### LOVD-version 3000-270 ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PHEX) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PHEX" "phosphate regulating endopeptidase homolog, X-linked" "X" "p22.2-p22.1" "unknown" "NG_007563.2" "UD_132118615490" "" "https://www.LOVD.nl/PHEX" "" "1" "8918" "5251" "300550" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/PHEX_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2018-08-13 09:06:09" "00000" "2022-05-09 16:01:56" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000973" "PHEX" "phosphate regulating endopeptidase homolog, X-linked" "001" "NM_000444.4" "" "NP_000435.3" "" "" "" "-203" "2658" "2250" "22050921" "22266478" "00000" "2012-09-13 13:03:59" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2016-10-22 17:54:40" "00424" "cancer, ovarian" "cancer, ovarian" "" "167000" "" "" "" "00006" "2014-06-18 09:01:54" "" "" "00470" "HPS3" "Hermansky-Pudlak syndrome, type 3 (HPS-3)" "AR" "614072" "" "" "" "00006" "2014-07-23 09:20:14" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02241" "XLHR" "rickets, hypophosphatemic, X-linked dominant (XLHR)" "XLD" "307800" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "06886" "HR" "hypophosphataemic rickets" "" "" "" "" "" "00006" "2021-12-18 20:30:38" "00006" "2021-12-18 20:31:29" "06887" "dysplasia, bone" "dysplasia, bone" "" "" "" "" "" "00006" "2021-12-27 10:53:47" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "PHEX" "02241" "PHEX" "06886" ## Individuals ## Do not remove or alter this header ## ## Count = 1613 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00174830" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174831" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174832" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174833" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174834" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174835" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174836" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174837" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174838" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174839" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174840" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174841" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174842" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174843" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174844" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174845" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174846" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174847" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174848" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174849" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174850" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174851" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00174852" "" "" "" "1" "" "02208" "{PMID:Quinlan 2012:22101457}" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat?" "00225631" "" "" "" "9" "" "03213" "{PMID:Li 2019:30920082}" "4-generation family, 9 affected (4F, 5M), heterozygous affected mother and healthy father" "M" "no" "China" "02y06m" "0" "yes" "yes" "yellow race" "" "00295015" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308773" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00392047" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392048" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392049" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392050" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392051" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392052" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392053" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392054" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392055" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392056" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392057" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392058" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392059" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392060" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392061" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392062" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392063" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392064" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392065" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392066" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392067" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392068" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392069" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392070" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392071" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392072" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392073" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392074" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392075" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392076" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392077" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392078" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392079" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392080" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392081" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392082" "" "" "" "1" "" "00006" "{PMID:Chesher 2018:29460029}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00392083" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat1" "00392084" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat2" "00392085" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat3" "00392086" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat4" "00392087" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat5" "00392088" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat6" "00392089" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat7" "00392090" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat8" "00392091" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat9" "00392092" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat10" "00392093" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat11" "00392094" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat12" "00392095" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat13" "00392096" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat14" "00392097" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat15" "00392098" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat16" "00392099" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat17" "00392100" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat18" "00392101" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat19" "00392102" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat20" "00392103" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat21" "00392104" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat22" "00392105" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat23" "00392106" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat24" "00392107" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat25" "00392108" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat26" "00392109" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat27" "00392110" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat28" "00392111" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat29" "00392112" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat30" "00392113" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat31" "00392114" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat32" "00392115" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "M" "" "Spain" "" "0" "" "" "" "Pat33" "00392116" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat34" "00392117" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat35" "00392118" "" "" "" "1" "" "00006" "{PMID:Morey 2011:21902834}" "" "F" "" "Spain" "" "0" "" "" "" "Pat36" "00392172" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Fam1" "00392173" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat4" "00392174" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Fam5" "00392175" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam8" "00392176" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat15" "00392177" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Fam3" "00392178" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Pat23" "00392179" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat28" "00392180" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat19" "00392181" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Pat22" "00392182" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam14" "00392183" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam9" "00392184" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam6" "00392185" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat20" "00392186" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam10" "00392187" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Pat18" "00392188" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat34" "00392189" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat16" "00392190" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Denmark" "" "0" "" "" "" "Pat13" "00392191" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "F" "" "Denmark" "" "0" "" "" "" "Fam12" "00392192" "" "" "" "1" "" "00006" "{PMID:Beck-Nielsen 2012:22695891}" "" "M" "" "Lebanon" "" "0" "" "" "" "Fam21" "00392193" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392194" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392195" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392196" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "M" "" "Argentina" "" "0" "" "" "" "" "00392197" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392198" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00392199" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "Europe-N" "" "00392200" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392201" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392202" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392203" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392204" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "Asia-SE" "" "00392205" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392206" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392207" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392208" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392209" "" "" "" "2" "" "00006" "{PMID:Dixon 1998:9768674}" "3-generation family, affected mother/son" "F;M" "" "" "" "0" "" "" "" "" "00392210" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392211" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392212" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392213" "" "" "" "3" "" "00006" "{PMID:Dixon 1998:9768674}" "2-generation family, affected mothe/twin daughters" "F" "" "" "" "0" "" "" "" "" "00392214" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "United States" "" "0" "" "" "African-American" "" "00392215" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "Europe-N" "" "00392216" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392217" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392218" "" "" "" "9" "" "00006" "{PMID:Dixon 1998:9768674}" "4-generation family, 9 affected (6F, 3M)" "F;M" "" "" "" "0" "" "" "" "" "00392219" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392220" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "United States" "" "0" "" "" "African-American" "" "00392221" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "India" "" "0" "" "" "" "" "00392222" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392223" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392224" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392225" "" "" "" "1" "" "00006" "{PMID:Dixon 1998:9768674}" "" "" "" "" "" "0" "" "" "" "" "00392226" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "Spain" "" "0" "" "" "" "AG75" "00392227" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "France" "" "0" "" "" "" "AJ24" "00392228" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "B10" "00392229" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "BA99" "00392230" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "BB35" "00392231" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "BD46" "00392232" "" "" "" "8" "" "00006" "{PMID:Rowe 1997:9097956}" "family, 8 affected" "" "" "Italy" "" "0" "" "" "" "BH41" "00392233" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "CL66" "00392234" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "CL69" "00392235" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "family" "" "" "" "" "0" "" "" "" "CM41" "00392236" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "France" "" "0" "" "" "" "CM98" "00392237" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "family" "" "" "" "" "0" "" "" "" "CP21" "00392238" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "family" "" "" "" "" "0" "" "" "" "CP64" "00392239" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "CQ5" "00392240" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "family" "" "" "" "" "0" "" "" "" "CT65" "00392241" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "DA52" "00392242" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "DC8" "00392243" "" "" "" "2" "" "00006" "{PMID:Rowe 1997:9097956}" "family, affected male twins" "" "" "" "" "0" "" "" "" "DS99" "00392244" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "HG" "00392245" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "M" "00392246" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "MW180" "00392247" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "Poland" "" "0" "" "" "" "POZN" "00392248" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "PY" "00392249" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "RG175" "00392250" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "S" "00392251" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "SG" "00392252" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "TH241" "00392253" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "XH011" "00392254" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "XH015" "00392255" "" "" "" "1" "" "00006" "{PMID:Rowe 1997:9097956}" "" "" "" "" "" "0" "" "" "" "XHYP018" "00392284" "" "" "" "2" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "family, 2 affected, son" "M" "" "United States" "" "0" "" "" "" "D31" "00392285" "" "" "" "6" "" "00006" "{PMID:Holm 2001:11502829}" "family, 6 affected, paternal grandmother" "F" "" "United States" "" "0" "" "" "" "E22" "00392286" "" "" "" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "patient" "F" "" "United States" "" "0" "" "" "" "B42" "00392287" "" "" "" "3" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "family, 3 affected, father" "M" "" "United States" "" "0" "" "" "" "C21" "00392288" "" "" "" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "patient" "F" "" "United States" "" "0" "" "" "" "V1" "00392289" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected, maternal grandmother" "F" "" "United States" "" "0" "" "" "" "K31" "00392290" "" "" "" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "patient" "F" "" "United States" "" "0" "" "" "" "P21" "00392291" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "2-generation family, affected mother/2 daugthers, daughter" "F" "" "United States" "" "0" "" "" "" "L42" "00392292" "" "" "" "2" "" "00006" "{PMID:Holm 2001:11502829}" "2-generation family, affected mother/son" "F" "" "United States" "" "0" "" "" "" "G45" "00392395" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected, maternal grandmother" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "125-06" "00392396" "" "" "00392395" "1" "" "00006" "{PMID:Holm 2001:11502829}" "mother" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "125-01" "00392397" "" "" "00392395" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "125-04" "00392398" "" "" "00392395" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "125-02" "00392399" "" "" "00392292" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "G51" "00392400" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AJ21" "00392401" "" "" "00392400" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AJ31" "00392402" "" "" "00392400" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AJ32" "00392403" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected" "M" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "106-05" "00392404" "" "" "00392403" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "106-04" "00392405" "" "" "00392403" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "106-01" "00392406" "" "" "00392403" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "106-02" "00392407" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "M" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "110-02" "00392408" "" "" "00392407" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "110-03" "00392409" "" "" "00392407" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "110-05" "00392410" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "M" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "086-02" "00392411" "" "" "00392410" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "086-03" "00392412" "" "" "00392410" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "086-04" "00392413" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected" "M" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "122-01" "00392414" "" "" "00392413" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "122-04" "00392415" "" "" "00392413" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "122-03" "00392416" "" "" "00392413" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "122-05" "00392417" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "112-01" "00392418" "" "" "00392417" "1" "" "00006" "{PMID:Holm 2001:11502829}" "mother’s brother" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "112-04" "00392419" "" "" "00392417" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "112-02" "00392420" "" "" "" "2" "" "00006" "{PMID:Holm 2001:11502829}" "family, 2 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AI1-1" "00392421" "" "" "00392420" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AI1-2" "00392422" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "081-02" "00392423" "" "" "00392422" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "081-03" "00392424" "" "" "00392422" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "081-04" "00392425" "" "" "00392285" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "father" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "E3-10" "00392426" "" "" "00392285" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "E42" "00392427" "" "" "00392285" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "E43" "00392428" "" "" "00392285" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father’s brothers’ daughter" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "E46" "00392429" "" "" "00392285" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father’s brothers’ daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "E47" "00392430" "" "" "" "6" "" "00006" "{PMID:Holm 2001:11502829}" "family, 6 affected, paternal grandmother" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "H01" "00392431" "" "" "00392430" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father\'s brother" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "H12" "00392432" "" "" "00392430" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "H11" "00392433" "" "" "00392430" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father’s brothers’ daughter" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "H22" "00392434" "" "" "00392430" "1" "" "00006" "{PMID:Holm 2001:11502829}" "father’s brothers’ daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "H23" "00392435" "" "" "00392430" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "H21" "00392436" "" "" "" "2" "" "00006" "{PMID:Holm 2001:11502829}" "family, 2 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "Y21" "00392437" "" "" "00392436" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "Y22" "00392438" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected, maternal grandmother" "F" "" "United States" "" "0" "" "" "" "109-05" "00392439" "" "" "00392438" "1" "" "00006" "{PMID:Holm 2001:11502829}" "mother" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "109-01" "00392440" "" "" "00392438" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "109-03" "00392441" "" "" "00392438" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "109-04" "00392442" "" "" "" "4" "" "00006" "{PMID:Holm 2001:11502829}" "family, 4 affected, maternal grandmother" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "114-01" "00392443" "" "" "00392442" "1" "" "00006" "{PMID:Holm 2001:11502829}" "maternal grandmother" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "114-04" "00392444" "" "" "00392442" "1" "" "00006" "{PMID:Holm 2001:11502829}" "mother’s brother" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "114-05" "00392445" "" "" "00392442" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "114-03" "00392446" "" "" "" "1" "" "00006" "{PMID:Holm 2001:11502829}" "" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "O21" "00392447" "" "" "" "1" "" "00006" "{PMID:Holm 2001:11502829}" "" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AC" "00392448" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "C21" "00392449" "" "" "00392287" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "C31" "00392450" "" "" "00392287" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "C32" "00392451" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "T1" "00392452" "" "" "00392451" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "T2" "00392453" "" "" "00392451" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "T3" "00392454" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "F32" "00392455" "" "" "00392454" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "F42" "00392456" "" "" "00392454" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "F43" "00392457" "" "" "00392289" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "K41" "00392458" "" "" "00392289" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "K42" "00392459" "" "" "00392289" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "K43" "00392460" "" "" "00392291" "1" "" "00006" "{PMID:Holm 2001:11502829}" "mother" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "L31" "00392461" "" "" "00392291" "1" "" "00006" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "L41" "00392462" "" "" "" "1" "" "00006" "{PMID:Holm 2001:11502829}" "" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AA1" "00392463" "" "" "" "2" "" "00006" "{PMID:Holm 2001:11502829}" "family, 2 affected" "F" "" "United States" "" "0" "" "" "" "AB1" "00392464" "" "" "00392463" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "AB2" "00392465" "" "" "" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "123-03" "00392466" "" "" "" "2" "" "00006" "{PMID:Holm 2001:11502829}" "family, 2 affected" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "083-02" "00392467" "" "" "00392466" "1" "" "00006" "{PMID:Holm 2001:11502829}" "daughter" "F" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "083-01" "00392468" "" "" "" "3" "" "00006" "{PMID:Holm 2001:11502829}" "family, 3 affected" "F" "" "United States" "" "0" "" "no treatment within 1y of diagnosis" "" "M11" "00392469" "" "" "00392468" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "M21" "00392470" "" "" "00392468" "1" "" "00006" "{PMID:Holm 2001:11502829}" "son" "M" "" "United States" "" "0" "" "treatment started within 1y of diagnosis" "" "M22" "00392471" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "324Pat4152" "00392472" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Belgium" "" "0" "" "" "" "353Pat8817" "00392473" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "318Pat4331" "00392474" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "" "" "0" "" "" "Balkan" "310Pat3941" "00392475" "" "" "" "2" "" "00006" "{PMID:Francis 1997:9199930}, {PMID:Kienitz 2011:21553362}" "2-generation family, affected mother/daughter" "F" "" "Germany" "" "0" "" "" "" "304Pat2985;Pat2" "00392476" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "315Pat4205" "00392477" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "323Pat4142" "00392478" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "325Pat4173" "00392479" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Switzerland" "" "0" "" "" "" "347Pat7754" "00392480" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "303Pat2770" "00392481" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "339Pat5761" "00392482" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "313Pat3998" "00392483" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "321Pat4098" "00392484" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "309Pat3819" "00392485" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "338Pat5760" "00392486" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "333Pat4913" "00392487" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "351Pat8496" "00392488" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "342Pat6991" "00392489" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "305Pat3752" "00392490" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "317Pat4057" "00392491" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "334Pat5587" "00392492" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "340Pat5762" "00392493" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "314Pat4004" "00392494" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "319Pat4350" "00392495" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "344Pat7339" "00392496" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "320Pat4090" "00392497" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Switzerland" "" "0" "" "" "" "349Pat7756" "00392498" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "301Pat1928" "00392499" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "332Pat4845" "00392500" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "336Pat5647" "00392501" "" "" "" "6" "" "00006" "{PMID:Francis 1997:9199930}" "3-generation family, 6 affected (4F, 2M)" "M" "" "Germany" "" "0" "" "" "" "316Pat4064" "00392502" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "M" "" "Germany" "" "0" "" "" "" "327Pat4184" "00392503" "" "" "" "1" "" "00006" "{PMID:Francis 1997:9199930}" "" "F" "" "Germany" "" "0" "" "" "" "330Pat4316" "00392680" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "M" "" "" "" "0" "" "" "Europe" "FA73" "00392681" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EA87" "00392682" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EM84" "00392683" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "EG10" "00392684" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "EL65" "00392685" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EM18" "00392686" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "FM47" "00392687" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EW36" "00392688" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "M" "" "" "" "0" "" "" "Europe" "FA63" "00392689" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "DR51" "00392690" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "ET78" "00392691" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EW77" "00392692" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "DY36" "00392693" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "FA70" "00392694" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "M" "" "" "" "0" "" "" "Europe" "FA66" "00392695" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "CL73" "00392696" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "FA67" "00392697" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EH90" "00392698" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "M" "" "" "" "0" "" "" "Europe" "EO15" "00392699" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "M" "" "" "" "0" "" "" "Europe" "FA69" "00392700" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "EL27" "00392701" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "FA68" "00392702" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EO59" "00392703" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "EP5" "00392704" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "CE37" "00392705" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "family" "F" "" "" "" "0" "" "" "Europe" "EL50" "00392706" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "EA96" "00392707" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "FA72" "00392708" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "F" "" "" "" "0" "" "" "Europe" "EJ16" "00392709" "" "" "" "1" "" "00006" "{PMID:Filisetti 1999:10439971}" "patient" "M" "" "" "" "0" "" "" "Europe" "ET31" "00392710" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID1, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392711" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID13, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392712" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID133, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392713" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID17, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392714" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID172, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392715" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID173, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392716" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID174, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392717" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID175, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392718" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID176, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392719" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID177, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392720" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID178, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392721" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID179, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392722" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID18, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392723" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID71, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392724" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID9, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392725" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077} from PHEXdb-MutID90, {PMID:Pronicka 2004:15057978}" "" "" "" "Poland" "" "0" "" "" "" "" "00392726" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID1" "" "" "" "Poland" "" "0" "" "" "" "" "00392727" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID13" "" "" "" "Poland" "" "0" "" "" "" "" "00392728" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID133" "" "" "" "Poland" "" "0" "" "" "" "" "00392729" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID17" "" "" "" "Poland" "" "0" "" "" "" "" "00392730" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID172" "" "" "" "Poland" "" "0" "" "" "" "" "00392731" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID173" "" "" "" "Poland" "" "0" "" "" "" "" "00392732" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID174" "" "" "" "Poland" "" "0" "" "" "" "" "00392733" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID175" "" "" "" "Poland" "" "0" "" "" "" "" "00392734" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID176" "" "" "" "Poland" "" "0" "" "" "" "" "00392735" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID177" "" "" "" "Poland" "" "0" "" "" "" "" "00392736" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID178" "" "" "" "Poland" "" "0" "" "" "" "" "00392737" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID179" "" "" "" "Poland" "" "0" "" "" "" "" "00392738" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID18" "" "" "" "Poland" "" "0" "" "" "" "" "00392739" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID71" "" "" "" "Poland" "" "0" "" "" "" "" "00392740" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID9" "" "" "" "Poland" "" "0" "" "" "" "" "00392741" "" "" "" "1" "" "00006" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID90" "" "" "" "Poland" "" "0" "" "" "" "" "00392742" "" "" "" "2" "" "00006" "{PMID:Sato 2000:11004247}" "family, 2 affected" "" "" "Japan" "" "0" "" "" "" "Fam1" "00392743" "" "" "" "3" "" "00006" "{PMID:Sato 2000:11004247}" "family, 3 affected" "" "" "Japan" "" "0" "" "" "" "Fam2" "00392744" "" "" "" "3" "" "00006" "{PMID:Sato 2000:11004247}" "family, 3 affected" "" "" "Japan" "" "0" "" "" "" "Fam3" "00392745" "" "" "" "2" "" "00006" "{PMID:Sato 2000:11004247}" "family, 2 affected" "" "" "Japan" "" "0" "" "" "" "Fam4" "00392746" "" "" "" "11" "" "00006" "{PMID:Econs 1998:9768646}" "large-multigeneration family, >11 affected" "F;M" "no" "United States" "" "0" "" "" "France;Scotland" "family" "00392747" "" "" "" "2" "" "00006" "{PMID:Christie 2001:11502821}" "family, affected father/daughter" "F;M" "" "United States" "" "0" "" "" "" "FamR" "00392780" "" "" "" "1" "" "00006" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID129" "" "" "" "" "" "0" "" "" "" "" "00392781" "" "" "" "1" "" "00006" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID130" "" "" "" "" "" "0" "" "" "" "" "00392782" "" "" "" "1" "" "00006" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID178" "" "" "" "Poland" "" "0" "" "" "" "" "00392783" "" "" "" "1" "" "00006" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID22" "" "" "" "" "" "0" "" "" "" "" "00392784" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392785" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392786" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392787" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392788" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392789" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392790" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392791" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392792" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392793" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392794" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392795" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392796" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392797" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392798" "" "" "" "1" "" "00006" "{PMID:Tyynismaa 2000:10737991}" "" "" "" "Finland" "" "0" "" "" "" "" "00392799" "" "" "" "2" "" "00006" "{PMID:Yamazaki 2002:12414858}" "family, affected father/son" "" "" "Japan" "" "0" "" "" "" "Case2" "00392800" "" "" "00392799" "1" "" "00006" "{PMID:Yamazaki 2002:12414858}" "son" "M" "" "Japan" "" "0" "" "" "" "Case1" "00392801" "" "" "" "1" "" "00006" "{PMID:Yamazaki 2002:12414858}" "" "" "" "Japan" "" "0" "" "" "" "Case3" "00392802" "" "" "" "2" "" "00006" "{PMID:Yamazaki 2002:12414858}" "family, 2 affected sisters" "F" "" "Japan" "" "0" "" "" "" "Case4" "00392803" "" "" "00392802" "1" "" "00006" "{PMID:Yamazaki 2002:12414858}" "sister" "F" "" "Japan" "" "0" "" "" "" "Case5" "00392804" "" "" "" "1" "" "00006" "{PMID:Yamazaki 2002:12414858}" "" "" "" "Japan" "" "0" "" "" "" "Case6" "00392805" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "family" "F" "" "Korea" "" "0" "" "" "" "Pat1" "00392806" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "patient" "M" "" "Korea" "" "0" "" "" "" "Pat2" "00392807" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "family" "M" "" "Korea" "" "0" "" "" "" "Pat3" "00392808" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "patient" "F" "" "Korea" "" "0" "" "" "" "Pat4" "00392809" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}" "patient" "F" "" "Korea" "" "0" "" "" "" "Pat5" "00392810" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "patient" "F" "" "Korea" "" "0" "" "" "" "Pat6" "00392811" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "family" "M" "" "Korea" "" "0" "" "" "" "Pat7" "00392812" "" "" "" "1" "" "00006" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "patient" "F" "" "Korea" "" "0" "" "" "" "Pat8" "00392814" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392815" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392816" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392817" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392818" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392819" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392820" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392821" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392822" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392823" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392824" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392825" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392826" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392827" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392828" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392829" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392830" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392831" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392832" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392833" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392834" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392835" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392836" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392837" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392838" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392839" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392840" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392841" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392842" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392843" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392844" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392845" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392846" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392847" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392848" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392849" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392850" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392851" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392852" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392853" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392854" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392855" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392856" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392857" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392858" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392859" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392860" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392861" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392862" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392863" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392864" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392865" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392866" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392867" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392868" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392869" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392870" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392871" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392872" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392873" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392874" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392875" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392876" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392877" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392878" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392879" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392880" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392881" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392882" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392883" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392884" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392885" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392886" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392887" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392888" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392889" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392890" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392891" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392892" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392893" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392894" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392895" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392896" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392897" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392898" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392899" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "family" "" "" "France" "" "0" "" "" "" "" "00392900" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392901" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392902" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patient" "" "" "France" "" "0" "" "" "" "" "00392903" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00392904" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00392905" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00392906" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00392907" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00392908" "" "" "" "1" "" "00006" "{PMID:Gaucher 2009:19219621}" "patients" "" "" "France" "" "0" "" "" "" "" "00393205" "" "" "" "1" "" "00006" "{PMID:Chou 2005:15818436}}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat1" "00393206" "" "" "" "1" "" "00006" "{PMID:Chou 2005:15818436}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat2" "00393207" "" "" "" "2" "" "00006" "{PMID:Lo 2006:16636593}" "2-generation family, affected father/daughter" "F" "" "Taiwan" "" "0" "" "" "" "Fam1PatII1" "00393208" "" "" "" "4" "" "00006" "{PMID:Lo 2006:16636593}" "2-generation family, affected mother/3 sibs (2F 2M)" "M" "" "Taiwan" "" "0" "" "" "" "Fam2PatII1" "00393211" "" "" "" "3" "" "00006" "{PMID:Makras 2008:18252791}" "2-generation family, affected mother/2 sons" "M" "" "Netherlands" "" "0" "" "" "" "FamPat1" "00393213" "" "" "" "2" "" "00006" "{PMID:Raeder 2008:18775977}" "3-generation family, affected mother/daughter" "F" "" "Norway" "" "0" "" "" "" "FamPatIII1" "00393214" "" "" "" "2" "" "00006" "{PMID:Saito 2009:19581284}" "2-generation family, affected sister/brother" "F" "" "Japan" "" "0" "" "" "" "FamPat1" "00393216" "" "" "" "1" "" "00006" "{PMID:Kim 2009:19429806}" "" "F" "" "Korea" "" "0" "" "" "" "Pat1" "00393226" "" "" "" "3" "" "00006" "{PMID:Xia 2007:18046499}" "3-generation family, 6 affected (5F, M)" "F" "" "China" "" "0" "" "" "" "Fam1PatI2" "00393227" "" "" "00393226" "1" "" "00006" "{PMID:Xia 2007:18046499}" "" "F" "" "China" "" "0" "" "" "" "Fam1PatII2" "00393228" "" "" "00393226" "1" "" "00006" "{PMID:Xia 2007:18046499}" "" "M" "" "China" "" "0" "" "" "" "Fam1PatII4" "00393229" "" "" "00393226" "1" "" "00006" "{PMID:Xia 2007:18046499}" "" "F" "" "China" "" "0" "" "" "" "Fam1PatIII1" "00393230" "" "" "" "2" "" "00006" "{PMID:Xia 2007:18046499}" "3-generation family, 2 affected (2F)" "F" "" "China" "" "0" "" "" "" "Fam2PatII2" "00393231" "" "" "00393230" "1" "" "00006" "{PMID:Xia 2007:18046499}" "" "F" "" "China" "" "0" "" "" "" "Fam2PatIII1" "00393232" "" "" "" "2" "" "00006" "{PMID:Xia 2007:18046499}" "3-generation family, 2 affected (2F)" "F" "" "China" "" "0" "" "" "" "Fam3PatI2" "00393233" "" "" "00393232" "1" "" "00006" "{PMID:Xia 2007:18046499}" "" "F" "" "China" "" "0" "" "" "" "Fam3PatII1" "00393234" "" "" "" "4" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, affected mother/2 daughters/son" "F" "" "Turkey" "" "0" "" "" "" "Fam1Pat1" "00393235" "" "" "00393234" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "daughter" "F" "" "Turkey" "" "0" "" "" "" "Fam1Pat2" "00393236" "" "" "00393234" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "daughter" "F" "" "Turkey" "" "0" "" "" "" "Fam1Pat3" "00393237" "" "" "00393234" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "son" "M" "" "Turkey" "" "0" "" "" "" "Fam1Pat4" "00393238" "" "" "" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Turkey" "" "0" "" "" "" "Fam2Pat3" "00393239" "" "" "" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Turkey" "" "0" "" "" "" "Fam3Pat3" "00393240" "" "" "" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Turkey" "" "0" "" "" "" "Fam4Pat3" "00393241" "" "" "" "2" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, affected mother/son" "F" "" "Turkey" "" "0" "" "" "" "Fam5Pat2" "00393242" "" "" "00393241" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "son" "M" "" "Turkey" "" "0" "" "" "" "Fam5Pat3" "00393243" "" "" "" "1" "" "00006" "{PMID:Durmaz 2013:23079138}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Turkey" "" "0" "" "" "" "Fam9Pat3" "00393244" "" "" "" "1" "" "00006" "{PMID:Cheon 2014:24926462}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Korea" "" "0" "" "" "" "patient" "00393246" "" "" "" "2" "" "00006" "{PMID:Huang 2015:25839938}" "3-generation family, affected mother/son" "F" "" "China" "" "0" "" "" "" "Fam1PatII2" "00393247" "" "" "00393246" "1" "" "00006" "{PMID:Huang 2015:25839938}" "" "M" "" "China" "" "0" "" "" "" "Fam1PatIII1" "00393248" "" "" "" "3" "" "00006" "{PMID:Huang 2015:25839938}" "4-generation family, 3 affected" "F" "" "China" "" "0" "" "" "" "Fam2PatII2" "00393249" "" "" "00393248" "1" "" "00006" "{PMID:Huang 2015:25839938}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam2PatIII3" "00393250" "" "" "" "1" "" "00006" "{PMID:Huang 2015:25839938}" "3-generation family, 1 affected" "F" "" "China" "" "0" "" "" "" "Fam3PatIII2" "00393251" "" "" "" "2" "" "00006" "{PMID:Huang 2015:25839938}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam4PatII4" "00393252" "" "" "00393251" "1" "" "00006" "{PMID:Huang 2015:25839938}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam4PatIII1" "00393253" "" "" "" "7" "" "00006" "{PMID:Xie 2014:25237965}" "3-generation family, 7 affected (5F, 2M)" "F" "" "China" "" "0" "" "" "" "FamPatII10" "00393254" "" "" "" "2" "" "00006" "{PMID:Goji 2006:16303832}" "2-generation family, affected father/daughter" "M" "" "Japan" "" "0" "" "" "" "FamPatII1" "00393255" "" "" "00393254" "1" "" "00006" "{PMID:Goji 2006:16303832}" "daughter" "F" "" "Japan" "" "0" "" "" "" "FamPatIII1" "00393256" "" "" "" "2" "" "00006" "{PMID:Roetzer 2007:17406123}" "3-generation family, affected mother/son" "M" "" "Austria" "" "0" "" "" "" "family" "00393257" "" "" "" "7" "" "00006" "{PMID:Song 2007:18162710}" "3-generation family, 7 affected (6F, 3M)" "F" "" "Korea" "" "0" "" "" "" "Fam1Pat1" "00393258" "" "" "00393257" "1" "" "00006" "{PMID:Song 2007:18162710}" "mother" "F" "" "Korea" "" "0" "" "" "" "Fam1Pat2" "00393259" "" "" "00393257" "1" "" "00006" "{PMID:Song 2007:18162710}" "maternal aunt" "F" "" "Korea" "" "0" "" "" "" "Fam1Pat3" "00393260" "" "" "00393257" "1" "" "00006" "{PMID:Song 2007:18162710}" "cousin" "M" "" "Korea" "" "0" "" "" "" "Fam1Pat4" "00393261" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam2Pat1" "00393262" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam3Pat1" "00393263" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam4Pat1" "00393264" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam5Pat1" "00393265" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam6Pat1" "00393266" "" "" "" "4" "" "00006" "{PMID:Song 2007:18162710}" "3-generation family, 4 affected (4F)" "F" "" "Korea" "" "0" "" "" "" "Fam7Pat1" "00393267" "" "" "00393266" "1" "" "00006" "{PMID:Song 2007:18162710}" "mother" "F" "" "Korea" "" "0" "" "" "" "Fam7Pat2" "00393268" "" "" "00393266" "1" "" "00006" "{PMID:Song 2007:18162710}" "maternal aunt" "F" "" "Korea" "" "0" "" "" "" "Fam7Pat3" "00393269" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "F" "" "Korea" "" "0" "" "" "" "Fam8Pat1" "00393270" "" "" "" "1" "" "00006" "{PMID:Song 2007:18162710}" "proband" "M" "" "Korea" "" "0" "" "" "" "Fam9Pat1" "00393271" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "African-American" "PatA1" "00393272" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatB1" "00393273" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatH1" "00393274" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatI1" "00393275" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatJ1" "00393276" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatK1" "00393277" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatL1" "00393278" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatM1" "00393279" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatN1" "00393280" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatO1" "00393281" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatP1" "00393282" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatQ1" "00393283" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatR1" "00393284" "" "" "" "2" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatS1-S6" "00393285" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatT1" "00393286" "" "" "" "2" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatU1/U2" "00393287" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatV1" "00393288" "" "" "" "2" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatW1/W2" "00393289" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatY1" "00393290" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatZ1" "00393291" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "" "PatY1" "00393292" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatC1" "00393293" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatD1" "00393294" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatE1" "00393295" "" "" "" "1" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatF1" "00393296" "" "" "" "2" "" "00006" "{PMID:Ichikawa 2008:18625346}" "" "" "" "United States" "" "0" "" "" "white" "PatG1/G2" "00393297" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "patient" "F" "" "Germany" "" "0" "" "" "" "Pat1" "00393298" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "family" "F" "" "Germany" "" "0" "" "" "" "Pat2" "00393299" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "patient" "M" "" "Germany" "" "0" "" "" "" "Pat3" "00393300" "" "" "" "5" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "4-generation family, 5 affected (3F, 2M)" "F" "" "Germany" "" "0" "" "" "" "Pat4" "00393301" "" "" "" "4" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "3-generation family, 4 affected (2F, 2M)" "F" "" "Germany" "" "0" "" "" "" "Pat5" "00393302" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "patient" "F" "" "Germany" "" "0" "" "" "" "Pat6" "00393303" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "family" "F" "" "Germany" "" "0" "" "" "" "Pat7" "00393304" "" "" "" "1" "" "00006" "{PMID:Clausmeyer 2009:19513579}" "patient" "F" "" "Germany" "" "0" "" "" "" "Pat8" "00393394" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam8" "00393395" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam37" "00393396" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam38" "00393397" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam18" "00393398" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam23" "00393399" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam3" "00393400" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam27" "00393401" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam32" "00393404" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam21" "00393405" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam41" "00393406" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam34" "00393407" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam30" "00393408" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam29" "00393409" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam12" "00393410" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam22" "00393411" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam36" "00393412" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam17" "00393413" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam9" "00393414" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam39" "00393415" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam5" "00393416" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam46" "00393417" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam19" "00393418" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam44" "00393419" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam10" "00393420" "" "" "" "1" "" "00006" "{PMID:Ruppe 2011:21050253}" "" "" "" "United States" "" "0" "" "" "" "Fam35" "00393430" "" "" "" "2" "" "00006" "{PMID:Chandran 2010:20664300}" "2-generation family, affected mother/daughter" "F" "" "Singapore" "" "0" "" "" "India" "family" "00394383" "" "" "" "1" "" "00006" "{PMID:Jap 2011:21293852}" "family" "M" "" "China" "" "0" "" "" "" "Pat1" "00394384" "" "" "" "1" "" "00006" "{PMID:Jap 2011:21293852}" "family" "F" "" "China" "" "0" "" "" "" "Pat2" "00394385" "" "" "" "1" "" "00006" "{PMID:Jap 2011:21293852}" "patient" "M" "" "China" "" "0" "" "" "" "Pat3" "00394386" "" "" "" "1" "" "00006" "{PMID:Jap 2011:21293852}" "patient" "F" "" "China" "" "0" "" "" "" "Pat4" "00394387" "" "" "" "1" "" "00006" "{PMID:Jap 2011:21293852}" "family" "F" "" "China" "" "0" "" "" "" "Pat5" "00394388" "" "" "" "1" "" "00006" "{PMID:Kienitz 2011:21553362}" "" "" "" "Germany" "" "0" "" "" "" "Pat1" "00394389" "" "" "" "4" "" "00006" "{PMID:Kienitz 2011:21553362}" "family, affected sisters/father, niece" "" "" "Germany" "" "0" "" "" "" "Pat3" "00394390" "" "" "" "1" "" "00006" "{PMID:Ellison 2009:19309785}" "" "" "" "United States" "" "0" "" "" "" "patient" "00394391" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat1" "00394392" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat3" "00394393" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat5" "00394394" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat6" "00394395" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat7" "00394396" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat10" "00394397" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected mother/daughter" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat11" "00394398" "" "" "00394397" "1" "" "00006" "{PMID:Park 2021:34434907}" "mother" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat11-1" "00394399" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat12" "00394400" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat13" "00394401" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat14" "00394402" "" "" "00394401" "1" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected mother/daughter" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat14-1" "00394403" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "mother" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat15" "00394404" "" "" "00394403" "1" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected mother/son" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat15-1" "00394405" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "mother" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat16" "00394406" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat17" "00394407" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat18" "00394408" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat19" "00394409" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat20" "00394410" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat21" "00394411" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat22" "00394412" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat23" "00394413" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat24" "00394414" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat25" "00394415" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat26" "00394416" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat27" "00394417" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat28" "00394418" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected brothers" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat29" "00394419" "" "" "00394418" "1" "" "00006" "{PMID:Park 2021:34434907}" "brother" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat29-1" "00394420" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat30" "00394421" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat31" "00394422" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat32" "00394423" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat33" "00394424" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat34" "00394425" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected sisters" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat34-1" "00394426" "" "" "00394425" "1" "" "00006" "{PMID:Park 2021:34434907}" "sister" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat35" "00394427" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected father/daughter" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat35-1" "00394428" "" "" "00394427" "1" "" "00006" "{PMID:Park 2021:34434907}" "father" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat36" "00394429" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat37" "00394430" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat38" "00394431" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat39" "00394432" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat42" "00394433" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat43" "00394434" "" "" "" "2" "" "00006" "{PMID:Park 2021:34434907}" "2-generation family, affected mother/son" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat45" "00394435" "" "" "00394434" "1" "" "00006" "{PMID:Park 2021:34434907}" "mother" "F" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat45-1" "00394436" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat46" "00394437" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat47" "00394438" "" "" "" "1" "" "00006" "{PMID:Park 2021:34434907}" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "Pat48" "00394440" "" "" "" "2" "" "00006" "{PMID:Kinoshita 2012:22577109}" "family, 2 affected" "F" "" "Japan" "" "0" "" "" "" "Fam1Pat1" "00394441" "" "" "00394440" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "M" "" "Japan" "" "0" "" "" "" "Fam1Pat2" "00394442" "" "" "" "3" "" "00006" "{PMID:Kinoshita 2012:22577109}" "family, 3 affected" "M" "" "Japan" "" "0" "" "" "" "Fam2Pat3" "00394443" "" "" "00394442" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam2Pat4" "00394444" "" "" "00394442" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam2Pat5" "00394445" "" "" "" "2" "" "00006" "{PMID:Kinoshita 2012:22577109}" "family, 2 affected" "M" "" "Japan" "" "0" "" "" "" "Fam3Pat6" "00394446" "" "" "00394440" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam3Pat7" "00394447" "" "" "" "3" "" "00006" "{PMID:Kinoshita 2012:22577109}" "family, 3 affected" "M" "" "Japan" "" "0" "" "" "" "Fam4Pat8" "00394448" "" "" "00394447" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam4Pat9" "00394449" "" "" "00394447" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam4Pat10" "00394450" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "M" "" "Japan" "" "0" "" "" "" "Fam5Pat11" "00394452" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam7Pat13" "00394453" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam8Pat14" "00394454" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam9Pat15" "00394455" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam10Pat16" "00394456" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam11Pat17" "00394457" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam12Pat18" "00394458" "" "" "" "4" "" "00006" "{PMID:Kinoshita 2012:22577109}" "family, 4 affected" "M" "" "Japan" "" "0" "" "" "" "Fam13Pat19" "00394459" "" "" "00394458" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam13Pat20" "00394460" "" "" "00394458" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam13Pat21" "00394461" "" "" "00394458" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam13Pat22" "00394462" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam14Pat23" "00394463" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "M" "" "Japan" "" "0" "" "" "" "Fam15Pat24" "00394465" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam17Pat26" "00394466" "" "" "" "1" "" "00006" "{PMID:Kinoshita 2012:22577109}" "" "F" "" "Japan" "" "0" "" "" "" "Fam18Pat27" "00394815" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR01" "00394816" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR02" "00394817" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR04" "00394818" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR05" "00394819" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR08" "00394820" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR09" "00394821" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR10" "00394822" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR11" "00394823" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR12" "00394824" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib/brother" "F" "" "China" "" "0" "" "" "" "HR13" "00394825" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR14" "00394826" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR15" "00394827" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR16" "00394828" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR18" "00394829" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR20" "00394830" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR21" "00394831" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR22" "00394832" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR23" "00394833" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR24" "00394834" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR25" "00394835" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR26" "00394836" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR27" "00394837" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR28" "00394838" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "father/sib" "F" "" "China" "" "0" "" "" "" "HR29" "00394839" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR30" "00394840" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR31" "00394841" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR32" "00394842" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR33" "00394843" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "F" "" "China" "" "0" "" "" "" "HR34" "00394844" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR35" "00394845" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "F" "" "China" "" "0" "" "" "" "HR36" "00394846" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "F" "" "China" "" "0" "" "" "" "HR37" "00394847" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR38" "00394848" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR39" "00394849" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR41" "00394850" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR44" "00394851" "" "" "" "2" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR45" "00394852" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "father/sib" "M" "" "China" "" "0" "" "" "" "HR47" "00394853" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR48" "00394854" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR49" "00394855" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR50" "00394856" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR51" "00394857" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR54" "00394858" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR55" "00394859" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR56" "00394860" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR57" "00394861" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR58" "00394862" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "M" "" "China" "" "0" "" "" "" "HR59" "00394863" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR60" "00394864" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR17" "00394865" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "F" "" "China" "" "0" "" "" "" "HR40" "00394866" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "mother/sib" "M" "" "China" "" "0" "" "" "" "HR06" "00394867" "" "" "" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "patient" "F" "" "China" "" "0" "" "" "" "HR19" "00394917" "" "" "00394851" "1" "" "00006" "{PMID:Zheng 2020:32329911}" "healthy mother of HR45" "F" "" "China" "" "0" "" "" "" "HR45m" "00394918" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamIPat1" "00394919" "" "" "00394918" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "sister" "F" "" "Spain" "" "0" "" "" "" "FamIPat2" "00394920" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamIIPat1" "00394921" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamIIIPat1" "00394922" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamIVPat1" "00394923" "" "" "00394922" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "brother" "M" "" "Spain" "" "0" "" "" "" "FamIVPat2" "00394924" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamVPat1" "00394925" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamVIPat1" "00394926" "" "" "" "4" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamVIIPat1" "00394927" "" "" "00394926" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "brother" "M" "" "Spain" "" "0" "" "" "" "FamVIIPat2" "00394928" "" "" "00394926" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "daughter" "F" "" "Spain" "" "0" "" "" "" "FamVIIPat3" "00394929" "" "" "00394926" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "daughter" "F" "" "Spain" "" "0" "" "" "" "FamVIIPat4" "00394930" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamVIIIPat1" "00394931" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamIXPat1" "00394932" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXPat1" "00394933" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXIPat1" "00394934" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXIIPat1" "00394935" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXIIIPat1" "00394936" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXIVPat1" "00394937" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXVPat1" "00394938" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXVIPat1" "00394939" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXVIIPat1" "00394940" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXVIIIPat1" "00394941" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXIXPat1" "00394942" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXPat1" "00394943" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXIPat1" "00394944" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXIIPat1" "00394945" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXIIIPat1" "00394946" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXIVPat1" "00394947" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXVPat1" "00394948" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXVIPat1" "00394949" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXVIIPat1" "00394950" "" "" "00394949" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "father" "M" "" "Spain" "" "0" "" "" "" "FamXXVIIPat2" "00394951" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXVIIIPat1" "00394952" "" "" "00394951" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "sister" "F" "" "Spain" "" "0" "" "" "" "FamXXVIIIPat2" "00394953" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXIXPat1" "00394954" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXPat1" "00394955" "" "" "00394954" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "mother" "F" "" "Spain" "" "0" "" "" "" "FamXXXPat2" "00394956" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXXIPat1" "00394957" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXIIPat1" "00394958" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXIIIPat1" "00394959" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXIVPat1" "00394960" "" "" "" "2" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXVPat1" "00394961" "" "" "00394960" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "mother" "F" "" "Spain" "" "0" "" "" "" "FamXXXVPat2" "00394962" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXXVIPat1" "00394963" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXVIIPat1" "00394964" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "F" "" "Spain" "" "0" "" "" "" "FamXXXVIIIPat1" "00394965" "" "" "" "1" "" "00006" "{PMID:Rodriguez-Rubio 2021:33639975}" "index" "M" "" "Spain" "" "0" "" "" "" "FamXXXIXPat1" "00394968" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394969" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394970" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394971" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394972" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394973" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394974" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394975" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394976" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394977" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394978" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394979" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394980" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394981" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "patient" "" "" "Poland" "" "0" "" "" "" "" "00394982" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394983" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394984" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394985" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394986" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394987" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394988" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394989" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394990" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394991" "" "" "" "1" "" "00006" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "family" "" "" "Poland" "" "0" "" "" "" "" "00394992" "" "" "" "1" "" "00006" "{PMID:Balazs 2008:18057152}" "" "F" "" "United States" "" "0" "" "" "African-American" "patient" "00394993" "" "" "" "3" "" "00006" "{PMID:Poon 2015:26904698}" "2-generation family, affected mother/2 sons" "F;M" "" "Singapore" "" "0" "" "" "" "Fam" "00395067" "" "" "" "2" "" "00006" "{PMID:Yue 2014:24836714}" "2-generation family, affected father/daughter" "F" "" "China" "" "0" "" "" "" "Fam1PatII2" "00395068" "" "" "00395067" "1" "" "00006" "{PMID:Yue 2014:24836714}" "father" "M" "" "China" "" "0" "" "" "" "Fam1PatI1" "00395069" "" "" "" "2" "" "00006" "{PMID:Yue 2014:24836714}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam2PatII1" "00395070" "" "" "00395069" "1" "" "00006" "{PMID:Yue 2014:24836714}" "mother" "F" "" "China" "" "0" "" "" "" "Fam2PatI2" "00395071" "" "" "" "2" "" "00006" "{PMID:Yue 2014:24836714}" "3-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam3PatII2" "00395072" "" "" "00395071" "1" "" "00006" "{PMID:Yue 2014:24836714}" "mother" "F" "" "China" "" "0" "" "" "" "Fam3PatI2" "00395073" "" "" "" "3" "" "00006" "{PMID:Yue 2014:24836714}" "3-generation family, affected grandmother/mother/son" "M" "" "China" "" "0" "" "" "" "Fam4PatIII2" "00395074" "" "" "00395073" "1" "" "00006" "{PMID:Yue 2014:24836714}" "mother" "F" "" "China" "" "0" "" "" "" "Fam4PatII2" "00395075" "" "" "00395073" "1" "" "00006" "{PMID:Yue 2014:24836714}" "grandmother" "F" "" "China" "" "0" "" "" "" "Fam4PatI2" "00395076" "" "" "" "2" "" "00006" "{PMID:Yue 2014:24836714}" "2-generation family, affected mother/son" "M" "" "China" "" "0" "" "" "" "Fam5PatII1" "00395077" "" "" "00395076" "1" "" "00006" "{PMID:Yue 2014:24836714}" "mother" "F" "" "China" "" "0" "" "" "" "Fam5PatI2" "00395078" "" "" "" "2" "" "00006" "{PMID:Yue 2014:24836714}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam6PatII1" "00395079" "" "" "00395078" "1" "" "00006" "{PMID:Yue 2014:24836714}" "mother" "F" "" "China" "" "0" "" "" "" "Fam6PatI2" "00395080" "" "" "" "1" "" "00006" "{PMID:Yue 2014:24836714}" "3-generation family, 1 affected, unaffected non-carrier parents" "M" "" "China" "" "0" "" "" "" "Fam7PatIII1" "00395081" "" "" "" "1" "" "00006" "{PMID:Yue 2014:24836714}" "3-generation family, 1 affected, unaffected non-carrier parents" "M" "" "China" "" "0" "" "" "" "Fam8PatIII1" "00395082" "" "" "" "1" "" "00006" "{PMID:Yue 2014:24836714}" "3-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Fam9PatIII1" "00395083" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat1" "00395084" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat2" "00395085" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat4" "00395086" "" "" "" "2" "" "00006" "{PMID:Capelli 2015:26051471}" "2-generation family, 2 affected brothers" "M" "" "Italy" "" "0" "" "" "" "Pat7" "00395087" "" "" "00395086" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "brother" "M" "" "Italy" "" "0" "" "" "" "Pat8" "00395088" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat9" "00395089" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat10" "00395090" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat11" "00395091" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat12" "00395092" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat13" "00395093" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "adopted" "M" "" "Italy" "" "0" "" "" "" "Pat14" "00395094" "" "" "" "2" "" "00006" "{PMID:Capelli 2015:26051471}" "2-generation family, 2 affected brothers" "M" "" "Italy" "" "0" "" "" "" "Pat15" "00395095" "" "" "00395094" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "brother" "M" "" "Italy" "" "0" "" "" "" "Pat16" "00395096" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat17" "00395097" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat18" "00395098" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat19" "00395099" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat20" "00395100" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat21" "00395101" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat22" "00395102" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "M" "" "Italy" "" "0" "" "" "" "Pat24" "00395103" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat25" "00395104" "" "" "" "1" "" "00006" "{PMID:Capelli 2015:26051471}" "" "F" "" "Italy" "" "0" "" "" "" "Pat26" "00395109" "" "" "" "3" "" "00006" "{PMID:Ma 2015:26107949}" "2-generation family, affected mother/2 sons" "M" "" "India" "" "0" "" "" "" "E0023PatII1" "00395110" "" "" "00395109" "1" "" "00006" "{PMID:Ma 2015:26107949}" "son" "M" "" "India" "" "0" "" "" "" "E0023PatII2" "00395111" "" "" "00395109" "1" "" "00006" "{PMID:Ma 2015:26107949}" "mother" "F" "" "India" "" "0" "" "" "" "E0023PatI2" "00395112" "" "" "00395109" "1" "" "00006" "{PMID:Ma 2015:26107949}" "" "F" "" "India" "" "0" "" "" "" "E0024PatII1" "00395113" "" "" "" "1" "" "00006" "{PMID:Bai 2018:30298485}" "" "" "" "China" "" "0" "" "" "" "Fam1" "00395114" "" "" "" "1" "" "00006" "{PMID:Bai 2018:30298485}" "" "" "" "China" "" "0" "" "" "" "Fam2" "00395115" "" "" "" "1" "" "00006" "{PMID:Bai 2018:30298485}" "" "" "" "China" "" "0" "" "" "" "Fam3" "00395116" "" "" "" "1" "" "00006" "{PMID:Bai 2018:30298485}" "" "" "" "China" "" "0" "" "" "" "Fam4" "00395117" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Turkey" "" "0" "" "" "" "FamIPat3" "00395118" "" "" "" "2" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected mother/sib" "F" "" "Turkey" "" "0" "" "" "" "FamIIPat2" "00395119" "" "" "00395118" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamIIPat3" "00395120" "" "" "" "3" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected mother/2 sibs" "F" "" "Turkey" "" "0" "" "" "" "FamIIIPat2" "00395121" "" "" "00395120" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamIIIPat3" "00395122" "" "" "00395120" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "M" "" "Turkey" "" "0" "" "" "" "FamIIIPat4" "00395123" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Turkey" "" "0" "" "" "" "FamIVPat3" "00395124" "" "" "" "2" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected father/sib" "M" "" "Turkey" "" "0" "" "" "" "FamVPat1" "00395125" "" "" "00395124" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamVPat3" "00395126" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Turkey" "" "0" "" "" "" "FamVIPat4" "00395127" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Turkey" "" "0" "" "" "" "FamVIIPat3" "00395128" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Turkey" "" "0" "" "" "" "FamVIIIPat3" "00395129" "" "" "" "2" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected mother/sib" "F" "" "Turkey" "" "0" "" "" "" "FamIXPat2" "00395130" "" "" "00395129" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "M" "" "Turkey" "" "0" "" "" "" "FamIXPat3" "00395133" "" "" "" "3" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected mother/2 sib" "F" "" "Turkey" "" "0" "" "" "" "FamXIIPat2" "00395134" "" "" "00395133" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "M" "" "Turkey" "" "0" "" "" "" "FamXIIPat3" "00395135" "" "" "00395133" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamXIIPat4" "00395136" "" "" "" "2" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, affected mother/sib" "F" "" "Turkey" "" "0" "" "" "" "FamXIVPat2" "00395137" "" "" "00395136" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamXIVPat3" "00395138" "" "" "" "1" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Turkey" "" "0" "" "" "" "FamXVPat3" "00395402" "" "" "" "6" "" "00006" "{PMID:Yang 2013:23813354}" "32-generation family, 6 affected (5F, M)" "F;M" "" "China" "" "0" "" "" "" "family" "00395403" "" "" "" "2" "" "00006" "{PMID:Ito 2005:16261449}" "family, 2 affected (F, M)" "F;M" "" "Japan" "" "0" "" "" "" "Fam2" "00395404" "" "" "" "2" "" "00006" "{PMID:Ito 2005:16261449}" "family, 2 affected (F, M)" "F;M" "" "Japan" "" "0" "" "" "" "Fam4" "00395405" "" "" "" "2" "" "00006" "{PMID:Ito 2005:16261449}" "family, 2 affected (2F)" "F" "" "Japan" "" "0" "" "" "" "Fam5" "00395406" "" "" "" "2" "" "00006" "{PMID:Ito 2005:16261449}" "family, 2 affected (F, M)" "F;M" "" "Japan" "" "0" "" "" "" "Fam6" "00395407" "" "" "" "3" "" "00006" "{PMID:Ito 2005:16261449}" "family, 2 affected (2F, M)" "F;M" "" "Japan" "" "0" "" "" "" "Fam7" "00395408" "" "" "" "1" "" "00006" "{PMID:Ito 2005:16261449}" "" "F" "" "Japan" "" "0" "" "" "" "Fam8" "00395409" "" "" "" "1" "" "00006" "{PMID:Ito 2005:16261449}" "" "F" "" "Japan" "" "0" "" "" "" "Fam16" "00395410" "" "" "" "1" "" "00006" "{PMID:Ito 2005:16261449}" "" "M" "" "Japan" "" "0" "" "" "" "Fam17" "00395411" "" "" "" "1" "" "00006" "{PMID:Marik 2018:29707405}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "" "India" "" "0" "" "" "" "Pat1" "00395412" "" "" "" "1" "" "00006" "{PMID:Marik 2018:29707405}" "patient" "F" "" "India" "" "0" "" "" "" "Pat2" "00395413" "" "" "" "3" "" "00006" "{PMID:Marik 2018:29707405}" "family, 3 affected" "F;M" "" "India" "" "0" "" "" "" "Pat3" "00395414" "" "" "" "1" "" "00006" "{PMID:Marik 2018:29707405}" "patient" "F" "" "India" "" "0" "" "" "" "Pat4" "00395415" "" "" "" "4" "" "00006" "{PMID:Marik 2018:29707405}" "family, 4 affected" "F;M" "" "India" "" "0" "" "" "" "Pat5" "00395416" "" "" "" "2" "" "00006" "{PMID:Marik 2018:29707405}" "family, affected mother/daughter" "F" "" "India" "" "0" "" "" "" "Pat6" "00395417" "" "" "" "1" "" "00006" "{PMID:Marik 2018:29707405}" "patient" "F" "" "India" "" "0" "" "" "" "Pat7" "00395418" "" "" "" "1" "" "00006" "{PMID:Marik 2018:29707405}" "patient" "F" "" "India" "" "0" "" "" "" "Pat8" "00396967" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat01-01" "00396968" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat12-15" "00396969" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat09-10" "00396970" "" "" "" "3" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "family, 3 affected sisters" "F" "" "Germany" "" "0" "" "" "" "Pat05-06/12/13" "00396971" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat07-08" "00396972" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat11-14" "00396973" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat04-05" "00396974" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat03-04" "00396975" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat05-12" "00396976" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat05-13" "00396977" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "F" "" "Germany" "" "0" "" "" "" "Pat13-16" "00396978" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat02-02" "00396979" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat10-11" "00396980" "" "" "" "1" "" "00006" "{PMID:Zivicnjak 2011:21994957}" "" "M" "" "Germany" "" "0" "" "" "" "Pat06-07" "00396982" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "M" "" "France" "" "0" "" "" "" "Pat1" "00396983" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "M" "" "France" "" "0" "" "" "" "Pat2" "00396984" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "F" "" "France" "" "0" "" "" "" "Pat3" "00396985" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "F" "" "France" "" "0" "" "" "" "Pat4" "00396986" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "M" "" "France" "" "0" "" "" "" "Pat5" "00396988" "" "" "" "1" "" "00006" "{PMID:Boukpessi 2017:27884786}" "" "M" "" "France" "" "0" "" "" "" "Pat7" "00396989" "" "" "" "3" "" "00006" "{PMID:Guven 2017:28383812}" "family, 4 affected (mother/2 daughters/aunt)" "F" "" "Turkey" "" "0" "" "" "" "FamIPat2" "00396990" "" "" "00396989" "1" "" "00006" "{PMID:Guven 2017:28383812}" "" "F" "" "Turkey" "" "0" "" "" "" "FamIPat3" "00396991" "" "" "00396989" "1" "" "00006" "{PMID:Guven 2017:28383812}" "" "F" "" "Turkey" "" "0" "" "" "" "FamIPat4" "00396992" "" "" "" "1" "" "00006" "{PMID:Guven 2017:28383812}" "family, 1 affected, unaffected parents" "F" "" "Turkey" "" "0" "" "" "" "FamIIPat3" "00396993" "" "" "" "2" "" "00006" "{PMID:Guven 2017:28383812}" "family, 2 affected (mother/daughter)" "F" "" "Turkey" "" "0" "" "" "" "FamIIIPat2" "00396994" "" "" "00396993" "1" "" "00006" "{PMID:Guven 2017:28383812}" "daughter" "F" "" "Turkey" "" "0" "" "" "" "FamIIIPat3" "00396995" "" "" "" "2" "" "00006" "{PMID:Guven 2017:28383812}" "family, 2 affected (mother/daughter)" "F" "" "Turkey" "" "0" "" "" "" "FamIVPat2" "00396996" "" "" "00396995" "1" "" "00006" "{PMID:Guven 2017:28383812}" "daughter" "F" "" "Turkey" "" "0" "" "" "" "FamIVPat3" "00397000" "" "" "" "2" "" "00006" "{PMID:Guven 2017:28383812}" "family, 2 affected (mother/daughter)" "F" "" "Turkey" "" "0" "" "" "" "FamVIIPat2" "00397001" "" "" "00397000" "1" "" "00006" "{PMID:Guven 2017:28383812}" "daughter" "F" "" "Turkey" "" "0" "" "" "" "FamVIIPat3" "00397002" "" "" "" "1" "" "00006" "{PMID:Guven 2017:28383812}" "family, 1 affected, unaffected parents" "M" "" "Turkey" "" "0" "" "" "" "FamVIIIPat3" "00397003" "" "" "" "1" "" "00006" "{PMID:Guven 2017:28383812}" "family, 1 affected, unaffected parents" "M" "" "Turkey" "" "0" "" "" "" "FamIXPat3" "00397006" "" "" "" "2" "" "00006" "{PMID:Canete 2014:25115781}" "2-generation family, affected twin sisters, unaffected non-carrier parents" "F" "" "Spain" "" "0" "" "" "" "patient" "00397007" "" "" "" "1" "" "00006" "{PMID:Castellarin 2013:22996961}" "" "" "" "Canada" "" "0" "" "" "" "patient" "00397008" "" "" "" "7" "" "00006" "{PMID:Chen 2019:31567381}" "4-generation family, 7 affected (5F, 2M)" "F;M" "" "China" "" "0" "" "" "" "patient" "00397009" "" "" "" "6" "" "00006" "{PMID:Fang 2016:26894575}" "2-generation family, 6 affected (4F, 2M)" "F;M" "" "China" "" "0" "" "" "" "family" "00397010" "" "" "" "4" "" "00006" "{PMID:Fratzl-Zelman 2020:32619592}" "3-generation family, 4 affected (2F, 2M)" "F;M" "" "Austria" "" "0" "" "" "" "family" "00397011" "" "" "" "1" "" "00006" "{PMID:Fratzl-Zelman 2020:32619592}" "" "M" "" "Austria" "" "0" "" "" "" "patient" "00397012" "" "" "" "3" "" "00006" "{PMID:Fratzl-Zelman 2020:32619592}" "2-generation family, 3 affected (mother, son, daughter)" "F;M" "" "Austria" "" "0" "" "" "" "family" "00397013" "" "" "" "8" "" "00006" "{PMID:Huang 2019:31537998}" "4-generation family, 8 affected (4F, 4M)" "F;M" "" "China" "" "0" "" "" "" "family" "00397014" "" "" "" "9" "" "00006" "{PMID:Jo 2020:32252220}" "4-generation family, 9 affected (4F, 5M)" "F;M" "" "Korea" "" "0" "" "" "" "family" "00397015" "" "" "" "3" "" "00006" "{PMID:Kawahara 2015:25861491}" "3-generation family, 3 affected (grandmother, father, daughter)" "F;M" "" "Japan" "" "0" "" "" "" "family" "00397016" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397017" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397018" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397019" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397020" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397021" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397022" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397023" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397024" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397025" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397026" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397027" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397028" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397029" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397030" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397031" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397032" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397033" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397034" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397035" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397036" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397037" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397038" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397039" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397040" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397041" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397042" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397043" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397044" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397140" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397141" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397142" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397143" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397144" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397145" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397146" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397147" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397148" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397149" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397150" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397151" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397152" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397153" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397154" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397155" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397156" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397157" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397158" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397159" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397160" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397161" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397162" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397163" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397164" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397165" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397166" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397167" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397168" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397170" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397171" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397172" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397173" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397174" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397175" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397176" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397177" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397178" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397179" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397180" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397181" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397182" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397183" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397184" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397185" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397186" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397187" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397188" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397189" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397190" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397191" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397192" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397193" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397194" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397195" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397196" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397197" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397198" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397199" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397200" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397201" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397202" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397203" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397204" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397205" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397206" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397207" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397208" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397209" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397210" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397211" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397212" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397213" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397214" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397215" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397216" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397217" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397218" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397219" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397220" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397221" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397222" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397223" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397224" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397225" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397226" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397227" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397228" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397229" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397230" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397231" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397232" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397233" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397234" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397235" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397236" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397237" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397238" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397239" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397240" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397241" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397242" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397243" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397244" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397245" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397246" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397247" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397248" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397249" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397250" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397251" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397252" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397253" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397254" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397255" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397256" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397257" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397258" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397259" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397260" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397261" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397262" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397263" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397264" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397265" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397266" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397267" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397268" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397269" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397270" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397271" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397272" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397273" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397274" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397275" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397276" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397277" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397278" "" "" "" "1" "" "00006" "{PMID:Zhang 2019:30682568}" "" "" "" "China" "" "0" "" "" "" "" "00397280" "" "" "" "2" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "2-generation family, affeced father/daughter" "F" "" "Poland" "" "0" "" "" "" "Pat1" "00397281" "" "" "" "2" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "2-generation family, affeced mother/daughter" "F" "" "Poland" "" "0" "" "" "" "Pat2" "00397282" "" "" "" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "" "M" "" "Poland" "" "0" "" "" "" "Pat3" "00397283" "" "" "" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "" "M" "" "Poland" "" "0" "" "" "" "Pat4" "00397284" "" "" "" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "" "M" "" "Poland" "" "0" "" "" "" "Pat5" "00397285" "" "" "" "3" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "2-generation family, affeced mother/2 daughters" "M" "" "Poland" "" "0" "" "" "" "Pat6" "00397286" "" "" "00397285" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "sister" "F" "" "Poland" "" "0" "" "" "" "Pat7" "00397287" "" "" "" "3" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "2-generation family, affeced mother/son/daughter" "M" "" "Poland" "" "0" "" "" "" "Pat8" "00397288" "" "" "00397287" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "sister" "F" "" "Poland" "" "0" "" "" "" "Pat9" "00397289" "" "" "" "1" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "" "F" "" "Poland" "" "0" "" "" "" "Pat10" "00397290" "" "" "" "2" "" "00006" "{PMID:Obara-Moszynska 2020:33295632}" "2-generation family, affeced mother/daughter" "F" "" "Poland" "" "0" "" "" "" "Pat11" "00397291" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamIPat1" "00397292" "" "" "" "2" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "2-generation family, 2 affected" "F" "" "Spain" "" "0" "" "" "" "FamIIPat1" "00397293" "" "" "00397292" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "Pat2" "F" "" "Spain" "" "0" "" "" "" "FamIIPat2" "00397294" "" "" "" "2" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "2-generation family, 2 affected" "M" "" "Spain" "" "0" "" "" "" "FamIIIPat1" "00397295" "" "" "00397294" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "Pat2" "M" "" "Spain" "" "0" "" "" "" "FamIIIPat2" "00397296" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamIVPat1" "00397297" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamVPat1" "00397298" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "M" "" "Spain" "" "0" "" "" "" "FamVIPat1" "00397299" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamVIIPat1" "00397300" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamVIIIPat1" "00397301" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamIXPat1" "00397302" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "M" "" "Spain" "" "0" "" "" "" "FamXPat1" "00397303" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXIPat1" "00397304" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXIIPat1" "00397305" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXIIIPat1" "00397306" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXIVPat1" "00397307" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "M" "" "Spain" "" "0" "" "" "" "FamXVPat1" "00397308" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXVIPat1" "00397309" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXVIIPat1" "00397310" "" "" "" "2" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "2-generation family, 2 affected" "F" "" "Spain" "" "0" "" "" "" "FamXVIIIPat1" "00397311" "" "" "00397310" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "Pat2" "F" "" "Spain" "" "0" "" "" "" "FamXVIIIPat2" "00397312" "" "" "" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "" "F" "" "Spain" "" "0" "" "" "" "FamXIXPat1" "00397313" "" "" "" "2" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "2-generation family, 2 affected" "M" "" "Spain" "" "0" "" "" "" "FamXXPat1" "00397314" "" "" "00397313" "1" "" "00006" "{PMID:Hernandez-Frias 2019:30607568}" "Pat2" "F" "" "Spain" "" "0" "" "" "" "FamXXPat2" "00397315" "" "" "" "2" "" "00006" "{PMID:Gao 2018:30075510}" "3-generation family, affected mother/son" "F;M" "" "China" "" "0" "" "" "" "Fam1" "00397316" "" "" "" "2" "" "00006" "{PMID:Gao 2018:30075510}" "3-generation family, affected mother/son" "F;M" "" "China" "" "0" "" "" "" "Fam2" "00397318" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected mother/son" "F" "" "China" "" "0" "" "" "" "Fam1PatI2" "00397319" "" "" "00397318" "1" "" "00006" "{PMID:Gu 2018:29901142}" "son" "M" "" "China" "" "0" "" "" "" "Fam1PatII1" "00397320" "" "" "" "4" "" "00006" "{PMID:Gu 2018:29901142}" "3-generation family, 4 affected (2F, 2M)" "F" "" "China" "" "0" "" "" "" "Fam2PatI2" "00397321" "" "" "00397320" "1" "" "00006" "{PMID:Gu 2018:29901142}" "" "M" "" "China" "" "0" "" "" "" "Fam2PatII1" "00397322" "" "" "00397320" "1" "" "00006" "{PMID:Gu 2018:29901142}" "" "F" "" "China" "" "0" "" "" "" "Fam2PatII3" "00397323" "" "" "00397320" "1" "" "00006" "{PMID:Gu 2018:29901142}" "" "M" "" "China" "" "0" "" "" "" "Fam2PatIII1" "00397324" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam3PatI2" "00397325" "" "" "00397324" "1" "" "00006" "{PMID:Gu 2018:29901142}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam3PatII1" "00397326" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam4PatI2" "00397327" "" "" "00397326" "1" "" "00006" "{PMID:Gu 2018:29901142}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam4PatII1" "00397328" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam5PatI2" "00397329" "" "" "00397328" "1" "" "00006" "{PMID:Gu 2018:29901142}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam5PatII1" "00397330" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected father/daughter" "M" "" "China" "" "0" "" "" "" "Fam6PatI1" "00397331" "" "" "00397330" "1" "" "00006" "{PMID:Gu 2018:29901142}" "daughter" "F" "" "China" "" "0" "" "" "" "Fam6PatII2" "00397332" "" "" "" "2" "" "00006" "{PMID:Gu 2018:29901142}" "2-generation family, affected mother/son" "F" "" "China" "" "0" "" "" "" "Fam7PatI2" "00397333" "" "" "00397332" "1" "" "00006" "{PMID:Gu 2018:29901142}" "son" "M" "" "China" "" "0" "" "" "" "Fam7PatII1" "00397349" "" "" "" "1" "" "00006" "{PMID:Ran 2017:28506344}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "China" "" "0" "" "" "" "Pat1" "00397350" "" "" "" "1" "" "00006" "{PMID:Ran 2017:28506344}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "China" "" "0" "" "" "" "Pat2" "00397351" "" "" "" "1" "" "00006" "{PMID:Rauch 2014:25086671}" "" "" "" "Canada" "" "0" "" "" "" "PatV35" "00397352" "" "" "" "1" "" "00006" "{PMID:Rauch 2014:25086671}" "" "" "" "Canada" "" "0" "" "" "" "PatT18" "00397353" "" "" "" "1" "" "00006" "{PMID:Rauch 2014:25086671}" "" "" "" "Canada" "" "0" "" "" "" "PatT19" "00397380" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat1" "00397381" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat2" "00397382" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat3" "00397383" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat4" "00397384" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat5" "00397385" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat6" "00397386" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat7" "00397387" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat8" "00397388" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat9" "00397389" "" "" "" "1" "" "00006" "{PMID:Song 2013:24229582}" "" "" "" "China" "" "0" "" "" "" "Pat10" "00397448" "" "" "" "3" "" "00006" "{PMID:Liao 2018:29393334}" "4-generation family, 3 affected (2F, M)" "F;M" "" "China" "" "0" "" "" "" "Fam1" "00397449" "" "" "" "8" "" "00006" "{PMID:Liao 2018:29393334}" "4-generation family,8 affected (4F, 4M)" "F;M" "" "China" "" "0" "" "" "" "Fam2" "00397450" "" "" "" "1" "" "00006" "{PMID:Lin 2020:31658436}" "2-generation family, 1 affected, unaffected parents" "F" "" "China" "" "0" "" "" "" "patient" "00397451" "" "" "" "1" "" "00006" "{PMID:Maio 2021:32897287}" "" "F" "" "Portugal" "" "0" "" "" "" "patient" "00397452" "" "" "" "1" "" "00006" "{PMID:Martin Ramos 2020:32133333}" "patient" "F" "" "Spain" "" "0" "" "" "" "Pat1" "00397453" "" "" "" "1" "" "00006" "{PMID:Martin Ramos 2020:32133333}" "patient" "M" "" "Spain" "" "0" "" "" "" "Pat2" "00397454" "" "" "" "1" "" "00006" "{PMID:Martin Ramos 2020:32133333}" "patient" "F" "" "Spain" "" "0" "" "" "" "Pat3" "00397455" "" "" "" "1" "" "00006" "{PMID:Martin Ramos 2020:32133333}" "patient" "M" "" "Spain" "" "0" "" "" "" "Pat4" "00397456" "" "" "" "1" "" "00006" "{PMID:Martin Ramos 2020:32133333}" "patient" "F" "" "Spain" "" "0" "" "" "" "Pat5" "00397458" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected carrier mother" "M" "" "United States" "" "0" "" "" "" "Pat1" "00397459" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected carrier mother" "M" "" "United States" "" "0" "" "" "" "Pat2" "00397460" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected carreir mother" "M" "" "United States" "" "0" "" "" "" "Pat3" "00397461" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected parents" "M" "" "United States" "" "0" "" "" "" "Pat5" "00397462" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected carrier mother" "M" "" "United States" "" "0" "" "" "" "Pat4" "00397463" "" "" "" "1" "" "00006" "{PMID:Mumm 2015:25042154}" "2-generation family, 1 affected, unaffected non-carrier mother" "F" "" "United States" "" "0" "" "" "" "PatF" "00397464" "" "" "" "1" "" "00006" "{PMID:Sako 2019:30792871}" "" "F" "" "Japan" "" "0" "" "" "" "patient" "00397468" "" "" "" "1" "" "00006" "{PMID:Cui 2012:22913777}" "" "" "" "China" "" "0" "" "" "" "patient" "00397469" "" "" "" "1" "" "00006" "{PMID:Cui 2012:22913777}" "" "" "" "China" "" "0" "" "" "" "patient" "00397493" "" "" "" "2" "" "00006" "{PMID:Murthy 2009:19242361}" "2-generation family, affected mother/son" "F;M" "" "United States" "" "0" "" "" "" "patient" "00397494" "" "" "" "1" "" "00006" "{PMID:Martos Moreno 2016:27221261}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "" "Spain" "" "0" "" "" "" "Pat1" "00397495" "" "" "" "1" "" "00006" "{PMID:Martos Moreno 2016:27221261}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "" "Spain" "" "0" "" "" "" "Pat2" "00397496" "" "" "" "1" "" "00006" "{PMID:Jorgensen 2019:31903094}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat1" "00397497" "" "" "" "1" "" "00006" "{PMID:Jorgensen 2019:31903094}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat2" "00397498" "" "" "" "1" "" "00006" "{PMID:Jorgensen 2019:31903094}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat3" "00397499" "" "" "" "1" "" "00006" "{PMID:Jorgensen 2019:31903094}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat4" "00397500" "" "" "" "1" "" "00006" "{PMID:Jorgensen 2019:31903094}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat5" "00397503" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397504" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397505" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397506" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397507" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397508" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397509" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397510" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397511" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397512" "" "" "" "1" "" "00006" "{PMID:Imel 2010:20157195}" "" "" "" "United States" "" "0" "" "" "" "" "00397513" "" "" "" "3" "" "00006" "{PMID:Moreira 2020:33049132}" "2-generation family, affected father/2 daughters" "F;M" "" "Brazil" "" "0" "" "" "" "Pat1/2/3" "00397514" "" "" "" "1" "" "00006" "{PMID:Moreira 2020:33049132}" "" "" "" "Brazil" "" "0" "" "" "" "Pat4" "00397515" "" "" "" "1" "" "00006" "{PMID:Moreira 2020:33049132}" "" "" "" "Brazil" "" "0" "" "" "" "Pat5" "00397516" "" "" "" "2" "" "00006" "{PMID:Moreira 2020:33049132}" "2-generation family, affected mother/daughter" "F" "" "Brazil" "" "0" "" "" "" "Pat6/7" "00397518" "" "" "" "1" "" "00006" "{PMID:Tournis 2011:21885902}" "" "F" "" "Greece" "" "0" "" "" "" "patient" "00397519" "" "" "" "4" "" "00006" "{PMID:Vakharia 2018:29610183}" "2-generation family, 1 affected, carrier affected mother, maternal grandmother, maternal cousins" "F" "" "United States" "" "0" "" "" "" "Case1" "00397520" "" "" "" "1" "" "00006" "{PMID:Vakharia 2018:29610183}" "" "M" "" "United States" "" "0" "" "" "" "Case2" "00397521" "" "" "" "1" "" "00006" "{PMID:Vanacker 2008:25983897}" "" "F" "" "Belgium" "" "0" "" "" "" "patient" "00397522" "" "" "" "1" "" "00006" "{PMID:Watts 2015:26561226}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Case1" "00397523" "" "" "" "4" "" "00006" "{PMID:Yamamoto 2020:32257293}" "3-generation family, 4 affected (3F, M)" "F;M" "" "Japan" "" "0" "" "" "" "family" "00397569" "" "" "" "1" "" "00006" "{PMID:Xiong 2008:17710565}" "mouse model" "-" "" "" "" "0" "" "" "" "Pug" "00397570" "" "" "" "1" "" "00006" "{PMID:Yang 2018:30599486}" "2-generation family, 1 affected, unaffected non-carrier mother" "M" "" "Korea" "" "0" "" "" "" "patient" "00397571" "" "" "" "1" "" "00006" "{PMID:Kang 2014:25031893}" "" "F" "" "Korea" "" "0" "" "" "" "Case1" "00397572" "" "" "" "1" "" "00006" "{PMID:Weng 2016:26559751}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "China" "" "0" "" "" "" "patient" "00397573" "" "" "" "4" "" "00006" "{PMID:Yuan 2015:25060345}" "4-generation family, 4 affected (3F, M)" "F;M" "" "China" "" "0" "" "" "" "family" "00397594" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "F" "" "China" "" "0" "" "" "" "Tab2-Pat1" "00397595" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "M" "" "China" "" "0" "" "" "" "Tab2-Pat2" "00397596" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "M" "" "China" "" "0" "" "" "" "Tab2-Pat3" "00397597" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "M" "" "China" "" "0" "" "" "" "Tab2-Pat4" "00397598" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "M" "" "China" "" "0" "" "" "" "Tab2-Pat5" "00397599" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "F" "" "China" "" "0" "" "" "" "Tab2-Pat6" "00397600" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "F" "" "China" "" "0" "" "" "" "Tab2-Pat7" "00397601" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "M" "" "China" "" "0" "" "" "" "Tab2-Pat8" "00397602" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "F" "" "China" "" "0" "" "" "" "Tab2-Pat9" "00397603" "" "" "" "1" "" "00006" "{PMID:Zhang 2015:26377240}" "" "F" "" "China" "" "0" "" "" "" "Tab3-Pat1" "00399119" "" "" "" "2" "" "00006" "{PMID:Douyere 2008:19201216}" "3-generation family, affected mother/son" "M" "" "France" "" "0" "" "" "" "patient" "00399120" "" "" "" "2" "" "00006" "{PMID:Zou 2015:25153221}" "3-generation family, affected mother/son" "F" "" "Saudi Arabia" "" "0" "" "" "" "patient" "00399121" "" "" "" "2" "" "00006" "{PMID:Liu 2014:24857004}" "" "" "" "China" "" "0" "" "" "" "patient" "00399122" "" "" "" "2" "" "00006" "{PMID:Liu 2014:24857004}" "" "" "" "China" "" "0" "" "" "" "patient" "00399123" "" "" "" "2" "" "00006" "{PMID:Liu 2014:24857004}" "" "" "" "China" "" "0" "" "" "" "patient" "00399145" "" "" "" "1" "" "00006" "{PMID:Karunaratne 2012:22161748}" "ENU-induced mouse model" "F;M" "" "- (not applicable)" "" "0" "" "" "" "mouse" "00399149" "" "" "" "1" "" "00006" "{PMID:Treff 2013:23312231}" "pre-implantation analysis" "" "" "United States" "" "0" "" "" "" "case" "00401281" "" "" "" "3" "" "00006" "{PMID:Kang 2012:22713460}" "3-generation family, 3 affected (3F)" "F" "" "China" "" "0" "" "" "" "Fam1" "00401282" "" "" "" "5" "" "00006" "{PMID:Kang 2012:22713460}" "4-generation family, 5 affected (2F, 3M)" "F;M" "" "China" "" "0" "" "" "" "Fam2" "00401283" "" "" "" "4" "" "00006" "{PMID:Kang 2012:22713460}" "4-generation family, 4 affected (2F, 2M)" "F;M" "" "China" "" "0" "" "" "" "Fam3" "00401284" "" "" "" "6" "" "00006" "{PMID:Kang 2012:22713460}" "4-generation family, 6 affected (3F, 3M)" "F;M" "" "China" "" "0" "" "" "" "Fam4" "00401285" "" "" "" "1" "" "00006" "{PMID:Dayal 2014:24756041}" "2-generation family, 1 affected, unaffected non-carrier mother" "F" "" "India" "" "0" "" "" "" "patient" "00401286" "" "" "" "1" "" "00006" "{PMID:Broseta 2020:31474501}" "2-generation family, 1 affected, unaffected non-carrier mother" "M" "" "Spain" "" "0" "" "" "" "Pat1" "00401287" "" "" "" "2" "" "00006" "{PMID:Broseta 2020:31474501}" "2-generation family, affected mother/daughter; duaghter" "F" "" "Spain" "" "0" "" "" "" "Pat2" "00401521" "" "" "" "1" "" "00006" "{PMID:Blázquez Gómez 2021:33358363}" "analysis 53 primary tubulopathies cases" "" "" "Spain" "" "0" "" "" "" "1" "00401522" "" "" "" "1" "" "00006" "{PMID:Blazquez Gomez 2021:33358363}" "analysis 53 primary tubulopathies cases" "" "" "Spain" "" "0" "" "" "" "2" "00401523" "" "" "" "1" "" "00006" "{PMID:Blazquez Gomez 2021:33358363}" "analysis 53 primary tubulopathies cases" "" "" "Spain" "" "0" "" "" "" "3" "00401524" "" "" "" "1" "" "00006" "{PMID:Blazquez Gomez 2021:33358363}" "analysis 53 primary tubulopathies cases" "" "" "Spain" "" "0" "" "" "" "4" "00401527" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat1" "00401528" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat2" "00401529" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat3" "00401530" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat4" "00401531" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat5" "00401532" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat6" "00401533" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat7" "00401534" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat8" "00401535" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat9" "00401536" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat10" "00401537" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat11" "00401538" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat12" "00401539" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat13" "00401540" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat14" "00401541" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat15" "00401542" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat16" "00401543" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat17" "00401544" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "M" "" "Ireland" "" "0" "" "" "" "Pat18" "00401545" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat19" "00401546" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat20" "00401547" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat21" "00401550" "" "" "" "1" "" "00006" "{PMID:Crowley 2014:24594262}, {PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat;Pat26" "00401551" "" "" "" "1" "" "00006" "{PMID:McKenna 2019:30238432}" "" "F" "" "Ireland" "" "0" "" "" "" "Pat27" "00401556" "" "" "" "1" "" "00006" "{PMID:Imel 2019:31485552}" "" "F" "" "Australia" "" "0" "" "" "" "patient" "00401557" "" "" "" "4" "" "00006" "{PMID:Li 2020:32511895}" "2-generation family, 2 affected (2M), 2 mildly affected carrier females" "M" "" "China" "" "0" "" "" "" "family" "00401558" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat1" "00401559" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat2" "00401560" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat3" "00401561" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat4" "00401562" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat5" "00401563" "" "" "" "1" "" "00006" "{PMID:Lee 2012:22261628}" "" "F" "" "Korea" "" "0" "" "" "" "Pat6" "00401564" "" "" "" "3" "" "00006" "{PMID:Joel 2010:20838491}" "3-generation family, affected gransfather, mother, son" "M" "" "Belgium" "" "0" "" "" "" "FamPatXY2" "00401565" "" "" "" "1" "" "00006" "{PMID:Radlovic 2014:24684036}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Serbia" "" "0" "" "" "" "patient" "00401652" "" "" "" "1" "" "00006" "{PMID:Thiele 2020:33107440}" "" "F" "" "Germany" "" "0" "" "" "" "Pat1" "00401655" "" "" "" "1" "" "00006" "{PMID:Grove-Laugesen 2014:24660072}" "" "F" "" "Denmark" "" "0" "" "" "" "patient" "00401656" "" "" "" "1" "" "00006" "{PMID:Yavropoulou 2010:20688626}" "" "F" "" "Greece" "" "0" "" "" "" "patient" "00401657" "" "" "" "1" "" "00006" "{PMID:Forero-Delgadillo 2020:32104046}" "" "F" "" "Colombia" "" "0" "" "" "" "patient" "00401658" "" "" "" "1" "" "00006" "{PMID:Goljanek-Whysall 2018:28982589}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "patient" "00401659" "" "" "" "1" "" "00006" "{PMID:Freudlsperger 2013:23466123}" "" "M" "" "Germany" "" "0" "" "" "" "patient" "00401660" "" "" "" "3" "" "00006" "{PMID:Sheng 2015:26040324}" "2-generation family, affected mother/son/daughter" "F" "" "China" "" "0" "" "" "Hui" "FamXLH01PatII2" "00401661" "" "" "" "2" "" "00006" "{PMID:Sheng 2015:26040324}" "mother/son" "F;M" "" "China" "" "0" "" "" "Hui" "FamXLH01PatI2/II1" "00401662" "" "" "" "1" "" "00006" "{PMID:Zhera 2021:33537138}" "" "F" "" "Pakistan" "" "0" "" "" "" "patient" "00401663" "" "" "" "1" "" "00006" "{PMID:Galvez-Ruiz 2013:28163769}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "patient" "00401664" "" "" "" "30" "" "00006" "{PMID:Smith 2020:31910300}" "comparison XLHT cases with *231A>G cases" "F;M" "" "United States" "" "0" "" "" "" "patients" "00401686" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401687" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401688" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Asia" "" "00401689" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401690" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401691" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401692" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Japan" "" "0" "" "" "" "" "00401693" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401694" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401695" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401696" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401697" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401698" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00401699" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401700" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401701" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401702" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401703" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401704" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401705" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401706" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401707" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401708" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401709" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401710" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401711" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401712" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401713" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Spain" "" "0" "" "" "" "" "00401714" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401715" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401716" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401717" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401718" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401719" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401720" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401721" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401722" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401723" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401724" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401725" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401726" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401727" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401728" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401729" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401730" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Japan" "" "0" "" "" "" "" "00401731" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401732" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401733" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "American" "" "00401734" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401735" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401736" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401737" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Canada" "" "0" "" "" "Canadian" "" "00401738" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401739" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401740" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401741" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401742" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401743" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401744" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401745" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401746" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "American" "" "00401747" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "American" "" "00401748" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401749" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401750" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401751" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Spain" "" "0" "" "" "" "" "00401752" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401753" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401754" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401755" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401756" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401757" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401758" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401759" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401760" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401761" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401762" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401763" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401764" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401765" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401766" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401767" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401768" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00401769" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "mediterranean" "" "00401770" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401771" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401772" "" "" "" "30" "" "00006" "{PMID:Sarafrazi 2022:34806794}" ">30 cases" "" "" "" "" "0" "" "" "" "" "00401773" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401774" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401775" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401776" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401777" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401778" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401779" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401780" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401781" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401782" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401783" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401784" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Asia" "" "00401785" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401786" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401787" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401788" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401789" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401790" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401791" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401792" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401793" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401794" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401795" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401796" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401797" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401798" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401799" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401800" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401801" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401802" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401803" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401804" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401805" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401806" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401807" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401808" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401809" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401810" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401811" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401812" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401813" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401814" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401815" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401816" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401817" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401818" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401819" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401820" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401821" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401822" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401823" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401824" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" "00401825" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401826" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401827" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401828" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "Spain" "" "0" "" "" "" "" "00401829" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401830" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401831" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401832" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401833" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401834" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401835" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401836" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401837" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401838" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401839" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401840" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401841" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401842" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401843" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401844" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401845" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401846" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401847" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401848" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401849" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401850" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401851" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401852" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401853" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401854" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401855" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401856" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401857" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401858" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401859" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401860" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401861" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401862" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401863" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401864" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401865" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401866" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401867" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401868" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401869" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401870" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401871" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401872" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401873" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401874" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401875" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401876" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401877" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401878" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401879" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401880" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401881" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Jewish-Ashkenazi;American-native" "" "00401882" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Asia" "" "00401883" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Asia" "" "00401884" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401885" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401886" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401887" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401888" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401889" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401890" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401891" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401892" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401893" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401894" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401895" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401896" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401897" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401898" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401899" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401900" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401901" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401902" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401903" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401904" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401905" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401906" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401907" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401908" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401909" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401910" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401911" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401912" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401913" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401914" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401915" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401916" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401917" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401918" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401919" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401920" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "" "" "00401921" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "native American" "" "00401922" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "native American" "" "00401923" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "United States" "" "0" "" "" "native American" "" "00401924" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401925" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401926" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401927" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401928" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401929" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401930" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401931" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401932" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401933" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401934" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401935" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401936" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401937" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401938" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401939" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401940" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401941" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401942" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401943" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401944" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401945" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401946" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401947" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401948" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401949" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401950" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401951" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401952" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401953" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401954" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401955" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401956" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401957" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401958" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401959" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401960" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401961" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401962" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401963" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401964" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401965" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401966" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401967" "" "" "" "1" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "fewer then 3 cases" "" "" "" "" "0" "" "" "white" "" "00401968" "" "" "" "11" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "11-20 cases" "" "" "" "" "0" "" "" "white" "" "00401969" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401970" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401971" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401972" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401973" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401974" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401975" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401976" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "" "" "00401977" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "United States" "" "0" "" "" "African-American" "" "00401978" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401979" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401980" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "Hispanic" "" "00401981" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401982" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401983" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401984" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401985" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401986" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401987" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401988" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401989" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401990" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401991" "" "" "" "3" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "3-5 cases" "" "" "" "" "0" "" "" "white" "" "00401992" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" "00401993" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" "00401994" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" "00401995" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" "00401996" "" "" "" "6" "" "00006" "{PMID:Sarafrazi 2022:34806794}" "6-10 cases" "" "" "" "" "0" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 1613 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00174830" "02241" "00174831" "02241" "00174832" "02241" "00174833" "02241" "00174834" "02241" "00174835" "02241" "00174836" "02241" "00174837" "02241" "00174838" "02241" "00174839" "02241" "00174840" "02241" "00174841" "02241" "00174842" "02241" "00174843" "02241" "00174844" "02241" "00174845" "02241" "00174846" "02241" "00174847" "02241" "00174848" "02241" "00174849" "02241" "00174850" "02241" "00174851" "02241" "00174852" "02241" "00225631" "02241" "00295015" "00198" "00308773" "00000" "00392047" "02241" "00392048" "02241" "00392049" "02241" "00392050" "02241" "00392051" "02241" "00392052" "02241" "00392053" "02241" "00392054" "02241" "00392055" "02241" "00392056" "02241" "00392057" "02241" "00392058" "02241" "00392059" "02241" "00392060" "02241" "00392061" "02241" "00392062" "02241" "00392063" "02241" "00392064" "02241" "00392065" "02241" "00392066" "02241" "00392067" "02241" "00392068" "02241" "00392069" "02241" "00392070" "02241" "00392071" "02241" "00392072" "02241" "00392073" "02241" "00392074" "02241" "00392075" "02241" "00392076" "02241" "00392077" "02241" "00392078" "02241" "00392079" "02241" "00392080" "02241" "00392081" "02241" "00392082" "02241" "00392083" "02241" "00392084" "02241" "00392085" "02241" "00392086" "02241" "00392087" "02241" "00392088" "02241" "00392089" "02241" "00392090" "02241" "00392091" "02241" "00392092" "02241" "00392093" "02241" "00392094" "02241" "00392095" "02241" "00392096" "02241" "00392097" "02241" "00392098" "02241" "00392099" "02241" "00392100" "02241" "00392101" "02241" "00392102" "02241" "00392103" "02241" "00392104" "02241" "00392105" "02241" "00392106" "02241" "00392107" "02241" "00392108" "02241" "00392109" "02241" "00392110" "02241" "00392111" "02241" "00392112" "02241" "00392113" "02241" "00392114" "02241" "00392115" "02241" "00392116" "02241" "00392117" "02241" "00392118" "02241" "00392172" "02241" "00392173" "02241" "00392174" "02241" "00392175" "02241" "00392176" "02241" "00392177" "02241" "00392178" "02241" "00392179" "02241" "00392180" "02241" "00392181" "02241" "00392182" "02241" "00392183" "02241" "00392184" "02241" "00392185" "02241" "00392186" "02241" "00392187" "02241" "00392188" "02241" "00392189" "02241" "00392190" "02241" "00392191" "02241" "00392192" "02241" "00392193" "02241" "00392194" "02241" "00392195" "02241" "00392196" "02241" "00392197" "02241" "00392198" "02241" "00392199" "02241" "00392200" "02241" "00392201" "02241" "00392202" "02241" "00392203" "02241" "00392204" "02241" "00392205" "02241" "00392206" "02241" "00392207" "02241" "00392208" "02241" "00392209" "02241" "00392210" "02241" "00392211" "02241" "00392212" "02241" "00392213" "02241" "00392214" "02241" "00392215" "02241" "00392216" "02241" "00392217" "02241" "00392218" "02241" "00392219" "02241" "00392220" "02241" "00392221" "02241" "00392222" "02241" "00392223" "02241" "00392224" "02241" "00392225" "02241" "00392226" "02241" "00392227" "02241" "00392228" "02241" "00392229" "02241" "00392230" "02241" "00392231" "02241" "00392232" "02241" "00392233" "02241" "00392234" "02241" "00392235" "02241" "00392236" "02241" "00392237" "02241" "00392238" "02241" "00392239" "02241" "00392240" "02241" "00392241" "02241" "00392242" "02241" "00392243" "02241" "00392244" "02241" "00392245" "02241" "00392246" "02241" "00392247" "02241" "00392248" "02241" "00392249" "02241" "00392250" "02241" "00392251" "02241" "00392252" "02241" "00392253" "02241" "00392254" "02241" "00392255" "02241" "00392284" "02241" "00392285" "02241" "00392286" "02241" "00392287" "02241" "00392288" "02241" "00392289" "02241" "00392290" "02241" "00392291" "02241" "00392292" "02241" "00392395" "02241" "00392396" "02241" "00392397" "02241" "00392398" "02241" "00392399" "02241" "00392400" "02241" "00392401" "02241" "00392402" "02241" "00392403" "02241" "00392404" "02241" "00392405" "02241" "00392406" "02241" "00392407" "02241" "00392408" "02241" "00392409" "02241" "00392410" "02241" "00392411" "02241" "00392412" "02241" "00392413" "02241" "00392414" "02241" "00392415" "02241" "00392416" "02241" "00392417" "02241" "00392418" "02241" "00392419" "02241" "00392420" "02241" "00392421" "02241" "00392422" "02241" "00392423" "02241" "00392424" "02241" "00392425" "02241" "00392426" "02241" "00392427" "02241" "00392428" "02241" "00392429" "02241" "00392430" "02241" "00392431" "02241" "00392432" "02241" "00392433" "02241" "00392434" "02241" "00392435" "02241" "00392436" "02241" "00392437" "02241" "00392438" "02241" "00392439" "02241" "00392440" "02241" "00392441" "02241" "00392442" "02241" "00392443" "02241" "00392444" "02241" "00392445" "02241" "00392446" "02241" "00392447" "02241" "00392448" "02241" "00392449" "02241" "00392450" "02241" "00392451" "02241" "00392452" "02241" "00392453" "02241" "00392454" "02241" "00392455" "02241" "00392456" "02241" "00392457" "02241" "00392458" "02241" "00392459" "02241" "00392460" "02241" "00392461" "02241" "00392462" "02241" "00392463" "02241" "00392464" "02241" "00392465" "02241" "00392466" "02241" "00392467" "02241" "00392468" "02241" "00392469" "02241" "00392470" "02241" "00392471" "02241" "00392472" "02241" "00392473" "02241" "00392474" "02241" "00392475" "02241" "00392476" "02241" "00392477" "02241" "00392478" "02241" "00392479" "02241" "00392480" "02241" "00392481" "02241" "00392482" "02241" "00392483" "02241" "00392484" "02241" "00392485" "02241" "00392486" "02241" "00392487" "02241" "00392488" "02241" "00392489" "02241" "00392490" "02241" "00392491" "02241" "00392492" "02241" "00392493" "02241" "00392494" "02241" "00392495" "02241" "00392496" "02241" "00392497" "02241" "00392498" "02241" "00392499" "02241" "00392500" "02241" "00392501" "02241" "00392502" "02241" "00392503" "02241" "00392680" "02241" "00392681" "02241" "00392682" "02241" "00392683" "02241" "00392684" "02241" "00392685" "02241" "00392686" "02241" "00392687" "02241" "00392688" "02241" "00392689" "02241" "00392690" "02241" "00392691" "02241" "00392692" "02241" "00392693" "02241" "00392694" "02241" "00392695" "02241" "00392696" "02241" "00392697" "02241" "00392698" "02241" "00392699" "02241" "00392700" "02241" "00392701" "02241" "00392702" "02241" "00392703" "02241" "00392704" "02241" "00392705" "02241" "00392706" "02241" "00392707" "02241" "00392708" "02241" "00392709" "02241" "00392710" "02241" "00392711" "02241" "00392712" "02241" "00392713" "02241" "00392714" "02241" "00392715" "02241" "00392716" "02241" "00392717" "02241" "00392718" "02241" "00392719" "02241" "00392720" "02241" "00392721" "02241" "00392722" "02241" "00392723" "02241" "00392724" "02241" "00392725" "02241" "00392726" "02241" "00392727" "02241" "00392728" "02241" "00392729" "02241" "00392730" "02241" "00392731" "02241" "00392732" "02241" "00392733" "02241" "00392734" "02241" "00392735" "02241" "00392736" "02241" "00392737" "02241" "00392738" "02241" "00392739" "02241" "00392740" "02241" "00392741" "02241" "00392742" "02241" "00392743" "02241" "00392744" "02241" "00392745" "02241" "00392746" "02241" "00392747" "02241" "00392780" "02241" "00392781" "02241" "00392782" "02241" "00392783" "02241" "00392784" "02241" "00392785" "02241" "00392786" "02241" "00392787" "02241" "00392788" "02241" "00392789" "02241" "00392790" "02241" "00392791" "02241" "00392792" "02241" "00392793" "02241" "00392794" "02241" "00392795" "02241" "00392796" "02241" "00392797" "02241" "00392798" "02241" "00392799" "02241" "00392800" "02241" "00392801" "02241" "00392802" "02241" "00392803" "02241" "00392804" "02241" "00392805" "02241" "00392806" "02241" "00392807" "02241" "00392808" "02241" "00392809" "02241" "00392810" "02241" "00392811" "02241" "00392812" "02241" "00392814" "02241" "00392815" "02241" "00392816" "02241" "00392817" "02241" "00392818" "02241" "00392819" "02241" "00392820" "02241" "00392821" "02241" "00392822" "02241" "00392823" "02241" "00392824" "02241" "00392825" "02241" "00392826" "02241" "00392827" "02241" "00392828" "02241" "00392829" "02241" "00392830" "02241" "00392831" "02241" "00392832" "02241" "00392833" "02241" "00392834" "02241" "00392835" "02241" "00392836" "02241" "00392837" "02241" "00392838" "02241" "00392839" "02241" "00392840" "02241" "00392841" "02241" "00392842" "02241" "00392843" "02241" "00392844" "02241" "00392845" "02241" "00392846" "02241" "00392847" "02241" "00392848" "02241" "00392849" "02241" "00392850" "02241" "00392851" "02241" "00392852" "02241" "00392853" "02241" "00392854" "02241" "00392855" "02241" "00392856" "02241" "00392857" "02241" "00392858" "02241" "00392859" "02241" "00392860" "02241" "00392861" "02241" "00392862" "02241" "00392863" "02241" "00392864" "02241" "00392865" "02241" "00392866" "02241" "00392867" "02241" "00392868" "02241" "00392869" "02241" "00392870" "02241" "00392871" "02241" "00392872" "02241" "00392873" "02241" "00392874" "02241" "00392875" "02241" "00392876" "02241" "00392877" "02241" "00392878" "02241" "00392879" "02241" "00392880" "02241" "00392881" "02241" "00392882" "02241" "00392883" "02241" "00392884" "02241" "00392885" "02241" "00392886" "02241" "00392887" "02241" "00392888" "02241" "00392889" "02241" "00392890" "02241" "00392891" "02241" "00392892" "02241" "00392893" "02241" "00392894" "02241" "00392895" "02241" "00392896" "02241" "00392897" "02241" "00392898" "02241" "00392899" "02241" "00392900" "02241" "00392901" "02241" "00392902" "02241" "00392903" "02241" "00392904" "02241" "00392905" "02241" "00392906" "02241" "00392907" "02241" "00392908" "02241" "00393205" "02241" "00393206" "02241" "00393207" "02241" "00393208" "02241" "00393211" "02241" "00393213" "02241" "00393214" "02241" "00393216" "02241" "00393226" "02241" "00393227" "02241" "00393228" "02241" "00393229" "02241" "00393230" "02241" "00393231" "02241" "00393232" "02241" "00393233" "02241" "00393234" "02241" "00393235" "02241" "00393236" "02241" "00393237" "02241" "00393238" "02241" "00393239" "02241" "00393240" "02241" "00393241" "02241" "00393242" "02241" "00393243" "02241" "00393244" "02241" "00393246" "02241" "00393247" "02241" "00393248" "02241" "00393249" "02241" "00393250" "02241" "00393251" "02241" "00393252" "02241" "00393253" "02241" "00393254" "02241" "00393255" "02241" "00393256" "02241" "00393257" "02241" "00393258" "02241" "00393259" "02241" "00393260" "02241" "00393261" "02241" "00393262" "02241" "00393263" "02241" "00393264" "02241" "00393265" "02241" "00393266" "02241" "00393267" "02241" "00393268" "02241" "00393269" "02241" "00393270" "02241" "00393271" "02241" "00393272" "02241" "00393273" "02241" "00393274" "02241" "00393275" "02241" "00393276" "02241" "00393277" "02241" "00393278" "02241" "00393279" "02241" "00393280" "02241" "00393281" "02241" "00393282" "02241" "00393283" "02241" "00393284" "02241" "00393285" "02241" "00393286" "02241" "00393287" "02241" "00393288" "02241" "00393289" "02241" "00393290" "02241" "00393291" "02241" "00393292" "02241" "00393293" "02241" "00393294" "02241" "00393295" "02241" "00393296" "02241" "00393297" "02241" "00393298" "02241" "00393299" "02241" "00393300" "02241" "00393301" "02241" "00393302" "02241" "00393303" "02241" "00393304" "02241" "00393394" "02241" "00393395" "02241" "00393396" "02241" "00393397" "02241" "00393398" "02241" "00393399" "02241" "00393400" "02241" "00393401" "02241" "00393404" "02241" "00393405" "02241" "00393406" "02241" "00393407" "02241" "00393408" "02241" "00393409" "02241" "00393410" "02241" "00393411" "02241" "00393412" "02241" "00393413" "02241" "00393414" "02241" "00393415" "02241" "00393416" "02241" "00393417" "02241" "00393418" "02241" "00393419" "02241" "00393420" "02241" "00393430" "02241" "00394383" "02241" "00394384" "02241" "00394385" "02241" "00394386" "02241" "00394387" "02241" "00394388" "02241" "00394389" "02241" "00394390" "02241" "00394391" "02241" "00394392" "02241" "00394393" "02241" "00394394" "02241" "00394395" "02241" "00394396" "02241" "00394397" "02241" "00394398" "02241" "00394399" "02241" "00394400" "02241" "00394401" "02241" "00394402" "02241" "00394403" "02241" "00394404" "02241" "00394405" "02241" "00394406" "02241" "00394407" "02241" "00394408" "02241" "00394409" "02241" "00394410" "02241" "00394411" "02241" "00394412" "02241" "00394413" "02241" "00394414" "02241" "00394415" "02241" "00394416" "02241" "00394417" "02241" "00394418" "02241" "00394419" "02241" "00394420" "02241" "00394421" "02241" "00394422" "02241" "00394423" "02241" "00394424" "02241" "00394425" "02241" "00394426" "02241" "00394427" "02241" "00394428" "02241" "00394429" "02241" "00394430" "02241" "00394431" "02241" "00394432" "02241" "00394433" "02241" "00394434" "02241" "00394435" "02241" "00394436" "02241" "00394437" "02241" "00394438" "02241" "00394440" "02241" "00394441" "02241" "00394442" "02241" "00394443" "02241" "00394444" "02241" "00394445" "02241" "00394446" "02241" "00394447" "02241" "00394448" "02241" "00394449" "02241" "00394450" "02241" "00394452" "02241" "00394453" "02241" "00394454" "02241" "00394455" "02241" "00394456" "02241" "00394457" "02241" "00394458" "02241" "00394459" "02241" "00394460" "02241" "00394461" "02241" "00394462" "02241" "00394463" "02241" "00394465" "02241" "00394466" "02241" "00394815" "02241" "00394816" "02241" "00394817" "02241" "00394818" "02241" "00394819" "02241" "00394820" "02241" "00394821" "02241" "00394822" "02241" "00394823" "02241" "00394824" "02241" "00394825" "02241" "00394826" "02241" "00394827" "02241" "00394828" "02241" "00394829" "02241" "00394830" "02241" "00394831" "02241" "00394832" "02241" "00394833" "02241" "00394834" "02241" "00394835" "02241" "00394836" "02241" "00394837" "02241" "00394838" "02241" "00394839" "02241" "00394840" "02241" "00394841" "02241" "00394842" "02241" "00394843" "02241" "00394844" "02241" "00394845" "02241" "00394846" "02241" "00394847" "02241" "00394848" "02241" "00394849" "02241" "00394850" "02241" "00394851" "02241" "00394852" "02241" "00394853" "02241" "00394854" "02241" "00394855" "02241" "00394856" "02241" "00394857" "02241" "00394858" "02241" "00394859" "02241" "00394860" "02241" "00394861" "02241" "00394862" "02241" "00394863" "02241" "00394864" "02241" "00394865" "02241" "00394866" "02241" "00394867" "02241" "00394917" "00000" "00394918" "02241" "00394919" "02241" "00394920" "02241" "00394921" "02241" "00394922" "02241" "00394923" "02241" "00394924" "02241" "00394925" "02241" "00394926" "02241" "00394927" "02241" "00394928" "02241" "00394929" "02241" "00394930" "02241" "00394931" "02241" "00394932" "02241" "00394933" "02241" "00394934" "02241" "00394935" "02241" "00394936" "02241" "00394937" "02241" "00394938" "02241" "00394939" "02241" "00394940" "02241" "00394941" "02241" "00394942" "02241" "00394943" "02241" "00394944" "02241" "00394945" "02241" "00394946" "02241" "00394947" "02241" "00394948" "02241" "00394949" "02241" "00394950" "02241" "00394951" "02241" "00394952" "02241" "00394953" "02241" "00394954" "02241" "00394955" "02241" "00394956" "02241" "00394957" "02241" "00394958" "02241" "00394959" "02241" "00394960" "02241" "00394961" "02241" "00394962" "02241" "00394963" "02241" "00394964" "02241" "00394965" "02241" "00394968" "02241" "00394969" "02241" "00394970" "02241" "00394971" "02241" "00394972" "02241" "00394973" "02241" "00394974" "02241" "00394975" "02241" "00394976" "02241" "00394977" "02241" "00394978" "02241" "00394979" "02241" "00394980" "02241" "00394981" "02241" "00394982" "02241" "00394983" "02241" "00394984" "02241" "00394985" "02241" "00394986" "02241" "00394987" "02241" "00394988" "02241" "00394989" "02241" "00394990" "02241" "00394991" "02241" "00394992" "02241" "00394993" "02241" "00395067" "02241" "00395068" "02241" "00395069" "02241" "00395070" "02241" "00395071" "02241" "00395072" "02241" "00395073" "02241" "00395074" "02241" "00395075" "02241" "00395076" "02241" "00395077" "02241" "00395078" "02241" "00395079" "02241" "00395080" "02241" "00395081" "02241" "00395082" "02241" "00395083" "02241" "00395084" "02241" "00395085" "02241" "00395086" "02241" "00395087" "02241" "00395088" "02241" "00395089" "02241" "00395090" "02241" "00395091" "02241" "00395092" "02241" "00395093" "02241" "00395094" "02241" "00395095" "02241" "00395096" "02241" "00395097" "02241" "00395098" "02241" "00395099" "02241" "00395100" "02241" "00395101" "02241" "00395102" "02241" "00395103" "02241" "00395104" "02241" "00395109" "02241" "00395110" "02241" "00395111" "02241" "00395112" "02241" "00395113" "02241" "00395114" "02241" "00395115" "02241" "00395116" "02241" "00395117" "02241" "00395118" "02241" "00395119" "02241" "00395120" "02241" "00395121" "02241" "00395122" "02241" "00395123" "02241" "00395124" "02241" "00395125" "02241" "00395126" "02241" "00395127" "02241" "00395128" "02241" "00395129" "02241" "00395130" "02241" "00395133" "02241" "00395134" "02241" "00395135" "02241" "00395136" "02241" "00395137" "02241" "00395138" "02241" "00395402" "02241" "00395403" "02241" "00395404" "02241" "00395405" "02241" "00395406" "02241" "00395407" "02241" "00395408" "02241" "00395409" "02241" "00395410" "02241" "00395411" "02241" "00395412" "02241" "00395413" "02241" "00395414" "02241" "00395415" "02241" "00395416" "02241" "00395417" "02241" "00395418" "02241" "00396967" "02241" "00396968" "02241" "00396969" "02241" "00396970" "02241" "00396971" "02241" "00396972" "02241" "00396973" "02241" "00396974" "02241" "00396975" "02241" "00396976" "02241" "00396977" "02241" "00396978" "02241" "00396979" "02241" "00396980" "02241" "00396982" "02241" "00396983" "02241" "00396984" "02241" "00396985" "02241" "00396986" "02241" "00396988" "02241" "00396989" "02241" "00396990" "02241" "00396991" "02241" "00396992" "02241" "00396993" "02241" "00396994" "02241" "00396995" "02241" "00396996" "02241" "00397000" "02241" "00397001" "02241" "00397002" "02241" "00397003" "02241" "00397006" "06886" "00397007" "00424" "00397008" "06886" "00397009" "06886" "00397010" "06886" "00397011" "06886" "00397012" "06886" "00397013" "06886" "00397014" "06886" "00397015" "06886" "00397016" "06886" "00397017" "06886" "00397018" "06886" "00397019" "06886" "00397020" "06886" "00397021" "06886" "00397022" "06886" "00397023" "06886" "00397024" "06886" "00397025" "06886" "00397026" "06886" "00397027" "06886" "00397028" "06886" "00397029" "06886" "00397030" "06886" "00397031" "06886" "00397032" "06886" "00397033" "06886" "00397034" "06886" "00397035" "06886" "00397036" "06886" "00397037" "06886" "00397038" "06886" "00397039" "06886" "00397040" "06886" "00397041" "06886" "00397042" "06886" "00397043" "06886" "00397044" "06886" "00397140" "06886" "00397141" "06886" "00397142" "06886" "00397143" "06886" "00397144" "06886" "00397145" "06886" "00397146" "06886" "00397147" "06886" "00397148" "06886" "00397149" "06886" "00397150" "06886" "00397151" "06886" "00397152" "06886" "00397153" "06886" "00397154" "06886" "00397155" "06886" "00397156" "06886" "00397157" "06886" "00397158" "06886" "00397159" "06886" "00397160" "06886" "00397161" "06886" "00397162" "06886" "00397163" "06886" "00397164" "06886" "00397165" "06886" "00397166" "06886" "00397167" "06886" "00397168" "06886" "00397170" "06886" "00397171" "06886" "00397172" "06886" "00397173" "06886" "00397174" "06886" "00397175" "06886" "00397176" "06886" "00397177" "06886" "00397178" "06886" "00397179" "06886" "00397180" "06886" "00397181" "06886" "00397182" "06886" "00397183" "06886" "00397184" "06886" "00397185" "06886" "00397186" "06886" "00397187" "06886" "00397188" "06886" "00397189" "06886" "00397190" "06886" "00397191" "06886" "00397192" "06886" "00397193" "06886" "00397194" "06886" "00397195" "06886" "00397196" "06886" "00397197" "06886" "00397198" "06886" "00397199" "06886" "00397200" "06886" "00397201" "06886" "00397202" "06886" "00397203" "06886" "00397204" "06886" "00397205" "06886" "00397206" "06886" "00397207" "06886" "00397208" "06886" "00397209" "06886" "00397210" "06886" "00397211" "06886" "00397212" "06886" "00397213" "06886" "00397214" "06886" "00397215" "06886" "00397216" "06886" "00397217" "06886" "00397218" "06886" "00397219" "06886" "00397220" "06886" "00397221" "06886" "00397222" "06886" "00397223" "06886" "00397224" "06886" "00397225" "06886" "00397226" "06886" "00397227" "06886" "00397228" "06886" "00397229" "06886" "00397230" "06886" "00397231" "06886" "00397232" "06886" "00397233" "06886" "00397234" "06886" "00397235" "06886" "00397236" "06886" "00397237" "06886" "00397238" "06886" "00397239" "06886" "00397240" "06886" "00397241" "06886" "00397242" "06886" "00397243" "06886" "00397244" "06886" "00397245" "06886" "00397246" "06886" "00397247" "06886" "00397248" "06886" "00397249" "06886" "00397250" "06886" "00397251" "06886" "00397252" "06886" "00397253" "06886" "00397254" "06886" "00397255" "06886" "00397256" "06886" "00397257" "06886" "00397258" "06886" "00397259" "06886" "00397260" "06886" "00397261" "06886" "00397262" "06886" "00397263" "06886" "00397264" "06886" "00397265" "06886" "00397266" "06886" "00397267" "06886" "00397268" "06886" "00397269" "06886" "00397270" "06886" "00397271" "06886" "00397272" "06886" "00397273" "06886" "00397274" "06886" "00397275" "06886" "00397276" "06886" "00397277" "06886" "00397278" "06886" "00397280" "06886" "00397281" "06886" "00397282" "06886" "00397283" "06886" "00397284" "06886" "00397285" "06886" "00397286" "06886" "00397287" "06886" "00397288" "06886" "00397289" "06886" "00397290" "06886" "00397291" "06886" "00397292" "06886" "00397293" "06886" "00397294" "06886" "00397295" "06886" "00397296" "06886" "00397297" "06886" "00397298" "06886" "00397299" "06886" "00397300" "06886" "00397301" "06886" "00397302" "06886" "00397303" "06886" "00397304" "06886" "00397305" "06886" "00397306" "06886" "00397307" "06886" "00397308" "06886" "00397309" "06886" "00397310" "06886" "00397311" "06886" "00397312" "06886" "00397313" "06886" "00397314" "06886" "00397315" "06886" "00397316" "06886" "00397318" "06886" "00397319" "06886" "00397320" "06886" "00397321" "06886" "00397322" "06886" "00397323" "06886" "00397324" "06886" "00397325" "06886" "00397326" "06886" "00397327" "06886" "00397328" "06886" "00397329" "06886" "00397330" "06886" "00397331" "06886" "00397332" "06886" "00397333" "06886" "00397349" "06886" "00397350" "06886" "00397351" "06886" "00397352" "06886" "00397353" "06886" "00397380" "06886" "00397381" "06886" "00397382" "06886" "00397383" "06886" "00397384" "06886" "00397385" "06886" "00397386" "06886" "00397387" "06886" "00397388" "06886" "00397389" "06886" "00397448" "06886" "00397449" "06886" "00397450" "06886" "00397451" "06886" "00397452" "06886" "00397453" "06886" "00397454" "06886" "00397455" "06886" "00397456" "06886" "00397458" "06886" "00397459" "06886" "00397460" "06886" "00397461" "06886" "00397462" "06886" "00397463" "06886" "00397464" "06886" "00397468" "06886" "00397469" "06886" "00397493" "06886" "00397494" "06886" "00397495" "06886" "00397496" "06886" "00397497" "06886" "00397498" "06886" "00397499" "06886" "00397500" "06886" "00397503" "05086" "00397504" "05086" "00397505" "05086" "00397506" "05086" "00397507" "05086" "00397508" "05086" "00397509" "05086" "00397510" "05086" "00397511" "05086" "00397512" "05086" "00397513" "05086" "00397514" "05086" "00397515" "05086" "00397516" "05086" "00397518" "06886" "00397519" "06886" "00397520" "06886" "00397521" "06886" "00397522" "06886" "00397523" "06886" "00397569" "06886" "00397570" "06886" "00397571" "06886" "00397572" "06886" "00397573" "06886" "00397594" "06887" "00397595" "06887" "00397596" "06887" "00397597" "06887" "00397598" "06887" "00397599" "06887" "00397600" "06887" "00397601" "06887" "00397602" "06887" "00397603" "06887" "00399119" "06886" "00399120" "06886" "00399121" "06886" "00399122" "06886" "00399123" "06886" "00399145" "02241" "00399149" "02241" "00401281" "06886" "00401282" "06886" "00401283" "06886" "00401284" "06886" "00401285" "06886" "00401286" "06886" "00401287" "06886" "00401521" "06886" "00401522" "06886" "00401523" "06886" "00401524" "06886" "00401527" "06886" "00401528" "06886" "00401529" "06886" "00401530" "06886" "00401531" "06886" "00401532" "06886" "00401533" "06886" "00401534" "06886" "00401535" "06886" "00401536" "06886" "00401537" "06886" "00401538" "06886" "00401539" "06886" "00401540" "06886" "00401541" "06886" "00401542" "06886" "00401543" "06886" "00401544" "06886" "00401545" "06886" "00401546" "06886" "00401547" "06886" "00401550" "06886" "00401551" "06886" "00401556" "06886" "00401557" "06886" "00401558" "06886" "00401559" "06886" "00401560" "06886" "00401561" "06886" "00401562" "06886" "00401563" "06886" "00401564" "00470" "00401565" "06886" "00401652" "06886" "00401655" "06886" "00401656" "06886" "00401657" "06886" "00401658" "06886" "00401659" "06886" "00401660" "00198" "00401661" "06886" "00401662" "06886" "00401663" "06886" "00401664" "06886" "00401686" "06886" "00401687" "06886" "00401688" "06886" "00401689" "06886" "00401690" "06886" "00401691" "06886" "00401692" "06886" "00401693" "06886" "00401694" "06886" "00401695" "06886" "00401696" "06886" "00401697" "06886" "00401698" "06886" "00401699" "06886" "00401700" "06886" "00401701" "06886" "00401702" "06886" "00401703" "06886" "00401704" "06886" "00401705" "06886" "00401706" "06886" "00401707" "06886" "00401708" "06886" "00401709" "06886" "00401710" "06886" "00401711" "06886" "00401712" "06886" "00401713" "06886" "00401714" "06886" "00401715" "06886" "00401716" "06886" "00401717" "06886" "00401718" "06886" "00401719" "06886" "00401720" "06886" "00401721" "06886" "00401722" "06886" "00401723" "06886" "00401724" "06886" "00401725" "06886" "00401726" "06886" "00401727" "06886" "00401728" "06886" "00401729" "06886" "00401730" "06886" "00401731" "06886" "00401732" "06886" "00401733" "06886" "00401734" "06886" "00401735" "06886" "00401736" "06886" "00401737" "06886" "00401738" "06886" "00401739" "06886" "00401740" "06886" "00401741" "06886" "00401742" "06886" "00401743" "06886" "00401744" "06886" "00401745" "06886" "00401746" "06886" "00401747" "06886" "00401748" "06886" "00401749" "06886" "00401750" "06886" "00401751" "06886" "00401752" "06886" "00401753" "06886" "00401754" "06886" "00401755" "06886" "00401756" "06886" "00401757" "06886" "00401758" "06886" "00401759" "06886" "00401760" "06886" "00401761" "06886" "00401762" "06886" "00401763" "06886" "00401764" "06886" "00401765" "06886" "00401766" "06886" "00401767" "06886" "00401768" "06886" "00401769" "06886" "00401770" "06886" "00401771" "06886" "00401772" "06886" "00401773" "06886" "00401774" "06886" "00401775" "06886" "00401776" "06886" "00401777" "06886" "00401778" "06886" "00401779" "06886" "00401780" "06886" "00401781" "06886" "00401782" "06886" "00401783" "06886" "00401784" "06886" "00401785" "06886" "00401786" "06886" "00401787" "06886" "00401788" "06886" "00401789" "06886" "00401790" "06886" "00401791" "06886" "00401792" "06886" "00401793" "06886" "00401794" "06886" "00401795" "06886" "00401796" "06886" "00401797" "06886" "00401798" "06886" "00401799" "06886" "00401800" "06886" "00401801" "06886" "00401802" "06886" "00401803" "06886" "00401804" "06886" "00401805" "06886" "00401806" "06886" "00401807" "06886" "00401808" "06886" "00401809" "06886" "00401810" "06886" "00401811" "06886" "00401812" "06886" "00401813" "06886" "00401814" "06886" "00401815" "06886" "00401816" "06886" "00401817" "06886" "00401818" "06886" "00401819" "06886" "00401820" "06886" "00401821" "06886" "00401822" "06886" "00401823" "06886" "00401824" "06886" "00401825" "06886" "00401826" "06886" "00401827" "06886" "00401828" "06886" "00401829" "06886" "00401830" "06886" "00401831" "06886" "00401832" "06886" "00401833" "06886" "00401834" "06886" "00401835" "06886" "00401836" "06886" "00401837" "06886" "00401838" "06886" "00401839" "06886" "00401840" "06886" "00401841" "06886" "00401842" "06886" "00401843" "06886" "00401844" "06886" "00401845" "06886" "00401846" "06886" "00401847" "06886" "00401848" "06886" "00401849" "06886" "00401850" "06886" "00401851" "06886" "00401852" "06886" "00401853" "06886" "00401854" "06886" "00401855" "06886" "00401856" "06886" "00401857" "06886" "00401858" "06886" "00401859" "06886" "00401860" "06886" "00401861" "06886" "00401862" "06886" "00401863" "06886" "00401864" "06886" "00401865" "06886" "00401866" "06886" "00401867" "06886" "00401868" "06886" "00401869" "06886" "00401870" "06886" "00401871" "06886" "00401872" "06886" "00401873" "06886" "00401874" "06886" "00401875" "06886" "00401876" "06886" "00401877" "06886" "00401878" "06886" "00401879" "06886" "00401880" "06886" "00401881" "06886" "00401882" "06886" "00401883" "06886" "00401884" "06886" "00401885" "06886" "00401886" "06886" "00401887" "06886" "00401888" "06886" "00401889" "06886" "00401890" "06886" "00401891" "06886" "00401892" "06886" "00401893" "06886" "00401894" "06886" "00401895" "06886" "00401896" "06886" "00401897" "06886" "00401898" "06886" "00401899" "06886" "00401900" "06886" "00401901" "06886" "00401902" "06886" "00401903" "06886" "00401904" "06886" "00401905" "06886" "00401906" "06886" "00401907" "06886" "00401908" "06886" "00401909" "06886" "00401910" "06886" "00401911" "06886" "00401912" "06886" "00401913" "06886" "00401914" "06886" "00401915" "06886" "00401916" "06886" "00401917" "06886" "00401918" "06886" "00401919" "06886" "00401920" "06886" "00401921" "06886" "00401922" "06886" "00401923" "06886" "00401924" "06886" "00401925" "06886" "00401926" "06886" "00401927" "06886" "00401928" "06886" "00401929" "06886" "00401930" "06886" "00401931" "06886" "00401932" "06886" "00401933" "06886" "00401934" "06886" "00401935" "06886" "00401936" "06886" "00401937" "06886" "00401938" "06886" "00401939" "06886" "00401940" "06886" "00401941" "06886" "00401942" "06886" "00401943" "06886" "00401944" "06886" "00401945" "06886" "00401946" "06886" "00401947" "06886" "00401948" "06886" "00401949" "06886" "00401950" "06886" "00401951" "06886" "00401952" "06886" "00401953" "06886" "00401954" "06886" "00401955" "06886" "00401956" "06886" "00401957" "06886" "00401958" "06886" "00401959" "06886" "00401960" "06886" "00401961" "06886" "00401962" "06886" "00401963" "06886" "00401964" "06886" "00401965" "06886" "00401966" "06886" "00401967" "06886" "00401968" "06886" "00401969" "06886" "00401970" "06886" "00401971" "06886" "00401972" "06886" "00401973" "06886" "00401974" "06886" "00401975" "06886" "00401976" "06886" "00401977" "06886" "00401978" "06886" "00401979" "06886" "00401980" "06886" "00401981" "06886" "00401982" "06886" "00401983" "06886" "00401984" "06886" "00401985" "06886" "00401986" "06886" "00401987" "06886" "00401988" "06886" "00401989" "06886" "00401990" "06886" "00401991" "06886" "00401992" "06886" "00401993" "06886" "00401994" "06886" "00401995" "06886" "00401996" "06886" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00424, 00470, 01157, 02241, 05086, 06886, 06887 ## Count = 1560 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Cancer/Sub_type}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "" "0000139654" "02241" "00174830" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139655" "02241" "00174831" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139656" "02241" "00174832" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139657" "02241" "00174833" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139658" "02241" "00174834" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139659" "02241" "00174835" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139660" "02241" "00174836" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139661" "02241" "00174837" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139662" "02241" "00174838" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139663" "02241" "00174839" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139664" "02241" "00174840" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139665" "02241" "00174841" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139666" "02241" "00174842" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139667" "02241" "00174843" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139668" "02241" "00174844" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139669" "02241" "00174845" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139670" "02241" "00174846" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139671" "02241" "00174847" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139672" "02241" "00174848" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139673" "02241" "00174849" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139674" "02241" "00174850" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139675" "02241" "00174851" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139676" "02241" "00174852" "02208" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000285325" "02241" "00392047" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285326" "02241" "00392048" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285327" "02241" "00392049" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285328" "02241" "00392050" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285329" "02241" "00392051" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285330" "02241" "00392052" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285331" "02241" "00392053" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285332" "02241" "00392054" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285333" "02241" "00392055" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285334" "02241" "00392056" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285335" "02241" "00392057" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285336" "02241" "00392058" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285337" "02241" "00392059" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285338" "02241" "00392060" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285339" "02241" "00392061" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285340" "02241" "00392062" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285341" "02241" "00392063" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285342" "02241" "00392064" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285343" "02241" "00392065" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285344" "02241" "00392066" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285345" "02241" "00392067" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285346" "02241" "00392068" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285347" "02241" "00392069" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285348" "02241" "00392070" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285349" "02241" "00392071" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285350" "02241" "00392072" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285351" "02241" "00392073" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285352" "02241" "00392074" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285353" "02241" "00392075" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285354" "02241" "00392076" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285355" "02241" "00392077" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285356" "02241" "00392078" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285357" "02241" "00392079" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285358" "02241" "00392080" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285359" "02241" "00392081" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285360" "02241" "00392082" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285361" "02241" "00392083" "00006" "Familial, X-linked" "" "see paper; ..., mild bone phenotype, phosphate serum level 2.9 mg/dl, tubular reabsorption of phosphate 0., 25 hydroxy vitamin D 28 ng/mL, 1,25 dihydroxi vitamin D 87 pg/mL, alkaline phosphatase 1531" "" "1y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285362" "02241" "00392084" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-2.71), phosphate serum level 2.3 mg/dl, tubular reabsorption of phosphate 0.60, parathyroid hormone 48 pg/mL, alkaline phosphatase 558, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285363" "02241" "00392085" "00006" "Familial, X-linked" "" "see paper; ..., severe bone phenotype, height (SD-3.38), phosphate serum level 2.3 mg/dl, tubular reabsorption of phosphate 0.564, 1,25 dihydroxi vitamin D 13.2 pg/ml, parathyroid hormone 21 pg/mL, alkaline phosphatase 766, nephrocalcinosis after treatment, no hyperparathyroidism" "" "9y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285364" "02241" "00392086" "00006" "Familial, X-linked" "" "see paper; ..., severe bone phenotype, height (SD-2.34), phosphate serum level 2.8 mg/dl, tubular reabsorption of phosphate 0.784, 25 hydroxy vitamin D 29.7 ng/mL, 1,25 dihydroxi vitamin D 73 pg/ml, parathyroid hormone 28 pg/mL, alkaline phosphatase 378, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285365" "02241" "00392087" "00006" "Isolated (sporadic)" "" "see paper; ..., phosphate serum level 2.7 mg/dl, tubular reabsorption of phosphate 0.253, 25 hydroxy vitamin D 12 ng/mL, nephrocalcinosis" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285366" "02241" "00392088" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-4.06), phosphate serum level 2.1 mg/dl, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285367" "02241" "00392089" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-3.2), phosphate serum level 2.9 mg/dl, tubular reabsorption of phosphate 0.76, 25 hydroxy vitamin D 175.2 ng/mL, pg/ml, parathyroid hormone 79 pg/mL, alkaline phosphatase 1786, nephrocalcinosis, no hyperparathyroidism" "" "2y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285368" "02241" "00392090" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285369" "02241" "00392091" "00006" "Familial, X-linked" "" "see paper; ..., moderate bone phenotype, height (SD-2.01), phosphate serum level 2.4 mg/dl, tubular reabsorption of phosphate 0.80, 25 hydroxy vitamin D 79 ng/mL, 1,25 dihydroxi vitamin D 38.2 pg/ml, parathyroid hormone 18 pg/mL, alkaline phosphatase 584, nephrocalcinosis, hyperparathyroidism after treatment" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285370" "02241" "00392092" "00006" "Familial, X-linked" "" "see paper; ..., moderate bone phenotype, height (SD-2.05), phosphate serum level 2.7 mg/dl, tubular reabsorption of phosphate 0.91, parathyroid hormone 52 pg/mL, alkaline phosphatase 791, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285371" "02241" "00392093" "00006" "Isolated (sporadic)" "" "see paper; ..., mild bone phenotype, height (SD0.88), phosphate serum level 4 mg/dl, tubular reabsorption of phosphate 0.89, 25 hydroxy vitamin D 41 ng/mL, 1,25 dihydroxi vitamin D 75 pg/ml, parathyroid hormone 75 pg/mL, alkaline phosphatase 1755, nephrocalcinosis after treatment, no hyperparathyroidism" "" "4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285372" "02241" "00392094" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-3.35), phosphate serum level 2.1 mg/dl, tubular reabsorption of phosphate 0.32, 25 hydroxy vitamin D 27.5 ng/mL, 1,25 dihydroxi vitamin D 16 pg/ml, parathyroid hormone 68 pg/mL, alkaline phosphatase 1646, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285373" "02241" "00392095" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-2.24), phosphate serum level 2.8 mg/dl, tubular reabsorption of phosphate 0.582, 1,25 dihydroxi vitamin D 21.9 pg/ml, parathyroid hormone 49 pg/mL, alkaline phosphatase 1699, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "7y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285374" "02241" "00392096" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285375" "02241" "00392097" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285376" "02241" "00392098" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-1.97), phosphate serum level 2.5 mg/dl, tubular reabsorption of phosphate 0.52, 1,25 dihydroxi vitamin D 28 pg/ml, parathyroid hormone 29 pg/mL, alkaline phosphatase 991, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "4y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285377" "02241" "00392099" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-4.86), 25 hydroxy vitamin D 16 ng/mL, 1,25 dihydroxi vitamin D 28 pg/ml, parathyroid hormone 25 pg/mL, alkaline phosphatase 755, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "4y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285378" "02241" "00392100" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-3.11), phosphate serum level 3.1 mg/dl, tubular reabsorption of phosphate 0.823, 25 hydroxy vitamin D 43 ng/mL, 1,25 dihydroxi vitamin D 60 pg/ml, parathyroid hormone 60 pg/mL, alkaline phosphatase 934, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285379" "02241" "00392101" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-3.84), tubular reabsorption of phosphate 0.66, 25 hydroxy vitamin D 37.5 ng/mL, parathyroid hormone 42 pg/mL, alkaline phosphatase 534, nephrocalcinosis after treatment, no hyperparathyroidism" "" "14y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285380" "02241" "00392102" "00006" "Isolated (sporadic)" "" "see paper; ..., mild bone phenotype, height (SD-2.53), phosphate serum level 2.2 mg/dl, tubular reabsorption of phosphate 0.71, 25 hydroxy vitamin D 30.1 ng/mL, 1,25 dihydroxi vitamin D 129 pg/ml, parathyroid hormone 66.7 pg/mL, alkaline phosphatase 597, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "1y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285381" "02241" "00392103" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-2.97), phosphate serum level 2.5 mg/dl, tubular reabsorption of phosphate 0.78, 25 hydroxy vitamin D 28 ng/mL, 1,25 dihydroxi vitamin D 53 pg/ml, parathyroid hormone 66 pg/mL, alkaline phosphatase 1020, nephrocalcinosis after treatment, no hyperparathyroidism" "" "2y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285382" "02241" "00392104" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-1.65), phosphate serum level 2.1 mg/dl, tubular reabsorption of phosphate 0.83, parathyroid hormone 23 pg/mL, alkaline phosphatase 448, nephrocalcinosis, no hyperparathyroidism" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285383" "02241" "00392105" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-5.47), phosphate serum level 2.7 mg/dl, tubular reabsorption of phosphate 0.23, nephrocalcinosis, hyperparathyroidism before treatment" "" "3y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285384" "02241" "00392106" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-2.26), phosphate serum level 2.0 mg/dl, tubular reabsorption of phosphate 0.59, 1,25 dihydroxi vitamin D 30.1 pg/ml, parathyroid hormone 57 pg/mL, alkaline phosphatase 1010, nephrocalcinosis, hyperparathyroidism after treatment" "" "1y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285385" "02241" "00392107" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-2), phosphate serum level 2.7 mg/dl, tubular reabsorption of phosphate 0.46, 25 hydroxy vitamin D 45.2 ng/mL, 1,25 dihydroxi vitamin D 53.4 pg/ml, parathyroid hormone 48 pg/mL, alkaline phosphatase 528, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285386" "02241" "00392108" "00006" "Isolated (sporadic)" "" "see paper; ..., mild bone phenotype, height (SD0.62), phosphate serum level 2.5 mg/dl, tubular reabsorption of phosphate 0., 25 hydroxy vitamin D 73 ng/mL, 1,25 dihydroxi vitamin D 76 pg/ml, parathyroid hormone 60 pg/mL, alkaline phosphatase 1249, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285387" "02241" "00392109" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-3.23), phosphate serum level 2.6 mg/dl, tubular reabsorption of phosphate 0.776, 25 hydroxy vitamin D 30 ng/mL, 1,25 dihydroxi vitamin D 41 pg/ml, parathyroid hormone 43 pg/mL, alkaline phosphatase 1389, nephrocalcinosis after treatment, no hyperparathyroidism" "" "3y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285388" "02241" "00392110" "00006" "Isolated (sporadic)" "" "see paper; ..., mild bone phenotype, height (SD-2.56), phosphate serum level 2.8 mg/dl, tubular reabsorption of phosphate 0.33, alkaline phosphatase 220, nephrocalcinosis after treatment, no hyperparathyroidism" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285389" "02241" "00392111" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-3.1), phosphate serum level 2.4 mg/dl, tubular reabsorption of phosphate 0.66, 25 hydroxy vitamin D 54.2 ng/mL, 1,25 dihydroxi vitamin D 39.8 pg/ml, parathyroid hormone 58 pg/mL, alkaline phosphatase 856, nephrocalcinosis after treatment, no hyperparathyroidism" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285390" "02241" "00392112" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-1.84), phosphate serum level 2.1 mg/dl, tubular reabsorption of phosphate 0.85, 25 hydroxy vitamin D 18 ng/mL, 1,25 dihydroxi vitamin D 147 pg/ml, parathyroid hormone 78 pg/mL, alkaline phosphatase 1513, nephrocalcinosis after treatment, hyperparathyroidism before treatment" "" "4y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285391" "02241" "00392113" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285392" "02241" "00392114" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-3.31), phosphate serum level 3.1 mg/dl, tubular reabsorption of phosphate 0.592, 1,25 dihydroxi vitamin D 32 pg/ml, parathyroid hormone 52.3 pg/mL, alkaline phosphatase 1110, nephrocalcinosis after treatment, hyperparathyroidism after treatment" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285393" "02241" "00392115" "00006" "Familial, X-linked" "" "see paper; ..., severe bone phenotype, height (SD0.64), phosphate serum level 3.7 mg/dl, tubular reabsorption of phosphate 0.623, 25 hydroxy vitamin D 6.6 ng/mL, 1,25 dihydroxi vitamin D 13.8 pg/ml, parathyroid hormone 22 pg/mL, alkaline phosphatase 1204, nephrocalcinosis after treatment, no hyperparathyroidism" "" "5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285394" "02241" "00392116" "00006" "Isolated (sporadic)" "" "see paper; ..., mild bone phenotype, height (SD-4.37), phosphate serum level 2.2 mg/dl, nephrocalcinosis after treatment, no hyperparathyroidism" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285395" "02241" "00392117" "00006" "Isolated (sporadic)" "" "see paper; ..., moderate bone phenotype, height (SD-2.3), phosphate serum level 2.6 mg/dl, tubular reabsorption of phosphate 0.75, 25 hydroxy vitamin D 39 ng/mL, 1,25 dihydroxi vitamin D 14 pg/ml, parathyroid hormone 49 pg/mL, alkaline phosphatase 1109, nephrocalcinosis after treatment, no hyperparathyroidism" "" "3y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285396" "02241" "00392118" "00006" "Isolated (sporadic)" "" "see paper; ..., severe bone phenotype, height (SD-1.95), phosphate serum level 3.7 mg/dl, tubular reabsorption of phosphate 0.867, 25 hydroxy vitamin D 31 ng/mL, 1,25 dihydroxi vitamin D 56.3 pg/ml, parathyroid hormone 49 pg/mL, alkaline phosphatase 470, nephrocalcinosis after treatment, no hyperparathyroidism" "" "4y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285450" "02241" "00392172" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 69 (±22) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285451" "02241" "00392173" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 128 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285452" "02241" "00392174" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 112 (±42) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285453" "02241" "00392175" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 95 (±27) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285454" "02241" "00392176" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 103 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285455" "02241" "00392177" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 51 (±6) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285456" "02241" "00392178" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 180 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285457" "02241" "00392179" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 67 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285458" "02241" "00392180" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 98 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285459" "02241" "00392181" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 73 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285460" "02241" "00392182" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 331 (±368) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285461" "02241" "00392183" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 310 (±331) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285462" "02241" "00392184" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 91 (±59) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285463" "02241" "00392185" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 56 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285464" "02241" "00392186" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 68 (±20) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285465" "02241" "00392187" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 321 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285466" "02241" "00392188" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 246 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285467" "02241" "00392189" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 72 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285468" "02241" "00392190" "00006" "Isolated (sporadic)" "" "see paper; ..., S-FGF23 2430 pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285469" "02241" "00392191" "00006" "Familial, X-linked dominant" "" "see paper; ..., S-FGF23 70 (±13) pg/ml" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285470" "02241" "00392192" "00006" "Familial, autosomal recessive" "" "see paper; ..., S-FGF23 71 pg/ml" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285471" "02241" "00392193" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285472" "02241" "00392194" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285473" "02241" "00392195" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285474" "02241" "00392196" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets, Duchenne muscular dystropy" "" "0000285475" "02241" "00392197" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285476" "02241" "00392198" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285477" "02241" "00392199" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285478" "02241" "00392200" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285479" "02241" "00392201" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285480" "02241" "00392202" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285481" "02241" "00392203" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285482" "02241" "00392204" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285483" "02241" "00392205" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285484" "02241" "00392206" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285485" "02241" "00392207" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285486" "02241" "00392208" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285487" "02241" "00392209" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285488" "02241" "00392210" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285489" "02241" "00392211" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285490" "02241" "00392212" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285491" "02241" "00392213" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285492" "02241" "00392214" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285493" "02241" "00392215" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285494" "02241" "00392216" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285495" "02241" "00392217" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285496" "02241" "00392218" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285497" "02241" "00392219" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285498" "02241" "00392220" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285499" "02241" "00392221" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets, congenital adrenal hypoplasia" "" "0000285500" "02241" "00392222" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285501" "02241" "00392223" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285502" "02241" "00392224" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285503" "02241" "00392225" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285504" "02241" "00392226" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285505" "02241" "00392227" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285506" "02241" "00392228" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285507" "02241" "00392229" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285508" "02241" "00392230" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285509" "02241" "00392231" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285510" "02241" "00392232" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285511" "02241" "00392233" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285512" "02241" "00392234" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285513" "02241" "00392235" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285514" "02241" "00392236" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285515" "02241" "00392237" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285516" "02241" "00392238" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285517" "02241" "00392239" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285518" "02241" "00392240" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285519" "02241" "00392241" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285520" "02241" "00392242" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285521" "02241" "00392243" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285522" "02241" "00392244" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285523" "02241" "00392245" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285524" "02241" "00392246" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285525" "02241" "00392247" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285526" "02241" "00392248" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285527" "02241" "00392249" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285528" "02241" "00392250" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285529" "02241" "00392251" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285530" "02241" "00392252" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285531" "02241" "00392253" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285532" "02241" "00392254" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285533" "02241" "00392255" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000285561" "02241" "00392284" "00006" "Familial, X-linked dominant" "31y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, VitD treatment" "" "01y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285562" "02241" "00392285" "00006" "Familial, X-linked dominant" "64y" "see paper; ..., severe lower extremity bowing, osteotomies (1x), dental abscesses; phosphate treatment as child, VitD treatment" "" "07y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285563" "02241" "00392286" "00006" "Isolated (sporadic)" "11y" "see paper; ..., moderate lower extremity bowing, osteotomies (2x), some dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "03y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285564" "02241" "00392287" "00006" "Familial, X-linked dominant" "58y" "see paper; ..., lower extremity bowing, steotomies, dental abscesses" "" "07y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285565" "02241" "00392288" "00006" "Isolated (sporadic)" "17y" "see paper; ..., lower extremity bowing, steotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "02y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285566" "02241" "00392289" "00006" "Familial, X-linked dominant" "37y" "see paper; ..., moderate/severe lower extremity bowing; no phosphate treatment as child, no VitD treatment" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285567" "02241" "00392290" "00006" "Isolated (sporadic)" "13y" "see paper; ..., moderate lower extremity bowing, osteotomies (4x), some dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285568" "02241" "00392291" "00006" "Familial, X-linked dominant" "14y" "see paper; ..., , DHT/1,25-dihydroxyvitaminD2 treatment" "" "00y05m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285569" "02241" "00392292" "00006" "Familial, X-linked dominant" "45y" "see paper; ..., lower extremity bowing, steotomies, dental abscesses; phosphate treatment as child, VitD treatment" "" "02y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285671" "02241" "00392395" "00006" "Familial, X-linked" "68y" "see paper; ..., knock-knee bowing lower extremities, no osteotomies, bad teeth; no phosphate treatment as child, no VitD treatment" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285672" "02241" "00392396" "00006" "Familial, X-linked" "44y" "see paper; ..., knock-knee bowing lower extremities, osteotomies (4x), many dental abscesses; no phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "13y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285673" "02241" "00392397" "00006" "Familial, X-linked" "21y" "see paper; ..., mild lower extremity bowing, no osteotomies, bad teeth; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285674" "02241" "00392398" "00006" "Familial, X-linked" "18y" "see paper; ..., mild lower extremity bowing, no osteotomies, many dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285675" "02241" "00392399" "00006" "Familial, X-linked" "27y" "see paper; ..., lower extremity bowing, no osteotomies, dental abscesses; phosphate treatment as child, VitD/1,25-dihydroxyvitaminD2 treatment" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285676" "02241" "00392400" "00006" "Familial, X-linked" "25y" "see paper; ..., lower extremity bowing" "" "21m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285677" "02241" "00392401" "00006" "Familial, X-linked" "4y" "see paper; ..., mild lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285678" "02241" "00392402" "00006" "Familial, X-linked" "2y" "see paper; ..., mild lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "15m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285679" "02241" "00392403" "00006" "Familial, X-linked" "50y" "see paper; ..., severe lower extremity bowing, osteotomies (4x), many dental abscesses; no phosphate treatment as child, no VitD treatment" "" "01y-02y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285680" "02241" "00392404" "00006" "Familial, X-linked" "20y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285681" "02241" "00392405" "00006" "Familial, X-linked" "18y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285682" "02241" "00392406" "00006" "Familial, X-linked" "16y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285683" "02241" "00392407" "00006" "Familial, X-linked" "44y" "see paper; ..., mild lower extremity bowing, osteotomies (5x), many dental abscesses; no phosphate treatment as child, no VitD treatment" "" "05y-06y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285684" "02241" "00392408" "00006" "Familial, X-linked" "10y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285685" "02241" "00392409" "00006" "Familial, X-linked" "7y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285686" "02241" "00392410" "00006" "Familial, X-linked" "50y" "see paper; ..., moderate lower extremity bowing, osteotomies (4x), many dental abscesses; no phosphate treatment as child, no VitD treatment" "" "37y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285687" "02241" "00392411" "00006" "Familial, X-linked" "16y" "see paper; ..., mild lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285688" "02241" "00392412" "00006" "Familial, X-linked" "9y" "see paper; ..., severe lower extremity bowing, steotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285689" "02241" "00392413" "00006" "Familial, X-linked" "49y" "see paper; ..., moderate lower extremity bowing, osteotomies (2x), bad teeth; no phosphate treatment as child, no VitD treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285690" "02241" "00392414" "00006" "Familial, X-linked" "16y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285691" "02241" "00392415" "00006" "Familial, X-linked" "13y" "see paper; ..., no lower extremity bowing, no osteotomies, few dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285692" "02241" "00392416" "00006" "Familial, X-linked" "10y" "see paper; ..., knock-knee bowing lower extremities, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285693" "02241" "00392417" "00006" "Familial, X-linked" "38y" "see paper; ..., severe lower extremity bowing, osteotomies (4x), bad teeth; no phosphate treatment as child, cod liver oil treatment" "" "01y-02y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285694" "02241" "00392418" "00006" "Familial, X-linked" "33y" "see paper; ..., severe lower extremity bowing, osteotomies (5x); no phosphate treatment as child, cod liver oil treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285695" "02241" "00392419" "00006" "Familial, X-linked" "9y" "see paper; ..., severe lower extremity bowing, osteotomies (3x), no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285696" "02241" "00392420" "00006" "Familial, X-linked" "43y" "see paper; ...; phosphate treatment as child, VitD treatment" "" "13y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285697" "02241" "00392421" "00006" "Familial, X-linked" "16y" "see paper; ..., no lower extremity bowing; phosphate treatment as child, DHT treatment" "" "42d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285698" "02241" "00392422" "00006" "Familial, X-linked" "44y" "see paper; ..., mild lower extremity bowing, osteotomies (5x), no dental abscesses; no phosphate treatment as child, cod liver oil treatment" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285699" "02241" "00392423" "00006" "Familial, X-linked" "13y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285700" "02241" "00392424" "00006" "Familial, X-linked" "12y" "see paper; ..., severe lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285701" "02241" "00392425" "00006" "Familial, X-linked" "38y" "see paper; ..., severe lower extremity bowing, steotomies; phosphate treatment as child, DHT treatment" "" "4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285702" "02241" "00392426" "00006" "Familial, X-linked" "13y" "see paper; ..., slight lower extremity bowing, no osteotomies; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285703" "02241" "00392427" "00006" "Familial, X-linked" "10y" "see paper; ..., mild lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "42d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285704" "02241" "00392428" "00006" "Familial, X-linked" "" "see paper; ..., mild lower extremity bowing, no osteotomies; no phosphate treatment as child, no VitD treatment" "" "10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285705" "02241" "00392429" "00006" "Familial, X-linked" "7y" "see paper; ..., mild lower extremity bowing, no osteotomies; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285706" "02241" "00392430" "00006" "Familial, X-linked" "62y" "see paper; ..., severe lower extremity bowing, steotomies; no phosphate treatment as child, VitD treatment" "" "6y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285707" "02241" "00392431" "00006" "Familial, X-linked" "32y" "see paper; ..., severe lower extremity bowing, steotomies; no phosphate treatment as child, VitD treatment" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285708" "02241" "00392432" "00006" "Familial, X-linked" "40y" "see paper; ..., severe lower extremity bowing, steotomies; no phosphate treatment as child, VitD treatment" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285709" "02241" "00392433" "00006" "Familial, X-linked" "13y" "see paper; ..., severe lower extremity bowing, steotomies; phosphate treatment as child, DHT treatment" "" "34m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285710" "02241" "00392434" "00006" "Familial, X-linked" "11y" "see paper; ..., severe lower extremity bowing, no osteotomies; phosphate treatment as child, DHT treatment" "" "7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285711" "02241" "00392435" "00006" "Familial, X-linked" "" "see paper; ..., moderate lower extremity bowing, no osteotomies; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285712" "02241" "00392436" "00006" "Familial, X-linked" "" "see paper; ..., osteotomies (2x); VitD treatment" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285713" "02241" "00392437" "00006" "Familial, X-linked" "9y" "see paper; ..., moderate lower extremity bowing, no osteotomies; phosphate treatment as child, VitD treatment" "" "42d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285714" "02241" "00392438" "00006" "Familial, X-linked" "61y" "see paper; ..., moderate lower extremity bowing, osteotomies (2x), no dental abscesses, parathyroidectomy" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285715" "02241" "00392439" "00006" "Familial, X-linked" "40y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; no phosphate treatment as child, VitD treatment" "" "01y-02y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285716" "02241" "00392440" "00006" "Familial, X-linked" "11y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285717" "02241" "00392441" "00006" "Familial, X-linked" "10y" "see paper; ..., severe lower extremity bowing, osteotomies (2x), no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "42d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285718" "02241" "00392442" "00006" "Familial, X-linked" "35y" "see paper; ..., lower extremity bowing, osteotomies (2x), few dental abscesses; phosphate treatment as child, VitD treatment" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285719" "02241" "00392443" "00006" "Familial, X-linked" "55y" "see paper; ..., moderate lower extremity bowing, no osteotomies, no dental abscesses; no phosphate treatment as child, no VitD treatment" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285720" "02241" "00392444" "00006" "Familial, X-linked" "29y" "see paper; ..., moderate lower extremity bowing, osteotomies (2x), no dental abscesses; phosphate treatment as child, VitD treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285721" "02241" "00392445" "00006" "Familial, X-linked" "8y" "see paper; ..., severe lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285722" "02241" "00392446" "00006" "Isolated (sporadic)" "9y" "see paper; ..., mild/moderate lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment; parathyroidectomy, seizures, developmental delay" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285723" "02241" "00392447" "00006" "Isolated (sporadic)" "10y" "see paper; ..., severe lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment, parathyroidectomy" "" "8y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285724" "02241" "00392448" "00006" "Familial, X-linked" "58y" "see paper; ..., lower extremity bowing, steotomies, dental abscesses" "" "7y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285725" "02241" "00392449" "00006" "Familial, X-linked" "22y" "see paper; ..., no osteotomies, no dental abscesses; phosphate treatment as child, VitD treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285726" "02241" "00392450" "00006" "Familial, X-linked" "18y" "see paper; ..., no osteotomies, no dental abscesses; phosphate treatment as child, VitD treatment" "" "3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285727" "02241" "00392451" "00006" "Familial, X-linked" "46y" "see paper; ..., lower extremity bowing, steotomies, no dental abscesses; phosphate treatment as child, VitD treatment" "" "7y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285728" "02241" "00392452" "00006" "Familial, X-linked" "18y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285729" "02241" "00392453" "00006" "Familial, X-linked" "21y" "see paper; ..., no lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, VitD/1,25-dihydroxyvitaminD2 treatment" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285730" "02241" "00392454" "00006" "Familial, X-linked" "35y" "see paper; ..., no lower extremity bowing, no osteotomies, severe dental abscesses; no phosphate treatment as child, no VitD treatment" "" "32y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285731" "02241" "00392455" "00006" "Familial, X-linked" "5y" "see paper; ..., lower extremity bowing, osteotomies (1x), no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285732" "02241" "00392456" "00006" "Familial, X-linked" "16y" "see paper; ..., no lower extremity bowing, no osteotomies; no phosphate treatment as child, no VitD treatment" "" "13y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285733" "02241" "00392457" "00006" "Familial, X-linked" "18y" "see paper; ..., severe lower extremity bowing, osteotomies (4x); phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285734" "02241" "00392458" "00006" "Familial, X-linked" "15m" "see paper; ..., moderate lower extremity bowing, no osteotomies; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285735" "02241" "00392459" "00006" "Familial, X-linked" "8y" "see paper; ..., moderate/severe lower extremity bowing, no osteotomies; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285736" "02241" "00392460" "00006" "Familial, X-linked" "" "" "" "24y-25y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285737" "02241" "00392461" "00006" "Familial, X-linked" "17y" "see paper; ..., , DHT/1,25-dihydroxyvitaminD2 treatment" "" "9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285738" "02241" "00392462" "00006" "Isolated (sporadic)" "24y" "see paper; ..., mild lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment, parathyroidectomy" "" "26m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285739" "02241" "00392463" "00006" "Familial, X-linked" "" "see paper; ..., parathyroidectomy" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285740" "02241" "00392464" "00006" "Familial, X-linked" "12y" "see paper; ..., no lower extremity bowing, no osteotomies, many dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment; parathyroidectomy, seizures, developmental delay" "" "4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285741" "02241" "00392465" "00006" "Isolated (sporadic)" "11y" "see paper; ..., moderate lower extremity bowing, no osteotomies, no dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment, parathyroidectomy" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285742" "02241" "00392466" "00006" "Familial, X-linked" "41y" "see paper; ..., lower extremity bowing, osteotomies (8x), many dental abscesses; no phosphate treatment as child, VitD treatment" "" "06y-07y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285743" "02241" "00392467" "00006" "Familial, X-linked" "17y" "see paper; ..., moderate lower extremity bowing, osteotomies (5x), some dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "1d" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285744" "02241" "00392468" "00006" "Familial, X-linked" "" "see paper; ..., dental abscesses; no phosphate treatment as child, no VitD treatment" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285745" "02241" "00392469" "00006" "Familial, X-linked" "17y" "see paper; ..., mild lower extremity bowing, no osteotomies, dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285746" "02241" "00392470" "00006" "Familial, X-linked" "19y" "see paper; ..., no lower extremity bowing, no osteotomies, dental abscesses; phosphate treatment as child, 1,25-dihydroxyvitaminD2 treatment" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285747" "02241" "00392471" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285748" "02241" "00392472" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285749" "02241" "00392473" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285750" "02241" "00392474" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285751" "02241" "00392475" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285752" "02241" "00392476" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285753" "02241" "00392477" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285754" "02241" "00392478" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285755" "02241" "00392479" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285756" "02241" "00392480" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285757" "02241" "00392481" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285758" "02241" "00392482" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285759" "02241" "00392483" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285760" "02241" "00392484" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285761" "02241" "00392485" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285762" "02241" "00392486" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285763" "02241" "00392487" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285764" "02241" "00392488" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285765" "02241" "00392489" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285766" "02241" "00392490" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285767" "02241" "00392491" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285768" "02241" "00392492" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285769" "02241" "00392493" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285770" "02241" "00392494" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285771" "02241" "00392495" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285772" "02241" "00392496" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285773" "02241" "00392497" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285774" "02241" "00392498" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285775" "02241" "00392499" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285776" "02241" "00392500" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285777" "02241" "00392501" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285778" "02241" "00392502" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285779" "02241" "00392503" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285927" "02241" "00392680" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285928" "02241" "00392681" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285929" "02241" "00392682" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285930" "02241" "00392683" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285931" "02241" "00392684" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285932" "02241" "00392685" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285933" "02241" "00392686" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285934" "02241" "00392687" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285935" "02241" "00392688" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285936" "02241" "00392689" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285937" "02241" "00392690" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285938" "02241" "00392691" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285939" "02241" "00392692" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285940" "02241" "00392693" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285941" "02241" "00392694" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285942" "02241" "00392695" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285943" "02241" "00392696" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285944" "02241" "00392697" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285945" "02241" "00392698" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285946" "02241" "00392699" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285947" "02241" "00392700" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285948" "02241" "00392701" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285949" "02241" "00392702" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285950" "02241" "00392703" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285951" "02241" "00392704" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285952" "02241" "00392705" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285953" "02241" "00392706" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285954" "02241" "00392707" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285955" "02241" "00392708" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285956" "02241" "00392709" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285957" "02241" "00392710" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285958" "02241" "00392711" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285959" "02241" "00392712" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285960" "02241" "00392713" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285961" "02241" "00392714" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285962" "02241" "00392715" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285963" "02241" "00392716" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285964" "02241" "00392717" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285965" "02241" "00392718" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285966" "02241" "00392719" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285967" "02241" "00392720" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285968" "02241" "00392721" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285969" "02241" "00392722" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285970" "02241" "00392723" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285971" "02241" "00392724" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285972" "02241" "00392725" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285973" "02241" "00392726" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285974" "02241" "00392727" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285975" "02241" "00392728" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285976" "02241" "00392729" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285977" "02241" "00392730" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285978" "02241" "00392731" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285979" "02241" "00392732" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285980" "02241" "00392733" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285981" "02241" "00392734" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285982" "02241" "00392735" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285983" "02241" "00392736" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285984" "02241" "00392737" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285985" "02241" "00392738" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285986" "02241" "00392739" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285987" "02241" "00392740" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285988" "02241" "00392741" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285989" "02241" "00392742" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285990" "02241" "00392743" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285991" "02241" "00392744" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285992" "02241" "00392745" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000285993" "02241" "00392746" "00006" "Familial, X-linked dominant" "" "hypophosphatemia, normocalcemia, normal renal function" "" "" "" "" "" "" "" "" "" "XLHR" "" "" "0000285994" "02241" "00392747" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "" "" "0000286026" "02241" "00392780" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286027" "02241" "00392781" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286028" "02241" "00392782" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286029" "02241" "00392783" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286030" "02241" "00392784" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286031" "02241" "00392785" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286032" "02241" "00392786" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286033" "02241" "00392787" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286034" "02241" "00392788" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286035" "02241" "00392789" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286036" "02241" "00392790" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286037" "02241" "00392791" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286038" "02241" "00392792" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286039" "02241" "00392793" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286040" "02241" "00392794" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286041" "02241" "00392795" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286042" "02241" "00392796" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286043" "02241" "00392797" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286044" "02241" "00392798" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286045" "02241" "00392799" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286046" "02241" "00392800" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286047" "02241" "00392801" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286048" "02241" "00392802" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286049" "02241" "00392803" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286050" "02241" "00392804" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286051" "02241" "00392805" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286052" "02241" "00392806" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286053" "02241" "00392807" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286054" "02241" "00392808" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286055" "02241" "00392809" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286056" "02241" "00392810" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286057" "02241" "00392811" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286058" "02241" "00392812" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286060" "02241" "00392814" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286061" "02241" "00392815" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286062" "02241" "00392816" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286063" "02241" "00392817" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286064" "02241" "00392818" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286065" "02241" "00392819" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286066" "02241" "00392820" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286067" "02241" "00392821" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286068" "02241" "00392822" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286069" "02241" "00392823" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286070" "02241" "00392824" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286071" "02241" "00392825" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286072" "02241" "00392826" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286073" "02241" "00392827" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286074" "02241" "00392828" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286075" "02241" "00392829" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286076" "02241" "00392830" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286077" "02241" "00392831" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286078" "02241" "00392832" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286079" "02241" "00392833" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286080" "02241" "00392834" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286081" "02241" "00392835" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286082" "02241" "00392836" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286083" "02241" "00392837" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286084" "02241" "00392838" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286085" "02241" "00392839" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286086" "02241" "00392840" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286087" "02241" "00392841" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286088" "02241" "00392842" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286089" "02241" "00392843" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286090" "02241" "00392844" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286091" "02241" "00392845" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286092" "02241" "00392846" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286093" "02241" "00392847" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286094" "02241" "00392848" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286095" "02241" "00392849" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286096" "02241" "00392850" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286097" "02241" "00392851" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286098" "02241" "00392852" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286099" "02241" "00392853" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286100" "02241" "00392854" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286101" "02241" "00392855" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286102" "02241" "00392856" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286103" "02241" "00392857" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286104" "02241" "00392858" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286105" "02241" "00392859" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286106" "02241" "00392860" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286107" "02241" "00392861" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286108" "02241" "00392862" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286109" "02241" "00392863" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286110" "02241" "00392864" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286111" "02241" "00392865" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286112" "02241" "00392866" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286113" "02241" "00392867" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286114" "02241" "00392868" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286115" "02241" "00392869" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286116" "02241" "00392870" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286117" "02241" "00392871" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286118" "02241" "00392872" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286119" "02241" "00392873" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286120" "02241" "00392874" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286121" "02241" "00392875" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286122" "02241" "00392876" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286123" "02241" "00392877" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286124" "02241" "00392878" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286125" "02241" "00392879" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286126" "02241" "00392880" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286127" "02241" "00392881" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286128" "02241" "00392882" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286129" "02241" "00392883" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286130" "02241" "00392884" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286131" "02241" "00392885" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286132" "02241" "00392886" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286133" "02241" "00392887" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286134" "02241" "00392888" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286135" "02241" "00392889" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286136" "02241" "00392890" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286137" "02241" "00392891" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286138" "02241" "00392892" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286139" "02241" "00392893" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286140" "02241" "00392894" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286141" "02241" "00392895" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286142" "02241" "00392896" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286143" "02241" "00392897" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286144" "02241" "00392898" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286145" "02241" "00392899" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286146" "02241" "00392900" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286147" "02241" "00392901" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286148" "02241" "00392902" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286445" "02241" "00393205" "00006" "Isolated (sporadic)" "02y06m" "see paper; ..., lower extremity deformities, short stature, genu varum" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286446" "02241" "00393206" "00006" "Isolated (sporadic)" "03y06m" "see paper; ..., lower extremity deformities, short stature, bilateral bowed legs, genu varum" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286447" "02241" "00393207" "00006" "Familial, X-linked dominant" "01y05m" "see paper; ..., bilateral tibia vara" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286448" "02241" "00393208" "00006" "Familial, X-linked dominant" "07y06m" "see paper; ..., bilateral tibia vara, severe dental caries" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286451" "02241" "00393211" "00006" "Familial, X-linked dominant" "31y" "see paper; ..., vitamin D-resistant hypophosphatemic rickets" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286453" "02241" "00393213" "00006" "Familial, X-linked dominant" "14y" "see paper; ..., hypophosphatemic rickets, nephrocalcinosis, hypertension, renal failure" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286455" "02241" "00393214" "00006" "Familial, X-linked dominant" "39y" "see paper; ..., 21m-bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286457" "02241" "00393216" "00006" "Familial, X-linked dominant" "33y" "see paper; ..., very short stature, leg pain, dental defects, deformities lower extremities, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "short stature" "" "0000286467" "02241" "00393226" "00006" "Familial, autosomal dominant" "53y" "see paper; ..., height 150 cm, weight 60 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286468" "02241" "00393227" "00006" "Familial, autosomal dominant" "30y" "see paper; ..., height 155 cm, weight 48 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286469" "02241" "00393228" "00006" "Familial, autosomal dominant" "28y" "see paper; ..., height 152 cm, weight 55 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286470" "02241" "00393229" "00006" "Familial, autosomal dominant" "6y" "see paper; ..., height 108 cm, weight 33 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286471" "02241" "00393230" "00006" "Familial, autosomal dominant" "48y" "see paper; ..., height 145 cm, weight 48 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286472" "02241" "00393231" "00006" "Familial, autosomal dominant" "15y" "see paper; ..., height 144 cm, weight 50 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286473" "02241" "00393232" "00006" "Familial, autosomal dominant" "38y" "see paper; ..., height 149 cm, weight 52 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286474" "02241" "00393233" "00006" "Familial, autosomal dominant" "1y" "see paper; ..., height 76 cm, weight 25 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286475" "02241" "00393234" "00006" "Familial, autosomal dominant" "40y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286476" "02241" "00393235" "00006" "Familial, autosomal dominant" "14y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286477" "02241" "00393236" "00006" "Familial, autosomal dominant" "10y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286478" "02241" "00393237" "00006" "Familial, autosomal dominant" "9y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286479" "02241" "00393238" "00006" "Isolated (sporadic)" "14y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286480" "02241" "00393239" "00006" "Isolated (sporadic)" "11y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286481" "02241" "00393240" "00006" "Isolated (sporadic)" "3y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286482" "02241" "00393241" "00006" "Familial, autosomal dominant" "38y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286483" "02241" "00393242" "00006" "Familial, autosomal dominant" "4y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286484" "02241" "00393243" "00006" "Familial, autosomal dominant" "2y" "see paper; ..., failure to walk, bowing of legs" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286485" "02241" "00393244" "00006" "Isolated (sporadic)" "02y" "see paper; ..., height 3-5th percentile, genua vara, café au lait spots on abdomen, dental defects (formation of abscesses, recurent extractions)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286487" "02241" "00393246" "00006" "Familial, autosomal dominant" "31y" "see paper; ..., height 137 cm, weight 45kg; joint pain; no bone fracture; waddling gait; genu varum; dental crowding, dental absence" "" "8y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286488" "02241" "00393247" "00006" "Familial, autosomal dominant" "8y" "see paper; ..., height 105 cm, weight 20kg; joint pain; no bone fracture; pectus carinatum; waddling gait; genu varum; dental crowding, dental absence" "" "8y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286489" "02241" "00393248" "00006" "Familial, autosomal dominant" "62y" "see paper; ..., height 146 cm, weight 52kg; joint pain; bone fracture; waddling gait; genu varum; dental crowding, dental absence" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286490" "02241" "00393249" "00006" "Familial, autosomal dominant" "34y" "see paper; ..., height 148 cm, weight 48kg; joint pain; no bone fracture; pectus carinatum; waddling gait; genu varum; dental crowding, dental absence; blue sclera" "" "8y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286491" "02241" "00393250" "00006" "Isolated (sporadic)" "6y" "see paper; ..., height 97 cm, weight 18kg; pectus carinatum; waddling gait; genu varum; dental crowding, dental absence; hypermetropia, astigmatism, strabismus" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286492" "02241" "00393251" "00006" "Familial, autosomal dominant" "50y" "see paper; ..., height 140 cm, weight 51kg; joint pain; bone fracture; pectus carinatum; waddling gait; genu varum; dental crowding, dental absence" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286493" "02241" "00393252" "00006" "Familial, autosomal dominant" "26y" "see paper; ..., height 137 cm, weight 50kg; joint pain; bone fracture; pectus carinatum; waddling gait; genu varum; dental crowding, dental absence" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286494" "02241" "00393253" "00006" "Familial, X-linked dominant" "42y" "see paper; ..., lower limb weakness, severe bone pain, 38y-wheelchair-bound; short stature, bowing of legs, loss all teeth; spastic paraplegia lower limbs (motor power 1/5) with sensory loss below neck and mute plantar response; MRI cervical spine protrusion of cervical disc at C5‐C6 and OPLL with significant cord compression" "" "" "" "" "" "" "" "" "" "XLHR" "ower limb weakness, severe bone pain" "" "0000286495" "02241" "00393254" "00006" "Isolated (sporadic)" "" "see paper; ..., hypophosphatemic rick- ets/osteomalacia" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286496" "02241" "00393255" "00006" "Familial, X-linked dominant" "" "see paper; ..., 19m-bowing lower extremities" "" "" "" "" "" "" "" "" "" "XLHR" "bowing lower extremities" "" "0000286497" "02241" "00393256" "00006" "Familial, X-linked dominant" "54y" "see paper; ..., 54y-very short stature, length, 154 cm, weight 70 kg; pain lumbar spine, deformities lower limbs, dental enamel (adamantine) defects, slightly blue sclerae, sensorineural hearing loss, pruritus; undergone several osteotomies to straighten deformities, sustained multiple fatigue fractures" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286498" "02241" "00393257" "00006" "Familial, autosomal dominant" "18y" "see paper; ..., severe bowing, osteotomy, mild dental severity" "5y" "14y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286499" "02241" "00393258" "00006" "Familial, autosomal dominant" "40y" "see paper; ..., severe bowing, osteotomy, mild dental severity" "5y" "37y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286500" "02241" "00393259" "00006" "Familial, autosomal dominant" "32y" "see paper; ..., mild bowing, osteotomy, severe dental severity" "6y" "28y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286501" "02241" "00393260" "00006" "Familial, autosomal dominant" "22y" "see paper; ..., mild bowing, osteotomy, moderate dental severity" "2y" "17y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286502" "02241" "00393261" "00006" "Isolated (sporadic)" "18y" "see paper; ..., moderate bowing, osteotomy, no dental involvement" "1d" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286503" "02241" "00393262" "00006" "Isolated (sporadic)" "34y" "see paper; ..., mild bowing, osteotomy, moderate dental severity" "3y" "32y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286504" "02241" "00393263" "00006" "Isolated (sporadic)" "39y" "see paper; ..., severe bowing, osteotomy, severe dental severity" "01y-02y" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286505" "02241" "00393264" "00006" "Isolated (sporadic)" "16y" "see paper; ..., moderate bowing, osteotomy, moderate dental severity" "3y" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286506" "02241" "00393265" "00006" "Isolated (sporadic)" "3y" "see paper; ..., mild bowing, no osteotomy, moderate dental severity" "2y" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286507" "02241" "00393266" "00006" "Familial, autosomal dominant" "33y" "see paper; ..., severe bowing, osteotomy, severe dental severity" "<1y" "30y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286508" "02241" "00393267" "00006" "Familial, autosomal dominant" "60y" "see paper; ..., moderate bowing, osteotomy, mild dental severity" "38y" "44y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286509" "02241" "00393268" "00006" "Familial, autosomal dominant" "47y" "see paper; ..., mild bowing, no osteotomy, mild dental severity" "" "11y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286510" "02241" "00393269" "00006" "Isolated (sporadic)" "20y" "see paper; ..., mild bowing, no osteotomy, no dental involvement" "5y" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286511" "02241" "00393270" "00006" "Familial, autosomal dominant" "15y" "see paper; ..., severe bowing, osteotomy, moderate dental severity" "10y" "10y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286512" "02241" "00393271" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286513" "02241" "00393272" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286514" "02241" "00393273" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286515" "02241" "00393274" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286516" "02241" "00393275" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286517" "02241" "00393276" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286518" "02241" "00393277" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286519" "02241" "00393278" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286520" "02241" "00393279" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286521" "02241" "00393280" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286522" "02241" "00393281" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286523" "02241" "00393282" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286524" "02241" "00393283" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286525" "02241" "00393284" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286526" "02241" "00393285" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286527" "02241" "00393286" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286528" "02241" "00393287" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286529" "02241" "00393288" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286530" "02241" "00393289" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286531" "02241" "00393290" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286532" "02241" "00393291" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286533" "02241" "00393292" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286534" "02241" "00393293" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286535" "02241" "00393294" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286536" "02241" "00393295" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286537" "02241" "00393296" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286538" "02241" "00393297" "00006" "Isolated (sporadic)" "" "see paper; ..., rickets, bowing legs, growth retardation" "18m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286539" "02241" "00393298" "00006" "Familial, X-linked dominant" "" "see paper; ..., genua vara" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286540" "02241" "00393299" "00006" "Isolated (sporadic)" "" "see paper; ..., rickets, bowing legs, growth retardation, bone pain" "20m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286541" "02241" "00393300" "00006" "Familial, X-linked dominant" "" "see paper; ..., bowing legs" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286542" "02241" "00393301" "00006" "Familial, X-linked dominant" "" "see paper; ..., rickets, genua vara" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286543" "02241" "00393302" "00006" "Isolated (sporadic)" "" "see paper; ..., rickets, genua vara, surgical intervention" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286544" "02241" "00393303" "00006" "Familial, X-linked dominant" "" "see paper; ..., rickets, genua vara" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286545" "02241" "00393304" "00006" "Isolated (sporadic)" "" "see paper; ..., genua vara, surgical intervention" "20m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000286636" "02241" "00393430" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287587" "02241" "00394383" "00006" "Familial, X-linked dominant" "29y" "see paper; ..., height 150 cm (Z -3.69), weight 50 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287588" "02241" "00394384" "00006" "Familial, X-linked dominant" "20y" "see paper; ..., height 133 cm (Z -5.00), weight 47 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287589" "02241" "00394385" "00006" "Unknown" "30y" "see paper; ..., height 148 cm (Z -4.03), weight 53 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287590" "02241" "00394386" "00006" "Unknown" "33y" "see paper; ..., height 144 cm (Z -2.92), weight 62 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287591" "02241" "00394387" "00006" "Familial, X-linked dominant" "36y" "see paper; ..., height 142 cm (Z -3.30), weight 42 kg" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287592" "02241" "00394388" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287593" "02241" "00394389" "00006" "Familial, X-linked dominant" "35y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287594" "02241" "00394391" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287595" "02241" "00394392" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287596" "02241" "00394393" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287597" "02241" "00394394" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287598" "02241" "00394395" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287599" "02241" "00394396" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287600" "02241" "00394397" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287601" "02241" "00394398" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287602" "02241" "00394399" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287603" "02241" "00394400" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287604" "02241" "00394401" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287605" "02241" "00394402" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287606" "02241" "00394403" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287607" "02241" "00394404" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287608" "02241" "00394405" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287609" "02241" "00394406" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287610" "02241" "00394407" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287611" "02241" "00394408" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287612" "02241" "00394409" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287613" "02241" "00394410" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287614" "02241" "00394411" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287615" "02241" "00394412" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287616" "02241" "00394413" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287617" "02241" "00394414" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287618" "02241" "00394415" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287619" "02241" "00394416" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287620" "02241" "00394417" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287621" "02241" "00394418" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287622" "02241" "00394419" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287623" "02241" "00394420" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287624" "02241" "00394421" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287625" "02241" "00394422" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287626" "02241" "00394423" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287627" "02241" "00394424" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287628" "02241" "00394425" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287629" "02241" "00394426" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287630" "02241" "00394427" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287631" "02241" "00394428" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287632" "02241" "00394429" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287633" "02241" "00394430" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287634" "02241" "00394431" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287635" "02241" "00394432" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287636" "02241" "00394433" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287637" "02241" "00394434" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287638" "02241" "00394435" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287639" "02241" "00394436" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287640" "02241" "00394437" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287641" "02241" "00394438" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287642" "02241" "00394440" "00006" "Familial, X-linked dominant" "39y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287643" "02241" "00394441" "00006" "Familial, X-linked dominant" "37y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287644" "02241" "00394442" "00006" "Familial, X-linked dominant" "35y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287645" "02241" "00394443" "00006" "Familial, X-linked dominant" "4y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287646" "02241" "00394444" "00006" "Familial, X-linked dominant" "2y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287647" "02241" "00394445" "00006" "Familial, X-linked dominant" "33y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287648" "02241" "00394446" "00006" "Familial, X-linked dominant" "0y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287649" "02241" "00394447" "00006" "Familial, X-linked dominant" "45y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287650" "02241" "00394448" "00006" "Familial, X-linked dominant" "18y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287651" "02241" "00394449" "00006" "Familial, X-linked dominant" "15y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287652" "02241" "00394450" "00006" "Unknown" "24y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287654" "02241" "00394452" "00006" "Unknown" "51y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287655" "02241" "00394453" "00006" "Unknown" "2y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287656" "02241" "00394454" "00006" "Unknown" "45y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287657" "02241" "00394455" "00006" "Unknown" "35y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287658" "02241" "00394456" "00006" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287659" "02241" "00394457" "00006" "Unknown" "41y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287660" "02241" "00394458" "00006" "Familial, X-linked dominant" "47y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287661" "02241" "00394459" "00006" "Familial, X-linked dominant" "23y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287662" "02241" "00394460" "00006" "Familial, X-linked dominant" "20y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287663" "02241" "00394461" "00006" "Familial, X-linked dominant" "18y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287664" "02241" "00394462" "00006" "Unknown" "9y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287665" "02241" "00394463" "00006" "Unknown" "22y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287667" "02241" "00394465" "00006" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000287668" "02241" "00394466" "00006" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288016" "02241" "00394815" "00006" "Familial, X-linked dominant" "" "height 94 cm (SD -2.28), O-bowed legs, moderate bone phenotype, dental caries, no bone pain, no muscle weakness" "" "3y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288017" "02241" "00394816" "00006" "Familial, X-linked dominant" "" "height 83 cm (SD -3.18), O-bowed legs, moderate bone phenotype, dental caries, no bone pain, no muscle weakness" "" "2y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288018" "02241" "00394817" "00006" "Familial, X-linked dominant" "" "height 113 cm (SD -3.93), O-bowed legs, moderate bone phenotype, normal teeth, bone pain, no muscle weakness" "" "9y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288019" "02241" "00394818" "00006" "Familial, X-linked dominant" "" "height 84.8 cm (SD -2.14), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "2y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288020" "02241" "00394819" "00006" "Isolated (sporadic)" "" "height 100 cm (SD -2.69), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "5y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288021" "02241" "00394820" "00006" "Isolated (sporadic)" "" "height 78.5 cm (SD -2.65), O-bowed legs, severe bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288022" "02241" "00394821" "00006" "Isolated (sporadic)" "" "height 104 cm (SD -2.24), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "5y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288023" "02241" "00394822" "00006" "Isolated (sporadic)" "" "height 109 cm (SD -3.29), O-bowed legs, severe bone phenotype, normal teeth, no bone pain, muscle weakness" "" "7y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288024" "02241" "00394823" "00006" "Familial, X-linked dominant" "" "height 88 cm (SD -1.82), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "2y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288025" "02241" "00394824" "00006" "Familial, X-linked dominant" "" "height 63 cm (SD -1.65), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288026" "02241" "00394825" "00006" "Isolated (sporadic)" "" "height 95 cm (SD -2.71), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "4y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288027" "02241" "00394826" "00006" "Familial, X-linked dominant" "" "height 73.8 cm (SD -1.00), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288028" "02241" "00394827" "00006" "Isolated (sporadic)" "" "height 97 cm (SD -1.26), X-bowed legs, mild bone phenotype, dental caries, no bone pain, no muscle weakness" "" "3y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288029" "02241" "00394828" "00006" "Familial, X-linked dominant" "" "height 81 cm (SD -2.21), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288030" "02241" "00394829" "00006" "Familial, X-linked dominant" "" "height 95.5 cm (SD -5.38), X-bowed legs, mild bone phenotype, dental caries, tooth loss, bone pain, no muscle weakness" "" "6y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288031" "02241" "00394830" "00006" "Isolated (sporadic)" "" "height 75 cm (SD -2.23), O-bowed legs, severe bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288032" "02241" "00394831" "00006" "Familial, X-linked dominant" "" "height 83 cm (SD -1.32), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288033" "02241" "00394832" "00006" "Isolated (sporadic)" "" "height 72 cm (SD -1.67), O-bowed legs, mild bone phenotype, tooth loss, delayed dentition, no bone pain, no muscle weakness" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288034" "02241" "00394833" "00006" "Isolated (sporadic)" "" "height 79 cm (SD -1.69), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "21m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288035" "02241" "00394834" "00006" "Isolated (sporadic)" "" "height 78 cm (SD -2.52), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288036" "02241" "00394835" "00006" "Isolated (sporadic)" "" "height 79 cm (SD -1.75), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "20m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288037" "02241" "00394836" "00006" "Isolated (sporadic)" "" "height 82 cm (SD -3.05), O-bowed legs, mild bone phenotype, normal teeth, bone pain, no muscle weakness" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288038" "02241" "00394837" "00006" "Familial, X-linked dominant" "" "height 94 cm (SD -1.54), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "3y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288039" "02241" "00394838" "00006" "Familial, X-linked dominant" "" "height 73 cm (SD -1.54), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288040" "02241" "00394839" "00006" "Isolated (sporadic)" "" "height 69 cm (SD -1.88), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288041" "02241" "00394840" "00006" "Isolated (sporadic)" "" "height 75.5 cm (SD -2.00), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288042" "02241" "00394841" "00006" "Isolated (sporadic)" "" "height 90 cm (SD -1.47), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288043" "02241" "00394842" "00006" "Isolated (sporadic)" "" "height 125 cm (SD -2.45), O-bowed legs, severe bone phenotype, dental caries, no bone pain, no muscle weakness" "" "10y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288044" "02241" "00394843" "00006" "Familial, X-linked dominant" "" "height 95 cm (SD -2.33), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "5y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288045" "02241" "00394844" "00006" "Familial, X-linked dominant" "" "height 109 cm (SD -2.33), O-bowed legs, moderate bone phenotype" "" "6y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288046" "02241" "00394845" "00006" "Familial, X-linked dominant" "" "height 73 cm (SD -2.50), O-bowed legs, mild bone phenotype" "" "1y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288047" "02241" "00394846" "00006" "Familial, X-linked dominant" "" "height 87 cm (SD -0.97), O-bowed legs, mild bone phenotype" "" "2y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288048" "02241" "00394847" "00006" "Isolated (sporadic)" "" "height 79 cm (SD -2.00), O-bowed legs, mild bone phenotype, dental caries, no bone pain, no muscle weakness" "" "1y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288049" "02241" "00394848" "00006" "Familial, X-linked dominant" "" "height 71 cm (SD -2.04), O-bowed legs, mild bone phenotype, dental caries, no bone pain, no muscle weakness" "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288050" "02241" "00394849" "00006" "Isolated (sporadic)" "" "height 78 cm (SD -2.21), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288051" "02241" "00394850" "00006" "Familial, X-linked dominant" "" "height 135 cm (SD -3.80), O-bowed legs, moderate bone phenotype, normal teeth, bone pain, no muscle weakness" "" "13y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288052" "02241" "00394851" "00006" "Isolated (sporadic)" "" "height 84 cm (SD 0.40), X-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288053" "02241" "00394852" "00006" "Familial, X-linked dominant" "" "height 80 cm (SD -2.50), O-bowed legs, mild bone phenotype, dental caries, no bone pain, no muscle weakness" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288054" "02241" "00394853" "00006" "Familial, X-linked dominant" "" "height 79 cm (SD -0.28), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288055" "02241" "00394854" "00006" "Familial, X-linked dominant" "" "height 76 cm (SD -2.69), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288056" "02241" "00394855" "00006" "Isolated (sporadic)" "" "height 76 cm (SD -1.60), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288057" "02241" "00394856" "00006" "Isolated (sporadic)" "" "height 82 cm (SD -2.14), O-bowed legs, mild bone phenotype, dental caries, no bone pain, no muscle weakness" "" "2y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288058" "02241" "00394857" "00006" "Isolated (sporadic)" "" "height 75 cm (SD -1.55), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288059" "02241" "00394858" "00006" "Isolated (sporadic)" "" "height 89.5 cm (SD -3.49), O-bowed legs, moderate bone phenotype" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288060" "02241" "00394859" "00006" "Familial, X-linked dominant" "" "height 90 cm (SD -1.22), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "2y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288061" "02241" "00394860" "00006" "Isolated (sporadic)" "" "height 107 cm (SD -2.22), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "5y11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288062" "02241" "00394861" "00006" "Isolated (sporadic)" "" "height 88 cm (SD -2.00), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288063" "02241" "00394862" "00006" "Isolated (sporadic)" "" "height 89 cm (SD -3.87), X-bowed legs, moderate bone phenotype, dental caries, no bone pain, no muscle weakness" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288064" "02241" "00394863" "00006" "Isolated (sporadic)" "" "height 80 cm (SD -0.81), O-bowed legs, mild bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288065" "02241" "00394864" "00006" "Isolated (sporadic)" "" "height 89.5 cm (SD -1.95), O-bowed legs, moderate bone phenotype, dental caries, no bone pain, no muscle weakness" "" "3y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288066" "02241" "00394865" "00006" "Familial, X-linked dominant" "" "height 126 cm (SD -4.06), O-bowed legs, severe bone phenotype, dental caries, bone pain, cataclasis, muscle weakness" "" "12y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288067" "02241" "00394866" "00006" "Familial, X-linked dominant" "" "height 74 cm (SD -2.57), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "1y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288068" "02241" "00394867" "00006" "Isolated (sporadic)" "" "height 81 cm (SD -2.00), O-bowed legs, moderate bone phenotype, normal teeth, no bone pain, no muscle weakness" "" "2y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288117" "02241" "00394918" "00006" "Familial, X-linked dominant" "" "no bone deformities, no longitudinal growth retardation (≤2 SD)," "" "3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288118" "02241" "00394919" "00006" "Familial, X-linked dominant" "" "bone deformities, longitudinal growth retardation (≤2 SD)," "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288119" "02241" "00394920" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "1y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288120" "02241" "00394921" "00006" "Unknown" "" "active rickets, longitudinal growth retardation (≤2 SD), dental problems" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288121" "02241" "00394922" "00006" "Familial, X-linked dominant" "" "no bone deformities, no active rickets, longitudinal growth retardation (≤2 SD), dental problems" "" "1y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288122" "02241" "00394923" "00006" "Familial, X-linked dominant" "" "no bone deformities, no active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288123" "02241" "00394924" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288124" "02241" "00394925" "00006" "Unknown" "" "bone deformities, no active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288125" "02241" "00394926" "00006" "Familial, X-linked dominant" "" "" "" "8y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288126" "02241" "00394927" "00006" "Familial, X-linked dominant" "" "active rickets, no dental problems" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288127" "02241" "00394928" "00006" "Familial, X-linked dominant" "" "active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288128" "02241" "00394929" "00006" "Familial, X-linked dominant" "" "longitudinal growth retardation (≤2 SD)," "" "1y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288129" "02241" "00394930" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288130" "02241" "00394931" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288131" "02241" "00394932" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288132" "02241" "00394933" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "2y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288133" "02241" "00394934" "00006" "Unknown" "" "bone deformities, active rickets," "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288134" "02241" "00394935" "00006" "Unknown" "" "active rickets," "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288135" "02241" "00394936" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288136" "02241" "00394937" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD)," "" "1y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288137" "02241" "00394938" "00006" "Unknown" "" "bone deformities, longitudinal growth retardation (≤2 SD), no dental problems" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288138" "02241" "00394939" "00006" "Unknown" "" "longitudinal growth retardation (≤2 SD)," "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288139" "02241" "00394940" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288140" "02241" "00394941" "00006" "Unknown" "" "bone deformities, active rickets, no dental problems" "" "7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288141" "02241" "00394942" "00006" "Unknown" "" "bone deformities, longitudinal growth retardation (≤2 SD)," "" "2y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288142" "02241" "00394943" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "4y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288143" "02241" "00394944" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288144" "02241" "00394945" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288145" "02241" "00394946" "00006" "Unknown" "" "bone deformities, no longitudinal growth retardation (≤2 SD)," "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288146" "02241" "00394947" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288147" "02241" "00394948" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "4y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288148" "02241" "00394949" "00006" "Familial, X-linked dominant" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288149" "02241" "00394950" "00006" "Familial, X-linked dominant" "" "active rickets, no dental problems" "" "8y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288150" "02241" "00394951" "00006" "Familial, X-linked dominant" "" "bone deformities, no longitudinal growth retardation (≤2 SD)," "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288151" "02241" "00394952" "00006" "Familial, X-linked dominant" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288152" "02241" "00394953" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "1y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288153" "02241" "00394954" "00006" "Familial, X-linked dominant" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD)," "" "1y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288154" "02241" "00394955" "00006" "Familial, X-linked dominant" "" "active rickets, no dental problems" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288155" "02241" "00394956" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), no dental problems" "" "8y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288156" "02241" "00394957" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288157" "02241" "00394958" "00006" "Unknown" "" "longitudinal growth retardation (≤2 SD)," "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288158" "02241" "00394959" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "2y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288159" "02241" "00394960" "00006" "Familial, X-linked dominant" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD)," "" "7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288160" "02241" "00394961" "00006" "Familial, X-linked dominant" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD)," "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288161" "02241" "00394962" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288162" "02241" "00394963" "00006" "Unknown" "" "bone deformities, active rickets, longitudinal growth retardation (≤2 SD), dental problems" "" "1y9m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288163" "02241" "00394964" "00006" "Unknown" "" "bone deformities, active rickets, no longitudinal growth retardation (≤2 SD), no dental problems" "" "1y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288164" "02241" "00394965" "00006" "Unknown" "" "bone deformities, active rickets, no dental problems" "" "2y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288167" "02241" "00394968" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288168" "02241" "00394969" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288169" "02241" "00394970" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288170" "02241" "00394971" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288171" "02241" "00394972" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288172" "02241" "00394973" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288173" "02241" "00394974" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288174" "02241" "00394975" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288175" "02241" "00394976" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288176" "02241" "00394977" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288177" "02241" "00394978" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288178" "02241" "00394979" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288179" "02241" "00394980" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288180" "02241" "00394981" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288181" "02241" "00394982" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288182" "02241" "00394983" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288183" "02241" "00394984" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288184" "02241" "00394985" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288185" "02241" "00394986" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288186" "02241" "00394987" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288187" "02241" "00394988" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288188" "02241" "00394989" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288189" "02241" "00394990" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288190" "02241" "00394991" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288191" "02241" "00394992" "00006" "Isolated (sporadic)" "05y" "see paper; ..., respiratory arrest, limb deformities, leg pain, combative, became lethargic, developmental delay, limping, waddling gait" "" "" "" "" "" "" "" "" "" "" "respiratory arrest" "" "0000288192" "02241" "00225631" "03213" "Familial, X-linked dominant" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "" "" "" "0000288193" "02241" "00394993" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288267" "02241" "00395067" "00006" "Familial, X-linked dominant" "5y" "see paper; ..., height 92 cm (<1st ), weight 13.5kg, BMI 15.95 (kg/m2), retarded dentition" "3y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288268" "02241" "00395068" "00006" "Familial, X-linked dominant" "34y" "see paper; ..., height 147 cm (<5th ), weight 54kg, BMI 24.99 (kg/m2), genu varum" "1y6m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288269" "02241" "00395069" "00006" "Familial, X-linked dominant" "4y" "see paper; ..., height 95 cm (<3rd ), weight 15kg, BMI 16.62 (kg/m2), genu varum, retarded dentition" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288270" "02241" "00395070" "00006" "Familial, X-linked dominant" "27y" "see paper; ..., height 139 cm (<5th ), weight 45kg, BMI 23.29 (kg/m2), genu varum, retarded dentition, odontodysplasia, teeth falling out" "1y6m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288271" "02241" "00395071" "00006" "Familial, X-linked dominant" "43y" "see paper; ..., height 150 cm (<25th ), weight 51kg, BMI 22.67 (kg/m2), genu varum and bone pain" "4y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288272" "02241" "00395072" "00006" "Familial, X-linked dominant" "73y" "see paper; ..., height 145 cm (<25th ), weight 53kg, BMI 25.21 (kg/m2), hip/knee joint pain, kyphosis, bone pain" "5y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288273" "02241" "00395073" "00006" "Familial, X-linked dominant" "4y" "see paper; ..., height 99 cm (<15th ), weight 17kg, BMI 17.35 (kg/m2), genu varum" "1y6m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288274" "02241" "00395074" "00006" "Familial, X-linked dominant" "33y" "see paper; ..., height 141 cm (<5th ), weight 41kg, BMI 20.62 (kg/m2), genu varum" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288275" "02241" "00395075" "00006" "Familial, X-linked dominant" "58y" "see paper; ..., height 127 cm (<5th ), weight 48kg, BMI 29.76 (kg/m2), genu varum" "5y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288276" "02241" "00395076" "00006" "Familial, X-linked dominant" "14y" "see paper; ..., height 137 cm (<1st ), weight 31.5kg, BMI 16.78 (kg/m2), genu varum (mild), bone pain, growth retardation" "5y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288277" "02241" "00395077" "00006" "Familial, X-linked dominant" "37y" "see paper; ..., height 137.5 cm (<5th ), weight 47kg, BMI 24.86 (kg/m2), genu varum, odontodysplasia, teeth falling out, growth retardation" "4y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288278" "02241" "00395078" "00006" "Familial, X-linked dominant" "13y" "see paper; ..., height 142 cm (<3rd ), weight 45kg, BMI 22.32 (kg/m2), bowing of legs" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288279" "02241" "00395079" "00006" "Familial, X-linked dominant" "37y" "see paper; ..., height 138 cm (<5th ), weight 41kg, BMI 21.53 (kg/m2), bowing of legs" "2y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288280" "02241" "00395080" "00006" "Isolated (sporadic)" "16y" "see paper; ..., height 145 cm (<1st ), weight 40.5kg, BMI 19.26 (kg/m2), genu varum, hip pain, growth retardation" "9m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288281" "02241" "00395081" "00006" "Isolated (sporadic)" "3y" "see paper; ..., height 82 cm (<1st ), weight 12kg, BMI 17.85 (kg/m2), genu varum, cephalus quadratus" "1y6m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288282" "02241" "00395082" "00006" "Isolated (sporadic)" "11y" "see paper; ..., height 98 cm (<1st ), weight 21kg, BMI 21.87 (kg/m2), genu varum" "1y3m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288283" "02241" "00395083" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation; osteoporosis, cupping and fraying of femoral and tibial metaphyses" "" "3y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288284" "02241" "00395084" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation; cupping and fraying of ulnar, radial and metacarpal metaphyses" "" "2y5m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288285" "02241" "00395085" "00006" "Isolated (sporadic)" "" "severe bowing of legs; cupping and fraying of femoral and tibial metaphyses" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288286" "02241" "00395086" "00006" "Familial, X-linked dominant" "" "severe bowing of legs at deambulation; severe bowing of legs, cupping and fraying of femoral metaphyses, irregular widened epiphyseal plates" "" "20m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288287" "02241" "00395087" "00006" "Familial, X-linked dominant" "" "bowing of legs at deambulation; cupping and fraying of ulnar, femoral and tibial metaphyses" "" "12y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288288" "02241" "00395088" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation; cupping and fraying of femoral and tibial metaphyses, bowing of legs" "" "22m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288289" "02241" "00395089" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation; cupping and fraying of femoral and tibial metaphyses, bowing of legs" "" "4y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288290" "02241" "00395090" "00006" "Isolated (sporadic)" "" "severe bowing of legs at deambulation; osteoporosis" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288291" "02241" "00395091" "00006" "Familial, X-linked dominant" "" "mild bowing of legs at deambulation; bowing of legs, cupping and fraying of radial and ulnar metaphyses" "" "5y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288292" "02241" "00395092" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation, trigonocephaly; cupping and fraying of femoral and tibial metaphyses" "" "1y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288293" "02241" "00395093" "00006" "Isolated (sporadic)" "" "severe bowing of legs at deambulation, turricephaly, pectus carinatum, rachitic rosary, swelling of wrist, tibial recurvation; osteoporosis, bowing of legs, cupping and fraying of metaphyses with erosion of peroneal metaphyses" "" "1y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288294" "02241" "00395094" "00006" "Familial, X-linked dominant" "" "bowing of legs at deambulation" "" "4y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288295" "02241" "00395095" "00006" "Familial, X-linked dominant" "" "bowing of legs at deambulation" "" "1y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288296" "02241" "00395096" "00006" "Familial, X-linked dominant" "" "bowing of legs at deambulation; cupping and fraying of radial and ulnar metaphyses, diffuse demineralization, bowing of legs, transversal radio opaque bands (stress fractures) on femoral metaphysis" "" "9y10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288297" "02241" "00395097" "00006" "Isolated (sporadic)" "" "poor growing; bowing of legs, poor growing" "" "2y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288298" "02241" "00395098" "00006" "Isolated (sporadic)" "" "bowing of legs at deambulation; cupping and fraying of radial and ulnar metaphyses" "" "2y6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288299" "02241" "00395099" "00006" "Familial, X-linked dominant" "" "bowing of legs, short inferior limbs, poor growing; short stature, short inferior limbs, bowing of legs" "" "36y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288300" "02241" "00395100" "00006" "Familial, X-linked dominant" "" "mild bowing of legs; cupping and fraying of femoral, tibial and peroneal metaphyses" "" "10m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288301" "02241" "00395101" "00006" "Isolated (sporadic)" "" "bowing of legs; cupping and fraying of long bones metaphyses, bowing of legs, rachitic rosary" "" "3y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288302" "02241" "00395102" "00006" "Familial, X-linked dominant" "" "poor growing, bowing of legs; no radiological abnormalities" "" "6m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288303" "02241" "00395103" "00006" "Isolated (sporadic)" "" "bowing of legs, prominent thorax, swelling of wrist; cupping and fraying of ulnar and radial metaphyses" "" "2y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288304" "02241" "00395104" "00006" "Isolated (sporadic)" "" "swelling of wrist and ankle, delayed dentition; cupping and fraying of ulnar, radial and metacarpal metaphyses" "" "1y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288309" "02241" "00395109" "00006" "Familial, X-linked dominant" "10y" "see paper; ..., height 110 cm, weight 17 kg, growth retardation, dental hypoplasia, genu valgum (knock-knee)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288310" "02241" "00395110" "00006" "Familial, X-linked dominant" "9y" "see paper; ..., height 124 cm, weight 23 kg, growth retardation, dental hypoplasia, genu varum (bowlegs)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288311" "02241" "00395111" "00006" "Familial, X-linked dominant" "35y" "see paper; ..., height 135 cm, weight 45 kg, growth retardation, dental hypoplasia, genu valgum (knock-knee)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288312" "02241" "00395112" "00006" "Isolated (sporadic)" "8y" "see paper; ..., height 111 cm, weight 18 kg, growth retardation, genu valgum (knock-knee)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288313" "02241" "00395113" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288314" "02241" "00395114" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288315" "02241" "00395115" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288316" "02241" "00395116" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288317" "02241" "00395117" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288318" "02241" "00395118" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288319" "02241" "00395119" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288320" "02241" "00395120" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288321" "02241" "00395121" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288322" "02241" "00395122" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288323" "02241" "00395123" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288324" "02241" "00395124" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288325" "02241" "00395125" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288326" "02241" "00395126" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288327" "02241" "00395127" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288328" "02241" "00395128" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288329" "02241" "00395129" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288330" "02241" "00395130" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288333" "02241" "00395133" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288334" "02241" "00395134" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288335" "02241" "00395135" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288336" "02241" "00395136" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288337" "02241" "00395137" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288338" "02241" "00395138" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288601" "02241" "00395402" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288602" "02241" "00395403" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288603" "02241" "00395404" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288604" "02241" "00395405" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288605" "02241" "00395406" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288606" "02241" "00395407" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288607" "02241" "00395408" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288608" "02241" "00395409" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288609" "02241" "00395410" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288610" "02241" "00395411" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288611" "02241" "00395412" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288612" "02241" "00395413" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288613" "02241" "00395414" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288614" "02241" "00395415" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288615" "02241" "00395416" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288616" "02241" "00395417" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000288617" "02241" "00395418" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290122" "02241" "00396967" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290123" "02241" "00396968" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290124" "02241" "00396969" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290125" "02241" "00396970" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290126" "02241" "00396971" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290127" "02241" "00396972" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290128" "02241" "00396973" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290129" "02241" "00396974" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290130" "02241" "00396975" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290131" "02241" "00396976" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290132" "02241" "00396977" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290133" "02241" "00396978" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290134" "02241" "00396979" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290135" "02241" "00396980" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290137" "02241" "00396982" "00006" "Unknown" "13y6m" "see paper; ..., height 136.0cm (-2.6), weight 44.5kg (0.0): leg bowing, leg surgery: dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290138" "02241" "00396983" "00006" "Unknown" "7y6m" "see paper; ..., height 121.5cm (-0.2), weight 27.5kg (1.4): leg bowing: dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290139" "02241" "00396984" "00006" "Unknown" "5y" "see paper; ..., height 108.3cm (0.5), weight 22.0kg (3.7): leg bowing: dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290140" "02241" "00396985" "00006" "Unknown" "9y6m" "see paper; ..., height 127.5cm (-0.9), weight 39kg (3.7): leg bowing: no dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290141" "02241" "00396986" "00006" "Unknown" "16y" "leg bowing: dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290143" "02241" "00396988" "00006" "Unknown" "17y" "see paper; ..., height 152.5cm (-3.6), weight 55.0kg (0.3): leg bowing, leg surgery: dental abscesses" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290144" "02241" "00396989" "00006" "Familial, X-linked dominant" "31y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290145" "02241" "00396990" "00006" "Familial, X-linked dominant" "4y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290146" "02241" "00396991" "00006" "Familial, X-linked dominant" "7y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290147" "02241" "00396992" "00006" "Isolated (sporadic)" "2y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290148" "02241" "00396993" "00006" "Familial, X-linked dominant" "37y" "see paper; ..., bowed legs, short stature" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290149" "02241" "00396994" "00006" "Familial, X-linked dominant" "6y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290150" "02241" "00396995" "00006" "Familial, X-linked dominant" "50y" "see paper; ..., bowed legs, short stature" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290151" "02241" "00396996" "00006" "Familial, X-linked dominant" "11y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290155" "02241" "00397000" "00006" "Familial, X-linked dominant" "36y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290156" "02241" "00397001" "00006" "Familial, X-linked dominant" "12y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290157" "02241" "00397002" "00006" "Unknown" "13y" "see paper; ..., bone pain, bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290158" "02241" "00397003" "00006" "Isolated (sporadic)" "15y" "see paper; ..., bowed legs" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290161" "06886" "00397006" "00006" "Isolated (sporadic)" "03y11m" "see paper; ..., hypophosphataemic rickets, short stature, bilateral genu varum tibias" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000290162" "06886" "00397008" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000290163" "06886" "00397009" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290164" "06886" "00397010" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290165" "06886" "00397011" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290166" "06886" "00397012" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290167" "06886" "00397013" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290168" "06886" "00397014" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290169" "06886" "00397015" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290170" "06886" "00397016" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290171" "06886" "00397017" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290172" "06886" "00397018" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290173" "06886" "00397019" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290174" "06886" "00397020" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290175" "06886" "00397021" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290176" "06886" "00397022" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290177" "06886" "00397023" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290178" "06886" "00397024" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290179" "06886" "00397025" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290180" "06886" "00397026" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290181" "06886" "00397027" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290182" "06886" "00397028" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290183" "06886" "00397029" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290184" "06886" "00397030" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290185" "06886" "00397031" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290186" "06886" "00397032" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290187" "06886" "00397033" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290188" "06886" "00397034" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290189" "06886" "00397035" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290190" "06886" "00397036" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290191" "06886" "00397037" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290192" "06886" "00397038" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290193" "06886" "00397039" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290194" "06886" "00397040" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290195" "06886" "00397041" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290196" "06886" "00397042" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290197" "06886" "00397043" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290198" "06886" "00397044" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290294" "06886" "00397140" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290295" "06886" "00397141" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290296" "06886" "00397142" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290297" "06886" "00397143" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290298" "06886" "00397144" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290299" "06886" "00397145" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290300" "06886" "00397146" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290301" "06886" "00397147" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290302" "06886" "00397148" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290303" "06886" "00397149" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290304" "06886" "00397150" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290305" "06886" "00397151" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290306" "06886" "00397152" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290307" "06886" "00397153" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290308" "06886" "00397154" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290309" "06886" "00397155" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290310" "06886" "00397156" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290311" "06886" "00397157" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290312" "06886" "00397158" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290313" "06886" "00397159" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290314" "06886" "00397160" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290315" "06886" "00397161" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290316" "06886" "00397162" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290317" "06886" "00397163" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290318" "06886" "00397164" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290319" "06886" "00397165" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290320" "06886" "00397166" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290321" "06886" "00397167" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290322" "06886" "00397168" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290324" "06886" "00397170" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290325" "06886" "00397171" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290326" "06886" "00397172" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290327" "06886" "00397173" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290328" "06886" "00397174" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290329" "06886" "00397175" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290330" "06886" "00397176" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290331" "06886" "00397177" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290332" "06886" "00397178" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290333" "06886" "00397179" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290334" "06886" "00397180" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290335" "06886" "00397181" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290336" "06886" "00397182" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290337" "06886" "00397183" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290338" "06886" "00397184" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290339" "06886" "00397185" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290340" "06886" "00397186" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290341" "06886" "00397187" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290342" "06886" "00397188" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290343" "06886" "00397189" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290344" "06886" "00397190" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290345" "06886" "00397191" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290346" "06886" "00397192" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290347" "06886" "00397193" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290348" "06886" "00397194" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290349" "06886" "00397195" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290350" "06886" "00397196" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290351" "06886" "00397197" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290352" "06886" "00397198" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290353" "06886" "00397199" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290354" "06886" "00397200" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290355" "06886" "00397201" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290356" "06886" "00397202" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290357" "06886" "00397203" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290358" "06886" "00397204" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290359" "06886" "00397205" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290360" "06886" "00397206" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290361" "06886" "00397207" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290362" "06886" "00397208" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290363" "06886" "00397209" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290364" "06886" "00397210" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290365" "06886" "00397211" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290366" "06886" "00397212" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290367" "06886" "00397213" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290368" "06886" "00397214" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290369" "06886" "00397215" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290370" "06886" "00397216" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290371" "06886" "00397217" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290372" "06886" "00397218" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290373" "06886" "00397219" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290374" "06886" "00397220" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290375" "06886" "00397221" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290376" "06886" "00397222" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290377" "06886" "00397223" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290378" "06886" "00397224" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290379" "06886" "00397225" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290380" "06886" "00397226" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290381" "06886" "00397227" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290382" "06886" "00397228" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290383" "06886" "00397229" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290384" "06886" "00397230" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290385" "06886" "00397231" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290386" "06886" "00397232" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290387" "06886" "00397233" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290388" "06886" "00397234" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290389" "06886" "00397235" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290390" "06886" "00397236" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290391" "06886" "00397237" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290392" "06886" "00397238" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290393" "06886" "00397239" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290394" "06886" "00397240" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290395" "06886" "00397241" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290396" "06886" "00397242" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290397" "06886" "00397243" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290398" "06886" "00397244" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290399" "06886" "00397245" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290400" "06886" "00397246" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290401" "06886" "00397247" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290402" "06886" "00397248" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290403" "06886" "00397249" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290404" "06886" "00397250" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290405" "06886" "00397251" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290406" "06886" "00397252" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290407" "06886" "00397253" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290408" "06886" "00397254" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290409" "06886" "00397255" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290410" "06886" "00397256" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290411" "06886" "00397257" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290412" "06886" "00397258" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290413" "06886" "00397259" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290414" "06886" "00397260" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290415" "06886" "00397261" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290416" "06886" "00397262" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290417" "06886" "00397263" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290418" "06886" "00397264" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290419" "06886" "00397265" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290420" "06886" "00397266" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290421" "06886" "00397267" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290422" "06886" "00397268" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290423" "06886" "00397269" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290424" "06886" "00397270" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290425" "06886" "00397271" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290426" "06886" "00397272" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290427" "06886" "00397273" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290428" "06886" "00397274" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290429" "06886" "00397275" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290430" "06886" "00397276" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290431" "06886" "00397277" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290432" "06886" "00397278" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290433" "06886" "00397280" "00006" "Familial, X-linked dominant" "9y7m" "bowing lower limbs, short stature; no ear problems; no dental problems" "" "2y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290434" "06886" "00397281" "00006" "Familial, X-linked dominant" "13y4m" "bowing lower limbs, short stature limbs, short stature, lumbar hyperlordosis; no ear problems; no dental problems" "" "7y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290435" "06886" "00397282" "00006" "Unknown" "8y" "bowing lower limbs, short stature, frontal bossing, widening distal parts forearms; no ear problems; gingivitis" "" "2y3m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290436" "06886" "00397283" "00006" "Unknown" "9y6m" "bowing lower limbs, short stature; no ear problems; gingivitis; transient hypogammaglobulinemia, increased muscle tension" "" "2y8m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290437" "06886" "00397284" "00006" "Unknown" "7y" "bowing lower limbs, short stature, deformation chest, widening distal parts forearms; no ear problems; no dental problems; suspected immunodeficiency, left cryptorchidism" "" "1y1m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290438" "06886" "00397285" "00006" "Familial, X-linked dominant" "18y3m" "bowing lower limbs, genu varum, lumbar hyperlordosis; no ear problems; no dental problems; chronic rhinitis, obesity, low level cholesterol and triglycerides (as father)" "" "11m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290439" "06886" "00397286" "00006" "Familial, X-linked dominant" "16y11m" "genu valgus, lumbar hyperlordosis; no ear problems; no dental problems; low level cholesterol and triglycerides (as father)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290440" "06886" "00397287" "00006" "Familial, X-linked dominant" "11y9m" "bowing lower limbs, lumbar hyperlordosis, asymmetry skull bones; no ear problems; no dental problems" "" "8y2m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290441" "06886" "00397288" "00006" "Familial, X-linked dominant" "10y7m" "bowing lower limbs; no ear problems; advanced caries" "" "8y4m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290442" "06886" "00397289" "00006" "Unknown" "5y8m" "bowing limbs, widening distal parts forearms; no ear problems; advanced caries" "" "2y7m" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290443" "06886" "00397290" "00006" "Familial, X-linked dominant" "17y4m" "bowing limbs; no ear problems; no dental problems" "" "9y" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290444" "06886" "00397291" "00006" "Unknown" "8y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290445" "06886" "00397292" "00006" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290446" "06886" "00397293" "00006" "Unknown" "14y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290447" "06886" "00397294" "00006" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290448" "06886" "00397295" "00006" "Unknown" "12y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290449" "06886" "00397296" "00006" "Unknown" "11y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290450" "06886" "00397297" "00006" "Unknown" "12y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290451" "06886" "00397298" "00006" "Unknown" "16y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290452" "06886" "00397299" "00006" "Unknown" "7y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290453" "06886" "00397300" "00006" "Unknown" "13y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290454" "06886" "00397301" "00006" "Unknown" "16y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290455" "06886" "00397302" "00006" "Unknown" "5y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290456" "06886" "00397303" "00006" "Unknown" "13y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290457" "06886" "00397304" "00006" "Unknown" "6y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290458" "06886" "00397305" "00006" "Unknown" "17y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290459" "06886" "00397306" "00006" "Unknown" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290460" "06886" "00397307" "00006" "Unknown" "8y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290461" "06886" "00397308" "00006" "Unknown" "13y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290462" "06886" "00397309" "00006" "Unknown" "12y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290463" "06886" "00397310" "00006" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290464" "06886" "00397311" "00006" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290465" "06886" "00397312" "00006" "Unknown" "17y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290466" "06886" "00397313" "00006" "Unknown" "5y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290467" "06886" "00397314" "00006" "Unknown" "1y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290468" "06886" "00397315" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290469" "06886" "00397316" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290471" "06886" "00397318" "00006" "Familial, X-linked dominant" "48y" "see paper; ..., short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290472" "06886" "00397319" "00006" "Familial, X-linked dominant" "21y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290473" "06886" "00397320" "00006" "Familial, X-linked dominant" "79y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290474" "06886" "00397321" "00006" "Familial, X-linked dominant" "58y" "see paper; ..., genu varum, short stature, teeth falling out" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290475" "06886" "00397322" "00006" "Familial, X-linked dominant" "56y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290476" "06886" "00397323" "00006" "Familial, X-linked dominant" "30y" "see paper; ..., genu varum, short stature, teeth falling out" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290477" "06886" "00397324" "00006" "Familial, X-linked dominant" "73y" "see paper; ..., short stature, teeth falling out" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290478" "06886" "00397325" "00006" "Familial, X-linked dominant" "47y" "see paper; ..., short stature, teeth falling out" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290479" "06886" "00397326" "00006" "Familial, X-linked dominant" "62y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290480" "06886" "00397327" "00006" "Familial, X-linked dominant" "31y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290481" "06886" "00397328" "00006" "Familial, X-linked dominant" "52y" "see paper; ..., short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290482" "06886" "00397329" "00006" "Familial, X-linked dominant" "28y" "see paper; ..., short stature, hard to walk" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290483" "06886" "00397330" "00006" "Familial, X-linked dominant" "48y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290484" "06886" "00397331" "00006" "Familial, X-linked dominant" "21y" "see paper; ..., genu varum, short stature, bone pain" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290485" "06886" "00397332" "00006" "Familial, X-linked dominant" "33y" "see paper; ..., genu varum, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290486" "06886" "00397333" "00006" "Familial, X-linked dominant" "9y" "see paper; ..., genu varum, short stature, groth retardation" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290488" "06886" "00397349" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290489" "06886" "00397350" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290490" "06886" "00397351" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290491" "06886" "00397352" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290492" "06886" "00397353" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290519" "06886" "00397380" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290520" "06886" "00397381" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290521" "06886" "00397382" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290522" "06886" "00397383" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290523" "06886" "00397384" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290524" "06886" "00397385" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290525" "06886" "00397386" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290526" "06886" "00397387" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290527" "06886" "00397388" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290528" "06886" "00397389" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290582" "06886" "00397448" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290583" "06886" "00397449" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290584" "06886" "00397450" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290585" "06886" "00397451" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290586" "06886" "00397452" "00006" "Familial, X-linked dominant" "" "see paper; ..., leg bowing, hyperlordosis, no dental abnormalities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290587" "06886" "00397453" "00006" "Familial, X-linked dominant" "" "see paper; ..., leg bowing, no dental abnormalities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290588" "06886" "00397454" "00006" "Familial, X-linked dominant" "" "see paper; ..., leg bowing, no dental abnormalities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290589" "06886" "00397455" "00006" "Familial, X-linked dominant" "" "see paper; ..., leg bowing, scaphocephaly, dental abscesses" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290590" "06886" "00397456" "00006" "Familial, X-linked dominant" "13y" "see paper; ..., leg bowing, dental abscesses" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290591" "06886" "00397458" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290592" "06886" "00397459" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290593" "06886" "00397460" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290594" "06886" "00397461" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290595" "06886" "00397462" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290596" "06886" "00397463" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290597" "06886" "00397464" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290601" "06886" "00397468" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290602" "06886" "00397469" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "" "hypophosphatemic rickets" "" "0000290625" "06886" "00397493" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290626" "06886" "00397494" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290627" "06886" "00397495" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290628" "06886" "00397496" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290629" "06886" "00397497" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290630" "06886" "00397498" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290631" "06886" "00397499" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290632" "06886" "00397500" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290635" "05086" "00397513" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290636" "05086" "00397514" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290637" "05086" "00397515" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290638" "05086" "00397516" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290640" "06886" "00397518" "00006" "Unknown" "29y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290641" "06886" "00397519" "00006" "Familial, X-linked dominant" "" "see paper; ..., craniosynostosis, scaphocephaly secondary to isolated sagittal synostosis" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290642" "06886" "00397520" "00006" "Unknown" "00y06m" "see paper; ..., 1d-frontal bossing; 3m-sagittal ridging ; 6m-protruding left occiput (or occipital “bullet deformity”)" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290643" "06886" "00397521" "00006" "Unknown" "71y" "see paper; ..., diffuse bone pain both wrists, shoulders, spine; limb deformities, genu varum left leg, genu valgum right leg, short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290644" "06886" "00397522" "00006" "Unknown" "36y" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290645" "06886" "00397523" "00006" "Familial, X-linked dominant" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290691" "06886" "00397569" "00006" "Familial, X-linked" "" "see paper; ..., growth retardation, hypophosphatemia, decreased bone mineral density" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290693" "06886" "00397570" "00006" "Unknown" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290694" "06886" "00397571" "00006" "Unknown" "50y" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290695" "06886" "00397572" "00006" "Unknown" "4y6m" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290696" "06886" "00397573" "00006" "Familial, X-linked dominant" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290718" "06887" "00397594" "00006" "Isolated (sporadic)" "1y4m" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290719" "06887" "00397595" "00006" "Isolated (sporadic)" "6y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290720" "06887" "00397596" "00006" "Isolated (sporadic)" "2y6m" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290721" "06887" "00397597" "00006" "Familial, X-linked" "1y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290722" "06887" "00397598" "00006" "Isolated (sporadic)" "10m" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290723" "06887" "00397599" "00006" "Familial, X-linked" "1y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290724" "06887" "00397600" "00006" "Familial, X-linked" "5y7m" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290725" "06887" "00397601" "00006" "Isolated (sporadic)" "1y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290726" "06887" "00397602" "00006" "Isolated (sporadic)" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000290727" "06887" "00397603" "00006" "Isolated (sporadic)" "7y" "see paper; ..." "" "" "" "" "" "" "" "" "" "EDM1" "multiple epiphyseal dysplasia" "" "0000292207" "06886" "00399119" "00006" "Familial, X-linked recessive" "04y" "see paper; ..., hypophosphataemic rickets, abscess right primary maxillary incisor with severe mobility tooth" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000292208" "06886" "00399120" "00006" "Isolated (sporadic)" "02y" "see paper; ..., inability to walk, frontal bossing, widened epiphysis at wrist, rickety rosary, bowed legs; growth retardation (77 cm SD–2.82)" "" "" "inability to walk" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000292209" "06886" "00399121" "00006" "Unknown" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000292210" "06886" "00399122" "00006" "Unknown" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000292211" "06886" "00399123" "00006" "Unknown" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294300" "06886" "00401281" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294301" "06886" "00401282" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294302" "06886" "00401283" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294303" "06886" "00401284" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294304" "06886" "00401285" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294305" "06886" "00401286" "00006" "Isolated (sporadic)" "" "see paper; ..." "02y08m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294306" "06886" "00401287" "00006" "Familial, X-linked dominant" "" "see paper; ..." "18y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294319" "06886" "00401527" "00006" "Familial, X-linked dominant" "19y" "see paper; ..., height 150cm, BMI 39.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294320" "06886" "00401528" "00006" "Familial, X-linked dominant" "20y" "see paper; ..., height 166cm, BMI 26.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294321" "06886" "00401529" "00006" "Familial, X-linked dominant" "45y" "see paper; ..., height 144cm, BMI 30.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294322" "06886" "00401530" "00006" "Familial, X-linked dominant" "19y" "see paper; ..., height 142cm, BMI 21.7 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294323" "06886" "00401531" "00006" "Familial, X-linked dominant" "50y" "see paper; ..., height 170cm, BMI 29.7 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294324" "06886" "00401532" "00006" "Familial, X-linked dominant" "19y" "see paper; ..., height 162cm, BMI 29.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294325" "06886" "00401533" "00006" "Familial, X-linked dominant" "46y" "see paper; ..., height 149cm, BMI 28.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294326" "06886" "00401534" "00006" "Familial, X-linked dominant" "34y" "see paper; ..., height 152cm, BMI 24.5 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294327" "06886" "00401535" "00006" "Familial, X-linked dominant" "51y" "see paper; ..., height 158cm, BMI 24kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294328" "06886" "00401536" "00006" "Familial, X-linked dominant" "62y" "see paper; ..., height 151cm, BMI 27.6 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294329" "06886" "00401537" "00006" "Familial, X-linked dominant" "27y" "see paper; ..., height 159cm, BMI 23.4 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294330" "06886" "00401538" "00006" "Familial, X-linked dominant" "20y" "see paper; ..., height 161cm, BMI 22kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294331" "06886" "00401539" "00006" "Familial, X-linked dominant" "23y" "see paper; ..., height 159cm, BMI 21.8 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294332" "06886" "00401540" "00006" "Familial, X-linked dominant" "20y" "see paper; ..., height 160cm, BMI 30.2 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294333" "06886" "00401541" "00006" "Familial, X-linked dominant" "21y" "see paper; ..., height 163cm, BMI 29kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294334" "06886" "00401542" "00006" "Familial, X-linked dominant" "46y" "see paper; ..., height 143cm, BMI 35.6 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294335" "06886" "00401543" "00006" "Familial, X-linked dominant" "23y" "see paper; ..., height 147cm, BMI 26kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294336" "06886" "00401544" "00006" "Familial, X-linked dominant" "20y" "see paper; ..., height 175cm, BMI 25.7 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294337" "06886" "00401545" "00006" "Familial, X-linked dominant" "43y" "see paper; ..., height 142cm, BMI 32.7 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294338" "06886" "00401546" "00006" "Familial, X-linked dominant" "18y" "see paper; ..., height 139cm, BMI 28.7 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294339" "06886" "00401547" "00006" "Familial, X-linked dominant" "36y" "see paper; ..., height 153cm, BMI 21.9 kg/m" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294342" "06886" "00401550" "00006" "Familial, X-linked dominant" "36y" "see paper; ..., height 159cm, BMI 35.2 kg/m; hypoparathyroid post-total parathyroidectomy" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294343" "06886" "00401551" "00006" "Familial, X-linked dominant" "37y" "see paper; ..., height 155cm, BMI 26.2 kg/m; hypoparathyroid post-total parathyroidectomy" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294347" "06886" "00401556" "00006" "Unknown" "14y" "see paper; ..." "00y07m" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemic rickets" "" "0000294348" "06886" "00401557" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294349" "06886" "00401558" "00006" "Familial, X-linked dominant" "36y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294350" "06886" "00401559" "00006" "Familial, X-linked dominant" "51y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294351" "06886" "00401560" "00006" "Familial, X-linked dominant" "45y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294352" "06886" "00401561" "00006" "Familial, X-linked dominant" "55y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294353" "06886" "00401562" "00006" "Familial, X-linked dominant" "64y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294354" "06886" "00401563" "00006" "Familial, X-linked dominant" "40y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294355" "00470" "00401564" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets, autism" "" "0000294356" "06886" "00401565" "00006" "Isolated (sporadic)" "02y02m" "see paper; ..., prominent lower limb rachitic deformity, waddling gait, disproportionate short stature" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294426" "06886" "00401655" "00006" "Familial, X-linked dominant" "53y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294427" "06886" "00401656" "00006" "Familial, X-linked dominant" "39y" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294428" "06886" "00401657" "00006" "Familial, X-linked dominant" "09y" "see paper; ..., bone deformities inferior extremities, prominent joints, loss of teeth" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294429" "06886" "00401658" "00006" "Familial, X-linked dominant" "43y" "see paper; ..., hypophosphatemic osteomalacia , raised serum FGF23, widespread psoriasis in association with 12m history pain and stiffness affecting lumbar back, hips feet, swelling metacarpophalangeal joints" "42y" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic osteomalacia" "" "0000294430" "06886" "00401659" "00006" "Familial, autosomal dominant" "00y18m" "see paper; ..., bilateral coronal and sagittal synostosis" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294431" "00198" "00401660" "00006" "Unknown" "" "see paper; ...bilateral ectopia lentis, atrial septal defect, ventricular septal defect, widening tibial metaphysis with medial bowing, dolichostenomelia in digits" "" "" "" "" "" "" "" "" "" "XLHR;MFS" "" "" "0000294432" "06886" "00401661" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294433" "06886" "00401662" "00006" "Familial, X-linked dominant" "43y" "see paper; ..., 43y-wheelchair-bound, short stature, grossly deformed bones limbs and vertebrae, achieved all milestones on time in childhood" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294434" "06886" "00401663" "00006" "Familial, X-linked dominant" "04y" "see paper; ..., hypophosphataemic rickets, bilateral proptosis, prominent bilateral widening optic nerve sheaths" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphatemic rickets" "" "0000294435" "06886" "00401664" "00006" "Familial, X-linked dominant" "" "see paper; ... cases in general with milder phenotype" "" "" "" "" "" "" "" "" "" "XLHR" "mild hypophosphataemic rickets" "" "0000294449" "06886" "00401686" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294450" "06886" "00401687" "00006" "Familial, X-linked dominant" "" "Fractures/Pseudo-Fractures, Gait Abnormalities, Lower Limb Deformities, Tooth Abscesses and/or Excessive Dental Caries" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294451" "06886" "00401688" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294452" "06886" "00401689" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294453" "06886" "00401690" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294454" "06886" "00401691" "00006" "Familial, X-linked dominant" "" "Gait abnormalities, Tooth abscesses and/or excessive dental caries, Reduced_Serum_Phosphate" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294455" "06886" "00401692" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294456" "06886" "00401693" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294457" "06886" "00401694" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294458" "06886" "00401695" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294459" "06886" "00401696" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294460" "06886" "00401697" "00006" "Familial, X-linked dominant" "" "Fractures/Pseudo-Fractures, Gait Abnormalities, Lower Limb Deformities, Tooth Abscesses and/or Excessive Dental Caries" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294461" "06886" "00401698" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294462" "06886" "00401699" "00006" "Familial, X-linked dominant" "" "Lower limb deformities, Reduced_Serum_Phosphate" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294463" "06886" "00401700" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294464" "06886" "00401701" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294465" "06886" "00401702" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294466" "06886" "00401703" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294467" "06886" "00401704" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294468" "06886" "00401705" "00006" "Familial, X-linked dominant" "" "Lower limb deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294469" "06886" "00401706" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294470" "06886" "00401707" "00006" "Familial, X-linked dominant" "" "Fractures/Pseudo-Fractures, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294471" "06886" "00401708" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294472" "06886" "00401709" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294473" "06886" "00401710" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294474" "06886" "00401711" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294475" "06886" "00401712" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294476" "06886" "00401713" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294477" "06886" "00401714" "00006" "Familial, X-linked dominant" "" "Tooth Abscesses and/or Excessive Dental Caries, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294478" "06886" "00401715" "00006" "Familial, X-linked dominant" "" "Gait Abnormalities, Tooth Abscesses and/or Excessive Dental Caries, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294479" "06886" "00401716" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294480" "06886" "00401717" "00006" "Familial, X-linked dominant" "" "Gait abnormalities, Lower limb deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294481" "06886" "00401718" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294482" "06886" "00401719" "00006" "Familial, X-linked dominant" "" "Lower limb deformities, Reduced_Serum_Phosphate" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294483" "06886" "00401720" "00006" "Familial, X-linked dominant" "" "Reduced_Serum_Phosphate, Gait abnormalities, Lower limb deformities, Fractures/pseudo-fractures, Tooth abscesses and/or excessive dental caries" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294484" "06886" "00401721" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294485" "06886" "00401722" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294486" "06886" "00401723" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294487" "06886" "00401724" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294488" "06886" "00401725" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294489" "06886" "00401726" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294490" "06886" "00401727" "00006" "Familial, X-linked dominant" "" "Tooth Abscesses and/or Excessive Dental Caries, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294491" "06886" "00401728" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294492" "06886" "00401729" "00006" "Familial, X-linked dominant" "" "Gait abnormalities, Lower limb deformities, Reduced_Serum_Phosphate" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294493" "06886" "00401730" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294494" "06886" "00401731" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294495" "06886" "00401732" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294496" "06886" "00401733" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294497" "06886" "00401734" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294498" "06886" "00401735" "00006" "Familial, X-linked dominant" "" "Tooth Abscesses and/or Excessive Dental Caries, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294499" "06886" "00401736" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294500" "06886" "00401737" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294501" "06886" "00401738" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294502" "06886" "00401739" "00006" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294503" "06886" "00401740" "00006" "Familial, X-linked dominant" "" "Gait Abnormalities, Fractures/Pseudo-Fractures, Lower Limb Deformities" "" "" "" "" "" "" "" "" "" "XLHR" "hypophosphataemia" "" "0000294504" "06886" "00401741" "00006" "Familial, X-linked dominant" "" "Reduced_TmP/GFR_(G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.22226404C>G" "" "VUS" "" "0000254733" "0" "30" "X" "22151682" "22151682" "subst" "0" "01943" "PHEX_000018" "g.22151682A>G" "" "" "" "PHEX(NM_000444.5):c.1345A>G (p.M449V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22133565A>G" "" "likely benign" "" "0000255341" "0" "30" "X" "22112220" "22112220" "subst" "0.000718831" "01943" "PHEX_000007" "g.22112220A>G" "" "" "" "PHEX(NM_000444.4):c.849+3A>G (p.?), PHEX(NM_000444.5):c.849+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22094102A>G" "" "likely benign" "" "0000296937" "0" "90" "X" "22151650" "22151650" "subst" "0" "02325" "PHEX_000009" "g.22151650T>C" "" "" "" "PHEX(NM_000444.6):c.1313T>C (p.L438S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22133533T>C" "" "pathogenic" "" "0000300733" "0" "10" "X" "22244539" "22244540" "del" "0" "02326" "PHEX_000015" "g.22244539_22244540del" "" "" "" "PHEX(NM_000444.6):c.1900-21_1900-20delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22226422_22226423del" "" "benign" "" "0000300734" "0" "90" "X" "22266057" "22266057" "subst" "0" "02326" "PHEX_000017" "g.22266057G>A" "" "" "" "PHEX(NM_000444.6):c.2237G>A (p.C746Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22247940G>A" "" "pathogenic" "" "0000305522" "0" "30" "X" "22117222" "22117222" "subst" "0.0000111954" "01943" "PHEX_000008" "g.22117222G>A" "" "" "" "PHEX(NM_000444.5):c.1032G>A (p.P344=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22099104G>A" "" "likely benign" "" "0000305523" "0" "30" "X" "22196383" "22196383" "subst" "0.000179604" "01943" "PHEX_000011" "g.22196383T>C" "" "" "" "PHEX(NM_000444.5):c.1483-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22178266T>C" "" "likely benign" "" "0000305524" "0" "30" "X" "22231011" "22231011" "subst" "0.0000504363" "01943" "PHEX_000012" "g.22231011C>T" "" "" "" "PHEX(NM_000444.5):c.1646-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22212894C>T" "" "likely benign" "" "0000305525" "0" "90" "X" "22231074" "22231074" "subst" "0" "01943" "PHEX_000013" "g.22231074C>T" "" "" "" "PHEX(NM_000444.5):c.1699C>T (p.R567*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000305526" "0" "30" "X" "22266052" "22266052" "subst" "0" "01943" "PHEX_000016" "g.22266052C>A" "" "" "" "PHEX(NM_000444.5):c.2232C>A (p.D744E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22247935C>A" "" "likely benign" "" "0000305527" "0" "30" "X" "22051182" "22051182" "subst" "0.00000560648" "01943" "PHEX_000005" "g.22051182G>A" "" "" "" "PHEX(NM_000444.5):c.59G>A (p.R20Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22033064G>A" "" "likely benign" "" "0000333418" "0" "90" "X" "22051133" "22051133" "subst" "0.00072759" "01804" "PHEX_000004" "g.22051133G>C" "" "" "" "PHEX(NM_000444.4):c.10G>C (p.(Glu4Gln)), PHEX(NM_000444.5):c.10G>C (p.E4Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.22033015G>C" "" "pathogenic" "" "0000398574" "0" "79" "X" "22129662" "22129662" "subst" "0" "02208" "PHEX_000019" "g.22129662G>A" "" "{PMID:Quinlan 2012:22101457}" "" "Trp386X" "" "Germline" "" "" "0" "" "" "g.22111544G>A" "" "pathogenic (dominant)" "" "0000398575" "0" "90" "X" "22129662" "22129662" "subst" "0" "02208" "PHEX_000019" "g.22129662G>A" "" "{PMID:Quinlan 2012:22101457}" "" "Trp386X" "" "Germline" "" "" "0" "" "" "g.22111544G>A" "" "pathogenic (dominant)" "" "0000398576" "0" "90" "X" "22265966" "22265966" "subst" "0" "02208" "PHEX_000034" "g.22265966A>G" "" "{PMID:Quinlan 2012:22101457}" "" "" "" "Germline" "" "" "0" "" "" "g.22247849A>G" "" "pathogenic (dominant)" "" "0000398577" "0" "90" "X" "22244618" "22244618" "subst" "0" "02208" "PHEX_000032" "g.22244618C>A" "" "{PMID:Quinlan 2012:22101457}" "" "Ala653Asp" "" "Germline" "" "" "0" "" "" "g.22226501C>A" "" "pathogenic (dominant)" "" "0000398578" "0" "90" "X" "22219820" "22234114" "del" "0" "02208" "PHEX_000020" "g.(22208620_22231020)_(22231076_22237152)del" "" "{PMID:Quinlan 2012:22101457}" "" "1646-1.1kb_1700+300 del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000398579" "0" "90" "X" "22117223" "22117223" "subst" "0" "02208" "PHEX_000023" "g.22117223C>T" "" "{PMID:Quinlan 2012:22101457}" "" "Gln345X" "" "Germline" "" "" "0" "" "" "g.22099105C>T" "" "pathogenic (dominant)" "" "0000398580" "0" "90" "X" "22142172" "22169085" "del" "0" "02208" "PHEX_000002" "g.(22132705_22151639)_(22151742_22186428)del" "" "{PMID:Quinlan 2012:22101457}" "" "del ex12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000398581" "0" "90" "X" "22142172" "22169085" "del" "0" "02208" "PHEX_000002" "g.(22132705_22151639)_(22151742_22186428)del" "" "{PMID:Quinlan 2012:22101457}" "" "del ex12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000398582" "0" "90" "X" "22151705" "22151705" "subst" "0" "02208" "PHEX_000025" "g.22151705G>Y" "" "{PMID:Quinlan 2012:22101457}" "" "Trp456Cys" "" "Germline" "" "" "0" "" "" "g.22133588G>Y" "" "pathogenic (dominant)" "" "0000398583" "0" "90" "X" "22231074" "22231074" "subst" "0" "02208" "PHEX_000013" "g.22231074C>T" "" "{PMID:Quinlan 2012:22101457}" "" "Arg567X" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000398584" "0" "90" "X" "22151705" "22151705" "subst" "0" "02208" "PHEX_000025" "g.22151705G>Y" "" "{PMID:Quinlan 2012:22101457}" "" "Trp546Cys" "" "Germline" "" "" "0" "" "" "g.22133588G>Y" "" "pathogenic (dominant)" "" "0000398585" "0" "90" "X" "22151705" "22151705" "subst" "0" "02208" "PHEX_000025" "g.22151705G>Y" "" "{PMID:Quinlan 2012:22101457}" "" "Trp546Cys" "" "Germline" "" "" "0" "" "" "g.22133588G>Y" "" "pathogenic (dominant)" "" "0000398586" "0" "90" "X" "22237191" "22237191" "subst" "0" "02208" "PHEX_000029" "g.22237191A>C" "" "{PMID:Quinlan 2012:22101457}" "" "His580Pro" "" "Germline" "" "" "0" "" "" "g.22219074A>C" "" "pathogenic (dominant)" "" "0000398587" "0" "90" "X" "22245724" "22245724" "subst" "0" "02208" "PHEX_000033" "g.22245724C>A" "" "{PMID:Quinlan 2012:22101457}" "" "Ala689Asp" "" "Germline" "" "" "0" "" "" "g.22227607C>A" "" "pathogenic (dominant)" "" "0000398588" "0" "90" "X" "22239822" "22239822" "subst" "0" "02208" "PHEX_000031" "g.22239822C>T" "" "{PMID:Quinlan 2012:22101457}" "" "Gn621X" "" "Germline" "" "" "0" "" "" "g.22221705C>T" "" "pathogenic (dominant)" "" "0000398589" "0" "90" "X" "22208620" "22208620" "subst" "0" "02208" "PHEX_000028" "g.22208620G>A" "" "{PMID:Quinlan 2012:22101457}" "" "" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000398590" "0" "90" "X" "22129679" "22129679" "subst" "0" "02208" "PHEX_000024" "g.22129679G>T" "" "{PMID:Quinlan 2012:22101457}" "" "" "" "Germline" "" "" "0" "" "" "g.22111561G>T" "" "pathogenic (dominant)" "" "0000398591" "0" "90" "X" "22115073" "22115073" "del" "0" "02208" "PHEX_000022" "g.22115073del" "" "{PMID:Quinlan 2012:22101457}" "" "850delA" "" "Germline" "" "" "0" "" "" "g.22096955del" "" "pathogenic (dominant)" "" "0000398592" "0" "90" "X" "22094505" "22094505" "subst" "0" "02208" "PHEX_000021" "g.22094505G>T" "" "{PMID:Quinlan 2012:22101457}" "" "" "" "Germline" "" "" "0" "" "" "g.22076387G>T" "" "pathogenic (dominant)" "" "0000398593" "0" "90" "X" "22239791" "22239791" "del" "0" "02208" "PHEX_000030" "g.22239791del" "" "{PMID:Quinlan 2012:22101457}" "" "1830delG" "" "Germline" "" "" "0" "" "" "g.22221674del" "" "pathogenic (dominant)" "" "0000398594" "0" "90" "X" "22208575" "22208575" "subst" "0" "02208" "PHEX_000027" "g.22208575C>T" "" "{PMID:Quinlan 2012:22101457}" "" "Pro534Leu" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic (dominant)" "" "0000398595" "0" "90" "X" "22208575" "22208575" "subst" "0" "02208" "PHEX_000027" "g.22208575C>T" "" "{PMID:Quinlan 2012:22101457}" "" "Pro534Leu" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic (dominant)" "" "0000398596" "0" "90" "X" "22196442" "22196442" "subst" "0" "02208" "PHEX_000026" "g.22237187G>M" "" "{PMID:Quinlan 2012:22101457}" "" "Gly579Arg" "" "Germline" "" "" "0" "" "" "g.22219070G>M" "" "pathogenic (dominant)" "" "0000459054" "1" "90" "X" "22132611" "22132611" "subst" "0" "03213" "PHEX_000035" "g.22132611G>A" "" "{PMID:Li 2019:30920082}" "MfeI+" "" "" "Germline" "yes" "rs886039584" "0" "" "" "g.22114493G>A" "" "pathogenic (dominant)" "" "0000575288" "0" "30" "X" "22051248" "22051248" "subst" "0.00466702" "01804" "PHEX_000036" "g.22051248G>T" "" "" "" "PHEX(NM_000444.4):c.118+7G>T (p.(=)), PHEX(NM_000444.6):c.118+7G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22033130G>T" "" "likely benign" "" "0000575290" "0" "90" "X" "22094598" "22094598" "subst" "0" "02325" "PHEX_000038" "g.22094598T>C" "" "" "" "PHEX(NM_000444.6):c.436+6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22076480T>C" "" "pathogenic" "" "0000575292" "0" "50" "X" "22095653" "22095653" "subst" "0.00000560174" "01943" "PHEX_000040" "g.22095653C>T" "" "" "" "PHEX(NM_000444.5):c.496C>T (p.R166C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22077535C>T" "" "VUS" "" "0000575293" "0" "30" "X" "22112220" "22112220" "subst" "0.000718831" "01804" "PHEX_000007" "g.22112220A>G" "" "" "" "PHEX(NM_000444.4):c.849+3A>G (p.?), PHEX(NM_000444.5):c.849+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22094102A>G" "" "likely benign" "" "0000575294" "0" "70" "X" "22196496" "22196496" "subst" "0" "02327" "PHEX_000041" "g.22196496G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22178379G>C" "" "likely pathogenic" "" "0000575295" "0" "30" "X" "22208579" "22208579" "subst" "0" "01943" "PHEX_000042" "g.22208579G>A" "" "" "" "PHEX(NM_000444.5):c.1605G>A (p.T535=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22190462G>A" "" "likely benign" "" "0000575296" "0" "90" "X" "22231018" "22231018" "subst" "0" "02325" "PHEX_000043" "g.22231018T>G" "" "" "" "PHEX(NM_000444.6):c.1646-3T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22212901T>G" "" "pathogenic" "" "0000575297" "0" "90" "X" "22231074" "22231074" "subst" "0" "02327" "PHEX_000013" "g.22231074C>T" "" "" "" "PHEX(NM_000444.5):c.1699C>T (p.R567*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22212957C>T" "" "pathogenic" "" "0000575298" "0" "90" "X" "22239728" "22239728" "subst" "0" "02325" "PHEX_000044" "g.22239728A>T" "" "" "" "PHEX(NM_000444.6):c.1769-2A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22221611A>T" "" "pathogenic" "" "0000575299" "0" "10" "X" "22244438" "22244441" "dup" "0" "02326" "PHEX_000045" "g.22244438_22244441dup" "" "" "" "PHEX(NM_000444.6):c.1900-124_1900-121dupTGAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22226321_22226324dup" "" "benign" "" "0000575300" "0" "30" "X" "22244553" "22244553" "subst" "0" "01804" "PHEX_000046" "g.22244553C>T" "" "" "" "PHEX(NM_000444.4):c.1900-7C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22226436C>T" "" "likely benign" "" "0000575302" "0" "90" "X" "22266059" "22266059" "subst" "0" "01943" "PHEX_000048" "g.22266059C>T" "" "" "" "PHEX(NM_000444.5):c.2239C>T (p.R747*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22247942C>T" "" "pathogenic" "" "0000619403" "0" "90" "X" "22094553" "22094554" "del" "0" "02325" "PHEX_000049" "g.22094553_22094554del" "" "" "" "PHEX(NM_000444.6):c.397_398delCA (p.Q133Efs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22076435_22076436del" "" "pathogenic" "" "0000619404" "0" "90" "X" "22095627" "22095627" "dup" "0" "02327" "PHEX_000050" "g.22095627dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22077509dup" "" "pathogenic" "" "0000619405" "0" "30" "X" "22095750" "22095750" "subst" "0" "01943" "PHEX_000051" "g.22095750A>T" "" "" "" "PHEX(NM_000444.5):c.593A>T (p.Y198F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22077632A>T" "" "likely benign" "" "0000619406" "0" "30" "X" "22108574" "22108574" "subst" "0.000117778" "01943" "PHEX_000053" "g.22108574G>A" "" "" "" "PHEX(NM_000444.5):c.691G>A (p.V231M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22090456G>A" "" "likely benign" "" "0000619407" "0" "90" "X" "22112147" "22112147" "dup" "0" "02325" "PHEX_000054" "g.22112147dup" "" "" "" "PHEX(NM_000444.6):c.779dupT (p.L260Ffs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22094029dup" "" "pathogenic" "" "0000619408" "0" "30" "X" "22186461" "22186461" "subst" "0.000179199" "01943" "PHEX_000057" "g.22186461A>G" "" "" "" "PHEX(NM_000444.5):c.1437A>G (p.P479=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22168344A>G" "" "likely benign" "" "0000619409" "0" "50" "X" "22239805" "22239805" "subst" "0" "01943" "PHEX_000058" "g.22239805C>G" "" "" "" "PHEX(NM_000444.5):c.1844C>G (p.T615R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22221688C>G" "" "VUS" "" "0000619410" "0" "90" "X" "22239822" "22239822" "subst" "0" "02325" "PHEX_000031" "g.22239822C>T" "" "" "" "PHEX(NM_000444.6):c.1861C>T (p.Q621*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22221705C>T" "" "pathogenic" "" "0000619411" "0" "50" "X" "22244591" "22244591" "subst" "0" "01943" "PHEX_000059" "g.22244591T>C" "" "" "" "PHEX(NM_000444.5):c.1931T>C (p.I644T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22226474T>C" "" "VUS" "" "0000619412" "0" "30" "X" "22266008" "22266008" "subst" "0.000179132" "01943" "PHEX_000061" "g.22266008G>T" "" "" "" "PHEX(NM_000444.5):c.2188G>T (p.A730S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22247891G>T" "" "likely benign" "" "0000624557" "0" "30" "X" "22108573" "22108573" "subst" "0.0000729088" "01943" "PHEX_000052" "g.22108573C>T" "" "" "" "PHEX(NM_000444.5):c.690C>T (p.A230=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22090455C>T" "" "likely benign" "" "0000624558" "0" "30" "X" "22115126" "22115126" "subst" "0.000324672" "01943" "PHEX_000055" "g.22115126C>T" "" "" "" "PHEX(NM_000444.5):c.903C>T (p.N301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22097008C>T" "" "likely benign" "" "0000624559" "0" "30" "X" "22132587" "22132587" "subst" "0.000044766" "01943" "PHEX_000056" "g.22132587G>C" "" "" "" "PHEX(NM_000444.5):c.1185G>C (p.G395=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22114469G>C" "" "likely benign" "" "0000624560" "0" "70" "X" "22245666" "22245666" "subst" "0" "02325" "PHEX_000060" "g.22245666G>A" "" "" "" "PHEX(NM_000444.6):c.2008G>A (p.E670K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22227549G>A" "" "likely pathogenic" "" "0000652872" "1" "30" "X" "22132608" "22132608" "subst" "0.00285375" "03575" "PHEX_000062" "g.22132608A>G" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININkgp22737261}" "Germline" "" "" "0" "" "" "g.22114490A>G" "" "likely benign" "" "0000659247" "0" "50" "X" "22196435" "22196435" "subst" "0" "02327" "PHEX_000063" "g.22196435C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.22178318C>T" "" "VUS" "" "0000682345" "0" "50" "X" "22051133" "22051133" "subst" "0.00072759" "01943" "PHEX_000004" "g.22051133G>C" "" "" "" "PHEX(NM_000444.4):c.10G>C (p.(Glu4Gln)), PHEX(NM_000444.5):c.10G>C (p.E4Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682346" "0" "70" "X" "22263521" "22263521" "del" "0" "01804" "PHEX_000064" "g.22263521del" "" "" "" "PHEX(NM_000444.4):c.2142del (p.(Gln714HisfsTer26))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000684820" "0" "30" "X" "22051133" "22051133" "subst" "0.00072759" "00004" "PHEX_000004" "g.22051133G>C" "frequency 0.014" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.22033015G>C" "" "likely benign" "" "0000693528" "0" "30" "X" "22095601" "22095601" "subst" "0.0000729153" "01943" "PHEX_000065" "g.22095601T>C" "" "" "" "PHEX(NM_000444.5):c.444T>C (p.I148=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693529" "0" "50" "X" "22132604" "22132604" "subst" "0.000156675" "01943" "PHEX_000066" "g.22132604C>T" "" "" "" "PHEX(NM_000444.5):c.1202C>T (p.P401L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693530" "0" "30" "X" "22245695" "22245695" "subst" "0.000179356" "01943" "PHEX_000067" "g.22245695C>T" "" "" "" "PHEX(NM_000444.5):c.2037C>T (p.T679=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728766" "0" "30" "X" "22051204" "22051204" "subst" "0.000258233" "01943" "PHEX_000068" "g.22051204C>T" "" "" "" "PHEX(NM_000444.5):c.81C>T (p.V27=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728767" "0" "90" "X" "22132619" "22132619" "subst" "0" "02326" "PHEX_000069" "g.22132619G>A" "" "" "" "PHEX(NM_000444.6):c.1217G>A (p.C406Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728768" "0" "30" "X" "22151661" "22151661" "subst" "0.0000223957" "01804" "PHEX_000070" "g.22151661G>A" "" "" "" "PHEX(NM_000444.4):c.1324G>A (p.(Val442Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728769" "0" "50" "X" "22186430" "22186430" "subst" "0.000162528" "01943" "PHEX_000071" "g.22186430C>T" "" "" "" "PHEX(NM_000444.5):c.1406C>T (p.A469V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728770" "0" "70" "X" "22186511" "22186511" "subst" "0" "02327" "PHEX_000072" "g.22186511G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000728771" "0" "90" "X" "22196467" "22196467" "subst" "0" "02326" "PHEX_000073" "g.22196467G>A" "" "" "" "PHEX(NM_000444.6):c.1560G>A (p.W520*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728772" "0" "90" "X" "22208620" "22208620" "subst" "0" "02325" "PHEX_000028" "g.22208620G>A" "" "" "" "PHEX(NM_000444.6):c.1645+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728773" "0" "50" "X" "22245715" "22245715" "subst" "0" "02326" "PHEX_000074" "g.22245715T>C" "" "" "" "PHEX(NM_000444.6):c.2057T>C (p.L686P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728774" "0" "30" "X" "22266025" "22266025" "subst" "0.0000279805" "01943" "PHEX_000075" "g.22266025C>T" "" "" "" "PHEX(NM_000444.5):c.2205C>T (p.P735=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810235" "0" "50" "X" "22095758" "22095758" "subst" "0" "02325" "PHEX_000076" "g.22095758T>G" "" "" "" "PHEX(NM_000444.6):c.601T>G (p.S201A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810236" "0" "90" "X" "22117168" "22117169" "del" "0" "02325" "PHEX_000077" "g.22117168_22117169del" "" "" "" "PHEX(NM_000444.6):c.978_979delCT (p.Y327Pfs*21)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000810237" "0" "30" "X" "22132630" "22132630" "subst" "0" "01943" "PHEX_000078" "g.22132630A>G" "" "" "" "PHEX(NM_000444.5):c.1228A>G (p.I410V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810238" "0" "50" "X" "22237190" "22237190" "subst" "0" "02327" "PHEX_000079" "g.22237190C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000824021" "0" "90" "X" "22117223" "22117223" "subst" "0" "00006" "PHEX_000023" "g.22117223C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22099105C>T" "" "pathogenic" "" "0000824022" "0" "90" "X" "22129663" "22129663" "subst" "0" "00006" "PHEX_000116" "g.22129663G>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22111545G>A" "" "pathogenic" "" "0000824023" "0" "90" "X" "22129679" "22129679" "subst" "0" "00006" "PHEX_000024" "g.22129679G>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22111561G>T" "" "pathogenic" "" "0000824024" "0" "70" "X" "22132619" "22132619" "subst" "0" "00006" "PHEX_000118" "g.22132619G>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22114501G>T" "" "likely pathogenic" "" "0000824025" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Chesher 2018:29460029}" "" "del ex12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824026" "0" "90" "X" "22151694" "22151697" "del" "0" "00006" "PHEX_000121" "g.22151694_22151697del" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22133577_22133580del" "" "pathogenic" "" "0000824027" "0" "70" "X" "22151703" "22151703" "subst" "0" "00006" "PHEX_000122" "g.22151703T>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22133586T>A" "" "likely pathogenic" "" "0000824028" "0" "90" "X" "22151705" "22151705" "subst" "0" "00006" "PHEX_000123" "g.22151705G>C" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22133588G>C" "" "pathogenic" "" "0000824029" "0" "90" "X" "22186498" "22186498" "del" "0" "00006" "PHEX_000126" "g.22186498del" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22168381del" "" "pathogenic" "" "0000824030" "0" "90" "X" "22186511" "22186511" "subst" "0" "00006" "PHEX_000072" "g.22186511G>C" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22168394G>C" "" "pathogenic" "" "0000824031" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Chesher 2018:29460029}" "" "del ex14-15" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824032" "0" "50" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000134" "g.22208574C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22190457C>T" "" "VUS" "" "0000824033" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000824034" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824035" "0" "90" "X" "22219820" "22234114" "del" "0" "00006" "PHEX_000020" "g.(22208620_22231020)_(22231076_22237152)del" "" "{PMID:Chesher 2018:29460029}" "" "del ex16" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000824036" "0" "90" "X" "22231045" "22231045" "del" "0" "00006" "PHEX_000137" "g.22231045del" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22212928del" "" "pathogenic" "" "0000824037" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000824038" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000824039" "0" "90" "X" "22237191" "22237191" "subst" "0" "00006" "PHEX_000029" "g.22237191A>C" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22219074A>C" "" "pathogenic" "" "0000824040" "0" "90" "X" "22239736" "22239739" "dup" "0" "00006" "PHEX_000141" "g.22239736_22239739dup" "" "{PMID:Chesher 2018:29460029}" "" "c.1775_1778dupAATA" "" "Germline" "" "" "0" "" "" "g.22221619_22221622dup" "" "pathogenic" "" "0000824041" "0" "90" "X" "22239791" "22239791" "del" "0" "00006" "PHEX_000030" "g.22239791del" "" "{PMID:Chesher 2018:29460029}" "" "c.1830delG" "" "Germline" "" "" "0" "" "" "g.22221674del" "" "pathogenic" "" "0000824042" "0" "90" "X" "22239835" "22239836" "dup" "0" "00006" "PHEX_000144" "g.22239835_22239836dup" "" "{PMID:Chesher 2018:29460029}" "" "c.1874_1875dupAT" "" "Germline" "" "" "0" "" "" "g.22221718_22221719dup" "" "pathogenic" "" "0000824043" "0" "90" "X" "22244618" "22244618" "subst" "0" "00006" "PHEX_000032" "g.22244618C>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22226501C>A" "" "pathogenic" "" "0000824044" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000824045" "0" "90" "X" "22245636" "22245646" "del" "0" "00006" "PHEX_000148" "g.22245636_22245646del" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22227519_22227529del" "" "pathogenic" "" "0000824046" "0" "70" "X" "22245676" "22245676" "subst" "0" "00006" "PHEX_000150" "g.22245676T>G" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22227559T>G" "" "likely pathogenic" "" "0000824047" "0" "90" "X" "22245724" "22245724" "subst" "0" "00006" "PHEX_000033" "g.22245724C>A" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22227607C>A" "" "pathogenic" "" "0000824048" "0" "90" "X" "22094505" "22094505" "subst" "0" "00006" "PHEX_000021" "g.22094505G>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22076387G>T" "" "pathogenic" "" "0000824049" "0" "90" "X" "22094504" "22094504" "subst" "0" "00006" "PHEX_000091" "g.22094504A>G" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22076386A>G" "" "pathogenic" "" "0000824050" "0" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000093" "g.22094593G>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22076475G>T" "" "pathogenic" "" "0000824051" "0" "90" "X" "22095660" "22095660" "subst" "0" "00006" "PHEX_000096" "g.22095660C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22077542C>T" "" "pathogenic" "" "0000824052" "0" "90" "X" "22095699" "22095699" "subst" "0" "00006" "PHEX_000098" "g.22095699C>G" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22077581C>G" "" "pathogenic" "" "0000824053" "0" "90" "X" "22095787" "22095787" "del" "0" "00006" "PHEX_000101" "g.22095787del" "" "{PMID:Chesher 2018:29460029}" "" "630delT" "" "Germline" "" "" "0" "" "" "g.22077669del" "" "pathogenic" "" "0000824054" "0" "90" "X" "22108616" "22108616" "subst" "0" "00006" "PHEX_000104" "g.22108616G>C" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22090498G>C" "" "pathogenic" "" "0000824055" "0" "90" "X" "22115073" "22115073" "del" "0" "00006" "PHEX_000022" "g.22115073del" "" "{PMID:Chesher 2018:29460029}" "" "c.850delA" "" "Germline" "" "" "0" "" "" "g.22096955del" "" "pathogenic" "" "0000824056" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Chesher 2018:29460029}" "" "" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824057" "0" "90" "X" "22051200" "22051201" "del" "0" "00006" "PHEX_000087" "g.22051200_22051201del" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22033082_22033083del" "" "pathogenic" "" "0000824058" "0" "90" "X" "22060912" "22079946" "del" "0" "00006" "PHEX_000678" "g.(22056656_22065167)_(22065386_22094505)del" "" "{PMID:Morey 2011:21902834}" "" "del ex3" "Del (>0.16 Kb)" "Germline" "" "" "0" "" "" "g.(22038538_22047049)_(22047268_22076387)del" "" "pathogenic" "" "0000824059" "0" "70" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Morey 2011:21902834}" "" "dup ex3" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000824060" "0" "70" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000088" "g.22065192A>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22047074A>T" "" "likely pathogenic" "" "0000824061" "0" "90" "X" "22094551" "22094554" "dup" "0" "00006" "PHEX_000092" "g.22094551_22094554dup" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22076433_22076436dup" "" "pathogenic" "" "0000824062" "0" "90" "X" "22094595" "22094595" "subst" "0" "00006" "PHEX_000094" "g.22094595G>C" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22076477G>C" "" "pathogenic" "" "0000824063" "0" "90" "X" "22095722" "22095722" "subst" "0" "00006" "PHEX_000099" "g.22095722C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22077604C>T" "" "pathogenic" "" "0000824064" "0" "90" "X" "22095748" "22095748" "subst" "0" "00006" "PHEX_000100" "g.22095748A>G" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22077630A>G" "" "pathogenic" "" "0000824065" "0" "90" "X" "22108565" "22108565" "dup" "0" "00006" "PHEX_000103" "g.22108565dup" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22090447dup" "" "pathogenic" "" "0000824066" "0" "90" "X" "22112118" "22112118" "subst" "0" "00006" "PHEX_000105" "g.22112118C>G" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22094000C>G" "" "pathogenic" "" "0000824067" "0" "70" "X" "22112152" "22112152" "subst" "0" "00006" "PHEX_000107" "g.22112152G>C" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22094034G>C" "" "likely pathogenic" "" "0000824068" "0" "90" "X" "22115120" "22115121" "del" "0" "00006" "PHEX_000109" "g.22115120_22115121del" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22097002_22097003del" "" "pathogenic" "" "0000824069" "0" "90" "X" "22129610" "22129610" "subst" "0" "00006" "PHEX_000115" "g.22129610A>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22111492A>T" "" "pathogenic" "" "0000824070" "0" "90" "X" "22129679" "22129679" "subst" "0" "00006" "PHEX_000117" "g.22129679G>A" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22111561G>A" "" "pathogenic" "" "0000824071" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Morey 2011:21902834}" "" "del ex13-15" "Del (>22 Kb)" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824072" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Morey 2011:21902834}" "" "del ex13-22" "Del (>80 Kb)" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824073" "0" "90" "X" "22186510" "22186510" "del" "0" "00006" "PHEX_000127" "g.22186510del" "" "{PMID:Morey 2011:21902834}" "" "c.1482+4delA" "" "Germline" "" "" "0" "" "" "g.22168393del" "" "pathogenic" "" "0000824074" "0" "70" "X" "22196436" "22196436" "subst" "0" "00006" "PHEX_000129" "g.22196436G>C" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22178319G>C" "" "likely pathogenic" "" "0000824075" "0" "90" "X" "22196450" "22196450" "subst" "0" "00006" "PHEX_000130" "g.22196450C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22178333C>T" "" "pathogenic" "" "0000824076" "0" "90" "X" "22208613" "22208613" "subst" "0" "00006" "PHEX_000135" "g.22208613C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22190496C>T" "" "pathogenic" "" "0000824077" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824078" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824079" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000824080" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Morey 2011:21902834}" "" "del ex16-22" "Del (>34 Kb)" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824081" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Morey 2011:21902834}" "" "del ex17-20" "Del (>29 Kb)" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824082" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824083" "0" "90" "X" "22237397" "22237400" "dup" "0" "00006" "PHEX_000140" "g.22237397_22237400dup" "" "{PMID:Morey 2011:21902834}" "" "c.1768+174_1768+177dupTAAG" "" "Germline" "" "" "0" "" "" "g.22219280_22219283dup" "" "pathogenic" "" "0000824084" "0" "90" "X" "22239786" "22239786" "subst" "0" "00006" "PHEX_000142" "g.22239786G>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22221669G>T" "" "pathogenic" "" "0000824085" "0" "70" "X" "22244596" "22244598" "del" "0" "00006" "PHEX_000145" "g.22244596_22244598del" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22226479_22226481del" "" "likely pathogenic" "" "0000824086" "0" "70" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22226495G>C" "" "likely pathogenic" "" "0000824087" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000824088" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824089" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824090" "0" "90" "X" "22263518" "22263519" "dup" "0" "00006" "PHEX_000157" "g.22263518_22263519dup" "" "{PMID:Morey 2011:21902834}" "" "c.2138_2139dupCT" "" "Germline" "" "" "0" "" "" "g.22245401_22245402dup" "" "pathogenic" "" "0000824091" "0" "90" "X" "22265988" "22265988" "dup" "0" "00006" "PHEX_000160" "g.22265988dup" "" "{PMID:Morey 2011:21902834}" "" "c.2168dupA" "" "Germline" "" "" "0" "" "" "g.22247871dup" "" "pathogenic" "" "0000824092" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Morey 2011:21902834}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824172" "0" "90" "X" "22051110" "22051131" "delins" "0" "00006" "PHEX_000085" "g.22051110_22051131delinsTGGGAGCAGCGTGG" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22032992_22033013delinsTGGGAGCAGCGTGG" "" "pathogenic" "" "0000824173" "0" "90" "X" "22051138" "22051139" "del" "0" "00006" "PHEX_000086" "g.22051138_22051139del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.15_16delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033020_22033021del" "" "pathogenic" "" "0000824174" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.350-?_1899+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824175" "0" "90" "X" "22117148" "22117150" "del" "0" "00006" "PHEX_000112" "g.22117148_22117150del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.958_960delAAG" "" "Germline" "" "" "0" "" "" "g.22099030_22099032del" "" "pathogenic" "" "0000824176" "0" "90" "X" "22129608" "22129608" "subst" "0" "00006" "PHEX_000114" "g.22129608G>A" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111490G>A" "" "pathogenic" "" "0000824177" "0" "90" "X" "22151650" "22151650" "subst" "0" "00006" "PHEX_000119" "g.22151650T>G" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22133533T>G" "" "pathogenic" "" "0000824178" "0" "90" "X" "22151668" "22151668" "subst" "0" "00006" "PHEX_000120" "g.22151668G>A" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133551G>A" "" "pathogenic" "" "0000824179" "0" "90" "X" "22151743" "22151746" "del" "0" "00006" "PHEX_000125" "g.22151743_22151746del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.1404+2_5delTAAGG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133626_22133629del" "" "pathogenic" "" "0000824180" "0" "90" "X" "22196429" "22196429" "subst" "0" "00006" "PHEX_000128" "g.22196429C>T" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178312C>T" "" "pathogenic" "" "0000824181" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.1586+3_6delGAGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824182" "0" "90" "X" "22208560" "22208560" "subst" "0" "00006" "PHEX_000132" "g.22208560G>C" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22190443G>C" "" "pathogenic" "" "0000824183" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000824184" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000824185" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.1646-?_2453+?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "" "0000824186" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.1646-?_2070+?dup" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824187" "0" "90" "X" "22237180" "22237183" "dup" "0" "00006" "PHEX_000138" "g.22237180_22237183dup" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.1728_1731dupAATT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219063_22219066dup" "" "pathogenic" "" "0000824188" "0" "90" "X" "22245666" "22245666" "del" "0" "00006" "PHEX_000149" "g.22245666del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.2008delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227549del" "" "pathogenic" "" "0000824189" "0" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000824190" "0" "90" "X" "22265967" "22265967" "subst" "0" "00006" "PHEX_000158" "g.22265967G>T" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247850G>T" "" "pathogenic" "" "0000824191" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824192" "3" "90" "X" "22065227" "22065228" "del" "0" "00006" "PHEX_000089" "g.22065227_22065228del" "" "{PMID:Beck-Nielsen 2012:22695891}" "" "c.247_248delGG" "" "Germline" "" "" "0" "" "" "g.22047109_22047110del" "" "pathogenic" "" "0000824193" "0" "90" "X" "22095806" "22095806" "subst" "0" "00006" "PHEX_000102" "g.22095806G>T" "" "{PMID:Dixon 1998:9768674}" "MseI" "E217X" "" "Germline" "" "" "0" "" "" "g.22077688G>T" "" "pathogenic" "" "0000824194" "0" "90" "X" "22112118" "22112118" "subst" "0" "00006" "PHEX_000106" "g.22112118C>A" "" "{PMID:Dixon 1998:9768674}" "MseI" "Y250X" "" "Germline" "" "" "0" "" "" "g.22094000C>A" "" "pathogenic" "" "0000824195" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Dixon 1998:9768674}" "" "R291X" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824196" "0" "90" "X" "22208564" "22208564" "subst" "0" "00006" "PHEX_000133" "g.22208564G>A" "" "{PMID:Dixon 1998:9768674}" "" "W530X" "" "Germline" "" "" "0" "" "" "g.22190447G>A" "" "pathogenic" "" "0000824197" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Dixon 1998:9768674}" "DdeI" "R702X" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824198" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Dixon 1998:9768674}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824199" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Dixon 1998:9768674}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824200" "0" "90" "X" "22065307" "22065307" "del" "0" "00006" "PHEX_000090" "g.22065307del" "" "{PMID:Dixon 1998:9768674}" "" "codon109 delT" "" "Germline" "" "" "0" "" "" "g.22047189del" "" "pathogenic" "" "0000824201" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Dixon 1998:9768674}" "PvuII,EcoRI" "del ex6, >9.5kb" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824202" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Dixon 1998:9768674}" "PvuII,EcoRI" "del ex13, >18kb" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824203" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Dixon 1998:9768674}" "" "del ex16-17" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824204" "0" "90" "X" "22263478" "22263478" "del" "0" "00006" "PHEX_000154" "g.22263478del" "" "{PMID:Dixon 1998:9768674}" "AluI" "delC codon 700" "" "Germline" "" "" "0" "" "" "g.22245361del" "" "pathogenic" "" "0000824205" "0" "90" "X" "22245699" "22245701" "del" "0" "00006" "PHEX_000151" "g.22245699_22245701del" "" "{PMID:Dixon 1998:9768674}" "" "c.2041_2043delAAC" "" "Germline" "" "" "0" "" "" "g.22227582_22227584del" "" "pathogenic" "" "0000824206" "0" "90" "X" "" "" "" "" "00006" "PHEX_000080" "g.22245713(ins5)" "" "{PMID:Dixon 1998:9768674}" "GE" "codon687 ins5" "" "Germline" "" "" "0" "" "" "g.22227596(ins5)" "" "pathogenic" "" "0000824207" "0" "90" "X" "22117156" "22117160" "ins" "0" "00006" "PHEX_000081" "g.22117156_22117160insN[8]" "" "{PMID:Dixon 1998:9768674}" "" "codon323 ins8" "" "Germline" "" "" "0" "" "" "g.22099038_22099042insN[8]" "" "pathogenic" "" "0000824208" "0" "90" "X" "22117175" "22117175" "dup" "0" "00006" "PHEX_000113" "g.22117175dup" "" "{PMID:Dixon 1998:9768674}" "" "codon329 insC" "" "Germline" "" "" "0" "" "" "g.22099057dup" "" "pathogenic" "" "0000824209" "0" "90" "X" "22263516" "22263522" "delins" "0" "00006" "PHEX_000156" "g.22263516_22263522delinsAA" "" "{PMID:Dixon 1998:9768674}" "DdeI-" "" "" "De novo" "" "" "0" "" "" "g.22245399_22245405delinsAA" "" "pathogenic" "" "0000824210" "0" "90" "X" "22117122" "22117122" "subst" "0" "00006" "PHEX_000110" "g.22117122A>G" "" "{PMID:Dixon 1998:9768674}" "DdeI" "Partial exon 9 skip" "" "Germline" "" "" "0" "" "" "g.22099004A>G" "" "pathogenic" "" "0000824211" "0" "90" "X" "22151742" "22151742" "subst" "0" "00006" "PHEX_000124" "g.22151742G>C" "" "{PMID:Dixon 1998:9768674}" "DdeI" "Exon 12 skip" "" "Germline" "" "" "0" "" "" "g.22133625G>C" "" "pathogenic" "" "0000824212" "0" "90" "X" "22263453" "22263461" "del" "0" "00006" "PHEX_000153" "g.22263453_22263461del" "" "{PMID:Dixon 1998:9768674}" "" "del 8 bp" "" "Germline" "" "" "0" "" "" "g.22245336_22245344del" "" "pathogenic" "" "0000824213" "0" "70" "X" "22117140" "22117140" "subst" "0" "00006" "PHEX_000111" "g.22117140A>T" "" "{PMID:Dixon 1998:9768674}" "" "Y317F" "" "Germline" "" "" "0" "" "" "g.22099022A>T" "" "likely pathogenic" "" "0000824214" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Dixon 1998:9768674}" "" "P534L" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824215" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Dixon 1998:9768674}" "" "P534L" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824216" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Dixon 1998:9768674}" "" "G579R" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824217" "0" "70" "X" "22239823" "22239823" "subst" "0" "00006" "PHEX_000143" "g.22239823A>G" "" "{PMID:Dixon 1998:9768674}" "" "Q621R" "" "Germline" "" "" "0" "" "" "g.22221706A>G" "" "likely pathogenic" "" "0000824218" "0" "70" "X" "22265978" "22265978" "subst" "0" "00006" "PHEX_000159" "g.22265978G>A" "" "{PMID:Dixon 1998:9768674}" "RsaI+" "A720T" "" "Germline" "" "" "0" "" "" "g.22247861G>A" "" "likely pathogenic" "" "0000824219" "0" "70" "X" "22266012" "22266012" "subst" "0" "00006" "PHEX_000161" "g.22266012T>A" "" "{PMID:Dixon 1998:9768674}" "" "F731Y" "" "Germline" "" "" "0" "" "" "g.22247895T>A" "" "likely pathogenic" "" "0000824220" "0" "70" "X" "22266065" "22266065" "subst" "0" "00006" "PHEX_000162" "g.22266065T>C" "" "{PMID:Dixon 1998:9768674}" "MspI" "W749R" "" "Germline" "" "" "0" "" "" "g.22247948T>C" "" "likely pathogenic" "" "0000824221" "0" "50" "X" "22050695" "22050695" "subst" "0" "00006" "PHEX_000082" "g.22050695A>G" "" "{PMID:Dixon 1998:9768674}" "" "" "" "Germline" "" "" "0" "" "" "g.22032577A>G" "" "VUS" "" "0000824222" "0" "10" "X" "22051032" "22051032" "subst" "0" "00006" "PHEX_000083" "g.22051032G>A" "0.43" "{PMID:Dixon 1998:9768674}" "" "" "" "Germline" "" "" "0" "" "" "g.22032914G>A" "" "benign" "" "0000824223" "0" "10" "X" "22051091" "22051091" "subst" "0.0928897" "00006" "PHEX_000084" "g.22051091C>T" "0.18" "{PMID:Dixon 1998:9768674}" "" "" "" "Germline" "" "" "0" "" "" "g.22032973C>T" "" "benign" "" "0000824224" "0" "10" "X" "22095642" "22095642" "subst" "0" "00006" "PHEX_000095" "g.22095642A>G" "<0.01" "{PMID:Dixon 1998:9768674}" "" "" "" "Germline" "" "" "0" "" "" "g.22077524A>G" "" "benign" "" "0000824225" "0" "10" "X" "22095694" "22095694" "subst" "0.00183108" "00006" "PHEX_000097" "g.22095694T>A" "<0.01" "{PMID:Dixon 1998:9768674}" "" "" "" "Germline" "" "" "0" "" "" "g.22077576T>A" "" "benign" "" "0000824230" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Rowe 1997:9097956}" "" "1734G>A (G579R)" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824231" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824232" "0" "90" "X" "22112100" "22112100" "subst" "0" "00006" "PHEX_000234" "g.22112100G>A" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22093982G>A" "" "pathogenic" "" "0000824233" "0" "90" "X" "22132705" "22132705" "subst" "0" "00006" "PHEX_000273" "g.22132705G>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22114587G>T" "" "pathogenic" "" "0000824234" "0" "90" "X" "22117266" "22117266" "del" "0" "00006" "PHEX_000253" "g.22117266del" "" "{PMID:Rowe 1997:9097956}" "" "deletion B3a" "" "Germline" "" "" "0" "" "" "g.22099148del" "" "pathogenic" "" "0000824235" "0" "90" "X" "22117232" "22117232" "subst" "0" "00006" "PHEX_000251" "g.22117232A>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22099114A>T" "" "pathogenic" "" "0000824236" "0" "70" "X" "22237137" "22237137" "subst" "0" "00006" "PHEX_000163" "g.22237137T>A" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22219020T>A" "" "VUS" "" "0000824237" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000824238" "0" "90" "X" "22112218" "22112218" "subst" "0" "00006" "PHEX_000238" "g.22112218G>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22094100G>T" "" "pathogenic" "" "0000824239" "1" "70" "X" "22065210" "22065210" "subst" "0" "00006" "PHEX_000173" "g.22065210G>C" "" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22047092G>C" "" "likely pathogenic" "" "0000824240" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824241" "1" "90" "X" "22115154" "22115154" "subst" "0" "00006" "PHEX_000174" "g.22115154C>T" "" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22097036C>T" "" "pathogenic" "" "0000824242" "1" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824243" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824244" "1" "90" "X" "22186458" "22186458" "subst" "0" "00006" "PHEX_000175" "g.22186458T>A" "" "{PMID:Rowe 1997:9097956}, {PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22168341T>A" "" "pathogenic" "" "0000824245" "0" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22038501C>T" "" "pathogenic" "" "0000824246" "0" "70" "X" "22094569" "22094569" "subst" "0" "00006" "PHEX_000214" "g.22094569T>C" "" "{PMID:Rowe 1997:9097956}" "" "" "" "De novo" "" "" "0" "" "" "g.22076451T>C" "" "likely pathogenic" "" "0000824247" "0" "90" "X" "22129583" "22129583" "subst" "0" "00006" "PHEX_000257" "g.22129583A>G" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22111465A>G" "" "pathogenic" "" "0000824248" "0" "90" "X" "22117151" "22117152" "ins" "0" "00006" "PHEX_000245" "g.22117151_22117152insGAGTTACT" "" "{PMID:Rowe 1997:9097956}" "" "insGAGTTACT" "" "Germline" "" "" "0" "" "" "g.22099033_22099034insGAGTTACT" "" "pathogenic" "" "0000824249" "0" "90" "X" "22132611" "22132611" "subst" "0" "00006" "PHEX_000035" "g.22132611G>A" "" "{PMID:Rowe 1997:9097956}" "" "W403Stop" "" "Germline" "" "" "0" "" "" "g.22114493G>A" "" "pathogenic" "" "0000824250" "0" "90" "X" "22095767" "22095870" "del" "0" "00006" "PHEX_000227" "g.22095767_22095870del" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22077649_22077752del" "" "pathogenic" "" "0000824251" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Rowe 1997:9097956}" "" "1734G>A (G579R)" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824252" "0" "90" "X" "22151737" "22151741" "del" "0" "00006" "PHEX_000279" "g.22151737_22151741del" "" "{PMID:Rowe 1997:9097956}" "" "delAAAAG" "" "Germline" "" "" "0" "" "" "g.22133620_22133624del" "" "pathogenic" "" "0000824253" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Rowe 1997:9097956}" "" "5 bp del" "" "Germline" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000824254" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824255" "0" "90" "X" "22117175" "22117175" "dup" "0" "00006" "PHEX_000113" "g.22117175dup" "" "{PMID:Rowe 1997:9097956}" "" "insC" "" "Germline" "" "" "0" "" "" "g.22099057dup" "" "pathogenic" "" "0000824256" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824257" "0" "90" "X" "22108616" "22108616" "subst" "0" "00006" "PHEX_000232" "g.22108616G>T" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22090498G>T" "" "pathogenic" "" "0000824258" "0" "90" "X" "22112100" "22112100" "subst" "0" "00006" "PHEX_000235" "g.22112100G>C" "" "{PMID:Rowe 1997:9097956}" "" "" "" "Germline" "" "" "0" "" "" "g.22093982G>C" "" "pathogenic" "" "0000824259" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Rowe 1997:9097956}" "" "exon 15 skip" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824289" "1" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Holm 1997:9106524},{PMID:Holm 2001:11502829}" "" "51C>T" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824290" "0" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "1518delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824291" "0" "90" "X" "22112198" "22112198" "subst" "0" "00006" "PHEX_000164" "g.22112198T>A" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "823T>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094080T>A" "" "pathogenic" "" "0000824292" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Holm 1997:9106524},{PMID:Holm 2001:11502829}" "" "" "" "Germline" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824293" "0" "90" "X" "22237188" "22237188" "subst" "0" "00006" "PHEX_000170" "g.22237188G>T" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "1729G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219071G>T" "" "pathogenic" "" "0000824294" "0" "90" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000167" "g.22065234G>A" "" "{PMID:Holm 2001:11502829}" "" "247G>A" "" "Germline" "" "" "0" "" "" "g.22047116G>A" "" "pathogenic" "" "0000824295" "0" "90" "X" "22095653" "22095653" "subst" "0.00000560174" "00006" "PHEX_000040" "g.22095653C>T" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "489C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077535C>T" "" "pathogenic" "" "0000824296" "21" "50" "X" "22112123" "22112123" "subst" "0" "00006" "PHEX_000168" "g.22112123T>C" "" "{PMID:Holm 2001:11502829}" "" "F252S;M253I" "" "Germline" "" "" "0" "" "" "g.22094005T>C" "" "VUS" "" "0000824297" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Holm 2001:11502829}" "" "864C>T" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824298" "21" "50" "X" "22112127" "22112127" "subst" "0" "00006" "PHEX_000169" "g.22112127G>A" "" "{PMID:Holm 2001:11502829}" "" "F252S;M253I" "" "Germline" "" "" "0" "" "" "g.22094009G>A" "" "VUS" "" "0000824418" "0" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Holm 2001:11502829}" "" "Q51X" "" "Germline" "" "" "0" "" "" "g.22038501C>T" "" "pathogenic" "" "0000824419" "21" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Holm 2001:11502829}" "" "Q51X" "" "Germline" "" "" "0" "" "" "g.22038501C>T" "" "pathogenic" "" "0000824420" "21" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Holm 2001:11502829}" "" "Q51X" "" "Germline" "" "" "0" "" "" "g.22038501C>T" "" "pathogenic" "" "0000824421" "21" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Holm 2001:11502829}" "" "Q51X" "" "Germline" "" "" "0" "" "" "g.22038501C>T" "" "pathogenic" "" "0000824422" "11" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "R288X, R291X" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824423" "0" "90" "X" "22117132" "22117132" "subst" "0" "00006" "PHEX_000244" "g.22117131G>A^22117132G>A" "" "{PMID:Holm 2001:11502829}" "" "W314X" "" "Germline" "" "" "0" "" "" "g.22099013G>A^22099014G>A" "" "pathogenic" "" "0000824424" "21" "90" "X" "22117132" "22117132" "subst" "0" "00006" "PHEX_000244" "g.22117131G>A^22117132G>A" "" "{PMID:Holm 2001:11502829}" "" "W314X" "" "Germline" "" "" "0" "" "" "g.22099013G>A^22099014G>A" "" "pathogenic" "" "0000824425" "21" "90" "X" "22117132" "22117132" "subst" "0" "00006" "PHEX_000244" "g.22117131G>A^22117132G>A" "" "{PMID:Holm 2001:11502829}" "" "W314X" "" "Germline" "" "" "0" "" "" "g.22099013G>A^22099014G>A" "" "pathogenic" "" "0000824426" "0" "90" "X" "22132680" "22132680" "subst" "0" "00006" "PHEX_000271" "g.22132680C>G" "" "{PMID:Holm 2001:11502829}" "" "Y426X" "" "Germline" "" "" "0" "" "" "g.22114562C>G" "" "pathogenic" "" "0000824427" "11" "90" "X" "22132680" "22132680" "subst" "0" "00006" "PHEX_000271" "g.22132680C>G" "" "{PMID:Holm 2001:11502829}" "" "Y426X" "" "Germline" "" "" "0" "" "" "g.22114562C>G" "" "pathogenic" "" "0000824428" "11" "90" "X" "22132680" "22132680" "subst" "0" "00006" "PHEX_000271" "g.22132680C>G" "" "{PMID:Holm 2001:11502829}" "" "Y426X" "" "Germline" "" "" "0" "" "" "g.22114562C>G" "" "pathogenic" "" "0000824429" "11" "90" "X" "22132680" "22132680" "subst" "0" "00006" "PHEX_000271" "g.22132680C>G" "" "{PMID:Holm 2001:11502829}" "" "Y426X" "" "Germline" "" "" "0" "" "" "g.22114562C>G" "" "pathogenic" "" "0000824430" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Holm 2001:11502829}" "" "R702X" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824431" "11" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Holm 2001:11502829}" "" "R702X" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824432" "11" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Holm 2001:11502829}" "" "R702X" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000824433" "0" "90" "X" "22266058" "22266058" "subst" "0" "00006" "PHEX_000359" "g.22266058C>A" "" "{PMID:Holm 2001:11502829}" "" "C746X" "" "Germline" "" "" "0" "" "" "g.22247941C>A" "" "pathogenic" "" "0000824434" "11" "90" "X" "22266058" "22266058" "subst" "0" "00006" "PHEX_000359" "g.22266058C>A" "" "{PMID:Holm 2001:11502829}" "" "C746X" "" "Germline" "" "" "0" "" "" "g.22247941C>A" "" "pathogenic" "" "0000824435" "11" "90" "X" "22266058" "22266058" "subst" "0" "00006" "PHEX_000359" "g.22266058C>A" "" "{PMID:Holm 2001:11502829}" "" "C746X" "" "Germline" "" "" "0" "" "" "g.22247941C>A" "" "pathogenic" "" "0000824436" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Holm 2001:11502829}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824437" "11" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Holm 2001:11502829}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824438" "11" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Holm 2001:11502829}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824439" "11" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Holm 2001:11502829}" "" "R747X" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824440" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Holm 2001:11502829}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824441" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Holm 2001:11502829}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824442" "21" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Holm 2001:11502829}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824443" "0" "90" "X" "22051140" "22051141" "del" "0" "00006" "PHEX_000190" "g.22051140_22051141del" "" "{PMID:Holm 2001:11502829}" "" "c.16delGG" "" "Germline" "" "" "0" "" "" "g.22033022_22033023del" "" "pathogenic" "" "0000824444" "21" "90" "X" "22051140" "22051141" "del" "0" "00006" "PHEX_000190" "g.22051140_22051141del" "" "{PMID:Holm 2001:11502829}" "" "c.16delGG" "" "Germline" "" "" "0" "" "" "g.22033022_22033023del" "" "pathogenic" "" "0000824445" "0" "90" "X" "22129671" "22129671" "del" "0" "00006" "PHEX_000265" "g.22129671del" "" "{PMID:Holm 2001:11502829}" "" "c.1166delT" "" "Germline" "" "" "0" "" "" "g.22111553del" "" "pathogenic" "" "0000824446" "21" "90" "X" "22129671" "22129671" "del" "0" "00006" "PHEX_000265" "g.22129671del" "" "{PMID:Holm 2001:11502829}" "" "c.1166delT" "" "Germline" "" "" "0" "" "" "g.22111553del" "" "pathogenic" "" "0000824447" "21" "90" "X" "22129671" "22129671" "del" "0" "00006" "PHEX_000265" "g.22129671del" "" "{PMID:Holm 2001:11502829}" "" "c.1166delT" "" "Germline" "" "" "0" "" "" "g.22111553del" "" "pathogenic" "" "0000824448" "21" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "c.1525delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824449" "11" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 2001:11502829}" "" "c.1525delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824450" "11" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 2001:11502829}" "" "c.1525delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824451" "11" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 2001:11502829}" "" "c.1525delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824452" "11" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Holm 2001:11502829}" "" "c.1525delA" "" "Germline" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000824453" "0" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824454" "21" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824455" "21" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824456" "11" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824457" "11" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824458" "11" "90" "X" "22244596" "22244599" "dup" "0" "00006" "PHEX_000326" "g.22244596_22244599dup" "" "{PMID:Holm 2001:11502829}" "" "c.1939insGATA" "" "Germline" "" "" "0" "" "" "g.22226479_22226482dup" "" "pathogenic" "" "0000824459" "0" "90" "X" "22245651" "22245651" "del" "0" "00006" "PHEX_000333" "g.22245651del" "" "{PMID:Holm 2001:11502829}" "" "c.1993delA" "" "Germline" "" "" "0" "" "" "g.22227534del" "" "pathogenic" "" "0000824460" "21" "90" "X" "22245651" "22245651" "del" "0" "00006" "PHEX_000333" "g.22245651del" "" "{PMID:Holm 2001:11502829}" "" "c.1993delA" "" "Germline" "" "" "0" "" "" "g.22227534del" "" "pathogenic" "" "0000824461" "0" "90" "X" "22263483" "22263483" "del" "0" "00006" "PHEX_000346" "g.22263483del" "" "{PMID:Holm 2001:11502829}" "" "c.2104delC" "" "Germline" "" "" "0" "" "" "g.22245366del" "" "pathogenic" "" "0000824462" "21" "90" "X" "22263483" "22263483" "del" "0" "00006" "PHEX_000346" "g.22263483del" "" "{PMID:Holm 2001:11502829}" "" "c.2104delC" "" "Germline" "" "" "0" "" "" "g.22245366del" "" "pathogenic" "" "0000824463" "21" "90" "X" "22263483" "22263483" "del" "0" "00006" "PHEX_000346" "g.22263483del" "" "{PMID:Holm 2001:11502829}" "" "c.2104delC" "" "Germline" "" "" "0" "" "" "g.22245366del" "" "pathogenic" "" "0000824464" "21" "90" "X" "22263483" "22263483" "del" "0" "00006" "PHEX_000346" "g.22263483del" "" "{PMID:Holm 2001:11502829}" "" "c.2104delC" "" "Germline" "" "" "0" "" "" "g.22245366del" "" "pathogenic" "" "0000824465" "21" "90" "X" "22065167" "22065167" "subst" "0" "00006" "PHEX_000202" "g.22065167G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS2-1G>C" "" "Germline" "" "" "0" "" "" "g.22047049G>C" "" "pathogenic" "" "0000824466" "0" "90" "X" "22065167" "22065167" "subst" "0" "00006" "PHEX_000202" "g.22065167G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS2-1G>C" "" "Germline" "" "" "0" "" "" "g.22047049G>C" "" "pathogenic" "" "0000824467" "21" "90" "X" "22065167" "22065167" "subst" "0" "00006" "PHEX_000202" "g.22065167G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS2-1G>C" "" "Germline" "" "" "0" "" "" "g.22047049G>C" "" "pathogenic" "" "0000824468" "21" "90" "X" "22065167" "22065167" "subst" "0" "00006" "PHEX_000202" "g.22065167G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS2-1G>C" "" "Germline" "" "" "0" "" "" "g.22047049G>C" "" "pathogenic" "" "0000824469" "0" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000282" "g.22186507G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS13+1G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168390G>C" "" "pathogenic" "" "0000824470" "0" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000282" "g.22186507G>C" "" "{PMID:Holm 2001:11502829}" "" "IVS13+1G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168390G>C" "" "pathogenic" "" "0000824471" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Holm 2001:11502829}" "" "IVS14+3delGAGT" "" "Germline" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824472" "11" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Holm 2001:11502829}" "" "IVS14+3delGAGT" "" "Germline" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824473" "11" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Holm 2001:11502829}" "" "IVS14+3delGAGT" "" "Germline" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824474" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+1G>A" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000824475" "21" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+1G>A" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000824476" "21" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+1G>A" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000824477" "0" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+5G>A" "" "Germline" "" "" "0" "" "" "g.22190507G>A" "" "pathogenic" "" "0000824478" "21" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+5G>A" "" "Germline" "" "" "0" "" "" "g.22190507G>A" "" "pathogenic" "" "0000824479" "21" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Holm 2001:11502829}" "" "IVS15+5G>A" "" "Germline" "" "" "0" "" "" "g.22190507G>A" "" "pathogenic" "" "0000824480" "21" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000167" "g.22065234G>A" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "C85Y" "" "Germline" "" "" "0" "" "" "g.22047116G>A" "" "likely pathogenic" "" "0000824481" "21" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000167" "g.22065234G>A" "" "{PMID:Holm 2001:11502829}" "" "C85Y" "" "Germline" "" "" "0" "" "" "g.22047116G>A" "" "likely pathogenic" "" "0000824482" "21" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000167" "g.22065234G>A" "" "{PMID:Holm 2001:11502829}" "" "C85Y" "" "Germline" "" "" "0" "" "" "g.22047116G>A" "" "likely pathogenic" "" "0000824483" "1" "50" "X" "22112123" "22112123" "subst" "0" "00006" "PHEX_000168" "g.22112123T>C" "" "{PMID:Holm 2001:11502829}" "" "F252S;M253I" "" "Germline" "" "" "0" "" "" "g.22094005T>C" "" "VUS" "" "0000824484" "21" "50" "X" "22112127" "22112127" "subst" "0" "00006" "PHEX_000169" "g.22112127G>A" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "748T>C;759G>A" "" "Germline" "" "" "0" "" "" "g.22094009G>A" "" "VUS" "" "0000824485" "0" "70" "X" "22129638" "22129638" "subst" "0" "00006" "PHEX_000262" "g.22129638T>C" "" "{PMID:Holm 2001:11502829}" "" "L378P" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111520T>C" "" "likely pathogenic" "" "0000824486" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Holm 2001:11502829}" "" "P534L" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824487" "11" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Holm 2001:11502829}" "" "P534L" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824488" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Holm 2001:11502829}" "" "P534L" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824489" "0" "70" "X" "22237167" "22237167" "subst" "0" "00006" "PHEX_000300" "g.22237167G>A" "" "{PMID:Holm 2001:11502829}" "" "G572D" "" "Germline" "" "" "0" "" "" "g.22219050G>A" "" "likely pathogenic" "" "0000824490" "21" "70" "X" "22237167" "22237167" "subst" "0" "00006" "PHEX_000300" "g.22237167G>A" "" "{PMID:Holm 2001:11502829}" "" "G572D" "" "Germline" "" "" "0" "" "" "g.22219050G>A" "" "likely pathogenic" "" "0000824491" "0" "70" "X" "22263512" "22263512" "subst" "0" "00006" "PHEX_000347" "g.22263512T>A" "" "{PMID:Holm 2001:11502829}" "" "S711R" "" "Germline" "" "" "0" "" "" "g.22245395T>A" "" "likely pathogenic" "" "0000824492" "11" "70" "X" "22263512" "22263512" "subst" "0" "00006" "PHEX_000347" "g.22263512T>A" "" "{PMID:Holm 2001:11502829}" "" "S711R" "" "Germline" "" "" "0" "" "" "g.22245395T>A" "" "likely pathogenic" "" "0000824493" "11" "70" "X" "22263512" "22263512" "subst" "0" "00006" "PHEX_000347" "g.22263512T>A" "" "{PMID:Holm 2001:11502829}" "" "S711R" "" "Germline" "" "" "0" "" "" "g.22245395T>A" "" "likely pathogenic" "" "0000824494" "1" "50" "X" "22112127" "22112127" "subst" "0" "00006" "PHEX_000169" "g.22112127G>A" "" "{PMID:Holm 2001:11502829}" "" "F252S;M253I" "" "Germline" "" "" "0" "" "" "g.22094009G>A" "" "VUS" "" "0000824495" "21" "50" "X" "22112123" "22112123" "subst" "0" "00006" "PHEX_000168" "g.22112123T>C" "" "{PMID:Holm 1997:9106524}, {PMID:Holm 2001:11502829}" "" "748T>C;759G>A" "" "Germline" "" "" "0" "" "" "g.22094005T>C" "" "VUS" "" "0000824497" "1" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Francis 1997:9199930}" "TaqI-" "58C>T, R20X" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824498" "1" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Francis 1997:9199930}" "TaqI-" "58C>T, R20X" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824499" "1" "70" "X" "22065233" "22065233" "subst" "0" "00006" "PHEX_000205" "g.22065233T>C" "" "{PMID:Francis 1997:9199930}" "" "253T>C, C85R" "" "Germline" "" "" "0" "" "" "g.22047115T>C" "" "likely pathogenic" "" "0000824500" "1" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Francis 1997:9199930}" "" "del ex4-5" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824501" "21" "90" "X" "22108565" "22108566" "del" "0" "00006" "PHEX_000230" "g.22108565_22108566del" "" "{PMID:Francis 1997:9199930},{PMID:Kienitz 2011:21553362}" "" "682delTC" "" "Germline" "" "" "0" "" "" "g.22090447_22090448del" "" "pathogenic" "" "0000824502" "1" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Francis 1997:9199930}" "" "del ex5" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824503" "1" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Francis 1997:9199930}" "" "871C>T, R291X" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824504" "1" "90" "X" "22115157" "22115157" "subst" "0" "00006" "PHEX_000242" "g.22115157G>T" "" "{PMID:Francis 1997:9199930}" "BstNI-" "IVS8+1GT>TT" "" "Germline" "" "" "0" "" "" "g.22097039G>T" "" "pathogenic" "" "0000824505" "0" "90" "X" "22116140" "22123427" "del" "0" "00006" "PHEX_000506" "g.(22115157_22117123)_(22117270_22129584)del" "" "{PMID:Francis 1997:9199930}" "" "del ex9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22097039_22099005)_(22099152_22111466)del" "" "pathogenic" "" "0000824506" "1" "90" "X" "22129639" "22129639" "del" "0" "00006" "PHEX_000263" "g.22129639del" "" "{PMID:Francis 1997:9199930}" "MaeI+" "1134delT" "" "Germline" "" "" "0" "" "" "g.22111521del" "" "pathogenic" "" "0000824507" "1" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Francis 1997:9199930}" "" "del ex10-11" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824508" "1" "90" "X" "22151704" "22151704" "subst" "0" "00006" "PHEX_000278" "g.22151704G>A" "" "{PMID:Francis 1997:9199930}" "" "1367G>A, W456X" "" "Germline" "" "" "0" "" "" "g.22133587G>A" "" "pathogenic" "" "0000824509" "1" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Francis 1997:9199930}" "" "del ex12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824510" "0" "90" "X" "22196467" "22196467" "del" "0" "00006" "PHEX_000287" "g.22196467del" "" "{PMID:Francis 1997:9199930}" "CviJI-" "1559delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178350del" "" "pathogenic" "" "0000824511" "1" "90" "X" "22196479" "22196479" "dup" "0" "00006" "PHEX_000288" "g.22196479dup" "" "{PMID:Francis 1997:9199930}" "" "1571insC" "" "Germline" "" "" "0" "" "" "g.22178362dup" "" "pathogenic" "" "0000824512" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Francis 1997:9199930}" "" "1601C>T, P534L" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824513" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Francis 1997:9199930}" "" "1601C>T, P534L" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824514" "1" "90" "X" "22231077" "22231077" "subst" "0" "00006" "PHEX_000299" "g.22231077T>C" "" "{PMID:Francis 1997:9199930}" "" "IVS16+1GT>GC" "" "Germline" "" "" "0" "" "" "g.22212960T>C" "" "pathogenic" "" "0000824515" "1" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000302" "g.22237187G>C" "" "{PMID:Francis 1997:9199930}" "" "1735G>C, G579R" "" "Germline" "yes" "" "0" "" "" "g.22219070G>C" "" "likely pathogenic" "" "0000824516" "1" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Francis 1997:9199930}" "" "1735G>A, G579R" "" "Germline" "yes" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824517" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Francis 1997:9199930}" "" "1735G>A, G579R" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824518" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Francis 1997:9199930}" "" "1735G>A, G579R" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824519" "1" "90" "X" "22234114" "22269427" "del" "0" "00006" "PHEX_000521" "g.(22231076_22237152)_(22269427_?)del" "" "{PMID:Francis 1997:9199930}" "" "del ex17-22" "" "Germline" "" "" "0" "" "" "g.(22212959_22219035)_(22251310_?)del" "" "pathogenic" "" "0000824520" "1" "90" "X" "22239740" "22239743" "dup" "0" "00006" "PHEX_000312" "g.22239740_22239743dup" "" "{PMID:Francis 1997:9199930}" "" "1783insTGAT  duplication" "" "Germline" "" "" "0" "" "" "g.22221623_22221626dup" "" "pathogenic" "" "0000824521" "1" "90" "X" "22239793" "22239794" "del" "0" "00006" "PHEX_000316" "g.22239793_22239794del" "" "{PMID:Francis 1997:9199930}" "MseI-" "1831delTT" "" "Germline" "" "" "0" "" "" "g.22221676_22221677del" "" "pathogenic" "" "0000824522" "1" "70" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Francis 1997:9199930}" "AciI-;MspI+" "1952G>C, R651P" "" "Germline" "" "" "0" "" "" "g.22226495G>C" "" "likely pathogenic" "" "0000824523" "1" "90" "X" "0" "0" "" "0" "00006" "PHEX_000705" "g.?" "" "{PMID:Francis 1997:9199930}" "" "del ex19-22" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824524" "1" "90" "X" "22245637" "22245637" "subst" "0" "00006" "PHEX_000330" "g.22245637G>A" "" "{PMID:Francis 1997:9199930}" "" "1979G>A, W660X" "" "Germline" "" "" "0" "" "" "g.22227520G>A" "" "pathogenic" "" "0000824525" "0" "90" "X" "22245644" "22245647" "dup" "0" "00006" "PHEX_000331" "g.22245644_22245647dup" "" "{PMID:Francis 1997:9199930}" "" "1991insTGAC duplication" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227527_22227530dup" "" "pathogenic" "" "0000824526" "1" "90" "X" "22263472" "22263472" "del" "0" "00006" "PHEX_000345" "g.22263472del" "" "{PMID:Francis 1997:9199930}" "" "2093delC" "" "Germline" "" "" "0" "" "" "g.22245355del" "" "pathogenic" "" "0000824527" "1" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Francis 1997:9199930}" "" "2239C>T, R747X" "" "Germline" "yes" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824528" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Francis 1997:9199930}" "" "2239C>T, R747X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824529" "1" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Francis 1997:9199930}" "" "2239C>T, R747X" "" "Germline" "yes" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824810" "0" "90" "X" "22056656" "22056656" "subst" "0" "00006" "PHEX_000200" "g.22056656G>T" "" "{PMID:Filisetti 1999:10439971}" "" "gt>tt" "" "Germline" "" "" "0" "" "" "g.22038538G>T" "" "pathogenic" "" "0000824811" "0" "70" "X" "22065222" "22065222" "subst" "0" "00006" "PHEX_000204" "g.22065222T>C" "" "{PMID:Filisetti 1999:10439971}" "" "T242C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047104T>C" "" "likely pathogenic" "" "0000824812" "0" "70" "X" "22094569" "22094569" "subst" "0" "00006" "PHEX_000214" "g.22094569T>C" "" "{PMID:Filisetti 1999:10439971}" "" "T413C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076451T>C" "" "likely pathogenic" "" "0000824813" "0" "70" "X" "22094581" "22094581" "subst" "0" "00006" "PHEX_000217" "g.22094581G>T" "" "{PMID:Filisetti 1999:10439971}" "" "G425C" "" "Germline" "" "" "0" "" "" "g.22076463G>T" "" "likely pathogenic" "" "0000824814" "0" "90" "X" "22094594" "22094594" "subst" "0" "00006" "PHEX_000219" "g.22094594T>A" "" "{PMID:Filisetti 1999:10439971}" "" "gt>ga" "" "Germline" "" "" "0" "" "" "g.22076476T>A" "" "pathogenic" "" "0000824815" "0" "70" "X" "22108593" "22108593" "subst" "0" "00006" "PHEX_000231" "g.22108593A>G" "" "{PMID:Filisetti 1999:10439971}" "" "A710G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090475A>G" "" "likely pathogenic" "" "0000824816" "0" "90" "X" "22112200" "22112200" "subst" "0" "00006" "PHEX_000237" "g.22112200G>T" "" "{PMID:Filisetti 1999:10439971}" "" "G832" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094082G>T" "" "pathogenic" "" "0000824817" "0" "90" "X" "22117271" "22117271" "subst" "0" "00006" "PHEX_000255" "g.22117271T>G" "" "{PMID:Filisetti 1999:10439971}" "" "gt>gg" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099153T>G" "" "pathogenic" "" "0000824818" "0" "90" "X" "22132671" "22132671" "del" "0" "00006" "PHEX_000270" "g.22132671del" "" "{PMID:Filisetti 1999:10439971}" "" "1269delA" "" "Germline" "" "" "0" "" "" "g.22114553del" "" "pathogenic" "" "0000824819" "0" "90" "X" "22151688" "22151688" "subst" "0" "00006" "PHEX_000276" "g.22151688G>T" "" "{PMID:Filisetti 1999:10439971}" "" "G1351T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133571G>T" "" "pathogenic" "" "0000824820" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Filisetti 1999:10439971}" "" "G1363T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000824821" "0" "90" "X" "22196408" "22196411" "dup" "0" "00006" "PHEX_000286" "g.22196408_22196411dup" "" "{PMID:Filisetti 1999:10439971}" "" "1504insGACT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178291_22178294dup" "" "pathogenic" "" "0000824822" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Filisetti 1999:10439971}" "" "del gagt" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000824823" "0" "70" "X" "22208564" "22208564" "subst" "0" "00006" "PHEX_000290" "g.22208564G>C" "" "{PMID:Filisetti 1999:10439971}" "" "G1590C" "" "Germline" "" "" "0" "" "" "g.22190447G>C" "" "likely pathogenic" "" "0000824824" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Filisetti 1999:10439971}" "" "C1601T" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824825" "0" "90" "X" "22208621" "22208621" "subst" "0" "00006" "PHEX_000291" "g.22208621T>A" "" "{PMID:Filisetti 1999:10439971}" "" "gt>at" "" "Germline" "" "" "0" "" "" "g.22190504T>A" "" "pathogenic" "" "0000824826" "0" "70" "X" "22237170" "22237170" "subst" "0" "00006" "PHEX_000301" "g.22237170C>A" "" "{PMID:Filisetti 1999:10439971}" "" "C1728A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219053C>A" "" "likely pathogenic" "" "0000824827" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Filisetti 1999:10439971}" "" "G1736A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824828" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Filisetti 1999:10439971}" "" "G1736A" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824829" "0" "90" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000306" "g.22237221G>A" "" "{PMID:Filisetti 1999:10439971}" "" "gt>at" "" "Germline" "" "" "0" "" "" "g.22219104G>A" "" "pathogenic" "" "0000824830" "0" "70" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Filisetti 1999:10439971}" "" "G1952C" "" "Germline" "" "" "0" "" "" "g.22226495G>C" "" "likely pathogenic" "" "0000824831" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Filisetti 1999:10439971}" "" "gt>at" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000824832" "0" "90" "X" "22245644" "22245647" "dup" "0" "00006" "PHEX_000331" "g.22245644_22245647dup" "" "{PMID:Filisetti 1999:10439971}" "" "1986insTGAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227527_22227530dup" "" "pathogenic" "" "0000824833" "0" "90" "X" "22245722" "22245722" "subst" "0" "00006" "PHEX_000339" "g.22245722T>A" "" "{PMID:Filisetti 1999:10439971}" "" "T2064A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227605T>A" "" "pathogenic" "" "0000824834" "0" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000340" "g.22263448A>C" "" "{PMID:Filisetti 1999:10439971}" "" "ag>cg" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245331A>C" "" "pathogenic" "" "0000824835" "0" "90" "X" "22265969" "22265969" "del" "0" "00006" "PHEX_000350" "g.22265969del" "" "{PMID:Filisetti 1999:10439971}" "" "2148delG" "" "Germline" "" "" "0" "" "" "g.22247852del" "" "pathogenic" "" "0000824836" "0" "90" "X" "22265982" "22265983" "ins" "0" "00006" "PHEX_000353" "g.22265982_22265983insCCCT" "" "{PMID:Filisetti 1999:10439971}" "" "2162insCCCT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247865_22247866insCCCT" "" "pathogenic" "" "0000824837" "0" "70" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000357" "g.22266018G>C" "" "{PMID:Filisetti 1999:10439971}" "" "G2198C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247901G>C" "" "likely pathogenic" "" "0000824838" "0" "70" "X" "22266058" "22266058" "subst" "0" "00006" "PHEX_000360" "g.22266058C>G" "" "{PMID:Filisetti 1999:10439971}" "" "C2238G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247941C>G" "" "likely pathogenic" "" "0000824839" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Filisetti 1999:10439971}" "" "C2239T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824840" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "TaqI-" "R20X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824841" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "R549X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824842" "0" "70" "X" "22196436" "22196436" "subst" "0" "00006" "PHEX_000129" "g.22196436G>C" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "R510P" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178319G>C" "" "likely pathogenic" "" "0000824843" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "R747X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824844" "0" "90" "X" "22051242" "22051242" "subst" "0" "00006" "PHEX_000194" "g.22051242G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033124G>A" "" "pathogenic" "" "0000824845" "0" "90" "X" "22094568" "22094568" "del" "0" "00006" "PHEX_000213" "g.22094568del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "c.412delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076450del" "" "pathogenic" "" "0000824846" "0" "90" "X" "22108560" "22108560" "del" "0" "00006" "PHEX_000229" "g.22108560del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "c.677delC" "" "Germline" "" "" "0" "" "" "g.22090442del" "" "pathogenic" "" "0000824847" "0" "90" "X" "22117203" "22117208" "del" "0" "00006" "PHEX_000248" "g.22117203_22117208del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099085_22099090del" "" "pathogenic" "" "0000824848" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "" "" "Germline" "" "" "0" "" "" "g.22099152G>A" "" "pathogenic" "" "0000824849" "0" "90" "X" "22132684" "22132684" "subst" "0" "00006" "PHEX_000272" "g.22132684C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "Q428X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114566C>T" "" "pathogenic" "" "0000824850" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "del ex2-4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824851" "0" "70" "X" "22129608" "22129608" "subst" "0" "00006" "PHEX_000114" "g.22129608G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "W368X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111490G>A" "" "likely pathogenic" "" "0000824852" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "201-205del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000824853" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "P534L" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824854" "0" "90" "X" "22132611" "22132611" "subst" "0" "00006" "PHEX_000035" "g.22132611G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "W403X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114493G>A" "" "pathogenic" "" "0000824855" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G579R" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824856" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID1" "TaqI-" "R20X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824857" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID13" "" "R549X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000824858" "0" "70" "X" "22196436" "22196436" "subst" "0" "00006" "PHEX_000129" "g.22196436G>C" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID133" "" "R510P" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178319G>C" "" "likely pathogenic" "" "0000824859" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID17" "" "R747X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000824860" "0" "90" "X" "22051242" "22051242" "subst" "0" "00006" "PHEX_000194" "g.22051242G>A" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID172" "" "IVS1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033124G>A" "" "pathogenic" "" "0000824861" "0" "90" "X" "22094568" "22094568" "del" "0" "00006" "PHEX_000213" "g.22094568del" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID173" "" "c.412delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076450del" "" "pathogenic" "" "0000824862" "0" "90" "X" "22108560" "22108560" "del" "0" "00006" "PHEX_000229" "g.22108560del" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID174" "" "c.677delC" "" "Germline" "" "" "0" "" "" "g.22090442del" "" "pathogenic" "" "0000824863" "0" "90" "X" "22117203" "22117208" "del" "0" "00006" "PHEX_000248" "g.22117203_22117208del" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID175" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099085_22099090del" "" "pathogenic" "" "0000824864" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID176" "" "" "" "Germline" "" "" "0" "" "" "g.22099152G>A" "" "pathogenic" "" "0000824865" "0" "90" "X" "22132684" "22132684" "subst" "0" "00006" "PHEX_000272" "g.22132684C>T" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID177" "" "Q428X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114566C>T" "" "pathogenic" "" "0000824866" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID178" "" "del ex2-4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000824867" "0" "70" "X" "22129608" "22129608" "subst" "0" "00006" "PHEX_000114" "g.22129608G>A" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID179" "" "W368X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111490G>A" "" "likely pathogenic" "" "0000824868" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID18" "" "201-205del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000824869" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID71" "" "P534L" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824870" "0" "90" "X" "22132611" "22132611" "subst" "0" "00006" "PHEX_000035" "g.22132611G>A" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID9" "" "W403X" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114493G>A" "" "pathogenic" "" "0000824871" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Popowska 2001:14564066} from PHEXdb-MutID90" "" "G579R" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic" "" "0000824872" "0" "90" "X" "22095751" "22095751" "subst" "0" "00006" "PHEX_000226" "g.22095751C>G" "" "{PMID:Sato 2000:11004247}" "" "" "" "Germline" "" "" "0" "" "" "g.22077633C>G" "" "pathogenic" "" "0000824873" "0" "70" "X" "22151669" "22151670" "ins" "0" "00006" "PHEX_000275" "g.22151669_22151670insAAC" "" "{PMID:Sato 2000:11004247}" "" "" "" "Germline" "" "" "0" "" "" "g.22133552_22133553insAAC" "" "likely pathogenic" "" "0000824874" "0" "70" "X" "22095636" "22095636" "subst" "0" "00006" "PHEX_000224" "g.22095636T>G" "" "{PMID:Sato 2000:11004247}" "" "" "" "Germline" "" "" "0" "" "" "g.22077518T>G" "" "likely pathogenic" "" "0000824875" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Sato 2000:11004247}" "" "" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824876" "1" "90" "X" "22231039" "22231039" "subst" "0" "00006" "PHEX_000171" "g.22231039T>C" "" "{PMID:Econs 1998:9768646}" "" "" "" "Germline" "yes" "" "0" "" "" "g.22212922T>C" "" "pathogenic (dominant)" "" "0000824877" "1" "90" "X" "22113485" "22113485" "subst" "0" "00006" "PHEX_000172" "g.22113485G>T" "" "{PMID:Christie 2001:11502821}" "" "" "" "Germline" "yes" "" "0" "" "" "g.22095367G>T" "" "pathogenic (dominant)" "" "0000824880" "0" "90" "X" "22263512" "22263512" "subst" "0" "00006" "PHEX_000347" "g.22263512T>A" "" "{PMID:Sabbagh 2001:11468271}, {PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein retained in ER, associated with calnexin, rescued at 26oC, devoid of catalytic activity" "In vitro (cloned)" "" "" "0" "" "" "g.22245395T>A" "" "NA" "" "0000824881" "0" "90" "X" "22065233" "22065233" "subst" "0" "00006" "PHEX_000205" "g.22065233T>C" "" "{PMID:Sabbagh 2001:11468271}, {PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein retained in ER, associated with calnexin" "In vitro (cloned)" "" "" "0" "" "" "g.22047115T>C" "" "NA" "" "0000824882" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000302" "g.22237187G>C" "" "{PMID:Sabbagh 2001:11468271}, {PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein retained in ER, associated with calnexin, protein retained intracellularly" "In vitro (cloned)" "" "" "0" "" "" "g.22219070G>C" "" "NA" "" "0000824883" "0" "90" "X" "22237194" "22237194" "subst" "0" "00006" "PHEX_000303" "g.22237194T>A" "" "{PMID:Sabbagh 2001:11468271}, {PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein not sensitive to endoglycosidase H digestion, devoid of catalytic activity" "In vitro (cloned)" "" "" "0" "" "" "g.22219077T>A" "" "NA" "" "0000824884" "0" "70" "X" "22117140" "22117140" "subst" "0" "00006" "PHEX_000111" "g.22117140A>T" "" "{PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein secreted, 0.50-0.60 activity using synthetic substrate" "In vitro (cloned)" "" "" "0" "" "" "g.22099022A>T" "" "NA" "" "0000824885" "0" "70" "X" "22237188" "22237188" "subst" "0" "00006" "PHEX_000170" "g.22237188G>T" "" "{PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein retained in ER, protein rescued at 26oC" "In vitro (cloned)" "" "" "0" "" "" "g.22219071G>T" "" "NA" "" "0000824886" "0" "50" "X" "22265978" "22265978" "subst" "0" "00006" "PHEX_000159" "g.22265978G>A" "" "{PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein retained in ER, rescued at 26oC; 0.90-1.00 catalytic activity using synthetic peptide" "In vitro (cloned)" "" "" "0" "" "" "g.22247861G>A" "" "NA" "" "0000824887" "0" "50" "X" "22266012" "22266012" "subst" "0" "00006" "PHEX_000161" "g.22266012T>A" "" "{PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein secreted, 0.90-1.00 catalytic activity, protein more sensitive to trypsin" "In vitro (cloned)" "" "" "0" "" "" "g.22247895T>A" "" "NA" "" "0000824888" "0" "70" "X" "22108593" "22108593" "subst" "0" "00006" "PHEX_000231" "g.22108593A>G" "" "{PMID:Sabbagh 2003:12727977}" "" "" "cDNA expression cloning HEK293 cells protein secreted, 0.50-0.60 activity using synthetic substrate; more resistant to endoporteinase Glu-c" "In vitro (cloned)" "" "" "0" "" "" "g.22090475A>G" "" "NA" "" "0000824938" "0" "90" "X" "22056586" "22056586" "subst" "0" "00006" "PHEX_000195" "g.22056586G>A" "" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID129" "" "IVS1-1G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038468G>A" "" "pathogenic (dominant)" "" "0000824939" "0" "90" "X" "22056586" "22056586" "subst" "0" "00006" "PHEX_000196" "g.22056586G>C" "" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID130" "" "IVS1-1G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038468G>C" "" "pathogenic (dominant)" "" "0000824940" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID178" "" "del ex2-4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000824941" "0" "90" "X" "22108565" "22108566" "del" "0" "00006" "PHEX_000230" "g.22108565_22108566del" "" "{PMID:HYP Consortium 1995:7550339} from PHEXdb-MutID22" "" "682delTC" "" "Germline" "" "" "0" "" "" "g.22090447_22090448del" "" "pathogenic (dominant)" "" "0000824942" "0" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000206" "g.22065234G>T" "" "{PMID:Tyynismaa 2000:10737991}" "" "254G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047116G>T" "" "likely pathogenic" "" "0000824943" "0" "70" "X" "22065330" "22065330" "subst" "0" "00006" "PHEX_000211" "g.22065330G>A" "" "{PMID:Tyynismaa 2000:10737991}" "" "IVS3+1G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047212G>A" "" "likely pathogenic" "" "0000824944" "0" "70" "X" "22094577" "22094577" "subst" "0" "00006" "PHEX_000216" "g.22094577T>C" "" "{PMID:Tyynismaa 2000:10737991}" "" "421T>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076459T>C" "" "likely pathogenic" "" "0000824945" "0" "90" "X" "22186511" "22186511" "subst" "0" "00006" "PHEX_000072" "g.22186511G>C" "" "{PMID:Tyynismaa 2000:10737991}" "" "935-939insGTTCG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168394G>C" "" "pathogenic" "" "0000824946" "0" "70" "X" "22117210" "22117212" "del" "0" "00006" "PHEX_000249" "g.22117210_22117212del" "" "{PMID:Tyynismaa 2000:10737991}" "" "1020-1022delGGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099092_22099094del" "" "likely pathogenic" "" "0000824947" "0" "90" "X" "22117234" "22117234" "del" "0" "00006" "PHEX_000252" "g.22117234del" "" "{PMID:Tyynismaa 2000:10737991}" "" "1042delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099116del" "" "pathogenic" "" "0000824948" "0" "90" "X" "22129663" "22129663" "subst" "0" "00006" "PHEX_000116" "g.22129663G>A" "" "{PMID:Tyynismaa 2000:10737991}" "" "1158G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111545G>A" "" "pathogenic" "" "0000824949" "0" "90" "X" "22231075" "22231075" "subst" "0" "00006" "PHEX_000297" "g.22231075G>C" "" "{PMID:Tyynismaa 2000:10737991}" "" "IVS13+5G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212958G>C" "" "pathogenic" "" "0000824950" "0" "70" "X" "22231075" "22231075" "subst" "0" "00006" "PHEX_000297" "g.22231075G>C" "" "{PMID:Tyynismaa 2000:10737991}" "" "1700G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212958G>C" "" "likely pathogenic" "" "0000824951" "0" "90" "X" "22244589" "22244589" "del" "0" "00006" "PHEX_000325" "g.22244589del" "" "{PMID:Tyynismaa 2000:10737991}" "" "1929delT" "" "Germline" "" "" "0" "" "" "g.22226472del" "" "pathogenic" "" "0000824952" "0" "70" "X" "22245698" "22245698" "subst" "0" "00006" "PHEX_000336" "g.22245698C>A" "" "{PMID:Tyynismaa 2000:10737991}" "" "2040C>A" "" "Germline" "" "" "0" "" "" "g.22227581C>A" "" "likely pathogenic" "" "0000824953" "0" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Tyynismaa 2000:10737991}" "" "IVS20-2A>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000824954" "0" "70" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000342" "g.22263457G>A" "" "{PMID:Tyynismaa 2000:10737991}" "" "2078G>A" "" "Germline" "" "" "0" "" "" "g.22245340G>A" "" "likely pathogenic" "" "0000824955" "0" "90" "X" "22265966" "22265966" "subst" "0" "00006" "PHEX_000349" "g.22265966A>T" "" "{PMID:Tyynismaa 2000:10737991}" "" "IVS21-2A>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247849A>T" "" "pathogenic" "" "0000824956" "0" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000358" "g.22266018G>A" "" "{PMID:Tyynismaa 2000:10737991}" "" "2198G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247901G>A" "" "pathogenic" "" "0000824957" "0" "90" "X" "22263449" "22263449" "subst" "0" "00006" "PHEX_000341" "g.22263449G>A" "" "{PMID:Yamazaki 2002:12414858}" "" "IVS20-1" "" "Germline" "" "" "0" "" "" "g.22245332G>A" "" "pathogenic" "" "0000824958" "11" "90" "X" "22263449" "22263449" "subst" "0" "00006" "PHEX_000341" "g.22263449G>A" "" "{PMID:Yamazaki 2002:12414858}" "" "IVS20-1" "" "Germline" "" "" "0" "" "" "g.22245332G>A" "" "pathogenic" "" "0000824959" "0" "90" "X" "22112218" "22112218" "subst" "0" "00006" "PHEX_000239" "g.22112218G>A" "" "{PMID:Yamazaki 2002:12414858}" "" "IVS7+1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094100G>A" "" "pathogenic" "" "0000824960" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Yamazaki 2002:12414858}" "" "IVS20-2" "" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000824961" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Yamazaki 2002:12414858}" "" "IVS20-2" "" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000824962" "0" "90" "X" "22095722" "22095722" "subst" "0" "00006" "PHEX_000099" "g.22095722C>T" "" "{PMID:Yamazaki 2002:12414858}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077604C>T" "" "pathogenic" "" "0000824963" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic" "" "0000824964" "0" "70" "X" "22237167" "22237167" "subst" "0" "00006" "PHEX_000300" "g.22237167G>A" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219050G>A" "" "likely pathogenic" "" "0000824965" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824966" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000824967" "0" "70" "X" "22266062" "22266062" "subst" "0" "00006" "PHEX_000361" "g.22266062C>T" "" "{PMID:Cho 2005:16055933}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247945C>T" "" "likely pathogenic" "" "0000824968" "0" "70" "X" "22244615" "22244626" "del" "0" "00006" "PHEX_000328" "g.22244615_22244626del" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "c.1952-1963delGGGAAGCTTTTA (E652-R655del4)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226498_22226509del" "" "likely pathogenic" "" "0000824969" "0" "90" "X" "22245654" "22245666" "del" "0" "00006" "PHEX_000334" "g.22245654_22245666del" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "c.1996 -2008delCAGGGACTTGAGG" "" "Germline" "" "" "0" "" "" "g.22227537_22227549del" "" "pathogenic" "" "0000824970" "0" "90" "X" "22265991" "22265992" "del" "0" "00006" "PHEX_000355" "g.22265991_22265992del" "" "{PMID:Cho 2005:16055933}, {PMID:Park 2021:34434907}" "" "c.2171-2172delTT (F724X)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247874_22247875del" "" "pathogenic" "" "0000824972" "0" "90" "X" "22051142" "22051143" "dup" "0" "00006" "PHEX_000191" "g.22051142_22051143dup" "" "{PMID:Gaucher 2009:19219621}" "" "20_21insAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033024_22033025dup" "" "pathogenic" "" "0000824973" "0" "90" "X" "22051240" "22051240" "del" "0" "00006" "PHEX_000193" "g.22051240del" "" "{PMID:Gaucher 2009:19219621}" "" "117delA" "" "Germline" "" "" "0" "" "" "g.22033122del" "" "pathogenic" "" "0000824974" "0" "90" "X" "22056610" "22056610" "subst" "0" "00006" "PHEX_000197" "g.22056610C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22038492C>T" "" "pathogenic" "" "0000824975" "0" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000206" "g.22065234G>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22047116G>T" "" "likely pathogenic" "" "0000824976" "0" "90" "X" "22065274" "22065275" "ins" "0" "00006" "PHEX_000209" "g.22065274_22065275insAAGAG" "" "{PMID:Gaucher 2009:19219621}" "" "293_294insGAAGA" "" "Germline" "" "" "0" "" "" "g.22047156_22047157insAAGAG" "" "pathogenic" "" "0000824977" "0" "90" "X" "22065331" "22065331" "subst" "0" "00006" "PHEX_000212" "g.22065331T>C" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22047213T>C" "" "pathogenic" "" "0000824978" "0" "90" "X" "22094505" "22094505" "subst" "0" "00006" "PHEX_000021" "g.22094505G>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076387G>T" "" "pathogenic" "" "0000824979" "0" "90" "X" "22094569" "22094569" "subst" "0" "00006" "PHEX_000214" "g.22094569T>C" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22076451T>C" "" "pathogenic" "" "0000824980" "0" "90" "X" "22094571" "22094571" "del" "0" "00006" "PHEX_000215" "g.22094571del" "" "{PMID:Gaucher 2009:19219621}" "" "415delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076453del" "" "pathogenic" "" "0000824981" "0" "90" "X" "22094596" "22094596" "subst" "0" "00006" "PHEX_000220" "g.22094596A>C" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22076478A>C" "" "pathogenic" "" "0000824982" "0" "90" "X" "22095591" "22095591" "subst" "0" "00006" "PHEX_000222" "g.22095591C>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22077473C>G" "" "pathogenic" "" "0000824983" "0" "90" "X" "22095695" "22095695" "del" "0" "00006" "PHEX_000225" "g.22095695del" "" "{PMID:Gaucher 2009:19219621}" "" "538delT" "" "Germline" "" "" "0" "" "" "g.22077577del" "" "pathogenic" "" "0000824984" "0" "90" "X" "22095778" "22095778" "subst" "0" "00006" "PHEX_000228" "g.22095778T>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077660T>A" "" "pathogenic" "" "0000824985" "0" "70" "X" "" "" "" "" "00006" "PHEX_000188" "g.[22108548T>C/=]" "" "{PMID:Gaucher 2009:19219621}" "" "[=;665T>C]" "mosaicism" "Germline/De novo (untested)" "" "" "0" "" "" "g.[22090430T>C/=]" "" "likely pathogenic" "" "0000824986" "0" "90" "X" "22108616" "22108617" "del" "0" "00006" "PHEX_000233" "g.22108616_22108617del" "" "{PMID:Gaucher 2009:19219621}" "" "732+1_732+2delGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090498_22090499del" "" "pathogenic" "" "0000824987" "0" "90" "X" "22112100" "22112100" "subst" "0" "00006" "PHEX_000236" "g.22112100G>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22093982G>T" "" "pathogenic" "" "0000824988" "0" "90" "X" "22112218" "22112218" "subst" "0" "00006" "PHEX_000238" "g.22112218G>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22094100G>T" "" "pathogenic" "" "0000824989" "0" "90" "X" "22112223" "22112223" "dup" "0" "00006" "PHEX_000240" "g.22112223dup" "" "{PMID:Gaucher 2009:19219621}" "" "849+6insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094105dup" "" "pathogenic" "" "0000824990" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824991" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824992" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000824993" "0" "90" "X" "22117168" "22117169" "dup" "0" "00006" "PHEX_000246" "g.22117168_22117169dup" "" "{PMID:Gaucher 2009:19219621}" "" "979_980insCT" "" "Germline" "" "" "0" "" "" "g.22099050_22099051dup" "" "pathogenic" "" "0000824994" "0" "90" "X" "22117192" "22117193" "ins" "0" "00006" "PHEX_000247" "g.22117192_22117193insG" "" "{PMID:Gaucher 2009:19219621}" "" "1002insG" "" "Germline" "" "" "0" "" "" "g.22099074_22099075insG" "" "pathogenic" "" "0000824995" "0" "70" "X" "22117226" "22117226" "subst" "0" "00006" "PHEX_000250" "g.22117226T>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099108T>G" "" "likely pathogenic" "" "0000824996" "0" "90" "X" "22117232" "22117232" "subst" "0" "00006" "PHEX_000251" "g.22117232A>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22099114A>T" "" "pathogenic" "" "0000824997" "0" "90" "X" "22117271" "22117274" "del" "0" "00006" "PHEX_000256" "g.22117271_22117274del" "" "{PMID:Gaucher 2009:19219621}" "" "1078_1079+2delAAGT" "" "Germline" "" "" "0" "" "" "g.22099153_22099156del" "" "pathogenic" "" "0000824998" "0" "70" "X" "22129597" "22129597" "subst" "0" "00006" "PHEX_000258" "g.22129597C>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111479C>G" "" "likely pathogenic" "" "0000824999" "0" "70" "X" "22129597" "22129597" "subst" "0" "00006" "PHEX_000259" "g.22129597C>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111479C>A" "" "likely pathogenic" "" "0000825000" "0" "70" "X" "22129615" "22129616" "ins" "0" "00006" "PHEX_000261" "g.22129615_22129616insAAG" "" "{PMID:Gaucher 2009:19219621}" "" "1109_1110insGAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111497_22111498insAAG" "" "likely pathogenic" "" "0000825001" "0" "90" "X" "22129657" "22129657" "subst" "0" "00006" "PHEX_000264" "g.22129657T>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111539T>G" "" "pathogenic" "" "0000825002" "0" "90" "X" "22129657" "22129657" "subst" "0" "00006" "PHEX_000264" "g.22129657T>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22111539T>G" "" "pathogenic" "" "0000825003" "0" "90" "X" "22129657" "22129657" "subst" "0" "00006" "PHEX_000264" "g.22129657T>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111539T>G" "" "pathogenic" "" "0000825004" "0" "90" "X" "22132587" "22132587" "del" "0" "00006" "PHEX_000267" "g.22132587del" "" "{PMID:Gaucher 2009:19219621}" "" "1185delG" "" "Germline" "" "" "0" "" "" "g.22114469del" "" "pathogenic" "" "0000825005" "0" "90" "X" "22132610" "22132610" "subst" "0" "00006" "PHEX_000268" "g.22132610G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22114492G>A" "" "pathogenic" "" "0000825006" "0" "90" "X" "22132665" "22132665" "del" "0" "00006" "PHEX_000269" "g.22132665del" "" "{PMID:Gaucher 2009:19219621}" "" "1263delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114547del" "" "pathogenic" "" "0000825007" "0" "70" "X" "22151656" "22151658" "del" "0" "00006" "PHEX_000274" "g.22151656_22151658del" "" "{PMID:Gaucher 2009:19219621}" "" "1319_1321delAGG" "" "Germline" "" "" "0" "" "" "g.22133539_22133541del" "" "likely pathogenic" "" "0000825008" "0" "90" "X" "22151740" "22151740" "del" "0" "00006" "PHEX_000280" "g.22151740del" "" "{PMID:Gaucher 2009:19219621}" "" "1403delA" "" "Germline" "" "" "0" "" "" "g.22133623del" "" "pathogenic" "" "0000825009" "0" "90" "X" "22186495" "22186495" "del" "0" "00006" "PHEX_000281" "g.22186495del" "" "{PMID:Gaucher 2009:19219621}" "" "1471delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168378del" "" "pathogenic" "" "0000825010" "0" "90" "X" "22186509" "22186510" "delins" "0" "00006" "PHEX_000284" "g.22186509_22186510delinsT" "" "{PMID:Gaucher 2009:19219621}" "" "1482+2delAAinsT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168392_22168393delinsT" "" "pathogenic" "" "0000825011" "0" "90" "X" "22196429" "22196429" "subst" "0" "00006" "PHEX_000128" "g.22196429C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178312C>T" "" "pathogenic" "" "0000825012" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Gaucher 2009:19219621}" "" "1586+3_1586+6delGAGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000825013" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Gaucher 2009:19219621}" "" "1586+3_1586+6delGAGT" "" "Germline" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000825014" "0" "90" "X" "22196493" "22196494" "del" "0" "00006" "PHEX_000182" "g.22196493_22196494del" "" "{PMID:Gaucher 2009:19219621}" "" "1586_1586+1delAG" "" "Germline" "" "" "0" "" "" "g.22178376_22178377del" "" "pathogenic" "" "0000825015" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000825016" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000825017" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000825018" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000825019" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000825020" "0" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22190507G>A" "" "pathogenic" "" "0000825021" "0" "90" "X" "22231058" "22231058" "subst" "0" "00006" "PHEX_000295" "g.22231058G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22212941G>A" "" "pathogenic" "" "0000825022" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825023" "0" "90" "X" "22231076" "22231076" "subst" "0" "00006" "PHEX_000298" "g.22231076G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22212959G>A" "" "pathogenic" "" "0000825024" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825025" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825026" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825027" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825028" "0" "90" "X" "22237217" "22237220" "del" "0" "00006" "PHEX_000305" "g.22237217_22237220del" "" "{PMID:Gaucher 2009:19219621}" "" "1765_1768delAATG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219100_22219103del" "" "pathogenic" "" "0000825029" "0" "90" "X" "22237222" "22237222" "dup" "0" "00006" "PHEX_000308" "g.22237222dup" "" "{PMID:Gaucher 2009:19219621}" "" "1768+2insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219105dup" "" "pathogenic" "" "0000825030" "0" "90" "X" "22239740" "22239740" "subst" "0" "00006" "PHEX_000311" "g.22239740T>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221623T>A" "" "pathogenic" "" "0000825031" "0" "90" "X" "22239740" "22239743" "dup" "0" "00006" "PHEX_000312" "g.22239740_22239743dup" "" "{PMID:Gaucher 2009:19219621}" "" "1782_1783insTGAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221623_22221626dup" "" "pathogenic" "" "0000825032" "0" "90" "X" "22239740" "22239743" "dup" "0" "00006" "PHEX_000312" "g.22239740_22239743dup" "" "{PMID:Gaucher 2009:19219621}" "" "1782_1783insTGAT" "" "Germline" "" "" "0" "" "" "g.22221623_22221626dup" "" "pathogenic" "" "0000825033" "0" "90" "X" "22239767" "22239767" "subst" "0" "00006" "PHEX_000313" "g.22239767G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22221650G>A" "" "pathogenic" "" "0000825034" "0" "90" "X" "22239804" "22239804" "dup" "0" "00006" "PHEX_000317" "g.22239804dup" "" "{PMID:Gaucher 2009:19219621}" "" "1843insA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221687dup" "" "pathogenic" "" "0000825035" "0" "90" "X" "22239815" "22239818" "dup" "0" "00006" "PHEX_000319" "g.22239815_22239818dup" "" "{PMID:Gaucher 2009:19219621}" "" "1857_1858insGATT" "" "Germline" "" "" "0" "" "" "g.22221698_22221701dup" "" "pathogenic" "" "0000825036" "0" "90" "X" "22239856" "22239878" "del" "0" "00006" "PHEX_000320" "g.22239856_22239878del" "" "{PMID:Gaucher 2009:19219621}" "" "1895_1899+18delTAAATGTGAGTACAACTGTGGCT" "" "Germline" "" "" "0" "" "" "g.22221739_22221761del" "" "pathogenic" "" "0000825037" "0" "90" "X" "22239861" "22239861" "subst" "0" "00006" "PHEX_000321" "g.22239861G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22221744G>A" "" "pathogenic" "" "0000825038" "0" "90" "X" "22239861" "22239861" "subst" "0" "00006" "PHEX_000321" "g.22239861G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221744G>A" "" "pathogenic" "" "0000825039" "0" "90" "X" "22239865" "22239865" "subst" "0" "00006" "PHEX_000322" "g.22239865G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221748G>A" "" "pathogenic" "" "0000825040" "0" "70" "X" "22244579" "22244579" "subst" "0" "00006" "PHEX_000323" "g.22244579T>C" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226462T>C" "" "likely pathogenic" "" "0000825041" "0" "90" "X" "22244587" "22244590" "dup" "0" "00006" "PHEX_000324" "g.22244587_22244590dup" "" "{PMID:Gaucher 2009:19219621}" "" "1929_1930insAAAT" "" "Germline" "" "" "0" "" "" "g.22226470_22226473dup" "" "pathogenic" "" "0000825042" "0" "70" "X" "22244612" "22244620" "dup" "0" "00006" "PHEX_000327" "g.22244612_22244620dup" "" "{PMID:Gaucher 2009:19219621}" "" "1953_1954insGAAGCTTGG" "" "Germline" "" "" "0" "" "" "g.22226495_22226503dup" "" "likely pathogenic" "" "0000825043" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000825044" "0" "70" "X" "22245628" "22245628" "subst" "0" "00006" "PHEX_000329" "g.22245628A>G" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227511A>G" "" "likely pathogenic" "" "0000825045" "0" "90" "X" "22245647" "22245648" "del" "0" "00006" "PHEX_000332" "g.22245647_22245648del" "" "{PMID:Gaucher 2009:19219621}" "" "1989_1990delCA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227530_22227531del" "" "pathogenic" "" "0000825046" "0" "90" "X" "22245676" "22245694" "del" "0" "00006" "PHEX_000335" "g.22245676_22245694del" "" "{PMID:Gaucher 2009:19219621}" "" "2018_2036delTACCAGGCATCACATTCAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227559_22227577del" "" "pathogenic" "" "0000825047" "0" "90" "X" "22245698" "22245699" "del" "0" "00006" "PHEX_000337" "g.22245698_22245699del" "" "{PMID:Gaucher 2009:19219621}" "" "2040_2041delCA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227581_22227582del" "" "pathogenic" "" "0000825048" "0" "90" "X" "22245718" "22245721" "dup" "0" "00006" "PHEX_000338" "g.22245718_22245721dup" "" "{PMID:Gaucher 2009:19219621}" "" "2063_2064insGTTA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227601_22227604dup" "" "pathogenic" "" "0000825049" "0" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000340" "g.22263448A>C" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245331A>C" "" "pathogenic" "" "0000825050" "0" "90" "X" "22263468" "22263471" "dup" "0" "00006" "PHEX_000344" "g.22263468_22263471dup" "" "{PMID:Gaucher 2009:19219621}" "" "2092-2093insAGAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245351_22245354dup" "" "pathogenic" "" "0000825051" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000825052" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000825053" "0" "90" "X" "22263517" "22263517" "dup" "0" "00006" "PHEX_000348" "g.22263517dup" "" "{PMID:Gaucher 2009:19219621}" "" "2138_2139insC" "" "Germline" "" "" "0" "" "" "g.22245400dup" "" "pathogenic" "" "0000825054" "0" "90" "X" "22265967" "22265967" "subst" "0" "00006" "PHEX_000158" "g.22265967G>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22247850G>T" "" "pathogenic" "" "0000825055" "0" "70" "X" "22265970" "22265970" "subst" "0" "00006" "PHEX_000351" "g.22265970T>A" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247853T>A" "" "likely pathogenic" "" "0000825056" "0" "70" "X" "" "" "" "" "00006" "PHEX_000189" "g.[22265975G>T/=]" "" "{PMID:Gaucher 2009:19219621}" "" "[=;2155G>T]" "mosaicism" "Germline/De novo (untested)" "" "" "0" "" "" "g.[22247858G>T/=]" "" "likely pathogenic" "" "0000825057" "0" "90" "X" "22265980" "22265995" "del" "0" "00006" "PHEX_000352" "g.22265980_22265995del" "" "{PMID:Gaucher 2009:19219621}" "" "2160_2175delAATTAGTAACTTTGAA" "" "Germline" "" "" "0" "" "" "g.22247863_22247878del" "" "pathogenic" "" "0000825058" "0" "90" "X" "22265987" "22265990" "dup" "0" "00006" "PHEX_000354" "g.22265987_22265990dup" "" "{PMID:Gaucher 2009:19219621}" "" "c.2171_2172insAACT (Phe724X)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247870_22247873dup" "" "pathogenic" "" "0000825059" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000825060" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000825061" "0" "10" "X" "22051091" "22051091" "subst" "0.0928897" "00006" "PHEX_000084" "g.22051091C>T" "0.10" "{PMID:Gaucher 2009:19219621}" "" "1-33C>T" "" "Germline" "" "rs5951494" "0" "" "" "g.22032973C>T" "" "benign" "" "0000825062" "0" "10" "X" "22065121" "22065121" "subst" "0.170964" "00006" "PHEX_000201" "g.22065121C>T" "0.20" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "rs178720" "0" "" "" "g.22047003C>T" "" "benign" "" "0000825063" "0" "10" "X" "22112355" "22112355" "=" "0" "00006" "PHEX_000241" "g.22112355=" "0.025" "{PMID:Gaucher 2009:19219621}" "" "849+138G>A" "" "Germline" "" "rs6629449" "0" "" "" "g.22094237=" "" "benign" "" "0000825064" "0" "10" "X" "22115202" "22115202" "subst" "0" "00006" "PHEX_000243" "g.22115202A>G" "0.035" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "" "0" "" "" "g.22097084A>G" "" "benign" "" "0000825065" "0" "10" "X" "22239720" "22239720" "subst" "0.26339" "00006" "PHEX_000310" "g.22239720C>T" "0.30" "{PMID:Gaucher 2009:19219621}" "" "" "" "Germline" "" "rs3752433" "0" "" "" "g.22221603C>T" "" "benign" "" "0000825066" "0" "10" "X" "22244539" "22244540" "del" "0" "00006" "PHEX_000015" "g.22244539_22244540del" "0.28" "{PMID:Gaucher 2009:19219621}" "" "1900-20delTT" "" "Germline" "" "rs60807057" "0" "" "" "g.22226422_22226423del" "" "benign" "" "0000825369" "0" "90" "X" "22108553" "22108553" "subst" "0" "00006" "PHEX_000176" "g.22108553C>T" "" "{PMID:Chou 2005:15818436}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000825370" "0" "90" "X" "22263469" "22263470" "del" "0" "00006" "PHEX_000177" "g.22263469_22263470del" "" "{PMID:Chou 2005:15818436}" "" "2090delGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245352_22245353del" "" "pathogenic (dominant)" "" "0000825371" "11" "90" "X" "22095774" "22095774" "subst" "0" "00006" "PHEX_000178" "g.22095774T>G" "" "{PMID:Lo 2006:16636593}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825372" "21" "90" "X" "22239787" "22239791" "del" "0" "00006" "PHEX_000179" "g.22239787_22239791del" "" "{PMID:Lo 2006:16636593}" "" "1826–1830delAAAAG" "" "Germline" "yes" "" "0" "" "" "g.22221670_22221674del" "" "pathogenic (dominant)" "" "0000825375" "20" "90" "X" "22094598" "22094598" "subst" "0" "00006" "PHEX_000038" "g.22094598T>C" "" "{PMID:Makras 2008:18252791}" "" "IVS4+6T>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000825376" "21" "90" "X" "22115137" "22115137" "subst" "0" "00006" "PHEX_000180" "g.22115137T>C" "" "{PMID:Raeder 2008:18775977}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825378" "20" "90" "X" "22029061" "22081204" "del" "0" "00006" "PHEX_000181" "g.22029061_22081204del" "" "{PMID:Saito 2009:19581284}" "" "del ex1-3" "52143 bp deletion" "Germline" "" "" "0" "" "" "g.22010943_22063086del" "" "pathogenic (dominant)" "" "0000825380" "0" "90" "X" "22196493" "22196494" "del" "0" "00006" "PHEX_000182" "g.22196493_22196494del" "" "{PMID:Kim 2009:19429806}" "" "1586_1586+1delAG" "" "Germline" "" "" "0" "" "" "g.22178376_22178377del" "" "pathogenic (dominant)" "" "0000825392" "0" "90" "X" "22065244" "22065244" "del" "0" "00006" "PHEX_000207" "g.22065244del" "" "{PMID:Xia 2007:18046499}" "" "264delG" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.22047126del" "" "pathogenic" "" "0000825393" "21" "90" "X" "22065244" "22065244" "del" "0" "00006" "PHEX_000207" "g.22065244del" "" "{PMID:Xia 2007:18046499}" "" "265delG" "" "Germline" "yes" "" "0" "" "" "g.22047126del" "" "pathogenic" "" "0000825394" "21" "90" "X" "22065244" "22065244" "del" "0" "00006" "PHEX_000207" "g.22065244del" "" "{PMID:Xia 2007:18046499}" "" "266delG" "" "Germline" "yes" "" "0" "" "" "g.22047126del" "" "pathogenic" "" "0000825395" "21" "90" "X" "22065244" "22065244" "del" "0" "00006" "PHEX_000207" "g.22065244del" "" "{PMID:Xia 2007:18046499}" "" "267delG" "" "Germline" "yes" "" "0" "" "" "g.22047126del" "" "pathogenic" "" "0000825396" "0" "70" "X" "22231048" "22231048" "subst" "0" "00006" "PHEX_000184" "g.22231048C>G" "" "{PMID:Xia 2007:18046499}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.22212931C>G" "" "pathogenic" "" "0000825397" "21" "70" "X" "22231048" "22231048" "subst" "0" "00006" "PHEX_000184" "g.22231048C>G" "" "{PMID:Xia 2007:18046499}" "" "" "" "Germline" "yes" "" "0" "" "" "g.22212931C>G" "" "pathogenic" "" "0000825398" "0" "90" "X" "22239770" "22239770" "subst" "0" "00006" "PHEX_000314" "g.22239770G>A" "" "{PMID:Xia 2007:18046499}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.22221653G>A" "" "pathogenic" "" "0000825399" "21" "90" "X" "22239770" "22239770" "subst" "0" "00006" "PHEX_000314" "g.22239770G>A" "" "{PMID:Xia 2007:18046499}" "" "" "" "Germline" "yes" "" "0" "" "" "g.22221653G>A" "" "pathogenic" "" "0000825400" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825401" "21" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825402" "3" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825403" "21" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825404" "0" "90" "X" "22132619" "22132619" "subst" "0" "00006" "PHEX_000069" "g.22132619G>A" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "De novo" "" "" "0" "" "" "g.22114501G>A" "" "pathogenic" "" "0000825405" "0" "90" "X" "22196388" "22196388" "subst" "0" "00006" "PHEX_000285" "g.22196388A>G" "" "{PMID:Durmaz 2013:23079138}" "" "IVS13-2A>G" "" "De novo" "" "" "0" "" "" "g.22178271A>G" "" "pathogenic" "" "0000825406" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Durmaz 2013:23079138}" "" "IVS15+1G>A" "" "De novo" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000825407" "0" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000283" "g.22186507G>T" "" "{PMID:Durmaz 2013:23079138}" "" "IVS13+1G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168390G>T" "" "pathogenic" "" "0000825408" "21" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000283" "g.22186507G>T" "" "{PMID:Durmaz 2013:23079138}" "" "IVS13+1G>T" "" "Germline" "" "" "0" "" "" "g.22168390G>T" "" "pathogenic" "" "0000825409" "0" "90" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000343" "g.22263457G>T" "" "{PMID:Durmaz 2013:23079138}" "" "" "" "De novo" "" "" "0" "" "" "g.22245340G>T" "" "pathogenic" "" "0000825410" "0" "90" "X" "22117123" "22117123" "subst" "0" "00006" "PHEX_000183" "g.22117123G>T" "" "{PMID:Cheon 2014:24926462}" "" "IVS8-1G>T" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000825412" "0" "90" "X" "22266017" "22266017" "subst" "0" "00006" "PHEX_000356" "g.22266017T>C" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247900T>C" "" "pathogenic" "" "0000825413" "21" "90" "X" "22266017" "22266017" "subst" "0" "00006" "PHEX_000356" "g.22266017T>C" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline" "" "" "0" "" "" "g.22247900T>C" "" "pathogenic" "" "0000825414" "0" "90" "X" "22231021" "22231021" "subst" "0" "00006" "PHEX_000294" "g.22231021G>C" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212904G>C" "" "pathogenic" "" "0000825415" "21" "90" "X" "22231021" "22231021" "subst" "0" "00006" "PHEX_000294" "g.22231021G>C" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline" "" "" "0" "" "" "g.22212904G>C" "" "pathogenic" "" "0000825416" "0" "90" "X" "22056616" "22056616" "subst" "0" "00006" "PHEX_000198" "g.22056616A>T" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038498A>T" "" "pathogenic" "" "0000825417" "0" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000358" "g.22266018G>A" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247901G>A" "" "pathogenic" "" "0000825418" "21" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000358" "g.22266018G>A" "" "{PMID:Huang 2015:25839938}" "" "" "" "Germline" "" "" "0" "" "" "g.22247901G>A" "" "pathogenic" "" "0000825420" "10" "90" "X" "22208617" "22208617" "subst" "0" "00006" "PHEX_000185" "g.22208617T>C" "" "{PMID:Xie 2014:25237965}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000825422" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000186" "g.22231074C>T/=" "" "{PMID:Goji 2006:16303832}" "" "" "germline mosaicism" "Somatic" "" "" "0" "" "" "" "" "pathogenic" "" "0000825423" "11" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Goji 2006:16303832}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000825424" "20" "90" "X" "22056645" "22056645" "del" "0" "00006" "PHEX_000187" "g.22056645del" "" "{PMID:Roetzer 2007:17406123}" "" "" "" "Germline" "" "" "0" "" "" "g.22038527del" "" "pathogenic" "" "0000825425" "21" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000825426" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000825427" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000825428" "21" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000825429" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000825430" "0" "90" "X" "22095622" "22095623" "dup" "0" "00006" "PHEX_000223" "g.22095622_22095623dup" "" "{PMID:Song 2007:18162710}" "" "c.466_467insAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077504_22077505dup" "" "pathogenic" "" "0000825431" "0" "90" "X" "22132575" "22132575" "subst" "0" "00006" "PHEX_000266" "g.22132575G>A" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114457G>A" "" "pathogenic" "" "0000825432" "0" "90" "X" "22132575" "22132575" "subst" "0" "00006" "PHEX_000266" "g.22132575G>A" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114457G>A" "" "pathogenic" "" "0000825433" "0" "90" "X" "22051187" "22051187" "subst" "0.0000336481" "00006" "PHEX_000192" "g.22051187G>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033069G>T" "" "pathogenic" "" "0000825434" "21" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825435" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825436" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825437" "0" "90" "X" "22237225" "22237225" "subst" "0" "00006" "PHEX_000309" "g.22237225G>A" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219108G>A" "" "pathogenic" "" "0000825438" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Song 2007:18162710}" "" "" "" "Germline" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic" "" "0000825439" "1" "70" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "likely pathogenic" "" "0000825440" "1" "70" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "likely pathogenic" "" "0000825441" "0" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000218" "g.22094593G>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076475G>C" "" "pathogenic" "" "0000825442" "0" "90" "X" "22094597" "22094600" "del" "0" "00006" "PHEX_000221" "g.22094597_22094600del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.436+5_8delGTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076479_22076482del" "" "pathogenic" "" "0000825443" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.1586+3_6delGAGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000825444" "0" "90" "X" "22196499" "22196499" "subst" "0" "00006" "PHEX_000289" "g.22196499T>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178382T>C" "" "pathogenic" "" "0000825445" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000825446" "0" "90" "X" "22208625" "22208625" "subst" "0" "00006" "PHEX_000293" "g.22208625T>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190508T>C" "" "pathogenic" "" "0000825447" "0" "90" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000307" "g.22237221G>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219104G>C" "" "pathogenic" "" "0000825448" "0" "90" "X" "22065308" "22065310" "del" "0" "00006" "PHEX_000210" "g.22065308_22065310del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.328_330delAAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047190_22047192del" "" "pathogenic" "" "0000825449" "0" "90" "X" "22196432" "22196432" "del" "0" "00006" "PHEX_000166" "g.22196432del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.1525delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178315del" "" "pathogenic" "" "0000825450" "0" "90" "X" "22231060" "22231060" "del" "0" "00006" "PHEX_000296" "g.22231060del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.1685delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212943del" "" "pathogenic" "" "0000825451" "0" "90" "X" "22239770" "22239777" "del" "0" "00006" "PHEX_000315" "g.22239770_22239777del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.1809_1816delGTCTACTG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221653_22221660del" "" "pathogenic" "" "0000825452" "1" "90" "X" "22239809" "22239809" "del" "0" "00006" "PHEX_000318" "g.22239809del" "" "{PMID:Ichikawa 2008:18625346}" "" "c.1848delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221692del" "" "pathogenic" "" "0000825453" "0" "90" "X" "22129614" "22129614" "subst" "0" "00006" "PHEX_000260" "g.22129614T>G" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111496T>G" "" "pathogenic" "" "0000825454" "1" "90" "X" "22231021" "22231021" "subst" "0" "00006" "PHEX_000294" "g.22231021G>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212904G>C" "" "pathogenic" "" "0000825455" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000825456" "1" "90" "X" "22237209" "22237209" "subst" "0" "00006" "PHEX_000304" "g.22237209T>C" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219092T>C" "" "pathogenic" "" "0000825457" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825458" "0" "50" "X" "22065268" "22065268" "subst" "0.00278782" "00006" "PHEX_000208" "g.22065268A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047150A>G" "" "VUS" "" "0000825459" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825460" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825461" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825462" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825463" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825464" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "not in 867 control chromosomes" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825465" "2" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825466" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825467" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825468" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825469" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825470" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825471" "1" "50" "X" "22266128" "22266128" "subst" "0" "00006" "PHEX_000362" "g.22266128C>T" "" "{PMID:Ichikawa 2008:18625346}" "" "[*58C>T;*231A>G]" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248011C>T" "" "VUS" "" "0000825472" "0" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Clausmeyer 2009:19513579}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825473" "1" "90" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Clausmeyer 2009:19513579}" "" "" "" "Germline" "" "" "0" "" "" "g.22248184A>G" "" "pathogenic" "" "0000825474" "20" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000218" "g.22094593G>C" "" "{PMID:Clausmeyer 2009:19513579}" "" "G28S;delThr535" "probable somatic mosaicism" "Somatic" "" "" "0" "" "" "g.22076475G>C" "" "pathogenic" "" "0000825475" "21" "90" "X" "22094597" "22094600" "del" "0" "00006" "PHEX_000221" "g.22094597_22094600del" "" "{PMID:Clausmeyer 2009:19513579}" "" "C59S;A363V" "" "Germline" "" "" "0" "" "" "g.22076479_22076482del" "" "pathogenic" "" "0000825476" "21" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000704" "g.(22263527_22265967)_(22269427_?)del" "" "{PMID:Clausmeyer 2009:19513579}" "" "del ex22" ">1.5 kb deletion" "Germline" "" "" "0" "" "" "g.(22245410_22247850)_(22251310_?)del" "" "pathogenic" "" "0000825477" "0" "90" "X" "22196499" "22196499" "subst" "0" "00006" "PHEX_000703" "g.(22245729_22263449)_(22269427_?)del" "" "{PMID:Clausmeyer 2009:19513579}" "" "del ex21-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22227612_22245332)_(22251310_?)del" "" "pathogenic" "" "0000825478" "1" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000684" "g.(?_22050443)_(22117270_22129584)del" "" "{PMID:Clausmeyer 2009:19513579}" "" "del ex1-9" ">67 kb deletion" "Germline" "" "" "0" "" "" "g.(?_22032325)_(22099152_22111466)del" "" "pathogenic" "" "0000825479" "0" "90" "X" "22208625" "22208625" "subst" "0" "00006" "PHEX_000688" "g.(22065330_22094505)_(22245729_22263449)del" "" "{PMID:Clausmeyer 2009:19513579}" "" "del ex4-20" ">150 kb deletion" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22227612_22245332)del" "" "pathogenic" "" "0000825480" "21" "30" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000307" "g.22237221G>C" "" "{PMID:Clausmeyer 2009:19513579}" "" "G28S;delThr535" "" "Germline" "" "" "0" "" "" "g.22219104G>C" "" "likely benign" "" "0000825481" "21" "50" "X" "22065308" "22065310" "del" "0" "00006" "PHEX_000210" "g.22065308_22065310del" "" "{PMID:Clausmeyer 2009:19513579}" "" "C59S;A363V" "" "Germline" "" "" "0" "" "" "g.22047190_22047192del" "" "VUS" "" "0000825594" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic" "" "0000825595" "0" "90" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000385" "g.22065192A>C" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22047074A>C" "" "pathogenic" "" "0000825596" "0" "90" "X" "22094553" "22094553" "subst" "0" "00006" "PHEX_000369" "g.22094553C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22076435C>T" "" "pathogenic" "" "0000825597" "0" "90" "X" "22095639" "22095639" "subst" "0" "00006" "PHEX_000397" "g.22095639G>C" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22077521G>C" "" "pathogenic" "" "0000825598" "0" "90" "X" "22108557" "22108557" "del" "0" "00006" "PHEX_000403" "g.22108557del" "" "{PMID:Ruppe 2011:21050253}" "" "674delA" "" "Germline" "" "" "0" "" "" "g.22090439del" "" "pathogenic" "" "0000825599" "0" "90" "X" "22112218" "22112218" "subst" "0" "00006" "PHEX_000238" "g.22112218G>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22094100G>T" "" "pathogenic" "" "0000825600" "0" "90" "X" "22117234" "22117234" "del" "0" "00006" "PHEX_000252" "g.22117234del" "" "{PMID:Ruppe 2011:21050253}" "" "1042delA" "" "Germline" "" "" "0" "" "" "g.22099116del" "" "pathogenic" "" "0000825601" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22099152G>A" "" "pathogenic" "" "0000825602" "0" "90" "X" "22129669" "22129669" "dup" "0" "00006" "PHEX_000422" "g.22129669dup" "" "{PMID:Ruppe 2011:21050253}" "" "1163insA" "" "Germline" "" "" "0" "" "" "g.22111551dup" "" "pathogenic" "" "0000825603" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Ruppe 2011:21050253}" "" "del ex6-10" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000825604" "0" "90" "X" "22132633" "22132633" "subst" "0" "00006" "PHEX_000430" "g.22132633G>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22114515G>T" "" "pathogenic" "" "0000825605" "0" "90" "X" "22132617" "22132618" "ins" "0" "00006" "PHEX_000429" "g.22132617_22132618insC" "" "{PMID:Ruppe 2011:21050253}" "" "1305insC (406C>L, 411E>X)" "" "Germline" "" "" "0" "" "" "g.22114499_22114500insC" "" "pathogenic" "" "0000825606" "0" "90" "X" "22151686" "22151686" "subst" "0" "00006" "PHEX_000437" "g.22151686T>C" "" "{PMID:Ruppe 2011:21050253}" "" "1348T>C (450L>P)" "" "Germline" "" "" "0" "" "" "g.22133569T>C" "" "pathogenic" "" "0000825607" "0" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000282" "g.22186507G>C" "" "{PMID:Ruppe 2011:21050253}" "" "1483+1G>C" "" "Germline" "" "" "0" "" "" "g.22168390G>C" "" "pathogenic" "" "0000825608" "0" "90" "X" "22196429" "22196429" "subst" "0" "00006" "PHEX_000128" "g.22196429C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22178312C>T" "" "pathogenic" "" "0000825609" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000825610" "0" "90" "X" "22231033" "22231033" "subst" "0" "00006" "PHEX_000455" "g.22231033G>A" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22212916G>A" "" "pathogenic" "" "0000825611" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000825612" "0" "90" "X" "22237157" "22237158" "del" "0" "00006" "PHEX_000459" "g.22237157_22237158del" "" "{PMID:Ruppe 2011:21050253}" "" "1705_6delCT" "" "Germline" "" "" "0" "" "" "g.22219040_22219041del" "" "pathogenic" "" "0000825613" "0" "90" "X" "22237179" "22237190" "del" "0" "00006" "PHEX_000464" "g.22237179_22237190del" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22219062_22219073del" "" "pathogenic" "" "0000825614" "0" "90" "X" "22239729" "22239729" "subst" "0" "00006" "PHEX_000468" "g.22239729G>C" "" "{PMID:Ruppe 2011:21050253}" "" "1768-1G>C" "" "Germline" "" "" "0" "" "" "g.22221612G>C" "" "pathogenic" "" "0000825615" "0" "90" "X" "22239805" "22239808" "dup" "0" "00006" "PHEX_000472" "g.22239805_22239808dup" "" "{PMID:Ruppe 2011:21050253}" "" "1847insCAAA" "" "Germline" "" "" "0" "" "" "g.22221688_22221691dup" "" "pathogenic" "" "0000825616" "0" "90" "X" "22239861" "22239861" "subst" "0" "00006" "PHEX_000475" "g.22239861G>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22221744G>T" "" "pathogenic" "" "0000825617" "0" "90" "X" "22244596" "22244596" "subst" "0" "00006" "PHEX_000477" "g.22244596G>A" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22226479G>A" "" "pathogenic" "" "0000825618" "0" "90" "X" "22245624" "22245627" "dup" "0" "00006" "PHEX_000484" "g.22245624_22245627dup" "" "{PMID:Ruppe 2011:21050253}" "" "1966insGCTT" "" "Germline" "" "" "0" "" "" "g.22227507_22227510dup" "" "pathogenic" "" "0000825619" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000825620" "0" "90" "X" "22266069" "22266069" "subst" "0" "00006" "PHEX_000504" "g.22266069A>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22247952A>T" "" "pathogenic" "" "0000825632" "0" "90" "X" "22129623" "22129623" "subst" "0.00000559904" "00006" "PHEX_000421" "g.22129623C>T" "" "{PMID:Ruppe 2011:21050253}" "" "" "" "Germline" "" "" "0" "" "" "g.22111505C>T" "" "pathogenic" "" "0000825651" "21" "90" "X" "22065266" "22065266" "subst" "0" "00006" "PHEX_000364" "g.22065266G>T" "" "{PMID:Chandran 2010:20664300}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827021" "1" "90" "X" "22239804" "22239804" "del" "0" "00006" "PHEX_000470" "g.22239804del" "" "{PMID:Jap 2011:21293852}" "" "1843delA" "" "Germline" "" "" "0" "" "" "g.22221687del" "" "pathogenic (dominant)" "" "0000827022" "1" "90" "X" "22095822" "22095822" "del" "0" "00006" "PHEX_000401" "g.22095822del" "" "{PMID:Jap 2011:21293852}" "" "IVS5+2delt" "" "Germline" "" "" "0" "" "" "g.22077704del" "" "pathogenic (dominant)" "" "0000827023" "0" "90" "X" "22239862" "22239862" "subst" "0" "00006" "PHEX_000476" "g.22239862T>A" "" "{PMID:Jap 2011:21293852}" "" "IVS18+2t>a" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221745T>A" "" "pathogenic" "" "0000827024" "0" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000358" "g.22266018G>A" "" "{PMID:Jap 2011:21293852}" "" "p.C733Y" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247901G>A" "" "pathogenic" "" "0000827025" "1" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Jap 2011:21293852}" "" "p.G579R" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic (dominant)" "" "0000827026" "20" "90" "X" "22112103" "22112103" "subst" "0" "00006" "PHEX_000405" "g.22112103T>G" "" "{PMID:Kienitz 2011:21553362}" "" "" "" "Germline" "" "" "0" "" "" "g.22093985T>G" "" "pathogenic (dominant)" "" "0000827027" "11" "90" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Kienitz 2011:21553362}" "" "" "" "Germline" "" "" "0" "" "" "g.22226495G>C" "" "pathogenic (dominant)" "" "0000827028" "0" "90" "X" "22117169" "22117169" "dup" "0" "00006" "PHEX_000365" "g.22117169dup" "" "{PMID:Ellison 2009:19309785}" "" "979dupT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099051dup" "" "pathogenic (dominant)" "" "0000827029" "0" "70" "X" "22117227" "22117227" "subst" "0" "00006" "PHEX_000417" "g.22117227A>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099109A>G" "" "likely pathogenic" "" "0000827030" "0" "70" "X" "22208612" "22208612" "subst" "0" "00006" "PHEX_000451" "g.22208612C>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190495C>G" "" "likely pathogenic" "" "0000827031" "0" "90" "X" "22237169" "22237169" "subst" "0" "00006" "PHEX_000462" "g.22237169G>C" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219052G>C" "" "pathogenic" "" "0000827032" "0" "90" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000343" "g.22263457G>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245340G>T" "" "pathogenic" "" "0000827033" "0" "50" "X" "22265969" "22265969" "subst" "0" "00006" "PHEX_000495" "g.22265969G>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247852G>T" "" "VUS" "" "0000827034" "0" "90" "X" "22065302" "22065302" "subst" "0" "00006" "PHEX_000391" "g.22065302A>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047184A>T" "" "pathogenic" "" "0000827035" "21" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000827036" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000827037" "0" "90" "X" "22115154" "22115154" "subst" "0" "00006" "PHEX_000174" "g.22115154C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097036C>T" "" "pathogenic" "" "0000827038" "0" "90" "X" "22115154" "22115154" "subst" "0" "00006" "PHEX_000174" "g.22115154C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097036C>T" "" "pathogenic" "" "0000827039" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000827040" "21" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22133583G>T" "" "pathogenic" "" "0000827041" "0" "90" "X" "22196443" "22196443" "subst" "0" "00006" "PHEX_000444" "g.22196443T>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178326T>A" "" "pathogenic" "" "0000827042" "21" "90" "X" "22196443" "22196443" "subst" "0" "00006" "PHEX_000444" "g.22196443T>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22178326T>A" "" "pathogenic" "" "0000827043" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000827044" "0" "90" "X" "22245629" "22245629" "subst" "0" "00006" "PHEX_000485" "g.22245629C>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227512C>G" "" "pathogenic" "" "0000827045" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000827046" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827047" "0" "50" "X" "22094597" "22094597" "subst" "0" "00006" "PHEX_000394" "g.22094597G>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076479G>A" "" "VUS" "" "0000827048" "0" "90" "X" "22115071" "22115071" "subst" "0" "00006" "PHEX_000409" "g.22115071A>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096953A>G" "" "pathogenic" "" "0000827049" "0" "90" "X" "22129680" "22129680" "subst" "0" "00006" "PHEX_000423" "g.22129680T>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111562T>A" "" "pathogenic" "" "0000827050" "0" "90" "X" "22196495" "22196495" "subst" "0" "00006" "PHEX_000449" "g.22196495T>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178378T>G" "" "pathogenic" "" "0000827051" "0" "90" "X" "22231020" "22231020" "subst" "0" "00006" "PHEX_000454" "g.22231020G>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212903G>A" "" "pathogenic" "" "0000827052" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000827053" "0" "70" "X" "22237152" "22237152" "del" "0" "00006" "PHEX_000458" "g.22237152del" "" "{PMID:Park 2021:34434907}" "" "c.1701-1delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219035del" "" "likely pathogenic" "" "0000827054" "0" "90" "X" "22231076" "22231076" "subst" "0" "00006" "PHEX_000298" "g.22231076G>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212959G>A" "" "pathogenic" "" "0000827055" "0" "90" "X" "22265967" "22265967" "subst" "0" "00006" "PHEX_000494" "g.22265967G>A" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247850G>A" "" "pathogenic" "" "0000827056" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000827057" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Park 2021:34434907}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000827058" "0" "90" "X" "22051138" "22051139" "del" "0" "00006" "PHEX_000086" "g.22051138_22051139del" "" "{PMID:Park 2021:34434907}" "" "c.15_16delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033020_22033021del" "" "pathogenic" "" "0000827059" "0" "90" "X" "22056600" "22056615" "dup" "0" "00006" "PHEX_000381" "g.22056600_22056615dup" "" "{PMID:Park 2021:34434907}" "" "c.130_145dupCTCTTAAGTCTCCAAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038482_22038497dup" "" "pathogenic" "" "0000827060" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Park 2021:34434907}" "" "c.208_212delGTAAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000827061" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Park 2021:34434907}" "" "c.208_212delGTAAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000827062" "0" "90" "X" "22129588" "22129588" "del" "0" "00006" "PHEX_000420" "g.22129588del" "" "{PMID:Park 2021:34434907}" "" "c.1082delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111470del" "" "pathogenic" "" "0000827063" "1" "90" "X" "22129588" "22129588" "del" "0" "00006" "PHEX_000420" "g.22129588del" "" "{PMID:Park 2021:34434907}" "" "c.1082delC" "" "Germline" "" "" "0" "" "" "g.22111470del" "" "pathogenic" "" "0000827064" "1" "90" "X" "22132579" "22132580" "del" "0" "00006" "PHEX_000424" "g.22132579_22132580del" "" "{PMID:Park 2021:34434907}" "" "c.1177_1178delAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114461_22114462del" "" "pathogenic" "" "0000827065" "11" "90" "X" "22132579" "22132580" "del" "0" "00006" "PHEX_000424" "g.22132579_22132580del" "" "{PMID:Park 2021:34434907}" "" "c.1177_1178delAT" "" "Germline" "" "" "0" "" "" "g.22114461_22114462del" "" "pathogenic" "" "0000827066" "0" "90" "X" "22132579" "22132580" "del" "0" "00006" "PHEX_000424" "g.22132579_22132580del" "" "{PMID:Park 2021:34434907}" "" "c.1177_1178delAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114461_22114462del" "" "pathogenic" "" "0000827067" "0" "90" "X" "22151670" "22151670" "del" "0" "00006" "PHEX_000436" "g.22151670del" "" "{PMID:Park 2021:34434907}" "" "c.1331delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133553del" "" "pathogenic" "" "0000827068" "0" "90" "X" "22196433" "22196433" "del" "0" "00006" "PHEX_000443" "g.22196433del" "" "{PMID:Park 2021:34434907}" "" "c.1526delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178316del" "" "pathogenic" "" "0000827069" "0" "90" "X" "22196493" "22196494" "del" "0" "00006" "PHEX_000182" "g.22196493_22196494del" "" "{PMID:Park 2021:34434907}" "" "c.1585_1586delGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178376_22178377del" "" "pathogenic" "" "0000827070" "0" "90" "X" "22266046" "22266050" "dup" "0" "00006" "PHEX_000501" "g.22266046_22266050dup" "" "{PMID:Park 2021:34434907}" "" "c.2226_2230dupCATGG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247929_22247933dup" "" "pathogenic" "" "0000827071" "0" "70" "X" "22117188" "22117190" "del" "0" "00006" "PHEX_000414" "g.22117188_22117190del" "" "{PMID:Park 2021:34434907}" "" "c.996_998delCAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099070_22099072del" "" "likely pathogenic" "" "0000827072" "21" "90" "X" "" "" "" "" "00006" "PHEX_000683" "g.(?_22050443)_(22065330_22094505)del" "" "{PMID:Park 2021:34434907}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "g.(?_22032325)_(22047212_22076387)del" "" "pathogenic" "" "0000827073" "0" "90" "X" "" "" "" "" "00006" "PHEX_000683" "g.(?_22050443)_(22065330_22094505)del" "" "{PMID:Park 2021:34434907}" "" "del ex1-3" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22047212_22076387)del" "" "pathogenic" "" "0000827074" "0" "90" "X" "" "" "" "" "00006" "PHEX_000691" "g.(22112218_22115072)_(22117270_22129584)del" "" "{PMID:Park 2021:34434907}" "" "del ex8-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22094100_22096954)_(22099152_22111466)del" "" "pathogenic" "" "0000827075" "0" "90" "X" "" "" "" "" "00006" "PHEX_000692" "g.(22117270_22129584)_(22132705_22151639)del" "" "{PMID:Park 2021:34434907}" "" "del ex10-11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22099152_22111466)_(22114587_22133522)del" "" "pathogenic" "" "0000827076" "0" "90" "X" "" "" "" "" "00006" "PHEX_000696" "g.(22151742_22186428)_(22269427_?)del" "" "{PMID:Park 2021:34434907}" "" "del ex 13-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22251310_?)del" "" "pathogenic" "" "0000827079" "1" "90" "X" "" "" "" "" "00006" "PHEX_000683" "g.(?_22050443)_(22065330_22094505)del" "" "{PMID:Kinoshita 2012:22577109}" "" "del ex1-3" "family, 2 affected" "Germline" "" "" "0" "" "" "g.(?_22032325)_(22047212_22076387)del" "" "pathogenic" "" "0000827080" "1" "90" "X" "" "" "" "" "00006" "PHEX_000683" "g.(?_22050443)_(22065330_22094505)del" "" "{PMID:Kinoshita 2012:22577109}" "" "del ex1-3" "" "Germline" "" "" "0" "" "" "g.(?_22032325)_(22047212_22076387)del" "" "pathogenic" "" "0000827081" "1" "90" "X" "22244606" "22244606" "subst" "0" "00006" "PHEX_000481" "g.22244606G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "family, 3 affected" "Germline" "" "" "0" "" "" "g.22226489G>A" "" "pathogenic" "" "0000827082" "1" "90" "X" "22244606" "22244606" "subst" "0" "00006" "PHEX_000481" "g.22244606G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline" "" "" "0" "" "" "g.22226489G>A" "" "pathogenic" "" "0000827083" "1" "90" "X" "22244606" "22244606" "subst" "0" "00006" "PHEX_000481" "g.22244606G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline" "" "" "0" "" "" "g.22226489G>A" "" "pathogenic" "" "0000827084" "1" "90" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000450" "g.22208574C>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "family, 2 affected" "Germline" "" "" "0" "" "" "g.22190457C>A" "" "pathogenic" "" "0000827085" "1" "90" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000450" "g.22208574C>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline" "" "" "0" "" "" "g.22190457C>A" "" "pathogenic" "" "0000827086" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Kinoshita 2012:22577109}" "" "IVS20-2(A>G)" "family, 3 affected" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000827087" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Kinoshita 2012:22577109}" "" "IVS20-2(A>G)" "" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000827088" "1" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Kinoshita 2012:22577109}" "" "IVS20-2(A>G)" "" "Germline" "" "" "0" "" "" "g.22245331A>G" "" "pathogenic" "" "0000827089" "0" "90" "X" "22245709" "22245709" "subst" "0" "00006" "PHEX_000489" "g.22245709T>G" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227592T>G" "" "pathogenic" "" "0000827091" "0" "90" "X" "22117195" "22117195" "del" "0" "00006" "PHEX_000415" "g.22117195del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.1002delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099077del" "" "pathogenic" "" "0000827092" "0" "90" "X" "22094505" "22094505" "subst" "0" "00006" "PHEX_000392" "g.22094505G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "IVS3-1(G>A)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076387G>A" "" "pathogenic" "" "0000827093" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000827094" "0" "90" "X" "22051138" "22051139" "del" "0" "00006" "PHEX_000086" "g.22051138_22051139del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.15_16delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033020_22033021del" "" "pathogenic" "" "0000827095" "0" "90" "X" "22056656" "22056656" "del" "0" "00006" "PHEX_000383" "g.22056656del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.186delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038538del" "" "pathogenic" "" "0000827096" "0" "90" "X" "22065201" "22065202" "del" "0" "00006" "PHEX_000386" "g.22065201_22065202del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.219_220delTG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047083_22047084del" "" "pathogenic" "" "0000827097" "1" "90" "X" "22095724" "22095733" "del" "0" "00006" "PHEX_000399" "g.22095724_22095733del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.564_573del" "family, 4 affected" "Germline" "" "" "0" "" "" "g.22077606_22077615del" "" "pathogenic" "" "0000827098" "1" "90" "X" "22095724" "22095733" "del" "0" "00006" "PHEX_000399" "g.22095724_22095733del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.564_573del" "" "Germline" "" "" "0" "" "" "g.22077606_22077615del" "" "pathogenic" "" "0000827099" "1" "90" "X" "22095724" "22095733" "del" "0" "00006" "PHEX_000399" "g.22095724_22095733del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.564_573del" "" "Germline" "" "" "0" "" "" "g.22077606_22077615del" "" "pathogenic" "" "0000827100" "1" "90" "X" "22095724" "22095733" "del" "0" "00006" "PHEX_000399" "g.22095724_22095733del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.564_573del" "" "Germline" "" "" "0" "" "" "g.22077606_22077615del" "" "pathogenic" "" "0000827101" "0" "90" "X" "22151705" "22151705" "subst" "0" "00006" "PHEX_000438" "g.22151705G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133588G>A" "" "pathogenic" "" "0000827102" "0" "90" "X" "22196389" "22196389" "subst" "0" "00006" "PHEX_000366" "g.22196389G>A" "" "{PMID:Kinoshita 2012:22577109}" "" "IVS13-1(G>A)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178272G>A" "" "pathogenic" "" "0000827104" "0" "90" "X" "22117224" "22117224" "del" "0" "00006" "PHEX_000416" "g.22117224del" "" "{PMID:Kinoshita 2012:22577109}" "" "c.1034delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099106del" "" "pathogenic" "" "0000827105" "0" "90" "X" "22231021" "22231021" "subst" "0" "00006" "PHEX_000294" "g.22231021G>C" "" "{PMID:Kinoshita 2012:22577109}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212904G>C" "" "pathogenic" "" "0000827632" "21" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827633" "21" "90" "X" "22129662" "22129662" "subst" "0" "00006" "PHEX_000019" "g.22129662G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22111544G>A" "" "pathogenic" "" "0000827634" "21" "90" "X" "22239786" "22239789" "dup" "0" "00006" "PHEX_000469" "g.22239786_22239789dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1824_1825insGAAA" "" "Germline" "" "" "0" "" "" "g.22221669_22221672dup" "" "pathogenic" "" "0000827635" "21" "90" "X" "22065210" "22065210" "subst" "0" "00006" "PHEX_000388" "g.22065210G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22047092G>A" "" "pathogenic" "" "0000827636" "0" "90" "X" "22196496" "22196499" "del" "0" "00006" "PHEX_000131" "g.22196496_22196499del" "" "{PMID:Zheng 2020:32329911}" "" "c.1585_1586+2delGAGT" "" "De novo" "" "" "0" "" "" "g.22178379_22178382del" "" "pathogenic" "" "0000827637" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Zheng 2020:32329911}" "" "IVS15+1G>A" "" "De novo" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000827638" "0" "90" "X" "22112210" "22112210" "subst" "0" "00006" "PHEX_000407" "g.22112210T>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22094092T>A" "" "pathogenic" "" "0000827639" "0" "90" "X" "22132705" "22132705" "subst" "0" "00006" "PHEX_000432" "g.22132705G>A" "" "{PMID:Zheng 2020:32329911}" "" "IVS11+1G>A" "effect on splicing predicted from in vitro splicing assay" "De novo" "" "" "0" "" "" "g.22114587G>A" "" "pathogenic" "" "0000827640" "21" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000827641" "21" "90" "X" "" "" "" "" "00006" "PHEX_000694" "g.(22132705_22151639)_(22151742_22186428)del" "" "{PMID:Zheng 2020:32329911}" "" "del ex12" "" "Germline" "" "" "0" "" "" "g.(22114587_22133522)_(22133625_22168311)del" "" "pathogenic" "" "0000827642" "0" "90" "X" "22056642" "22056642" "del" "0" "00006" "PHEX_000382" "g.22056642del" "" "{PMID:Zheng 2020:32329911}" "" "c.174_174delA" "" "De novo" "" "" "0" "" "" "g.22038524del" "" "pathogenic" "" "0000827643" "21" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Zheng 2020:32329911}" "" "IVS9+1G>A" "effect on splicing predicted from in vitro splicing assay" "Germline" "" "" "0" "" "" "g.22099152G>A" "" "pathogenic" "" "0000827644" "0" "90" "X" "22263472" "22263472" "del" "0" "00006" "PHEX_000345" "g.22263472del" "" "{PMID:Zheng 2020:32329911}" "" "c.2093delC" "" "De novo" "" "" "0" "" "" "g.22245355del" "" "pathogenic" "" "0000827645" "21" "90" "X" "22239740" "22239743" "dup" "0" "00006" "PHEX_000312" "g.22239740_22239743dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1782_1783insTGAT" "" "Germline" "" "" "0" "" "" "g.22221623_22221626dup" "" "pathogenic" "" "0000827646" "21" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000827647" "0" "90" "X" "22239805" "22239806" "del" "0" "00006" "PHEX_000471" "g.22239805_22239806del" "" "{PMID:Zheng 2020:32329911}" "" "c.1843_1844delAC" "" "De novo" "" "" "0" "" "" "g.22221688_22221689del" "" "pathogenic" "" "0000827648" "21" "90" "X" "22239736" "22239739" "dup" "0" "00006" "PHEX_000141" "g.22239736_22239739dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1778_1779insAATA" "" "Germline" "" "" "0" "" "" "g.22221619_22221622dup" "" "pathogenic" "" "0000827649" "0" "90" "X" "22108546" "22108546" "subst" "0" "00006" "PHEX_000402" "g.22108546G>C" "" "{PMID:Zheng 2020:32329911}" "" "IVS5-1G>C" "effect on splicing predicted from in vitro splicing assay" "De novo" "" "" "0" "" "" "g.22090428G>C" "" "pathogenic" "" "0000827650" "0" "90" "X" "22237166" "22237166" "subst" "0" "00006" "PHEX_000461" "g.22237166G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22219049G>A" "" "pathogenic" "" "0000827651" "0" "90" "X" "" "" "" "" "00006" "PHEX_000690" "g.(22108616_22112100)_(22132705_22151639)del" "" "{PMID:Zheng 2020:32329911}" "" "del ex7-11" "" "De novo" "" "" "0" "" "" "g.(22090498_22093982)_(22114587_22133522)del" "" "pathogenic" "" "0000827652" "0" "90" "X" "" "" "" "" "00006" "PHEX_000700" "g.(22231076_22237152)_(22269427_?)del" "" "{PMID:Zheng 2020:32329911}" "" "del ex17-22" "" "De novo" "" "" "0" "" "" "g.(22212959_22219035)_(22251310_?)del" "" "pathogenic" "" "0000827653" "0" "90" "X" "22263519" "22263519" "subst" "0" "00006" "PHEX_000374" "g.22263519C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22245402C>T" "" "pathogenic" "" "0000827654" "21" "90" "X" "22117188" "22117190" "del" "0" "00006" "PHEX_000414" "g.22117188_22117190del" "" "{PMID:Zheng 2020:32329911}" "" "c.996_998delCAT" "" "Germline" "" "" "0" "" "" "g.22099070_22099072del" "" "pathogenic" "" "0000827655" "11" "90" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000389" "g.22065234G>C" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22047116G>C" "" "pathogenic" "" "0000827656" "0" "90" "X" "22245730" "22245730" "subst" "0" "00006" "PHEX_000490" "g.22245730T>G" "" "{PMID:Zheng 2020:32329911}" "" "IVS20+2T>G" "effect on splicing predicted from in vitro splicing assay" "De novo" "" "" "0" "" "" "g.22227613T>G" "" "pathogenic" "" "0000827657" "0" "90" "X" "22196447" "22196447" "subst" "0" "00006" "PHEX_000445" "g.22196447G>C" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22178330G>C" "" "pathogenic" "" "0000827658" "0" "90" "X" "22108616" "22108616" "subst" "0" "00006" "PHEX_000404" "g.22108616G>A" "" "{PMID:Zheng 2020:32329911}" "" "IVS6+1G>A" "effect on splicing predicted from in vitro splicing assay" "De novo" "" "" "0" "" "" "g.22090498G>A" "" "pathogenic" "" "0000827659" "0" "90" "X" "22231033" "22231033" "subst" "0" "00006" "PHEX_000455" "g.22231033G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22212916G>A" "" "pathogenic" "" "0000827660" "21" "90" "X" "22196450" "22196450" "del" "0" "00006" "PHEX_000446" "g.22196450del" "" "{PMID:Zheng 2020:32329911}" "" "c.1543delC" "" "Germline" "" "" "0" "" "" "g.22178333del" "" "pathogenic" "" "0000827661" "21" "90" "X" "22245637" "22245653" "dup" "0" "00006" "PHEX_000486" "g.22245637_22245653dup" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22227520_22227536dup" "" "pathogenic" "" "0000827662" "21" "90" "X" "22263517" "22263517" "dup" "0" "00006" "PHEX_000348" "g.22263517dup" "" "{PMID:Zheng 2020:32329911}" "" "c.2138_2139insC" "" "Germline" "" "" "0" "" "" "g.22245400dup" "" "pathogenic" "" "0000827663" "21" "90" "X" "" "" "" "" "00006" "PHEX_000699" "g.(22231076_22237152)_(22239861_22244559)del" "" "{PMID:Zheng 2020:32329911}" "" "del ex17-18" "" "Germline" "" "" "0" "" "" "g.(22212959_22219035)_(22221744_22226442)del" "" "pathogenic" "" "0000827664" "21" "90" "X" "" "" "" "" "00006" "PHEX_000685" "g.(22051242_22056586)_(22056656_22065167)del" "" "{PMID:Zheng 2020:32329911}" "" "del ex2" "mother mosaic" "Germline" "" "" "0" "" "" "g.(22033124_22038468)_(22038538_22047049)del" "" "pathogenic" "" "0000827665" "21" "90" "X" "22108616" "22108616" "subst" "0" "00006" "PHEX_000104" "g.22108616G>C" "" "{PMID:Zheng 2020:32329911}" "" "IVS6+1G>C" "effect on splicing predicted from in vitro splicing assay" "Germline" "" "" "0" "" "" "g.22090498G>C" "" "pathogenic" "" "0000827666" "0" "90" "X" "22263467" "22263467" "subst" "0" "00006" "PHEX_000492" "g.22263467C>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22245350C>A" "" "pathogenic" "" "0000827667" "21" "90" "X" "22151739" "22151739" "subst" "0" "00006" "PHEX_000439" "g.22151739A>G" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22133622A>G" "" "pathogenic" "" "0000827668" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000827669" "11" "90" "X" "22117139" "22117139" "subst" "0" "00006" "PHEX_000412" "g.22117139T>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22099021T>A" "" "pathogenic" "" "0000827670" "21" "90" "X" "22265999" "22265999" "subst" "0" "00006" "PHEX_000498" "g.22265999T>C" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22247882T>C" "" "pathogenic" "" "0000827671" "21" "90" "X" "22263458" "22263458" "subst" "0" "00006" "PHEX_000491" "g.22263458C>A" "" "{PMID:Zheng 2020:32329911}" "" "c.2082C>A (Cys694*)" "" "Germline" "" "" "0" "" "" "g.22245341C>A" "" "pathogenic" "" "0000827672" "0" "90" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22226495G>C" "" "pathogenic" "" "0000827673" "0" "90" "X" "22065290" "22065290" "del" "0" "00006" "PHEX_000390" "g.22065290del" "" "{PMID:Zheng 2020:32329911}" "" "c.310delT" "" "De novo" "" "" "0" "" "" "g.22047172del" "" "pathogenic" "" "0000827674" "0" "90" "X" "22266056" "22266056" "dup" "0" "00006" "PHEX_000502" "g.22266056dup" "" "{PMID:Zheng 2020:32329911}" "" "c.2236dupT" "" "De novo" "" "" "0" "" "" "g.22247939dup" "" "pathogenic" "" "0000827675" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827676" "21" "90" "X" "22245644" "22245647" "dup" "0" "00006" "PHEX_000331" "g.22245644_22245647dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1985_1986insTGAC" "" "Germline" "" "" "0" "" "" "g.22227527_22227530dup" "" "pathogenic" "" "0000827677" "0" "90" "X" "22244622" "22244622" "dup" "0" "00006" "PHEX_000483" "g.22244622dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1959dupT" "" "De novo" "" "" "0" "" "" "g.22226505dup" "" "pathogenic" "" "0000827678" "0" "90" "X" "22237175" "22237179" "dup" "0" "00006" "PHEX_000463" "g.22237175_22237179dup" "" "{PMID:Zheng 2020:32329911}" "" "c.1722_1723insGGAGT" "" "De novo" "" "" "0" "" "" "g.22219058_22219062dup" "" "pathogenic" "" "0000827679" "0" "90" "X" "22151668" "22151668" "subst" "0" "00006" "PHEX_000120" "g.22151668G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22133551G>A" "" "pathogenic" "" "0000827680" "0" "90" "X" "22112107" "22112107" "del" "0" "00006" "PHEX_000406" "g.22112107del" "" "{PMID:Zheng 2020:32329911}" "" "c.739delG" "" "De novo" "" "" "0" "" "" "g.22093989del" "" "pathogenic" "" "0000827681" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Zheng 2020:32329911}" "" "IVS15+1G>A" "" "De novo" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000827682" "21" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000827683" "21" "90" "X" "22065210" "22065210" "subst" "0" "00006" "PHEX_000388" "g.22065210G>A" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.22047092G>A" "" "pathogenic" "" "0000827684" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Zheng 2020:32329911}" "" "" "" "De novo" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827708" "21" "70" "X" "22050921" "22266478" "dup" "0" "00006" "PHEX_000368" "g.(?_22050443)_(22269427_?)dup" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline" "" "" "0" "" "" "g.(?_22032325)_(22251310_?)dup" "" "likely benign (!)" "" "0000827709" "0" "90" "X" "22050921" "22266478" "dup" "0" "00006" "PHEX_000368" "g.(?_22050443)_(22269427_?)dup" "" "{PMID:Zheng 2020:32329911}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22251310_?)dup" "" "likely benign (!)" "" "0000827710" "1" "90" "X" "22051200" "22051201" "del" "0" "00006" "PHEX_000087" "g.22051200_22051201del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.758_759delTT" "" "Germline" "" "" "0" "" "" "g.22033082_22033083del" "" "pathogenic" "" "0000827711" "1" "90" "X" "22051200" "22051201" "del" "0" "00006" "PHEX_000087" "g.22051200_22051201del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.758_759delTT" "" "Germline" "" "" "0" "" "" "g.22033082_22033083del" "" "pathogenic" "" "0000827712" "0" "90" "X" "22196450" "22196451" "del" "0" "00006" "PHEX_000447" "g.22196450_22196451del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2223_2224delAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178333_22178334del" "" "pathogenic" "" "0000827713" "0" "90" "X" "22115120" "22115121" "del" "0" "00006" "PHEX_000109" "g.22115120_22115121del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1578_1579delAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097002_22097003del" "" "pathogenic" "" "0000827714" "1" "90" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000088" "g.22065192A>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.893A>T" "" "Germline" "" "" "0" "" "" "g.22047074A>T" "" "pathogenic" "" "0000827715" "1" "90" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000088" "g.22065192A>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.893A>T" "" "Germline" "" "" "0" "" "" "g.22047074A>T" "" "pathogenic" "" "0000827716" "0" "90" "X" "22244612" "22244612" "subst" "0" "00006" "PHEX_000146" "g.22244612G>C" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2633G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226495G>C" "" "pathogenic" "" "0000827717" "0" "90" "X" "22132606" "22132606" "subst" "0" "00006" "PHEX_000426" "g.22132606C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1885C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114488C>T" "" "pathogenic" "" "0000827718" "21" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.?-2664dup2949-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic" "" "0000827719" "21" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.?-2664dup2949-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic" "" "0000827720" "11" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.?-2664dup2949-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic" "" "0000827721" "11" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.?-2664dup2949-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic" "" "0000827722" "0" "90" "X" "22065184" "22065184" "dup" "0" "00006" "PHEX_000384" "g.22065184dup" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.886insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047066dup" "" "pathogenic" "" "0000827723" "0" "90" "X" "22151704" "22151704" "subst" "0" "00006" "PHEX_000278" "g.22151704G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2048G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133587G>A" "" "pathogenic" "" "0000827724" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000418" "g.22117270G>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099152G>T" "" "pathogenic" "" "0000827725" "0" "90" "X" "22245125" "22269427" "del" "0" "00006" "PHEX_000702" "g.(22244626_22245623)_(22269427_?)del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2648_?del, del ex20-.." "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22226509_22227506)_(22251310_?)del" "" "pathogenic" "" "0000827726" "0" "90" "X" "" "" "" "" "00006" "PHEX_000697" "g.(22208620_22231020)_(22269427_?)del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2327_?del, del ex16-.." "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22190503_22212903)_(22251310_?)del" "" "pathogenic" "" "0000827727" "0" "90" "X" "22186510" "22186510" "del" "0" "00006" "PHEX_000127" "g.22186510del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "g.22168393_delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168393del" "" "pathogenic" "" "0000827728" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1552C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic" "" "0000827729" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000827730" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.889_893delGTAAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000827731" "0" "90" "X" "22169085" "22269427" "del" "0" "00006" "PHEX_000681" "g.(22151742_22186428)_(22269427_?)del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2086_?del, Ala469_?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22251310_?)del" "" "pathogenic" "" "0000827732" "0" "90" "X" "22095656" "22095656" "subst" "0" "00006" "PHEX_000398" "g.22095656T>C" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1180T>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077538T>C" "" "pathogenic" "" "0000827733" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2282C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827734" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2416G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000827735" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2920C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827736" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2920C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827737" "0" "90" "X" "22095628" "22095628" "del" "0" "00006" "PHEX_000396" "g.22095628del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1152delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077510del" "" "pathogenic" "" "0000827738" "1" "90" "X" "22115114" "22115114" "subst" "0" "00006" "PHEX_000410" "g.22115114C>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1572C>A;1580_1582delTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096996C>A" "" "pathogenic" "" "0000827739" "0" "90" "X" "22094596" "22094596" "subst" "0" "00006" "PHEX_000393" "g.22094596A>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076478A>T" "" "pathogenic" "" "0000827740" "0" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190507G>A" "" "pathogenic" "" "0000827741" "11" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.889_893delGTAAA" "" "Germline" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000827742" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.889_893delGTAAA" "" "Germline" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic" "" "0000827743" "21" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000500" "g.22266018G>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2879G>T" "" "Germline" "" "" "0" "" "" "g.22247901G>T" "" "pathogenic" "" "0000827744" "21" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000500" "g.22266018G>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2879G>T" "" "Germline" "" "" "0" "" "" "g.22247901G>T" "" "pathogenic" "" "0000827745" "0" "90" "X" "22244621" "22244621" "subst" "0" "00006" "PHEX_000482" "g.22244621T>C" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2642T>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226504T>C" "" "pathogenic" "" "0000827746" "21" "90" "X" "22237158" "22237158" "subst" "0" "00006" "PHEX_000460" "g.22237158T>G" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2387T>G" "" "Germline" "" "" "0" "" "" "g.22219041T>G" "" "pathogenic" "" "0000827747" "0" "90" "X" "22237158" "22237158" "subst" "0" "00006" "PHEX_000460" "g.22237158T>G" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2387T>G" "" "Germline" "" "" "0" "" "" "g.22219041T>G" "" "pathogenic" "" "0000827748" "0" "90" "X" "22151741" "22151741" "subst" "0" "00006" "PHEX_000440" "g.22151741G>C" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2085G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133624G>C" "" "pathogenic" "" "0000827749" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2282C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827750" "0" "90" "X" "22051243" "22051243" "subst" "0" "00006" "PHEX_000380" "g.22051243T>G" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033125T>G" "" "pathogenic" "" "0000827751" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2380C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic" "" "0000827752" "21" "90" "X" "22151661" "22151661" "subst" "0" "00006" "PHEX_000434" "g.22151661G>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2005G>T" "" "Germline" "" "" "0" "" "" "g.22133544G>T" "" "pathogenic" "" "0000827753" "0" "90" "X" "22151661" "22151661" "subst" "0" "00006" "PHEX_000434" "g.22151661G>T" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2005G>T" "" "Germline" "" "" "0" "" "" "g.22133544G>T" "" "pathogenic" "" "0000827754" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2416G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000827755" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099152G>A" "" "pathogenic" "" "0000827756" "0" "90" "X" "22244596" "22244596" "del" "0" "00006" "PHEX_000478" "g.22244596del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.2617delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226479del" "" "pathogenic" "" "0000827757" "0" "90" "X" "22108565" "22108566" "del" "0" "00006" "PHEX_000230" "g.22108565_22108566del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1363_1364delTC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090447_22090448del" "" "pathogenic" "" "0000827758" "1" "50" "X" "22115122" "22115124" "del" "0" "00006" "PHEX_000411" "g.22115122_22115124del" "" "{PMID:Rodriguez-Rubio 2021:33639975}" "" "c.1572C>A;1580_1582delTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097004_22097006del" "" "VUS" "" "0000827761" "0" "90" "X" "22132582" "22132582" "subst" "0" "00006" "PHEX_000313" "g.22132582C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C1180>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114464C>T" "" "pathogenic" "" "0000827762" "0" "90" "X" "22245702" "22245702" "subst" "0" "00006" "PHEX_000488" "g.22245702C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C2044>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227585C>T" "" "pathogenic" "" "0000827763" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C2104>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000827764" "0" "90" "X" "22266002" "22266002" "subst" "0" "00006" "PHEX_000499" "g.22266002C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C2182>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247885C>T" "" "pathogenic" "" "0000827765" "0" "90" "X" "22132587" "22132587" "del" "0" "00006" "PHEX_000267" "g.22132587del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1185del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114469del" "" "pathogenic" "" "0000827766" "0" "90" "X" "22132672" "22132673" "del" "0" "00006" "PHEX_000431" "g.22132672_22132673del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1270-A1271del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114554_22114555del" "" "pathogenic" "" "0000827767" "0" "90" "X" "22151737" "22151741" "del" "0" "00006" "PHEX_000279" "g.22151737_22151741del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "A1400-G1404del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133620_22133624del" "" "pathogenic" "" "0000827768" "0" "90" "X" "22196430" "22196444" "del" "0" "00006" "PHEX_000442" "g.22196430_22196444del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "A1523-T1537del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178313_22178327del" "" "pathogenic" "" "0000827769" "0" "90" "X" "22094597" "22094597" "subst" "0" "00006" "PHEX_000395" "g.22094597G>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS4+5g>t" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076479G>T" "" "pathogenic" "" "0000827770" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS15+1g>a" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic" "" "0000827771" "0" "90" "X" "22237222" "22237222" "dup" "0" "00006" "PHEX_000308" "g.22237222dup" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS17+3inst" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219105dup" "" "pathogenic" "" "0000827772" "0" "90" "X" "22237225" "22237225" "subst" "0" "00006" "PHEX_000309" "g.22237225G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS17+5g>a" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219108G>A" "" "pathogenic" "" "0000827773" "0" "90" "X" "22244596" "22244626" "dup" "0" "00006" "PHEX_000479" "g.22244596_22244626dup" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "dup1936-1965+1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226479_22226509dup" "" "pathogenic" "" "0000827774" "0" "90" "X" "22263449" "22263449" "subst" "0" "00006" "PHEX_000341" "g.22263449G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS20-1g>a" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245332G>A" "" "pathogenic" "" "0000827775" "1" "90" "X" "22151661" "22151661" "subst" "0" "00006" "PHEX_000434" "g.22151661G>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1324>T" "" "Germline" "" "" "0" "" "" "g.22133544G>T" "" "pathogenic" "" "0000827776" "1" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C1601>T" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827777" "1" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1735>A" "" "Germline" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic" "" "0000827778" "1" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "C1645>T" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000827779" "1" "90" "X" "22231059" "22231059" "subst" "0" "00006" "PHEX_000456" "g.22231059G>T" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1684>T" "" "Germline" "" "" "0" "" "" "g.22212942G>T" "" "pathogenic" "" "0000827780" "1" "90" "X" "22239842" "22239842" "subst" "0" "00006" "PHEX_000474" "g.22239842G>A" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "G1881>A" "" "Germline" "" "" "0" "" "" "g.22221725G>A" "" "pathogenic" "" "0000827781" "1" "90" "X" "22095767" "22095870" "del" "0" "00006" "PHEX_000227" "g.22095767_22095870del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "104bp del ex 5 cod:204–221 and IVS5+1–50" "" "Germline" "" "" "0" "" "" "g.22077649_22077752del" "" "pathogenic" "" "0000827782" "1" "90" "X" "22245644" "22245647" "dup" "0" "00006" "PHEX_000331" "g.22245644_22245647dup" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "1990 ins TGAC (dup)" "" "Germline" "" "" "0" "" "" "g.22227527_22227530dup" "" "pathogenic" "" "0000827783" "1" "90" "X" "22266061" "22266064" "dup" "0" "00006" "PHEX_000503" "g.22266061_22266064dup" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "2245 ins ACTC (dup)" "" "Germline" "" "" "0" "" "" "g.22247944_22247947dup" "" "pathogenic" "" "0000827784" "1" "90" "X" "22117271" "22117274" "del" "0" "00006" "PHEX_000256" "g.22117271_22117274del" "" "{PMID:Popowska 2000:14564077}, {PMID:Pronicka 2004:15057978}" "" "IVS9+2–5taag del" "" "Germline" "" "" "0" "" "" "g.22099153_22099156del" "" "pathogenic" "" "0000827785" "0" "90" "X" "22094553" "22094553" "subst" "0" "00006" "PHEX_000369" "g.22094553C>T" "" "{PMID:Balazs 2008:18057152}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827786" "0" "90" "X" "22094594" "22094594" "subst" "0" "00006" "PHEX_000219" "g.22094594T>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22076476T>A" "" "NA" "" "0000827787" "0" "90" "X" "22094595" "22094595" "subst" "0" "00006" "PHEX_000094" "g.22094595G>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22076477G>C" "" "NA" "" "0000827788" "0" "90" "X" "22094596" "22094596" "subst" "0" "00006" "PHEX_000220" "g.22094596A>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22076478A>C" "" "NA" "" "0000827789" "0" "70" "X" "22094598" "22094598" "subst" "0" "00006" "PHEX_000038" "g.22094598T>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22076480T>C" "" "NA" "" "0000827790" "0" "90" "X" "22095591" "22095591" "subst" "0" "00006" "PHEX_000222" "g.22095591C>G" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22077473C>G" "" "NA" "" "0000827791" "0" "90" "X" "22115070" "22115070" "subst" "0" "00006" "PHEX_000408" "g.22115070C>G" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22096952C>G" "" "NA" "" "0000827792" "0" "90" "X" "22129583" "22129583" "subst" "0" "00006" "PHEX_000370" "g.22129583A>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22111465A>C" "" "NA" "" "0000827793" "0" "90" "X" "22129582" "22129582" "subst" "0" "00006" "PHEX_000419" "g.22129582C>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22111464C>A" "" "NA" "" "0000827794" "0" "90" "X" "22186507" "22186507" "subst" "0" "00006" "PHEX_000282" "g.22186507G>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22168390G>C" "" "NA" "" "0000827795" "0" "90" "X" "22186511" "22186511" "subst" "0" "00006" "PHEX_000072" "g.22186511G>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22168394G>C" "" "NA" "" "0000827796" "0" "90" "X" "22196494" "22196494" "subst" "0" "00006" "PHEX_000448" "g.22196494G>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22178377G>A" "" "NA" "" "0000827797" "0" "70" "X" "22196499" "22196499" "subst" "0" "00006" "PHEX_000028" "g.22196499T>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22178382T>C" "" "NA" "" "0000827798" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22190502C>T" "" "NA" "" "0000827799" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22190503G>A" "" "NA" "" "0000827800" "0" "90" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22190507G>A" "" "NA" "" "0000827801" "0" "90" "X" "22208625" "22208625" "subst" "0" "00006" "PHEX_000028" "g.22208625T>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22190508T>C" "" "NA" "" "0000827802" "0" "90" "X" "22237137" "22237137" "subst" "0" "00006" "PHEX_000163" "g.22237137T>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22219020T>A" "" "NA" "" "0000827803" "0" "90" "X" "22237222" "22237222" "subst" "0" "00006" "PHEX_000467" "g.22237222T>G" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22219105T>G" "" "NA" "" "0000827804" "0" "90" "X" "22237225" "22237225" "subst" "0" "00006" "PHEX_000309" "g.22237225G>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22219108G>A" "" "NA" "" "0000827805" "0" "90" "X" "22239729" "22239729" "subst" "0" "00006" "PHEX_000468" "g.22239729G>C" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22221612G>C" "" "NA" "" "0000827806" "0" "90" "X" "22239861" "22239861" "subst" "0" "00006" "PHEX_000475" "g.22239861G>T" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22221744G>T" "" "NA" "" "0000827807" "0" "90" "X" "22239865" "22239865" "subst" "0" "00006" "PHEX_000322" "g.22239865G>A" "" "{PMID:BinEssa 2019:31102713}" "" "" "variant analysed in mini-gene expression construct" "In vitro (cloned)" "" "" "0" "" "" "g.22221748G>A" "" "NA" "" "0000827808" "21" "90" "X" "22129583" "22129583" "subst" "0" "00006" "PHEX_000370" "g.22129583A>C" "" "{PMID:Poon 2015:26904698}" "" "c.1080A>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827909" "11" "90" "X" "22245638" "22245638" "subst" "0" "00006" "PHEX_000487" "g.22245638G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22227521G>A" "" "pathogenic" "" "0000827910" "0" "90" "X" "22245638" "22245638" "subst" "0" "00006" "PHEX_000487" "g.22245638G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227521G>A" "" "pathogenic" "" "0000827911" "21" "70" "X" "22237203" "22237203" "subst" "0" "00006" "PHEX_000465" "g.22237203A>C" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22219086A>C" "" "likely pathogenic" "" "0000827912" "1" "70" "X" "22237203" "22237203" "subst" "0" "00006" "PHEX_000465" "g.22237203A>C" "" "{PMID:Yue 2014:24836714}" "" "1751A>C;1183G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219086A>C" "" "likely pathogenic" "" "0000827913" "21" "90" "X" "22151669" "22151669" "subst" "0" "00006" "PHEX_000435" "g.22151669G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22133552G>A" "" "pathogenic" "" "0000827914" "0" "90" "X" "22151669" "22151669" "subst" "0" "00006" "PHEX_000435" "g.22151669G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133552G>A" "" "pathogenic" "" "0000827915" "21" "90" "X" "22231019" "22231019" "subst" "0" "00006" "PHEX_000453" "g.22231019A>T" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22212902A>T" "" "pathogenic" "" "0000827916" "21" "90" "X" "22231019" "22231019" "subst" "0" "00006" "PHEX_000453" "g.22231019A>T" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22212902A>T" "" "pathogenic" "" "0000827917" "0" "90" "X" "22231019" "22231019" "subst" "0" "00006" "PHEX_000453" "g.22231019A>T" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212902A>T" "" "pathogenic" "" "0000827918" "21" "90" "X" "22132575" "22132575" "subst" "0" "00006" "PHEX_000266" "g.22132575G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline" "" "" "0" "" "" "g.22114457G>A" "" "pathogenic" "" "0000827919" "0" "90" "X" "22132575" "22132575" "subst" "0" "00006" "PHEX_000266" "g.22132575G>A" "" "{PMID:Yue 2014:24836714}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114457G>A" "" "pathogenic" "" "0000827920" "21" "90" "X" "22231069" "22231069" "del" "0" "00006" "PHEX_000457" "g.22231069del" "" "{PMID:Yue 2014:24836714}" "" "1694delA" "" "Germline" "" "" "0" "" "" "g.22212952del" "" "pathogenic" "" "0000827921" "0" "90" "X" "22231069" "22231069" "del" "0" "00006" "PHEX_000457" "g.22231069del" "" "{PMID:Yue 2014:24836714}" "" "1694delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212952del" "" "pathogenic" "" "0000827922" "0" "90" "X" "22237222" "22237222" "subst" "0" "00006" "PHEX_000467" "g.22237222T>G" "" "{PMID:Yue 2014:24836714}" "" "" "" "De novo" "" "" "0" "" "" "g.22219105T>G" "" "pathogenic" "" "0000827923" "0" "90" "X" "22265974" "22265989" "delins" "0" "00006" "PHEX_000497" "g.22265974_22265989delinsA" "" "{PMID:Yue 2014:24836714}" "" "2077_*4delinsA" "" "De novo" "" "" "0" "" "" "g.22247857_22247872delinsA" "" "pathogenic" "" "0000827924" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Yue 2014:24836714}" "" "" "" "De novo" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000827925" "2" "70" "X" "22132585" "22132585" "subst" "0" "00006" "PHEX_000425" "g.22132585G>C" "" "{PMID:Yue 2014:24836714}" "" "1751A>C;1183G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114467G>C" "" "likely pathogenic" "" "0000827926" "0" "90" "X" "" "" "" "" "00006" "PHEX_000686" "g.(22051242_22056586)_(22065330_22094505)del" "" "{PMID:Capelli 2015:26051471}" "" "del ex2-3" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22033124_22038468)_(22047212_22076387)del" "" "pathogenic" "" "0000827927" "0" "70" "X" "22065209" "22065209" "subst" "0" "00006" "PHEX_000387" "g.22065209T>A" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047091T>A" "" "likely pathogenic" "" "0000827928" "0" "90" "X" "22129583" "22129583" "subst" "0" "00006" "PHEX_000257" "g.22129583A>G" "" "{PMID:Capelli 2015:26051471}" "" "IVS9-2A>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111465A>G" "" "pathogenic" "" "0000827929" "21" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827930" "21" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827931" "0" "90" "X" "22094504" "22094504" "subst" "0" "00006" "PHEX_000091" "g.22094504A>G" "" "{PMID:Capelli 2015:26051471}" "" "IVS3-2A>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076386A>G" "" "pathogenic" "" "0000827932" "0" "90" "X" "22095812" "22095813" "del" "0" "00006" "PHEX_000400" "g.22095812_22095813del" "" "{PMID:Capelli 2015:26051471}" "" "c.655_656delAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077694_22077695del" "" "pathogenic" "" "0000827933" "0" "90" "X" "" "" "" "" "00006" "PHEX_000697" "g.(22208620_22231020)_(22269427_?)del" "" "{PMID:Capelli 2015:26051471}" "" "del ex16-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22190503_22212903)_(22251310_?)del" "" "pathogenic" "" "0000827934" "21" "90" "X" "22265970" "22265971" "ins" "0" "00006" "PHEX_000496" "g.22265970_22265971insTG" "" "{PMID:Capelli 2015:26051471}" "" "c.2150_2151insTG" "" "Germline" "" "" "0" "" "" "g.22247853_22247854insTG" "" "pathogenic" "" "0000827935" "0" "90" "X" "22196494" "22196494" "subst" "0" "00006" "PHEX_000448" "g.22196494G>A" "" "{PMID:Capelli 2015:26051471}" "" "IVS14+1G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178377G>A" "" "pathogenic" "" "0000827936" "0" "90" "X" "22244602" "22244602" "subst" "0" "00006" "PHEX_000480" "g.22244602G>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226485G>T" "" "pathogenic" "" "0000827937" "21" "90" "X" "" "" "" "" "00006" "PHEX_000687" "g.(22051242_22056586)_(22132705_22151639)dup" "" "{PMID:Capelli 2015:26051471}" "" "dup ex2-11" "" "Germline" "" "" "0" "" "" "g.(22033124_22038468)_(22114587_22133522)dup" "" "pathogenic" "" "0000827938" "21" "90" "X" "" "" "" "" "00006" "PHEX_000687" "g.(22051242_22056586)_(22132705_22151639)dup" "" "{PMID:Capelli 2015:26051471}" "" "dup ex2-11" "" "Germline" "" "" "0" "" "" "g.(22033124_22038468)_(22114587_22133522)dup" "" "pathogenic" "" "0000827939" "21" "90" "X" "" "" "" "" "00006" "PHEX_000701" "g.(22237221_22239729)_(22269427_?)del" "" "{PMID:Capelli 2015:26051471}" "" "del ex18-22" "" "Germline" "" "" "0" "" "" "g.(22219104_22221612)_(22251310_?)del" "" "pathogenic" "" "0000827940" "0" "90" "X" "22239820" "22239823" "dup" "0" "00006" "PHEX_000473" "g.22239820_22239823dup" "" "{PMID:Capelli 2015:26051471}" "" "c.1862_1863insACCA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221703_22221706dup" "" "pathogenic" "" "0000827941" "0" "90" "X" "22266070" "22266070" "subst" "0" "00006" "PHEX_000505" "g.22266070G>C" "" "{PMID:Capelli 2015:26051471}" "" "X750Tyr" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247953G>C" "" "pathogenic" "" "0000827943" "21" "90" "X" "22051127" "22051127" "subst" "0" "00006" "PHEX_000371" "g.22051127G>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline" "" "" "0" "" "" "g.22033009G>T" "" "pathogenic" "" "0000827944" "0" "90" "X" "22263528" "22263528" "subst" "0" "00006" "PHEX_000493" "g.22263528T>A" "" "{PMID:Capelli 2015:26051471}" "" "IVS21+2T>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245411T>A" "" "pathogenic" "" "0000827945" "21" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000827946" "0" "90" "X" "" "" "" "" "00006" "PHEX_000694" "g.(22132705_22151639)_(22151742_22186428)del" "" "{PMID:Capelli 2015:26051471}" "" "del ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22133625_22168311)del" "" "pathogenic" "" "0000827947" "0" "90" "X" "22151639" "22151639" "subst" "0" "00006" "PHEX_000433" "g.22151639G>T" "" "{PMID:Capelli 2015:26051471}" "" "IVS11-1G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133522G>T" "" "pathogenic" "" "0000827949" "21" "90" "X" "22051127" "22051127" "subst" "0" "00006" "PHEX_000371" "g.22051127G>T" "" "{PMID:Capelli 2015:26051471}" "" "" "" "Germline" "" "" "0" "" "" "g.22033009G>T" "" "pathogenic" "" "0000827953" "21" "90" "X" "22129582" "22129582" "subst" "0" "00006" "PHEX_000419" "g.22129582C>A" "" "{PMID:Ma 2015:26107949}" "" "" "" "Germline" "" "" "0" "" "" "g.22111464C>A" "" "pathogenic" "" "0000827954" "21" "90" "X" "22129582" "22129582" "subst" "0" "00006" "PHEX_000419" "g.22129582C>A" "" "{PMID:Ma 2015:26107949}" "" "" "" "Germline" "" "" "0" "" "" "g.22111464C>A" "" "likely pathogenic" "" "0000827955" "0" "90" "X" "22129582" "22129582" "subst" "0" "00006" "PHEX_000419" "g.22129582C>A" "" "{PMID:Ma 2015:26107949}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111464C>A" "" "pathogenic" "" "0000827956" "0" "90" "X" "22132613" "22132617" "delins" "0" "00006" "PHEX_000428" "g.22132613_22132617delinsTTTACAT" "" "{PMID:Ma 2015:26107949}" "" "1211_1215delACAAAinsTTTACAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114495_22114499delinsTTTACAT" "" "pathogenic" "" "0000827957" "0" "90" "X" "22115070" "22115070" "subst" "0" "00006" "PHEX_000408" "g.22115070C>G" "" "{PMID:Bai 2018:30298485}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096952C>G" "" "pathogenic" "" "0000827958" "0" "90" "X" "" "" "" "" "00006" "PHEX_000693" "g.(22129679_22132575)_(22132705_22151639)del" "" "{PMID:Bai 2018:30298485}" "" "del ex11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22111561_22114457)_(22114587_22133522)del" "" "pathogenic" "" "0000827959" "0" "90" "X" "" "" "" "" "00006" "PHEX_000695" "g.(22151742_22186428)_(22186507_22196389)del" "" "{PMID:Bai 2018:30298485}" "" "del ex13" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22168390_22178272)del" "" "pathogenic" "" "0000827960" "0" "90" "X" "22237205" "22237205" "subst" "0" "00006" "PHEX_000466" "g.22237205G>A" "" "{PMID:Bai 2018:30298485}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219088G>A" "" "pathogenic" "" "0000827962" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "De novo" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic" "" "0000827963" "0" "90" "X" "22117169" "22117173" "dup" "0" "00006" "PHEX_000413" "g.22117169_22117173dup" "" "{PMID:Acar 2018:29505567}" "" "c.978_982dupCTACC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099051_22099055dup" "" "pathogenic" "" "0000827964" "21" "90" "X" "22117169" "22117173" "dup" "0" "00006" "PHEX_000413" "g.22117169_22117173dup" "" "{PMID:Acar 2018:29505567}" "" "c.978_982dupCTACC" "" "Germline" "" "" "0" "" "" "g.22099051_22099055dup" "" "pathogenic" "" "0000827965" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827966" "21" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827967" "21" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic" "" "0000827968" "0" "90" "X" "22196495" "22196495" "subst" "0" "00006" "PHEX_000449" "g.22196495T>G" "" "{PMID:Acar 2018:29505567}" "" "" "" "De novo" "" "" "0" "" "" "g.22178378T>G" "" "pathogenic" "" "0000827969" "0" "90" "X" "22215887" "22395767" "del" "0" "00006" "PHEX_000452" "g.22215887_22395767del" "" "{PMID:Acar 2018:29505567}" "" "g.22,215,887–22,395,767del" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "" "0000827970" "11" "90" "X" "22215887" "22395767" "del" "0" "00006" "PHEX_000452" "g.22215887_22395767del" "" "{PMID:Acar 2018:29505567}" "" "g.22,215,887–22,395,767del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000827971" "0" "90" "X" "22132619" "22132619" "subst" "0" "00006" "PHEX_000118" "g.22132619G>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "De novo" "" "" "0" "" "" "g.22114501G>T" "" "pathogenic" "" "0000827972" "0" "90" "X" "22056656" "22056656" "subst" "0" "00006" "PHEX_000200" "g.22056656G>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "De novo" "" "" "0" "" "" "g.22038538G>T" "" "pathogenic" "" "0000827973" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "De novo" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000827974" "0" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000093" "g.22094593G>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076475G>T" "" "pathogenic" "" "0000827975" "21" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000093" "g.22094593G>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.22076475G>T" "" "pathogenic" "" "0000827978" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827979" "21" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827980" "21" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic" "" "0000827981" "0" "90" "X" "22151742" "22151742" "del" "0" "00006" "PHEX_000441" "g.22151742del" "" "{PMID:Acar 2018:29505567}" "" "c.1404+1delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133625del" "" "pathogenic" "" "0000827982" "21" "90" "X" "22151742" "22151742" "del" "0" "00006" "PHEX_000441" "g.22151742del" "" "{PMID:Acar 2018:29505567}" "" "c.1404+1delG" "" "Germline" "" "" "0" "" "" "g.22133625del" "" "pathogenic" "" "0000827983" "0" "90" "X" "22132608" "22132608" "del" "0" "00006" "PHEX_000427" "g.22132608del" "" "{PMID:Acar 2018:29505567}" "" "c.1206delA" "" "De novo" "" "" "0" "" "" "g.22114490del" "" "pathogenic" "" "0000828291" "21" "90" "X" "22266057" "22266057" "subst" "0" "00006" "PHEX_000017" "g.22266057G>A" "" "{PMID:Yang 2013:23813354}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828292" "21" "90" "X" "22112119" "22112119" "subst" "0" "00006" "PHEX_000372" "g.22112119A>T" "" "{PMID:Ito 2005:16261449}" "" "K251X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828293" "21" "90" "X" "22231019" "22231019" "subst" "0" "00006" "PHEX_000373" "g.22231019A>G" "" "{PMID:Ito 2005:16261449}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828294" "21" "90" "X" "0" "0" "" "0" "00006" "PHEX_000698" "g.(22231076_22237152)_(22237221_22239729)del" "" "{PMID:Ito 2005:16261449}" "" "del ex17" "" "Germline" "yes" "" "0" "" "" "g.(22212959_22219035)_(22219104_22221612)del" "" "pathogenic (dominant)" "" "0000828295" "21" "90" "X" "22263519" "22263519" "subst" "0" "00006" "PHEX_000374" "g.22263519C>T" "" "{PMID:Ito 2005:16261449}" "" "Q714X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828296" "11" "90" "X" "22263448" "22263448" "subst" "0" "00006" "PHEX_000152" "g.22263448A>G" "" "{PMID:Ito 2005:16261449}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828297" "21" "90" "X" "22095722" "22095722" "subst" "0" "00006" "PHEX_000099" "g.22095722C>T" "" "{PMID:Ito 2005:16261449}" "" "Q189X" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828298" "21" "90" "X" "22244559" "22244559" "subst" "0" "00006" "PHEX_000375" "g.22244559G>A" "" "{PMID:Ito 2005:16261449}" "" "IVS18 1600-1G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828299" "21" "90" "X" "22095660" "22095660" "subst" "0" "00006" "PHEX_000096" "g.22095660C>T" "" "{PMID:Ito 2005:16261449}" "" "P168L" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828300" "0" "90" "X" "22095723" "22095724" "del" "0" "00006" "PHEX_000376" "g.22095723_22095724del" "" "{PMID:Marik 2018:29707405}" "" "566_567delAG" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828301" "0" "90" "X" "22095809" "22095812" "del" "0" "00006" "PHEX_000377" "g.22095809_22095812del" "" "{PMID:Marik 2018:29707405}" "" "651_654delACAT" "" "De novo" "yes" "" "0" "" "" "g.22077691_22077694del" "" "pathogenic (dominant)" "" "0000828302" "21" "90" "X" "22112119" "22112119" "subst" "0" "00006" "PHEX_000108" "g.22112119A>T" "" "{PMID:Marik 2018:29707405}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828303" "0" "90" "X" "22151674" "22151674" "delins" "0" "00006" "PHEX_000378" "g.22151674delinsAATAA" "" "{PMID:Marik 2018:29707405}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828304" "11" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Marik 2018:29707405}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828305" "21" "90" "X" "22245706" "22245706" "subst" "0" "00006" "PHEX_000379" "g.22245706T>A" "" "{PMID:Marik 2018:29707405}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828306" "0" "90" "X" "22245628" "22245628" "subst" "0" "00006" "PHEX_000329" "g.22245628A>G" "" "{PMID:Marik 2018:29707405}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828307" "0" "90" "X" "22266008" "22266008" "subst" "0.000179132" "00006" "PHEX_000061" "g.22266008G>T" "" "{PMID:Marik 2018:29707405}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830419" "0" "90" "X" "22129657" "22129657" "subst" "0" "00006" "PHEX_000264" "g.22129657T>G" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111539T>G" "" "pathogenic (dominant)" "" "0000830420" "0" "90" "X" "22065166" "22065166" "subst" "0" "00006" "PHEX_000529" "g.22065166A>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047048A>T" "" "pathogenic (dominant)" "" "0000830421" "0" "90" "X" "22116140" "22123427" "del" "0" "00006" "PHEX_000506" "g.(22115157_22117123)_(22117270_22129584)del" "" "{PMID:Zivicnjak 2011:21994957}" "" "del ex9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22097039_22099005)_(22099152_22111466)del" "" "pathogenic (dominant)" "" "0000830422" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830423" "0" "90" "X" "" "" "" "" "00006" "PHEX_000682" "g.(?_22050443)_(22051242_22056586)del" "" "{PMID:Zivicnjak 2011:21994957}" "" "del ex1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22033124_22038468)del" "" "pathogenic (dominant)" "" "0000830424" "0" "90" "X" "22117198" "22117198" "dup" "0" "00006" "PHEX_000536" "g.22117198dup" "" "{PMID:Zivicnjak 2011:21994957}" "" "1006_1007insC (S336L)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099080dup" "" "pathogenic (dominant)" "" "0000830425" "0" "90" "X" "22263528" "22263535" "del" "0" "00006" "PHEX_000545" "g.22263528_22263535del" "" "{PMID:Zivicnjak 2011:21994957}" "" "2147+1del8" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245411_22245418del" "" "pathogenic (dominant)" "" "0000830426" "0" "90" "X" "22245632" "22245633" "ins" "0" "00006" "PHEX_000544" "g.22245632_22245633insN[5]" "" "{PMID:Zivicnjak 2011:21994957}" "" "1974_1975ins5 (W658X)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227515_22227516insN[5]" "" "pathogenic (dominant)" "" "0000830427" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830428" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830429" "0" "90" "X" "22056649" "22056649" "subst" "0" "00006" "PHEX_000528" "g.22056649G>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038531G>T" "" "pathogenic (dominant)" "" "0000830430" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic (dominant)" "" "0000830431" "0" "90" "X" "22051124" "22051124" "subst" "0" "00006" "PHEX_000525" "g.22051124A>G" "" "{PMID:Zivicnjak 2011:21994957}" "" "M1V" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033006A>G" "" "pathogenic (dominant)" "" "0000830432" "0" "90" "X" "22231075" "22231075" "subst" "0" "00006" "PHEX_000297" "g.22231075G>C" "" "{PMID:Zivicnjak 2011:21994957}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212958G>C" "" "pathogenic (dominant)" "" "0000830433" "0" "90" "X" "22095695" "22095695" "del" "0" "00006" "PHEX_000225" "g.22095695del" "" "{PMID:Boukpessi 2017:27884786}" "" "538delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077577del" "" "pathogenic (dominant)" "" "0000830434" "0" "90" "X" "" "" "" "" "00006" "PHEX_000689" "g.(22108616_22112100)_(22115157_22117123)del" "" "{PMID:Boukpessi 2017:27884786}" "" "del ex7-8" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22090498_22093982)_(22097039_22099005)del" "" "pathogenic (dominant)" "" "0000830435" "0" "90" "X" "22108616" "22108617" "del" "0" "00006" "PHEX_000233" "g.22108616_22108617del" "" "{PMID:Boukpessi 2017:27884786}" "" "732+1delGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090498_22090499del" "" "pathogenic (dominant)" "" "0000830436" "0" "90" "X" "22186495" "22186495" "del" "0" "00006" "PHEX_000281" "g.22186495del" "" "{PMID:Boukpessi 2017:27884786}" "" "1471delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168378del" "" "pathogenic (dominant)" "" "0000830437" "0" "90" "X" "22094569" "22094569" "subst" "0" "00006" "PHEX_000214" "g.22094569T>C" "" "{PMID:Boukpessi 2017:27884786}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076451T>C" "" "pathogenic (dominant)" "" "0000830438" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Boukpessi 2017:27884786}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic (dominant)" "" "0000830439" "0" "90" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000134" "g.22208574C>T" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22190457C>T" "" "pathogenic (dominant)" "" "0000830440" "0" "90" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000134" "g.22208574C>T" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22190457C>T" "" "pathogenic (dominant)" "" "0000830441" "0" "90" "X" "22208574" "22208574" "subst" "0" "00006" "PHEX_000134" "g.22208574C>T" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22190457C>T" "" "pathogenic (dominant)" "" "0000830442" "0" "90" "X" "22056622" "22056622" "subst" "0" "00006" "PHEX_000527" "g.22056622G>T" "" "{PMID:Guven 2017:28383812}" "" "" "" "De novo" "" "" "0" "" "" "g.22038504G>T" "" "pathogenic (dominant)" "" "0000830443" "0" "90" "X" "22094557" "22094558" "ins" "0" "00006" "PHEX_000532" "g.22094557_22094558insGCCAAA" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22076439_22076440insGCCAAA" "" "pathogenic (dominant)" "" "0000830444" "0" "90" "X" "22094557" "22094558" "ins" "0" "00006" "PHEX_000532" "g.22094557_22094558insGCCAAA" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22076439_22076440insGCCAAA" "" "pathogenic (dominant)" "" "0000830445" "0" "90" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000306" "g.22237221G>A" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22219104G>A" "" "pathogenic (dominant)" "" "0000830446" "0" "90" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000306" "g.22237221G>A" "" "{PMID:Guven 2017:28383812}" "" "" "" "Germline" "" "" "0" "" "" "g.22219104G>A" "" "pathogenic (dominant)" "" "0000830450" "0" "90" "X" "22239767" "22239767" "subst" "0" "00006" "PHEX_000313" "g.22239767G>A" "" "{PMID:Guven 2017:28383812}" "" "1807G>A" "" "Germline" "" "" "0" "" "" "g.22221650G>A" "" "pathogenic (dominant)" "" "0000830451" "0" "90" "X" "22239767" "22239767" "subst" "0" "00006" "PHEX_000313" "g.22239767G>A" "" "{PMID:Guven 2017:28383812}" "" "1807G>A" "" "Germline" "" "" "0" "" "" "g.22221650G>A" "" "pathogenic (dominant)" "" "0000830452" "0" "90" "X" "22034835" "22074923" "del" "0" "00006" "PHEX_000524" "g.22034835_22074923del" "" "{PMID:Guven 2017:28383812}" "" "g.22016715_22056805del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22016717_22056805del" "" "pathogenic (dominant)" "" "0000830453" "0" "90" "X" "22266064" "22266065" "del" "0" "00006" "PHEX_000546" "g.22266064_22266065del" "" "{PMID:Guven 2017:28383812}" "" "2242_2243delCT" "" "De novo" "" "" "0" "" "" "g.22247947_22247948del" "" "pathogenic (dominant)" "" "0000830456" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000507" "g.22244626G>T" "" "{PMID:Canete 2014:25115781}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830457" "0" "50" "X" "22095620" "22095620" "subst" "0" "00006" "PHEX_000508" "g.22095620C>G" "" "{PMID:Castellarin 2013:22996961}" "" "" "" "Somatic" "" "" "0" "" "" "" "" "VUS" "" "0000830458" "1" "90" "X" "22196389" "22196389" "subst" "0" "00006" "PHEX_000509" "g.22196389G>C" "" "{PMID:Chen 2019:31567381}" "" "" "ACMG PVS1, PM2, PP1, PP3" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830459" "1" "70" "X" "22094578" "22094578" "subst" "0" "00006" "PHEX_000510" "g.22094578C>T" "" "{PMID:Fang 2016:26894575}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830460" "21" "90" "X" "22117234" "22117234" "del" "0" "00006" "PHEX_000252" "g.22117234del" "" "{PMID:Fratzl-Zelman 2020:32619592}" "" "1044delA" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830461" "0" "90" "X" "22196473" "22196477" "del" "0" "00006" "PHEX_000511" "g.22196473_22196477delAAAAG" "" "{PMID:Fratzl-Zelman 2020:32619592}" "" "1566_1570delAAAAG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830462" "21" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Fratzl-Zelman 2020:32619592}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830463" "21" "90" "X" "22231067" "22231067" "del" "0" "00006" "PHEX_000512" "g.22231067del" "" "{PMID:Huang 2019:31537998}" "" "1692delA" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830464" "21" "70" "X" "22244609" "22244609" "subst" "0" "00006" "PHEX_000513" "g.22244609T>C" "" "{PMID:Jo 2020:32252220}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830465" "11" "70" "X" "22117137" "22117137" "subst" "0.0000224474" "00006" "PHEX_000514" "g.22117137G>T" "" "{PMID:Kawahara 2015:25861491}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830466" "0" "90" "X" "22053914" "22060912" "del" "0" "00006" "PHEX_000526" "g.(22051242_22056586)_(22056656_22065167)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex2" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22033124_22038468)_(22038538_22047049)del" "" "pathogenic (dominant)" "" "0000830467" "0" "90" "X" "22079918" "22142172" "del" "0" "00006" "PHEX_000530" "g.(22065330_22094505)_(22132705_22151639)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex4-11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22114587_22133522)del" "" "pathogenic (dominant)" "" "0000830468" "0" "90" "X" "22079918" "22254589" "dup" "0" "00006" "PHEX_000531" "g.(22065330_22094505)_(22245729_22263449)dup" "" "{PMID:Zhang 2019:30682568}" "" "dup ex4-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22227612_22245332)dup" "" "pathogenic (dominant)" "" "0000830469" "0" "90" "X" "" "" "" "" "00006" "PHEX_000517" "g.(22065330_22094505)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex4-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830470" "0" "90" "X" "22102184" "22123427" "del" "0" "00006" "PHEX_000533" "g.(22095821_22108546)_(22117270_22129584)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex6-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22077703_22090428)_(22099152_22111466)del" "" "pathogenic (dominant)" "" "0000830471" "0" "90" "X" "22102184" "22219820" "del" "0" "00006" "PHEX_000515" "g.(22095821_22108546)_(22208620_22231020)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex6-15;19-22" "non-contiguous deletion exons 6-15 and 19-22" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22077703_22090428)_(22190503_22212903)del" "" "pathogenic (dominant)" "" "0000830472" "0" "90" "X" "22110358" "22123427" "dup" "0" "00006" "PHEX_000534" "g.(22108616_22112100)_(22117270_22129584)dup" "" "{PMID:Zhang 2019:30682568}" "" "dup ex7-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22090498_22093982)_(22099152_22111466)dup" "" "pathogenic (dominant)" "" "0000830473" "0" "90" "X" "22110358" "22142172" "del" "0" "00006" "PHEX_000535" "g.(22108616_22112100)_(22132705_22151639)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex7-11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22090498_22093982)_(22114587_22133522)del" "" "pathogenic (dominant)" "" "0000830474" "0" "90" "X" "22116140" "22123427" "del" "0" "00006" "PHEX_000506" "g.(22115157_22117123)_(22117270_22129584)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22097039_22099005)_(22099152_22111466)del" "" "pathogenic (dominant)" "" "0000830475" "0" "90" "X" "22123427" "22131127" "del" "0" "00006" "PHEX_000537" "g.(22117270_22129584)_(22129679_22132575)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex10" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22099152_22111466)_(22111561_22114457)del" "" "pathogenic (dominant)" "" "0000830476" "0" "90" "X" "22123427" "22169085" "del" "0" "00006" "PHEX_000538" "g.(22117270_22129584)_(22151742_22186428)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex10-12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22099152_22111466)_(22133625_22168311)del" "" "pathogenic (dominant)" "" "0000830477" "0" "90" "X" "" "" "" "" "00006" "PHEX_000518" "g.(22117270_22129584)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex10-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22099152_22111466)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830478" "0" "90" "X" "22142172" "22169085" "del" "0" "00006" "PHEX_000002" "g.(22132705_22151639)_(22151742_22186428)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22133625_22168311)del" "" "pathogenic (dominant)" "" "0000830479" "0" "90" "X" "22142172" "22169085" "dup" "0" "00006" "PHEX_000539" "g.(22132705_22151639)_(22151742_22186428)dup" "" "{PMID:Zhang 2019:30682568}" "" "dup ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22133625_22168311)dup" "" "pathogenic (dominant)" "" "0000830480" "0" "90" "X" "22169085" "22202527" "del" "0" "00006" "PHEX_000540" "g.(22151742_22186428)_(22196494_22208560)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex13-14" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22178377_22190443)del" "" "pathogenic (dominant)" "" "0000830481" "0" "90" "X" "22169085" "22202527" "del" "0" "00006" "PHEX_000540" "g.(22151742_22186428)_(22196494_22208560)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex13-14" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22178377_22190443)del" "" "pathogenic (dominant)" "" "0000830482" "0" "90" "X" "22169085" "22234114" "del" "0" "00006" "PHEX_000541" "g.(22151742_22186428)_(22231076_22237152)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex13-16" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22212959_22219035)del" "" "pathogenic (dominant)" "" "0000830483" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.(22151742_22186428)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex13-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830484" "0" "90" "X" "" "" "" "" "00006" "PHEX_000519" "g.(22151742_22186428)_(22269427_?)dup" "" "{PMID:Zhang 2019:30682568}" "" "dup ex13-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22251310_?)dup" "" "pathogenic (dominant)" "" "0000830485" "0" "90" "X" "" "" "" "" "00006" "PHEX_000520" "g.(22196494_22208560)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex15-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22178377_22190443)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830486" "0" "90" "X" "22234114" "22238475" "del" "0" "00006" "PHEX_000542" "g.(22231076_22237152)_(22237221_22239729)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex17" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22212959_22219035)_(22219104_22221612)del" "" "pathogenic (dominant)" "" "0000830487" "0" "90" "X" "" "" "" "" "00006" "PHEX_000521" "g.(22231076_22237152)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex17-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22212959_22219035)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830488" "0" "90" "X" "" "" "" "" "00006" "PHEX_000521" "g.(22231076_22237152)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex17-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22212959_22219035)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830489" "0" "90" "X" "22242210" "22245125" "del" "0" "00006" "PHEX_000543" "g.(22239861_22244559)_(22244626_22245623)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex19" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22221744_22226442)_(22226509_22227506)del" "" "pathogenic (dominant)" "" "0000830490" "0" "90" "X" "" "" "" "" "00006" "PHEX_000522" "g.(22245729_22263449)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex21-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22227612_22245332)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830491" "0" "90" "X" "" "" "" "" "00006" "PHEX_000522" "g.(22245729_22263449)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex21-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22227612_22245332)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830492" "0" "90" "X" "" "" "" "" "00006" "PHEX_000522" "g.(22245729_22263449)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex21-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22227612_22245332)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830493" "0" "90" "X" "" "" "" "" "00006" "PHEX_000522" "g.(22245729_22263449)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex21-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22227612_22245332)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830494" "0" "90" "X" "" "" "" "" "00006" "PHEX_000523" "g.(22263527_22265967)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22245410_22247850)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830495" "0" "90" "X" "22242210" "22269427" "del" "0" "00006" "PHEX_000705" "g.(22239861_22244559)_(22269427_?)del" "" "{PMID:Zhang 2019:30682568}" "" "del ex6-15;19-22" "non-contiguous deletion exons 6-15 and 19-22" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830591" "0" "70" "X" "22051124" "22051124" "subst" "0" "00006" "PHEX_000525" "g.22051124A>G" "" "{PMID:Zhang 2019:30682568}" "" "M1V" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033006A>G" "" "likely pathogenic (dominant)" "" "0000830592" "0" "70" "X" "22051133" "22051133" "subst" "0.00072759" "00006" "PHEX_000004" "g.22051133G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033015G>C" "" "likely pathogenic (dominant)" "" "0000830593" "0" "70" "X" "22065211" "22065211" "subst" "0" "00006" "PHEX_000577" "g.22065211T>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047093T>G" "" "likely pathogenic (dominant)" "" "0000830594" "0" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000167" "g.22065234G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047116G>A" "" "likely pathogenic (dominant)" "" "0000830595" "0" "70" "X" "22065234" "22065234" "subst" "0" "00006" "PHEX_000389" "g.22065234G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047116G>C" "" "likely pathogenic (dominant)" "" "0000830596" "0" "70" "X" "22065284" "22065284" "subst" "0" "00006" "PHEX_000579" "g.22065284G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047166G>A" "" "likely pathogenic (dominant)" "" "0000830597" "0" "70" "X" "22094578" "22094578" "subst" "0" "00006" "PHEX_000510" "g.22094578C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076460C>T" "" "likely pathogenic (dominant)" "" "0000830598" "0" "70" "X" "22112188" "22112188" "subst" "0" "00006" "PHEX_000596" "g.22112188G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094070G>C" "" "likely pathogenic (dominant)" "" "0000830599" "0" "70" "X" "22117130" "22117130" "subst" "0" "00006" "PHEX_000603" "g.22117130T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099012T>C" "" "likely pathogenic (dominant)" "" "0000830600" "0" "70" "X" "22132618" "22132618" "subst" "0" "00006" "PHEX_000609" "g.22132618T>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114500T>A" "" "likely pathogenic (dominant)" "" "0000830601" "0" "70" "X" "22151739" "22151739" "subst" "0" "00006" "PHEX_000439" "g.22151739A>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133622A>G" "" "likely pathogenic (dominant)" "" "0000830602" "0" "70" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "likely pathogenic (dominant)" "" "0000830603" "0" "70" "X" "22231048" "22231048" "subst" "0" "00006" "PHEX_000184" "g.22231048C>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212931C>G" "" "likely pathogenic (dominant)" "" "0000830604" "0" "70" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "likely pathogenic (dominant)" "" "0000830605" "0" "70" "X" "22239804" "22239804" "subst" "0" "00006" "PHEX_000633" "g.22239804A>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221687A>C" "" "likely pathogenic (dominant)" "" "0000830606" "0" "70" "X" "22239826" "22239826" "subst" "0" "00006" "PHEX_000634" "g.22239826A>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221709A>G" "" "likely pathogenic (dominant)" "" "0000830607" "0" "70" "X" "22244579" "22244579" "subst" "0" "00006" "PHEX_000323" "g.22244579T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226462T>C" "" "likely pathogenic (dominant)" "" "0000830608" "0" "70" "X" "22244602" "22244602" "subst" "0" "00006" "PHEX_000643" "g.22244602G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226485G>A" "" "likely pathogenic (dominant)" "" "0000830609" "0" "70" "X" "22245627" "22245627" "subst" "0" "00006" "PHEX_000648" "g.22245627T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227510T>C" "" "likely pathogenic (dominant)" "" "0000830610" "0" "70" "X" "22245706" "22245706" "subst" "0" "00006" "PHEX_000655" "g.22245706T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227589T>C" "" "likely pathogenic (dominant)" "" "0000830611" "0" "70" "X" "22245712" "22245712" "subst" "0" "00006" "PHEX_000657" "g.22245712T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227595T>C" "" "likely pathogenic (dominant)" "" "0000830612" "0" "70" "X" "22245717" "22245717" "subst" "0" "00006" "PHEX_000660" "g.22245717A>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227600A>C" "" "likely pathogenic (dominant)" "" "0000830613" "0" "70" "X" "22263456" "22263456" "subst" "0" "00006" "PHEX_000662" "g.22263456T>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245339T>A" "" "likely pathogenic (dominant)" "" "0000830614" "0" "70" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000342" "g.22263457G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245340G>A" "" "likely pathogenic (dominant)" "" "0000830615" "0" "70" "X" "22266068" "22266068" "subst" "0" "00006" "PHEX_000670" "g.22266068T>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247951T>C" "" "likely pathogenic (dominant)" "" "0000830616" "0" "90" "X" "22051151" "22051151" "subst" "0.00000559769" "00006" "PHEX_000569" "g.22051151G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033033G>T" "" "pathogenic (dominant)" "" "0000830617" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic (dominant)" "" "0000830618" "0" "90" "X" "22056630" "22056630" "subst" "0" "00006" "PHEX_000573" "g.22056630C>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038512C>A" "" "pathogenic (dominant)" "" "0000830619" "0" "90" "X" "22065243" "22065243" "subst" "0" "00006" "PHEX_000578" "g.22065243G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047125G>A" "" "pathogenic (dominant)" "" "0000830620" "0" "90" "X" "22094521" "22094521" "subst" "0" "00006" "PHEX_000584" "g.22094521C>A" "" "{PMID:Zhang 2019:30682568}" "" "365A>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076403C>A" "" "pathogenic (dominant)" "" "0000830621" "0" "90" "X" "22095617" "22095617" "subst" "0" "00006" "PHEX_000589" "g.22095617A>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077499A>T" "" "pathogenic (dominant)" "" "0000830622" "0" "90" "X" "22095701" "22095701" "subst" "0" "00006" "PHEX_000592" "g.22095701G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077583G>T" "" "pathogenic (dominant)" "" "0000830623" "0" "90" "X" "22095722" "22095722" "subst" "0" "00006" "PHEX_000099" "g.22095722C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077604C>T" "" "pathogenic (dominant)" "" "0000830624" "0" "90" "X" "22095778" "22095778" "subst" "0" "00006" "PHEX_000228" "g.22095778T>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077660T>A" "" "pathogenic (dominant)" "" "0000830625" "0" "90" "X" "22108553" "22108553" "subst" "0" "00006" "PHEX_000176" "g.22108553C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090435C>T" "" "pathogenic (dominant)" "" "0000830626" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic (dominant)" "" "0000830627" "0" "90" "X" "22117223" "22117223" "subst" "0" "00006" "PHEX_000023" "g.22117223C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099105C>T" "" "pathogenic (dominant)" "" "0000830628" "0" "90" "X" "22129608" "22129608" "subst" "0" "00006" "PHEX_000114" "g.22129608G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111490G>A" "" "pathogenic (dominant)" "" "0000830629" "0" "90" "X" "22132615" "22132615" "subst" "0" "00006" "PHEX_000608" "g.22132615A>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114497A>T" "" "pathogenic (dominant)" "" "0000830630" "0" "90" "X" "22132680" "22132680" "subst" "0" "00006" "PHEX_000612" "g.22132680C>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114562C>A" "" "pathogenic (dominant)" "" "0000830631" "0" "90" "X" "22151668" "22151668" "subst" "0" "00006" "PHEX_000120" "g.22151668G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133551G>A" "" "pathogenic (dominant)" "" "0000830632" "0" "90" "X" "22151705" "22151705" "subst" "0" "00006" "PHEX_000438" "g.22151705G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133588G>A" "" "pathogenic (dominant)" "" "0000830633" "0" "90" "X" "22151736" "22151736" "subst" "0" "00006" "PHEX_000614" "g.22151736G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133619G>T" "" "pathogenic (dominant)" "" "0000830634" "0" "90" "X" "22196450" "22196450" "subst" "0" "00006" "PHEX_000130" "g.22196450C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178333C>T" "" "pathogenic (dominant)" "" "0000830635" "0" "90" "X" "22208563" "22208563" "subst" "0" "00006" "PHEX_000619" "g.22208563G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190446G>A" "" "pathogenic (dominant)" "" "0000830636" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000830637" "0" "90" "X" "22231041" "22231041" "subst" "0" "00006" "PHEX_000552" "g.22231041C>T" "" "{PMID:Zhang 2019:30682568}" "" "1665C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212924C>T" "" "pathogenic (dominant)" "" "0000830638" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830639" "0" "90" "X" "22237193" "22237193" "subst" "0" "00006" "PHEX_000627" "g.22237193G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219076G>T" "" "pathogenic (dominant)" "" "0000830640" "0" "90" "X" "22239735" "22239735" "subst" "0" "00006" "PHEX_000628" "g.22239735A>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221618A>T" "" "pathogenic (dominant)" "" "0000830641" "0" "90" "X" "22239740" "22239740" "subst" "0" "00006" "PHEX_000311" "g.22239740T>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221623T>A" "" "pathogenic (dominant)" "" "0000830642" "0" "90" "X" "22239766" "22239766" "subst" "0" "00006" "PHEX_000561" "g.22239766G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221649G>A" "" "pathogenic (dominant)" "" "0000830643" "0" "90" "X" "22239770" "22239770" "subst" "0" "00006" "PHEX_000314" "g.22239770G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221653G>A" "" "pathogenic (dominant)" "" "0000830644" "0" "90" "X" "22239786" "22239786" "subst" "0" "00006" "PHEX_000142" "g.22239786G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221669G>T" "" "pathogenic (dominant)" "" "0000830645" "0" "90" "X" "22239839" "22239839" "subst" "0" "00006" "PHEX_000636" "g.22239839T>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221722T>G" "" "pathogenic (dominant)" "" "0000830646" "0" "90" "X" "22239843" "22239843" "subst" "0" "00006" "PHEX_000637" "g.22239843A>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221726A>T" "" "pathogenic (dominant)" "" "0000830647" "0" "90" "X" "22263467" "22263467" "subst" "0" "00006" "PHEX_000663" "g.22263467C>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245350C>G" "" "pathogenic (dominant)" "" "0000830648" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic (dominant)" "" "0000830649" "0" "90" "X" "22263489" "22263489" "subst" "0" "00006" "PHEX_000664" "g.22263489C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245372C>T" "" "pathogenic (dominant)" "" "0000830650" "0" "90" "X" "22263519" "22263519" "subst" "0" "00006" "PHEX_000374" "g.22263519C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245402C>T" "" "pathogenic (dominant)" "" "0000830651" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic (dominant)" "" "0000830652" "0" "90" "X" "22051242" "22051242" "subst" "0" "00006" "PHEX_000194" "g.22051242G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033124G>A" "" "pathogenic (dominant)" "" "0000830653" "0" "90" "X" "22056586" "22056586" "subst" "0" "00006" "PHEX_000195" "g.22056586G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038468G>A" "" "pathogenic (dominant)" "" "0000830654" "0" "90" "X" "22056656" "22056656" "subst" "0" "00006" "PHEX_000200" "g.22056656G>T" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038538G>T" "" "pathogenic (dominant)" "" "0000830655" "0" "90" "X" "22056656" "22056656" "subst" "0" "00006" "PHEX_000575" "g.22056656G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038538G>C" "" "pathogenic (dominant)" "" "0000830656" "0" "90" "X" "22065330" "22065330" "subst" "0" "00006" "PHEX_000581" "g.22065330G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047212G>C" "" "pathogenic (dominant)" "" "0000830657" "0" "70" "X" "22065334" "22065334" "subst" "0" "00006" "PHEX_000582" "g.22065334G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047216G>C" "" "likely pathogenic (dominant)" "" "0000830658" "0" "90" "X" "22108546" "22108546" "subst" "0" "00006" "PHEX_000402" "g.22108546G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090428G>C" "" "pathogenic (dominant)" "" "0000830659" "0" "90" "X" "22115157" "22115157" "subst" "0" "00006" "PHEX_000602" "g.22115157G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097039G>A" "" "pathogenic (dominant)" "" "0000830660" "0" "90" "X" "22129583" "22129583" "subst" "0" "00006" "PHEX_000257" "g.22129583A>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111465A>G" "" "pathogenic (dominant)" "" "0000830661" "0" "90" "X" "22151742" "22151742" "subst" "0" "00006" "PHEX_000124" "g.22151742G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133625G>C" "" "pathogenic (dominant)" "" "0000830662" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000830663" "0" "70" "X" "22208623" "22208623" "subst" "0" "00006" "PHEX_000620" "g.22208623A>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190506A>G" "" "likely pathogenic (dominant)" "" "0000830664" "0" "70" "X" "22208624" "22208624" "subst" "0" "00006" "PHEX_000292" "g.22208624G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190507G>A" "" "likely pathogenic (dominant)" "" "0000830665" "0" "90" "X" "22231076" "22231076" "subst" "0" "00006" "PHEX_000298" "g.22231076G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212959G>A" "" "pathogenic (dominant)" "" "0000830666" "0" "70" "X" "22231080" "22231080" "subst" "0" "00006" "PHEX_000622" "g.22231080G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212963G>A" "" "likely pathogenic (dominant)" "" "0000830667" "0" "90" "X" "22237221" "22237221" "subst" "0" "00006" "PHEX_000306" "g.22237221G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219104G>A" "" "pathogenic (dominant)" "" "0000830668" "0" "70" "X" "22237225" "22237225" "subst" "0" "00006" "PHEX_000309" "g.22237225G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219108G>A" "" "likely pathogenic (dominant)" "" "0000830669" "0" "90" "X" "22239729" "22239729" "subst" "0" "00006" "PHEX_000567" "g.22239729G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221612G>A" "" "pathogenic (dominant)" "" "0000830670" "0" "70" "X" "22239865" "22239865" "subst" "0" "00006" "PHEX_000322" "g.22239865G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221748G>A" "" "likely pathogenic (dominant)" "" "0000830671" "0" "90" "X" "22244626" "22244626" "subst" "0" "00006" "PHEX_000147" "g.22244626G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226509G>A" "" "pathogenic (dominant)" "" "0000830672" "0" "90" "X" "22245623" "22245623" "subst" "0" "00006" "PHEX_000646" "g.22245623G>C" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227506G>C" "" "pathogenic (dominant)" "" "0000830673" "0" "90" "X" "22245622" "22245622" "subst" "0" "00006" "PHEX_000645" "g.22245622A>G" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227505A>G" "" "pathogenic (dominant)" "" "0000830674" "0" "90" "X" "22265967" "22265967" "subst" "0" "00006" "PHEX_000494" "g.22265967G>A" "" "{PMID:Zhang 2019:30682568}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247850G>A" "" "pathogenic (dominant)" "" "0000830675" "0" "90" "X" "22051138" "22051139" "del" "0" "00006" "PHEX_000086" "g.22051138_22051139del" "" "{PMID:Zhang 2019:30682568}" "" "15_16delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033020_22033021del" "" "pathogenic (dominant)" "" "0000830676" "0" "90" "X" "22051219" "22051219" "del" "0" "00006" "PHEX_000571" "g.22051219del" "" "{PMID:Zhang 2019:30682568}" "" "95_96delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033101del" "" "pathogenic (dominant)" "" "0000830677" "0" "90" "X" "22056652" "22056654" "delins" "0" "00006" "PHEX_000574" "g.22056652_22056654delinsCC" "" "{PMID:Zhang 2019:30682568}" "" "184_186delGCGinsCC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038534_22038536delinsCC" "" "pathogenic (dominant)" "" "0000830678" "0" "90" "X" "22065201" "22065201" "del" "0" "00006" "PHEX_000576" "g.22065201del" "" "{PMID:Zhang 2019:30682568}" "" "221delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047083del" "" "pathogenic (dominant)" "" "0000830679" "0" "90" "X" "22065244" "22065244" "del" "0" "00006" "PHEX_000207" "g.22065244del" "" "{PMID:Zhang 2019:30682568}" "" "263_264delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047126del" "" "pathogenic (dominant)" "" "0000830680" "0" "90" "X" "22094507" "22094507" "del" "0" "00006" "PHEX_000583" "g.22094507del" "" "{PMID:Zhang 2019:30682568}" "" "350_351delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076389del" "" "pathogenic (dominant)" "" "0000830681" "0" "90" "X" "22094558" "22094558" "del" "0" "00006" "PHEX_000585" "g.22094558del" "" "{PMID:Zhang 2019:30682568}" "" "402delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076440del" "" "pathogenic (dominant)" "" "0000830682" "0" "90" "X" "22094580" "22094580" "del" "0" "00006" "PHEX_000586" "g.22094580del" "" "{PMID:Zhang 2019:30682568}" "" "424delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076462del" "" "pathogenic (dominant)" "" "0000830683" "0" "90" "X" "22094587" "22094590" "del" "0" "00006" "PHEX_000588" "g.22094587_22094590del" "" "{PMID:Zhang 2019:30682568}" "" "431_434delATGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076469_22076472del" "" "pathogenic (dominant)" "" "0000830684" "0" "90" "X" "22095621" "22095621" "del" "0" "00006" "PHEX_000590" "g.22095621del" "" "{PMID:Zhang 2019:30682568}" "" "463_464delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077503del" "" "pathogenic (dominant)" "" "0000830685" "0" "90" "X" "22095689" "22095693" "del" "0" "00006" "PHEX_000591" "g.22095689_22095693del" "" "{PMID:Zhang 2019:30682568}" "" "532_536delGGGGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077571_22077575del" "" "pathogenic (dominant)" "" "0000830686" "0" "90" "X" "22108565" "22108566" "del" "0" "00006" "PHEX_000230" "g.22108565_22108566del" "" "{PMID:Zhang 2019:30682568}" "" "682_683delTC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090447_22090448del" "" "pathogenic (dominant)" "" "0000830687" "0" "90" "X" "22108616" "22108617" "del" "0" "00006" "PHEX_000233" "g.22108616_22108617del" "" "{PMID:Zhang 2019:30682568}" "" "732+1_732+2delGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090498_22090499del" "" "pathogenic (dominant)" "" "0000830688" "0" "90" "X" "22112118" "22112119" "del" "0" "00006" "PHEX_000595" "g.22112118_22112119del" "" "{PMID:Zhang 2019:30682568}" "" "749_750delAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094000_22094001del" "" "pathogenic (dominant)" "" "0000830689" "0" "90" "X" "22115123" "22115123" "del" "0" "00006" "PHEX_000599" "g.22115123del" "" "{PMID:Zhang 2019:30682568}" "" "900delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097005del" "" "pathogenic (dominant)" "" "0000830690" "0" "90" "X" "22115150" "22115150" "del" "0" "00006" "PHEX_000601" "g.22115150del" "" "{PMID:Zhang 2019:30682568}" "" "927delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097032del" "" "pathogenic (dominant)" "" "0000830691" "0" "90" "X" "22117174" "22117175" "del" "0" "00006" "PHEX_000604" "g.22117174_22117175del" "" "{PMID:Zhang 2019:30682568}" "" "984_985delCC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099056_22099057del" "" "pathogenic (dominant)" "" "0000830692" "0" "90" "X" "22117188" "22117188" "del" "0" "00006" "PHEX_000605" "g.22117188del" "" "{PMID:Zhang 2019:30682568}" "" "998delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099070del" "" "pathogenic (dominant)" "" "0000830693" "0" "90" "X" "22129676" "22129676" "del" "0" "00006" "PHEX_000607" "g.22129676del" "" "{PMID:Zhang 2019:30682568}" "" "1171delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111558del" "" "pathogenic (dominant)" "" "0000830694" "0" "90" "X" "22132628" "22132629" "del" "0" "00006" "PHEX_000610" "g.22132628_22132629del" "" "{PMID:Zhang 2019:30682568}" "" "1226_1227delTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114510_22114511del" "" "pathogenic (dominant)" "" "0000830695" "0" "90" "X" "22151670" "22151670" "del" "0" "00006" "PHEX_000436" "g.22151670del" "" "{PMID:Zhang 2019:30682568}" "" "1333delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133553del" "" "pathogenic (dominant)" "" "0000830696" "0" "90" "X" "22151740" "22151741" "delins" "0" "00006" "PHEX_000615" "g.22151740_22151741delinsT" "" "{PMID:Zhang 2019:30682568}" "" "1403_1404delAGinsT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133623_22133624delinsT" "" "pathogenic (dominant)" "" "0000830697" "0" "90" "X" "22186488" "22186488" "del" "0" "00006" "PHEX_000616" "g.22186488del" "" "{PMID:Zhang 2019:30682568}" "" "1463_1464delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168371del" "" "pathogenic (dominant)" "" "0000830698" "0" "90" "X" "22186505" "22186511" "del" "0" "00006" "PHEX_000617" "g.22186505_22186511del" "" "{PMID:Zhang 2019:30682568}" "" "1481_1482+5delCTgtaag" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168388_22168394del" "" "pathogenic (dominant)" "" "0000830699" "0" "90" "X" "22196493" "22196494" "del" "0" "00006" "PHEX_000182" "g.22196493_22196494del" "" "{PMID:Zhang 2019:30682568}" "" "1584_1585delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178376_22178377del" "" "pathogenic (dominant)" "" "0000830700" "0" "90" "X" "22237184" "22237197" "del" "0" "00006" "PHEX_000625" "g.22237184_22237197del" "" "{PMID:Zhang 2019:30682568}" "" "1732_1745delGTCGGACATGAATT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219067_22219080del" "" "pathogenic (dominant)" "" "0000830701" "0" "90" "X" "22239835" "22239838" "delins" "0" "00006" "PHEX_000635" "g.22239835_22239838delinsCC" "" "{PMID:Zhang 2019:30682568}" "" "1874_1877delATTAinsCC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221718_22221721delinsCC" "" "pathogenic (dominant)" "" "0000830702" "0" "90" "X" "22244545" "22244566" "del" "0" "00006" "PHEX_000639" "g.22244545_22244566del" "" "{PMID:Zhang 2019:30682568}" "" "1900-15_1906delTTTTCTTTCTGTTAGGTCAAGG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226428_22226449del" "" "pathogenic (dominant)" "" "0000830703" "0" "90" "X" "22245711" "22245713" "del" "0" "00006" "PHEX_000656" "g.22245711_22245713del" "" "{PMID:Zhang 2019:30682568}" "" "2053_2055delTTC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227594_22227596del" "" "pathogenic (dominant)" "" "0000830704" "0" "90" "X" "22245712" "22245715" "delins" "0" "00006" "PHEX_000658" "g.22245712_22245715delinsA" "" "{PMID:Zhang 2019:30682568}" "" "2054_2057delTCCTinsA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227595_22227598delinsA" "" "pathogenic (dominant)" "" "0000830705" "0" "90" "X" "22266034" "22266034" "del" "0" "00006" "PHEX_000668" "g.22266034del" "" "{PMID:Zhang 2019:30682568}" "" "2214delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247917del" "" "pathogenic (dominant)" "" "0000830706" "0" "90" "X" "22051217" "22051217" "dup" "0" "00006" "PHEX_000570" "g.22051217dup" "" "{PMID:Zhang 2019:30682568}" "" "94dupG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033099dup" "" "pathogenic (dominant)" "" "0000830707" "0" "90" "X" "22056604" "22056604" "dup" "0" "00006" "PHEX_000572" "g.22056604dup" "" "{PMID:Zhang 2019:30682568}" "" "135_136dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038486dup" "" "pathogenic (dominant)" "" "0000830708" "0" "90" "X" "22129657" "22129658" "dup" "0" "00006" "PHEX_000606" "g.22129657_22129658dup" "" "{PMID:Zhang 2019:30682568}" "" "1152_1153dupTA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111539_22111540dup" "" "pathogenic (dominant)" "" "0000830709" "0" "90" "X" "22132661" "22132661" "dup" "0" "00006" "PHEX_000611" "g.22132661dup" "" "{PMID:Zhang 2019:30682568}" "" "1257_1259dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114543dup" "" "pathogenic (dominant)" "" "0000830710" "0" "90" "X" "22237159" "22237162" "dup" "0" "00006" "PHEX_000623" "g.22237159_22237162dup" "" "{PMID:Zhang 2019:30682568}" "" "1707_1710dupGAGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219042_22219045dup" "" "pathogenic (dominant)" "" "0000830711" "0" "90" "X" "22237190" "22237194" "dup" "0" "00006" "PHEX_000626" "g.22237190_22237194dup" "" "{PMID:Zhang 2019:30682568}" "" "1736_1740dupGACAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219073_22219077dup" "" "pathogenic (dominant)" "" "0000830712" "0" "90" "X" "22239747" "22239748" "dup" "0" "00006" "PHEX_000629" "g.22239747_22239748dup" "" "{PMID:Zhang 2019:30682568}" "" "1783_1787dupAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221630_22221631dup" "" "pathogenic (dominant)" "" "0000830713" "0" "90" "X" "22239777" "22239780" "dup" "0" "00006" "PHEX_000630" "g.22239777_22239780dup" "" "{PMID:Zhang 2019:30682568}" "" "1816_1819dupGAAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221660_22221663dup" "" "pathogenic (dominant)" "" "0000830714" "0" "90" "X" "22239780" "22239787" "dup" "0" "00006" "PHEX_000631" "g.22239780_22239787dup" "" "{PMID:Zhang 2019:30682568}" "" "1819_1826dupTCAGAAGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221663_22221670dup" "" "pathogenic (dominant)" "" "0000830715" "0" "90" "X" "22239793" "22239794" "dup" "0" "00006" "PHEX_000632" "g.22239793_22239794dup" "" "{PMID:Zhang 2019:30682568}" "" "1832_1833dupTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221676_22221677dup" "" "pathogenic (dominant)" "" "0000830716" "0" "90" "X" "22239804" "22239804" "dup" "0" "00006" "PHEX_000317" "g.22239804dup" "" "{PMID:Zhang 2019:30682568}" "" "1843dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221687dup" "" "pathogenic (dominant)" "" "0000830717" "0" "90" "X" "22244561" "22244568" "dup" "0" "00006" "PHEX_000641" "g.22244561_22244568dup" "" "{PMID:Zhang 2019:30682568}" "" "1900-1_1906dupGGTCAAGG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226444_22226451dup" "" "pathogenic (dominant)" "" "0000830718" "0" "90" "X" "22244559" "22244569" "dup" "0" "00006" "PHEX_000640" "g.22244559_22244569dup" "" "{PMID:Zhang 2019:30682568}" "" "1900-1_1909dupGGTCAAGGGGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226442_22226452dup" "" "pathogenic (dominant)" "" "0000830719" "0" "90" "X" "22244582" "22244582" "dup" "0" "00006" "PHEX_000642" "g.22244582dup" "" "{PMID:Zhang 2019:30682568}" "" "1920_1922dupG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226465dup" "" "pathogenic (dominant)" "" "0000830720" "0" "90" "X" "22244606" "22244606" "dup" "0" "00006" "PHEX_000644" "g.22244606dup" "" "{PMID:Zhang 2019:30682568}" "" "1945_1946dupG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226489dup" "" "pathogenic (dominant)" "" "0000830721" "0" "90" "X" "22245631" "22245677" "dup" "0" "00006" "PHEX_000649" "g.22245631_22245677dup" "" "{PMID:Zhang 2019:30682568}" "" "1973_2019dupGGAAATGGATAAATGACAGAAGGCAGGGACTTGAGGAGCCTCTTCTA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227514_22227560dup" "" "pathogenic (dominant)" "" "0000830722" "0" "90" "X" "22245644" "22245647" "dup" "0" "00006" "PHEX_000331" "g.22245644_22245647dup" "" "{PMID:Zhang 2019:30682568}" "" "1986_1989dupTGAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227527_22227530dup" "" "pathogenic (dominant)" "" "0000830723" "0" "90" "X" "22245660" "22245664" "dup" "0" "00006" "PHEX_000650" "g.22245660_22245664dup" "" "{PMID:Zhang 2019:30682568}" "" "2002_2006dupCTTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227543_22227547dup" "" "pathogenic (dominant)" "" "0000830724" "0" "90" "X" "22245661" "22245664" "dup" "0" "00006" "PHEX_000651" "g.22245661_22245664dup" "" "{PMID:Zhang 2019:30682568}" "" "2003_2006dupTTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227544_22227547dup" "" "pathogenic (dominant)" "" "0000830725" "0" "90" "X" "22245681" "22245687" "dup" "0" "00006" "PHEX_000652" "g.22245681_22245687dup" "" "{PMID:Zhang 2019:30682568}" "" "2023_2029dupGGCATCA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227564_22227570dup" "" "pathogenic (dominant)" "" "0000830726" "0" "90" "X" "22245697" "22245700" "dup" "0" "00006" "PHEX_000654" "g.22245697_22245700dup" "" "{PMID:Zhang 2019:30682568}" "" "2039_2042dupACAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227580_22227583dup" "" "pathogenic (dominant)" "" "0000830727" "0" "90" "X" "22245718" "22245720" "dup" "0" "00006" "PHEX_000661" "g.22245718_22245720dup" "" "{PMID:Zhang 2019:30682568}" "" "2060_2062dupGTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227601_22227603dup" "" "pathogenic (dominant)" "" "0000830728" "0" "90" "X" "22245718" "22245721" "dup" "0" "00006" "PHEX_000338" "g.22245718_22245721dup" "" "{PMID:Zhang 2019:30682568}" "" "2060_2063dupGTTA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227601_22227604dup" "" "pathogenic (dominant)" "" "0000830729" "0" "90" "X" "22266057" "22266057" "dup" "0" "00006" "PHEX_000669" "g.22266057dup" "" "{PMID:Zhang 2019:30682568}" "" "2237dupG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247940dup" "" "pathogenic (dominant)" "" "0000830731" "11" "70" "X" "22065305" "22065306" "dup" "0" "00006" "PHEX_000580" "g.22065305_22065306dup" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "c.325_326dupCA" "" "Germline" "" "" "0" "" "" "g.22047187_22047188dup" "" "likely pathogenic (dominant)" "" "0000830732" "21" "70" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "" "0" "" "" "g.22190503G>A" "" "likely pathogenic (dominant)" "" "0000830733" "0" "70" "X" "" "" "" "" "00006" "PHEX_000521" "g.(22212959_22219035)_(2248361_?)del" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "del ex 17-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22231076_22237152)_(22251310_?)del" "" "likely pathogenic (dominant)" "" "0000830734" "0" "30" "X" "22230975" "22230975" "subst" "0.290293" "00006" "PHEX_000547" "g.22230975T>C" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline/De novo (untested)" "" "rs3213493" "0" "" "" "g.22212858T>C" "" "likely benign" "" "0000830735" "0" "70" "X" "22191448" "22202527" "del" "0" "00006" "PHEX_000618" "g.(22186507_22196389)_(22196494_22208560)del" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "del ex14" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22168390_22178272)del" "" "likely pathogenic (dominant)" "" "0000830736" "21" "70" "X" "22196389" "22196389" "subst" "0" "00006" "PHEX_000366" "g.22196389G>A" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "" "0" "" "" "g.22178272G>A" "" "likely pathogenic (dominant)" "" "0000830737" "21" "70" "X" "22196389" "22196389" "subst" "0" "00006" "PHEX_000366" "g.22196389G>A" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "" "0" "" "" "g.22178272G>A" "" "likely pathogenic (dominant)" "" "0000830738" "21" "70" "X" "22095821" "22095821" "subst" "0" "00006" "PHEX_000594" "g.22095821G>T" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "" "0" "" "" "g.22077703G>T" "" "likely pathogenic (dominant)" "" "0000830739" "21" "70" "X" "22095821" "22095821" "subst" "0" "00006" "PHEX_000594" "g.22095821G>T" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "" "0" "" "" "g.22077703G>T" "" "likely pathogenic (dominant)" "" "0000830740" "0" "70" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "likely pathogenic (dominant)" "" "0000830741" "21" "70" "X" "22115122" "22115123" "del" "0" "00006" "PHEX_000598" "g.22115122_22115123del" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "c.899_900delTG" "" "Germline" "" "" "0" "" "" "g.22097004_22097005del" "" "likely pathogenic (dominant)" "" "0000830742" "0" "10" "X" "22239720" "22239720" "subst" "0.26339" "00006" "PHEX_000310" "g.22239720C>T" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "rs3752433" "0" "" "" "" "" "benign" "" "0000830744" "21" "30" "X" "22239720" "22239720" "subst" "0.26339" "00006" "PHEX_000310" "g.22239720C>T" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "rs3752433" "0" "" "" "" "" "likely benign" "" "0000830745" "0" "10" "X" "22230975" "22230975" "subst" "0.290293" "00006" "PHEX_000547" "g.22230975T>C" "" "{PMID:Obara-Moszynska 2020:33295632}" "" "" "" "Germline" "" "rs3213493" "0" "" "" "" "" "benign" "" "0000830746" "0" "90" "X" "22115130" "22115130" "subst" "0" "00006" "PHEX_000600" "g.22115130T>A" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.1472T>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097012T>A" "" "pathogenic (dominant)" "" "0000830747" "1" "90" "X" "22051200" "22051201" "del" "0" "00006" "PHEX_000087" "g.22051200_22051201del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.642_643delTT" "" "Germline" "" "" "0" "" "" "g.22033082_22033083del" "" "pathogenic (dominant)" "" "0000830748" "1" "90" "X" "22051200" "22051201" "del" "0" "00006" "PHEX_000087" "g.22051200_22051201del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.641_642delTT" "" "Germline" "" "" "0" "" "" "g.22033082_22033083del" "" "pathogenic (dominant)" "" "0000830749" "1" "90" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000088" "g.22065192A>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.777A>T" "" "Germline" "" "" "0" "" "" "g.22047074A>T" "" "pathogenic (dominant)" "" "0000830750" "1" "90" "X" "22065192" "22065192" "subst" "0" "00006" "PHEX_000088" "g.22065192A>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.777A>T" "" "Germline" "" "" "0" "" "" "g.22047074A>T" "" "pathogenic (dominant)" "" "0000830751" "0" "90" "X" "22065184" "22065184" "dup" "0" "00006" "PHEX_000384" "g.22065184dup" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.770insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047066dup" "" "pathogenic (dominant)" "" "0000830752" "0" "90" "X" "22151704" "22151704" "subst" "0" "00006" "PHEX_000278" "g.22151704G>A" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.1932G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133587G>A" "" "pathogenic (dominant)" "" "0000830753" "0" "90" "X" "" "" "" "" "00006" "PHEX_000516" "g.(22244626_22245623)_(22269427_?)del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2532_?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22226509_22227506)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830754" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.1436C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic (dominant)" "" "0000830755" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.773_777delGTAAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic (dominant)" "" "0000830756" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2804C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic (dominant)" "" "0000830757" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "hg38 g.22190503G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000830758" "0" "90" "X" "22231076" "22231076" "subst" "0" "00006" "PHEX_000621" "g.22231076G>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "hg38 g.22212959G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212959G>T" "" "pathogenic (dominant)" "" "0000830759" "0" "90" "X" "22115111" "22115113" "delins" "0" "00006" "PHEX_000597" "g.22115111_22115113delinsC" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.1453_1455delinsC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096993_22096995delinsC" "" "pathogenic (dominant)" "" "0000830760" "0" "90" "X" "22094596" "22094596" "subst" "0" "00006" "PHEX_000393" "g.22094596A>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "hg38 g.22076478A>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076478A>T" "" "pathogenic (dominant)" "" "0000830761" "0" "90" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.773_777delGTAAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047070_22047074del" "" "pathogenic (dominant)" "" "0000830762" "0" "90" "X" "22239862" "22239862" "subst" "0" "00006" "PHEX_000638" "g.22239862T>G" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "hg38 g.22221745T>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221745T>G" "" "pathogenic (dominant)" "" "0000830763" "0" "90" "X" "22219820" "22266478" "del" "0" "00006" "USP9X_000005" "g.(22208620_22231020)_(22269427_?)del" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2211_?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22190503_22212903)_(22251310_?)del" "" "pathogenic (dominant)" "" "0000830764" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.1644+1G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000830765" "1" "90" "X" "22242210" "22266478" "dup" "0" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.?−2548dup2833-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic (dominant)" "" "0000830766" "1" "90" "X" "22242210" "22266478" "dup" "0" "00006" "USP9X_000005" "g.(22239861_22244559)_(22269427_?)dup" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.?−2548dup2833-?" "" "Germline" "" "" "0" "" "" "g.(22221744_22226442)_(22251310_?)dup" "" "pathogenic (dominant)" "" "0000830767" "0" "90" "X" "22263509" "22263521" "dup" "0" "00006" "PHEX_000665" "g.22263509_22263521dup" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2695_2707DupCAGTCCCCCTCAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245392_22245404dup" "" "pathogenic (dominant)" "" "0000830768" "1" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000500" "g.22266018G>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2763G>T" "" "Germline" "" "" "0" "" "" "g.22247901G>T" "" "pathogenic (dominant)" "" "0000830769" "1" "90" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000500" "g.22266018G>T" "" "{PMID:Hernandez-Frias 2019:30607568}" "" "c.2763G>T" "" "Germline" "" "" "0" "" "" "g.22247901G>T" "" "pathogenic (dominant)" "" "0000830770" "21" "90" "X" "22095654" "22095654" "del" "0" "00006" "PHEX_000548" "g.22095654del" "" "{PMID:Gao 2018:30075510}" "" "497delG" "" "Germline" "yes" "" "0" "" "" "g.22077536del" "" "pathogenic (dominant)" "" "0000830771" "21" "90" "X" "22094544" "22094544" "subst" "0" "00006" "PHEX_000549" "g.22094544G>T" "" "{PMID:Gao 2018:30075510}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830773" "0" "90" "X" "22065284" "22065284" "subst" "0" "00006" "PHEX_000579" "g.22065284G>A" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22047166G>A" "" "pathogenic (dominant)" "" "0000830774" "21" "90" "X" "22065284" "22065284" "subst" "0" "00006" "PHEX_000579" "g.22065284G>A" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22047166G>A" "" "pathogenic (dominant)" "" "0000830775" "0" "90" "X" "22132696" "22132696" "subst" "0" "00006" "PHEX_000613" "g.22132696A>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22114578A>T" "" "pathogenic (dominant)" "" "0000830776" "21" "90" "X" "22132696" "22132696" "subst" "0" "00006" "PHEX_000613" "g.22132696A>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22114578A>T" "" "pathogenic (dominant)" "" "0000830777" "21" "90" "X" "22132696" "22132696" "subst" "0" "00006" "PHEX_000613" "g.22132696A>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22114578A>T" "" "pathogenic (dominant)" "" "0000830778" "21" "90" "X" "22132696" "22132696" "subst" "0" "00006" "PHEX_000613" "g.22132696A>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22114578A>T" "" "pathogenic (dominant)" "" "0000830779" "0" "90" "X" "22151669" "22151669" "subst" "0" "00006" "PHEX_000435" "g.22151669G>A" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22133552G>A" "" "pathogenic (dominant)" "" "0000830780" "21" "90" "X" "22151669" "22151669" "subst" "0" "00006" "PHEX_000435" "g.22151669G>A" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22133552G>A" "" "pathogenic (dominant)" "" "0000830781" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000830782" "21" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000830783" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830784" "21" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830785" "0" "90" "X" "22266012" "22266012" "subst" "0" "00006" "PHEX_000667" "g.22266012T>C" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22247895T>C" "" "pathogenic (dominant)" "" "0000830786" "11" "90" "X" "22266012" "22266012" "subst" "0" "00006" "PHEX_000667" "g.22266012T>C" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22247895T>C" "" "pathogenic (dominant)" "" "0000830787" "0" "70" "X" "22095771" "22095771" "subst" "0" "00006" "PHEX_000593" "g.22095771G>C" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22077653G>C" "" "likely pathogenic (dominant)" "" "0000830788" "21" "70" "X" "22095771" "22095771" "subst" "0" "00006" "PHEX_000593" "g.22095771G>C" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.22077653G>C" "" "likely pathogenic (dominant)" "" "0000830803" "0" "90" "X" "22115154" "22115154" "dup" "0" "00006" "PHEX_000550" "g.22115154dup" "" "{PMID:Ran 2017:28506344}" "" "c.931dupC" "" "De novo" "" "" "0" "" "" "g.22097036dup" "" "pathogenic (dominant)" "" "0000830804" "0" "90" "X" "22196494" "22196494" "subst" "0" "00006" "PHEX_000448" "g.22196494G>A" "" "{PMID:Ran 2017:28506344}" "" "IVS14+1G>A" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830806" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Rauch 2014:25086671}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000830807" "0" "90" "X" "22094580" "22094580" "subst" "0" "00006" "PHEX_000587" "g.22094580T>C" "" "{PMID:Rauch 2014:25086671}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076462T>C" "" "pathogenic (dominant)" "" "0000830808" "0" "90" "X" "22245625" "22245683" "del" "0" "00006" "PHEX_000647" "g.22245625_22245683del" "" "{PMID:Rauch 2014:25086671}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227508_22227566del" "" "pathogenic (dominant)" "" "0000830835" "0" "90" "X" "22263449" "22263449" "subst" "0" "00006" "PHEX_000556" "g.22263449G>T" "" "{PMID:Song 2013:24229582}" "" "IVS20-1G>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245332G>T" "" "pathogenic (dominant)" "" "0000830836" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic (dominant)" "" "0000830837" "0" "90" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000342" "g.22263457G>A" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245340G>A" "" "pathogenic (dominant)" "" "0000830838" "0" "90" "X" "22196493" "22196494" "del" "0" "00006" "PHEX_000182" "g.22196493_22196494del" "" "{PMID:Song 2013:24229582}" "" "IVS14+1delAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178376_22178377del" "" "pathogenic (dominant)" "" "0000830839" "0" "90" "X" "22245706" "22245706" "subst" "0" "00006" "PHEX_000655" "g.22245706T>C" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227589T>C" "" "pathogenic (dominant)" "" "0000830840" "0" "90" "X" "22265975" "22265975" "subst" "0" "00006" "PHEX_000666" "g.22265975G>A" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247858G>A" "" "pathogenic (dominant)" "" "0000830841" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000830842" "0" "90" "X" "22263457" "22263457" "subst" "0" "00006" "PHEX_000342" "g.22263457G>A" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245340G>A" "" "pathogenic (dominant)" "" "0000830843" "0" "90" "X" "22245706" "22245706" "subst" "0" "00006" "PHEX_000655" "g.22245706T>C" "" "{PMID:Song 2013:24229582}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227589T>C" "" "pathogenic (dominant)" "" "0000830844" "0" "90" "X" "22094568" "22094568" "del" "0" "00006" "PHEX_000213" "g.22094568del" "" "{PMID:Song 2013:24229582}" "" "412delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076450del" "" "pathogenic (dominant)" "" "0000830907" "21" "90" "X" "22237173" "22237173" "subst" "0" "00006" "PHEX_000551" "g.22237173T>A" "" "{PMID:Liao 2018:29393334}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830908" "0" "90" "X" "22095748" "22095748" "subst" "0" "00006" "PHEX_000100" "g.22095748A>G" "" "{PMID:Liao 2018:29393334}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830909" "0" "90" "X" "22231041" "22231041" "subst" "0" "00006" "PHEX_000552" "g.22231041C>T" "" "{PMID:Lin 2020:31658436}" "" "" "germline mosaicism in father" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830910" "0" "90" "X" "22112135" "22112136" "del" "0" "00006" "PHEX_000553" "g.22112135_22112136del" "" "{PMID:Maio 2021:32897287}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830911" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Martin Ramos 2020:32133333}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830912" "0" "90" "X" "22108553" "22108553" "subst" "0" "00006" "PHEX_000176" "g.22108553C>T" "" "{PMID:Martin Ramos 2020:32133333}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830913" "0" "90" "X" "0" "0" "" "0" "00006" "PHEX_000554" "g.22244596(_?)del" "" "{PMID:Martin Ramos 2020:32133333}" "" "1936_?del (Asp646_?del)" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830914" "0" "90" "X" "22117270" "22117270" "subst" "0" "00006" "PHEX_000254" "g.22117270G>A" "" "{PMID:Martin Ramos 2020:32133333}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830915" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Martin Ramos 2020:32133333}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830916" "21" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830917" "21" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830918" "21" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830919" "0" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830920" "21" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830921" "0" "50" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Mumm 2015:25042154}" "" "" "high frequency of variant esp. in male cases" "Germline/De novo (untested)" "" "" "0" "" "" "g.22248184A>G" "" "VUS (!)" "" "0000830922" "0" "90" "X" "22266022" "22266022" "del" "0" "00006" "PHEX_000555" "g.22266022del" "" "{PMID:Sako 2019:30792871}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830926" "0" "90" "X" "22239822" "22239822" "subst" "0" "00006" "PHEX_000031" "g.22239822C>T" "" "{PMID:Cui 2012:22913777}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830927" "1" "90" "X" "22263449" "22263449" "subst" "0" "00006" "PHEX_000556" "g.22263449G>T" "" "{PMID:Cui 2012:22913777}" "" "IVS20-1G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830963" "21" "90" "X" "0" "0" "" "0" "00006" "PHEX_000557" "g.22239841^22239841G>A" "" "{PMID:Murthy 2009:19242361}" "" "W627X" "" "Germline" "yes" "" "0" "" "" "g.22221724^22221725G>A" "" "pathogenic (dominant)" "" "0000830964" "0" "90" "X" "22239841" "22239841" "subst" "0" "00006" "PHEX_000558" "g.22239841G>A" "" "{PMID:Martos Moreno 2016:27221261}" "" "2445G>A (Trp627X)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830965" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Martos Moreno 2016:27221261}" "" "2301G>A (Gly579Arg)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830966" "0" "90" "X" "22129608" "22129608" "subst" "0" "00006" "PHEX_000114" "g.22129608G>A" "" "{PMID:Jorgensen 2019:31903094}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830967" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Jorgensen 2019:31903094}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830968" "0" "90" "X" "22208560" "22208560" "subst" "0" "00006" "PHEX_000132" "g.22208560G>C" "" "{PMID:Jorgensen 2019:31903094}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830969" "0" "90" "X" "22208560" "22208560" "subst" "0" "00006" "PHEX_000132" "g.22208560G>C" "" "{PMID:Jorgensen 2019:31903094}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830970" "0" "90" "X" "22208560" "22208560" "subst" "0" "00006" "PHEX_000132" "g.22208560G>C" "" "{PMID:Jorgensen 2019:31903094}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830972" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Imel 2010:20157195}" "" "1721C>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830973" "0" "90" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Imel 2010:20157195}" "" "1721C>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830974" "0" "90" "X" "22239809" "22239809" "del" "0" "00006" "PHEX_000318" "g.22239809del" "" "{PMID:Imel 2010:20157195}" "" "1848delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221692del" "" "pathogenic (dominant)" "" "0000830975" "0" "90" "X" "22239809" "22239809" "del" "0" "00006" "PHEX_000318" "g.22239809del" "" "{PMID:Imel 2010:20157195}" "" "1848delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221692del" "" "pathogenic (dominant)" "" "0000830976" "0" "90" "X" "22239809" "22239809" "del" "0" "00006" "PHEX_000318" "g.22239809del" "" "{PMID:Imel 2010:20157195}" "" "1848delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221692del" "" "pathogenic (dominant)" "" "0000830977" "0" "90" "X" "22245688" "22245689" "dup" "0" "00006" "PHEX_000653" "g.22245688_22245689dup" "" "{PMID:Imel 2010:20157195}" "" "2030_2031dupCA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227571_22227572dup" "" "pathogenic (dominant)" "" "0000830978" "0" "90" "X" "22196499" "22196499" "subst" "0" "00006" "PHEX_000028" "g.22196499T>C" "" "{PMID:Imel 2010:20157195}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178382T>C" "" "pathogenic (dominant)" "" "0000830979" "0" "90" "X" "22065308" "22065310" "del" "0" "00006" "PHEX_000210" "g.22065308_22065310del" "" "{PMID:Imel 2010:20157195}" "" "328_330delAAT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047190_22047192del" "" "pathogenic (dominant)" "" "0000830980" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Imel 2010:20157195}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>A" "" "pathogenic (dominant)" "" "0000830981" "1" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Imel 2010:20157195}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033063C>T" "" "pathogenic (dominant)" "" "0000830982" "0" "50" "X" "" "" "" "" "00006" "USP9X_000005" "g.?" "" "{PMID:Imel 2010:20157195}" "" "281A>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000830984" "11" "70" "X" "22245715" "22245715" "subst" "0" "00006" "PHEX_000659" "g.22245715T>A" "" "{PMID:Moreira 2020:33049132}" "" "" "" "Germline" "" "" "0" "" "" "g.22227598T>A" "" "likely pathogenic (dominant)" "" "0000830985" "0" "90" "X" "22266059" "22266059" "subst" "0" "00006" "PHEX_000048" "g.22266059C>T" "" "{PMID:Moreira 2020:33049132}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247942C>T" "" "pathogenic (dominant)" "" "0000830986" "0" "70" "X" "22244618" "22244618" "subst" "0" "00006" "PHEX_000032" "g.22244618C>A" "" "{PMID:Moreira 2020:33049132}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226501C>A" "" "likely pathogenic (dominant)" "" "0000830987" "21" "70" "X" "22237176" "22237176" "subst" "0" "00006" "PHEX_000624" "g.22237176G>A" "" "{PMID:Moreira 2020:33049132}" "" "" "" "Germline" "" "" "0" "" "" "g.22219059G>A" "" "likely pathogenic (dominant)" "" "0000830990" "0" "70" "X" "22196499" "22196499" "subst" "0" "00006" "PHEX_000559" "g.22196499T>A" "" "{PMID:Tournis 2011:21885902}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830991" "21" "90" "X" "22112200" "22112200" "subst" "0" "00006" "PHEX_000560" "g.22112200G>A" "" "{PMID:Vakharia 2018:29610183}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830992" "0" "70" "X" "22266018" "22266018" "subst" "0" "00006" "PHEX_000357" "g.22266018G>C" "" "{PMID:Vakharia 2018:29610183}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830993" "0" "90" "X" "22239766" "22239766" "subst" "0" "00006" "PHEX_000561" "g.22239766G>A" "" "{PMID:Vanacker 2008:25983897}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830994" "0" "70" "X" "22245724" "22245724" "subst" "0" "00006" "PHEX_000562" "g.22245724C>T" "" "{PMID:Watts 2015:26561226}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000830995" "21" "90" "X" "22239728" "22239728" "del" "0" "00006" "PHEX_000563" "g.22239728del" "" "{PMID:Yamamoto 2020:32257293}" "" "1769-2delA" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831069" "0" "90" "X" "22065219" "22065219" "subst" "0" "00006" "PHEX_000564" "g.22065219T>C" "" "{PMID:Xiong 2008:17710565}" "" "" "" "animal model" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831070" "0" "90" "X" "22095746" "22095746" "subst" "0" "00006" "PHEX_000565" "g.22095746C>T" "" "{PMID:Yang 2018:30599486}" "" "" "NGS shows 0.3 variant reads" "Somatic" "-" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831071" "0" "90" "X" "22095821" "22095821" "subst" "0" "00006" "PHEX_000566" "g.22095821G>A" "" "{PMID:Kang 2014:25031893}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831072" "0" "90" "X" "22239729" "22239729" "subst" "0" "00006" "PHEX_000567" "g.22239729G>A" "" "{PMID:Weng 2016:26559751}" "" "" "effect on splicing predicted from in vitro mini-gene splicing assay; variant present in 13/32 reads" "Somatic" "-" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831073" "21" "90" "X" "22196460" "22196460" "del" "0" "00006" "PHEX_000568" "g.22196460del" "" "{PMID:Yuan 2015:25060345" "" "1553delT" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000831099" "0" "70" "X" "22117148" "22117150" "del" "0" "00006" "PHEX_000112" "g.22117148_22117150del" "" "{PMID:Zhang 2015:26377240}" "" "c.958_960del3" "" "De novo" "" "" "0" "" "" "g.22099030_22099032del" "" "likely pathogenic" "" "0000831100" "0" "70" "X" "22065188" "22065192" "del" "0" "00006" "PHEX_000203" "g.22065188_22065192del" "" "{PMID:Zhang 2015:26377240}" "" "c.208_212del5" "" "De novo" "" "" "0" "" "" "g.22047070_22047074del" "" "likely pathogenic" "" "0000831101" "0" "70" "X" "22196398" "22196416" "del" "0" "00006" "PHEX_000672" "g.22196398_22196416del" "" "{PMID:Zhang 2015:26377240}" "" "c.1491_1509del19" "" "De novo" "" "" "0" "" "" "g.22178281_22178299del" "" "likely pathogenic" "" "0000831102" "21" "90" "X" "22132610" "22132610" "subst" "0" "00006" "PHEX_000268" "g.22132610G>A" "" "{PMID:Zhang 2015:26377240}" "" "" "" "Germline" "" "" "0" "" "" "g.22114492G>A" "" "pathogenic" "" "0000831103" "0" "90" "X" "22196450" "22196450" "subst" "0" "00006" "PHEX_000130" "g.22196450C>T" "" "{PMID:Zhang 2015:26377240}" "" "" "" "De novo" "" "" "0" "" "" "g.22178333C>T" "" "pathogenic" "" "0000831104" "21" "90" "X" "22132705" "22132705" "subst" "0" "00006" "PHEX_000432" "g.22132705G>A" "" "{PMID:Zhang 2015:26377240}" "" "" "" "Germline" "" "" "0" "" "" "g.22114587G>A" "" "pathogenic" "" "0000831105" "21" "90" "X" "22231032" "22231032" "subst" "0" "00006" "PHEX_000673" "g.22231032G>T" "" "{PMID:Zhang 2015:26377240}" "" "" "" "Germline" "" "" "0" "" "" "g.22212915G>T" "" "pathogenic" "" "0000831106" "0" "90" "X" "22112210" "22112210" "subst" "0" "00006" "PHEX_000407" "g.22112210T>A" "" "{PMID:Zhang 2015:26377240}" "" "" "" "De novo" "" "" "0" "" "" "g.22094092T>A" "" "pathogenic" "" "0000831107" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Zhang 2015:26377240}" "" "" "" "De novo" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic" "" "0000831108" "0" "70" "X" "18896948" "18896948" "subst" "0" "00006" "PHEX_000671" "g.18896948T>C" "" "{PMID:Zhang 2015:26377240}" "" "" "" "De novo" "" "" "0" "" "" "g.18786138T>C" "" "likely pathogenic" "" "0000833207" "21" "90" "X" "22095695" "22095695" "del" "0" "00006" "PHEX_000225" "g.22095695del" "" "{PMID:Douyere 2008:19201216}" "" "538delT" "" "Germline" "" "" "0" "" "" "g.22077577del" "" "pathogenic (dominant)" "" "0000833208" "0" "90" "X" "22095820" "22095832" "del" "0" "00006" "PHEX_000674" "g.22095820_22095832del" "" "{PMID:Zou 2015:25153221}" "" "633+12del" "" "De novo" "" "" "0" "" "" "g.22077702_22077714del" "" "pathogenic (dominant)" "" "0000833209" "0" "90" "X" "22051181" "22051181" "subst" "0" "00006" "PHEX_000165" "g.22051181C>T" "" "{PMID:Liu 2014:24857004}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000833210" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:Liu 2014:24857004}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000833211" "0" "90" "X" "22094593" "22094593" "subst" "0" "00006" "PHEX_000675" "g.22094593G>A" "" "{PMID:Liu 2014:24857004}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000833238" "1" "90" "X" "22117130" "22117130" "subst" "0" "00006" "PHEX_000603" "g.(22117130T>C)" "" "{PMID:Karunaratne 2012:22161748}" "" "T>C (Trp314Arg)" "" "animal model" "yes" "" "0" "" "" "g.(22099012T>C)" "" "pathogenic (dominant)" "" "0000833243" "1" "90" "X" "22244606" "22244606" "subst" "0" "00006" "PHEX_000481" "g.22244606G>A" "" "{PMID:Treff 2013:23312231}" "" "G649D" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836745" "21" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Kang 2012:22713460}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836746" "21" "90" "X" "22245691" "22245691" "dup" "0" "00006" "PHEX_000676" "g.22245691dup" "" "{PMID:Kang 2012:22713460}" "" "2033dupT" "" "Germline" "yes" "" "0" "" "" "g.22227574dup" "" "pathogenic (dominant)" "" "0000836747" "21" "90" "X" "22132696" "22132696" "subst" "0" "00006" "PHEX_000613" "g.22132696A>T" "" "{PMID:Kang 2012:22713460}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836748" "11" "90" "X" "22266012" "22266012" "subst" "0" "00006" "PHEX_000667" "g.22266012T>C" "" "{PMID:Kang 2012:22713460}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836749" "21" "70" "X" "22132618" "22132618" "subst" "0" "00006" "PHEX_000677" "g.22132618T>C" "" "{PMID:Dayal 2014:24756041}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000836750" "0" "90" "X" "22266002" "22266002" "subst" "0" "00006" "PHEX_000499" "g.22266002C>T" "" "{PMID:Broseta 2020:31474501}" "" "" "" "Somatic" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836751" "21" "90" "X" "22219820" "22234114" "del" "0" "00006" "PHEX_000020" "g.(22208620_22231020)_(22231076_22237152)del" "" "{PMID:Broseta 2020:31474501}" "" "del ex16" "mother has also 47XXX" "Somatic" "" "" "0" "" "47XXX (22/25 metaphases)" "" "" "pathogenic (dominant)" "" "0000836998" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "3/4 cases HR" "{PMID:Blázquez Gómez 2021:33358363}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000836999" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "3/4 cases HR" "{PMID:Blazquez Gomez 2021:33358363}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837000" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "3/4 cases HR" "{PMID:Blazquez Gomez 2021:33358363}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837001" "0" "90" "X" "22151741" "22151741" "subst" "0" "00006" "PHEX_000440" "g.22151741G>C" "1/4 cases HR" "{PMID:Blazquez Gomez 2021:33358363}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837003" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000837004" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic (dominant)" "" "0000837005" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic (dominant)" "" "0000837006" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096976C>T" "" "pathogenic (dominant)" "" "0000837007" "0" "90" "X" "22142172" "22169085" "dup" "0" "00006" "PHEX_000539" "g.(22132705_22151639)_(22151742_22186428)dup" "" "{PMID:McKenna 2019:30238432}" "" "del ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837008" "0" "90" "X" "22142172" "22169085" "dup" "0" "00006" "PHEX_000539" "g.(22132705_22151639)_(22151742_22186428)dup" "" "{PMID:McKenna 2019:30238432}" "" "del ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837009" "0" "90" "X" "22095729" "22095729" "subst" "0" "00006" "PHEX_000787" "g.22095729T>C" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077611T>C" "" "pathogenic (dominant)" "" "0000837010" "0" "90" "X" "22237166" "22237166" "subst" "0" "00006" "PHEX_000461" "g.22237166G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219049G>A" "" "pathogenic (dominant)" "" "0000837011" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic (dominant)" "" "0000837012" "0" "90" "X" "22237166" "22237166" "subst" "0" "00006" "PHEX_000461" "g.22237166G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219049G>A" "" "pathogenic (dominant)" "" "0000837013" "0" "90" "X" "22208620" "22208620" "subst" "0" "00006" "PHEX_000028" "g.22208620G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190503G>A" "" "pathogenic (dominant)" "" "0000837014" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic (dominant)" "" "0000837015" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190458C>T" "" "pathogenic (dominant)" "" "0000837016" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000837017" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000837018" "0" "90" "X" "22208619" "22208619" "subst" "0" "00006" "PHEX_000136" "g.22208619C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190502C>T" "" "pathogenic (dominant)" "" "0000837019" "0" "90" "X" "22095696" "22095696" "subst" "0" "00006" "PHEX_000781" "g.22095696G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077578G>A" "" "pathogenic (dominant)" "" "0000837020" "0" "90" "X" "22095660" "22095686" "del" "0" "00006" "PHEX_000778" "g.22095660_22095686del" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077542_22077568del" "" "pathogenic (dominant)" "" "0000837021" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212957C>T" "" "pathogenic (dominant)" "" "0000837022" "0" "90" "X" "22060912" "22079946" "del" "0" "00006" "PHEX_000678" "g.(22056656_22065167)_(22065386_22094505)del" "" "{PMID:McKenna 2019:30238432}" "" "del ex3" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22038538_22047049)_(22047268_22076387)del" "" "pathogenic (dominant)" "" "0000837023" "0" "90" "X" "22237166" "22237166" "subst" "0" "00006" "PHEX_000461" "g.22237166G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219049G>A" "" "pathogenic (dominant)" "" "0000837026" "0" "90" "X" "22265986" "22265986" "delins" "0" "00006" "PHEX_000680" "g.22265986delinsGG" "" "{PMID:Crowley 2014:24594262}, {PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247869delinsGG" "" "pathogenic (dominant)" "" "0000837027" "0" "90" "X" "22263527" "22263527" "subst" "0" "00006" "PHEX_001010" "g.22263527G>A" "" "{PMID:McKenna 2019:30238432}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22245410G>A" "" "pathogenic (dominant)" "" "0000837035" "0" "90" "X" "22056619" "22056619" "subst" "0" "00006" "PHEX_000199" "g.22056619C>T" "" "{PMID:Imel 2019:31485552}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837036" "21" "90" "X" "22265999" "22265999" "subst" "0" "00006" "PHEX_000498" "g.22265999T>C" "" "{PMID:Li 2020:32511895}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000837037" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Lee 2012:22261628}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837038" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Lee 2012:22261628}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837039" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Lee 2012:22261628}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837040" "0" "90" "X" "22151700" "22151700" "subst" "0" "00006" "PHEX_000277" "g.22151700G>T" "" "{PMID:Lee 2012:22261628}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837041" "0" "90" "X" "22231074" "22231074" "subst" "0" "00006" "PHEX_000013" "g.22231074C>T" "" "{PMID:Lee 2012:22261628}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837042" "0" "90" "X" "22095622" "22095623" "dup" "0" "00006" "PHEX_000223" "g.22095622_22095623dup" "" "{PMID:Lee 2012:22261628}" "" "466_467insAC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077504_22077505dup" "" "pathogenic (dominant)" "" "0000837043" "21" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Joel 2010:20838491}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837044" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Radlovic 2014:24684036}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837178" "0" "90" "X" "22263483" "22263483" "subst" "0" "00006" "PHEX_000155" "g.22263483C>T" "" "{PMID:Thiele 2020:33107440}" "" "" "fraction read T:C = 706:646" "Somatic" "" "" "0" "" "" "g.22245366C>T" "" "pathogenic (dominant)" "" "0000837188" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Grove-Laugesen 2014:24660072}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837189" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Yavropoulou 2010:20688626}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837190" "0" "90" "X" "22208575" "22208575" "subst" "0" "00006" "PHEX_000027" "g.22208575C>T" "" "{PMID:Forero-Delgadillo 2020:32104046}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837191" "0" "70" "X" "22265978" "22265978" "subst" "0" "00006" "PHEX_000679" "g.22265978G>T" "" "{PMID:Goljanek-Whysall 2018:28982589}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22247861G>T" "" "likely pathogenic (dominant)" "" "0000837192" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Freudlsperger 2013:23466123}" "" "R291X" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837193" "21" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Sheng 2015:26040324}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837195" "21" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Sheng 2015:26040324}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837196" "0" "90" "X" "22115094" "22115094" "subst" "0" "00006" "PHEX_000108" "g.22115094C>T" "" "{PMID:Zhera 2021:33537138}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837197" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000139" "g.22237187G>A" "" "{PMID:Galvez-Ruiz 2013:28163769}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000837198" "1" "70" "X" "22266301" "22266301" "subst" "0" "00006" "PHEX_000313" "g.22266301A>G" "" "{PMID:Smith 2020:31910300}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000837227" "0" "90" "X" "22050443" "22219820" "del" "0" "00006" "PHEX_000710" "g.(?_22050443)_(22208620_22231020)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-15" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22190503_22212903)del" "" "pathogenic" "ACMG" "0000837228" "0" "90" "X" "22050443" "22060912" "del" "0" "00006" "PHEX_000706" "g.(?_22050443)_(22056656_22065167)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-2" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22038538_22047049)del" "" "pathogenic" "ACMG" "0000837229" "0" "90" "X" "22050443" "22102184" "del" "0" "00006" "PHEX_000707" "g.(?_22050443)_(22095821_22108546)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-5" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22077703_22090428)del" "" "pathogenic" "ACMG" "0000837230" "0" "90" "X" "22050443" "22269427" "del" "0" "00006" "PHEX_000711" "g.(?_22050443)_(22269427_?)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22251310_?)del" "" "pathogenic" "ACMG" "0000837231" "0" "90" "X" "22050443" "22131127" "del" "0" "00006" "PHEX_000708" "g.(?_22050443)_(22129679_22132575)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-10" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22111561_22114457)del" "" "pathogenic" "ACMG" "0000837232" "0" "90" "X" "22050443" "22202527" "del" "0" "00006" "PHEX_000709" "g.(?_22050443)_(22196494_22208560)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex1-14" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_22032325)_(22178377_22190443)del" "" "pathogenic" "ACMG" "0000837233" "0" "90" "X" "22051095" "22051775" "del" "0" "00006" "PHEX_000713" "g.22051095_22051775del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22032977_22033657del" "" "pathogenic" "" "0000837234" "0" "90" "X" "22051125" "22051125" "subst" "0" "00006" "PHEX_000714" "g.22051125T>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22033007T>C" "" "pathogenic" "ACMG" "0000837235" "0" "50" "X" "22053914" "22269427" "dup" "0" "00006" "PHEX_000724" "g.(22051242_22056586)_(22269427_?)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex2-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22033124_22038468)_(22251310_?)dup" "" "VUS" "ACMG" "0000837236" "0" "90" "X" "22056627" "22056627" "subst" "0" "00006" "PHEX_000729" "g.22056627C>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038509C>A" "" "pathogenic" "ACMG" "0000837237" "0" "90" "X" "22056634" "22056634" "subst" "0" "00006" "PHEX_000730" "g.22056634A>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038516A>T" "" "pathogenic" "ACMG" "0000837238" "0" "90" "X" "22056645" "22056645" "subst" "0" "00006" "PHEX_000731" "g.22056645C>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22038527C>A" "" "pathogenic" "ACMG" "0000837239" "0" "70" "X" "22060912" "22169085" "dup" "0" "00006" "PHEX_000736" "g.(22056656_22065167)_(22151742_22186428)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex3-12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22038538_22047049)_(22133625_22168311)dup" "" "likely pathogenic" "ACMG" "0000837240" "0" "90" "X" "22065167" "22065167" "subst" "0" "00006" "PHEX_000737" "g.22065167G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047049G>A" "" "pathogenic" "ACMG" "0000837241" "0" "90" "X" "22060912" "22142172" "dup" "0" "00006" "PHEX_000735" "g.(22056656_22065167)_(22132705_22151639)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex3-11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22038538_22047049)_(22114587_22133522)dup" "" "pathogenic" "ACMG" "0000837242" "0" "90" "X" "22065198" "22065201" "del" "0" "00006" "PHEX_000741" "g.22065198_22065201del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047080_22047083del" "" "pathogenic" "ACMG" "0000837243" "0" "90" "X" "22065207" "22065218" "dup" "0" "00006" "PHEX_000742" "g.22065207_22065218dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047089_22047100dup" "" "pathogenic" "ACMG" "0000837244" "0" "50" "X" "22065230" "22065230" "subst" "0" "00006" "PHEX_000745" "g.22065230G>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047112G>C" "" "VUS" "ACMG" "0000837245" "0" "90" "X" "22065268" "22065268" "del" "0" "00006" "PHEX_000748" "g.22065268del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047150del" "" "pathogenic" "ACMG" "0000837246" "0" "90" "X" "22065330" "22065330" "subst" "0" "00006" "PHEX_000754" "g.22065330G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047212G>T" "" "pathogenic" "ACMG" "0000837247" "0" "90" "X" "22065331" "22065331" "del" "0" "00006" "PHEX_000755" "g.22065331del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22047213del" "" "pathogenic" "ACMG" "0000837248" "0" "90" "X" "22079918" "22095093" "del" "0" "00006" "PHEX_000756" "g.(22065330_22094505)_(22094593_22095593)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex4" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22076475_22077475)del" "" "pathogenic" "ACMG" "0000837249" "0" "90" "X" "22079918" "22169085" "del" "0" "00006" "PHEX_000758" "g.(22065330_22094505)_(22151742_22186428)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex4-12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22133625_22168311)del" "" "pathogenic" "ACMG" "0000837250" "0" "90" "X" "22079918" "22269427" "del" "0" "00006" "PHEX_000517" "g.(22065330_22094505)_(22269427_?)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex4-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22251310_?)del" "" "pathogenic" "ACMG" "0000837251" "0" "90" "X" "22079918" "22110358" "del" "0" "00006" "PHEX_000757" "g.(22065330_22094505)_(22108616_22112100)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex4-6" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22047212_22076387)_(22090498_22093982)del" "" "pathogenic" "ACMG" "0000837252" "0" "90" "X" "22094517" "22094517" "subst" "0" "00006" "PHEX_000759" "g.22094517A>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076399A>T" "" "pathogenic" "ACMG" "0000837253" "0" "90" "X" "22094565" "22094565" "dup" "0" "00006" "PHEX_000761" "g.22094565dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076447dup" "" "pathogenic" "ACMG" "0000837254" "0" "90" "X" "22094574" "22094574" "subst" "0" "00006" "PHEX_000763" "g.22094574T>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076456T>C" "" "pathogenic" "" "0000837255" "0" "90" "X" "22094579" "22094579" "del" "0" "00006" "PHEX_000765" "g.22094579del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22076461del" "" "pathogenic" "ACMG" "0000837256" "0" "90" "X" "22095592" "22095592" "subst" "0" "00006" "PHEX_000771" "g.22095592A>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077474A>G" "" "pathogenic" "ACMG" "0000837257" "0" "90" "X" "22095093" "22169085" "del" "0" "00006" "PHEX_000770" "g.(22094593_22095593)_(22151742_22186428)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex5-12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22076475_22077475)_(22133625_22168311)del" "" "pathogenic" "ACMG" "0000837258" "0" "90" "X" "22095601" "22095601" "del" "0" "00006" "PHEX_000773" "g.22095601del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077483del" "" "pathogenic" "ACMG" "0000837259" "0" "90" "X" "22095612" "22095612" "dup" "0" "00006" "PHEX_000774" "g.22095612dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077494dup" "" "pathogenic" "ACMG" "0000837260" "0" "90" "X" "22095625" "22095625" "dup" "0" "00006" "PHEX_000776" "g.22095625dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077507dup" "" "pathogenic" "ACMG" "0000837261" "0" "90" "X" "22095709" "22095709" "del" "0" "00006" "PHEX_000785" "g.22095709del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077591del" "" "pathogenic" "ACMG" "0000837262" "0" "90" "X" "22095731" "22095731" "dup" "0" "00006" "PHEX_000788" "g.22095731dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077613dup" "" "pathogenic" "ACMG" "0000837263" "0" "90" "X" "22095750" "22095750" "dup" "0" "00006" "PHEX_000789" "g.22095750dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22077632dup" "" "pathogenic" "ACMG" "0000837264" "0" "90" "X" "22102184" "22116140" "del" "0" "00006" "PHEX_000795" "g.(22095821_22108546)_(22115157_22117123)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex6-8" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22077703_22090428)_(22097039_22099005)del" "" "pathogenic" "ACMG" "0000837265" "0" "90" "X" "22102184" "22123427" "del" "0" "00006" "PHEX_000533" "g.(22095821_22108546)_(22117270_22129584)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex6-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22077703_22090428)_(22099152_22111466)del" "" "pathogenic" "ACMG" "0000837266" "0" "90" "X" "22108600" "22108604" "del" "0" "00006" "PHEX_000799" "g.22108600_22108604del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090482_22090486del" "" "pathogenic" "ACMG" "0000837267" "0" "50" "X" "22108619" "22108620" "ins" "0" "00006" "PHEX_000801" "g.22108619_22108620insCA" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22090501_22090502insCA" "" "VUS" "ACMG" "0000837268" "0" "70" "X" "22110358" "22113645" "del" "0" "00006" "PHEX_000802" "g.(22108616_22112100)_(22112218_22115072)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex7" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22090498_22093982)_(22094100_22096954)del" "" "likely pathogenic" "ACMG" "0000837269" "0" "70" "X" "22112099" "22112099" "subst" "0" "00006" "PHEX_000804" "g.22112099A>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22093981A>C" "" "likely pathogenic" "ACMG" "0000837270" "0" "90" "X" "22110358" "22123427" "del" "0" "00006" "PHEX_000803" "g.(22108616_22112100)_(22117270_22129584)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex7-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22090498_22093982)_(22099152_22111466)del" "" "pathogenic" "ACMG" "0000837271" "0" "90" "X" "22112103" "22112103" "subst" "0" "00006" "PHEX_000405" "g.22112103T>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22093985T>G" "" "pathogenic" "" "0000837272" "0" "90" "X" "22112131" "22112152" "dup" "0" "00006" "PHEX_000806" "g.22112131_22112152dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094013_22094034dup" "" "pathogenic" "" "0000837273" "0" "90" "X" "22112147" "22112147" "subst" "0" "00006" "PHEX_000809" "g.22112147T>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094029T>G" "" "pathogenic" "ACMG" "0000837274" "0" "90" "X" "22112168" "22112168" "subst" "0" "00006" "PHEX_000810" "g.22112168C>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094050C>A" "" "pathogenic" "" "0000837275" "0" "50" "X" "22112187" "22112213" "del" "0" "00006" "PHEX_000812" "g.22112187_22112213del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094069_22094095del" "" "VUS" "ACMG" "0000837276" "0" "70" "X" "22112192" "22112192" "subst" "0" "00006" "PHEX_000813" "g.22112192T>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094074T>C" "" "likely pathogenic" "ACMG" "0000837277" "0" "90" "X" "22112208" "22112218" "del" "0" "00006" "PHEX_000814" "g.22112208_22112218del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094090_22094100del" "" "pathogenic" "ACMG" "0000837278" "0" "50" "X" "22112213" "22112213" "subst" "0" "00006" "PHEX_000815" "g.22112213C>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22094095C>A" "" "VUS" "ACMG" "0000837279" "0" "90" "X" "22115058" "22115076" "delins" "0" "00006" "PHEX_000818" "g.22115058_22115076delinsTCTCTTGG" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096940_22096958delinsTCTCTTGG" "" "pathogenic" "ACMG" "0000837280" "0" "90" "X" "22113645" "22123427" "del" "0" "00006" "PHEX_000691" "g.(22112218_22115072)_(22117270_22129584)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex8-9" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22094100_22096954)_(22099152_22111466)del" "" "pathogenic" "ACMG" "0000837281" "0" "70" "X" "22113645" "22116140" "del" "0" "00006" "PHEX_000817" "g.(22112218_22115072)_(22115157_22117123)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex8" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22094100_22096954)_(22097039_22099005)del" "" "likely pathogenic" "ACMG" "0000837282" "0" "90" "X" "22115076" "22115076" "dup" "0" "00006" "PHEX_000819" "g.22115076dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096958dup" "" "pathogenic" "ACMG" "0000837283" "0" "90" "X" "22115097" "22115097" "dup" "0" "00006" "PHEX_000820" "g.22115097dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096979dup" "" "pathogenic" "ACMG" "0000837284" "0" "90" "X" "22115111" "22115111" "delins" "0" "00006" "PHEX_000822" "g.22115111delinsAT" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096993delinsAT" "" "pathogenic" "ACMG" "0000837285" "0" "90" "X" "22115114" "22115114" "subst" "0" "00006" "PHEX_000823" "g.22115114C>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22096996C>G" "" "pathogenic" "ACMG" "0000837286" "0" "90" "X" "22115121" "22115121" "del" "0" "00006" "PHEX_000824" "g.22115121del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097003del" "" "pathogenic" "ACMG" "0000837287" "0" "90" "X" "22115127" "22115127" "subst" "0.0000111951" "00006" "PHEX_000825" "g.22115127A>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097009A>G" "" "pathogenic" "" "0000837288" "0" "90" "X" "22115158" "22115158" "subst" "0" "00006" "PHEX_000827" "g.22115158T>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22097040T>A" "" "pathogenic" "" "0000837289" "0" "90" "X" "22116140" "22269427" "del" "0" "00006" "PHEX_000828" "g.(22115157_22117123)_(22269427_?)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex9-22" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22097039_22099005)_(22251310_?)del" "" "pathogenic" "ACMG" "0000837290" "0" "90" "X" "22117184" "22117184" "del" "0" "00006" "PHEX_000837" "g.22117184del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099066del" "" "pathogenic" "ACMG" "0000837291" "0" "90" "X" "22117203" "22177151" "del" "0" "00006" "PHEX_000839" "g.22117203_22177151del" "" "{PMID:Sarafrazi 2022:34806794}" "" "c.1009_1405-9282del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099085_22159034del" "" "pathogenic" "ACMG" "0000837292" "0" "90" "X" "22117212" "22117212" "dup" "0" "00006" "PHEX_000841" "g.22117212dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099094dup" "" "pathogenic" "" "0000837293" "0" "50" "X" "22117217" "22117217" "subst" "0.0000447823" "00006" "PHEX_000842" "g.22117217G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099099G>A" "" "VUS" "ACMG" "0000837294" "0" "90" "X" "22117243" "22117267" "dup" "0" "00006" "PHEX_000844" "g.22117243_22117267dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22099125_22099149dup" "" "pathogenic" "ACMG" "0000837295" "0" "90" "X" "22123427" "22131127" "del" "0" "00006" "PHEX_000537" "g.(22117270_22129584)_(22129679_22132575)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex10" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22099152_22111466)_(22111561_22114457)del" "" "pathogenic" "ACMG" "0000837296" "0" "90" "X" "22129611" "22129613" "dup" "0" "00006" "PHEX_000847" "g.22129611_22129613dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111493_22111495dup" "" "pathogenic" "ACMG" "0000837297" "0" "90" "X" "22129642" "22129654" "del" "0" "00006" "PHEX_000849" "g.22129642_22129654del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111524_22111536del" "" "pathogenic" "ACMG" "0000837298" "0" "50" "X" "22129647" "22129647" "subst" "0.0000112" "00006" "PHEX_000850" "g.22129647G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22111529G>A" "" "VUS" "ACMG" "0000837299" "0" "90" "X" "22131127" "22142172" "del" "0" "00006" "PHEX_000693" "g.(22129679_22132575)_(22132705_22151639)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22111561_22114457)_(22114587_22133522)del" "" "pathogenic" "ACMG" "0000837300" "0" "90" "X" "22132612" "22132612" "del" "0" "00006" "PHEX_000859" "g.22132612del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114494del" "" "pathogenic" "ACMG" "0000837301" "0" "90" "X" "22132653" "22132653" "del" "0" "00006" "PHEX_000863" "g.22132653del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114535del" "" "pathogenic" "ACMG" "0000837302" "0" "50" "X" "22142172" "22242210" "del" "0" "00006" "PHEX_000867" "g.(22132705_22151639)_(22239861_22244559)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex12-18" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22221744_22226442)del" "" "VUS" "ACMG" "0000837303" "0" "50" "X" "22132708" "22132714" "del" "0" "00006" "PHEX_000865" "g.22132708_22132714del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22114590_22114596del" "" "VUS" "ACMG" "0000837304" "0" "50" "X" "22142172" "22254589" "dup" "0" "00006" "PHEX_000868" "g.(22132705_22151639)_(22245729_22263449)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex12-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22227612_22245332)dup" "" "VUS" "ACMG" "0000837305" "0" "50" "X" "22142172" "22191448" "dup" "0" "00006" "PHEX_000866" "g.(22132705_22151639)_(22186507_22196389)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex12-13" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22168390_22178272)dup" "" "VUS" "ACMG" "0000837306" "0" "50" "X" "22142172" "22169085" "dup" "0" "00006" "PHEX_000539" "g.(22132705_22151639)_(22151742_22186428)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22114587_22133522)_(22133625_22168311)dup" "" "VUS" "ACMG" "0000837307" "0" "50" "X" "22151641" "22151641" "subst" "0" "00006" "PHEX_000870" "g.22151641T>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133524T>G" "" "VUS" "ACMG" "0000837308" "0" "90" "X" "22151646" "22151646" "subst" "0" "00006" "PHEX_000872" "g.22151646G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133529G>T" "" "pathogenic" "ACMG" "0000837309" "0" "50" "X" "22151665" "22151665" "subst" "0.00000559845" "00006" "PHEX_000875" "g.22151665G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133548G>A" "" "VUS" "ACMG" "0000837310" "0" "70" "X" "22151671" "22151671" "subst" "0" "00006" "PHEX_000877" "g.22151671C>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133554C>A" "" "likely pathogenic" "ACMG" "0000837311" "0" "90" "X" "22151724" "22151724" "dup" "0" "00006" "PHEX_000881" "g.22151724dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133607dup" "" "pathogenic" "ACMG" "0000837312" "0" "90" "X" "22151735" "22151735" "dup" "0" "00006" "PHEX_000884" "g.22151735dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22133618dup" "" "pathogenic" "ACMG" "0000837313" "0" "70" "X" "22169085" "22219820" "dup" "0" "00006" "PHEX_000887" "g.(22151742_22186428)_(22208620_22231020)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex13-15" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22190503_22212903)dup" "" "likely pathogenic" "ACMG" "0000837314" "0" "70" "X" "22169085" "22254589" "dup" "0" "00006" "PHEX_000888" "g.(22151742_22186428)_(22245729_22263449)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex13-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22227612_22245332)dup" "" "likely pathogenic" "ACMG" "0000837315" "0" "70" "X" "22169085" "22191448" "del" "0" "00006" "PHEX_000695" "g.(22151742_22186428)_(22186507_22196389)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex13" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22133625_22168311)_(22168390_22178272)del" "" "likely pathogenic" "ACMG" "0000837316" "0" "50" "X" "22186436" "22186441" "del" "0" "00006" "PHEX_000890" "g.22186436_22186441del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168319_22168324del" "" "VUS" "ACMG" "0000837317" "0" "90" "X" "22186470" "22186476" "del" "0" "00006" "PHEX_000891" "g.22186470_22186476del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22168353_22168359del" "" "pathogenic" "ACMG" "0000837318" "0" "90" "X" "22191448" "22219820" "del" "0" "00006" "USP9X_000005" "g.(22186507_22196389)_(22208620_22231020)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex14-15" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22168390_22178272)_(22190503_22212903)del" "" "pathogenic" "ACMG" "0000837319" "0" "50" "X" "22196426" "22196426" "subst" "0" "00006" "PHEX_000896" "g.22196426C>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178309C>G" "" "VUS" "ACMG" "0000837320" "0" "90" "X" "22196438" "22196438" "subst" "0" "00006" "PHEX_000898" "g.22196438A>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178321A>T" "" "pathogenic" "ACMG" "0000837321" "0" "50" "X" "22196496" "22196496" "subst" "0" "00006" "PHEX_000904" "g.22196496G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22178379G>T" "" "VUS" "ACMG" "0000837322" "0" "90" "X" "22202527" "22219820" "del" "0" "00006" "PHEX_000906" "g.(22196494_22208560)_(22208620_22231020)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex15" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22178377_22190443)_(22190503_22212903)del" "" "pathogenic" "ACMG" "0000837323" "0" "90" "X" "22202527" "22254589" "del" "0" "00006" "PHEX_000907" "g.(22196494_22208560)_(22245729_22263449)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex15-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22178377_22190443)_(22227612_22245332)del" "" "pathogenic" "ACMG" "0000837324" "0" "70" "X" "22208614" "22208614" "subst" "0" "00006" "PHEX_000910" "g.22208614A>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190497A>C" "" "likely pathogenic" "ACMG" "0000837325" "0" "90" "X" "22208621" "22208621" "subst" "0" "00006" "PHEX_000912" "g.22208621T>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22190504T>G" "" "pathogenic" "ACMG" "0000837326" "0" "90" "X" "22219820" "22254589" "del" "0" "00006" "PHEX_000914" "g.(22208620_22231020)_(22245729_22263449)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex16-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22190503_22212903)_(22227612_22245332)del" "" "pathogenic" "ACMG" "0000837327" "0" "90" "X" "22231020" "22231020" "subst" "0" "00006" "PHEX_000915" "g.22231020G>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212903G>C" "" "pathogenic" "ACMG" "0000837328" "0" "90" "X" "22231056" "22231057" "ins" "0" "00006" "PHEX_000919" "g.22231056_22231057insN[?]" "" "{PMID:Sarafrazi 2022:34806794}" "" "c.1681_1682insAlu" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212939_22212940insN[?]" "" "pathogenic" "ACMG" "0000837329" "0" "50" "X" "22231080" "22231080" "subst" "0" "00006" "PHEX_000622" "g.22231080G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22212963G>A" "" "VUS" "ACMG" "0000837330" "0" "90" "X" "22237151" "22237151" "subst" "0" "00006" "PHEX_000924" "g.22237151A>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219034A>T" "" "pathogenic" "ACMG" "0000837331" "0" "90" "X" "22237159" "22237162" "dup" "0" "00006" "PHEX_000623" "g.22237159_22237162dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219042_22219045dup" "" "pathogenic" "ACMG" "0000837332" "0" "90" "X" "22237160" "22237160" "del" "0" "00006" "PHEX_000927" "g.22237160del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219043del" "" "pathogenic" "" "0000837333" "0" "50" "X" "22237166" "22237166" "subst" "0" "00006" "PHEX_000929" "g.22237166G>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219049G>C" "" "VUS" "ACMG" "0000837334" "0" "90" "X" "22237187" "22237187" "subst" "0" "00006" "PHEX_000932" "g.22237187G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22219070G>T" "" "pathogenic" "ACMG" "0000837335" "0" "70" "X" "22238475" "22254589" "dup" "0" "00006" "PHEX_000939" "g.(22237221_22239729)_(22245729_22263449)dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "dup ex18-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22219104_22221612)_(22227612_22245332)dup" "" "likely pathogenic" "ACMG" "0000837336" "0" "90" "X" "22239728" "22239728" "subst" "0" "00006" "PHEX_000940" "g.22239728A>G" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221611A>G" "" "pathogenic" "ACMG" "0000837337" "0" "90" "X" "22239773" "22239773" "del" "0" "00006" "PHEX_000949" "g.22239773del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221656del" "" "pathogenic" "ACMG" "0000837338" "0" "90" "X" "22239779" "22239782" "dup" "0" "00006" "PHEX_000950" "g.22239779_22239782dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221662_22221665dup" "" "pathogenic" "ACMG" "0000837339" "0" "90" "X" "22239808" "22239809" "del" "0" "00006" "PHEX_000953" "g.22239808_22239809del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221691_22221692del" "" "pathogenic" "ACMG" "0000837340" "0" "50" "X" "22239811" "22239811" "subst" "0" "00006" "PHEX_000955" "g.22239811G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221694G>T" "" "VUS" "ACMG" "0000837341" "0" "90" "X" "22239834" "22239837" "dup" "0" "00006" "PHEX_000956" "g.22239834_22239837dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221717_22221720dup" "" "pathogenic" "ACMG" "0000837342" "0" "90" "X" "22239836" "22239843" "dup" "0" "00006" "PHEX_000958" "g.22239836_22239843dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22221719_22221726dup" "" "pathogenic" "ACMG" "0000837343" "0" "90" "X" "22242210" "22254589" "del" "0" "00006" "PHEX_000960" "g.(22239861_22244559)_(22245729_22263449)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex19-20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22221744_22226442)_(22227612_22245332)del" "" "pathogenic" "ACMG" "0000837344" "0" "90" "X" "22242210" "22245125" "del" "0" "00006" "PHEX_000543" "g.(22239861_22244559)_(22244626_22245623)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex19" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22221744_22226442)_(22226509_22227506)del" "" "pathogenic" "ACMG" "0000837345" "0" "90" "X" "22244581" "22244581" "subst" "0" "00006" "PHEX_000961" "g.22244581G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226464G>T" "" "pathogenic" "ACMG" "0000837346" "0" "50" "X" "22244593" "22244593" "subst" "0" "00006" "PHEX_000963" "g.22244593G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226476G>A" "" "VUS" "ACMG" "0000837347" "0" "50" "X" "22244596" "22244596" "subst" "0" "00006" "PHEX_000965" "g.22244596G>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226479G>T" "" "VUS" "ACMG" "0000837348" "0" "50" "X" "22244602" "22244602" "subst" "0" "00006" "PHEX_000967" "g.22244602G>C" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226485G>C" "" "VUS" "ACMG" "0000837349" "0" "70" "X" "22244620" "22244620" "subst" "0" "00006" "PHEX_000968" "g.22244620T>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226503T>A" "" "likely pathogenic" "ACMG" "0000837350" "0" "90" "X" "22244621" "22244623" "delins" "0" "00006" "PHEX_000969" "g.22244621_22244623delinsN[?]" "" "{PMID:Sarafrazi 2022:34806794}" "" "c.1961_1963delTTAins" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22226504_22226506delinsN[?]" "" "pathogenic" "ACMG" "0000837351" "0" "70" "X" "22245125" "22254589" "del" "0" "00006" "PHEX_000970" "g.(22244626_22245623)_(22245729_22263449)del" "" "{PMID:Sarafrazi 2022:34806794}" "" "del ex20" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(22226509_22227506)_(22227612_22245332)del" "" "likely pathogenic" "ACMG" "0000837352" "0" "90" "X" "22245640" "22245644" "dup" "0" "00006" "PHEX_000972" "g.22245640_22245644dup" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227523_22227527dup" "" "pathogenic" "ACMG" "0000837353" "0" "50" "X" "22245662" "22245676" "del" "0" "00006" "PHEX_000977" "g.22245662_22245676del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227545_22227559del" "" "VUS" "ACMG" "0000837354" "0" "50" "X" "22245666" "22245666" "subst" "0" "00006" "PHEX_000060" "g.22245666G>A" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227549G>A" "" "VUS" "ACMG" "0000837355" "0" "50" "X" "22245667" "22245667" "subst" "0" "00006" "PHEX_000979" "g.22245667A>T" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227550A>T" "" "VUS" "ACMG" "0000837356" "0" "90" "X" "22245670" "22245670" "del" "0" "00006" "PHEX_000980" "g.22245670del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227553del" "" "pathogenic" "ACMG" "0000837357" "0" "90" "X" "22245680" "22245680" "del" "0" "00006" "PHEX_000982" "g.22245680del" "" "{PMID:Sarafrazi 2022:34806794}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.22227563del" "" "pathogenic" "ACMG" "0000837358" "