### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PDZD7) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PDZD7" "PDZ domain containing 7" "10" "q24.32" "unknown" "NG_028030.1" "UD_132118664593" "" "https://www.LOVD.nl/PDZD7" "KMeyeDB \r\nDeafness Variation Database \r\nMoBiDiC " "1" "26257" "79955" "612971" "1" "1" "1" "1" "The database is curated by the Montpellier Usher group.
You can directly access the PDZD7 database using: www.LOVD.nl/PDZD7
If you wish to perform particular analyses, please do not hesitate to contact us. We hope that you will find these databases useful!
This database is one of the ”Retinal and hearing impairment genetic variant databases”.
Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/PDZD7_codingDNA.html" "1" "" "
\r\nThis database is one of the ”Retinal and hearing impairment genetic variant databases”." "-1" "" "-1" "00001" "2013-02-19 00:00:00" "00006" "2021-06-22 16:45:45" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024123" "PDZD7" "transcript variant 1" "001" "NM_001195263.1" "" "NP_001182192.1" "" "" "" "-250" "3886" "3102" "102790914" "102767440" "00006" "2016-04-30 15:49:20" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00531" "DFNB;ARNSHL" "deafness, autosomal recessive, nonsyndromic (DFNB, autosomal recessive non syndromic hearing loss (ARNSHL))" "" "" "" "" "" "00006" "2014-09-21 11:25:16" "00006" "2015-12-08 23:59:30" "00669" "USH2C" "Usher syndrome,, type IIC (USH2C, GPR98/PDZD7 digenic)" "AR;DD" "605472" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02115" "USH1" "Usher syndrome, type I (USH-1)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-11 13:56:28" "02116" "USH2A" "Usher syndrome,, type 2A (USH2A)" "AR" "276901" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05103" "deafness" "deafness" "" "" "" "" "" "00006" "2015-12-02 12:30:46" "00006" "2017-08-25 19:47:08" "05414" "USH2" "Usher syndrome, type II (USH-2)" "" "" "" "" "" "00006" "2018-04-02 14:40:34" "00006" "2021-12-11 13:56:28" "05458" "DFN" "deafness, nonsyndromic (DFN)" "" "" "" "" "" "00006" "2018-07-12 10:48:26" "" "" "05949" "DFNB57" "deafness, autosomal recessive, type 57 (DFNB57)" "AR" "618003" "" "" "" "00006" "2021-06-22 16:46:51" "" "" "05981" "USH1" "Usher syndrome, type I" "" "276903" "" "" "" "00110" "2021-10-25 15:10:06" "00006" "2021-12-11 13:56:28" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "PDZD7" "00669" "PDZD7" "02116" "PDZD7" "05086" "PDZD7" "05458" "PDZD7" "05949" ## Individuals ## Do not remove or alter this header ## ## Count = 47 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00059178" "" "" "" "1" "" "01551" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "" "" "0" "" "" "" "" "00059188" "" "" "" "1" "" "01551" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "" "" "0" "" "" "" "" "00081426" "" "" "" "4" "" "01224" "" "family, affected homozygous mother and 3 children, heterozygous unaffected father/child" "F" "yes" "Pakistan" "" "0" "" "" "" "" "00163026" "" "" "" "3" "" "02416" "{PMID:Booth 2015:26416264}" "2-generation family, 3 affected sibs (2F, M), unaffected heterozygous carrier parents" "F" "" "Iran" "" "0" "" "" "" "FamL-755PatII1" "00163027" "" "" "00163026" "1" "" "02416" "{PMID:Booth 2015:26416264}" "brother" "M" "" "Iran" "" "0" "" "" "" "FamL-755PatII3" "00163028" "" "" "00163026" "1" "" "02416" "{PMID:Booth 2015:26416264}" "sister" "F" "" "" "" "0" "" "" "" "FamL-755PatII4" "00163029" "" "" "" "2" "" "02416" "{PMID:Booth 2015:26416264}" "Proband" "M" "" "Iran" "" "0" "" "" "" "FamL-8600482PatII2" "00163030" "" "" "00163029" "1" "" "02416" "{PMID:Booth 2015:26416264}" "sister" "F" "" "Iran" "" "0" "" "" "" "FamL-8600482PatII3" "00163031" "" "" "" "4" "" "02416" "{PMID:Booth 2015:26416264}" "2-generation family, 4 affected sibs (2F, 2M), unaffected heterozygous carrier parents" "F" "" "Iran" "" "0" "" "" "" "FamL-445PatII1" "00163032" "" "" "00163031" "1" "" "02416" "{PMID:Booth 2015:26416264}" "sister" "F" "" "Iran" "" "0" "" "" "" "FamL-445PatII2" "00163033" "" "" "00163031" "1" "" "02416" "{PMID:Booth 2015:26416264}" "brother" "M" "" "Iran" "" "0" "" "" "" "FamL-445PatII4" "00163034" "" "" "00163031" "1" "" "02416" "{PMID:Booth 2015:26416264}" "brother" "M" "" "Iran" "" "0" "" "" "" "FamL-445PatII6" "00163035" "" "" "" "3" "" "02416" "{PMID:Booth 2015:26416264}" "2-generation family, 3 affected sibs (2F, M), unaffected heterozygous carrier parents" "M" "" "Iran" "" "0" "" "" "" "FamL-8900092PatII1" "00163036" "" "" "00163035" "1" "" "02416" "{PMID:Booth 2015:26416264}" "sister" "F" "" "Iran" "" "0" "" "" "" "FamL-8900092PatII2" "00163037" "" "" "00163035" "1" "" "02416" "{PMID:Booth 2015:26416264}" "sister" "F" "" "Iran" "" "0" "" "" "" "FamL-8900092PatII3" "00163038" "" "" "" "1" "" "02404" "{PMID:Vona et al., 2016:26849169}" "Proband - Autosomal recessive deafness" "" "" "" "" "0" "" "" "" "" "00163039" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00163040" "" "" "" "1" "" "02416" "{PMID:Rong et al., 2014:24831256}" "Proband" "F" "" "China" "" "0" "" "" "" "" "00163041" "" "" "" "1" "" "02416" "{PMID:Rong et al., 2014:24831256}" "Proband" "M" "" "China" "" "0" "" "" "" "" "00163042" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00163043" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00163044" "" "" "" "1" "" "02416" "{PMID:Ebermann et al., 2010:20440071}" "Proband - Carries c.1750-2A>G in PDZD7 - heterozygous, 0/200 controls" "F" "" "" "" "0" "" "" "" "" "00163045" "" "" "" "1" "" "02416" "{PMID:Ebermann et al., 2009:18665195}" "Proband" "F" "" "Canada" "" "0" "" "" "" "" "00163046" "" "" "" "1" "" "02428" "{PMID:Bonnet et al., 2016:27460420}" "Proband" "M" "" "Italy" "" "0" "" "" "" "" "00163047" "" "" "" "1" "" "02416" "{PMID:Rong et al., 2014:24831256}" "Proband - variants found in samples of two affected brothers. They carry the same causative mutations in MYO7A, but other variants cannot be discriminated from the publication." "M" "" "China" "" "0" "" "" "" "" "00163048" "" "" "" "1" "" "02416" "{PMID:Ebermann et al., 2010:20440071}" "Proband - carries c.2194_2203del - p.Cys732Leufs* in PDZD7 - heterozygous, 0/405 controls" "M" "" "Germany" "" "0" "" "" "" "" "00163049" "" "" "" "1" "" "02416" "{PMID:Ebermann et al., 2010:20440071}" "Proband" "M" "" "France" "" "0" "" "" "" "" "00163050" "" "" "" "1" "" "02416" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "Proband" "F" "" "France" "" "0" "" "" "" "" "00275934" "" "" "" "1" "" "03557" "{PMID:Kim 2020:32203226}, {DOI:Kim 2020:10.1038/s41436-020-0774-9}" "" "" "" "Korea" "" "0" "" "" "" "SB78-137" "00289977" "" "" "" "159" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289978" "" "" "" "156" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289979" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289980" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295949" "" "" "" "1" "" "03607" "" "" "F" "?" "Korea, South (Republic)" "00y05m" "0" "" "" "Asian" "SB297-597" "00304227" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304228" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00325522" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "EC06" "00375416" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#008" "00375422" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#015" "00384215" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066887" "00386384" "" "" "" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2020:32050993}" "father of III:3" "M" "" "Spain" "" "0" "" "" "" "II:1" "00386385" "" "" "" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2020:32050993}" "proband" "F" "" "Spain" "" "0" "" "" "" "III:3" "00386959" "" "" "" "1" "" "02416" "{PMID:Mansard et al, 2021:34948090}" "" "?" "" "" "" "0" "" "" "" "" "00387243" "" "" "" "1" "" "02416" "{PMID:Mansard et al, 2021:34948090}" "" "M" "" "" "" "0" "" "" "" "" "00407356" "" "" "" "1" "" "00000" "{PMID:Borràs 2013:23534816}" "" "" "" "Spain" "" "0" "" "" "Spanish" "RP-95" "00447595" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-907" "00447706" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1166" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 47 "{{individualid}}" "{{diseaseid}}" "00059178" "00531" "00059188" "00531" "00081426" "00531" "00163026" "05103" "00163027" "05103" "00163028" "05103" "00163029" "05103" "00163030" "05103" "00163031" "05103" "00163032" "05103" "00163033" "05103" "00163034" "05103" "00163035" "05103" "00163036" "05103" "00163037" "05103" "00163038" "05103" "00163039" "05103" "00163040" "02115" "00163041" "02115" "00163042" "02115" "00163043" "02115" "00163044" "05414" "00163045" "05414" "00163046" "05414" "00163047" "05414" "00163048" "05414" "00163049" "05414" "00163050" "05414" "00275934" "05103" "00289977" "00198" "00289978" "00198" "00289979" "00198" "00289980" "00198" "00295949" "05103" "00304227" "00198" "00304228" "00198" "00325522" "04214" "00375416" "04214" "00375422" "04214" "00384215" "04214" "00386384" "04214" "00386385" "04214" "00386959" "02116" "00387243" "05981" "00407356" "04214" "00447595" "00198" "00447706" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00531, 00669, 02115, 02116, 04214, 05086, 05103, 05414, 05458, 05949, 05981 ## Count = 37 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000061015" "00531" "00081426" "01224" "Familial, autosomal recessive" "" "Autosomal recessive nonsyndromic hearing loss" "" "" "" "" "" "" "" "" "" "" "" "0000128163" "05103" "00163026" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128164" "05103" "00163027" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128165" "05103" "00163028" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128166" "05103" "00163029" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128167" "05103" "00163030" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128168" "05103" "00163031" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128169" "05103" "00163032" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128170" "05103" "00163033" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128171" "05103" "00163034" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128172" "05103" "00163035" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128173" "05103" "00163036" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128174" "05103" "00163037" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128175" "05103" "00163038" "02404" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128176" "05103" "00163039" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "deafness, non-syndromic (DFN)" "" "0000128177" "02115" "00163040" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type I (USH1)" "" "0000128178" "02115" "00163041" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type I (USH1)" "" "0000128179" "02115" "00163042" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type I (USH1)" "" "0000128180" "02115" "00163043" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type I (USH1)" "" "0000128181" "05414" "00163044" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128182" "05414" "00163045" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128183" "05414" "00163046" "02428" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128184" "05414" "00163047" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128185" "05414" "00163048" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128186" "05414" "00163049" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000128187" "05414" "00163050" "02416" "-" "" "" "" "" "" "" "" "" "" "" "" "Usher type II (USH2)" "" "0000210534" "05103" "00275934" "03557" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223425" "05103" "00295949" "03607" "Familial, autosomal recessive" "" "SNHL, moderate hearing loss" "" "" "" "" "" "" "" "" "" "" "" "0000244009" "04214" "00325522" "00006" "Unknown" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000270630" "04214" "00375416" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270636" "04214" "00375422" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278000" "04214" "00384215" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000280192" "04214" "00386384" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "autosomal dominant etinitis pigmentosa" "" "0000280193" "04214" "00386385" "00000" "Familial, autosomal recessive" "38y" "Night blindness, reduction of the visual field" "22y" "" "Night blindness" "" "" "" "" "" "Retinitis pigmentosa" "autosomal dominant etinitis pigmentosa" "" "0000299710" "04214" "00407356" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "severe autosomal dominant retinitis pigmentosa (adRP)" "" "0000336794" "00198" "00447595" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336905" "00198" "00447706" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" ## Screenings ## Do not remove or alter this header ## ## Count = 47 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000059161" "00059178" "1" "01551" "01551" "2016-02-29 16:22:20" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000059171" "00059188" "1" "01551" "01551" "2016-02-29 16:59:33" "00006" "2016-04-30 15:39:04" "SEQ;SEQ-NG-I" "DNA" "" "" "0000081540" "00081426" "1" "01224" "01224" "2016-10-11 14:22:11" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000163891" "00163026" "1" "02416" "00110" "2015-12-11 10:45:17" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163892" "00163027" "1" "02416" "00110" "2015-12-11 10:47:10" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163893" "00163028" "1" "02416" "00110" "2015-12-11 10:48:16" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163894" "00163029" "1" "02416" "00110" "2015-12-11 18:18:12" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163895" "00163030" "1" "02416" "00110" "2015-12-11 18:19:13" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163896" "00163031" "1" "02416" "00110" "2015-12-11 10:33:00" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163897" "00163032" "1" "02416" "00110" "2015-12-11 10:36:49" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163898" "00163033" "1" "02416" "00110" "2015-12-11 10:38:01" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163899" "00163034" "1" "02416" "00110" "2015-12-11 10:38:59" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163900" "00163035" "1" "02416" "00110" "2015-12-11 18:09:33" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163901" "00163036" "1" "02416" "00110" "2015-12-11 18:13:05" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163902" "00163037" "1" "02416" "00110" "2015-12-11 18:15:00" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163903" "00163038" "1" "02404" "02404" "2015-10-04 16:40:08" "00110" "2016-02-15 09:40:07" "SEQ-NG-S" "DNA" "" "" "0000163904" "00163039" "1" "02416" "00110" "2013-02-11 12:51:01" "00110" "2014-02-06 10:22:53" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163905" "00163040" "1" "02416" "00110" "2014-08-04 14:53:08" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163906" "00163041" "1" "02416" "00110" "2014-08-04 15:55:38" "" "" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163907" "00163042" "1" "02416" "00110" "2013-02-08 16:51:53" "00110" "2014-02-06 10:22:53" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163908" "00163043" "1" "02416" "00110" "2013-02-08 12:43:07" "00110" "2014-02-06 10:22:53" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163909" "00163044" "1" "02416" "00110" "2010-06-10 11:54:18" "00110" "2010-06-10 11:55:48" "SEQ" "DNA" "" "" "0000163910" "00163045" "1" "02416" "02416" "2010-03-01 09:22:54" "00110" "2013-02-21 18:05:03" "SEQ" "DNA" "" "" "0000163911" "00163046" "1" "02428" "00110" "2016-05-31 17:30:31" "00110" "2016-08-01 14:48:50" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163912" "00163047" "1" "02416" "00110" "2014-08-04 11:55:33" "00110" "2014-08-04 14:20:13" "SEQ;SEQ-NG-S" "DNA" "" "" "0000163913" "00163048" "1" "02416" "00110" "2010-06-10 12:03:37" "" "" "SEQ" "DNA" "" "" "0000163914" "00163049" "1" "02416" "00110" "2013-02-22 09:32:04" "" "" "SEQ" "DNA" "" "" "0000163915" "00163050" "1" "02416" "00110" "2012-07-05 16:26:53" "00110" "2014-02-06 10:22:53" "SEQ-NG-S;Southern" "DNA" "" "" "0000277087" "00275934" "1" "03557" "03557" "2020-01-21 09:02:00" "" "" "SEQ-NG-I" "DNA" "" "" "0000291145" "00289977" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291146" "00289978" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291147" "00289979" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291148" "00289980" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297121" "00295949" "1" "03607" "03607" "2020-03-30 13:46:37" "" "" "SEQ-NG-I" "DNA" "whole blood" "WES" "0000305356" "00304227" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305357" "00304228" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000326733" "00325522" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000376613" "00375416" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376619" "00375422" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000385440" "00384215" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep" "0000387612" "00386384" "1" "00000" "03840" "2021-10-22 11:28:19" "" "" "SEQ" "DNA" "blood" "" "0000387613" "00386385" "1" "00000" "03840" "2021-10-22 11:28:19" "" "" "SEQ" "DNA" "blood" "" "0000388185" "00386959" "1" "02416" "02416" "2021-10-28 13:56:02" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000388469" "00387243" "1" "02416" "02416" "2021-10-28 14:06:26" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000408604" "00407356" "1" "00000" "00008" "2022-04-06 13:32:24" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000449172" "00447595" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449283" "00447706" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 36 "{{screeningid}}" "{{geneid}}" "0000059161" "PDZD7" "0000059171" "PDZD7" "0000059171" "TECTA" "0000059171" "TMC1" "0000163891" "PDZD7" "0000163892" "PDZD7" "0000163893" "PDZD7" "0000163894" "PDZD7" "0000163895" "PDZD7" "0000163896" "PDZD7" "0000163897" "PDZD7" "0000163898" "PDZD7" "0000163899" "PDZD7" "0000163900" "PDZD7" "0000163901" "PDZD7" "0000163902" "PDZD7" "0000163903" "PDZD7" "0000163904" "PDZD7" "0000163905" "PDZD7" "0000163906" "PDZD7" "0000163907" "PDZD7" "0000163908" "PDZD7" "0000163909" "PDZD7" "0000163910" "PDZD7" "0000163911" "PDZD7" "0000163912" "PDZD7" "0000163913" "PDZD7" "0000163914" "PDZD7" "0000163915" "PDZD7" "0000277087" "PDZD7" "0000297121" "PDZD7" "0000326733" "PDZD7" "0000385440" "PDZD7" "0000387612" "USH2A" "0000387613" "USH2A" "0000408604" "SLC1A7" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 165 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000089979" "0" "50" "10" "102770321" "102770332" "del" "0" "01551" "PDZD7_000021" "g.102770321_102770332del" "" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "Germline" "" "" "0" "" "" "g.101010564_101010575del" "" "VUS" "" "0000096180" "0" "70" "10" "102770315" "102770332" "del" "0" "01551" "PDZD7_000020" "g.102770315_102770332del" "" "{PMID:Sommen 2016:27068579}, {DOI:Sommen 2016:10.1002/humu.22999}" "" "" "" "Germline" "" "" "0" "" "" "g.101010558_101010575del" "" "likely pathogenic" "" "0000132197" "3" "70" "10" "102789749" "102789752" "del" "0" "01224" "PDZD7_000022" "g.102789749_102789752del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.101029992_101029995del" "" "likely pathogenic" "" "0000246885" "0" "10" "10" "102768383" "102768383" "subst" "0.00222161" "02330" "PDZD7_000040" "g.102768383A>G" "" "" "" "PDZD7(NM_001195263.1):c.2943T>C (p.D981=), PDZD7(NM_001195263.2):c.2943T>C (p.D981=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101008626A>G" "" "benign" "" "0000246923" "0" "10" "10" "102778069" "102778069" "subst" "8.19887E-6" "02330" "PDZD7_000026" "g.102778069A>T" "" "" "" "PDZD7(NM_001195263.2):c.1325-16T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101018312A>T" "" "benign" "" "0000246948" "0" "30" "10" "102777967" "102777967" "subst" "0.000450743" "02330" "PDZD7_000025" "g.102777967A>G" "" "" "" "PDZD7(NM_001195263.1):c.1411T>C (p.F471L), PDZD7(NM_001195263.2):c.1411T>C (p.F471L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101018210A>G" "" "likely benign" "" "0000248622" "0" "10" "10" "102770327" "102770327" "subst" "0.807781" "02325" "PDZD7_000038" "g.102770327A>G" "" "" "" "PDZD7(NM_001195263.2):c.2319T>C (p.R773=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010570A>G" "" "benign" "" "0000254139" "0" "30" "10" "102768383" "102768383" "subst" "0.00222161" "01943" "PDZD7_000040" "g.102768383A>G" "" "" "" "PDZD7(NM_001195263.1):c.2943T>C (p.D981=), PDZD7(NM_001195263.2):c.2943T>C (p.D981=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101008626A>G" "" "likely benign" "" "0000254354" "0" "30" "10" "102770585" "102770585" "subst" "3.14569E-5" "01943" "PDZD7_000023" "g.102770585A>T" "" "" "" "PDZD7(NM_001195263.1):c.2061T>A (p.D687E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010828A>T" "" "likely benign" "" "0000254822" "0" "30" "10" "102775504" "102775504" "subst" "7.8012E-5" "01943" "PDZD7_000024" "g.102775504A>G" "" "" "" "PDZD7(NM_001195263.1):c.1638T>C (p.N546=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015747A>G" "" "likely benign" "" "0000256590" "0" "50" "10" "102782113" "102782113" "subst" "0.00361842" "01943" "PDZD7_000032" "g.102782113A>T" "" "" "" "PDZD7(NM_001195263.1):c.572T>A (p.V191E, p.(Val191Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101022356A>T" "" "VUS" "" "0000266347" "0" "30" "10" "102752964" "102752964" "subst" "4.06101E-6" "02325" "C10orf2_000024" "g.102752964C>T" "" "" "" "TWNK(NM_021830.5):c.1752C>T (p.D584=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.100993207C>T" "" "likely benign" "" "0000272222" "0" "30" "10" "102753066" "102753066" "subst" "2.84239E-5" "01943" "C10orf2_000025" "g.102753066G>A" "" "" "" "C10orf2(NM_021830.4):c.1854G>A (p.P618=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.100993309G>A" "" "likely benign" "" "0000272223" "0" "30" "10" "102753192" "102753192" "subst" "2.43778E-5" "01943" "C10orf2_000027" "g.102753192G>A" "" "" "" "C10orf2(NM_021830.4):c.1980G>A (p.T660=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.100993435G>A" "" "likely benign" "" "0000293647" "0" "30" "10" "102778030" "102778032" "del" "0" "02330" "PDZD7_000059" "g.102778030_102778032del" "" "" "" "PDZD7(NM_001195263.2):c.1348_1350delGAG (p.E450del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101018273_101018275del" "" "likely benign" "" "0000293648" "0" "10" "10" "102777931" "102777931" "subst" "0.00114514" "02330" "PDZD7_000058" "g.102777931C>T" "" "" "" "PDZD7(NM_001195263.1):c.1447G>A (p.D483N), PDZD7(NM_001195263.2):c.1447G>A (p.D483N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101018174C>T" "" "benign" "" "0000293649" "0" "10" "10" "102776203" "102776203" "subst" "2.80344E-5" "02330" "PDZD7_000057" "g.102776203C>T" "" "" "" "PDZD7(NM_001195263.2):c.1523-19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101016446C>T" "" "benign" "" "0000293650" "0" "10" "10" "102789821" "102789821" "subst" "0.00137148" "02330" "PDZD7_000036" "g.102789821G>A" "" "" "" "PDZD7(NM_001195263.1):c.156C>T (p.N52=), PDZD7(NM_001195263.2):c.156C>T (p.N52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101030064G>A" "" "benign" "" "0000293651" "0" "30" "10" "102775563" "102775563" "subst" "0.000406899" "02330" "PDZD7_000056" "g.102775563C>T" "" "" "" "PDZD7(NM_001195263.2):c.1579G>A (p.E527K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015806C>T" "" "likely benign" "" "0000293652" "0" "10" "10" "102770415" "102770415" "subst" "0.00402808" "02330" "PDZD7_000050" "g.102770415C>T" "" "" "" "PDZD7(NM_001195263.1):c.2231G>A (p.(Arg744Gln)), PDZD7(NM_001195263.2):c.2231G>A (p.R744Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010658C>T" "" "benign" "" "0000293653" "0" "30" "10" "102783679" "102783679" "subst" "0" "02330" "PDZD7_000033" "g.102783679G>A" "" "" "" "PDZD7(NM_001195263.2):c.367+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101023922G>A" "" "likely benign" "" "0000293654" "0" "50" "10" "102778932" "102778932" "subst" "0.00180737" "02330" "PDZD7_000027" "g.102778932C>T" "" "" "" "PDZD7(NM_001195263.1):c.971G>A (p.S324N, p.(Ser324Asn)), PDZD7(NM_001195263.2):c.971G>A (p.S324N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101019175C>T" "" "VUS" "" "0000296885" "0" "10" "10" "102770082" "102770082" "subst" "0.814453" "02325" "PDZD7_000008" "g.102770082T>G" "" "" "" "PDZD7(NM_001195263.2):c.2564A>C (p.N855T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010325T>G" "" "benign" "" "0000296886" "0" "10" "10" "102780357" "102780357" "del" "0" "02325" "PDZD7_000028" "g.102780357del" "" "" "" "PDZD7(NM_001195263.2):c.928+20delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101020600del" "" "benign" "" "0000298849" "0" "70" "10" "102770318" "102770327" "del" "0.000261982" "02329" "PDZD7_000048" "g.102770318_102770327del" "" "" "" "PDZD7(NM_001195263.1):c.2319_2328delTAGCCGCAGC (p.S774Vfs*31), PDZD7(NM_001195263.2):c.2319_2328delTAGCCGCAGC (p.S774Vfs*31)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010561_101010570del" "" "likely pathogenic" "" "0000305427" "0" "30" "10" "102789821" "102789821" "subst" "0.00137148" "01943" "PDZD7_000036" "g.102789821G>A" "" "" "" "PDZD7(NM_001195263.1):c.156C>T (p.N52=), PDZD7(NM_001195263.2):c.156C>T (p.N52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101030064G>A" "" "likely benign" "" "0000305428" "0" "30" "10" "102775529" "102775529" "subst" "0.00700467" "01943" "PDZD7_000055" "g.102775529C>T" "" "" "" "PDZD7(NM_001195263.1):c.1613G>A (p.G538E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015772C>T" "" "likely benign" "" "0000305429" "0" "50" "10" "102775472" "102775472" "subst" "8.50895E-5" "01943" "PDZD7_000054" "g.102775472C>T" "" "" "" "PDZD7(NM_001195263.1):c.1670G>A (p.R557Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015715C>T" "" "VUS" "" "0000305430" "0" "50" "10" "102775470" "102775470" "subst" "0.000120549" "01943" "PDZD7_000053" "g.102775470G>A" "" "" "" "PDZD7(NM_001195263.1):c.1672C>T (p.R558W), PDZD7(NM_001195263.2):c.1672C>T (p.R558W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015713G>A" "" "VUS" "" "0000305431" "0" "30" "10" "102775426" "102775426" "subst" "3.54846E-5" "01943" "PDZD7_000052" "g.102775426G>A" "" "" "" "PDZD7(NM_001195263.1):c.1716C>T (p.D572=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101015669G>A" "" "likely benign" "" "0000305432" "0" "50" "10" "102770635" "102770635" "subst" "9.54472E-5" "01943" "PDZD7_000051" "g.102770635G>T" "" "" "" "PDZD7(NM_001195263.1):c.2011C>A (p.R671S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010878G>T" "" "VUS" "" "0000305433" "0" "50" "10" "102770396" "102770396" "subst" "0.00131383" "01943" "PDZD7_000049" "g.102770396C>A" "" "" "" "PDZD7(NM_001195263.1):c.2250G>T (p.W750C), PDZD7(NM_001195263.2):c.2250G>T (p.W750C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010639C>A" "" "VUS" "" "0000305435" "0" "30" "10" "102770289" "102770289" "subst" "0.000197368" "01943" "PDZD7_000046" "g.102770289C>T" "" "" "" "PDZD7(NM_001195263.1):c.2357G>A (p.R786Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010532C>T" "" "likely benign" "" "0000305436" "0" "50" "10" "102770250" "102770250" "subst" "0.000146305" "01943" "PDZD7_000045" "g.102770250G>C" "" "" "" "PDZD7(NM_001195263.1):c.2396C>G (p.P799R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010493G>C" "" "VUS" "" "0000305437" "0" "30" "10" "102770185" "102770185" "subst" "0" "01943" "PDZD7_000044" "g.102770185G>A" "" "" "" "PDZD7(NM_001195263.1):c.2461C>T (p.P821S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010428G>A" "" "likely benign" "" "0000305438" "0" "30" "10" "102770108" "102770108" "subst" "0.000332417" "01943" "PDZD7_000043" "g.102770108C>G" "" "" "" "PDZD7(NM_001195263.1):c.2538G>C (p.G846=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010351C>G" "" "likely benign" "" "0000305439" "0" "30" "10" "102768616" "102768616" "subst" "0.000523853" "01943" "PDZD7_000042" "g.102768616G>T" "" "" "" "PDZD7(NM_001195263.1):c.2719-9C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101008859G>T" "" "likely benign" "" "0000305440" "0" "30" "10" "102768599" "102768599" "subst" "1.9171E-5" "01943" "PDZD7_000041" "g.102768599G>A" "" "" "" "PDZD7(NM_001195263.1):c.2727C>T (p.F909=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101008842G>A" "" "likely benign" "" "0000305441" "0" "50" "10" "102783774" "102783774" "subst" "0.000150292" "01943" "PDZD7_000035" "g.102783774G>A" "" "" "" "PDZD7(NM_001195263.1):c.278C>T (p.P93L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101024017G>A" "" "VUS" "" "0000305442" "0" "30" "10" "102783716" "102783716" "subst" "0.000101521" "01943" "PDZD7_000034" "g.102783716G>A" "" "" "" "PDZD7(NM_001195263.1):c.336C>T (p.F112=), PDZD7(NM_001195263.2):c.336C>T (p.F112=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101023959G>A" "" "likely benign" "" "0000305443" "0" "50" "10" "102782101" "102782101" "subst" "8.12209E-6" "01943" "PDZD7_000031" "g.102782101C>T" "" "" "" "PDZD7(NM_001195263.1):c.584G>A (p.G195D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101022344C>T" "" "VUS" "" "0000305444" "0" "50" "10" "102782093" "102782093" "subst" "3.24886E-5" "01943" "PDZD7_000030" "g.102782093G>A" "" "" "" "PDZD7(NM_001195263.1):c.592C>T (p.P198S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101022336G>A" "" "VUS" "" "0000305445" "0" "50" "10" "102782005" "102782005" "subst" "0" "01943" "PDZD7_000029" "g.102782005C>T" "" "" "" "PDZD7(NM_001195263.1):c.680G>A (p.R227H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101022248C>T" "" "VUS" "" "0000321738" "0" "50" "10" "102753137" "102753137" "subst" "2.43635E-5" "01804" "C10orf2_000026" "g.102753137A>G" "" "" "" "C10orf2(NM_001163812.1):c.*220A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.100993380A>G" "" "VUS" "" "0000321739" "0" "50" "10" "102770415" "102770415" "subst" "0.00402808" "01804" "PDZD7_000050" "g.102770415C>T" "" "" "" "PDZD7(NM_001195263.1):c.2231G>A (p.(Arg744Gln)), PDZD7(NM_001195263.2):c.2231G>A (p.R744Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010658C>T" "" "VUS" "" "0000321742" "0" "50" "10" "102778932" "102778932" "subst" "0.00180737" "01804" "PDZD7_000027" "g.102778932C>T" "" "" "" "PDZD7(NM_001195263.1):c.971G>A (p.S324N, p.(Ser324Asn)), PDZD7(NM_001195263.2):c.971G>A (p.S324N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101019175C>T" "" "VUS" "" "0000321744" "0" "30" "10" "102782113" "102782113" "subst" "0.00361842" "01804" "PDZD7_000032" "g.102782113A>T" "" "" "" "PDZD7(NM_001195263.1):c.572T>A (p.V191E, p.(Val191Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101022356A>T" "" "likely benign" "" "0000340690" "0" "10" "10" "102770327" "102770327" "subst" "0.807781" "02327" "PDZD7_000038" "g.102770327A>G" "" "" "" "PDZD7(NM_001195263.2):c.2319T>C (p.R773=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010570A>G" "" "benign" "" "0000343835" "0" "10" "10" "102770082" "102770082" "subst" "0.814453" "02327" "PDZD7_000008" "g.102770082T>G" "" "" "" "PDZD7(NM_001195263.2):c.2564A>C (p.N855T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101010325T>G" "" "benign" "" "0000348525" "0" "50" "10" "102753065" "102753065" "subst" "4.06055E-6" "02327" "C10orf2_000031" "g.102753065C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.100993308C>T" "" "VUS" "" "0000350805" "0" "50" "10" "102780374" "102780374" "subst" "8.12447E-6" "02327" "PDZD7_000039" "g.102780374C>T" "" "" "" "PDZD7(NM_001195263.1):c.928+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101020617C>T" "" "VUS" "" "0000366933" "21" "99" "10" "102777878" "102777878" "subst" "0" "02416" "PDZD7_000014" "g.102777878G>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "" "Germline" "" "" "0" "" "" "g.101018121G>T" "" "pathogenic" "ACMG" "0000366934" "21" "99" "10" "102777878" "102777878" "subst" "0" "02416" "PDZD7_000014" "g.102777878G>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "" "Germline" "" "" "0" "" "" "g.101018121G>T" "" "pathogenic" "ACMG" "0000366935" "21" "99" "10" "102777878" "102777878" "subst" "0" "02416" "PDZD7_000014" "g.102777878G>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "" "Germline" "" "" "0" "" "" "g.101018121G>T" "" "pathogenic" "ACMG" "0000366936" "3" "99" "10" "102775566" "102775566" "subst" "0" "02416" "PDZD7_000016" "g.102775566G>A" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "" "Germline" "" "" "0" "" "" "g.101015809G>A" "" "pathogenic" "ACMG" "0000366937" "3" "99" "10" "102775566" "102775566" "subst" "0" "02416" "PDZD7_000016" "g.102775566G>A" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "" "Germline" "" "" "0" "" "" "g.101015809G>A" "" "pathogenic" "ACMG" "0000366938" "3" "95" "10" "102783745" "102783745" "subst" "1.62442E-5" "02416" "PDZD7_000012" "g.102783745C>G" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly103Arg}" "Germline" "" "" "0" "" "" "g.101023988C>G" "" "VUS" "ACMG" "0000366939" "3" "95" "10" "102783745" "102783745" "subst" "1.62442E-5" "02416" "PDZD7_000012" "g.102783745C>G" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly103Arg}" "Germline" "" "" "0" "" "" "g.101023988C>G" "" "VUS" "ACMG" "0000366940" "3" "95" "10" "102783745" "102783745" "subst" "1.62442E-5" "02416" "PDZD7_000012" "g.102783745C>G" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly103Arg}" "Germline" "" "" "0" "" "" "g.101023988C>G" "" "VUS" "ACMG" "0000366941" "3" "95" "10" "102783745" "102783745" "subst" "1.62442E-5" "02416" "PDZD7_000012" "g.102783745C>G" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly103Arg}" "Germline" "" "" "0" "" "" "g.101023988C>G" "" "VUS" "ACMG" "0000366942" "11" "95" "10" "102781568" "102781568" "subst" "0" "02416" "PDZD7_000013" "g.102781568A>C" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Met285Arg}" "Germline" "" "" "0" "" "" "g.101021811A>C" "" "VUS" "ACMG" "0000366943" "11" "95" "10" "102781568" "102781568" "subst" "0" "02416" "PDZD7_000013" "g.102781568A>C" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Met285Arg}" "Germline" "" "" "0" "" "" "g.101021811A>C" "" "VUS" "ACMG" "0000366944" "11" "95" "10" "102781568" "102781568" "subst" "0" "02416" "PDZD7_000013" "g.102781568A>C" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Met285Arg}" "Germline" "" "" "0" "" "" "g.101021811A>C" "" "VUS" "ACMG" "0000366945" "3" "95" "10" "102782003" "102782003" "subst" "8.12209E-6" "02416" "PDZD7_000015" "g.102782003C>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly228Arg}" "Germline" "" "" "0" "" "" "g.101022246C>T" "" "VUS" "ACMG" "0000366946" "3" "95" "10" "102782003" "102782003" "subst" "8.12209E-6" "02416" "PDZD7_000015" "g.102782003C>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly228Arg}" "Germline" "" "" "0" "" "" "g.101022246C>T" "" "VUS" "ACMG" "0000366947" "3" "95" "10" "102782003" "102782003" "subst" "8.12209E-6" "02416" "PDZD7_000015" "g.102782003C>T" "0/600 controls" "{PMID:Booth 2015:26416264}" "" "" "{MSV3dQ9UKN7:p.Gly228Arg}" "Germline" "" "" "0" "" "" "g.101022246C>T" "" "VUS" "ACMG" "0000366948" "11" "99" "10" "102775494" "102775494" "subst" "0" "02404" "PDZD7_000010" "g.102775494G>A" "" "{PMID:Vona et al., 2016:26849169}" "" "" "" "Germline" "" "" "0" "" "" "g.101015737G>A" "" "pathogenic" "ACMG" "0000366949" "21" "99" "10" "102770540" "102770540" "del" "0" "02404" "PDZD7_000011" "g.102770540del" "" "{PMID:Vona et al., 2016:26849169}" "" "" "" "Germline" "" "rs397516633" "0" "" "" "g.101010783del" "" "pathogenic" "ACMG" "0000366950" "0" "35" "10" "102777926" "102777926" "subst" "0" "02416" "PDZD7_000004" "g.102777926C>A" "" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "+ BsiEI;+HpyCH4III;" "" "" "Germline" "" "" "0" "" "" "g.101018169C>A" "" "likely benign" "ACMG" "0000366951" "0" "11" "10" "102783678" "102783678" "subst" "0.565293" "02416" "PDZD7_000009" "g.102783678T>C" "" "{PMID:Rong et al., 2014:24831256}" "" "367+7C>T" "" "Germline" "" "rs6584410" "0" "" "" "g.101023921T>C" "" "benign" "ACMG" "0000366952" "0" "11" "10" "102783678" "102783678" "subst" "0.565293" "02416" "PDZD7_000009" "g.102783678T>C" "" "{PMID:Rong et al., 2014:24831256}" "" "367+7C>T" "" "Germline" "" "rs6584410" "0" "" "" "g.101023921T>C" "" "benign" "ACMG" "0000366953" "0" "11" "10" "102778892" "102778892" "subst" "0.0245248" "02416" "PDZD7_000007" "g.102778892G>A" "" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "" "" "" "Germline" "" "rs34705415" "0" "" "" "g.101019135G>A" "" "benign" "ACMG" "0000366954" "0" "15" "10" "102771699" "102771699" "subst" "0.00184178" "02416" "PDZD7_000005" "g.102771699G>C" "" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "" "" "{MSV3dQ9UKN7:p.Ala639Gly}" "Germline" "" "" "0" "" "" "g.101011942G>C" "" "likely benign" "ACMG" "0000366955" "21" "99" "10" "102772017" "102772017" "subst" "0" "02416" "PDZD7_000002" "g.102772017T>C" "0/200 controls" "{PMID:Ebermann et al., 2010:20440071}" "+AciI;-BstAPI;-PstI;-SfcI;" "" "Modifier" "Germline" "" "" "0" "" "" "g.101012260T>C" "" "pathogenic" "ACMG" "0000366956" "0" "99" "10" "102789817" "102789817" "dup" "0" "02416" "PDZD7_000001" "g.102789817dup" "0/254 controls" "{PMID:Ebermann et al., 2009:18665195}" "" "166_167insC" "Modifier" "Germline" "" "" "0" "" "" "g.101030060dup" "" "pathogenic" "ACMG" "0000366957" "0" "99" "10" "102768520" "102768520" "subst" "7.73204E-6" "02428" "PDZD7_000017" "g.102768520G>A" "" "{PMID:Bonnet et al., 2016:27460420}" "" "" "" "Germline" "" "rs746485256" "0" "" "" "g.101008763G>A" "" "pathogenic" "ACMG" "0000366958" "3" "11" "10" "102770082" "102770082" "subst" "0.814453" "02416" "PDZD7_000008" "g.102770082T>G" "" "{PMID:Rong et al., 2014:24831256}" "" "" "{MSV3dQ9UKN7:p.Asn855Thr}" "Germline" "" "rs807023" "0" "" "" "g.101010325T>G" "" "benign" "ACMG" "0000366959" "0" "99" "10" "102770445" "102770454" "del" "0" "02416" "PDZD7_000003" "g.102770445_102770454del" "0/405 controls" "{PMID:Ebermann et al., 2010:20440071}" "-BcgI;-BsaXI;-BsgI;-Cac8I;-HpyCH4V;" "" "" "Germline" "" "" "0" "" "" "g.101010688_101010697del" "" "pathogenic" "ACMG" "0000366960" "0" "99" "10" "102789817" "102789817" "dup" "0" "02416" "PDZD7_000001" "g.102789817dup" "0/254 controls" "{PMID:Ebermann et al., 2010:20440071}" "" "166_167insC" "" "Germline" "" "" "0" "" "" "g.101030060dup" "" "pathogenic" "ACMG" "0000366961" "0" "15" "10" "102770502" "102770502" "subst" "0.00737848" "02416" "PDZD7_000006" "g.102770502G>A" "" "{PMID:Besnard, Garcia-Garcia et al., 2014:24498627}" "" "" "{MSV3dQ9UKN7:p.Pro715Leu}" "Germline" "" "rs143414291" "0" "" "" "g.101010745G>A" "" "likely benign" "ACMG" "0000538899" "0" "30" "10" "102766875" "102766875" "subst" "0.000396004" "01943" "LZTS2_000001" "g.102766875G>A" "" "" "" "LZTS2(NM_032429.3):c.1960G>A (p.E654K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101007118G>A" "" "likely benign" "" "0000538900" "0" "50" "10" "102768226" "102768226" "subst" "0" "01943" "LZTS2_000002" "g.102768226A>G" "" "" "" "PDZD7(NM_001195263.1):c.3100T>C (p.*1034Rext*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101008469A>G" "" "VUS" "" "0000538901" "0" "50" "10" "102768475" "102768475" "subst" "6.93984E-5" "01943" "LZTS2_000003" "g.102768475C>T" "" "" "" "PDZD7(NM_001195263.1):c.2851G>A (p.G951R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101008718C>T" "" "VUS" "" "0000538902" "0" "10" "10" "102768554" "102768554" "subst" "0.000180245" "02330" "LZTS2_000004" "g.102768554G>A" "" "" "" "PDZD7(NM_001195263.2):c.2772C>T (p.H924=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101008797G>A" "" "benign" "" "0000538903" "0" "50" "10" "102768613" "102768613" "subst" "0" "02327" "LZTS2_000005" "g.102768613G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101008856G>C" "" "VUS" "" "0000538904" "0" "30" "10" "102770235" "102770235" "subst" "0.000414912" "01943" "LZTS2_000006" "g.102770235G>A" "" "" "" "PDZD7(NM_001195263.1):c.2411C>T (p.A804V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010478G>A" "" "likely benign" "" "0000538905" "0" "30" "10" "102770249" "102770249" "subst" "4.61972E-5" "01943" "LZTS2_000007" "g.102770249C>A" "" "" "" "PDZD7(NM_001195263.1):c.2397G>T (p.P799=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010492C>A" "" "likely benign" "" "0000538907" "0" "50" "10" "102770309" "102770310" "ins" "0" "01943" "LZTS2_000009" "g.102770309_102770310insAGGCTG" "" "" "" "PDZD7(NM_001195263.1):c.2341_2342insTCAGCC (p.S780_R781insLS)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010552_101010553insAGGCTG" "" "VUS" "" "0000538909" "0" "30" "10" "102770315" "102770332" "del" "0" "01804" "PDZD7_000020" "g.102770315_102770332del" "" "" "" "PDZD7(NM_001195263.1):c.2319_2336del (p.(Arg775_Ser780del)), PDZD7(NM_001195263.2):c.2319_2336delTAGCCGCAGCCGTAGCCG (p.R779_S784del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010558_101010575del" "" "likely benign" "" "0000538910" "0" "30" "10" "102770315" "102770332" "del" "0" "02325" "PDZD7_000020" "g.102770315_102770332del" "" "" "" "PDZD7(NM_001195263.1):c.2319_2336del (p.(Arg775_Ser780del)), PDZD7(NM_001195263.2):c.2319_2336delTAGCCGCAGCCGTAGCCG (p.R779_S784del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010558_101010575del" "" "likely benign" "" "0000538912" "0" "30" "10" "102770349" "102770349" "subst" "0" "01943" "LZTS2_000012" "g.102770349A>C" "" "" "" "PDZD7(NM_001195263.1):c.2297T>G (p.I766S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010592A>C" "" "likely benign" "" "0000538913" "0" "50" "10" "102770379" "102770379" "subst" "0" "01943" "LZTS2_000013" "g.102770379A>T" "" "" "" "PDZD7(NM_001195263.1):c.2267T>A (p.L756Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010622A>T" "" "VUS" "" "0000538914" "0" "50" "10" "102770396" "102770396" "subst" "0.00131383" "02330" "PDZD7_000049" "g.102770396C>A" "" "" "" "PDZD7(NM_001195263.1):c.2250G>T (p.W750C), PDZD7(NM_001195263.2):c.2250G>T (p.W750C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010639C>A" "" "VUS" "" "0000538915" "0" "30" "10" "102770409" "102770409" "subst" "8.52386E-5" "01943" "LZTS2_000014" "g.102770409A>T" "" "" "" "PDZD7(NM_001195263.1):c.2237T>A (p.L746Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010652A>T" "" "likely benign" "" "0000538916" "0" "30" "10" "102770416" "102770416" "subst" "0.00106502" "01943" "LZTS2_000015" "g.102770416G>T" "" "" "" "PDZD7(NM_001195263.1):c.2230C>A (p.R744=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010659G>T" "" "likely benign" "" "0000538917" "0" "30" "10" "102770434" "102770434" "subst" "0" "01943" "LZTS2_000016" "g.102770434G>A" "" "" "" "PDZD7(NM_001195263.1):c.2212C>T (p.L738=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010677G>A" "" "likely benign" "" "0000538918" "0" "10" "10" "102770502" "102770502" "subst" "0.00737848" "02330" "PDZD7_000006" "g.102770502G>A" "" "" "" "PDZD7(NM_001195263.1):c.2144C>T (p.P715L), PDZD7(NM_001195263.2):c.2144C>T (p.P715L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010745G>A" "" "benign" "" "0000538919" "0" "30" "10" "102770502" "102770502" "subst" "0.00737848" "01943" "PDZD7_000006" "g.102770502G>A" "" "" "" "PDZD7(NM_001195263.1):c.2144C>T (p.P715L), PDZD7(NM_001195263.2):c.2144C>T (p.P715L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010745G>A" "" "likely benign" "" "0000538921" "0" "90" "10" "102770540" "102770540" "del" "0" "01943" "PDZD7_000011" "g.102770540del" "" "" "" "PDZD7(NM_001195263.1):c.2107delA (p.S703Vfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010783del" "" "pathogenic" "" "0000538922" "0" "30" "10" "102770578" "102770578" "subst" "2.35897E-5" "01943" "LZTS2_000017" "g.102770578C>T" "" "" "" "PDZD7(NM_001195263.1):c.2068G>A (p.E690K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010821C>T" "" "likely benign" "" "0000538923" "0" "10" "10" "102771666" "102771666" "subst" "7.08938E-6" "02330" "LZTS2_000018" "g.102771666G>A" "" "" "" "PDZD7(NM_001195263.2):c.1933+16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101011909G>A" "" "benign" "" "0000538924" "0" "10" "10" "102771699" "102771699" "subst" "0.00184178" "02330" "PDZD7_000005" "g.102771699G>C" "" "" "" "PDZD7(NM_001195263.2):c.1916C>G (p.A639G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101011942G>C" "" "benign" "" "0000538925" "0" "50" "10" "102775470" "102775470" "subst" "0.000120549" "02330" "PDZD7_000053" "g.102775470G>A" "" "" "" "PDZD7(NM_001195263.1):c.1672C>T (p.R558W), PDZD7(NM_001195263.2):c.1672C>T (p.R558W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101015713G>A" "" "VUS" "" "0000538926" "0" "10" "10" "102777931" "102777931" "subst" "0.00114514" "01943" "PDZD7_000058" "g.102777931C>T" "" "" "" "PDZD7(NM_001195263.1):c.1447G>A (p.D483N), PDZD7(NM_001195263.2):c.1447G>A (p.D483N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101018174C>T" "" "benign" "" "0000538927" "0" "30" "10" "102777967" "102777967" "subst" "0.000450743" "01943" "PDZD7_000025" "g.102777967A>G" "" "" "" "PDZD7(NM_001195263.1):c.1411T>C (p.F471L), PDZD7(NM_001195263.2):c.1411T>C (p.F471L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101018210A>G" "" "likely benign" "" "0000538928" "0" "50" "10" "102778932" "102778932" "subst" "0.00180737" "01943" "PDZD7_000027" "g.102778932C>T" "" "" "" "PDZD7(NM_001195263.1):c.971G>A (p.S324N, p.(Ser324Asn)), PDZD7(NM_001195263.2):c.971G>A (p.S324N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101019175C>T" "" "VUS" "" "0000538929" "0" "10" "10" "102783678" "102783678" "subst" "0.565293" "02325" "PDZD7_000009" "g.102783678T>C" "" "" "" "PDZD7(NM_001195263.2):c.367+7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101023921T>C" "" "benign" "" "0000538930" "0" "30" "10" "102783716" "102783716" "subst" "0.000101521" "02330" "PDZD7_000034" "g.102783716G>A" "" "" "" "PDZD7(NM_001195263.1):c.336C>T (p.F112=), PDZD7(NM_001195263.2):c.336C>T (p.F112=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101023959G>A" "" "likely benign" "" "0000538931" "0" "30" "10" "102783728" "102783728" "subst" "0.000194921" "01943" "LZTS2_000020" "g.102783728G>A" "" "" "" "PDZD7(NM_001195263.1):c.324C>T (p.G108=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101023971G>A" "" "likely benign" "" "0000538932" "0" "50" "10" "102789780" "102789780" "subst" "8.1363E-6" "01943" "LZTS2_000021" "g.102789780C>T" "" "" "" "PDZD7(NM_001195263.1):c.197G>A (p.R66H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101030023C>T" "" "VUS" "" "0000612232" "0" "30" "10" "102762677" "102762677" "subst" "0" "01804" "LZTS2_000022" "g.102762677A>C" "" "" "" "LZTS2(NM_032429.2):c.382A>C (p.(Ile128Leu)), LZTS2(NM_032429.3):c.382A>C (p.I128L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101002920A>C" "" "likely benign" "" "0000612233" "0" "30" "10" "102770283" "102770283" "subst" "0" "01943" "LZTS2_000023" "g.102770283T>G" "" "" "" "PDZD7(NM_001195263.1):c.2363A>C (p.Q788P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010526T>G" "" "likely benign" "" "0000612234" "0" "50" "10" "102770315" "102770316" "del" "0" "01943" "LZTS2_000024" "g.102770315_102770316del" "" "" "" "PDZD7(NM_001195263.1):c.2330_2331delGT (p.R777Qfs*17)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010558_101010559del" "" "VUS" "" "0000612235" "0" "50" "10" "102770318" "102770327" "del" "0.000261982" "01943" "PDZD7_000048" "g.102770318_102770327del" "" "" "" "PDZD7(NM_001195263.1):c.2319_2328delTAGCCGCAGC (p.S774Vfs*31), PDZD7(NM_001195263.2):c.2319_2328delTAGCCGCAGC (p.S774Vfs*31)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101010561_101010570del" "" "VUS" "" "0000612236" "0" "50" "10" "102781611" "102781611" "subst" "2.43633E-5" "02327" "LZTS2_000026" "g.102781611G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101021854G>A" "" "VUS" "" "0000612237" "0" "50" "10" "102781620" "102781620" "subst" "0.000198969" "01943" "LZTS2_000027" "g.102781620C>T" "" "" "" "PDZD7(NM_001195263.1):c.802G>A (p.D268N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101021863C>T" "" "VUS" "" "0000622312" "0" "50" "10" "102777925" "102777927" "dup" "0" "01943" "LZTS2_000025" "g.102777925_102777927dup" "" "" "" "PDZD7(NM_001195263.1):c.1452_1454dupGCG (p.R486dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101018168_101018170dup" "" "VUS" "" "0000631818" "3" "70" "10" "102783245" "102783245" "subst" "5.28275E-5" "03557" "PDZD7_000060" "g.102783245G>A" "" "{PMID:Kim 2020:32203226}, {DOI:Kim 2020:10.1038/s41436-020-0774-9}" "" "" "ACMG PM2, PM3_P, PP1, PP3" "Germline" "" "" "0" "" "" "g.101023488G>A" "" "likely pathogenic (recessive)" "ACMG" "0000647834" "1" "10" "10" "102770278" "102770278" "subst" "0.0392547" "03575" "PDZD7_000061" "g.102770278T>C" "159/2675 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "159 heterozygous; {DB:CLININrs111287837}" "Germline" "" "rs111287837" "0" "" "" "g.101010521T>C" "" "benign" "" "0000647835" "1" "10" "10" "102770597" "102770597" "subst" "0.0363328" "03575" "PDZD7_000062" "g.102770597C>T" "156/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "156 heterozygous; {DB:CLININrs34693310}" "Germline" "" "rs34693310" "0" "" "" "g.101010840C>T" "" "benign" "" "0000647836" "1" "30" "10" "102775529" "102775529" "subst" "0.00700467" "03575" "PDZD7_000055" "g.102775529C>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs112571971}" "Germline" "" "rs112571971" "0" "" "" "g.101015772C>T" "" "likely benign" "" "0000647837" "1" "50" "10" "102782113" "102782113" "subst" "0.00361842" "03575" "PDZD7_000032" "g.102782113A>T" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs118098246}" "Germline" "" "rs118098246" "0" "" "" "g.101022356A>T" "" "VUS" "" "0000656404" "0" "50" "10" "102783229" "102783229" "subst" "4.06379E-6" "02327" "LZTS2_000028" "g.102783229A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101023472A>G" "" "VUS" "" "0000656405" "0" "90" "10" "102783745" "102783745" "subst" "1.62442E-5" "01943" "PDZD7_000012" "g.102783745C>G" "" "" "" "PDZD7(NM_001195263.1):c.307G>C (p.G103R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101023988C>G" "" "pathogenic" "" "0000659737" "3" "70" "10" "102783245" "102783245" "subst" "5.28275E-5" "03607" "PDZD7_000060" "g.102783245G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.101023488G>A" "" "VUS" "" "0000669044" "3" "10" "10" "102770278" "102770278" "subst" "0.0392547" "03575" "PDZD7_000061" "g.102770278T>C" "5/2675 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 homozygous; {DB:CLININrs111287837}" "Germline" "" "rs111287837" "0" "" "" "g.101010521T>C" "" "benign" "" "0000669045" "3" "10" "10" "102770597" "102770597" "subst" "0.0363328" "03575" "PDZD7_000062" "g.102770597C>T" "5/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 homozygous; {DB:CLININrs34693310}" "Germline" "" "rs34693310" "0" "" "" "g.101010840C>T" "" "benign" "" "0000678753" "0" "30" "10" "102770105" "102770105" "subst" "4.53008E-5" "01943" "LZTS2_000029" "g.102770105C>T" "" "" "" "PDZD7(NM_001195263.1):c.2541G>A (p.T847=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678754" "0" "50" "10" "102783241" "102783241" "subst" "1.21923E-5" "02327" "LZTS2_000030" "g.102783241C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000678755" "0" "30" "10" "102789758" "102789758" "subst" "4.0807E-6" "01943" "LZTS2_000031" "g.102789758G>A" "" "" "" "PDZD7(NM_001195263.1):c.219C>T (p.P73=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690633" "0" "30" "10" "102762677" "102762677" "subst" "0" "01943" "LZTS2_000022" "g.102762677A>C" "" "" "" "LZTS2(NM_032429.2):c.382A>C (p.(Ile128Leu)), LZTS2(NM_032429.3):c.382A>C (p.I128L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000710325" "1" "90" "10" "102770561" "102770561" "del" "0" "00006" "PDZD7_000063" "g.102770561del" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "2089delG" "" "Germline" "" "" "0" "" "" "g.101010804del" "" "pathogenic" "" "0000722641" "0" "50" "10" "102753029" "102753029" "subst" "1.21817E-5" "01943" "C10orf2_000060" "g.102753029C>G" "" "" "" "TWNK(NM_021830.4):c.1817C>G (p.S606C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722642" "0" "50" "10" "102783751" "102783751" "subst" "2.03056E-5" "01943" "LZTS2_000032" "g.102783751C>T" "" "" "" "PDZD7(NM_001195263.1):c.301G>A (p.V101M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000788397" "0" "50" "10" "102770422" "102770422" "subst" "0.00010274" "00000" "PDZD7_000065" "g.102770422C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G2224A" "" "Germline" "" "" "0" "" "" "g.101010665C>T" "" "VUS" "" "0000788435" "0" "50" "10" "102770422" "102770422" "subst" "0.00010274" "00000" "PDZD7_000065" "g.102770422C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G2224A" "" "Germline" "" "" "0" "" "" "g.101010665C>T" "" "VUS" "" "0000804267" "0" "30" "10" "102753170" "102753170" "subst" "2.84289E-5" "01943" "C10orf2_000062" "g.102753170C>T" "" "" "" "TWNK(NM_021830.4):c.1958C>T (p.S653F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804268" "0" "50" "10" "102777855" "102777855" "subst" "4.0655E-6" "01943" "LZTS2_000033" "g.102777855C>A" "" "" "" "PDZD7(NM_001195263.1):c.1522+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804269" "0" "90" "10" "102780374" "102780374" "subst" "8.12447E-6" "01943" "PDZD7_000039" "g.102780374C>T" "" "" "" "PDZD7(NM_001195263.1):c.928+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000804270" "0" "50" "10" "102783245" "102783245" "subst" "5.28275E-5" "02327" "PDZD7_000060" "g.102783245G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000812489" "3" "70" "10" "102781629" "102781629" "subst" "4.06058E-6" "00000" "PDZD7_000066" "g.102781629T>C" "" "{PMID:Tayebi 2019:30820146}" "" "c.793A>G, p.(Arg265Gly)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.101021872T>C" "" "likely pathogenic" "" "0000815738" "0" "90" "10" "102776164" "102776164" "subst" "1.39359E-5" "00000" "PDZD7_000067" "g.102776164G>A" "" "{PMID:Gonzalez-del Pozo 2020:32050993}" "" "PDZD7 M5: c.1543C>T;p.Gln515*" "heterozygous" "Germline" "yes" "rs979094623" "0" "" "" "g.101016407G>A" "" "pathogenic" "ACMG" "0000815740" "21" "90" "10" "102776164" "102776164" "subst" "1.39359E-5" "00000" "PDZD7_000067" "g.102776164G>A" "" "{PMID:Gonzalez-del Pozo 2020:32050993}" "" "PDZD7 M5: c.1543C>T;p.Gln515*" "heterozygous" "Germline" "yes" "rs979094623" "0" "" "" "g.101016407G>A" "" "pathogenic" "ACMG" "0000816630" "0" "50" "10" "102789771" "102789771" "subst" "5.29195E-5" "02416" "PDZD7_000069" "g.102789771A>G" "" "Mansard 2021, submitted" "" "" "" "Germline" "" "rs765515973" "0" "" "" "" "" "VUS" "ACMG" "0000817070" "0" "90" "10" "102770539" "102770539" "del" "0.00029313" "02416" "PDZD7_000068" "g.102770539del" "" "Mansard 2021, submitted" "" "" "" "Germline" "" "rs397516633" "0" "" "" "" "" "pathogenic" "ACMG" "0000845526" "0" "50" "10" "102778932" "102778932" "subst" "0.00180737" "00000" "PDZD7_000027" "g.102778932C>T" "Novel" "{PMID:Borràs 2013:23534816}" "" "c.971G>A" "" "Germline" "no" "" "0" "" "" "" "" "VUS" "" "0000852363" "0" "70" "10" "102769109" "102769109" "subst" "0" "02327" "LZTS2_000035" "g.102769109T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000852364" "0" "30" "10" "102781636" "102781636" "subst" "0.00121006" "02330" "LZTS2_000036" "g.102781636G>A" "" "" "" "PDZD7(NM_001195263.2):c.786C>T (p.N262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852365" "0" "50" "10" "102783702" "102783704" "del" "0" "01943" "LZTS2_000038" "g.102783702_102783704del" "" "" "" "PDZD7(NM_001195263.1):c.351_353delGGA (p.E118del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861793" "0" "30" "10" "102768594" "102768594" "subst" "9.20776E-6" "02330" "LZTS2_000034" "g.102768594A>G" "" "" "" "PDZD7(NM_001195263.2):c.2732T>C (p.L911P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861794" "0" "30" "10" "102783263" "102783263" "subst" "4.06388E-6" "01943" "LZTS2_000037" "g.102783263G>A" "" "" "" "PDZD7(NM_001195263.1):c.472C>T (p.R158C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888963" "0" "50" "10" "102778621" "102778621" "subst" "0" "02327" "LZTS2_000039" "g.102778621G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888964" "0" "50" "10" "102780422" "102780422" "subst" "0" "02327" "LZTS2_000040" "g.102780422T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925101" "0" "70" "10" "102752966" "102752966" "subst" "8.12156E-6" "02325" "C10orf2_000073" "g.102752966A>G" "" "" "" "C10ORF2(NM_021830.4):c.1754A>G (p.(Asn585Ser)), TWNK(NM_021830.5):c.1754A>G (p.N585S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000949333" "0" "50" "10" "102782005" "102782005" "subst" "8.12216E-6" "02327" "LZTS2_000041" "g.102782005C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000949334" "0" "50" "10" "102783745" "102783745" "subst" "2.84273E-5" "02327" "LZTS2_000042" "g.102783745C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000958939" "0" "50" "10" "102777967" "102777967" "subst" "0.000450743" "00006" "PDZD7_000025" "g.102777967A>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.101018210A>G" "" "VUS" "ACMG" "0000959376" "0" "50" "10" "102783249" "102783249" "subst" "0" "00006" "PDZD7_000071" "g.102783249C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.101023492C>T" "" "VUS" "ACMG" "0000959471" "0" "70" "10" "102782103" "102782103" "subst" "4.06128E-6" "00006" "PDZD7_000070" "g.102782103G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.101022346G>T" "" "likely pathogenic (recessive)" "ACMG" "0000998054" "0" "70" "10" "102752966" "102752966" "subst" "8.12156E-6" "01804" "C10orf2_000073" "g.102752966A>G" "" "" "" "C10ORF2(NM_021830.4):c.1754A>G (p.(Asn585Ser)), TWNK(NM_021830.5):c.1754A>G (p.N585S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000998055" "0" "50" "10" "102765312" "102765332" "dup" "0" "01804" "LZTS2_000043" "g.102765312_102765332dup" "" "" "" "LZTS2(NM_032429.2):c.1166_1186dupTGCTGCAGCTGCAGGTGTTCC (p.(Leu389_Phe395dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014580" "0" "50" "10" "102776181" "102776181" "subst" "0" "02327" "LZTS2_000044" "g.102776181C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014581" "0" "50" "10" "102782122" "102782122" "subst" "0" "02327" "LZTS2_000045" "g.102782122C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025703" "0" "90" "10" "102770540" "102770540" "del" "0" "02327" "PDZD7_000011" "g.102770540del" "" "" "" "PDZD7(NM_001195263.1):c.2107delA (p.S703Vfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001046218" "0" "70" "10" "102783745" "102783745" "subst" "1.62442E-5" "02327" "PDZD7_000012" "g.102783745C>G" "" "" "" "PDZD7(NM_001195263.1):c.307G>C (p.G103R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PDZD7 ## Count = 165 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Protein/Domain}}" "0000089979" "00024123" "50" "2331" "0" "2342" "0" "c.2331_2342del" "r.(?)" "p.(Arg781_Ser784del)" "15" "" "0000096180" "00024123" "70" "2319" "0" "2336" "0" "c.2319_2336del" "r.(?)" "p.(Arg779_Ser784del)" "15" "" "0000132197" "00024123" "90" "226" "2" "226" "5" "c.226+2_226+5del" "r.spl?" "p.?" "" "" "0000246885" "00024123" "10" "2943" "0" "2943" "0" "c.2943T>C" "r.(?)" "p.(Asp981=)" "" "" "0000246923" "00024123" "10" "1325" "-16" "1325" "-16" "c.1325-16T>A" "r.(=)" "p.(=)" "" "" "0000246948" "00024123" "30" "1411" "0" "1411" "0" "c.1411T>C" "r.(?)" "p.(Phe471Leu)" "" "" "0000248622" "00024123" "10" "2319" "0" "2319" "0" "c.2319T>C" "r.(?)" "p.(Arg773=)" "" "" "0000254139" "00024123" "30" "2943" "0" "2943" "0" "c.2943T>C" "r.(?)" "p.(Asp981=)" "" "" "0000254354" "00024123" "30" "2061" "0" "2061" "0" "c.2061T>A" "r.(?)" "p.(Asp687Glu)" "" "" "0000254822" "00024123" "30" "1638" "0" "1638" "0" "c.1638T>C" "r.(?)" "p.(Asn546=)" "" "" "0000256590" "00024123" "50" "572" "0" "572" "0" "c.572T>A" "r.(?)" "p.(Val191Glu)" "" "" "0000266347" "00024123" "30" "18362" "0" "18362" "0" "c.*15260G>A" "r.(=)" "p.(=)" "" "" "0000272222" "00024123" "30" "18260" "0" "18260" "0" "c.*15158C>T" "r.(=)" "p.(=)" "" "" "0000272223" "00024123" "30" "18134" "0" "18134" "0" "c.*15032C>T" "r.(=)" "p.(=)" "" "" "0000293647" "00024123" "30" "1348" "0" "1350" "0" "c.1348_1350del" "r.(?)" "p.(Glu450del)" "" "" "0000293648" "00024123" "10" "1447" "0" "1447" "0" "c.1447G>A" "r.(?)" "p.(Asp483Asn)" "" "" "0000293649" "00024123" "10" "1523" "-19" "1523" "-19" "c.1523-19G>A" "r.(=)" "p.(=)" "" "" "0000293650" "00024123" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Asn52=)" "" "" "0000293651" "00024123" "30" "1579" "0" "1579" "0" "c.1579G>A" "r.(?)" "p.(Glu527Lys)" "" "" "0000293652" "00024123" "10" "2231" "0" "2231" "0" "c.2231G>A" "r.(?)" "p.(Arg744Gln)" "" "" "0000293653" "00024123" "30" "367" "6" "367" "6" "c.367+6C>T" "r.(=)" "p.(=)" "" "" "0000293654" "00024123" "50" "971" "0" "971" "0" "c.971G>A" "r.(?)" "p.(Ser324Asn)" "" "" "0000296885" "00024123" "10" "2564" "0" "2564" "0" "c.2564A>C" "r.(?)" "p.(Asn855Thr)" "" "" "0000296886" "00024123" "10" "928" "20" "928" "20" "c.928+20del" "r.(=)" "p.(=)" "" "" "0000298849" "00024123" "70" "2319" "0" "2328" "0" "c.2319_2328del" "r.(?)" "p.(Ser774ValfsTer31)" "" "" "0000305427" "00024123" "30" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Asn52=)" "" "" "0000305428" "00024123" "30" "1613" "0" "1613" "0" "c.1613G>A" "r.(?)" "p.(Gly538Glu)" "" "" "0000305429" "00024123" "50" "1670" "0" "1670" "0" "c.1670G>A" "r.(?)" "p.(Arg557Gln)" "" "" "0000305430" "00024123" "50" "1672" "0" "1672" "0" "c.1672C>T" "r.(?)" "p.(Arg558Trp)" "" "" "0000305431" "00024123" "30" "1716" "0" "1716" "0" "c.1716C>T" "r.(?)" "p.(Asp572=)" "" "" "0000305432" "00024123" "50" "2011" "0" "2011" "0" "c.2011C>A" "r.(?)" "p.(Arg671Ser)" "" "" "0000305433" "00024123" "50" "2250" "0" "2250" "0" "c.2250G>T" "r.(?)" "p.(Trp750Cys)" "" "" "0000305435" "00024123" "30" "2357" "0" "2357" "0" "c.2357G>A" "r.(?)" "p.(Arg786Gln)" "" "" "0000305436" "00024123" "50" "2396" "0" "2396" "0" "c.2396C>G" "r.(?)" "p.(Pro799Arg)" "" "" "0000305437" "00024123" "30" "2461" "0" "2461" "0" "c.2461C>T" "r.(?)" "p.(Pro821Ser)" "" "" "0000305438" "00024123" "30" "2538" "0" "2538" "0" "c.2538G>C" "r.(?)" "p.(Gly846=)" "" "" "0000305439" "00024123" "30" "2719" "-9" "2719" "-9" "c.2719-9C>A" "r.(=)" "p.(=)" "" "" "0000305440" "00024123" "30" "2727" "0" "2727" "0" "c.2727C>T" "r.(?)" "p.(Phe909=)" "" "" "0000305441" "00024123" "50" "278" "0" "278" "0" "c.278C>T" "r.(?)" "p.(Pro93Leu)" "" "" "0000305442" "00024123" "30" "336" "0" "336" "0" "c.336C>T" "r.(?)" "p.(Phe112=)" "" "" "0000305443" "00024123" "50" "584" "0" "584" "0" "c.584G>A" "r.(?)" "p.(Gly195Asp)" "" "" "0000305444" "00024123" "50" "592" "0" "592" "0" "c.592C>T" "r.(?)" "p.(Pro198Ser)" "" "" "0000305445" "00024123" "50" "680" "0" "680" "0" "c.680G>A" "r.(?)" "p.(Arg227His)" "" "" "0000321738" "00024123" "50" "18189" "0" "18189" "0" "c.*15087T>C" "r.(=)" "p.(=)" "" "" "0000321739" "00024123" "50" "2231" "0" "2231" "0" "c.2231G>A" "r.(?)" "p.(Arg744Gln)" "" "" "0000321742" "00024123" "50" "971" "0" "971" "0" "c.971G>A" "r.(?)" "p.(Ser324Asn)" "" "" "0000321744" "00024123" "30" "572" "0" "572" "0" "c.572T>A" "r.(?)" "p.(Val191Glu)" "" "" "0000340690" "00024123" "10" "2319" "0" "2319" "0" "c.2319T>C" "r.(?)" "p.(Arg773=)" "" "" "0000343835" "00024123" "10" "2564" "0" "2564" "0" "c.2564A>C" "r.(?)" "p.(Asn855Thr)" "" "" "0000348525" "00024123" "50" "18261" "0" "18261" "0" "c.*15159G>A" "r.(=)" "p.(=)" "" "" "0000350805" "00024123" "50" "928" "1" "928" "1" "c.928+1G>A" "r.spl?" "p.?" "" "" "0000366933" "00024123" "99" "1500" "0" "1500" "0" "c.1500C>A" "r.(?)" "p.(Tyr500*)" "9" "" "0000366934" "00024123" "99" "1500" "0" "1500" "0" "c.1500C>A" "r.(?)" "p.(Tyr500*)" "9" "" "0000366935" "00024123" "99" "1500" "0" "1500" "0" "c.1500C>A" "r.(?)" "p.(Tyr500*)" "9" "" "0000366936" "00024123" "99" "1576" "0" "1576" "0" "c.1576C>T" "r.(?)" "p.(Gln526*)" "11" "" "0000366937" "00024123" "99" "1576" "0" "1576" "0" "c.1576C>T" "r.(?)" "p.(Gln526*)" "11" "" "0000366938" "00024123" "95" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "3" "PDZ 1 (86-168)" "0000366939" "00024123" "95" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "3" "PDZ 1 (86-168)" "0000366940" "00024123" "95" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "3" "PDZ 1 (86-168)" "0000366941" "00024123" "95" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "3" "PDZ 1 (86-168)" "0000366942" "00024123" "95" "854" "0" "854" "0" "c.854T>G" "r.(?)" "p.(Met285Arg)" "6" "PDZ 2 (210-293)" "0000366943" "00024123" "95" "854" "0" "854" "0" "c.854T>G" "r.(?)" "p.(Met285Arg)" "6" "PDZ 2 (210-293)" "0000366944" "00024123" "95" "854" "0" "854" "0" "c.854T>G" "r.(?)" "p.(Met285Arg)" "6" "PDZ 2 (210-293)" "0000366945" "00024123" "95" "682" "0" "682" "0" "c.682G>A" "r.(?)" "p.(Gly228Arg)" "5" "PDZ 2 (210-293)" "0000366946" "00024123" "95" "682" "0" "682" "0" "c.682G>A" "r.(?)" "p.(Gly228Arg)" "5" "PDZ 2 (210-293)" "0000366947" "00024123" "95" "682" "0" "682" "0" "c.682G>A" "r.(?)" "p.(Gly228Arg)" "5" "PDZ 2 (210-293)" "0000366948" "00024123" "99" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(Gln550*)" "10" "" "0000366949" "00024123" "99" "2107" "0" "2107" "0" "c.2107del" "r.(?)" "p.(Ser703Valfs*20)" "14" "" "0000366950" "00024123" "35" "1452" "0" "1452" "0" "c.1452G>T" "r.(?)" "p.(=)" "9" "" "0000366951" "00024123" "11" "367" "7" "367" "7" "c.367+7A>G" "r.(=)" "p.(=)" "3i" "" "0000366952" "00024123" "11" "367" "7" "367" "7" "c.367+7A>G" "r.(=)" "p.(=)" "3i" "" "0000366953" "00024123" "11" "1011" "0" "1011" "0" "c.1011C>T" "r.(?)" "p.(=)" "8" "Ser-rich (319-344)" "0000366954" "00024123" "15" "1916" "0" "1916" "0" "c.1916C>G" "r.(?)" "p.(Ala639Gly)" "13" "" "0000366955" "00024123" "99" "1750" "-2" "1750" "-2" "c.1750-2A>G" "r.spl" "p.?" "11i" "" "0000366956" "00024123" "99" "166" "0" "166" "0" "c.166dup" "r.(?)" "p.(Arg56Profs*24)" "2" "" "0000366957" "00024123" "99" "2806" "0" "2806" "0" "c.2806C>T" "r.(?)" "p.(Arg936*)" "18" "" "0000366958" "00024123" "11" "2564" "0" "2564" "0" "c.2564A>C" "r.(?)" "p.(Asn855Thr)" "16" "" "0000366959" "00024123" "99" "2194" "0" "2203" "0" "c.2194_2203del" "r.(?)" "p.(Cys732Leufs*18)" "15" "" "0000366960" "00024123" "99" "166" "0" "166" "0" "c.166dup" "r.(?)" "p.(Arg56Profs*24)" "2" "" "0000366961" "00024123" "15" "2144" "0" "2144" "0" "c.2144C>T" "r.(?)" "p.(Pro715Leu)" "15" "" "0000538899" "00024123" "30" "4451" "0" "4451" "0" "c.*1349C>T" "r.(=)" "p.(=)" "" "" "0000538900" "00024123" "50" "3100" "0" "3100" "0" "c.3100T>C" "r.(?)" "p.(Ter1034ArgextTer4)" "" "" "0000538901" "00024123" "50" "2851" "0" "2851" "0" "c.2851G>A" "r.(?)" "p.(Gly951Arg)" "" "" "0000538902" "00024123" "10" "2772" "0" "2772" "0" "c.2772C>T" "r.(?)" "p.(His924=)" "" "" "0000538903" "00024123" "50" "2719" "-6" "2719" "-6" "c.2719-6C>G" "r.(=)" "p.(=)" "" "" "0000538904" "00024123" "30" "2411" "0" "2411" "0" "c.2411C>T" "r.(?)" "p.(Ala804Val)" "" "" "0000538905" "00024123" "30" "2397" "0" "2397" "0" "c.2397G>T" "r.(?)" "p.(Pro799=)" "" "" "0000538907" "00024123" "50" "2341" "0" "2342" "0" "c.2341_2342insTCAGCC" "r.(?)" "p.(Ser780_Arg781insLeuSer)" "" "" "0000538909" "00024123" "30" "2319" "0" "2336" "0" "c.2319_2336del" "r.(?)" "p.(Arg779_Ser784del)" "" "" "0000538910" "00024123" "30" "2319" "0" "2336" "0" "c.2319_2336del" "r.(?)" "p.(Arg779_Ser784del)" "" "" "0000538912" "00024123" "30" "2297" "0" "2297" "0" "c.2297T>G" "r.(?)" "p.(Ile766Ser)" "" "" "0000538913" "00024123" "50" "2267" "0" "2267" "0" "c.2267T>A" "r.(?)" "p.(Leu756Gln)" "" "" "0000538914" "00024123" "50" "2250" "0" "2250" "0" "c.2250G>T" "r.(?)" "p.(Trp750Cys)" "" "" "0000538915" "00024123" "30" "2237" "0" "2237" "0" "c.2237T>A" "r.(?)" "p.(Leu746Gln)" "" "" "0000538916" "00024123" "30" "2230" "0" "2230" "0" "c.2230C>A" "r.(?)" "p.(Arg744=)" "" "" "0000538917" "00024123" "30" "2212" "0" "2212" "0" "c.2212C>T" "r.(?)" "p.(Leu738=)" "" "" "0000538918" "00024123" "10" "2144" "0" "2144" "0" "c.2144C>T" "r.(?)" "p.(Pro715Leu)" "" "" "0000538919" "00024123" "30" "2144" "0" "2144" "0" "c.2144C>T" "r.(?)" "p.(Pro715Leu)" "" "" "0000538921" "00024123" "90" "2107" "0" "2107" "0" "c.2107del" "r.(?)" "p.(Ser703ValfsTer20)" "" "" "0000538922" "00024123" "30" "2068" "0" "2068" "0" "c.2068G>A" "r.(?)" "p.(Glu690Lys)" "" "" "0000538923" "00024123" "10" "1933" "16" "1933" "16" "c.1933+16C>T" "r.(=)" "p.(=)" "" "" "0000538924" "00024123" "10" "1916" "0" "1916" "0" "c.1916C>G" "r.(?)" "p.(Ala639Gly)" "" "" "0000538925" "00024123" "50" "1672" "0" "1672" "0" "c.1672C>T" "r.(?)" "p.(Arg558Trp)" "" "" "0000538926" "00024123" "10" "1447" "0" "1447" "0" "c.1447G>A" "r.(?)" "p.(Asp483Asn)" "" "" "0000538927" "00024123" "30" "1411" "0" "1411" "0" "c.1411T>C" "r.(?)" "p.(Phe471Leu)" "" "" "0000538928" "00024123" "50" "971" "0" "971" "0" "c.971G>A" "r.(?)" "p.(Ser324Asn)" "" "" "0000538929" "00024123" "10" "367" "7" "367" "7" "c.367+7A>G" "r.(=)" "p.(=)" "" "" "0000538930" "00024123" "30" "336" "0" "336" "0" "c.336C>T" "r.(?)" "p.(Phe112=)" "" "" "0000538931" "00024123" "30" "324" "0" "324" "0" "c.324C>T" "r.(?)" "p.(Gly108=)" "" "" "0000538932" "00024123" "50" "197" "0" "197" "0" "c.197G>A" "r.(?)" "p.(Arg66His)" "" "" "0000612232" "00024123" "30" "8649" "0" "8649" "0" "c.*5547T>G" "r.(=)" "p.(=)" "" "" "0000612233" "00024123" "30" "2363" "0" "2363" "0" "c.2363A>C" "r.(?)" "p.(Gln788Pro)" "" "" "0000612234" "00024123" "50" "2330" "0" "2331" "0" "c.2330_2331del" "r.(?)" "p.(Arg777GlnfsTer17)" "" "" "0000612235" "00024123" "50" "2319" "0" "2328" "0" "c.2319_2328del" "r.(?)" "p.(Ser774ValfsTer31)" "" "" "0000612236" "00024123" "50" "811" "0" "811" "0" "c.811C>T" "r.(?)" "p.(His271Tyr)" "" "" "0000612237" "00024123" "50" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Asp268Asn)" "" "" "0000622312" "00024123" "50" "1452" "0" "1454" "0" "c.1452_1454dup" "r.(?)" "p.(Arg486dup)" "" "" "0000631818" "00024123" "70" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Trp)" "" "" "0000647834" "00024123" "10" "2368" "0" "2368" "0" "c.2368A>G" "r.(?)" "p.(Lys790Glu)" "" "" "0000647835" "00024123" "10" "2049" "0" "2049" "0" "c.2049G>A" "r.(=)" "p.(=)" "" "" "0000647836" "00024123" "30" "1613" "0" "1613" "0" "c.1613G>A" "r.(?)" "p.(Gly538Glu)" "" "" "0000647837" "00024123" "50" "572" "0" "572" "0" "c.572T>A" "r.(?)" "p.(Val191Glu)" "" "" "0000656404" "00024123" "50" "506" "0" "506" "0" "c.506T>C" "r.(?)" "p.(Val169Ala)" "" "" "0000656405" "00024123" "90" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "" "" "0000659737" "00024123" "70" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Trp)" "" "" "0000669044" "00024123" "10" "2368" "0" "2368" "0" "c.2368A>G" "r.(?)" "p.(Lys790Glu)" "" "" "0000669045" "00024123" "10" "2049" "0" "2049" "0" "c.2049G>A" "r.(=)" "p.(=)" "" "" "0000678753" "00024123" "30" "2541" "0" "2541" "0" "c.2541G>A" "r.(?)" "p.(Thr847=)" "" "" "0000678754" "00024123" "50" "494" "0" "494" "0" "c.494G>T" "r.(?)" "p.(Arg165Leu)" "" "" "0000678755" "00024123" "30" "219" "0" "219" "0" "c.219C>T" "r.(?)" "p.(Pro73=)" "" "" "0000690633" "00024123" "30" "8649" "0" "8649" "0" "c.*5547T>G" "r.(=)" "p.(=)" "" "" "0000710325" "00024123" "90" "2089" "0" "2089" "0" "c.2089del" "r.(?)" "p.(Ala697Profs*26)" "" "" "0000722641" "00024123" "50" "18297" "0" "18297" "0" "c.*15195G>C" "r.(=)" "p.(=)" "" "" "0000722642" "00024123" "50" "301" "0" "301" "0" "c.301G>A" "r.(?)" "p.(Val101Met)" "" "" "0000788397" "00024123" "50" "2224" "0" "2224" "0" "c.2224G>A" "r.(?)" "p.(Ala742Thr)" "15" "" "0000788435" "00024123" "50" "2224" "0" "2224" "0" "c.2224G>A" "r.(?)" "p.(Ala742Thr)" "15" "" "0000804267" "00024123" "30" "18156" "0" "18156" "0" "c.*15054G>A" "r.(=)" "p.(=)" "" "" "0000804268" "00024123" "50" "1522" "1" "1522" "1" "c.1522+1G>T" "r.spl?" "p.?" "" "" "0000804269" "00024123" "90" "928" "1" "928" "1" "c.928+1G>A" "r.spl?" "p.?" "" "" "0000804270" "00024123" "50" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Trp)" "" "" "0000812489" "00024123" "70" "793" "0" "793" "0" "c.793A>G" "r.(?)" "p.(Arg265Gly)" "6" "" "0000815738" "00024123" "90" "1543" "0" "1543" "0" "c.1543C>T" "r.(?)" "p.(Gln515Ter)" "" "" "0000815740" "00024123" "90" "1543" "0" "1543" "0" "c.1543C>T" "r.(?)" "p.(Gln515Ter)" "" "" "0000816630" "00024123" "50" "206" "0" "206" "0" "c.206T>C" "r.(?)" "p.(Leu69Pro)" "" "" "0000817070" "00024123" "90" "2107" "0" "2107" "0" "c.2107delA" "r.(?)" "p.(Ser703ValfsTer20)" "" "" "0000845526" "00024123" "50" "971" "0" "971" "0" "c.971G>A" "r.(?)" "p.(Ser324Asn)" "8" "" "0000852363" "00024123" "70" "2618" "-2" "2618" "-2" "c.2618-2A>T" "r.spl?" "p.?" "" "" "0000852364" "00024123" "30" "786" "0" "786" "0" "c.786C>T" "r.(?)" "p.(Asn262=)" "" "" "0000852365" "00024123" "50" "351" "0" "353" "0" "c.351_353del" "r.(?)" "p.(Glu118del)" "" "" "0000861793" "00024123" "30" "2732" "0" "2732" "0" "c.2732T>C" "r.(?)" "p.(Leu911Pro)" "" "" "0000861794" "00024123" "30" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "" "0000888963" "00024123" "50" "1282" "0" "1282" "0" "c.1282C>T" "r.(?)" "p.(Arg428Trp)" "" "" "0000888964" "00024123" "50" "881" "0" "881" "0" "c.881A>G" "r.(?)" "p.(Tyr294Cys)" "" "" "0000925101" "00024123" "70" "18360" "0" "18360" "0" "c.*15258T>C" "r.(=)" "p.(=)" "" "" "0000949333" "00024123" "50" "680" "0" "680" "0" "c.680G>T" "r.(?)" "p.(Arg227Leu)" "" "" "0000949334" "00024123" "50" "307" "0" "307" "0" "c.307G>A" "r.(?)" "p.(Gly103Arg)" "" "" "0000958939" "00024123" "50" "1411" "0" "1411" "0" "c.1411T>C" "r.(?)" "p.(Phe471Leu)" "" "" "0000959376" "00024123" "50" "486" "0" "486" "0" "c.486G>A" "r.(?)" "p.(Met162Ile)" "" "" "0000959471" "00024123" "70" "582" "0" "582" "0" "c.582C>A" "r.(?)" "p.(Cys194Ter)" "" "" "0000998054" "00024123" "70" "18360" "0" "18360" "0" "c.*15258T>C" "r.(=)" "p.(=)" "" "" "0000998055" "00024123" "50" "5995" "0" "6015" "0" "c.*2893_*2913dup" "r.(=)" "p.(=)" "" "" "0001014580" "00024123" "50" "1526" "0" "1526" "0" "c.1526G>C" "r.(?)" "p.(Gly509Ala)" "" "" "0001014581" "00024123" "50" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Arg188His)" "" "" "0001025703" "00024123" "90" "2107" "0" "2107" "0" "c.2107del" "r.(?)" "p.(Ser703ValfsTer20)" "" "" "0001046218" "00024123" "70" "307" "0" "307" "0" "c.307G>C" "r.(?)" "p.(Gly103Arg)" "" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 52 "{{screeningid}}" "{{variantid}}" "0000059161" "0000089979" "0000059171" "0000096180" "0000081540" "0000132197" "0000163891" "0000366933" "0000163891" "0000366942" "0000163892" "0000366934" "0000163892" "0000366943" "0000163893" "0000366935" "0000163893" "0000366944" "0000163894" "0000366936" "0000163895" "0000366937" "0000163896" "0000366938" "0000163897" "0000366939" "0000163898" "0000366940" "0000163899" "0000366941" "0000163900" "0000366945" "0000163901" "0000366946" "0000163902" "0000366947" "0000163903" "0000366948" "0000163903" "0000366949" "0000163904" "0000366950" "0000163905" "0000366951" "0000163906" "0000366952" "0000163907" "0000366953" "0000163908" "0000366954" "0000163909" "0000366955" "0000163910" "0000366956" "0000163911" "0000366957" "0000163912" "0000366958" "0000163913" "0000366959" "0000163914" "0000366960" "0000163915" "0000366961" "0000277087" "0000631818" "0000291145" "0000647834" "0000291146" "0000647835" "0000291147" "0000647836" "0000291148" "0000647837" "0000297121" "0000659737" "0000305356" "0000669044" "0000305357" "0000669045" "0000326733" "0000710325" "0000376613" "0000788397" "0000376619" "0000788435" "0000385440" "0000812489" "0000387612" "0000815738" "0000387613" "0000815740" "0000388185" "0000816630" "0000388469" "0000817070" "0000408604" "0000845526" "0000449172" "0000958939" "0000449172" "0000959376" "0000449283" "0000959471"