "c.1920+2T>C:p.?" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829832" "3" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Numa-2020:33247286}" "" "c.1669C>T:p.H557Y" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829839" "0" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Numa-2020:33247286}" "" "c.1604T>A:p.I535N" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829840" "0" "90" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Numa-2020:33247286}" "" "c.1669C>T:p.H557Y" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829847" "3" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Numa-2020:33247286}" "" "c.1604T>A:p.I535N" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829881" "0" "90" "4" "654276" "654276" "del" "0" "00000" "PDE6B_000283" "g.654276del" "" "{PMID:Numa-2020:33247286}" "" "c.1486delC:p.P496fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829882" "0" "90" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Numa-2020:33247286}" "" "c.1604T>A:p.I535N" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829893" "3" "90" "4" "619469" "619469" "del" "0" "00000" "PDE6B_000309" "g.619469del" "" "{PMID:Numa-2020:33247286}" "" "c.51delT:p.D17fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000829983" "0" "50" "4" "654302" "654302" "subst" "0" "00000" "PDE6B_000310" "g.654302A>C" "" "{PMID:Numa-2020:33247286}" "" "c.1514A>C:p.H505P" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000832801" "1" "30" "4" "650653" "650653" "subst" "0.000392542" "00000" "PDE6B_000204" "g.650653G>A" "" "{PMID:Gao 1996:8698075}" "" "PDE6B G to A transition in the tenth base of the splice acceptor site of intron 8; splicing testing proved no alteration" "extrapolated: c.1108-10G>A" "Germline" "yes" "" "0" "" "" "g.656864G>A" "" "likely benign" ""
"0000832802" "2" "50" "4" "629730" "629730" "subst" "0" "00000" "PDE6B_000317" "g.629730T>A" "" "{PMID:Gao 1996:8698075}" "" "PDE6B Leu228His" "coding DNA extrapolated from protein annotation; mutation non-causative of ADRP" "Germline" "yes" "" "0" "" "" "g.635941T>A" "" "VUS" ""
"0000832814" "1" "70" "4" "656302" "656302" "subst" "0" "00000" "PDE6B_000319" "g.656302G>A" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B Gly576Asp" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.662513G>A" "" "likely pathogenic" ""
"0000832815" "1" "70" "4" "656302" "656302" "subst" "0" "00000" "PDE6B_000319" "g.656302G>A" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B Gly576Asp" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.662513G>A" "" "likely pathogenic" ""
"0000832816" "1" "70" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B Lys706X" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.664208A>T" "" "likely pathogenic" ""
"0000832817" "1" "70" "4" "657997" "657997" "subst" "2.43904E-5" "00000" "PDE6B_000207" "g.657997A>T" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B Lys706X" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.664208A>T" "" "likely pathogenic" ""
"0000832818" "1" "70" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B His620(1-bp del)" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.663127del" "" "likely pathogenic" ""
"0000832819" "1" "70" "4" "656916" "656916" "del" "5.28009E-5" "00000" "PDE6B_000146" "g.656916del" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B His620(1-bp del)" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.663127del" "" "likely pathogenic" ""
"0000832820" "1" "70" "4" "629668" "629668" "subst" "0" "00000" "PDE6B_000316" "g.629668G>T" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B AG to AT splice acceptor site mutation in intron 2" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.635879G>T" "" "likely pathogenic" ""
"0000832821" "1" "70" "4" "629668" "629668" "subst" "0" "00000" "PDE6B_000316" "g.629668G>T" "" "{PMID:Danciger 1995:8595886}" "" "PDE6B AG to AT splice acceptor site mutation in intron 2" "actual variants extrapolated from literature and protein annotation" "Germline" "yes" "" "0" "" "" "g.635879G>T" "" "likely pathogenic" ""
"0000832822" "0" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.886G>T;p.(E296*)" "" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000832823" "1" "70" "4" "619592" "619663" "dup" "0" "00000" "PDE6B_000289" "g.619592_619663dup" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.177_248dup;p.(L60_L83dup), Variant 2: c.1401+2T>G;p.(?)" "" "Germline" "yes" "" "0" "" "" "g.625803_625874dup" "" "pathogenic (recessive)" "ACMG"
"0000832824" "1" "70" "4" "619592" "619663" "dup" "0" "00000" "PDE6B_000289" "g.619592_619663dup" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.177_248dup;p.(L60_L83dup), Variant 2: c.1401+2T>G;p.(?)" "" "Germline" "yes" "" "0" "" "" "g.625803_625874dup" "" "pathogenic (recessive)" "ACMG"
"0000832825" "3" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.892C>T;p.(Q298*)" "" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000832826" "3" "70" "4" "656408" "656408" "subst" "0" "00000" "PDE6B_000294" "g.656408G>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1832+1G>T;p.(?), Variant 2: c.1832+1G>T;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.662619G>T" "" "likely pathogenic" "ACMG"
"0000832827" "0" "70" "4" "651138" "651138" "subst" "0" "00000" "PDE6B_000318" "g.651138A>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1258-2A>G;p.(?), Variant 2: c.2193+1G>A;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.657349A>G" "" "likely pathogenic" "ACMG"
"0000832828" "3" "70" "4" "650033" "650033" "subst" "0" "00000" "PDE6B_000220" "g.650033G>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1060-1G>T;p.(?), Variant 2: c.1060-1G>T;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.656244G>T" "" "likely pathogenic" "ACMG"
"0000832829" "3" "70" "4" "656007" "656007" "subst" "0" "00000" "PDE6B_000216" "g.656007C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1699C>T;p.(Q567*), Variant 2: c.1699C>T;p.(Q567*)" "" "Germline" "yes" "" "0" "" "" "g.662218C>T" "" "pathogenic" "ACMG"
"0000832830" "0" "70" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1107+3A>G;p.(?), Variant 2: c.1920+2T>C;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.656295A>G" "" "VUS" "ACMG"
"0000832831" "3" "70" "4" "655975" "655975" "subst" "1.03239E-5" "00000" "PDE6B_000313" "g.655975A>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1667A>G;p.(Y556C), Variant 2: c.1667A>G;p.(Y556C)" "" "Unknown" "?" "" "0" "" "" "g.662186A>G" "" "VUS" "ACMG"
"0000832832" "3" "70" "4" "651272" "651272" "subst" "0" "00000" "PDE6B_000291" "g.651272C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1390C>T;p.(Q464*), Variant 2: c.1390C>T;p.(Q464*)" "" "Unknown" "?" "" "0" "" "" "g.657483C>T" "" "likely pathogenic" "ACMG"
"0000832833" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.2003A>G;(p.D668G)" "" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000832834" "3" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.2193+1G>A;p.(?), Variant 2: c.2193+1G>A;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" "ACMG"
"0000832835" "3" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.892C>T;p.(Q298*)" "" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" "ACMG"
"0000832836" "0" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1923_1969delinsTCTGGG;p.(N643Gfs*29), Variant 2: c.2326G>A;p.(D776N)" "" "Unknown" "?" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" "ACMG"
"0000832837" "3" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.2326G>A;p.(D776N), Variant 2: c.2326G>A;p.(D776N)" "" "Unknown" "?" "" "0" "" "" "g.666588G>A" "" "VUS" "ACMG"
"0000832838" "3" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)], Variant 2: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)]" "" "Unknown" "?" "" "0" "" "" "g.625925G>A" "" "VUS" "ACMG"
"0000832839" "1" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.2003A>G;(p.D668G)" "" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "likely pathogenic" "ACMG"
"0000832840" "3" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.2326G>A;p.(D776N), Variant 2: c.2326G>A;p.(D776N)" "" "Unknown" "?" "" "0" "" "" "g.666588G>A" "" "VUS" "ACMG"
"0000832841" "3" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)], Variant 2: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)]" "" "Unknown" "?" "" "0" "" "" "g.625925G>A" "" "VUS" "ACMG"
"0000832842" "3" "70" "4" "656373" "656373" "subst" "5.69073E-5" "00000" "PDE6B_000058" "g.656373G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1798G>A;p.(D600N), Variant 2: c.1798G>A;p.(D600N)" "" "Germline" "yes" "" "0" "" "" "g.662584G>A" "" "VUS" "ACMG"
"0000832843" "3" "70" "4" "619824" "619824" "subst" "0" "00000" "PDE6B_000192" "g.619824G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[409G>A;928-9_940dup];p.[(G137R);(?)], Variant 2: c.[409G>A;928-9_940dup];p.[(G137R);(?)]" "" "Unknown" "?" "" "0" "" "" "g.626035G>A" "" "VUS" "ACMG"
"0000832844" "3" "70" "4" "656319" "656319" "subst" "0" "00000" "PDE6B_000293" "g.656319T>C" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1744T>C;p.(Y582H), Variant 2: c.1744T>C;p.(Y582H)" "" "Unknown" "?" "" "0" "" "" "g.662530T>C" "" "VUS" "ACMG"
"0000832845" "0" "70" "4" "619636" "619636" "dup" "0" "00000" "PDE6B_000315" "g.619636dup" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.221dup;p.(V75Rfs*91), Variant 2: c.892C>T;p.(Q298*)" "" "Unknown" "?" "" "0" "" "" "g.625847dup" "" "likely pathogenic" "ACMG"
"0000832846" "0" "70" "4" "647902" "647902" "subst" "0" "00000" "PDE6B_000290" "g.647902G>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.886G>T;p.(E296*)" "" "Unknown" "?" "" "0" "" "" "g.654113G>T" "" "likely pathogenic" "ACMG"
"0000832847" "2" "70" "4" "651285" "651285" "subst" "0" "00000" "PDE6B_000292" "g.651285T>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.177_248dup;p.(L60_L83dup), Variant 2: c.1401+2T>G;p.(?)" "" "Germline" "yes" "" "0" "" "" "g.657496T>G" "" "likely pathogenic" "ACMG"
"0000832848" "2" "70" "4" "651285" "651285" "subst" "0" "00000" "PDE6B_000292" "g.651285T>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.177_248dup;p.(L60_L83dup), Variant 2: c.1401+2T>G;p.(?)" "" "Germline" "yes" "" "0" "" "" "g.657496T>G" "" "likely pathogenic" "ACMG"
"0000832849" "0" "70" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1258-2A>G;p.(?), Variant 2: c.2193+1G>A;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.664945G>A" "" "likely pathogenic" "ACMG"
"0000832850" "0" "70" "4" "656978" "656978" "subst" "8.13061E-6" "00000" "PDE6B_000006" "g.656978T>C" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1107+3A>G;p.(?), Variant 2: c.1920+2T>C;p.(?)" "" "Unknown" "?" "" "0" "" "" "g.663189T>C" "" "likely pathogenic" "ACMG"
"0000832851" "2" "70" "4" "657641" "657641" "subst" "0" "00000" "PDE6B_000295" "g.657641A>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.2003A>G;(p.D668G)" "" "Germline" "yes" "" "0" "" "" "g.663852A>G" "" "VUS" "ACMG"
"0000832852" "0" "70" "4" "660377" "660377" "subst" "5.28275E-5" "00000" "PDE6B_000008" "g.660377G>A" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.1923_1969delinsTCTGGG;p.(N643Gfs*29), Variant 2: c.2326G>A;p.(D776N)" "" "Unknown" "?" "" "0" "" "" "g.666588G>A" "" "VUS" "ACMG"
"0000832853" "3" "70" "4" "651287" "651331" "del" "0" "00000" "PDE6B_000069" "g.651287_651331del" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)], Variant 2: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)]" "" "Unknown" "?" "" "0" "" "" "g.657498_657542del" "" "VUS" "ACMG"
"0000832854" "2" "70" "4" "657641" "657641" "subst" "0" "00000" "PDE6B_000295" "g.657641A>G" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.892C>T;p.(Q298*), Variant 2: c.2003A>G;(p.D668G)" "" "Germline" "yes" "" "0" "" "" "g.663852A>G" "" "VUS" "ACMG"
"0000832855" "3" "70" "4" "651287" "651331" "del" "0" "00000" "PDE6B_000069" "g.651287_651331del" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)], Variant 2: c.[299G>A;1401+4_1401+48del];p.[(R100H);(?)]" "" "Unknown" "?" "" "0" "" "" "g.657498_657542del" "" "VUS" "ACMG"
"0000832856" "3" "70" "4" "648604" "648625" "dup" "0" "00000" "PDE6B_000023" "g.648604_648625dup" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.[409G>A;928-9_940dup];p.[(G137R);(?)], Variant 2: c.[409G>A;928-9_940dup];p.[(G137R);(?)]" "" "Unknown" "?" "" "0" "" "" "g.654815_654836dup" "" "likely pathogenic" "ACMG"
"0000832857" "0" "70" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Kuehlewein 2021:33673512}" "" "Variant 1: c.221dup;p.(V75Rfs*91), Variant 2: c.892C>T;p.(Q298*)" "" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000832871" "1" "70" "4" "647739" "647739" "subst" "4.06355E-6" "00000" "PDE6B_000050" "g.647739C>A" "" "{PMID:Jacobson 2007:17446517}" "" "PDE6B Cys270X" "nucleotide extrapolated from protein annotation" "Unknown" "?" "" "0" "" "" "g.653950C>A" "" "likely pathogenic" ""
"0000832887" "3" "70" "4" "656373" "656373" "subst" "5.69073E-5" "00000" "PDE6B_000058" "g.656373G>A" "" "{PMID:Tsang 2008:18723146}" "" "PDE6B c.1798G>A, D600N" "within the sam publication also variants without ascribed individuals and zygosities: CRB1 (T745M and P836T), USH2A (E478D, L555V, W4149R, P1978S, G713R, E767fs, and C759F), and RPE65 (A132T) without nucleotide description" "Unknown" "?" "" "0" "" "" "g.662584G>A" "" "likely pathogenic" ""
"0000832894" "3" "70" "4" "661711" "661711" "subst" "0" "03840" "PDE6B_000314" "g.661711T>A" "" "{PMID:Hmani-Aifa 2008:18854872}" "" "PDE6B c.2419T>A, W807R" "Originally only GPR98 variant added to the database" "Germline" "yes" "" "0" "" "" "g.667922T>A" "" "likely pathogenic" ""
"0000832897" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832898" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832899" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832900" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832901" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832902" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832903" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832904" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832905" "3" "70" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1655G>A (p.R552Q)" "" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "likely pathogenic" ""
"0000832906" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832907" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832908" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832909" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832910" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832911" "3" "70" "4" "650715" "650715" "subst" "0" "00000" "PDE6B_000021" "g.650715C>T" "" "{PMID:Ali 2011:21655355}" "" "PDE6B c.1160C>T (p.P387L)" "" "Germline" "yes" "" "0" "" "" "g.656926C>T" "" "likely pathogenic" ""
"0000832912" "3" "70" "4" "652756" "652756" "del" "0" "03840" "PDE6B_000164" "g.652756del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.658967del" "" "likely pathogenic" ""
"0000832913" "3" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Shen 2014:24828262}" "" "PDE6B c.1923_1969ins6del47 (p.T641TfsX31)" "error in annotation, inserted nucleotides not mentioned, protein annotation should start at the first modified aminoacid p.(N643Gfs*29) and not p.T641Tfs*31" "Germline" "yes" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000832914" "3" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Shen 2014:24828262}" "" "PDE6B c.1923_1969ins6del47 (p.T641TfsX31)" "error in annotation, inserted nucleotides not mentioned, protein annotation should start at the first modified aminoacid p.(N643Gfs*29) and not p.T641Tfs*31" "Germline" "yes" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000832915" "3" "70" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Shen 2014:24828262}" "" "PDE6B c.1923_1969ins6del47 (p.T641TfsX31)" "error in annotation, inserted nucleotides not mentioned, protein annotation should start at the first modified aminoacid p.(N643Gfs*29) and not p.T641Tfs*31" "Germline" "yes" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "likely pathogenic" ""
"0000832916" "3" "70" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Gonzalez-delPozo 2015:25823529}" "" "PDE6B c.1678C>T, p.R560C" "" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "likely pathogenic" ""
"0000832917" "3" "70" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Gonzalez-delPozo 2015:25823529}" "" "PDE6B c.1678C>T, p.R560C" "" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "likely pathogenic" ""
"0000833014" "11" "70" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Kuniyoshi 2015:25827439}" "" "PDE6B I535N (c.1604T>A)" "" "Germline" "yes" "" "0" "" "" "g.660603T>A" "" "likely pathogenic" ""
"0000833015" "11" "70" "4" "654392" "654392" "subst" "4.06891E-6" "00000" "PDE6B_000099" "g.654392T>A" "" "{PMID:Kuniyoshi 2015:25827439}" "" "PDE6B I535N (c.1604T>A)" "" "Germline" "yes" "" "0" "" "" "g.660603T>A" "" "likely pathogenic" ""
"0000833016" "21" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Kuniyoshi 2015:25827439}" "" "PDE6B H557Y (c.1669C>T)" "" "Germline" "yes" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" ""
"0000833017" "21" "70" "4" "655977" "655977" "subst" "3.08578E-5" "00000" "PDE6B_000101" "g.655977C>T" "" "{PMID:Kuniyoshi 2015:25827439}" "" "PDE6B H557Y (c.1669C>T)" "" "Germline" "yes" "" "0" "" "" "g.662188C>T" "" "likely pathogenic" ""
"0000833018" "3" "70" "4" "660402" "660402" "dup" "0" "00000" "PDE6B_000322" "g.660402dup" "" "{PMID:Palmowski 2019:30646425}" "" "c.[2351dupA],[2351dupA], p.[Q785Gfs*20], [Q785Gfs*20])" "homozygous" "Unknown" "?" "" "0" "" "" "g.666613dup" "" "likely pathogenic" ""
"0000833019" "0" "70" "4" "656889" "656898" "delins" "0" "00000" "PDE6B_000320" "g.656889_656898delinsCTTAG" "" "{PMID:Palmowski 2019:30646425}" "" "c.[1833_1842delinsCTTAG];[1699C>T], [p.(K611Nfs*6), p.(Q567*)]" "heterozygous" "Unknown" "?" "" "0" "" "" "g.663100_663109delinsCTTAG" "" "likely pathogenic" ""
"0000833020" "0" "70" "4" "647740" "647740" "subst" "5.28253E-5" "00000" "PDE6B_000087" "g.647740G>A" "" "{PMID:Palmowski 2019:30646425}" "" "c.[811G>A];[c.1879_1893del], [p.(E271K), p.(R627_E631del)]" "heterozygous" "Germline" "yes" "" "0" "" "" "g.653951G>A" "" "likely pathogenic" ""
"0000833021" "1" "70" "4" "656007" "656007" "subst" "0" "00000" "PDE6B_000216" "g.656007C>T" "" "{PMID:Palmowski 2019:30646425}" "" "c.[1833_1842delinsCTTAG];[1699C>T], [p.(K611Nfs*6), p.(Q567*)]" "heterozygous" "Unknown" "?" "" "0" "" "" "g.662218C>T" "" "likely pathogenic" ""
"0000833022" "2" "70" "4" "656935" "656949" "del" "0" "00000" "PDE6B_000321" "g.656935_656949del" "" "{PMID:Palmowski 2019:30646425}" "" "c.[811G>A];[c.1879_1893del], [p.(E271K), p.(R627_E631del)]" "heterozygous" "Germline" "yes" "" "0" "" "" "g.663146_663160del" "" "likely pathogenic" ""
"0000833023" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833024" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833025" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833026" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833027" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833028" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833029" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833030" "3" "70" "4" "657550" "657550" "subst" "0" "00000" "PDE6B_000168" "g.657550C>G" "" "{PMID:Tatour 2019:30820151}" "" "" "homozygous" "Germline" "yes" "" "0" "" "" "g.663761C>G" "" "likely pathogenic" ""
"0000833272" "3" "70" "4" "654402" "654402" "subst" "0" "00000" "PDE6B_000327" "g.654402G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1614G>C, p.(Glu538Asp)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.660613G>C" "" "likely pathogenic" "ACMG"
"0000833273" "0" "90" "4" "619596" "619596" "subst" "4.09786E-6" "00000" "PDE6B_000324" "g.619596G>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.181G>T, p.(Glu61*)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.625807G>T" "" "pathogenic" "ACMG"
"0000833274" "21" "90" "4" "657565" "657607" "delins" "0" "00000" "PDE6B_000007" "g.657565_657607delinsGG" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1927_1969delinsGG, p.(Asn643Glyfs*29)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.663776_663818delinsGG" "" "pathogenic" "ACMG"
"0000833275" "3" "70" "4" "619714" "619714" "subst" "5.70293E-5" "00000" "PDE6B_000010" "g.619714G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.299G>A, p.(Arg100His)" "homozygous; mother - het c.1927_1969delinsG G, p.(Asn643Glyfs*29)" "Germline" "yes" "" "0" "" "" "g.625925G>A" "" "likely pathogenic" "ACMG"
"0000833276" "3" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833277" "3" "70" "4" "659047" "659047" "subst" "0" "00000" "PDE6B_000209" "g.659047G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2197G>C, p.(Ala733Pro)" "homozygous; affected sister and affected nephew also hom with multiple consanguinity" "Germline" "yes" "" "0" "" "" "g.665258G>C" "" "likely pathogenic" "ACMG"
"0000833278" "10" "70" "4" "619824" "619824" "subst" "0" "00000" "PDE6B_000192" "g.619824G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.409G>A, p.(Gly137Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.626035G>A" "" "likely pathogenic" "ACMG"
"0000833279" "3" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.892C>T, p.(Gln298*)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000833280" "0" "90" "4" "619708" "619708" "subst" "0" "00000" "PDE6B_000122" "g.619708G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.293G>C, p.(Arg98Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.625919G>C" "" "pathogenic" "ACMG"
"0000833281" "0" "90" "4" "619708" "619708" "subst" "0" "00000" "PDE6B_000122" "g.619708G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.293G>C, p.(Arg98Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.625919G>C" "" "pathogenic" "ACMG"
"0000833282" "0" "90" "4" "619708" "619708" "subst" "0" "00000" "PDE6B_000122" "g.619708G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.293G>C, p.(Arg98Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.625919G>C" "" "pathogenic" "ACMG"
"0000833283" "3" "90" "4" "654255" "654255" "subst" "0" "00000" "PDE6B_000043" "g.654255G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1468-1G>A, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.660466G>A" "" "pathogenic" "ACMG"
"0000833284" "10" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(Asn643Glyfs*29)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833285" "10" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833286" "11" "90" "4" "650813" "650813" "subst" "4.07312E-6" "00000" "PDE6B_000326" "g.650813G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1257+1G>A, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.657024G>A" "" "pathogenic" "ACMG"
"0000833287" "3" "70" "4" "657926" "657926" "subst" "0" "00000" "PDE6B_000329" "g.657926T>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2045T>C, p.(Ile682Thr)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.664137T>C" "" "likely pathogenic" "ACMG"
"0000833288" "3" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1580T>C, p.(Leu527Pro)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" "ACMG"
"0000833289" "1" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1678C>T , p.(Arg560Cys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "pathogenic" "ACMG"
"0000833290" "1" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1678C>T , p.(Arg560Cys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "pathogenic" "ACMG"
"0000833291" "3" "90" "4" "650813" "650813" "subst" "4.07312E-6" "00000" "PDE6B_000326" "g.650813G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1257+1G>A, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.657024G>A" "" "pathogenic" "ACMG"
"0000833292" "3" "90" "4" "650813" "650813" "subst" "4.07312E-6" "00000" "PDE6B_000326" "g.650813G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1257+1G>A, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.657024G>A" "" "pathogenic" "ACMG"
"0000833293" "11" "90" "4" "619547" "619547" "subst" "0" "00000" "PDE6B_000323" "g.619547C>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.132C>A, p.(Cys44*)" "heterozygous, father heterozygous c.132C>A, p.(Cys44*) mother heterozygous c.1614G>C, p.(Glu538Asp)" "Germline" "yes" "" "0" "" "" "g.625758C>A" "" "pathogenic" "ACMG"
"0000833294" "1" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833295" "1" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833296" "1" "90" "4" "647726" "647727" "ins" "0" "00000" "PDE6B_000325" "g.647726_647727insGGTACTT" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.797_798insGGTACTT, p.(Tyr267Valfs* 24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.653937_653938insGGTACTT" "" "pathogenic" "ACMG"
"0000833297" "2" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833298" "21" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous, mother - heterozygous c.1107+3A>G" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833299" "3" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "homozygous, unaffected brother - reference" "Germline" "yes" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833300" "1" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1678C>T, p.(Arg560Cys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "pathogenic" "ACMG"
"0000833301" "1" "90" "4" "655986" "655986" "subst" "0" "00000" "PDE6B_000185" "g.655986C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1678C>T, p.(Arg560Cys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662197C>T" "" "pathogenic" "ACMG"
"0000833302" "3" "70" "4" "658692" "658692" "subst" "3.65559E-5" "00000" "PDE6B_000330" "g.658692G>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2152G>T, p.(Asp718Tyr)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.664903G>T" "" "likely pathogenic" "ACMG"
"0000833303" "3" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833304" "21" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2193+1G>A, p.(?)" "heterozygous, mother – heterozygous c.2193+1G>A Father - heterozygous c.2215G>A, p.(Glu739Ly" "Germline" "yes" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000833305" "21" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2193+1G>A, p.(?)" "heterozygous, mother – heterozygous c.2193+1G>A Father - heterozygous c.2215G>A, p.(Glu739Ly" "Germline" "yes" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000833306" "3" "70" "4" "619824" "619824" "subst" "0" "00000" "PDE6B_000192" "g.619824G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.409G>A, p.(Gly137Arg)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.626035G>A" "" "likely pathogenic" "ACMG"
"0000833307" "1" "70" "4" "619728" "619728" "subst" "0" "00000" "PDE6B_000191" "g.619728G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.313G>A, p.(Glu105Lys)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.625939G>A" "" "likely pathogenic" "ACMG"
"0000833308" "3" "90" "4" "657565" "657607" "delins" "0" "00000" "PDE6B_000007" "g.657565_657607delinsGG" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1927_1969delinsGG, p.(Asn643Glyfs *29)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.663776_663818delinsGG" "" "pathogenic" "ACMG"
"0000833323" "0" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1133G>A, p.(Trp378*)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.656899G>A" "" "pathogenic" "ACMG"
"0000833324" "11" "90" "4" "663896" "663896" "subst" "0" "00000" "PDE6B_000333" "g.663896A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2565A>G, p.(*855Trpext*30)" "heterozygous; father het c.2565A>G, p.(*855Trpext*3" "Germline" "yes" "" "0" "" "" "g.670107A>G" "" "pathogenic" "ACMG"
"0000833325" "21" "90" "4" "647908" "647908" "subst" "3.65922E-5" "00000" "PDE6B_000015" "g.647908C>T" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.892C>T, p.(Gln298*)" "heterozygous; unaffected brother, sister and mother - het c.892C>T p.(Gln298*)" "Germline" "yes" "" "0" "" "" "g.654119C>T" "" "pathogenic" "ACMG"
"0000833326" "0" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833327" "0" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833328" "0" "90" "4" "649746" "649746" "subst" "0" "00000" "PDE6B_000193" "g.649746A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1010A>G, p.(His337Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.655957A>G" "" "pathogenic" "ACMG"
"0000833329" "1" "90" "4" "657561" "657607" "delins" "0" "00000" "PDE6B_000060" "g.657561_657607delinsTCTGGG" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1923_1969delinsTCTGGG, p.(Asn643Glyfs*29)" "homozygous; Unaffected sister het c.1923_1969delinsTC TGGG p.(Asn643Glyfs*2" "Germline" "yes" "" "0" "" "" "g.663772_663818delinsTCTGGG" "" "pathogenic" "ACMG"
"0000833330" "21" "90" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1655G>A, p.(Arg552Gln)" "heterozygous; mother and one unaffected sisters- het c.1655G>A p.(Arg552Gln" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "pathogenic" "ACMG"
"0000833331" "21" "90" "4" "655963" "655963" "subst" "0" "00000" "PDE6B_000022" "g.655963G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1655G>A, p.(Arg552Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662174G>A" "" "pathogenic" "ACMG"
"0000833332" "21" "90" "4" "658734" "658734" "subst" "6.50037E-5" "00000" "PDE6B_000063" "g.658734G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2193+1G>A, p.(?)" "heterozygous; Father het c.1257+1G>A mother het c.2193+1G>A" "Germline" "yes" "" "0" "" "" "g.664945G>A" "" "pathogenic" "ACMG"
"0000833333" "3" "70" "4" "654368" "654368" "subst" "6.50682E-5" "00000" "PDE6B_000184" "g.654368T>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1580T>C, p.(Leu527Pro)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.660579T>C" "" "likely pathogenic" "ACMG"
"0000833335" "2" "90" "4" "656301" "656301" "subst" "4.06716E-6" "00000" "PDE6B_000187" "g.656301G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1726G>A , p.(Gly576Ser)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662512G>A" "" "pathogenic" "ACMG"
"0000833336" "2" "90" "4" "656301" "656301" "subst" "4.06716E-6" "00000" "PDE6B_000187" "g.656301G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1726G>A , p.(Gly576Ser)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662512G>A" "" "pathogenic" "ACMG"
"0000833337" "21" "70" "4" "654402" "654402" "subst" "0" "00000" "PDE6B_000327" "g.654402G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1614G>C, p.(Glu538Asp)" "heterozygous, father heterozygous c.132C>A, p.(Cys44*) mother heterozygous c.1614G>C, p.(Glu538Asp)" "Germline" "yes" "" "0" "" "" "g.660613G>C" "" "likely pathogenic" "ACMG"
"0000833338" "2" "90" "4" "661679" "661679" "subst" "2.03155E-5" "00000" "PDE6B_000332" "g.661679T>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2387T>C, p.(Met796Thr)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.667890T>C" "" "pathogenic" "ACMG"
"0000833339" "2" "90" "4" "661679" "661679" "subst" "2.03155E-5" "00000" "PDE6B_000332" "g.661679T>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2387T>C, p.(Met796Thr)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.667890T>C" "" "pathogenic" "ACMG"
"0000833340" "2" "90" "4" "650084" "650084" "subst" "3.65559E-5" "00000" "PDE6B_000003" "g.650084A>G" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1107+3A>G, p.(?)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.656295A>G" "" "pathogenic" "ACMG"
"0000833341" "1" "90" "4" "647726" "647727" "ins" "0" "00000" "PDE6B_000325" "g.647726_647727insGGTACTT" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.797_798insGGTACTT, p.(Tyr267Valfs* 24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.653937_653938insGGTACTT" "" "pathogenic" "ACMG"
"0000833342" "10" "70" "4" "654402" "654402" "subst" "0" "00000" "PDE6B_000327" "g.654402G>C" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1614G>C, p.(Glu538Asp)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.660613G>C" "" "likely pathogenic" "ACMG"
"0000833343" "2" "90" "4" "656301" "656301" "subst" "4.06716E-6" "00000" "PDE6B_000187" "g.656301G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1726G>A, p.(Gly576Ser)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662512G>A" "" "pathogenic" "ACMG"
"0000833344" "2" "90" "4" "656301" "656301" "subst" "4.06716E-6" "00000" "PDE6B_000187" "g.656301G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1726G>A, p.(Gly576Ser)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.662512G>A" "" "pathogenic" "ACMG"
"0000833345" "11" "90" "4" "659065" "659065" "subst" "4.06517E-6" "00000" "PDE6B_000331" "g.659065G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2215G>A, p.(Glu739Lys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.665276G>A" "" "pathogenic" "ACMG"
"0000833346" "11" "90" "4" "659065" "659065" "subst" "4.06517E-6" "00000" "PDE6B_000331" "g.659065G>A" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.2215G>A, p.(Glu739Lys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.665276G>A" "" "pathogenic" "ACMG"
"0000833347" "2" "90" "4" "656308" "656309" "delins" "0" "00000" "PDE6B_000328" "g.656308_656309delinsC" "" "{PMID:Khateb 2019:30998820}" "" "PDE6B c.1733_1734delinsC, p.(Leu578Profs* 14)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.662519_662520delinsC" "" "pathogenic" "ACMG"
"0000840244" "0" "30" "4" "652751" "652751" "subst" "0.000248244" "00000" "PDE6B_000041" "g.652751C>T" "" "{PMID:Men-2017:29062221}" "" "c.1412C>T" "" "Germline" "" "rs182071364" "0" "" "" "" "" "likely benign" ""
"0000846461" "0" "70" "14" "656373" "656373" "subst" "0" "00000" "PDE6B_000058" "g.656373G>A" "" "{PMID:Chebil 2016:26868535}" "" "PDE6B c.1798G>A, D600N" "homozygous" "Unknown" "?" "" "0" "" "" "g.662584G>A" "" "likely pathogenic" ""
"0000859562" "0" "30" "4" "648604" "648625" "dup" "0" "02330" "PDE6B_000023" "g.648604_648625dup" "" "" "" "PDE6B(NM_000283.4):c.928-18_928-17insTGTCTTCTGCTTCTCAGGAAAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000859563" "0" "30" "4" "650658" "650658" "subst" "6.128E-5" "01943" "PDE6B_000334" "g.650658C>T" "" "" "" "PDE6B(NM_000283.3):c.1108-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000859564" "0" "70" "4" "652740" "652740" "subst" "4.07027E-6" "02330" "PDE6B_000335" "g.652740G>C" "" "" "" "PDE6B(NM_000283.4):c.1402-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000859566" "0" "30" "4" "661663" "661663" "subst" "0.000349508" "01943" "ATP5I_000003" "g.661663G>A" "" "" "" "PDE6B(NM_000283.3):c.2371G>A (p.E791K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000869967" "3" "50" "4" "619754" "619768" "del" "0" "04333" "PDE6B_000336" "g.619754_619768del" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "" "" "0" "" "" "g.625965_625979del" "" "VUS" ""
"0000869968" "3" "70" "4" "619754" "619768" "del" "0" "04333" "PDE6B_000336" "g.619754_619768del" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "" "" "0" "" "" "g.625965_625979del" "" "VUS" ""
"0000871513" "3" "90" "4" "656350" "656350" "subst" "0" "04345" "PDE6B_000337" "g.656350C>T" "" "" "" "938C>T (Thr313Ile)" "" "Germline" "yes" "" "0" "" "" "g.662561C>T" "" "pathogenic (recessive)" ""
"0000886358" "0" "70" "4" "650661" "650661" "subst" "0" "02330" "PDE6B_000338" "g.650661A>G" "" "" "" "PDE6B(NM_000283.4):c.1108-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000886359" "0" "30" "4" "651288" "651288" "subst" "0.00146971" "02330" "PDE6B_000158" "g.651288G>A" "" "" "" "PDE6B(NM_000283.3):c.1401+5G>A, PDE6B(NM_000283.4):c.1401+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000886361" "0" "90" "4" "654397" "654397" "subst" "0" "02327" "PDE6B_000339" "g.654397C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000886362" "0" "70" "4" "656373" "656373" "subst" "5.69073E-5" "02329" "PDE6B_000058" "g.656373G>A" "" "" "" "PDE6B(NM_000283.4):c.1798G>A (p.D600N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000896675" "0" "90" "4" "650688" "650688" "subst" "2.44551E-5" "00000" "PDE6B_000228" "g.650688G>A" "Taiwan Biobank: 0.00066; GnomAD_exome_East: 0.000327; GnomAD_All: 0.000024" "{PMID:Chen 2021:33608557}" "" "PDE6B c.385G>A(;)1133G>A; p.(Trp378Ter)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.656899G>A" "" "pathogenic" ""
"0000896676" "0" "70" "4" "619800" "619800" "subst" "0" "00000" "PDE6B_000201" "g.619800G>A" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0.0000143" "{PMID:Chen 2021:33608557}" "" "PDE6B c.385G>A(;)1133G>A; p.(Glu129Lys)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.626011G>A" "" "likely pathogenic" ""
"0000912132" "0" "50" "4" "656334" "656334" "subst" "0" "02327" "PDE6B_000342" "g.656334G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000915797" "3" "70" "4" "656373" "656373" "subst" "5.69073E-5" "04436" "PDE6B_000058" "g.656373G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1798G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000915817" "3" "50" "4" "649755" "649755" "subst" "0" "04436" "PDE6B_000340" "g.649755T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.1019T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915821" "3" "50" "4" "656974" "656974" "subst" "4.06438E-5" "04436" "PDE6B_000345" "g.656974G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1918G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915824" "3" "70" "4" "647730" "647730" "subst" "3.25111E-5" "04436" "PDE6B_000014" "g.647730C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.801C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000915847" "3" "50" "4" "656974" "656974" "subst" "4.06438E-5" "04436" "PDE6B_000345" "g.656974G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1918G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915856" "1" "50" "4" "656974" "656974" "subst" "4.06438E-5" "04436" "PDE6B_000345" "g.656974G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1918G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915857" "2" "90" "4" "658734" "658734" "subst" "6.50037E-5" "04436" "PDE6B_000063" "g.658734G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2193+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000915894" "3" "70" "4" "647715" "647715" "subst" "0" "04436" "PDE6B_000086" "g.647715C>G" "" "{PMID:Panneman 2023:36819107}" "" "c.786C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000915971" "3" "90" "4" "648678" "648678" "subst" "8.12565E-6" "04436" "PDE6B_000219" "g.648678G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.992+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000915980" "3" "50" "4" "649746" "649746" "subst" "0" "04436" "PDE6B_000193" "g.649746A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1010A>G" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915987" "3" "70" "4" "658719" "658719" "del" "0" "04436" "PDE6B_000346" "g.658719del" "" "{PMID:Panneman 2023:36819107}" "" "c.2179del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916077" "3" "90" "4" "656978" "656978" "subst" "8.13061E-6" "04436" "PDE6B_000006" "g.656978T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.1920+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916080" "3" "70" "4" "656373" "656373" "subst" "5.69073E-5" "04436" "PDE6B_000058" "g.656373G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1798G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916102" "1" "90" "4" "650084" "650084" "subst" "3.65559E-5" "04436" "PDE6B_000003" "g.650084A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1107+3A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916103" "2" "70" "4" "658692" "658692" "subst" "1.62471E-5" "04436" "PDE6B_000045" "g.658692G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2152G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916128" "3" "70" "4" "655963" "655963" "subst" "0" "04436" "PDE6B_000022" "g.655963G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1655G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916286" "3" "70" "4" "661797" "661797" "subst" "4.09021E-6" "04436" "PDE6B_000065" "g.661797T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.2503+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916305" "1" "90" "4" "647908" "647908" "subst" "3.65922E-5" "04436" "PDE6B_000015" "g.647908C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.892C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916306" "2" "70" "4" "651255" "651255" "del" "0" "04436" "PDE6B_000341" "g.651255del" "" "{PMID:Panneman 2023:36819107}" "" "c.1373del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916313" "3" "90" "4" "650084" "650084" "subst" "3.65559E-5" "04436" "PDE6B_000003" "g.650084A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1107+3A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916319" "1" "70" "4" "656336" "656348" "del" "0" "04436" "PDE6B_000343" "g.656336_656348del" "" "{PMID:Panneman 2023:36819107}" "" "c.1761_1773del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916320" "2" "50" "4" "656916" "656916" "subst" "4.06167E-6" "04436" "PDE6B_000344" "g.656916C>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1860C>G" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916439" "3" "90" "4" "661693" "661693" "subst" "2.03181E-5" "04436" "PDE6B_000223" "g.661693C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2401C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916487" "1" "70" "4" "651255" "651255" "del" "0" "04436" "PDE6B_000341" "g.651255del" "" "{PMID:Panneman 2023:36819107}" "" "c.1373del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916488" "2" "70" "4" "656020" "656020" "subst" "0" "04436" "PDE6B_000205" "g.656020C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1712C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916697" "3" "70" "4" "658692" "658692" "subst" "1.62471E-5" "04436" "PDE6B_000045" "g.658692G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2152G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916748" "3" "90" "4" "658734" "658734" "subst" "6.50037E-5" "04436" "PDE6B_000063" "g.658734G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2193+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916759" "1" "50" "4" "654341" "654341" "subst" "1.22001E-5" "04436" "PDE6B_000189" "g.654341A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1553A>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916760" "2" "70" "4" "658692" "658692" "subst" "3.65559E-5" "04436" "PDE6B_000330" "g.658692G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2152G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000924143" "0" "90" "4" "654368" "654368" "subst" "6.50682E-5" "02327" "PDE6B_000184" "g.654368T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000924144" "0" "50" "4" "657629" "657629" "subst" "0" "02327" "PDE6B_000347" "g.657629T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000928928" "0" "90" "4" "647766" "647766" "del" "0" "02330" "PDE6B_000051" "g.647766del" "" "" "" "PDE6B(NM_000283.3):c.837delC (p.D279Efs*2), PDE6B(NM_000283.4):c.837delC (p.D279Efs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000948342" "0" "50" "4" "629751" "629751" "subst" "5.28198E-5" "02327" "PDE6B_000261" "g.629751G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000948354" "0" "10" "4" "651287" "651287" "subst" "9.00724E-5" "02327" "PDE6B_000005" "g.651287C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000948355" "0" "10" "4" "651290" "651291" "ins" "7.38674E-5" "02327" "PDE6B_000348" "g.651290_651291insA" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000948356" "0" "30" "4" "651299" "651299" "subst" "0.000119105" "02327" "PDE6B_000349" "g.651299A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000948357" "0" "50" "4" "655987" "655987" "subst" "0" "02327" "PDE6B_000167" "g.655987G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000948364" "0" "30" "4" "663843" "663843" "subst" "1.62607E-5" "02327" "ATP5I_000004" "g.663843G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000958045" "0" "90" "4" "650033" "650033" "subst" "0" "00006" "PDE6B_000220" "g.650033G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.656244G>T" "" "pathogenic (recessive)" "ACMG"
"0000958063" "0" "70" "4" "651285" "651285" "subst" "0" "00006" "PDE6B_000292" "g.651285T>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5" "Germline" "" "" "0" "" "" "g.657496T>G" "" "likely pathogenic (recessive)" "ACMG"
"0000958379" "3" "70" "4" "647668" "647668" "subst" "1.21981E-5" "00006" "PDE6B_000180" "g.647668T>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.653879T>A" "349362" "likely pathogenic (recessive)" "ACMG"
"0000958451" "0" "70" "4" "656020" "656020" "subst" "0" "00006" "PDE6B_000205" "g.656020C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM1_SUPPORTING, PP5_STRONG" "Germline" "" "" "0" "" "" "g.662231C>T" "" "likely pathogenic (recessive)" "ACMG"
"0000958546" "0" "50" "4" "649763" "649763" "subst" "1.22063E-5" "00006" "PDE6B_000352" "g.649763G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.655974G>A" "" "VUS" "ACMG"
"0000958549" "0" "50" "4" "628548" "628548" "subst" "0" "00006" "PDE6B_000350" "g.628548A>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.634759A>G" "" "VUS" "ACMG"
"0000958856" "3" "50" "4" "628579" "628579" "subst" "0" "00006" "PDE6B_000351" "g.628579C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.634790C>G" "" "VUS" "ACMG"
"0000959070" "0" "50" "4" "619588" "619588" "subst" "4.91485E-5" "00006" "PDE6B_000217" "g.619588C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, BP4; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.625799C>T" "" "VUS" "ACMG"
"0000959470" "11" "90" "4" "654254" "654254" "subst" "4.07123E-6" "00006" "PDE6B_000353" "g.654254A>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PVS1, PM2, PP5; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.660465A>G" "450087" "pathogenic (recessive)" "ACMG"
"0000963205" "0" "70" "4" "619800" "619800" "subst" "0" "02327" "PDE6B_000201" "g.619800G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000976338" "0" "50" "4" "649777" "649777" "subst" "1.22072E-5" "01804" "PDE6B_000038" "g.649777C>T" "" "" "" "PDE6B(NM_000283.4):c.1041C>T (p.Y347=, p.(Tyr347=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000994408" "0" "50" "4" "660377" "660377" "subst" "5.28275E-5" "01804" "PDE6B_000008" "g.660377G>A" "" "" "" "PDE6B(NM_000283.3):c.2326G>A (p.D776N, p.(Asp776Asn)), PDE6B(NM_000283.4):c.2326G>A (p.D776N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001013982" "0" "50" "4" "651252" "651252" "subst" "8.13617E-6" "02330" "PDE6B_000156" "g.651252A>G" "" "" "" "PDE6B(NM_000283.4):c.1370A>G (p.K457R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001013983" "0" "90" "4" "656916" "656916" "del" "5.28009E-5" "02330" "PDE6B_000146" "g.656916del" "" "" "" "PDE6B(NM_000283.3):c.1860delC (p.H620Qfs*23), PDE6B(NM_000283.4):c.1860delC (p.H620Qfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0001022295" "1" "90" "4" "656916" "656916" "del" "5.28009E-5" "00006" "PDE6B_000146" "g.656916del" "" "{PMID:Midgley 2024:39676705}" "" "1860delC" "" "Germline" "" "rs769671323" "0" "" "" "g.663127del" "" "pathogenic" ""
"0001022346" "2" "70" "4" "656935" "656935" "subst" "4.06184E-5" "00006" "PDE6B_000161" "g.656935C>G" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs371911345" "0" "" "" "g.663146C>G" "" "likely pathogenic" ""
"0001034629" "0" "50" "4" "619708" "619708" "subst" "0" "01804" "PDE6B_000265" "g.619708G>A" "" "" "" "PDE6B(NM_000283.4):c.293G>A (p.(Arg98His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001034641" "0" "50" "4" "647941" "647941" "subst" "8.14458E-6" "02325" "PDE6B_000354" "g.647941C>T" "" "" "" "PDE6B(NM_000283.4):c.925C>T (p.R309W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001034642" "0" "50" "4" "650046" "650046" "subst" "0" "02325" "PDE6B_000355" "g.650046A>G" "" "" "" "PDE6B(NM_000283.4):c.1072A>G (p.M358V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001034645" "0" "50" "4" "661679" "661679" "subst" "2.03155E-5" "01804" "PDE6B_000332" "g.661679T>C" "" "" "" "PDE6B(NM_000283.4):c.2387T>C (p.(Met796Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001045969" "0" "50" "4" "647723" "647723" "subst" "0.00109309" "02325" "PDE6B_000034" "g.647723G>A" "" "" "" "PDE6B(NM_000283.3):c.794G>A (p.R265Q), PDE6B(NM_000283.4):c.794G>A (p.R265Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001051628" "0" "30" "4" "660314" "660314" "subst" "0" "01804" "PDE6B_000356" "g.660314C>T" "" "" "" "PDE6B(NM_000283.4):c.2269-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001059922" "3" "50" "4" "658733" "658733" "subst" "0" "00006" "PDE6B_000357" "g.658733G>A" "" "{PMID:Lecca 2024:38840272}" "" "" "ACMG PM2_P, PP3_S" "Germline" "" "" "0" "" "" "g.664944G>A" "" "VUS" "ACMG"
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes PDE6B
## Count = 835
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000019516" "00015884" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Gln413*)" "9"
"0000019517" "00015884" "70" "2399" "0" "2399" "0" "c.2399T>C" "r.(?)" "p.(Leu800Pro)" "21"
"0000060124" "00015884" "90" "1043" "0" "1044" "0" "c.1043_1044insCG" "r.(?)" "p.(Ala349Glyfs*11)" "7"
"0000060125" "00015884" "50" "1060" "-13" "1060" "-13" "c.1060-13G>A" "r.(spl?)" "p.(?)" "6i"
"0000060126" "00015884" "50" "1060" "-13" "1060" "-13" "c.1060-13G>A" "r.(spl?)" "p.(?)" "6i"
"0000060127" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.(spl?)" "p.(?)" "8i"
"0000060128" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.(spl?)" "p.(?)" "8i"
"0000060129" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.(spl?)" "p.(?)" "8i"
"0000060130" "00015884" "50" "1401" "4" "1401" "16" "c.1401+4_1401+16delinsTGGCAGGGGCAGGT" "r.(spl?)" "p.(?)" "10i"
"0000060131" "00015884" "50" "1401" "4" "1401" "4" "c.1401+4C>T" "r.(spl?)" "p.(?)" "10i"
"0000060132" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.(spl?)" "p.(?)" "15i"
"0000060133" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.(spl?)" "p.(?)" "15i"
"0000060134" "00015884" "90" "1927" "0" "1969" "0" "c.1927_1969delinsGG" "r.(?)" "p.(Asn643Glyfs*29)" "16"
"0000060135" "00015884" "70" "1927" "0" "1969" "0" "c.1927_1969delinsGG" "r.(?)" "p.(Asn643Glyfs*29)" "16"
"0000060136" "00015884" "90" "1927" "0" "1969" "0" "c.1927_1969delinsGG" "r.(?)" "p.(Asn643Glyfs*29)" "16"
"0000060137" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" "20"
"0000060138" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" "20"
"0000060139" "00015884" "70" "2503" "5" "2503" "5" "c.2503+5G>C" "r.(spl?)" "p.?" "21i"
"0000060140" "00015884" "90" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" "1"
"0000060141" "00015884" "70" "3" "0" "3" "0" "c.3G>T" "r.(?)" "p.(M1?)" "1"
"0000060142" "00015884" "10" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Glu166Lys)" "2"
"0000060143" "00015884" "10" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" "3"
"0000060144" "00015884" "10" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" "3"
"0000060145" "00015884" "10" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" "3"
"0000060146" "00015884" "10" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" "3"
"0000060147" "00015884" "70" "801" "0" "801" "0" "c.801C>A" "r.(?)" "p.(Tyr267*)" "4"
"0000060148" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" "5"
"0000060149" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" "5"
"0000060150" "00015884" "70" "1189" "0" "1189" "0" "c.1189G>A" "r.(?)" "p.(Gly397Arg)" "9"
"0000060151" "00015884" "70" "1859" "0" "1859" "0" "c.1859A>G" "r.(?)" "p.(His620Arg)" "15"
"0000079605" "00015884" "00" "-547864" "0" "2714306" "0" "c.-547864_*2711741del" "r.0?" "p.0?" ""
"0000082500" "00015884" "50" "1317" "0" "1317" "0" "c.1317C>G" "r.(?)" "p.(Asn439Lys)" ""
"0000162795" "00015884" "90" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" "13"
"0000162802" "00015884" "90" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" "9"
"0000162803" "00015884" "90" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" "9"
"0000170966" "00015884" "70" "928" "-9" "940" "0" "c.928-9_940dup" "r.spl?" "p.?" "5i"
"0000246279" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.?" ""
"0000249054" "00015884" "10" "2577" "0" "2577" "0" "c.*12A>G" "r.(=)" "p.(=)" ""
"0000293603" "00015884" "10" "1041" "0" "1041" "0" "c.1041C>T" "r.(?)" "p.(Tyr347=)" ""
"0000293604" "00015884" "10" "1060" "-13" "1060" "-13" "c.1060-13G>A" "r.(=)" "p.(=)" ""
"0000293605" "00015884" "50" "1195" "0" "1195" "0" "c.1195G>A" "r.(?)" "p.(Ala399Thr)" ""
"0000293606" "00015884" "10" "132" "0" "132" "0" "c.132C>G" "r.(?)" "p.(Cys44Trp)" ""
"0000293607" "00015884" "10" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.spl?" "p.?" ""
"0000293608" "00015884" "30" "1412" "0" "1412" "0" "c.1412C>T" "r.(?)" "p.(Ala471Val)" ""
"0000293609" "00015884" "50" "1426" "0" "1426" "0" "c.1426G>A" "r.(?)" "p.(Glu476Lys)" ""
"0000293610" "00015884" "70" "1468" "-1" "1468" "-1" "c.1468-1G>A" "r.spl?" "p.?" ""
"0000293612" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.spl?" "p.?" ""
"0000293613" "00015884" "70" "2152" "0" "2152" "0" "c.2152G>A" "r.(?)" "p.(Asp718Asn)" ""
"0000293615" "00015884" "90" "2493" "0" "2503" "7" "c.2493_2503+7del" "r.spl?" "p.?" ""
"0000293616" "00015884" "10" "270" "0" "270" "0" "c.270C>T" "r.(?)" "p.(Asp90=)" ""
"0000293617" "00015884" "10" "615" "0" "615" "0" "c.615C>T" "r.(?)" "p.(Asp205=)" ""
"0000293618" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0000293619" "00015884" "10" "873" "0" "873" "0" "c.873T>C" "r.(?)" "p.(Ser291=)" ""
"0000293620" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298Ter)" ""
"0000293621" "00015884" "30" "993" "-17" "993" "-17" "c.993-17C>T" "r.(=)" "p.(=)" ""
"0000296850" "00015884" "10" "958" "0" "958" "0" "c.958=" "r.(=)" "p.(Ile320=)" ""
"0000305345" "00015884" "30" "1083" "0" "1083" "0" "c.1083C>T" "r.(?)" "p.(Ser361=)" ""
"0000305347" "00015884" "90" "122" "0" "122" "0" "c.122C>G" "r.(?)" "p.(Pro41Arg)" ""
"0000305349" "00015884" "50" "1253" "0" "1253" "0" "c.1253T>C" "r.(?)" "p.(Met418Thr)" ""
"0000305350" "00015884" "50" "1317" "0" "1317" "0" "c.1317C>G" "r.(?)" "p.(Asn439Lys)" ""
"0000305351" "00015884" "10" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.spl?" "p.?" ""
"0000305352" "00015884" "30" "1414" "0" "1414" "0" "c.1414C>T" "r.(?)" "p.(Arg472Cys)" ""
"0000305353" "00015884" "90" "2269" "-1" "2269" "-1" "c.2269-1G>T" "r.spl?" "p.?" ""
"0000305354" "00015884" "50" "245" "0" "245" "0" "c.245G>A" "r.(?)" "p.(Arg82His)" ""
"0000305355" "00015884" "30" "2476" "0" "2476" "0" "c.2476G>A" "r.(?)" "p.(Glu826Lys)" ""
"0000305356" "00015884" "70" "2503" "5" "2503" "5" "c.2503+5G>C" "r.spl?" "p.?" ""
"0000305357" "00015884" "30" "2526" "0" "2526" "0" "c.2526C>T" "r.(?)" "p.(Gly842=)" ""
"0000305358" "00015884" "10" "270" "0" "270" "0" "c.270C>T" "r.(?)" "p.(Asp90=)" ""
"0000305359" "00015884" "30" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Glu166Lys)" ""
"0000305360" "00015884" "30" "582" "0" "582" "0" "c.582C>T" "r.(?)" "p.(Asn194=)" ""
"0000305361" "00015884" "30" "615" "0" "615" "0" "c.615C>T" "r.(?)" "p.(Asp205=)" ""
"0000305362" "00015884" "30" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" ""
"0000305363" "00015884" "30" "711" "10" "711" "10" "c.711+10C>T" "r.(=)" "p.(=)" ""
"0000305364" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0000329777" "00015884" "50" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.spl?" "p.?" ""
"0000329778" "00015884" "50" "1450" "0" "1450" "0" "c.1450G>A" "r.(?)" "p.(Glu484Lys)" ""
"0000338585" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" ""
"0000338592" "00015884" "70" "2503" "2" "2503" "2" "c.2503+2T>C" "r.spl?" "p.?" ""
"0000338596" "00015884" "10" "2577" "0" "2577" "0" "c.*12A>G" "r.(=)" "p.(=)" ""
"0000341659" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000342474" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0000343363" "00015884" "50" "2363" "0" "2363" "0" "c.2363G>A" "r.(?)" "p.(Arg788His)" ""
"0000344038" "00015884" "90" "837" "0" "837" "0" "c.837del" "r.(?)" "p.(Asp279GlufsTer2)" ""
"0000344096" "00015884" "50" "1297" "0" "1297" "0" "c.1297G>A" "r.(?)" "p.(Asp433Asn)" ""
"0000344148" "00015884" "50" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000344188" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000344338" "00015884" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270Ter)" ""
"0000344744" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298Ter)" ""
"0000347464" "00015884" "90" "583" "0" "583" "0" "c.583A>T" "r.(?)" "p.(Lys195Ter)" ""
"0000349235" "00015884" "30" "2021" "12" "2021" "12" "c.2021+12C>A" "r.(=)" "p.(=)" ""
"0000351322" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.?" ""
"0000351323" "00015884" "50" "1108" "-3" "1108" "-3" "c.1108-3C>A" "r.spl?" "p.?" ""
"0000351327" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.spl?" "p.?" ""
"0000351328" "00015884" "50" "2129" "5" "2129" "5" "c.2129+5G>A" "r.spl?" "p.?" ""
"0000358308" "00015884" "90" "428" "0" "428" "0" "c.428C>A" "r.(?)" "p.(Ala143Asp)" "1"
"0000476288" "00015884" "10" "133" "0" "133" "0" "c.133G>A" "r.(?)" "p.(Asp45Asn)" ""
"0000476289" "00015884" "10" "145" "0" "145" "0" "c.145G>T" "r.(?)" "p.(Asp49Tyr)" ""
"0000476290" "00015884" "50" "221" "0" "221" "0" "c.221G>T" "r.(?)" "p.(Arg74Leu)" ""
"0000476291" "00015884" "50" "245" "0" "245" "0" "c.245G>A" "r.(?)" "p.(Arg82His)" ""
"0000476292" "00015884" "50" "307" "0" "307" "0" "c.307G>A" "r.(?)" "p.(Val103Met)" ""
"0000476293" "00015884" "50" "379" "0" "379" "0" "c.379G>A" "r.(?)" "p.(Asp127Asn)" ""
"0000476294" "00015884" "50" "454" "0" "454" "0" "c.454G>C" "r.(?)" "p.(Glu152Gln)" ""
"0000476295" "00015884" "50" "480" "0" "480" "0" "c.480C>G" "r.(?)" "p.(Phe160Leu)" ""
"0000476296" "00015884" "50" "485" "0" "485" "0" "c.485C>T" "r.(?)" "p.(Ser162Leu)" ""
"0000476297" "00015884" "10" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Glu166Lys)" ""
"0000476298" "00015884" "50" "556" "0" "556" "0" "c.556G>A" "r.(?)" "p.(Val186Ile)" ""
"0000476299" "00015884" "50" "592" "0" "592" "0" "c.592G>A" "r.(?)" "p.(Gly198Ser)" ""
"0000476300" "00015884" "50" "650" "0" "650" "0" "c.650C>G" "r.(?)" "p.(Thr217Arg)" ""
"0000476301" "00015884" "50" "785" "0" "785" "0" "c.785A>G" "r.(?)" "p.(Tyr262Cys)" ""
"0000476302" "00015884" "90" "786" "0" "786" "0" "c.786C>G" "r.(?)" "p.(Tyr262*)" ""
"0000476303" "00015884" "90" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Glu271Lys)" ""
"0000476304" "00015884" "50" "815" "0" "815" "0" "c.815G>A" "r.(?)" "p.(Arg272Gln)" ""
"0000476305" "00015884" "50" "967" "0" "967" "0" "c.967G>A" "r.(?)" "p.(Gly323Ser)" ""
"0000476306" "00015884" "50" "1066" "0" "1066" "0" "c.1066A>G" "r.(?)" "p.(Asn356Asp)" ""
"0000476307" "00015884" "50" "1242" "0" "1242" "0" "c.1242C>G" "r.(?)" "p.(Asp414Glu)" ""
"0000476308" "00015884" "50" "1268" "0" "1268" "0" "c.1268A>C" "r.(?)" "p.(Gln423Pro)" ""
"0000476309" "00015884" "50" "1342" "0" "1342" "0" "c.1342G>A" "r.(?)" "p.(Ala448Thr)" ""
"0000476310" "00015884" "50" "1351" "0" "1351" "0" "c.1351A>G" "r.(?)" "p.(Met451Val)" ""
"0000476311" "00015884" "50" "1454" "0" "1454" "0" "c.1454T>C" "r.(?)" "p.(Leu485Pro)" ""
"0000476312" "00015884" "50" "1541" "0" "1541" "0" "c.1541T>C" "r.(?)" "p.(Leu514Pro)" ""
"0000476313" "00015884" "50" "1569" "0" "1569" "0" "c.1569G>T" "r.(?)" "p.(Met523Ile)" ""
"0000476314" "00015884" "90" "1576" "0" "1576" "0" "c.1576G>A" "r.(?)" "p.(Glu526Lys)" ""
"0000476315" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000476316" "00015884" "50" "1606" "0" "1606" "0" "c.1606C>T" "r.(?)" "p.(Pro536Ser)" ""
"0000476317" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000476318" "00015884" "50" "1709" "0" "1709" "0" "c.1709T>C" "r.(?)" "p.(Phe570Ser)" ""
"0000476319" "00015884" "50" "1748" "0" "1748" "0" "c.1748C>T" "r.(?)" "p.(Thr583Met)" ""
"0000476320" "00015884" "50" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000476321" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>G" "r.spl?" "p.?" ""
"0000476322" "00015884" "50" "1945" "0" "1945" "0" "c.1945A>G" "r.(?)" "p.(Asn649Asp)" ""
"0000476323" "00015884" "90" "1954" "0" "1954" "0" "c.1954C>T" "r.(?)" "p.(Gln652*)" ""
"0000476324" "00015884" "90" "2018" "0" "2018" "0" "c.2018dup" "r.(?)" "p.(Lys674Glnfs*12)" ""
"0000476325" "00015884" "10" "2098" "0" "2098" "0" "c.2098T>A" "r.(?)" "p.(Ser700Thr)" ""
"0000476326" "00015884" "50" "2114" "0" "2114" "0" "c.2114G>A" "r.(?)" "p.(Arg705Gln)" ""
"0000476327" "00015884" "50" "2258" "0" "2258" "0" "c.2258A>C" "r.(?)" "p.(Gln753Pro)" ""
"0000476328" "00015884" "10" "2293" "0" "2293" "0" "c.2293G>C" "r.(?)" "p.(Ala765Pro)" ""
"0000476329" "00015884" "50" "2315" "0" "2315" "0" "c.2315T>G" "r.(?)" "p.(Val772Gly)" ""
"0000476330" "00015884" "50" "2363" "0" "2363" "0" "c.2363G>A" "r.(?)" "p.(Arg788His)" ""
"0000476331" "00015884" "50" "2486" "0" "2486" "0" "c.2486G>C" "r.(?)" "p.(Arg829Thr)" ""
"0000476332" "00015884" "50" "2510" "0" "2510" "0" "c.2510C>G" "r.(?)" "p.(Thr837Arg)" ""
"0000477470" "00015884" "10" "145" "0" "145" "0" "c.145G>T" "r.(?)" "p.(Asp49Tyr)" ""
"0000477471" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000477472" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000477473" "00015884" "50" "2363" "0" "2363" "0" "c.2363G>A" "r.(?)" "p.(Arg788His)" ""
"0000500575" "00015884" "90" "772" "0" "772" "0" "c.772C>A" "r.(?)" "p.(His258Asn)" "4"
"0000500576" "00015884" "90" "928" "-9" "940" "0" "c.928-9_940dup" "r.spl" "p.(Tyr314Cysfs*50)" "5i_6"
"0000522782" "00015884" "30" "23" "0" "23" "0" "c.23C>T" "r.(?)" "p.(Ala8Val)" ""
"0000522783" "00015884" "10" "26" "0" "26" "0" "c.26G>A" "r.(?)" "p.(Arg9Gln)" ""
"0000522784" "00015884" "90" "120" "0" "121" "0" "c.120_121insGAGGA" "r.(?)" "p.(Pro41GlufsTer111)" ""
"0000522785" "00015884" "90" "125" "0" "126" "0" "c.125_126insTGCGA" "r.(?)" "p.(Asp43AlafsTer109)" ""
"0000522786" "00015884" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" ""
"0000522787" "00015884" "70" "293" "0" "293" "0" "c.293G>C" "r.(?)" "p.(Arg98Pro)" ""
"0000522788" "00015884" "50" "298" "0" "298" "0" "c.298C>T" "r.(?)" "p.(Arg100Cys)" ""
"0000522789" "00015884" "50" "362" "0" "362" "0" "c.362A>G" "r.(?)" "p.(Asp121Gly)" ""
"0000522977" "00015884" "50" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Thr263Ala)" ""
"0000522978" "00015884" "30" "804" "0" "804" "0" "c.804C>T" "r.(?)" "p.(Leu268=)" ""
"0000522979" "00015884" "90" "837" "0" "837" "0" "c.837del" "r.(?)" "p.(Asp279GlufsTer2)" ""
"0000522980" "00015884" "10" "852" "11" "852" "11" "c.852+11C>T" "r.(=)" "p.(=)" ""
"0000522981" "00015884" "30" "852" "12" "852" "12" "c.852+12G>A" "r.(=)" "p.(=)" ""
"0000522983" "00015884" "70" "927" "1" "927" "1" "c.927+1G>C" "r.spl?" "p.?" ""
"0000522984" "00015884" "90" "1041" "0" "1042" "0" "c.1041_1042dup" "r.(?)" "p.(Val348AlafsTer12)" ""
"0000522985" "00015884" "90" "1041" "0" "1041" "0" "c.1041dup" "r.(?)" "p.(Val348ArgfsTer9)" ""
"0000522986" "00015884" "30" "1059" "9" "1059" "9" "c.1059+9C>G" "r.(=)" "p.(=)" ""
"0000522987" "00015884" "90" "1207" "0" "1208" "0" "c.1207_1208del" "r.(?)" "p.(Asn403GlnfsTer8)" ""
"0000522988" "00015884" "50" "1210" "0" "1210" "0" "c.1210A>G" "r.(?)" "p.(Arg404Gly)" ""
"0000522989" "00015884" "30" "1218" "0" "1218" "0" "c.1218C>T" "r.(?)" "p.(Asp406=)" ""
"0000522990" "00015884" "30" "1257" "19" "1257" "19" "c.1257+19G>A" "r.(=)" "p.(=)" ""
"0000522991" "00015884" "30" "1296" "0" "1296" "0" "c.1296C>T" "r.(?)" "p.(Thr432=)" ""
"0000522998" "00015884" "10" "1467" "18" "1467" "18" "c.1467+18G>A" "r.(=)" "p.(=)" ""
"0000522999" "00015884" "10" "1584" "0" "1584" "0" "c.1584C>T" "r.(?)" "p.(Gly528=)" ""
"0000523000" "00015884" "10" "1590" "0" "1590" "0" "c.1590C>T" "r.(?)" "p.(Val530=)" ""
"0000523001" "00015884" "90" "1643" "0" "1643" "0" "c.1643del" "r.(?)" "p.(Ser548ThrfsTer27)" ""
"0000523002" "00015884" "50" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000523003" "00015884" "10" "1722" "14" "1722" "37" "c.1722+14_1722+37dup" "r.(=)" "p.(=)" ""
"0000523004" "00015884" "30" "1783" "0" "1783" "0" "c.1783C>T" "r.(?)" "p.(Leu595=)" ""
"0000523005" "00015884" "30" "1851" "0" "1851" "0" "c.1851T>C" "r.(?)" "p.(Ala617=)" ""
"0000523006" "00015884" "90" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620GlnfsTer23)" ""
"0000523007" "00015884" "30" "1923" "0" "1923" "0" "c.1923C>T" "r.(?)" "p.(Thr641=)" ""
"0000523008" "00015884" "90" "1927" "0" "1948" "0" "c.1927_1948del" "r.(?)" "p.(Asn643GlyfsTer7)" ""
"0000523009" "00015884" "90" "1951" "0" "1969" "0" "c.1951_1969del" "r.(?)" "p.(Arg651SerfsTer3)" ""
"0000523010" "00015884" "50" "1996" "0" "1996" "0" "c.1996G>A" "r.(?)" "p.(Ala666Thr)" ""
"0000523011" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000523012" "00015884" "50" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000523013" "00015884" "50" "2363" "0" "2363" "0" "c.2363G>A" "r.(?)" "p.(Arg788His)" ""
"0000523014" "00015884" "10" "2427" "0" "2427" "0" "c.2427G>A" "r.(?)" "p.(Ala809=)" ""
"0000523015" "00015884" "50" "2503" "5" "2503" "5" "c.2503+5G>C" "r.spl?" "p.?" ""
"0000609277" "00015884" "10" "1108" "-9" "1108" "-9" "c.1108-9C>T" "r.(=)" "p.(=)" ""
"0000609279" "00015884" "30" "1587" "0" "1587" "0" "c.1587G>A" "r.(?)" "p.(Val529=)" ""
"0000621414" "00015884" "90" "2094" "0" "2094" "0" "c.2094C>G" "r.(?)" "p.(Tyr698Ter)" ""
"0000621415" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" ""
"0000624987" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000624988" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.?" ""
"0000624989" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000651496" "00015884" "30" "145" "0" "145" "0" "c.145G>T" "r.(?)" "p.(Asp49Tyr)" ""
"0000651498" "00015884" "30" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Glu166Lys)" ""
"0000651511" "00015884" "30" "926" "0" "926" "0" "c.926G>A" "r.(?)" "p.(Arg309Gln)" ""
"0000655168" "00015884" "90" "992" "1" "992" "1" "c.992+1del" "r.spl?" "p.?" ""
"0000655169" "00015884" "50" "1370" "0" "1370" "0" "c.1370A>G" "r.(?)" "p.(Lys457Arg)" ""
"0000655170" "00015884" "50" "1384" "0" "1384" "0" "c.1384G>A" "r.(?)" "p.(Glu462Lys)" ""
"0000655171" "00015884" "50" "1401" "5" "1401" "5" "c.1401+5G>A" "r.spl?" "p.?" ""
"0000655174" "00015884" "50" "1790" "0" "1790" "0" "c.1790A>G" "r.(?)" "p.(His597Arg)" ""
"0000664772" "00015884" "90" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000677305" "00015884" "30" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Gly302Asp)" ""
"0000677306" "00015884" "50" "1879" "0" "1879" "0" "c.1879C>G" "r.(?)" "p.(Arg627Gly)" ""
"0000684550" "00015884" "70" "537" "0" "540" "0" "c.537_540del" "r.(?)" "p.(Ile180*)" ""
"0000684551" "00015884" "70" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" ""
"0000684552" "00015884" "70" "1598" "0" "1598" "0" "c.1598T>C" "r.(?)" "p.(Phe533Ser)" ""
"0000684553" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000684637" "00015884" "70" "1679" "0" "1679" "0" "c.1679G>A" "r.(?)" "p.(Arg560His)" ""
"0000684665" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000684666" "00015884" "90" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Trp290*)" ""
"0000684667" "00015884" "70" "1636" "0" "1641" "0" "c.1636_1641del" "r.(?)" "p.(Ile547_Ser548del)" ""
"0000684701" "00015884" "70" "2492" "0" "2492" "0" "c.2492C>T" "r.(?)" "p.(Ala831Val)" ""
"0000684702" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000685348" "00015884" "90" "428" "0" "428" "0" "c.428C>A" "r.(?)" "p.(Ala143Asp)" ""
"0000685349" "00015884" "90" "1417" "0" "1417" "0" "c.1417del" "r.(?)" "p.(Leu473Trpfs*17)" ""
"0000685350" "00015884" "90" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.?" ""
"0000686106" "00015884" "90" "1568" "0" "1568" "0" "c.1568T>G" "r.(?)" "p.(Met523Arg)" ""
"0000689324" "00015884" "50" "998" "0" "998" "0" "c.998C>T" "r.(?)" "p.(Pro333Leu)" ""
"0000689325" "00015884" "50" "1049" "0" "1049" "0" "c.1049A>C" "r.(?)" "p.(Glu350Ala)" ""
"0000689326" "00015884" "30" "1114" "0" "1114" "0" "c.1114G>C" "r.(?)" "p.(Ala372Pro)" ""
"0000689327" "00015884" "30" "1117" "0" "1117" "0" "c.1117C>G" "r.(?)" "p.(Leu373Val)" ""
"0000689328" "00015884" "90" "1123" "0" "1135" "0" "c.1123_1135del" "r.(?)" "p.(Asp375SerfsTer43)" ""
"0000689329" "00015884" "50" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Gly407Arg)" ""
"0000689333" "00015884" "50" "1497" "0" "1497" "0" "c.1497T>G" "r.(?)" "p.(Phe499Leu)" ""
"0000710311" "00015884" "50" "2206" "0" "2206" "0" "c.2206G>A" "r.(?)" "p.(Val736Met)" ""
"0000713303" "00015884" "90" "1483" "0" "1484" "0" "c.1483_1484insG" "r.(?)" "p.(Pro496Alafs*5)" ""
"0000713325" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" ""
"0000713412" "00015884" "90" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000713418" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.?" ""
"0000713488" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000713515" "00015884" "90" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000713525" "00015884" "90" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Phe247Ile)" ""
"0000713679" "00015884" "90" "1" "0" "1" "0" "c.1A>G" "r.?" "p.?" ""
"0000713760" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000713764" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" ""
"0000713805" "00015884" "90" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000713816" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000713824" "00015884" "90" "1547" "0" "1547" "0" "c.1547T>C" "r.(?)" "p.(Leu516Pro)" ""
"0000714065" "00015884" "70" "830" "0" "830" "0" "c.830T>C" "r.(?)" "p.(Leu277Pro)" ""
"0000719970" "00015884" "50" "1042" "0" "1042" "0" "c.1042G>A" "r.(?)" "p.(Val348Met)" ""
"0000719973" "00015884" "50" "2503" "5" "2503" "5" "c.2503+5G>C" "r.spl?" "p.?" ""
"0000729757" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000730219" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000730242" "00015884" "70" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Gly576Ser)" ""
"0000730972" "00015884" "90" "928" "-9" "940" "0" "c.928-9_940dup" "r.spl" "p.(Tyr314Cysfs*50)" ""
"0000731538" "00015884" "90" "1373" "0" "1373" "0" "c.1373G>A" "r.(?)" "p.(Cys458Tyr)" ""
"0000731541" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000731565" "00015884" "90" "1553" "0" "1553" "0" "c.1553A>T" "r.(?)" "p.(Lys518Ile)" ""
"0000731566" "00015884" "90" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000732435" "00015884" "90" "3" "0" "3" "0" "c.3G>T" "r.(?)" "p.(Met1?)" ""
"0000732458" "00015884" "90" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" ""
"0000732512" "00015884" "90" "1653" "0" "1653" "0" "c.1653C>T" "r.(?)" "p.(Tyr551=)" ""
"0000732875" "00015884" "70" "772" "0" "772" "0" "c.772C>A" "r.(?)" "p.(His258Asn)" ""
"0000733086" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000733146" "00015884" "70" "1841" "0" "1841" "0" "c.1841dup" "r.(?)" "p.(Asn614Lysfs*5)" ""
"0000733147" "00015884" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Gly137Arg)" ""
"0000733148" "00015884" "70" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620Glnfs*23)" ""
"0000733210" "00015884" "70" "1466" "0" "1466" "0" "c.1466T>C" "r.(?)" "p.(Leu489Pro)" ""
"0000733211" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000733545" "00015884" "70" "2045" "0" "2045" "0" "c.2045T>A" "r.(?)" "p.(Ile682Asn)" ""
"0000733591" "00015884" "70" "2353" "-18" "2354" "0" "c.2353-18_2354del" "r.spl" "p.?" ""
"0000733592" "00015884" "70" "2140" "0" "2140" "0" "c.2140A>T" "r.(?)" "p.(Met714Leu)" ""
"0000733638" "00015884" "70" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.(Met1?)" ""
"0000733639" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000734417" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" ""
"0000734702" "00015884" "90" "2197" "0" "2197" "0" "c.2197G>C" "r.(?)" "p.(Ala733Pro)" ""
"0000734703" "00015884" "90" "2197" "0" "2197" "0" "c.2197G>C" "r.(?)" "p.(Ala733Pro)" ""
"0000734704" "00015884" "90" "2197" "0" "2197" "0" "c.2197G>C" "r.(?)" "p.(Ala733Pro)" ""
"0000734705" "00015884" "90" "2197" "0" "2197" "0" "c.2197G>C" "r.(?)" "p.(Ala733Pro)" ""
"0000735639" "00015884" "90" "1041" "0" "1042" "0" "c.1041_1042dup" "r.(?)" "p.(Val348Alafs*12)" ""
"0000735640" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000735641" "00015884" "90" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000735642" "00015884" "70" "2407" "0" "2407" "0" "c.2407A>G" "r.(?)" "p.(Asn803Asp)" ""
"0000735643" "00015884" "90" "583" "0" "583" "0" "c.583A>T" "r.(?)" "p.(Lys195*)" ""
"0000735644" "00015884" "90" "837" "0" "837" "0" "c.837del" "r.(?)" "p.(Asp279Glufs*2)" ""
"0000735752" "00015884" "90" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000735753" "00015884" "90" "1923" "0" "1971" "0" "c.1923_1971delinsTCTGGGTA" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000735754" "00015884" "90" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000735755" "00015884" "70" "2407" "0" "2407" "0" "c.2407A>G" "r.(?)" "p.(Asn803Asp)" ""
"0000735756" "00015884" "90" "1107" "2" "1107" "2" "c.1107+2dup" "r.spl?" "p.?" ""
"0000735757" "00015884" "90" "837" "0" "837" "0" "c.837del" "r.(?)" "p.(Asp279Glufs*2)" ""
"0000735826" "00015884" "70" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620GlnfsTer23)" ""
"0000735834" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000735903" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000735904" "00015884" "70" "985" "0" "985" "0" "c.985del" "r.(?)" "p.(Val329SerfsTer30)" ""
"0000735931" "00015884" "70" "754" "0" "754" "0" "c.754G>A" "r.(?)" "p.(Asp252Asn)" ""
"0000735932" "00015884" "70" "263" "0" "263" "0" "c.263A>G" "r.(?)" "p.(Gln88Arg)" ""
"0000736098" "00015884" "70" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Gly407Arg)" ""
"0000736139" "00015884" "70" "1712" "0" "1712" "0" "c.1712C>T" "r.(?)" "p.(Thr571Met)" ""
"0000736177" "00015884" "90" "1954" "0" "1954" "0" "c.1954C>T" "r.(?)" "p.(Gln652*)" ""
"0000736209" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1delG" "r.spl" "p.?" "18"
"0000736210" "00015884" "90" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" "4"
"0000736239" "00015884" "90" "2116" "0" "2116" "0" "c.2116A>T" "r.(?)" "p.(Lys706*)" ""
"0000736258" "00015884" "90" "1108" "-10" "1108" "-10" "c.1108-10G>A" "r.spl" "p.?" "8i"
"0000736806" "00015884" "90" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620GlnfsTer23)" ""
"0000759661" "00015884" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000759672" "00015884" "70" "704" "0" "704" "0" "c.704G>C" "r.(?)" "p.(Arg235Pro)" ""
"0000759941" "00015884" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" ""
"0000759962" "00015884" "90" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Glu271Lys)" ""
"0000760003" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0000760014" "00015884" "50" "1059" "51" "1059" "51" "c.1059+51G>A" "r.spl" "p.?" ""
"0000760102" "00015884" "50" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" ""
"0000760267" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000760478" "00015884" "50" "291" "0" "291" "0" "c.291C>A" "r.(?)" "p.(Tyr97*)" ""
"0000764115" "00015884" "90" "621" "97" "3350" "0" "c.621+97_*785del" "r.622_2562del" "p.(Val208_855del)" "2"
"0000764149" "00015884" "70" "469" "-776" "469" "-776" "c.469-776C>G" "r.?" "p.?" "1i"
"0000764898" "00015884" "70" "1699" "0" "1699" "0" "c.1699C>T" "r.(?)" "p.(Gln567Ter)" ""
"0000765541" "00015884" "90" "173" "0" "173" "0" "c.173C>T" "r.(?)" "p.(Ala58Val)" ""
"0000765548" "00015884" "90" "2116" "0" "2116" "0" "c.2116A>T" "r.(?)" "p.(Lys706*)" ""
"0000765564" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000765565" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000765566" "00015884" "90" "1540" "0" "1540" "0" "c.1540del" "r.(?)" "p.(Leu514Trpfs*61)" ""
"0000765586" "00015884" "90" "2401" "0" "2401" "0" "c.2401C>T" "r.(?)" "p.(Gln801*)" ""
"0000765589" "00015884" "90" "292" "0" "292" "0" "c.292C>T" "r.(?)" "p.(Arg98Cys)" ""
"0000765590" "00015884" "90" "2096" "0" "2100" "0" "c.2096_2100dup" "r.(?)" "p.(Leu701Cysfs*14)" ""
"0000765601" "00015884" "90" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000765602" "00015884" "90" "2116" "0" "2116" "0" "c.2116A>T" "r.(?)" "p.(Lys706*)" ""
"0000765653" "00015884" "90" "1060" "-1" "1060" "-1" "c.1060-1G>T" "r.spl" "p.?" "8i"
"0000765809" "00015884" "70" "992" "1" "992" "1" "c.992+1G>A" "r.spl" "p.?" ""
"0000765921" "00015884" "70" "992" "1" "992" "1" "c.992+1G>A" "r.spl" "p.?" ""
"0000783288" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "8"
"0000783290" "00015884" "70" "832" "0" "832" "0" "c.832C>T" "r.(?)" "p.(His557Tyr)" "8"
"0000783291" "00015884" "70" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Trp290*)" "1"
"0000783294" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" "8"
"0000784211" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378Ter)" ""
"0000784212" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378Ter)" ""
"0000784213" "00015884" "90" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" ""
"0000784214" "00015884" "90" "610" "0" "610" "0" "c.610G>T" "r.(?)" "p.(Glu204Ter)" ""
"0000784348" "00015884" "70" "424" "0" "424" "0" "c.424G>A" "r.(?)" "p.(Val142Met)" ""
"0000784352" "00015884" "70" "786" "0" "786" "0" "c.786C>A" "r.(?)" "p.(Tyr262Ter)" ""
"0000784371" "00015884" "70" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Cys)" ""
"0000784398" "00015884" "70" "2293" "0" "2293" "0" "c.2293G>C" "r.(?)" "p.(Ala765Pro)" ""
"0000784401" "00015884" "70" "1606" "0" "1606" "0" "c.1606C>T" "r.(?)" "p.(Pro536Ser)" ""
"0000784407" "00015884" "70" "2193" "5" "2193" "5" "c.2193+5G>A" "r.spl" "p.?" ""
"0000784471" "00015884" "50" "1258" "-9" "1258" "-9" "c.1258-9C>T" "r.(=)" "p.(=)" ""
"0000784485" "00015884" "50" "1401" "6" "1401" "7" "c.1401+6_1401+7insT" "r.(=)" "p.(=)" ""
"0000784580" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378Ter)" ""
"0000784581" "00015884" "90" "2047" "0" "2047" "0" "c.2047G>A" "r.(?)" "p.(Val683Met)" ""
"0000784589" "00015884" "90" "1615" "-1" "1615" "-1" "c.1615-1G>C" "r.spl" "p.?" ""
"0000784597" "00015884" "90" "1615" "-1" "1615" "-1" "c.1615-1G>C" "r.spl" "p.?" ""
"0000785399" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000785400" "00015884" "90" "1189" "0" "1189" "0" "c.1189G>A" "r.(?)" "p.(Gly397Arg)" ""
"0000785407" "00015884" "90" "" "0" "" "0" "
c.1923_1971delinsTCTGGGTA" "r.(?)" "p.(Asn643GlyfsTer29)" ""
"0000785408" "00015884" "90" "1859" "0" "1859" "0" "c.1859A>G" "r.(?)" "p.(His620Arg)" ""
"0000786334" "00015884" "90" "2116" "0" "2116" "0" "c.2116A>T" "r.(?)" "p.(Lys706Ter)" ""
"0000786358" "00015884" "90" "1547" "0" "1547" "0" "c.1547T>C" "r.(?)" "p.(Leu516Pro)" ""
"0000786359" "00015884" "90" "1895" "0" "1895" "0" "c.1895T>C" "r.(?)" "p.(Phe632Ser)" ""
"0000786383" "00015884" "90" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000786396" "00015884" "90" "2116" "0" "2116" "0" "c.2116A>T" "r.(?)" "p.(Lys706Ter)" ""
"0000787652" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000787656" "00015884" "70" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378Ter)" ""
"0000787659" "00015884" "70" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Gly407Arg)" ""
"0000787696" "00015884" "70" "1624" "0" "1624" "0" "c.1624C>T" "r.(?)" "p.(Arg542Trp)" ""
"0000787697" "00015884" "70" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000787710" "00015884" "70" "169" "0" "173" "0" "c.169_173del" "r.(?)" "p.(Thr57AlafsTer107)" ""
"0000787712" "00015884" "70" "1712" "0" "1712" "0" "c.1712C>T" "r.(?)" "p.(Thr571Met)" ""
"0000787739" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298Ter)" ""
"0000787740" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298Ter)" ""
"0000787741" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298Ter)" ""
"0000788081" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000788082" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000788083" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000788084" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000788106" "00015884" "90" "993" "-1" "993" "-1" "c.993-1G>C" "r.spl" "p.?" ""
"0000788142" "00015884" "70" "1576" "0" "1576" "0" "c.1576G>A" "r.(?)" "p.(Glu526Lys)" ""
"0000788161" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl" "p.?" ""
"0000788162" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000789682" "00015884" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" "14"
"0000789685" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000789686" "00015884" "90" "2012" "0" "2012" "0" "c.2012T>C" "r.(?)" "p.(Leu671Pro)" "16"
"0000789687" "00015884" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" "14"
"0000789688" "00015884" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" "14"
"0000789696" "00015884" "90" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" "14"
"0000789699" "00015884" "90" "699" "0" "699" "0" "c.699G>A" "r.(=)" "p.(=)" "3"
"0000789701" "00015884" "55" "922" "0" "922" "0" "c.922G>A" "r.(?)" "p.(Gly308Ser)" "5"
"0000790142" "00015884" "10" "1401" "31" "1401" "31" "c.1401+31C>A" "r.(=)" "p.(=)" "10i"
"0000790143" "00015884" "10" "2130" "-15" "2130" "-15" "c.2130-15G>A" "r.(=)" "p.(=)" "17i"
"0000790160" "00015884" "50" "772" "0" "772" "0" "c.772C>A" "r.(?)" "p.(His258Asn)" "4"
"0000790417" "00015884" "70" "1833" "-1" "1833" "-1" "c.1833-1G>C" "r.spl" "p.?" ""
"0000790418" "00015884" "70" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Trp290Ter)" ""
"0000790429" "00015884" "70" "973" "0" "973" "0" "c.973G>C" "r.(?)" "p.(Glu325Gln)" ""
"0000790435" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.?" ""
"0000790515" "00015884" "50" "1280" "0" "1280" "0" "c.1280G>A" "r.(?)" "p.(Trp427Ter)" ""
"0000790525" "00015884" "50" "1805" "0" "1805" "0" "c.1805G>A" "r.(?)" "p.(Arg602His)" ""
"0000790570" "00015884" "50" "145" "0" "145" "0" "c.145G>T" "r.(?)" "p.(Asp49Tyr)" ""
"0000790582" "00015884" "50" "711" "10" "711" "10" "c.711+10C>T" "r.spl?" "p.?" ""
"0000790586" "00015884" "50" "1624" "0" "1624" "0" "c.1624C>T" "r.(?)" "p.(Arg542Trp)" ""
"0000790611" "00015884" "50" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Ser161Asn)" ""
"0000790616" "00015884" "50" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.spl?" "p.?" ""
"0000790617" "00015884" "50" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.spl?" "p.?" ""
"0000790643" "00015884" "50" "2344" "0" "2344" "0" "c.2344G>A" "r.(?)" "p.(Val782Met)" ""
"0000790655" "00015884" "50" "221" "0" "221" "0" "c.221G>T" "r.(?)" "p.(Arg74Leu)" ""
"0000790742" "00015884" "70" "121" "0" "125" "0" "c.121_125delins(15)" "r.(?)" "p.?" ""
"0000791164" "00015884" "50" "1243" "0" "1243" "0" "c.1243G>A" "r.(?)" "p.(Glu415Lys)" "9"
"0000791204" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" "12"
"0000791637" "00015884" "50" "1679" "0" "1679" "0" "c.1679G>A" "r.(?)" "p.(Arg560His)" "13"
"0000792052" "00015884" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" "4"
"0000792053" "00015884" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" "4"
"0000792386" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000792387" "00015884" "70" "2068" "0" "2068" "0" "c.2068C>T" "r.(?)" "p.(Gln690*)" ""
"0000793733" "00015884" "50" "2399" "0" "2399" "0" "c.2399del" "r.(?)" "p.(Leu800Argfs*19)" "21"
"0000793742" "00015884" "90" "1685" "0" "1685" "0" "c.1685G>A" "r.(?)" "p.(Gly562Asp)" "13"
"0000793895" "00015884" "50" "1624" "0" "1624" "0" "c.1624C>T" "r.(?)" "p.(Arg542Trp)" "13"
"0000793896" "00015884" "50" "2140" "0" "2140" "0" "c.2140A>T" "r.(?)" "p.(Met714Leu)" "18"
"0000794102" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000794103" "00015884" "70" "2492" "0" "2492" "0" "c.2492C>T" "r.(?)" "p.(Ala831Val)" ""
"0000794220" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000794348" "00015884" "70" "698" "0" "698" "0" "c.698C>T" "r.(?)" "p.(Thr233Met)" "3"
"0000794349" "00015884" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "1"
"0000794350" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" "1"
"0000794351" "00015884" "70" "1613" "0" "1614" "1" "c.1613_1614+1del" "r.spl" "p.(Glu538del)" "12i"
"0000794352" "00015884" "70" "2204" "0" "2204" "0" "c.2204T>C" "r.(?)" "p.(Leu735Pro)" "19"
"0000794353" "00015884" "70" "3" "0" "3" "0" "c.3dup" "r.(?)" "p.(Met1?)" "1"
"0000794354" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl" "p.?" "11i"
"0000794355" "00015884" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "1"
"0000794925" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000794926" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000794927" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000794928" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000794932" "00015884" "50" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" "14"
"0000794985" "00015884" "50" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" "4"
"0000795063" "00015884" "90" "1568" "0" "1568" "0" "c.1568T>G" "r.(?)" "p.(Met523Arg)" "12"
"0000795923" "00015884" "70" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000796045" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000796046" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000796047" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000796161" "00015884" "90" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000796169" "00015884" "70" "1189" "0" "1189" "0" "c.1189G>A" "r.(?)" "p.(Gly397Arg)" "9"
"0000796170" "00015884" "70" "1859" "0" "1859" "0" "c.1859A>G" "r.(?)" "p.(His620Arg)" "15"
"0000796687" "00015884" "90" "669" "0" "669" "0" "c.669T>A" "r.(?)" "p.(Tyr223*)" "3"
"0000796689" "00015884" "90" "1699" "0" "1699" "0" "c.1699C>T" "r.(?)" "p.(Gln567*)" "13"
"0000796722" "00015884" "70" "703" "0" "703" "0" "c.703C>T" "r.(?)" "p.(Arg235Cys)" "3"
"0000796739" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" "18i"
"0000796752" "00015884" "90" "2047" "0" "2047" "0" "c.2047G>A" "r.(?)" "p.(Val683Met)" "17"
"0000796753" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" "18i"
"0000796754" "00015884" "70" "2249" "0" "2249" "0" "c.2249T>G" "r.(?)" "p.(Val750Gly)" "19"
"0000796804" "00015884" "70" "704" "0" "704" "0" "c.704G>A" "r.(?)" "p.(Arg235His)" "3"
"0000796899" "00015884" "90" "2399" "0" "2399" "0" "c.2399T>C" "r.(?)" "p.(Leu800Pro)" "21"
"0000796900" "00015884" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Gln413*)" "9"
"0000797080" "00015884" "70" "293" "0" "293" "0" "c.293G>C" "r.(?)" "p.(Arg98Pro)" "1"
"0000797081" "00015884" "90" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" "1"
"0000797082" "00015884" "70" "243" "0" "243" "0" "c.243del" "r.(?)" "p.(Arg82Alafs*68)" "1"
"0000797414" "00015884" "70" "2401" "0" "2401" "0" "c.2401C>T" "r.(?)" "p.(Gln801*)" ""
"0000797456" "00015884" "70" "173" "0" "173" "0" "c.173C>T" "r.(?)" "p.(Ala58Val)" ""
"0000797718" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000797719" "00015884" "70" "1576" "0" "1576" "0" "c.1576G>A" "r.(?)" "p.(Glu526Lys)" ""
"0000797720" "00015884" "50" "1833" "-3" "1833" "-3" "c.1833-3C>G" "r.spl?" "p.(?)" ""
"0000797721" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.(?)" ""
"0000797722" "00015884" "70" "1654" "0" "1654" "0" "c.1654del" "r.(?)" "p.(Arg552Glyfs*23)" ""
"0000797723" "00015884" "70" "207" "0" "207" "0" "c.207dup" "r.(?)" "p.(Ile70Hisfs*96)" ""
"0000797724" "00015884" "70" "293" "0" "293" "0" "c.293G>A" "r.(?)" "p.(Arg98His)" ""
"0000797725" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000797726" "00015884" "50" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000797728" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000797729" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000798017" "00015884" "70" "1401" "5" "1401" "5" "c.1401+5G>A" "r.spl?" "p.(?)" ""
"0000798042" "00015884" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" ""
"0000798043" "00015884" "70" "1670" "0" "1670" "0" "c.1670A>G" "r.(?)" "p.(His557Arg)" ""
"0000798423" "00015884" "50" "1722" "1" "1722" "1" "c.1722+1G>A" "r.spl?" "p.?" "13i"
"0000801689" "00015884" "10" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Gly302Asp)" ""
"0000801690" "00015884" "30" "1083" "0" "1083" "0" "c.1083C>T" "r.(?)" "p.(Ser361=)" ""
"0000801691" "00015884" "50" "1258" "-10" "1258" "-10" "c.1258-10T>A" "r.(=)" "p.(=)" ""
"0000801693" "00015884" "50" "1510" "0" "1510" "0" "c.1510T>C" "r.(?)" "p.(Phe504Leu)" ""
"0000801694" "00015884" "50" "1624" "0" "1624" "0" "c.1624C>T" "r.(?)" "p.(Arg542Trp)" ""
"0000801695" "00015884" "30" "2097" "0" "2097" "0" "c.2097G>C" "r.(?)" "p.(Leu699=)" ""
"0000801696" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl?" "p.?" ""
"0000811486" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000811487" "00015884" "90" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Trp290Ter)" ""
"0000811488" "00015884" "70" "1636" "0" "1641" "0" "c.1636_1641del" "r.(?)" "p.(Ile547_Ser548del)" ""
"0000811522" "00015884" "70" "2492" "0" "2492" "0" "c.2492C>T" "r.(?)" "p.(Ala831Val)" ""
"0000811523" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000811827" "00015884" "70" "3" "0" "3" "0" "c.3dup" "r.(?)" "p.(Met1?)" ""
"0000811847" "00015884" "70" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" ""
"0000811848" "00015884" "70" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" ""
"0000811882" "00015884" "70" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000812009" "00015884" "70" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" "4"
"0000812094" "00015884" "70" "1572" "0" "1572" "0" "c.1572del" "r.(?)" "p.(Tyr525Thrfs*50)" "12"
"0000812476" "00015884" "70" "782" "0" "784" "0" "c.782_784del" "r.(?)" "p.(Phe261del)" "5"
"0000813029" "00015884" "70" "1417" "0" "1417" "0" "c.1417del" "r.(?)" "p.(Leu473Trpfs*17)" ""
"0000813211" "00015884" "30" "615" "0" "615" "0" "c.615C>T" "r.(=)" "p.(=)" "2"
"0000813696" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000813697" "00015884" "90" "167" "0" "171" "0" "c.167_171delGCACG" "r.(?)" "p.(Thr57Alafs*107)" ""
"0000813798" "00015884" "70" "298" "0" "298" "0" "c.298C>T" "r.(?)" "p.(Arg100Cys)" ""
"0000813801" "00015884" "70" "298" "0" "298" "0" "c.298C>T" "r.(?)" "p.(Arg100Cys)" ""
"0000814782" "00015884" "50" "622" "0" "622" "0" "c.622G>A" "r.(?)" "p.(Val208Met)" "3"
"0000814813" "00015884" "50" "2435" "0" "2435" "0" "c.2435A>T" "r.(?)" "p.(Asp812Val)" "21"
"0000815067" "00015884" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000815068" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1?" "r.spl?" "p.?" "18i"
"0000815071" "00015884" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000815072" "00015884" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000815405" "00015884" "50" "760" "0" "760" "0" "c.760G>A" "r.(?)" "p.(Glu254Lys)" ""
"0000815516" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0000815575" "00015884" "50" "793" "0" "793" "0" "c.793C>G" "r.(?)" "p.(Arg265Gly)" ""
"0000815630" "00015884" "50" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000815631" "00015884" "70" "2408" "0" "2408" "0" "c.2408A>G" "r.(?)" "p.(Asn803Ser)" ""
"0000815998" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000816027" "00015884" "50" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Phe247Ile)" ""
"0000816039" "00015884" "50" "1712" "0" "1712" "0" "c.1712C>T" "r.(?)" "p.(Thr571Met)" ""
"0000816113" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000816194" "00015884" "50" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000816197" "00015884" "90" "992" "1" "992" "1" "c.992+1G>A" "r.spl" "p.(?)" ""
"0000816263" "00015884" "50" "0" "0" "0" "0" "c.?" "r.spl" "p.(?)" ""
"0000816291" "00015884" "50" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Gly407Arg)" ""
"0000816341" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000816369" "00015884" "50" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Phe247Ile)" ""
"0000816376" "00015884" "90" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620Glnfs*23)" ""
"0000816432" "00015884" "50" "2193" "0" "2193" "0" "c.2193G>C" "r.(?)" "p.(Lys731Asn)" ""
"0000816494" "00015884" "90" "1951" "0" "1969" "0" "c.1951_1969del" "r.(?)" "p.(Arg651Serfs*3)" ""
"0000816495" "00015884" "50" "44" "0" "44" "0" "c.44A>C" "r.(?)" "p.(Asn15Thr)" ""
"0000816498" "00015884" "90" "1951" "0" "1969" "0" "c.1951_1969del" "r.(?)" "p.(Arg651Serfs*3)" ""
"0000816752" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000816753" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000816754" "00015884" "70" "1488" "0" "1488" "0" "c.1488del" "r.(?)" "p.(Thr497Profs*78)" ""
"0000816755" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000816756" "00015884" "70" "1540" "0" "1540" "0" "c.1540del" "r.(?)" "p.(Leu514Trpfs*61)" ""
"0000816757" "00015884" "70" "1927" "0" "1967" "0" "c.1927_1967del" "r.(?)" "p.(Asn643Aspfs*29)" ""
"0000816758" "00015884" "70" "756" "0" "756" "0" "c.756del" "r.(?)" "p.(Asp252Glufs*29)" ""
"0000816843" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000816844" "00015884" "70" "2332" "0" "2332" "0" "c.2332G>A" "r.(?)" "p.(Val778Met)" ""
"0000818930" "00015884" "70" "0" "0" "0" "0" "c.-53_*785{0}" "r.0?" "p.0?" "_1_22_"
"0000818931" "00015884" "70" "1697" "0" "1697" "0" "c.1697C>T" "r.(?)" "p.(Ala566Val)" "13"
"0000819350" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000819351" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000819663" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000819819" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000819882" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000819950" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000820006" "00015884" "70" "177" "0" "248" "0" "c.177_248dup" "r.(?)" "p.(Leu60_Leu83dup)" ""
"0000820007" "00015884" "70" "177" "0" "248" "0" "c.177_248dup" "r.(?)" "p.(Leu60_Leu83dup)" ""
"0000820133" "00015884" "70" "1744" "0" "1744" "0" "c.1744T>C" "r.(?)" "p.(Tyr582His)" ""
"0000820228" "00015884" "70" "1832" "1" "1832" "1" "c.1832+1G>T" "r.spl" "p.(?)" ""
"0000820370" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000820433" "00015884" "70" "1390" "0" "1390" "0" "c.1390C>T" "r.(?)" "p.(Gln464*)" ""
"0000820435" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000820441" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000820463" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000820524" "00015884" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Gly137Arg)" ""
"0000820556" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.(?)" ""
"0000820566" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000820621" "00015884" "70" "2003" "0" "2003" "0" "c.2003A>G" "r.(?)" "p.(Asp668Gly)" ""
"0000820622" "00015884" "70" "2003" "0" "2003" "0" "c.2003A>G" "r.(?)" "p.(Asp668Gly)" ""
"0000820691" "00015884" "70" "886" "0" "886" "0" "c.886G>T" "r.(?)" "p.(Glu296*)" ""
"0000820782" "00015884" "70" "1401" "2" "1401" "2" "c.1401+2T>G" "r.spl" "p.(?)" ""
"0000820783" "00015884" "70" "1401" "2" "1401" "2" "c.1401+2T>G" "r.spl" "p.(?)" ""
"0000820915" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000820957" "00015884" "70" "928" "-9" "940" "0" "c.928-9_940dup" "r.spl" "p.(?)" ""
"0000820974" "00015884" "70" "1920" "2" "1920" "2" "c.1920+2T>C" "r.spl" "p.(?)" ""
"0000821323" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000821324" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000821325" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.(?)" ""
"0000821326" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000821327" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000821328" "00015884" "70" "1547" "0" "1547" "0" "c.1547T>C" "r.(?)" "p.(Leu516Pro)" ""
"0000821329" "00015884" "70" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" ""
"0000821586" "00015884" "70" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000821587" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000821588" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000821589" "00015884" "70" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000821590" "00015884" "70" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Phe247Ile)" ""
"0000822110" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" "5"
"0000822117" "00015884" "70" "655" "0" "655" "0" "c.655T>C" "r.(?)" "p.(Tyr219His)" "3"
"0000824639" "00015884" "50" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000824675" "00015884" "50" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000824676" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000824689" "00015884" "90" "1624" "0" "1624" "0" "c.1624C>T" "r.(?)" "p.(Arg542Trp)" ""
"0000824699" "00015884" "50" "1811" "0" "1811" "0" "c.1811C>T" "r.(?)" "p.(Thr604Ile)" ""
"0000824746" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000824747" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000824771" "00015884" "90" "2395" "0" "2395" "0" "c.2395C>T" "r.(?)" "p.(Arg799Ter)" ""
"0000824778" "00015884" "50" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000824808" "00015884" "50" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Gln88Ter)" ""
"0000825738" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" "1"
"0000825739" "00015884" "70" "1612" "0" "1614" "0" "c.1612_1614del" "r.spl?" "p.(Glu538del)" "12"
"0000825875" "00015884" "70" "2204" "0" "2204" "0" "c.2204T>C" "r.(?)" "p.(Leu735Pro)" "19"
"0000825876" "00015884" "70" "3" "0" "3" "0" "c.3dup" "r.(?)" "p.(Ser2Glufs*4)" "1"
"0000825923" "00015884" "70" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000825924" "00015884" "70" "2204" "0" "2204" "0" "c.2204T>C" "r.(?)" "p.(Leu735Pro)" "19"
"0000826079" "00015884" "70" "723" "0" "723" "0" "c.723G>A" "r.(?)" "p.(Trp241*)" "4"
"0000826080" "00015884" "70" "993" "-2" "993" "-2" "c.993-2A>G" "r.spl?" "p.?" "6i"
"0000826209" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" "1"
"0000826210" "00015884" "70" "973" "0" "973" "0" "c.973G>T" "r.(?)" "p.(Glu325*)" "6"
"0000826232" "00015884" "70" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000826233" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" "13"
"0000826274" "00015884" "70" "1467" "1" "1467" "1" "c.1467+1G>C" "r.spl?" "p.?" "11i"
"0000826275" "00015884" "70" "1700" "0" "1700" "0" "c.1700A>G" "r.(?)" "p.(Gln567Arg)" "13"
"0000826944" "00015884" "70" "1685" "0" "1685" "0" "c.1685G>A" "r.(?)" "p.(Gly562Asp)" ""
"0000827308" "00015884" "90" "616" "0" "616" "0" "c.616G>T" "r.(?)" "p.(Glu206*)" "2"
"0000827309" "00015884" "50" "1467" "4" "1467" "4" "c.1467+4del" "r.spl?" "p.?" "11i"
"0000827310" "00015884" "70" "760" "0" "760" "0" "c.760G>A" "r.(?)" "p.(Glu254Lys)" "4"
"0000827311" "00015884" "50" "1532" "0" "1532" "0" "c.1532G>T" "r.(?)" "p.(Cys511Phe)" "12"
"0000827312" "00015884" "70" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "1"
"0000827313" "00015884" "50" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl?" "p.?" "8i"
"0000827314" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>C" "r.spl?" "p.?" "18i"
"0000828498" "00015884" "70" "468" "1" "468" "1" "c.468+1G>A" "r.spl" "p.(?)" ""
"0000828499" "00015884" "70" "1757" "0" "1757" "0" "c.1757A>G" "r.(?)" "p.(Glu586Gly)" ""
"0000828781" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378*)" ""
"0000828986" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000829703" "00015884" "70" "1876" "0" "1876" "0" "c.1876G>T" "r.(?)" "p.(Glu626Ter)" ""
"0000829724" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643GlyfsTer29)" ""
"0000829820" "00015884" "90" "1768" "0" "1768" "0" "c.1768del" "r.(?)" "p.(Met590Trpfs*2)" "14"
"0000829821" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.spl?" "p.?" "15i"
"0000829832" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000829839" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" "12"
"0000829840" "00015884" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" "13"
"0000829847" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" "12"
"0000829881" "00015884" "90" "1488" "0" "1488" "0" "c.1488del" "r.(?)" "p.(Thr497Profs*78)" "12"
"0000829882" "00015884" "90" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" "12"
"0000829893" "00015884" "90" "54" "0" "54" "0" "c.54del" "r.(?)" "p.(Phe18Leufs*10)" "1"
"0000829983" "00015884" "50" "1514" "0" "1514" "0" "c.1514A>C" "r.(?)" "p.(His505Pro)" "12"
"0000832801" "00015884" "30" "1108" "-10" "1108" "-10" "c.1108-10G>A" "r.(=)" "p.(=)" ""
"0000832802" "00015884" "50" "683" "0" "683" "0" "c.683T>A" "r,(?)" "p.(Leu228His)" ""
"0000832814" "00015884" "70" "1727" "0" "1727" "0" "c.1727G>A" "r.(?)" "p.(Gly576Asp)" ""
"0000832815" "00015884" "70" "1727" "0" "1727" "0" "c.1727G>A" "r.(?)" "p.(Gly576Asp)" ""
"0000832816" "00015884" "70" "2116" "0" "2116" "0" "NM_000283.3:c.2116A>T" "r.(?)" "p.(Lys706*)" ""
"0000832817" "00015884" "70" "2116" "0" "2116" "0" "NM_000283.3:c.2116A>T" "r.(?)" "p.(Lys706*)" ""
"0000832818" "00015884" "70" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620Glnfs*23)" ""
"0000832819" "00015884" "70" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620Glnfs*23)" ""
"0000832820" "00015884" "70" "622" "-1" "622" "-1" "c.622-1G>T" "r.spl" "p.(?)" "2i"
"0000832821" "00015884" "70" "622" "-1" "622" "-1" "c.622-1G>T" "r.spl" "p.(?)" "2i"
"0000832822" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832823" "00015884" "70" "177" "0" "248" "0" "c.177_248dup" "r.(?)" "p.(Leu60_Leu83dup)" ""
"0000832824" "00015884" "70" "177" "0" "248" "0" "c.177_248dup" "r.(?)" "p.(Leu60_Leu83dup)" ""
"0000832825" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832826" "00015884" "70" "1832" "1" "1832" "1" "c.1832+1G>T" "r.spl" "p.(?)" ""
"0000832827" "00015884" "70" "1258" "-2" "1258" "-2" "c.1258-2A>G" "r.spl" "p.(?)" ""
"0000832828" "00015884" "70" "1060" "-1" "1060" "-1" "c.1060-1G>T" "r.spl" "p.(?)" ""
"0000832829" "00015884" "70" "1699" "0" "1699" "0" "c.1699C>T" "r.(?)" "p.(Gln567*)" ""
"0000832830" "00015884" "70" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" ""
"0000832831" "00015884" "70" "1667" "0" "1667" "0" "c.1667A>G" "r.(?)" "p.(?)" ""
"0000832832" "00015884" "70" "1390" "0" "1390" "0" "c.1390C>T" "r.(?)" "p.(Gln464*)" ""
"0000832833" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832834" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000832835" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832836" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000832837" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000832838" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000832839" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832840" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000832841" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" ""
"0000832842" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000832843" "00015884" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Gly137Arg)" ""
"0000832844" "00015884" "70" "1744" "0" "1744" "0" "c.1744T>C" "r.(?)" "p.(Tyr582His)" ""
"0000832845" "00015884" "70" "221" "0" "221" "0" "c.221dup" "r.(?)" "p.(Val75Argfs*91)" ""
"0000832846" "00015884" "70" "886" "0" "886" "0" "c.886G>T" "r.(?)" "p.(Glu296*)" ""
"0000832847" "00015884" "70" "1401" "2" "1401" "2" "c.1401+2T>G" "r.spl" "p.(?)" ""
"0000832848" "00015884" "70" "1401" "2" "1401" "2" "c.1401+2T>G" "r.spl" "p.(?)" ""
"0000832849" "00015884" "70" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" ""
"0000832850" "00015884" "70" "1920" "2" "1920" "2" "c.1920+2T>C" "r.spl" "p.(?)" ""
"0000832851" "00015884" "70" "2003" "0" "2003" "0" "c.2003A>G" "r.(?)" "p.(Asp668Gly)" ""
"0000832852" "00015884" "70" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0000832853" "00015884" "70" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.(?)" "p.(?)" ""
"0000832854" "00015884" "70" "2003" "0" "2003" "0" "c.2003A>G" "r.(?)" "p.(Asp668Gly)" ""
"0000832855" "00015884" "70" "1401" "4" "1401" "48" "c.1401+4_1401+48del" "r.(?)" "p.(?)" ""
"0000832856" "00015884" "70" "928" "-9" "940" "0" "c.928-9_940dup" "r.(?)" "p.(?)" ""
"0000832857" "00015884" "70" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000832871" "00015884" "70" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Cys270*)" ""
"0000832887" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000832894" "00015884" "70" "2419" "0" "2419" "0" "c.2419T>A" "r.(?)" "p.(Trp807Arg)" ""
"0000832897" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832898" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832899" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832900" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832901" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832902" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832903" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832904" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832905" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000832906" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832907" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832908" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832909" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832910" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832911" "00015884" "70" "1160" "0" "1160" "0" "c.1160C>T" "r.(?)" "p.(Pro387Leu)" ""
"0000832912" "00015884" "70" "1417" "0" "1417" "0" "c.1417delC" "r.(?)" "p.(Leu473Trpfs*17)" ""
"0000832913" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000832914" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000832915" "00015884" "70" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000832916" "00015884" "70" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000832917" "00015884" "70" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" ""
"0000833014" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000833015" "00015884" "70" "1604" "0" "1604" "0" "c.1604T>A" "r.(?)" "p.(Ile535Asn)" ""
"0000833016" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000833017" "00015884" "70" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(His557Tyr)" ""
"0000833018" "00015884" "70" "2351" "0" "2351" "0" "c.2351dupA" "r.(?)" "p.(Glu785Glyfs*20)" ""
"0000833019" "00015884" "70" "1833" "0" "1842" "0" "c.1833_1842delinsCTTAG" "r.(?)" "p.(Lys611Asnfs*6)" ""
"0000833020" "00015884" "70" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Glu271Lys)" ""
"0000833021" "00015884" "70" "1699" "0" "1699" "0" "c.1699C>T" "r.(?)" "p.(Gln567*)" ""
"0000833022" "00015884" "70" "1879" "0" "1893" "0" "c.1879_1893del" "r.(?)" "p.(Arg627_Glu631del)" ""
"0000833023" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833024" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833025" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833026" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833027" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833028" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833029" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833030" "00015884" "70" "1921" "-9" "1921" "-9" "c.1921-9C>G" "r.spl" "p.(?)" ""
"0000833272" "00015884" "70" "1614" "0" "1614" "0" "c.1614G>C" "r.(?)" "p.(Glu538Asp)" "12"
"0000833273" "00015884" "90" "181" "0" "181" "0" "c.181G>T" "r.(?)" "p.(Glu61*)" "1"
"0000833274" "00015884" "90" "1927" "0" "1969" "0" "c.1927_1969delinsGG" "r.(?)" "p.(Asn643Glyfs*29)" "16"
"0000833275" "00015884" "70" "299" "0" "299" "0" "c.299G>A" "r.(?)" "p.(Arg100His)" "1"
"0000833276" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833277" "00015884" "70" "2197" "0" "2197" "0" "c.2197G>C" "r.(?)" "p.(Ala733Pro)" "19"
"0000833278" "00015884" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Gly137Arg)" "1"
"0000833279" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" "5"
"0000833280" "00015884" "90" "293" "0" "293" "0" "c.293G>C" "r.(?)" "p.(Arg98Pro)" "1"
"0000833281" "00015884" "90" "293" "0" "293" "0" "c.293G>C" "r.(?)" "p.(Arg98Pro)" "1"
"0000833282" "00015884" "90" "293" "0" "293" "0" "c.293G>C" "r.(?)" "p.(Arg98Pro)" "1"
"0000833283" "00015884" "90" "1468" "-1" "1468" "-1" "c.1468-1G>A" "r.spl" "p.(?)" "11"
"0000833284" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(Asn643Glyfs*29)" "8"
"0000833285" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833286" "00015884" "90" "1257" "1" "1257" "1" "c.1257+1G>A" "r.spl" "p.(?)" "9"
"0000833287" "00015884" "70" "2045" "0" "2045" "0" "c.2045T>C" "r.(?)" "p.(Ile682Thr)" "17"
"0000833288" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" "12"
"0000833289" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" "13"
"0000833290" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" "13"
"0000833291" "00015884" "90" "1257" "1" "1257" "1" "c.1257+1G>A" "r.spl" "p.(?)" "9"
"0000833292" "00015884" "90" "1257" "1" "1257" "1" "c.1257+1G>A" "r.spl" "p.(?)" "9"
"0000833293" "00015884" "90" "132" "0" "132" "0" "c.132C>A" "r.(?)" "p.(Cys44*)" "1"
"0000833294" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833295" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833296" "00015884" "90" "797" "0" "798" "0" "c.797_798insGGTACTT" "r.(?)" "p.(Tyr267Valfs* 24)" "4"
"0000833297" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833298" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833299" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833300" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" "13"
"0000833301" "00015884" "90" "1678" "0" "1678" "0" "c.1678C>T" "r.(?)" "p.(Arg560Cys)" "13"
"0000833302" "00015884" "70" "2152" "0" "2152" "0" "c.2152G>T" "r.(?)" "p.(Asp718Tyr)" "18"
"0000833303" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833304" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" "18"
"0000833305" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" "18"
"0000833306" "00015884" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Gly137Arg)" "1"
"0000833307" "00015884" "70" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "1"
"0000833308" "00015884" "90" "1927" "0" "1969" "0" "c.1927_1969delinsGG" "r.(?)" "p.(Asn643Glyfs *29)" "16"
"0000833323" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378*)" "9"
"0000833324" "00015884" "90" "2565" "0" "2565" "0" "c.2565A>G" "r.(?)" "p.(*855Trpext*30)" "22"
"0000833325" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" "5"
"0000833326" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833327" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833328" "00015884" "90" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" "7"
"0000833329" "00015884" "90" "1923" "0" "1969" "0" "c.1923_1969delinsTCTGGG" "r.(?)" "p.(Asn643Glyfs*29)" "16"
"0000833330" "00015884" "90" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" "13"
"0000833331" "00015884" "90" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" "13"
"0000833332" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.spl" "p.(?)" "18"
"0000833333" "00015884" "70" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" "12"
"0000833335" "00015884" "90" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Gly576Ser)" "14"
"0000833336" "00015884" "90" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Gly576Ser)" "14"
"0000833337" "00015884" "70" "1614" "0" "1614" "0" "c.1614G>C" "r.(?)" "p.(Glu538Asp)" "12"
"0000833338" "00015884" "90" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Met796Thr)" "21"
"0000833339" "00015884" "90" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Met796Thr)" "21"
"0000833340" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.spl" "p.(?)" "8"
"0000833341" "00015884" "90" "797" "0" "798" "0" "c.797_798insGGTACTT" "r.(?)" "p.(Tyr267Valfs* 24)" "4"
"0000833342" "00015884" "70" "1614" "0" "1614" "0" "c.1614G>C" "r.(?)" "p.(Glu538Asp)" "12"
"0000833343" "00015884" "90" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Gly576Ser)" "14"
"0000833344" "00015884" "90" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Gly576Ser)" "14"
"0000833345" "00015884" "90" "2215" "0" "2215" "0" "c.2215G>A" "r.(?)" "p.(Glu739Lys)" "19"
"0000833346" "00015884" "90" "2215" "0" "2215" "0" "c.2215G>A" "r.(?)" "p.(Glu739Lys)" "19"
"0000833347" "00015884" "90" "1733" "0" "1734" "0" "c.1733_1734delinsC" "r.(?)" "p.(Leu578Profs* 14)" "14"
"0000840244" "00015884" "30" "1412" "0" "1412" "0" "c.1412C>T" "r.(?)" "p.(Ala471Val)" "11"
"0000846461" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000859562" "00015884" "30" "928" "-9" "940" "0" "c.928-9_940dup" "r.spl?" "p.?" ""
"0000859563" "00015884" "30" "1108" "-5" "1108" "-5" "c.1108-5C>T" "r.spl?" "p.?" ""
"0000859564" "00015884" "70" "1402" "-1" "1402" "-1" "c.1402-1G>C" "r.spl?" "p.?" ""
"0000859566" "00015884" "30" "2371" "0" "2371" "0" "c.2371G>A" "r.(?)" "p.(Glu791Lys)" ""
"0000869967" "00015884" "50" "339" "0" "353" "0" "c.339_353del" "r.(?)" "p.(Gln114_Val118del)" ""
"0000869968" "00015884" "70" "339" "0" "353" "0" "c.339_353del" "r.(?)" "p.(Gln114_Val118del)" ""
"0000871513" "00015884" "90" "1775" "0" "1775" "0" "c.1775C>T" "r.(?)" "p.(Thr592Ile)" "12"
"0000886358" "00015884" "70" "1108" "-2" "1108" "-2" "c.1108-2A>G" "r.spl?" "p.?" ""
"0000886359" "00015884" "30" "1401" "5" "1401" "5" "c.1401+5G>A" "r.spl?" "p.?" ""
"0000886361" "00015884" "90" "1609" "0" "1609" "0" "c.1609C>T" "r.(?)" "p.(Gln537*)" ""
"0000886362" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000896675" "00015884" "90" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Trp378Ter)" ""
"0000896676" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000912132" "00015884" "50" "1759" "0" "1759" "0" "c.1759G>C" "r.(?)" "p.(Ala587Pro)" ""
"0000915797" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000915817" "00015884" "50" "1019" "0" "1019" "0" "c.1019T>C" "r.(?)" "p.(Leu340Pro)" ""
"0000915821" "00015884" "50" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Glu640Lys)" ""
"0000915824" "00015884" "70" "801" "0" "801" "0" "c.801C>A" "r.(?)" "p.(Tyr267*)" ""
"0000915847" "00015884" "50" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Glu640Lys)" ""
"0000915856" "00015884" "50" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Glu640Lys)" ""
"0000915857" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.(?)" "p.(?)" ""
"0000915894" "00015884" "70" "786" "0" "786" "0" "c.786C>G" "r.(?)" "p.(Tyr262*)" ""
"0000915971" "00015884" "90" "992" "1" "992" "1" "c.992+1G>A" "r.(?)" "p.(?)" ""
"0000915980" "00015884" "50" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(His337Arg)" ""
"0000915987" "00015884" "70" "2179" "0" "2179" "0" "c.2179del" "r.(?)" "p.(Glu727Lysfs*32)" ""
"0000916077" "00015884" "90" "1920" "2" "1920" "2" "c.1920+2T>C" "r.(?)" "p.(?)" ""
"0000916080" "00015884" "70" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Asp600Asn)" ""
"0000916102" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000916103" "00015884" "70" "2152" "0" "2152" "0" "c.2152G>A" "r.(?)" "p.(Asp718Asn)" ""
"0000916128" "00015884" "70" "1655" "0" "1655" "0" "c.1655G>A" "r.(?)" "p.(Arg552Gln)" ""
"0000916286" "00015884" "70" "2503" "2" "2503" "2" "c.2503+2T>C" "r.(?)" "p.(?)" ""
"0000916305" "00015884" "90" "892" "0" "892" "0" "c.892C>T" "r.(?)" "p.(Gln298*)" ""
"0000916306" "00015884" "70" "1373" "0" "1373" "0" "c.1373del" "r.(?)" "p.(Cys458Serfs*32)" ""
"0000916313" "00015884" "90" "1107" "3" "1107" "3" "c.1107+3A>G" "r.(?)" "p.(Asn643Glyfs*29)" ""
"0000916319" "00015884" "70" "1761" "0" "1773" "0" "c.1761_1773del" "r.(?)" "p.(Phe588Glnfs*19)" ""
"0000916320" "00015884" "50" "1860" "0" "1860" "0" "c.1860C>G" "r.(?)" "p.(His620Gln)" ""
"0000916439" "00015884" "90" "2401" "0" "2401" "0" "c.2401C>T" "r.(?)" "p.(Gln801*)" ""
"0000916487" "00015884" "70" "1373" "0" "1373" "0" "c.1373del" "r.(?)" "p.(Cys458Serfs*32)" ""
"0000916488" "00015884" "70" "1712" "0" "1712" "0" "c.1712C>T" "r.(?)" "p.(Thr571Met)" ""
"0000916697" "00015884" "70" "2152" "0" "2152" "0" "c.2152G>A" "r.(?)" "p.(Asp718Asn)" ""
"0000916748" "00015884" "90" "2193" "1" "2193" "1" "c.2193+1G>A" "r.(?)" "p.(?)" ""
"0000916759" "00015884" "50" "1553" "0" "1553" "0" "c.1553A>T" "r.(?)" "p.(Lys518Ile)" ""
"0000916760" "00015884" "70" "2152" "0" "2152" "0" "c.2152G>T" "r.(?)" "p.(Asp718Tyr)" ""
"0000924143" "00015884" "90" "1580" "0" "1580" "0" "c.1580T>C" "r.(?)" "p.(Leu527Pro)" ""
"0000924144" "00015884" "50" "1991" "0" "1991" "0" "c.1991T>G" "r.(?)" "p.(Ile664Ser)" ""
"0000928928" "00015884" "90" "837" "0" "837" "0" "c.837del" "r.(?)" "p.(Asp279GlufsTer2)" ""
"0000948342" "00015884" "50" "704" "0" "704" "0" "c.704G>A" "r.(?)" "p.(Arg235His)" ""
"0000948354" "00015884" "10" "1401" "4" "1401" "4" "c.1401+4C>T" "r.spl?" "p.?" ""
"0000948355" "00015884" "10" "1401" "7" "1401" "8" "c.1401+7_1401+8insA" "r.(=)" "p.(=)" ""
"0000948356" "00015884" "30" "1401" "16" "1401" "16" "c.1401+16A>T" "r.(=)" "p.(=)" ""
"0000948357" "00015884" "50" "1679" "0" "1679" "0" "c.1679G>A" "r.(?)" "p.(Arg560His)" ""
"0000948364" "00015884" "30" "2512" "0" "2512" "0" "c.2512G>C" "r.(?)" "p.(Glu838Gln)" ""
"0000958045" "00015884" "90" "1060" "-1" "1060" "-1" "c.1060-1G>T" "r.spl" "p.?" ""
"0000958063" "00015884" "70" "1401" "2" "1401" "2" "c.1401+2T>G" "r.spl" "p.?" ""
"0000958379" "00015884" "70" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Phe247Ile)" ""
"0000958451" "00015884" "70" "1712" "0" "1712" "0" "c.1712C>T" "r.(?)" "p.(Thr571Met)" ""
"0000958546" "00015884" "50" "1027" "0" "1027" "0" "c.1027G>A" "r.(?)" "p.(Gly343Ser)" ""
"0000958549" "00015884" "50" "551" "0" "551" "0" "c.551A>G" "r.(?)" "p.(Lys184Arg)" ""
"0000958856" "00015884" "50" "582" "0" "582" "0" "c.582C>G" "r.(?)" "p.(Asn194Lys)" ""
"0000959070" "00015884" "50" "173" "0" "173" "0" "c.173C>T" "r.(?)" "p.(Ala58Val)" ""
"0000959470" "00015884" "90" "1468" "-2" "1468" "-2" "c.1468-2A>G" "r.spl" "p.?" ""
"0000963205" "00015884" "70" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Glu129Lys)" ""
"0000976338" "00015884" "50" "1041" "0" "1041" "0" "c.1041C>T" "r.(?)" "p.(Tyr347=)" ""
"0000994408" "00015884" "50" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Asp776Asn)" ""
"0001013982" "00015884" "50" "1370" "0" "1370" "0" "c.1370A>G" "r.(?)" "p.(Lys457Arg)" ""
"0001013983" "00015884" "90" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620GlnfsTer23)" ""
"0001022295" "00015884" "90" "1860" "0" "1860" "0" "c.1860del" "r.(?)" "p.(His620GlnfsTer23)" ""
"0001022346" "00015884" "70" "1879" "0" "1879" "0" "c.1879C>G" "r.(?)" "p.(Arg627Gly)" ""
"0001034629" "00015884" "50" "293" "0" "293" "0" "c.293G>A" "r.(?)" "p.(Arg98His)" ""
"0001034641" "00015884" "50" "925" "0" "925" "0" "c.925C>T" "r.(?)" "p.(Arg309Trp)" ""
"0001034642" "00015884" "50" "1072" "0" "1072" "0" "c.1072A>G" "r.(?)" "p.(Met358Val)" ""
"0001034645" "00015884" "50" "2387" "0" "2387" "0" "c.2387T>C" "r.(?)" "p.(Met796Thr)" ""
"0001045969" "00015884" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265Gln)" ""
"0001051628" "00015884" "30" "2269" "-6" "2269" "-6" "c.2269-6C>T" "r.(=)" "p.(=)" ""
"0001059922" "00015884" "50" "2193" "0" "2193" "0" "c.2193G>A" "r.spl" "p.?" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 681
"{{screeningid}}" "{{variantid}}"
"0000001611" "0000019516"
"0000001611" "0000019517"
"0000033163" "0000060132"
"0000033163" "0000060133"
"0000033164" "0000060124"
"0000033164" "0000060134"
"0000033174" "0000060142"
"0000033177" "0000060127"
"0000033180" "0000060125"
"0000033183" "0000060141"
"0000033190" "0000060130"
"0000033190" "0000060135"
"0000033190" "0000060137"
"0000033194" "0000060126"
"0000033196" "0000060136"
"0000033196" "0000060140"
"0000033198" "0000060147"
"0000033199" "0000060128"
"0000033199" "0000060129"
"0000033204" "0000060143"
"0000033206" "0000060139"
"0000033206" "0000060144"
"0000033210" "0000060148"
"0000033210" "0000060149"
"0000033212" "0000060131"
"0000033212" "0000060138"
"0000033212" "0000060145"
"0000033214" "0000060146"
"0000033670" "0000060150"
"0000033670" "0000060151"
"0000050625" "0000079605"
"0000052786" "0000082500"
"0000100496" "0000162795"
"0000100504" "0000162802"
"0000100504" "0000162803"
"0000105519" "0000170966"
"0000156386" "0000358308"
"0000174782" "0000790655"
"0000233580" "0000476288"
"0000233581" "0000476289"
"0000233582" "0000476290"
"0000233583" "0000476291"
"0000233584" "0000476292"
"0000233585" "0000476293"
"0000233586" "0000476294"
"0000233587" "0000476295"
"0000233588" "0000476296"
"0000233589" "0000476297"
"0000233590" "0000476298"
"0000233591" "0000476299"
"0000233592" "0000476300"
"0000233593" "0000476301"
"0000233594" "0000476302"
"0000233595" "0000476303"
"0000233596" "0000476304"
"0000233597" "0000476305"
"0000233598" "0000476306"
"0000233599" "0000476307"
"0000233600" "0000476308"
"0000233601" "0000476309"
"0000233602" "0000476310"
"0000233603" "0000476311"
"0000233604" "0000476312"
"0000233605" "0000476313"
"0000233606" "0000476314"
"0000233607" "0000476315"
"0000233608" "0000476316"
"0000233609" "0000476317"
"0000233610" "0000476318"
"0000233611" "0000476319"
"0000233612" "0000476320"
"0000233613" "0000476321"
"0000233614" "0000476322"
"0000233615" "0000476323"
"0000233616" "0000476324"
"0000233617" "0000476325"
"0000233618" "0000476326"
"0000233619" "0000476327"
"0000233620" "0000476328"
"0000233621" "0000476329"
"0000233622" "0000476330"
"0000233623" "0000476331"
"0000233624" "0000476332"
"0000234762" "0000477470"
"0000234763" "0000477471"
"0000234764" "0000477472"
"0000234765" "0000477473"
"0000247706" "0000500575"
"0000247707" "0000500576"
"0000271119" "0000624987"
"0000271120" "0000624988"
"0000271120" "0000624989"
"0000294807" "0000651496"
"0000294809" "0000651498"
"0000294822" "0000651511"
"0000301722" "0000664772"
"0000309677" "0000684550"
"0000309678" "0000684551"
"0000309679" "0000684552"
"0000309680" "0000684553"
"0000309764" "0000684637"
"0000309792" "0000684665"
"0000309793" "0000684666"
"0000309793" "0000684701"
"0000309794" "0000684667"
"0000309794" "0000684702"
"0000310437" "0000685348"
"0000310438" "0000685349"
"0000310439" "0000685350"
"0000310962" "0000686106"
"0000326719" "0000710311"
"0000329180" "0000713303"
"0000329202" "0000713325"
"0000329289" "0000713412"
"0000329289" "0000713760"
"0000329295" "0000713418"
"0000329295" "0000713764"
"0000329365" "0000713488"
"0000329365" "0000713805"
"0000329392" "0000713515"
"0000329392" "0000713816"
"0000329402" "0000713525"
"0000329402" "0000713824"
"0000329556" "0000713679"
"0000329708" "0000714065"
"0000332502" "0000729757"
"0000332845" "0000730219"
"0000332845" "0000730242"
"0000333399" "0000730972"
"0000333748" "0000731538"
"0000333748" "0000731565"
"0000333751" "0000731541"
"0000333751" "0000731566"
"0000334579" "0000732435"
"0000334579" "0000732458"
"0000334590" "0000732512"
"0000334868" "0000732875"
"0000335077" "0000733086"
"0000335077" "0000733545"
"0000335137" "0000733146"
"0000335137" "0000733591"
"0000335138" "0000733147"
"0000335138" "0000733592"
"0000335139" "0000733148"
"0000335201" "0000733210"
"0000335201" "0000733638"
"0000335202" "0000733211"
"0000335202" "0000733639"
"0000335699" "0000734417"
"0000335796" "0000734702"
"0000335797" "0000734703"
"0000335798" "0000734704"
"0000335799" "0000734705"
"0000336364" "0000735639"
"0000336364" "0000735752"
"0000336365" "0000735640"
"0000336365" "0000735753"
"0000336366" "0000735641"
"0000336366" "0000735754"
"0000336367" "0000735642"
"0000336367" "0000735755"
"0000336368" "0000735643"
"0000336368" "0000735756"
"0000336369" "0000735644"
"0000336369" "0000735757"
"0000336451" "0000735826"
"0000336459" "0000735834"
"0000336507" "0000735903"
"0000336508" "0000735904"
"0000336535" "0000735931"
"0000336536" "0000735932"
"0000336653" "0000736098"
"0000336653" "0000736139"
"0000336687" "0000736177"
"0000336687" "0000736239"
"0000336719" "0000736209"
"0000336720" "0000736210"
"0000336720" "0000736258"
"0000337182" "0000736806"
"0000360019" "0000759661"
"0000360030" "0000759672"
"0000360194" "0000760003"
"0000360198" "0000760014"
"0000360214" "0000759941"
"0000360214" "0000759962"
"0000360218" "0000760102"
"0000360375" "0000760267"
"0000360375" "0000760478"
"0000363460" "0000764115"
"0000363460" "0000764149"
"0000364136" "0000764898"
"0000364666" "0000765541"
"0000364666" "0000765586"
"0000364673" "0000765548"
"0000364673" "0000765589"
"0000364673" "0000765590"
"0000364689" "0000765564"
"0000364689" "0000765601"
"0000364690" "0000765565"
"0000364690" "0000765602"
"0000364691" "0000765566"
"0000364746" "0000765653"
"0000364867" "0000765809"
"0000364979" "0000765921"
"0000373316" "0000783288"
"0000373316" "0000783291"
"0000373318" "0000783290"
"0000373318" "0000783294"
"0000373856" "0000784371"
"0000373861" "0000784348"
"0000373878" "0000784401"
"0000373880" "0000784407"
"0000373886" "0000784398"
"0000373898" "0000784211"
"0000373898" "0000784580"
"0000373899" "0000784212"
"0000373899" "0000784589"
"0000373900" "0000784213"
"0000373900" "0000784581"
"0000373901" "0000784214"
"0000373901" "0000784597"
"0000373938" "0000784352"
"0000373947" "0000784471"
"0000373950" "0000784485"
"0000374607" "0000785399"
"0000374607" "0000785407"
"0000374608" "0000785400"
"0000374608" "0000785408"
"0000375067" "0000786334"
"0000375067" "0000786383"
"0000375091" "0000786358"
"0000375092" "0000786359"
"0000375092" "0000786396"
"0000376119" "0000787652"
"0000376119" "0000787710"
"0000376123" "0000787656"
"0000376126" "0000787659"
"0000376126" "0000787712"
"0000376163" "0000787696"
"0000376164" "0000787697"
"0000376171" "0000787739"
"0000376172" "0000787740"
"0000376174" "0000787741"
"0000376473" "0000788081"
"0000376473" "0000788161"
"0000376474" "0000788082"
"0000376475" "0000788083"
"0000376475" "0000788162"
"0000376476" "0000788084"
"0000376498" "0000788106"
"0000376534" "0000788142"
"0000377365" "0000789682"
"0000377367" "0000789685"
"0000377367" "0000789686"
"0000377368" "0000789687"
"0000377369" "0000789688"
"0000377377" "0000789696"
"0000377380" "0000789699"
"0000377382" "0000789701"
"0000377718" "0000790142"
"0000377718" "0000790143"
"0000377735" "0000790160"
"0000377967" "0000790417"
"0000377968" "0000790418"
"0000377968" "0000790515"
"0000377970" "0000790525"
"0000377978" "0000790570"
"0000377979" "0000790429"
"0000377983" "0000790582"
"0000377985" "0000790435"
"0000377985" "0000790586"
"0000377991" "0000790611"
"0000377992" "0000790616"
"0000377993" "0000790617"
"0000378002" "0000790643"
"0000378073" "0000790742"
"0000378409" "0000791164"
"0000378449" "0000791204"
"0000378747" "0000791637"
"0000379024" "0000792052"
"0000379024" "0000792053"
"0000379252" "0000792386"
"0000379252" "0000792387"
"0000380588" "0000793733"
"0000380597" "0000793742"
"0000380725" "0000793895"
"0000380725" "0000793896"
"0000380874" "0000794102"
"0000380874" "0000794103"
"0000380966" "0000794220"
"0000381056" "0000794348"
"0000381056" "0000794349"
"0000381057" "0000794350"
"0000381057" "0000794351"
"0000381058" "0000794352"
"0000381059" "0000794353"
"0000381060" "0000794354"
"0000381060" "0000794355"
"0000381465" "0000794925"
"0000381466" "0000794926"
"0000381467" "0000794927"
"0000381468" "0000794928"
"0000381472" "0000794932"
"0000381524" "0000794985"
"0000381585" "0000795063"
"0000382209" "0000795923"
"0000382295" "0000796045"
"0000382296" "0000796046"
"0000382297" "0000796047"
"0000382376" "0000796161"
"0000382382" "0000796169"
"0000382382" "0000796170"
"0000382819" "0000796687"
"0000382820" "0000796689"
"0000382837" "0000796722"
"0000382845" "0000796739"
"0000382852" "0000796752"
"0000382852" "0000796753"
"0000382852" "0000796754"
"0000382870" "0000796804"
"0000382932" "0000796899"
"0000382932" "0000796900"
"0000383088" "0000797080"
"0000383089" "0000797081"
"0000383090" "0000797082"
"0000383353" "0000797414"
"0000383353" "0000797456"
"0000383554" "0000797718"
"0000383555" "0000797719"
"0000383555" "0000797720"
"0000383556" "0000797721"
"0000383556" "0000797722"
"0000383557" "0000797723"
"0000383558" "0000797724"
"0000383559" "0000797725"
"0000383559" "0000797726"
"0000383561" "0000797728"
"0000383561" "0000797729"
"0000383767" "0000798017"
"0000383787" "0000798042"
"0000383788" "0000798043"
"0000384006" "0000798423"
"0000384718" "0000811486"
"0000384719" "0000811487"
"0000384719" "0000811522"
"0000384720" "0000811488"
"0000384720" "0000811523"
"0000384986" "0000811827"
"0000384986" "0000811882"
"0000385006" "0000811847"
"0000385007" "0000811848"
"0000385131" "0000812009"
"0000385187" "0000812094"
"0000385428" "0000812476"
"0000385863" "0000813029"
"0000385994" "0000813211"
"0000386289" "0000813696"
"0000386290" "0000813697"
"0000386329" "0000813798"
"0000386330" "0000813801"
"0000386959" "0000814782"
"0000386959" "0000814813"
"0000387188" "0000815067"
"0000387189" "0000815068"
"0000387192" "0000815071"
"0000387193" "0000815072"
"0000387401" "0000815575"
"0000387485" "0000815516"
"0000387521" "0000815405"
"0000387530" "0000815630"
"0000387530" "0000815631"
"0000387840" "0000815998"
"0000387840" "0000816341"
"0000387869" "0000816027"
"0000387869" "0000816369"
"0000387881" "0000816039"
"0000387881" "0000816376"
"0000387955" "0000816113"
"0000387955" "0000816432"
"0000388036" "0000816194"
"0000388036" "0000816494"
"0000388036" "0000816495"
"0000388039" "0000816197"
"0000388039" "0000816498"
"0000388105" "0000816263"
"0000388133" "0000816291"
"0000388292" "0000816752"
"0000388293" "0000816753"
"0000388294" "0000816754"
"0000388294" "0000816843"
"0000388295" "0000816755"
"0000388296" "0000816756"
"0000388297" "0000816757"
"0000388298" "0000816758"
"0000388298" "0000816844"
"0000389712" "0000818930"
"0000389712" "0000818931"
"0000390005" "0000819350"
"0000390005" "0000820621"
"0000390006" "0000819351"
"0000390006" "0000820622"
"0000390318" "0000819663"
"0000390318" "0000820691"
"0000390474" "0000819819"
"0000390537" "0000819882"
"0000390605" "0000819950"
"0000390661" "0000820006"
"0000390661" "0000820782"
"0000390662" "0000820007"
"0000390662" "0000820783"
"0000390788" "0000820133"
"0000390883" "0000820228"
"0000391025" "0000820370"
"0000391088" "0000820433"
"0000391090" "0000820435"
"0000391090" "0000820915"
"0000391096" "0000820441"
"0000391118" "0000820463"
"0000391179" "0000820524"
"0000391179" "0000820957"
"0000391211" "0000820556"
"0000391211" "0000820974"
"0000391221" "0000820566"
"0000391574" "0000821323"
"0000391575" "0000821324"
"0000391575" "0000821586"
"0000391576" "0000821325"
"0000391576" "0000821587"
"0000391577" "0000821326"
"0000391577" "0000821588"
"0000391578" "0000821327"
"0000391578" "0000821589"
"0000391579" "0000821328"
"0000391579" "0000821590"
"0000391580" "0000821329"
"0000391998" "0000822110"
"0000392015" "0000822117"
"0000393817" "0000824639"
"0000393853" "0000824675"
"0000393854" "0000824676"
"0000393854" "0000824771"
"0000393867" "0000824689"
"0000393867" "0000824778"
"0000393877" "0000824699"
"0000393924" "0000824746"
"0000393924" "0000824808"
"0000393925" "0000824747"
"0000394737" "0000825738"
"0000394737" "0000825739"
"0000394827" "0000825875"
"0000394828" "0000825876"
"0000394862" "0000825923"
"0000394862" "0000825924"
"0000394960" "0000826079"
"0000394960" "0000826080"
"0000395044" "0000826209"
"0000395044" "0000826210"
"0000395058" "0000826232"
"0000395058" "0000826233"
"0000395086" "0000826274"
"0000395086" "0000826275"
"0000395573" "0000826944"
"0000395864" "0000827308"
"0000395864" "0000827309"
"0000395865" "0000827310"
"0000395865" "0000827311"
"0000395866" "0000827312"
"0000395867" "0000827313"
"0000395868" "0000827314"
"0000396814" "0000828498"
"0000396814" "0000828499"
"0000397035" "0000828781"
"0000397035" "0000828986"
"0000397655" "0000829703"
"0000397655" "0000829724"
"0000397740" "0000829820"
"0000397740" "0000829821"
"0000397751" "0000829832"
"0000397758" "0000829839"
"0000397758" "0000829840"
"0000397763" "0000829847"
"0000397793" "0000829881"
"0000397793" "0000829882"
"0000397809" "0000829983"
"0000397815" "0000829893"
"0000400051" "0000832801"
"0000400051" "0000832802"
"0000400062" "0000832814"
"0000400062" "0000832818"
"0000400063" "0000832815"
"0000400063" "0000832819"
"0000400064" "0000832816"
"0000400064" "0000832820"
"0000400065" "0000832817"
"0000400065" "0000832821"
"0000400066" "0000832822"
"0000400066" "0000832846"
"0000400067" "0000832823"
"0000400067" "0000832847"
"0000400068" "0000832824"
"0000400068" "0000832848"
"0000400069" "0000832825"
"0000400070" "0000832826"
"0000400071" "0000832827"
"0000400071" "0000832849"
"0000400072" "0000832828"
"0000400073" "0000832829"
"0000400074" "0000832830"
"0000400074" "0000832850"
"0000400075" "0000832831"
"0000400076" "0000832832"
"0000400077" "0000832833"
"0000400077" "0000832851"
"0000400078" "0000832834"
"0000400079" "0000832835"
"0000400080" "0000832836"
"0000400080" "0000832852"
"0000400081" "0000832837"
"0000400082" "0000832838"
"0000400082" "0000832853"
"0000400083" "0000832839"
"0000400083" "0000832854"
"0000400084" "0000832840"
"0000400085" "0000832841"
"0000400085" "0000832855"
"0000400086" "0000832842"
"0000400087" "0000832843"
"0000400087" "0000832856"
"0000400088" "0000832844"
"0000400089" "0000832845"
"0000400089" "0000832857"
"0000400103" "0000832871"
"0000400119" "0000832887"
"0000400120" "0000832894"
"0000400122" "0000832897"
"0000400123" "0000832898"
"0000400124" "0000832899"
"0000400125" "0000832900"
"0000400126" "0000832901"
"0000400127" "0000832902"
"0000400128" "0000832903"
"0000400129" "0000832904"
"0000400130" "0000832905"
"0000400131" "0000832906"
"0000400132" "0000832907"
"0000400133" "0000832908"
"0000400134" "0000832909"
"0000400135" "0000832910"
"0000400136" "0000832911"
"0000400137" "0000832912"
"0000400138" "0000832913"
"0000400139" "0000832914"
"0000400140" "0000832915"
"0000400141" "0000832916"
"0000400142" "0000832917"
"0000400211" "0000833014"
"0000400211" "0000833016"
"0000400212" "0000833015"
"0000400212" "0000833017"
"0000400213" "0000833018"
"0000400214" "0000833019"
"0000400214" "0000833021"
"0000400215" "0000833020"
"0000400215" "0000833022"
"0000400216" "0000833023"
"0000400217" "0000833024"
"0000400218" "0000833025"
"0000400219" "0000833026"
"0000400220" "0000833027"
"0000400221" "0000833028"
"0000400222" "0000833029"
"0000400223" "0000833030"
"0000400423" "0000833272"
"0000400424" "0000833273"
"0000400424" "0000833323"
"0000400425" "0000833274"
"0000400425" "0000833324"
"0000400426" "0000833275"
"0000400427" "0000833276"
"0000400428" "0000833277"
"0000400429" "0000833278"
"0000400429" "0000833325"
"0000400430" "0000833279"
"0000400431" "0000833280"
"0000400431" "0000833326"
"0000400432" "0000833281"
"0000400432" "0000833327"
"0000400433" "0000833282"
"0000400433" "0000833328"
"0000400434" "0000833283"
"0000400434" "0000833329"
"0000400435" "0000833284"
"0000400435" "0000833330"
"0000400436" "0000833285"
"0000400436" "0000833331"
"0000400437" "0000833286"
"0000400437" "0000833332"
"0000400438" "0000833287"
"0000400439" "0000833288"
"0000400439" "0000833333"
"0000400440" "0000833289"
"0000400440" "0000833335"
"0000400441" "0000833290"
"0000400441" "0000833336"
"0000400442" "0000833291"
"0000400443" "0000833292"
"0000400444" "0000833293"
"0000400444" "0000833337"
"0000400445" "0000833294"
"0000400445" "0000833338"
"0000400446" "0000833295"
"0000400446" "0000833339"
"0000400447" "0000833296"
"0000400447" "0000833340"
"0000400448" "0000833297"
"0000400448" "0000833341"
"0000400449" "0000833298"
"0000400449" "0000833342"
"0000400450" "0000833299"
"0000400451" "0000833300"
"0000400451" "0000833343"
"0000400452" "0000833301"
"0000400452" "0000833344"
"0000400453" "0000833302"
"0000400454" "0000833303"
"0000400455" "0000833304"
"0000400455" "0000833345"
"0000400456" "0000833305"
"0000400456" "0000833346"
"0000400457" "0000833306"
"0000400458" "0000833307"
"0000400458" "0000833347"
"0000400459" "0000833308"
"0000404501" "0000840244"
"0000409315" "0000846461"
"0000412612" "0000869967"
"0000412613" "0000869968"
"0000413925" "0000871513"
"0000421856" "0000896675"
"0000421856" "0000896676"
"0000430908" "0000915797"
"0000430924" "0000915817"
"0000430927" "0000915821"
"0000430929" "0000915824"
"0000430943" "0000915847"
"0000430951" "0000915856"
"0000430951" "0000915857"
"0000430977" "0000915894"
"0000431032" "0000915971"
"0000431038" "0000915980"
"0000431044" "0000915987"
"0000431110" "0000916077"
"0000431113" "0000916080"
"0000431129" "0000916102"
"0000431129" "0000916103"
"0000431143" "0000916128"
"0000431237" "0000916286"
"0000431250" "0000916305"
"0000431250" "0000916306"
"0000431256" "0000916313"
"0000431261" "0000916319"
"0000431261" "0000916320"
"0000431339" "0000916439"
"0000431371" "0000916487"
"0000431371" "0000916488"
"0000431507" "0000916697"
"0000431543" "0000916748"
"0000431553" "0000916759"
"0000431553" "0000916760"
"0000448559" "0000958045"
"0000448577" "0000958063"
"0000448577" "0000958451"
"0000448713" "0000958546"
"0000448715" "0000958549"
"0000448893" "0000958379"
"0000449089" "0000958856"
"0000449282" "0000959470"
"0000449303" "0000959070"
"0000462744" "0001022295"
"0000462744" "0001022346"
"0000471698" "0001059922"