### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PHF21A) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PHF21A" "PHD finger protein 21A" "11" "p11.2" "unknown" "NC_000011.9" "UD_132319457748" "" "https://www.LOVD.nl/PHF21A" "" "1" "24156" "51317" "608325" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/PHF21A_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-08-13 08:40:22" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025313" "PHF21A" "transcript variant 1" "001" "NM_001101802.1" "" "NP_001095272.1" "" "" "" "-624" "6692" "2043" "46142985" "45950870" "00006" "2018-08-13 08:41:44" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00668" "KLEFS" "Kleefstra syndrome (KLEFS)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05281" "PSS" "Potocki-Shaffer syndrome (PSS, chromosome 11p11.2 deletion syndrome syndrome (P11pDS))" "" "601224" "" "" "" "00006" "2017-06-12 11:49:26" "00006" "2021-12-10 21:51:32" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06152" "IDDBCS" "Intellectual developmental disorder with behavioral abnormalities and craniofacial dysmorphism with or without seizures" "AD" "618725" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "PHF21A" "06152" ## Individuals ## Do not remove or alter this header ## ## Count = 15 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00174827" "" "" "" "1" "" "01290" "" "" "M" "" "" "" "0" "" "" "" "" "00174828" "" "" "" "1" "" "01290" "" "" "M" "?" "" "" "0" "" "" "" "" "00174829" "" "" "" "1" "" "01290" "" "" "M" "" "Norway" "" "0" "" "" "" "" "00174858" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "M" "" "United States" "" "0" "" "" "white" "22770980-PatDGAP012" "00174859" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "F" "" "United States" "" "0" "" "" "white" "22770980-PatMCN1762" "00174861" "" "" "" "1" "" "00006" "{PMID:Fantes 2008:18374296}" "" "F" "" "Pakistan" "" "0" "" "" "" "22770980-PatGILLE" "00174862" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "F" "" "Venezuela" "" "0" "" "" "" "22770980-PatGM03316" "00174863" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "M" "" "Bangladesh" "" "0" "" "" "" "22770980-PatGC14361" "00174864" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "?" "" "" "" "0" "" "" "" "22770980-PSS02" "00174865" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "" "" "" "" "0" "" "" "" "22770980-PSS08" "00174866" "" "" "" "1" "" "00006" "{PMID:Hyung-Goo 2012:22770980}" "" "M" "" "Belgium" "" "0" "" "" "" "22770980-PSS-Romeike" "00422284" "" "" "" "1" "" "01164" "" "" "M" "?" "Iraq" "" "0" "" "" "kurdish" "205618" "00435426" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "264896" "00453019" "" "" "" "1" "" "00006" "{PMID:Koemans 2017:29069077}, {PMID:Rots 2024:39013459}, {DOI:Rots 2024:10.1016/j.ajhg.2024.06.009}" "2-generation family, 1 affected, unaffected non carrier parents" "M" "" "" "" "0" "" "" "" "Pat1:Pat2" "00458572" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 15 "{{individualid}}" "{{diseaseid}}" "00174827" "05281" "00174828" "05281" "00174829" "05281" "00174858" "05281" "00174859" "05281" "00174861" "05281" "00174862" "05281" "00174863" "05281" "00174864" "05281" "00174865" "05281" "00174866" "05281" "00422284" "06152" "00435426" "06152" "00453019" "00668" "00458572" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00668, 05281, 05611, 06152 ## Count = 15 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000139680" "05281" "00174829" "01290" "Isolated (sporadic)" "09y" "Global developmental delay\r\nGeneralized hypotonia\r\nMacrocephaly\r\nAbnormal facial shape" "" "" "" "" "" "" "" "" "" "" "" "0000139681" "05281" "00174828" "01290" "Isolated (sporadic)" "05y" "Global developmental delay\r\nProminent metopic ridge" "" "" "" "" "" "" "" "" "" "" "" "0000139682" "05281" "00174827" "01290" "Isolated (sporadic)" "03y" "Global developmental delay\r\nGeneralized hypotonia\r\nSeizures\r\nBrachycephaly\r\nMacrocephaly\r\nProminent metopic ridge \r\nAbnormal facial shape" "" "" "" "" "" "" "" "" "" "" "" "0000139683" "05281" "00174858" "00006" "Isolated (sporadic)" "05y" "intellectual disability, facial dysmorphism, narrow nose, downturned mouth, large ears, brachycephaly, microcephaly, myopia, strabismus, heart defect, hypotonia, small hands and feet, digitalized thumbs, retinal dystrophy; no multiple exostoses, no parietal foramina, no tapering fingers" "" "" "" "" "" "" "" "" "" "" "" "0000139684" "05281" "00174859" "00006" "Isolated (sporadic)" "42y" "intellectual disability, facial dysmorphism, narrow nose, downturned mouth, brachycephaly, microcephaly, myopia, hypotonia; no large ears, no strabismus,no heart defect, no small hands and feet, no multiple exostoses, no parietal foramina, no tapering fingers, no digitalized thumbs, no retinal dystrophy" "" "" "" "" "" "" "" "" "" "" "" "0000139686" "05281" "00174861" "00006" "Isolated (sporadic)" "00y08m" "intellectual disability, facial dysmorphism, narrow nose, mild craniofacial asymmetry and thin corpus callosum, hypoplasia of inferior cerebellar vermis, nystagmus, hypotonia, iris hypoplasia, superior atypical coloboma, foveal hypoplasia; no large ears, no multiple exostoses, no parietal foramina" "" "" "" "" "" "" "" "" "" "" "Gillespie syndrome" "0000139687" "05281" "00174862" "00006" "Isolated (sporadic)" "03y06m" "3y-intellectual disability, strikingly unusual dysmorphology syndrome including epicanthus, hypertelorism, oblique palpebral fissures, trigonocephaly, micrognathia; 5y-vocabulary progressing well, good memory, quantitative intelligence 3yr-old girl, inability to concentrate, feed herself when wished; 3y6m-gained control sphincters both day/night; shy, easily frightened, was clumsy with both hands and legs" "" "" "" "" "" "" "" "" "" "" "" "0000139688" "05281" "00174863" "00006" "Isolated (sporadic)" "02y03m" "6m-static encephalopathy, developmental delay; microcephaly, short stature, small phallus, unilateral absent testis, dysmorphic features including short forehead, prominent biparietal foramina, midline parietal cortical defect, flat midface, flat occiput, sensorineural hearing loss, epicanthal folds, protuberant ears, bulbous nasal tip continued below columella, depressed nasal root, small mouth and small chin (micrognathia), hypotonia, slight pectus excavatum, recurrent otitis media, slender fingers" "" "" "" "" "" "" "" "" "" "" "" "0000139689" "05281" "00174864" "00006" "Unknown" "" "PSS, intellectual disability,craniofacial anomalies" "" "" "" "" "" "" "" "" "" "" "pss" "0000139690" "05281" "00174865" "00006" "Isolated (sporadic)" "" "PSS, intellectual disability, craniofacial anomalies" "" "" "" "" "" "" "" "" "" "" "pss" "0000139691" "05281" "00174866" "00006" "Unknown" "31y" "PSS, intellectual disability, craniofacial anomalies; 31y-microcephaly, brachycephaly, broad forehead, long narrow nose, hypoplastic mandible, very thin lips, hypotelorism, dysplastic low set\r\nears, no speech" "" "" "" "" "" "" "" "" "" "" "PSS" "0000313488" "06152" "00422284" "01164" "Isolated (sporadic)" "02y" "Abnormal vitamin B12 level, Hypotonia, Global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "0000325618" "06152" "00435426" "01164" "Isolated (sporadic)" "02y" "Global developmental delay, Plagiocephaly, Hemangioma, Patent foramen ovale, Hypotonia, Ankyloglossia, Pneumothorax, Periventricular white matter hyperintensities, Very preterm birth, Excessive salivation" "" "" "" "" "" "" "" "" "" "" "" "0000341663" "00668" "00453019" "00006" "Isolated (sporadic)" "29y" "moderate intellectual disability; language and motor delay; behavior problems, autistic traits; no childhood hypotonia; epilepsy; thoracal kyphosis; phenylketonuria; recurrent respiratory infections" "" "" "" "" "" "" "" "" "" "KLEFS2" "Kleefstra syndrome phenotypic spectrum" "0000347003" "05611" "00458572" "03544" "Isolated (sporadic)" "" "HP:0001256, HP: 0011327, HP: 0000750, HP: 0002361, HP: 0001999" "" "" "" "" "" "" "" "" "" "IDDBCS" "complex neurodevelopmental disorder" ## Screenings ## Do not remove or alter this header ## ## Count = 15 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000175718" "00174827" "1" "01290" "01290" "2018-08-11 10:23:43" "01290" "2018-08-11 14:22:40" "SEQ-NG-I" "DNA" "Blood" "WES" "0000175719" "00174828" "1" "01290" "01290" "2018-08-11 14:04:47" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000175720" "00174829" "1" "01290" "01290" "2018-08-11 14:13:16" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000175749" "00174858" "1" "00006" "00006" "2018-08-13 15:47:21" "" "" "FISH;PCR;SEQ" "DNA" "" "" "0000175750" "00174859" "1" "00006" "00006" "2018-08-13 16:22:40" "" "" "FISH;PCR;SEQ" "DNA" "" "" "0000175752" "00174861" "1" "00006" "00006" "2018-08-13 21:19:53" "" "" "FISH" "DNA" "" "" "0000175753" "00174862" "1" "00006" "00006" "2018-08-13 21:43:07" "" "" "arrayCGH;FISH" "DNA" "" "" "0000175754" "00174863" "1" "00006" "00006" "2018-08-13 21:51:35" "" "" "arrayCGH;FISH" "DNA" "" "" "0000175755" "00174864" "1" "00006" "00006" "2018-08-13 21:57:05" "" "" "arrayCGH" "DNA" "" "" "0000175756" "00174865" "1" "00006" "00006" "2018-08-13 22:00:27" "" "" "arrayCGH" "DNA" "" "" "0000175757" "00174866" "1" "00006" "00006" "2018-08-13 22:03:21" "" "" "arrayCGH" "DNA" "" "" "0000423595" "00422284" "1" "01164" "01164" "2022-11-09 14:51:21" "" "" "SEQ-NG-I" "DNA" "" "" "0000436905" "00435426" "1" "01164" "01164" "2023-07-25 12:29:48" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000454630" "00453019" "1" "00006" "00006" "2024-08-14 11:08:45" "" "" "SEQ-NG;SEQ" "DNA" "" "WES" "0000460193" "00458572" "1" "03544" "03544" "2024-12-19 07:31:30" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 12 "{{screeningid}}" "{{geneid}}" "0000175749" "ELAVL1" "0000175749" "PHF21A" "0000175750" "PHF21A" "0000175752" "ARHGAP6" "0000175752" "PHF21A" "0000175753" "PHF21A" "0000175754" "PHF21A" "0000175755" "PHF21A" "0000175756" "PHF21A" "0000175757" "PHF21A" "0000423595" "PHF21A" "0000436905" "PHF21A" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 79 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000255925" "0" "50" "11" "45948366" "45948366" "del" "0" "01943" "GYLTL1B_000004" "g.45948366del" "" "" "" "LARGE2(NM_152312.4):c.1269delA (p.E423Dfs*35)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45926815del" "" "VUS" "" "0000300735" "0" "70" "11" "45957234" "45957234" "subst" "0" "02326" "PHF21A_000002" "g.45957234G>A" "" "" "" "PHF21A(NM_001101802.2):c.1738C>T (p.R580*), PHF21A(NM_001101802.3):c.1738C>T (p.R580*), PHF21A(NM_001352025.1):c.1741C>T (p.R581*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45935683G>A" "" "likely pathogenic" "" "0000322209" "0" "50" "11" "45947685" "45947685" "subst" "0.00233361" "01804" "GYLTL1B_000002" "g.45947685A>G" "" "" "" "GYLTL1B(NM_152312.3):c.865A>G (p.(Thr289Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45926134A>G" "" "VUS" "" "0000322211" "0" "50" "11" "45947773" "45947773" "subst" "0" "01804" "GYLTL1B_000003" "g.45947773G>C" "" "" "" "GYLTL1B(NM_152312.3):c.883G>C (p.(Asp295His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45926222G>C" "" "VUS" "" "0000322212" "0" "50" "11" "45948379" "45948379" "subst" "4.89237E-5" "01804" "GYLTL1B_000005" "g.45948379C>T" "" "" "" "GYLTL1B(NM_152312.3):c.1282C>T (p.(Arg428Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45926828C>T" "" "VUS" "" "0000322214" "0" "30" "11" "45949745" "45949745" "subst" "0.000924079" "01804" "GYLTL1B_000007" "g.45949745G>A" "" "" "" "GYLTL1B(NM_152312.3):c.1772G>A (p.(Arg591Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45928194G>A" "" "likely benign" "" "0000398571" "0" "70" "11" "45970958" "45970958" "dup" "0" "01290" "PHF21A_000006" "g.45970958dup" "" "" "" "1223dupC" "" "De novo" "yes" "" "0" "" "" "g.45949407dup" "" "likely pathogenic (dominant)" "" "0000398572" "0" "70" "11" "45957234" "45957234" "subst" "0" "01290" "PHF21A_000002" "g.45957234G>A" "" "" "" "" "de novo in patient" "De novo" "yes" "" "0" "" "" "g.45935683G>A" "" "likely pathogenic (dominant)" "" "0000398573" "0" "70" "11" "45991407" "45991408" "ins" "0" "01290" "PHF21A_000007" "g.45991407_45991408insTT" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.45969856_45969857insTT" "" "likely pathogenic (dominant)" "" "0000398609" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000008" "g.pter_45965069delins[NC_000019.9:pter_8030126]" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "" "De novo" "" "" "0" "" "t(11;19)(p11.2;p13.2)dn" "" "" "pathogenic (dominant)" "" "0000398611" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000009" "g.[NC_000019.9:pter_8030132]delinspter_45965064" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "" "DUPLICATE record" "" "" "0" "" "t(11;19)(p11.2;p13.2)dn" "" "" "pathogenic" "" "0000398613" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000010" "g.pter_46063697delins[CTCCAAAT;NC_000001.10:106964377_qter]" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "" "De novo" "" "" "0" "" "t(1;11)(p21.1;p11.2)dn" "" "" "pathogenic (dominant)" "" "0000398615" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000011" "g.[NC_000001.10:pter_106964376]delins46063698_qter" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "" "DUPLICATE record" "" "" "0" "" "t(1;11)(p21.1;p11.2)dn" "" "" "pathogenic" "" "0000398621" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000012" "g.pter_(45955518_46105771)delins[NC_000023.10:pter_(11156982_11682949)]" "" "{PMID:Fantes 2008:18374296}" "" "" "" "De novo" "" "" "0" "" "t(X;11)(p22.3;p12)" "" "" "pathogenic" "" "0000398623" "0" "90" "11" "43125403" "46706549" "del" "0" "00006" "PHF21A_000013" "g.(43000000_43125403)_(46706549_47000000)del" "" "{PMID:Hyung-Goo 2012:22770980}" "" "t(X;11)(q11.1;p11.2)dn del(11)(p11.2p12)" "balanced translocation, 3.6Mb deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000398624" "0" "90" "11" "33430130" "47276580" "del" "0" "00006" "PHF21A_000013" "g.(33000000_33430130)_(47276580_48000000)del" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "13.8 Mb deletion" "Germline" "" "" "0" "" "del(11)(p11.12p12)" "" "" "pathogenic" "" "0000398625" "0" "90" "11" "0" "0" "" "0" "00006" "PHF21A_000013" "g.(40000000_40434231)_(46041804_46500000(del" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "5.6 Mb deletion" "Unknown" "" "" "0" "" "del(11)(p11.2p12)" "" "" "pathogenic" "" "0000398626" "0" "90" "11" "31009420" "46204605" "del" "0" "00006" "PHF21A_000013" "g.(31000000_31009420)_(46204605_46500000)del" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "15.2 Mb deletion" "Unknown" "" "" "0" "" "del(11)(p11.2p13)" "" "" "pathogenic" "" "0000398627" "0" "90" "11" "38824655" "50638770" "del" "0" "00006" "PHF21A_000013" "g.(38500000_38824655)_(50638770_51000000)del" "" "{PMID:Hyung-Goo 2012:22770980}" "" "" "11.9 MB deletion" "Unknown" "" "" "0" "" "del(11)(p11.2p12)" "" "" "pathogenic" "" "0000543958" "0" "50" "11" "45946079" "45946079" "subst" "0.000126195" "01804" "GYLTL1B_000012" "g.45946079A>G" "" "" "" "GYLTL1B(NM_152312.3):c.515A>G (p.(Asn172Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45924528A>G" "" "VUS" "" "0000543959" "0" "30" "11" "45946151" "45946151" "subst" "3.25137E-5" "01804" "GYLTL1B_000013" "g.45946151G>A" "" "" "" "GYLTL1B(NM_152312.3):c.587G>A (p.(Arg196His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45924600G>A" "" "likely benign" "" "0000543960" "0" "30" "11" "45946349" "45946349" "subst" "0" "01943" "GYLTL1B_000014" "g.45946349C>T" "" "" "" "LARGE2(NM_152312.4):c.678C>T (p.I226=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45924798C>T" "" "likely benign" "" "0000543962" "0" "30" "11" "45948053" "45948053" "subst" "2.84428E-5" "01804" "GYLTL1B_000016" "g.45948053C>T" "" "" "" "GYLTL1B(NM_152312.3):c.1069C>T (p.(Arg357Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45926502C>T" "" "likely benign" "" "0000543964" "0" "50" "11" "45948379" "45948379" "dup" "0" "01804" "GYLTL1B_000018" "g.45948379dup" "" "" "" "GYLTL1B(NM_152312.3):c.1275_1276insC (p.(Arg428ProfsTer68))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45926828dup" "" "VUS" "" "0000543966" "0" "50" "11" "45950254" "45950254" "subst" "4.06124E-5" "01804" "GYLTL1B_000020" "g.45950254G>A" "" "" "" "GYLTL1B(NM_152312.3):c.2024G>A (p.(Arg675His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45928703G>A" "" "VUS" "" "0000543967" "0" "30" "11" "45950260" "45950260" "subst" "0.00101534" "01804" "GYLTL1B_000021" "g.45950260G>A" "" "" "" "GYLTL1B(NM_152312.3):c.2030G>A (p.(Arg677His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45928709G>A" "" "likely benign" "" "0000543969" "0" "50" "11" "45955606" "45955606" "del" "0" "01804" "GYLTL1B_000023" "g.45955606del" "" "" "" "PHF21A(NM_016621.3):c.1818del (p.(Ala607ProfsTer103)), PHF21A(NM_016621.4):c.1818delT (p.A607Pfs*103)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45934055del" "" "VUS" "" "0000543970" "0" "30" "11" "45955711" "45955711" "subst" "4.06164E-6" "01943" "PHF21A_000014" "g.45955711C>T" "" "" "" "PHF21A(NM_001101802.1):c.1851G>A (p.K617=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45934160C>T" "" "likely benign" "" "0000543971" "0" "50" "11" "45955752" "45955752" "subst" "0.00144493" "01943" "PHF21A_000001" "g.45955752T>C" "" "" "" "PHF21A(NM_001101802.1):c.1810A>G (p.I604V), PHF21A(NM_001101802.3):c.1810A>G (p.I604V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45934201T>C" "" "VUS" "" "0000543973" "0" "30" "11" "45957313" "45957315" "del" "0" "01804" "PHF21A_000003" "g.45957313_45957315del" "" "" "" "PHF21A(NM_001101802.1):c.1682-6_1682-4del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45935762_45935764del" "" "likely benign" "" "0000543974" "0" "30" "11" "45957314" "45957315" "del" "0" "01804" "PHF21A_000004" "g.45957314_45957315del" "" "" "" "PHF21A(NM_001101802.1):c.1682-6_1682-5del (p.?), PHF21A(NM_016621.4):c.1544-4_1544-3delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45935763_45935764del" "" "likely benign" "" "0000543976" "0" "30" "11" "45967432" "45967432" "subst" "8.19766E-6" "01804" "PHF21A_000016" "g.45967432G>A" "" "" "" "PHF21A(NM_001101802.1):c.1408C>T (p.(Pro470Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45945881G>A" "" "likely benign" "" "0000543978" "0" "50" "11" "45971756" "45971756" "subst" "0" "01804" "PHF21A_000018" "g.45971756C>T" "" "" "" "PHF21A(NM_016621.3):c.1147+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45950205C>T" "" "VUS" "" "0000543980" "0" "30" "11" "45986892" "45986892" "subst" "0" "01804" "PHF21A_000020" "g.45986892G>A" "" "" "" "PHF21A(NM_001352027.3):c.970C>T (p.(Leu324Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45965341G>A" "" "likely benign" "" "0000543981" "0" "70" "11" "45986894" "45986894" "dup" "0" "01804" "PHF21A_000021" "g.45986894dup" "" "" "" "PHF21A(NM_016621.3):c.968dup (p.(Leu324AlafsTer2))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45965343dup" "" "likely pathogenic" "" "0000543982" "0" "70" "11" "45986898" "45986898" "del" "0" "01804" "PHF21A_000022" "g.45986898del" "" "" "" "PHF21A(NM_016621.3):c.964del (p.(Val322TyrfsTer52))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45965347del" "" "likely pathogenic" "" "0000543983" "0" "70" "11" "45986901" "45986904" "del" "0" "01804" "PHF21A_000023" "g.45986901_45986904del" "" "" "" "PHF21A(NM_016621.3):c.959_962del (p.(Gln320LeufsTer53))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45965350_45965353del" "" "likely pathogenic" "" "0000613343" "0" "50" "11" "45975128" "45975128" "subst" "4.06124E-6" "01943" "PHF21A_000025" "g.45975128T>C" "" "" "" "PHF21A(NM_001101802.1):c.1042A>G (p.T348A, p.(Thr348Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45953577T>C" "" "VUS" "" "0000613344" "0" "50" "11" "45975128" "45975128" "subst" "4.06124E-6" "01804" "PHF21A_000025" "g.45975128T>C" "" "" "" "PHF21A(NM_001101802.1):c.1042A>G (p.T348A, p.(Thr348Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45953577T>C" "" "VUS" "" "0000656794" "0" "10" "11" "45957312" "45957315" "del" "0" "02325" "PHF21A_000026" "g.45957312_45957315del" "" "" "" "PHF21A(NM_001352025.3):c.1685-6_1685-3delTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45935761_45935764del" "" "benign" "" "0000679190" "0" "70" "11" "45957234" "45957234" "subst" "0" "01943" "PHF21A_000002" "g.45957234G>A" "" "" "" "PHF21A(NM_001101802.2):c.1738C>T (p.R580*), PHF21A(NM_001101802.3):c.1738C>T (p.R580*), PHF21A(NM_001352025.1):c.1741C>T (p.R581*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000691068" "0" "50" "11" "45946339" "45946339" "subst" "0" "01943" "GYLTL1B_000025" "g.45946339C>T" "" "" "" "LARGE2(NM_001300721.2):c.668C>T (p.T223M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691069" "0" "50" "11" "45948050" "45948052" "del" "0" "01943" "GYLTL1B_000026" "g.45948050_45948052del" "" "" "" "LARGE2(NM_001300721.2):c.1066_1068delTTC (p.F356del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723452" "0" "10" "11" "45957311" "45957315" "del" "0" "02325" "PHF21A_000027" "g.45957311_45957315del" "" "" "" "PHF21A(NM_016621.5):c.1544-7_1544-3delTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000723453" "0" "50" "11" "45986864" "45986864" "subst" "0" "02329" "PHF21A_000019" "g.45986864A>G" "" "" "" "PHF21A(NM_001101802.2):c.993+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000862534" "0" "50" "11" "45957292" "45957293" "del" "0" "01943" "PHF21A_000028" "g.45957292_45957293del" "" "" "" "PHF21A(NM_001352025.1):c.1685-3_1685-2delTA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000862535" "0" "30" "11" "45958060" "45958060" "subst" "0" "02327" "PHF21A_000029" "g.45958060T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889831" "0" "90" "11" "45955606" "45955606" "del" "0" "02326" "GYLTL1B_000023" "g.45955606del" "" "" "" "PHF21A(NM_016621.3):c.1818del (p.(Ala607ProfsTer103)), PHF21A(NM_016621.4):c.1818delT (p.A607Pfs*103)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000889832" "0" "30" "11" "45955752" "45955752" "subst" "0.00144493" "02325" "PHF21A_000001" "g.45955752T>C" "" "" "" "PHF21A(NM_001101802.1):c.1810A>G (p.I604V), PHF21A(NM_001101802.3):c.1810A>G (p.I604V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889833" "0" "70" "11" "45971755" "45971755" "subst" "0" "02327" "PHF21A_000030" "g.45971755A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000899341" "0" "90" "11" "46001402" "46001402" "dup" "0" "01164" "PHF21A_000031" "g.46001402dup" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP; confirmed de novo in trio-exome" "De novo" "-" "" "0" "" "" "g.45979851dup" "" "pathogenic (dominant)" "ACMG" "0000913581" "0" "90" "11" "45958032" "45958052" "del" "0" "02329" "PHF21A_000032" "g.45958032_45958052del" "" "" "" "PHF21A(NM_001352025.3):c.1679_1684+15delAAGCAGGTAAGGAGTTATCCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929866" "0" "90" "11" "45957234" "45957234" "subst" "0" "02325" "PHF21A_000002" "g.45957234G>A" "" "" "" "PHF21A(NM_001101802.2):c.1738C>T (p.R580*), PHF21A(NM_001101802.3):c.1738C>T (p.R580*), PHF21A(NM_001352025.1):c.1741C>T (p.R581*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931585" "0" "70" "11" "45992685" "45992685" "del" "0" "01164" "PHF21A_000033" "g.45992685del" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP; confirmed de novo in trio-exome" "De novo" "-" "" "0" "" "" "g.45971134del" "" "pathogenic (dominant)" "ACMG" "0000949665" "0" "90" "11" "45959765" "45959765" "dup" "0" "02329" "PHF21A_000034" "g.45959765dup" "" "" "" "PHF21A(NM_001101802.3):c.1553dupC (p.L519Sfs*53), PHF21A(NM_016621.4):c.1415dupC (p.L473Sfs*53)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000966367" "0" "90" "11" "45955606" "45955606" "del" "0" "02327" "GYLTL1B_000023" "g.45955606del" "" "" "" "PHF21A(NM_016621.3):c.1818del (p.(Ala607ProfsTer103)), PHF21A(NM_016621.4):c.1818delT (p.A607Pfs*103)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000979581" "0" "70" "11" "45955613" "45955613" "del" "0" "01804" "GYLTL1B_000027" "g.45955613del" "" "" "" "PHF21A(NM_001352027.3):c.1958del (p.(Pro653Leufs*104))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000979582" "0" "50" "11" "45956717" "45956717" "subst" "0" "01804" "PHF21A_000035" "g.45956717G>A" "" "" "" "PHF21A(NM_001352027.3):c.1788+470C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979583" "0" "30" "11" "45958038" "45958038" "subst" "2.44774E-5" "01804" "PHF21A_000036" "g.45958038T>G" "" "" "" "PHF21A(NM_001352027.3):c.1684+7A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979584" "0" "50" "11" "45967551" "45967551" "subst" "1.21873E-5" "01804" "PHF21A_000037" "g.45967551C>T" "" "" "" "PHF21A(NM_001352027.3):c.1292G>A (p.(Arg431His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000989520" "0" "90" "11" "45955606" "45955606" "del" "0" "00006" "GYLTL1B_000023" "g.45955606del" "" "{PMID:Koemans 2017:29069077}" "" "" "" "De novo" "" "" "0" "" "" "g.45934055del" "" "VUS" "" "0000999038" "0" "90" "11" "45959765" "45959765" "dup" "0" "02326" "PHF21A_000034" "g.45959765dup" "" "" "" "PHF21A(NM_001101802.3):c.1553dupC (p.L519Sfs*53), PHF21A(NM_016621.4):c.1415dupC (p.L473Sfs*53)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000999039" "0" "50" "11" "45967403" "45967403" "subst" "0" "01804" "PHF21A_000038" "g.45967403G>T" "" "" "" "PHF21A(NM_001101802.1):c.1437C>A (p.(Ser479Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999040" "0" "30" "11" "45967545" "45967545" "subst" "0" "01804" "PHF21A_000039" "g.45967545G>A" "" "" "" "PHF21A(NM_001101802.1):c.1295C>T (p.(Pro432Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999041" "0" "50" "11" "45975125" "45975125" "subst" "0" "01804" "PHF21A_000040" "g.45975125T>C" "" "" "" "PHF21A(NM_001101802.1):c.1045A>G (p.(Thr349Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999042" "0" "50" "11" "45992855" "45992855" "subst" "0" "01804" "PHF21A_000041" "g.45992855T>C" "" "" "" "PHF21A(NM_001101802.1):c.424A>G (p.(Thr142Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999043" "0" "50" "11" "46001465" "46001465" "subst" "2.05143E-5" "01804" "PHF21A_000042" "g.46001465G>A" "" "" "" "PHF21A(NM_001101802.1):c.206C>T (p.(Pro69Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999044" "0" "30" "11" "46001522" "46001522" "subst" "0" "01804" "PHF21A_000043" "g.46001522C>A" "" "" "" "PHF21A(NM_001101802.1):c.154-5G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001019188" "0" "70" "11" "45975135" "45975138" "del" "0" "03544" "PHF21A_000044" "g.45975135_45975138del" "" "" "" "" "" "De novo" "-" "rs2092369866" "0" "" "" "g.45953584_45953587del" "{CV:986205}" "pathogenic" "ACMG" "0001025975" "0" "30" "11" "45957314" "45957315" "del" "0" "02326" "PHF21A_000004" "g.45957314_45957315del" "" "" "" "PHF21A(NM_001101802.1):c.1682-6_1682-5del (p.?), PHF21A(NM_016621.4):c.1544-4_1544-3delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025976" "0" "30" "11" "45957315" "45957315" "del" "0" "02326" "PHF21A_000005" "g.45957315del" "" "" "" "PHF21A(NM_016621.4):c.1544-3delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038459" "0" "30" "11" "45955596" "45955596" "subst" "0.000110439" "02326" "GYLTL1B_000028" "g.45955596C>T" "" "" "" "PHF21A(NM_016621.4):c.1828G>A (p.A610T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038460" "0" "30" "11" "45955613" "45955613" "subst" "0.000163092" "01804" "GYLTL1B_000029" "g.45955613G>A" "" "" "" "PHF21A(NM_001352027.3):c.1952C>T (p.(Thr651Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038461" "0" "30" "11" "45955677" "45955677" "subst" "2.84317E-5" "01804" "PHF21A_000045" "g.45955677C>T" "" "" "" "PHF21A(NM_001352027.3):c.1888G>A (p.(Asp630Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038462" "0" "90" "11" "45971009" "45971009" "subst" "0" "02327" "PHF21A_000046" "g.45971009G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053854" "0" "30" "11" "45971813" "45971813" "subst" "0" "01804" "PHF21A_000047" "g.45971813G>A" "" "" "" "PHF21A(NM_001352027.3):c.1096-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053855" "0" "50" "11" "45992919" "45992919" "del" "4.087E-6" "01804" "PHF21A_000048" "g.45992919del" "" "" "" "PHF21A(NM_001352027.3):c.361-1del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053856" "0" "50" "11" "46001357" "46001357" "subst" "4.10843E-6" "01804" "PHF21A_000049" "g.46001357T>C" "" "" "" "PHF21A(NM_001352027.3):c.314A>G (p.(His105Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001065454" "0" "50" "11" "45971762" "45971762" "subst" "0" "02325" "PHF21A_000050" "g.45971762A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PHF21A ## Count = 79 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000255925" "00025313" "50" "9197" "0" "9197" "0" "c.*7154del" "r.(?)" "p.(=)" "" "0000300735" "00025313" "70" "1738" "0" "1738" "0" "c.1738C>T" "r.(?)" "p.(Arg580Ter)" "" "0000322209" "00025313" "50" "9877" "0" "9877" "0" "c.*7834T>C" "r.(=)" "p.(=)" "" "0000322211" "00025313" "50" "9789" "0" "9789" "0" "c.*7746C>G" "r.(=)" "p.(=)" "" "0000322212" "00025313" "50" "9183" "0" "9183" "0" "c.*7140G>A" "r.(=)" "p.(=)" "" "0000322214" "00025313" "30" "7817" "0" "7817" "0" "c.*5774C>T" "r.(=)" "p.(=)" "" "0000398571" "00025313" "70" "1220" "0" "1220" "0" "c.1220dup" "r.(?)" "p.(Glu408Argfs*3)" "" "0000398572" "00025313" "70" "1738" "0" "1738" "0" "c.1738C>T" "r.(?)" "p.(Arg580*)" "" "0000398573" "00025313" "70" "657" "0" "658" "0" "c.657_658insAA" "r.(?)" "p.(Pro220Asnfs*48)" "" "0000398609" "00025313" "90" "0" "" "0" "" "c.[NM_001419.2:657-1435]::1449+2321" "r.?" "p.?" "14i" "0000398611" "00025313" "90" "0" "" "0" "" "c.1449+2321::[NM_001419.2:657-1442]" "r.?" "p.?" "14i" "0000398613" "00025313" "90" "0" "" "0" "" "c.153+34607::?" "r.?" "p.?" "5i" "0000398615" "00025313" "90" "0" "" "0" "" "c.?::insATTTGGAG;153+34610" "r.?" "p.?" "5i" "0000398621" "00025313" "90" "0" "" "0" "" "c.(-1_*1)::[NM_013427.2:(-1_*1)]" "r.?" "p.?" "" "0000398623" "00025313" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" "_1_18_" "0000398624" "00025313" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" "_1_18_" "0000398625" "00025313" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" "_1_18_" "0000398626" "00025313" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" "_1_18_" "0000398627" "00025313" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" "_1_18_" "0000543958" "00025313" "50" "11483" "0" "11483" "0" "c.*9440T>C" "r.(=)" "p.(=)" "" "0000543959" "00025313" "30" "11411" "0" "11411" "0" "c.*9368C>T" "r.(=)" "p.(=)" "" "0000543960" "00025313" "30" "11213" "0" "11213" "0" "c.*9170G>A" "r.(=)" "p.(=)" "" "0000543962" "00025313" "30" "9509" "0" "9509" "0" "c.*7466G>A" "r.(=)" "p.(=)" "" "0000543964" "00025313" "50" "9189" "0" "9189" "0" "c.*7146dup" "r.(?)" "p.(=)" "" "0000543966" "00025313" "50" "7308" "0" "7308" "0" "c.*5265C>T" "r.(=)" "p.(=)" "" "0000543967" "00025313" "30" "7302" "0" "7302" "0" "c.*5259C>T" "r.(=)" "p.(=)" "" "0000543969" "00025313" "50" "1956" "0" "1956" "0" "c.1956del" "r.(?)" "p.(Ala653ProfsTer103)" "" "0000543970" "00025313" "30" "1851" "0" "1851" "0" "c.1851G>A" "r.(?)" "p.(Lys617=)" "" "0000543971" "00025313" "50" "1810" "0" "1810" "0" "c.1810A>G" "r.(?)" "p.(Ile604Val)" "" "0000543973" "00025313" "30" "1682" "-5" "1682" "-3" "c.1682-5_1682-3del" "r.spl?" "p.?" "" "0000543974" "00025313" "30" "1682" "-4" "1682" "-3" "c.1682-4_1682-3del" "r.spl?" "p.?" "" "0000543976" "00025313" "30" "1408" "0" "1408" "0" "c.1408C>T" "r.(?)" "p.(Pro470Ser)" "" "0000543978" "00025313" "50" "1144" "1" "1144" "1" "c.1144+1G>A" "r.spl?" "p.?" "" "0000543980" "00025313" "30" "967" "0" "967" "0" "c.967C>T" "r.(?)" "p.(Leu323Phe)" "" "0000543981" "00025313" "70" "965" "0" "965" "0" "c.965dup" "r.(?)" "p.(Leu323AlafsTer2)" "" "0000543982" "00025313" "70" "961" "0" "961" "0" "c.961del" "r.(?)" "p.(Val321TyrfsTer52)" "" "0000543983" "00025313" "70" "956" "0" "959" "0" "c.956_959del" "r.(?)" "p.(Gln319LeufsTer53)" "" "0000613343" "00025313" "50" "1042" "0" "1042" "0" "c.1042A>G" "r.(?)" "p.(Thr348Ala)" "" "0000613344" "00025313" "50" "1042" "0" "1042" "0" "c.1042A>G" "r.(?)" "p.(Thr348Ala)" "" "0000656794" "00025313" "10" "1682" "-6" "1682" "-3" "c.1682-6_1682-3del" "r.spl?" "p.?" "" "0000679190" "00025313" "70" "1738" "0" "1738" "0" "c.1738C>T" "r.(?)" "p.(Arg580Ter)" "" "0000691068" "00025313" "50" "11223" "0" "11223" "0" "c.*9180G>A" "r.(=)" "p.(=)" "" "0000691069" "00025313" "50" "9513" "0" "9515" "0" "c.*7470_*7472del" "r.(=)" "p.(=)" "" "0000723452" "00025313" "10" "1682" "-7" "1682" "-3" "c.1682-7_1682-3del" "r.spl?" "p.?" "" "0000723453" "00025313" "50" "993" "2" "993" "2" "c.993+2T>C" "r.spl?" "p.?" "" "0000862534" "00025313" "50" "1682" "-3" "1682" "-2" "c.1682-3_1682-2del" "r.spl?" "p.?" "" "0000862535" "00025313" "30" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000889831" "00025313" "90" "1956" "0" "1956" "0" "c.1956del" "r.(?)" "p.(Ala653ProfsTer103)" "" "0000889832" "00025313" "30" "1810" "0" "1810" "0" "c.1810A>G" "r.(?)" "p.(Ile604Val)" "" "0000889833" "00025313" "70" "1144" "2" "1144" "2" "c.1144+2T>G" "r.spl?" "p.?" "" "0000899341" "00025313" "90" "270" "0" "270" "0" "c.270dup" "r.(?)" "p.(Pro91Thrfs*82)" "" "0000913581" "00025313" "90" "1676" "0" "1681" "15" "c.1676_1681+15del" "r.spl?" "p.?" "" "0000929866" "00025313" "90" "1738" "0" "1738" "0" "c.1738C>T" "r.(?)" "p.(Arg580Ter)" "" "0000931585" "00025313" "70" "599" "0" "599" "0" "c.599del" "r.(?)" "p.(Asn200Thrfs*67)" "" "0000949665" "00025313" "90" "1553" "0" "1553" "0" "c.1553dup" "r.(?)" "p.(Leu519Serfs*53)" "" "0000966367" "00025313" "90" "1956" "0" "1956" "0" "c.1956del" "r.(?)" "p.(Ala653ProfsTer103)" "" "0000979581" "00025313" "70" "1955" "0" "1955" "0" "c.1955del" "r.(?)" "p.(Pro652Leufs*104)" "" "0000979582" "00025313" "50" "1785" "470" "1785" "470" "c.1785+470C>T" "r.(=)" "p.(=)" "" "0000979583" "00025313" "30" "1681" "7" "1681" "7" "c.1681+7A>C" "r.(=)" "p.(=)" "" "0000979584" "00025313" "50" "1289" "0" "1289" "0" "c.1289G>A" "r.(?)" "p.(Arg430His)" "" "0000989520" "00025313" "90" "1956" "0" "1956" "0" "c.1956del" "r.(?)" "p.(Ala653Profs*103)" "" "0000999038" "00025313" "90" "1553" "0" "1553" "0" "c.1553dup" "r.(?)" "p.(Leu519Serfs*53)" "" "0000999039" "00025313" "50" "1437" "0" "1437" "0" "c.1437C>A" "r.(?)" "p.(=)" "" "0000999040" "00025313" "30" "1295" "0" "1295" "0" "c.1295C>T" "r.(?)" "p.(Pro432Leu)" "" "0000999041" "00025313" "50" "1045" "0" "1045" "0" "c.1045A>G" "r.(?)" "p.(Ile349Val)" "" "0000999042" "00025313" "50" "424" "0" "424" "0" "c.424A>G" "r.(?)" "p.(Thr142Ala)" "" "0000999043" "00025313" "50" "206" "0" "206" "0" "c.206C>T" "r.(?)" "p.(Pro69Leu)" "" "0000999044" "00025313" "30" "154" "-5" "154" "-5" "c.154-5G>T" "r.spl?" "p.?" "" "0001019188" "00025313" "70" "1034" "0" "1037" "0" "c.1034_1037del" "r.(?)" "p.(Glu345Alafs*27)" "11" "0001025975" "00025313" "30" "1682" "-4" "1682" "-3" "c.1682-4_1682-3del" "r.spl?" "p.?" "" "0001025976" "00025313" "30" "1682" "-3" "1682" "-3" "c.1682-3del" "r.spl?" "p.?" "" "0001038459" "00025313" "30" "1966" "0" "1966" "0" "c.1966G>A" "r.(?)" "p.(Ala656Thr)" "" "0001038460" "00025313" "30" "1949" "0" "1949" "0" "c.1949C>T" "r.(?)" "p.(Thr650Ile)" "" "0001038461" "00025313" "30" "1885" "0" "1885" "0" "c.1885G>A" "r.(?)" "p.(Asp629Asn)" "" "0001038462" "00025313" "90" "1168" "0" "1168" "0" "c.1168C>T" "r.(?)" "p.(Arg390*)" "" "0001053854" "00025313" "30" "1093" "-5" "1093" "-5" "c.1093-5C>T" "r.spl?" "p.?" "" "0001053855" "00025313" "50" "361" "-1" "361" "-1" "c.361-1del" "r.spl?" "p.?" "" "0001053856" "00025313" "50" "314" "0" "314" "0" "c.314A>G" "r.(?)" "p.(His105Arg)" "" "0001065454" "00025313" "50" "1139" "0" "1139" "0" "c.1139T>C" "r.(?)" "p.(Leu380Pro)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{variantid}}" "0000175718" "0000398571" "0000175719" "0000398572" "0000175720" "0000398573" "0000175749" "0000398609" "0000175749" "0000398611" "0000175750" "0000398613" "0000175750" "0000398615" "0000175752" "0000398621" "0000175753" "0000398623" "0000175754" "0000398624" "0000175755" "0000398625" "0000175756" "0000398626" "0000175757" "0000398627" "0000423595" "0000899341" "0000436905" "0000931585" "0000454630" "0000989520" "0000460193" "0001019188"