### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PIEZO1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PIEZO1" "piezo-type mechanosensitive ion channel component 1" "16" "q24.3" "unknown" "NC_000016.9" "UD_134753676289" "" "http://www.LOVD.nl/PIEZO1" "" "1" "28993" "9780" "611184" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/PIEZO1_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2015-09-11 18:37:26" "00000" "2025-10-20 15:39:03" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001687" "PIEZO1" "piezo-type mechanosensitive ion channel component 1" "001" "NM_001142864.2" "" "NP_001136336.2" "" "" "" "1" "7833" "7566" "88781746" "88851372" "00000" "2012-09-13 13:46:06" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00308" "HAG" "anemia, hemolytic, due to G6PD deficiency (HAG, incl favism)" "XLD" "300908" "" "" "X-linked dominant" "00006" "2014-01-24 11:32:05" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01615" "DHS1" "stomatocytosis, dehydrated, hereditary, with/without pseudohyperkalemia and/or perinatal edema (DHS, xerocytosis)" "AD" "194380" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04321" "-" "dysplasia, lymphatic, generalised" "" "" "" "" "" "00006" "2015-08-31 13:04:23" "" "" "05292" "IMD" "immunodeficiency (IMD)" "" "" "" "" "" "00006" "2017-06-24 18:16:32" "00006" "2017-10-24 17:01:05" "06293" "LMPHM6" "Lymphatic malformation 6" "AR" "616843" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "PIEZO1" "01615" "PIEZO1" "04321" "PIEZO1" "06293" ## Individuals ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00043814" "" "" "" "1" "" "00034" "" "" "M" "yes" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043815" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "F" "yes" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043816" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043817" "" "" "" "1" "" "00034" "" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043818" "" "" "" "1" "" "00034" "" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043819" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043820" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043821" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "M" "yes" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00043823" "" "" "" "1" "" "00034" "{DOI:Fotiou et al 2015:10.1038/NCOMMS9085}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "" "" "00269121" "" "" "" "1" "" "01164" "" "" "?" "" "" "" "0" "" "" "" "" "00291576" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291577" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00299641" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "2-generation family, 1 affeted" "M" "" "" "" "0" "" "" "" "FamGC3626Pat2" "00303369" "" "" "" "1" "" "03694" "" "child of heterozygous mother with a history of neonatal hemolytic anemia" "M" "" "United States" "00y03m" "0" "no" "phototherapy" "Mexico;Ecuador" "" "00394126" "" "" "" "1" "" "00006" "{PMID:Milev 2018:30120216}" "2-generation family, 1 affected, unaffected heterozygous carrier parents, second-degree cousins" "F" "yes" "Italy" "" "0" "" "" "" "Pat1" "00394128" "" "" "" "3" "" "00006" "{PMID:Al-Deri 2021:32843486}" "2-generation family, 3 affected sibs, unaffected heterozygous carrier parents/relatives" "F" "no" "United States" "" "0" "" "" "Jewish-Ashkenazi" "FamPatII2" "00394129" "" "" "00394128" "1" "" "00006" "{PMID:Al-Deri 2021:32843486}" "sister" "F" "no" "United States" "" "0" "" "" "Jewish-Ashkenazi" "FamPatII3" "00394130" "" "" "00394128" "1" "" "00006" "{PMID:Al-Deri 2021:32843486}" "brother" "M" "no" "United States" "" "0" "" "" "Jewish-Ashkenazi" "FamPatII4" "00433140" "" "" "" "1" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "" "M" "" "Norway" "" "0" "" "" "" "Pat121,1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 20 "{{individualid}}" "{{diseaseid}}" "00000209" "01157" "00043814" "04321" "00043815" "04321" "00043816" "04321" "00043817" "04321" "00043818" "04321" "00043819" "04321" "00043820" "04321" "00043821" "04321" "00043823" "04321" "00269121" "00198" "00291576" "00198" "00291577" "00198" "00299641" "04214" "00303369" "00308" "00394126" "00198" "00394128" "00198" "00394129" "00198" "00394130" "00198" "00433140" "05292" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00308, 01157, 01615, 04214, 04321, 05292, 06293 ## Count = 18 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000034732" "04321" "00043814" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034733" "04321" "00043815" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034734" "04321" "00043816" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034735" "04321" "00043817" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034736" "04321" "00043818" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034737" "04321" "00043819" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034738" "04321" "00043820" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034739" "04321" "00043821" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000034740" "04321" "00043823" "00034" "Unknown" "" "See paper: Fotiou 2015" "" "" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000206966" "00198" "00269121" "01164" "Unknown" "" "Macroglossia (HP:0000158); Hydrops fetalis (HP:0001789); Abnormality of the abdomen (HP:0001438)" "" "" "" "" "" "" "" "" "" "" "" "0000226951" "04214" "00299641" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., 29y-photopsia (HP:0030786), slightly reduced acuity (HP:0007663), mild nyctalopia (HP:0000662); irregular pigmented lesions in periphery(HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), peripheral telangiectasia (HP:0007763) with some retinal edema (HP:0020120) and vitreous cells (HP:0004327), possible para-arteriolar sparing; 29y-ERG no identifiable responses other than a minimal, delayed response to 30Hz flicker (PERG, EOG and ERG tested), severe photoreceptor dysfunction; 29y-colour vision Ishihara 15/15 each eye; 29y-Goldmann visual fields ring scotoma at 30 degrees, binocular Esterman age 36: central 20 degrees only retained; presenting VA logMAR (Snellen) R 0.48 (20/60), L 0.3 (20/40); latest VA logMAR R 1.8 (20/1250), L 1.5 (20/630); latest refractive error, dioptres R -1.00/-1.00x5, L +0.75/-1.00x90" "29y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000230445" "00308" "00303369" "03694" "Familial, X-linked recessive" "00y00m03d" "Decreased glucose-6-phosphate dehydrogenase level in red blood cells; Neonatal hemolytic anemia; Hb10.5g/dL; HCT 29.7%; RET 2.54% (89.9x10^3/uL); G6PD activity 2.9U/gHb (ref 9.9-16.6 U/gHb)" "00y00m03d" "00y00m05d" "00y00m01d" "" "" "" "" "" "anemia, hemolytic due to G6PD deficiency" "anemia, hemolytic" "" "0000287332" "00198" "00394126" "00006" "Isolated (sporadic)" "03y" "uneventful pregnancy; perinatal distress; illness provoked regression; 16m/39m-illness provoked regression events, multiple minor events; delayed development prior to first event, regression after first event; CK during illnesses up to 16000 (U/L), intermittent fluctuating: normal range/up to 1000; MRI 10m-delayed myelination, 16m-acute encephalopathy with posterior oedema, 18m-atrophy, 30m-increased atrophy; severe global developmental delay; 11m-sit alone, subsequently lost ability, never achieved independent walking; no speech; acquired microcephaly; tetraplegia; dystonia; epilepsy, polytherapy with anti-epileptic drugs (AEDs); cerebral visual impairment; 39m-protein-losing enteropathy9m-developmental delay;" "00y09m" "" "developmental delay" "" "" "" "" "" "PEERB" "developmental delay" "" "0000287334" "00198" "00394128" "00006" "Familial, autosomal recessive" "38y" "unremarkable prenatal/perinatal development; 12m-developmental delay; no illness provoked regression; 12m-sit independently, never crawled, 2y-walk; severe expressive language delay; no tetraplegia; no dystonia, no seizures" "00y12m" "" "developmental delay" "" "" "" "" "" "PEERB" "developmental delay" "" "0000287335" "00198" "00394129" "00006" "Familial, autosomal recessive" "36y" "unremarkable prenatal/perinatal development; 4m-developmental delay; no illness provoked regression; very mild motor delay, 15m-walk; severe expressive language delay; no tetraplegia; no dystonia, no seizures" "00y04m" "" "developmental delay" "" "" "" "" "" "PEERB" "developmental delay" "" "0000287336" "00198" "00394130" "00006" "Familial, autosomal recessive" "33y" "unremarkable prenatal/perinatal development; MRI brain 2y-normal; 6m-developmental delay; no illness provoked regression; 12m-sit, 18m-crawl, 2-3y-walk; severe expressive language delay; no tetraplegia; no dystonia, no seizures" "00y06m" "" "developmental delay" "" "" "" "" "" "PEERB" "developmental delay" "" "0000323666" "05292" "00433140" "00006" "Isolated (sporadic)" "15y" "immuno-osseous dysplasia, chromosomal disorder and other syndromic primary immunodeficiency diseases" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" ## Screenings ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000044059" "00043814" "1" "00034" "00034" "2015-06-23 12:41:20" "00008" "2015-09-03 19:24:33" "SEQ-NG" "DNA" "Blood" "" "0000044060" "00043815" "1" "00034" "00034" "2015-06-23 12:45:47" "" "" "SEQ" "DNA" "Blood" "" "0000044061" "00043816" "1" "00034" "00034" "2015-06-23 12:47:57" "" "" "SEQ" "DNA" "" "" "0000044062" "00043817" "1" "00034" "00034" "2015-06-23 12:51:21" "00008" "2015-09-03 19:53:48" "SEQ-NG" "DNA" "Blood" "" "0000044063" "00043818" "1" "00034" "00034" "2015-06-23 12:54:26" "00008" "2015-09-03 19:54:57" "SEQ-NG" "DNA" "Blood" "" "0000044064" "00043819" "1" "00034" "00034" "2015-06-23 12:58:12" "" "" "SEQ" "DNA" "Blood" "" "0000044065" "00043820" "1" "00034" "00034" "2015-06-23 13:01:36" "" "" "SEQ" "DNA" "blood" "" "0000044066" "00043821" "1" "00034" "00034" "2015-06-23 13:04:20" "" "" "SEQ" "DNA" "Blood" "" "0000044067" "00043823" "1" "00034" "00034" "2015-06-23 13:06:05" "" "" "SEQ" "DNA" "Blood" "" "0000270252" "00269121" "1" "01164" "01164" "2019-11-06 14:42:21" "" "" "SEQ-NG-S" "DNA" "" "" "0000292744" "00291576" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292745" "00291577" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000300751" "00299641" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:58" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS" "0000304495" "00303369" "1" "03694" "03694" "2020-06-10 20:32:37" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "gene panel (SPTA1, SPTB, ANK1, SLC4A1, EPB41, PIEZO1, CYB5R3, G6PD, GPI, GSR, HK1, NT5C3, PGK1, PKLR, PKM, TPI1, GSS, ADA, AK1, PFKM, PFKL, UGT1A1, UGT1A6, UGT1A7, SLCO1B1, SLCO1B3, GCLC, ALDOA)" "0000395374" "00394126" "1" "00006" "00006" "2021-11-30 16:23:30" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000395376" "00394128" "1" "00006" "00006" "2021-11-30 16:42:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000395377" "00394129" "1" "00006" "00006" "2021-11-30 16:42:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000395378" "00394130" "1" "00006" "00006" "2021-11-30 16:42:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000434571" "00433140" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 13 "{{screeningid}}" "{{geneid}}" "0000044059" "PIEZO1" "0000044060" "PIEZO1" "0000044061" "PIEZO1" "0000044062" "PIEZO1" "0000044063" "PIEZO1" "0000044064" "PIEZO1" "0000044065" "PIEZO1" "0000044066" "PIEZO1" "0000044067" "PIEZO1" "0000300751" "ARHGEF18" "0000304495" "G6PD" "0000304495" "PIEZO1" "0000304495" "SPTB" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 547 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000013615" "3" "30" "16" "88842953" "88842953" "subst" "0" "00037" "PIEZO1_000001" "g.88842953G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.88776545G>A" "" "likely benign" "" "0000071864" "3" "70" "16" "88788693" "88788693" "subst" "0" "00034" "PIEZO1_000008" "g.88788693C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88722285C>A" "" "likely pathogenic" "" "0000071865" "3" "70" "16" "88788693" "88788693" "subst" "0" "00034" "PIEZO1_000008" "g.88788693C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88722285C>A" "" "likely pathogenic" "" "0000071867" "21" "70" "16" "88800380" "88800380" "subst" "0" "00034" "PIEZO1_000011" "g.88800380C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88733972C>A" "" "likely pathogenic" "" "0000071868" "11" "70" "16" "88783285" "88783285" "subst" "0" "00034" "PIEZO1_000006" "g.88783285G>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88716877G>A" "" "likely pathogenic" "" "0000071870" "21" "70" "16" "88800380" "88800380" "subst" "0" "00034" "PIEZO1_000011" "g.88800380C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88733972C>A" "" "likely pathogenic" "" "0000071871" "11" "70" "16" "88783285" "88783285" "subst" "0" "00034" "PIEZO1_000006" "g.88783285G>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88716877G>A" "" "likely pathogenic" "" "0000071872" "11" "70" "16" "88792954" "88792954" "subst" "1.34791E-5" "00034" "PIEZO1_000009" "g.88792954C>T" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88726546C>T" "" "likely pathogenic" "" "0000071873" "21" "70" "16" "88783580" "88783580" "subst" "1.98195E-5" "00034" "PIEZO1_000007" "g.88783580C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88717172C>A" "" "likely pathogenic" "" "0000071874" "11" "70" "16" "88801542" "88801542" "subst" "0" "00034" "PIEZO1_000002" "g.88801542C>T" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "0" "" "" "g.88735134C>T" "" "likely pathogenic" "" "0000071875" "21" "70" "16" "88782368" "88782368" "subst" "6.72613E-6" "00034" "PIEZO1_000005" "g.88782368G>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88715960G>A" "" "likely pathogenic" "" "0000071876" "11" "70" "16" "88801542" "88801542" "subst" "0" "00034" "PIEZO1_000002" "g.88801542C>T" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88735134C>T" "" "likely pathogenic" "" "0000071877" "21" "70" "16" "88782368" "88782368" "subst" "6.72613E-6" "00034" "PIEZO1_000005" "g.88782368G>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88715960G>A" "" "likely pathogenic" "" "0000071878" "3" "70" "16" "88788693" "88788693" "subst" "0" "00034" "PIEZO1_000008" "g.88788693C>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88722285C>A" "" "likely pathogenic" "" "0000071879" "11" "70" "16" "88782213" "88782213" "subst" "0" "00034" "PIEZO1_000004" "g.88782213G>A" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "" "" "" "" "g.88715805G>A" "" "likely pathogenic" "" "0000071880" "21" "50" "16" "88782205" "88782205" "subst" "0.00107996" "00034" "PIEZO1_000003" "g.88782205G>C" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "rs202127176" "" "" "" "g.88715797G>C" "" "VUS" "" "0000071881" "21" "50" "16" "88798919" "88798919" "subst" "0.00107697" "00034" "PIEZO1_000010" "g.88798919G>T" "" "{DOI:Fotiou e2015:10.1038/NCOMMS9085}, {PMID:Fotiou 2015:26333996}" "" "" "" "Germline" "yes" "rs201226914" "" "" "" "g.88732511G>T" "" "VUS" "" "0000274612" "0" "10" "16" "88780649" "88780658" "del" "0" "01943" "CTU2_000007" "g.88780649_88780658del" "" "" "" "CTU2(NM_001012759.1):c.1097+1_1097+10del (p.?), CTU2(NM_001012759.3):c.1097+14_1097+23delTGGGTGTGTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88714241_88714250del" "" "benign" "" "0000274613" "0" "30" "16" "88781504" "88781504" "subst" "0.000174495" "01943" "CTU2_000008" "g.88781504C>T" "" "" "" "CTU2(NM_001012759.3):c.1468C>T (p.R490C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88715096C>T" "" "likely benign" "" "0000274614" "0" "30" "16" "88772985" "88772985" "subst" "0" "01943" "CTU2_000001" "g.88772985C>A" "" "" "" "CTU2(NM_001012759.3):c.47C>A (p.P16Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88706577C>A" "" "likely benign" "" "0000274615" "0" "30" "16" "88779307" "88779307" "subst" "0" "01943" "CTU2_000003" "g.88779307C>A" "" "" "" "CTU2(NM_001012759.3):c.731C>A (p.T244N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88712899C>A" "" "likely benign" "" "0000305575" "0" "30" "16" "88803092" "88803092" "subst" "0.000908509" "01943" "PIEZO1_000032" "g.88803092G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1251C>T (p.H417=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88736684G>A" "" "likely benign" "" "0000305576" "0" "50" "16" "88808818" "88808818" "subst" "0" "01943" "PIEZO1_000039" "g.88808818C>T" "" "" "" "PIEZO1(NM_001142864.4):c.173G>A (p.R58H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88742410C>T" "" "VUS" "" "0000305577" "0" "30" "16" "88800777" "88800777" "subst" "0.000166151" "01943" "PIEZO1_000031" "g.88800777G>A" "" "" "" "PIEZO1(NM_001142864.2):c.2167C>T (p.(Arg723Cys)), PIEZO1(NM_001142864.4):c.2167C>T (p.R723C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88734369G>A" "" "likely benign" "" "0000305578" "0" "10" "16" "88800395" "88800397" "del" "0" "01943" "PIEZO1_000030" "g.88800395_88800397del" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270del (p.(Glu756del)), PIEZO1(NM_001142864.4):c.2268_2270delGGA (p.E756del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88733987_88733989del" "" "benign" "" "0000305579" "0" "30" "16" "88798890" "88798890" "subst" "2.04374E-5" "01943" "PIEZO1_000029" "g.88798890G>C" "" "" "" "PIEZO1(NM_001142864.4):c.2844C>G (p.R948=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88732482G>C" "" "likely benign" "" "0000305580" "0" "50" "16" "88793260" "88793260" "subst" "1.33829E-5" "01943" "PIEZO1_000028" "g.88793260C>A" "" "" "" "PIEZO1(NM_001142864.4):c.3562G>T (p.G1188C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88726852C>A" "" "VUS" "" "0000305581" "0" "30" "16" "88791897" "88791897" "subst" "0" "01943" "PIEZO1_000026" "g.88791897C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4089G>A (p.K1363=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88725489C>T" "" "likely benign" "" "0000305582" "0" "30" "16" "88789701" "88789701" "subst" "0.000341699" "01943" "PIEZO1_000025" "g.88789701C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4371G>A (p.A1457=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88723293C>T" "" "likely benign" "" "0000305583" "0" "30" "16" "88789499" "88789499" "subst" "0.00387772" "01943" "PIEZO1_000024" "g.88789499G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4495+4C>T (p.?), PIEZO1(NM_001142864.4):c.4495+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88723091G>A" "" "likely benign" "" "0000305584" "0" "50" "16" "88789357" "88789357" "subst" "0.000386676" "01943" "PIEZO1_000023" "g.88789357T>G" "" "" "" "PIEZO1(NM_001142864.2):c.4556A>C (p.(Gln1519Pro)), PIEZO1(NM_001142864.4):c.4556A>C (p.Q1519P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88722949T>G" "" "VUS" "" "0000305585" "0" "30" "16" "88788618" "88788618" "subst" "0.000226635" "01943" "PIEZO1_000022" "g.88788618G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4955+8C>T (p.(=)), PIEZO1(NM_001142864.4):c.4955+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88722210G>A" "" "likely benign" "" "0000305586" "0" "50" "16" "88788376" "88788376" "subst" "2.03782E-5" "01943" "PIEZO1_000020" "g.88788376G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5054C>T (p.A1685V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88721968G>A" "" "VUS" "" "0000305587" "0" "30" "16" "88788291" "88788291" "subst" "0.00210347" "01943" "PIEZO1_000019" "g.88788291G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5139C>T (p.L1713=, p.(Leu1713=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88721883G>A" "" "likely benign" "" "0000305588" "0" "30" "16" "88805044" "88805044" "subst" "0" "01943" "PIEZO1_000037" "g.88805044C>T" "" "" "" "PIEZO1(NM_001142864.4):c.566G>A (p.R189Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88738636C>T" "" "likely benign" "" "0000305589" "0" "30" "16" "88787097" "88787097" "subst" "0.00198567" "01943" "PIEZO1_000017" "g.88787097C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5728G>A (p.(Glu1910Lys)), PIEZO1(NM_001142864.4):c.5728G>A (p.E1910K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88720689C>T" "" "likely benign" "" "0000305590" "0" "10" "16" "88804983" "88804983" "subst" "0.00365046" "01943" "PIEZO1_000036" "g.88804983T>C" "" "" "" "PIEZO1(NM_001142864.4):c.627A>G (p.A209=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88738575T>C" "" "benign" "" "0000305591" "0" "10" "16" "88783289" "88783289" "subst" "0.025075" "01943" "PIEZO1_000014" "g.88783289G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6678C>T (p.(Ser2226=)), PIEZO1(NM_001142864.4):c.6678C>T (p.S2226=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88716881G>A" "" "benign" "" "0000305592" "0" "50" "16" "88782029" "88782029" "subst" "0.000364284" "01943" "PIEZO1_000012" "g.88782029G>C" "" "" "" "PIEZO1(NM_001142864.2):c.7550C>G (p.(Thr2517Ser)), PIEZO1(NM_001142864.4):c.7550C>G (p.T2517S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88715621G>C" "" "VUS" "" "0000305593" "0" "50" "16" "88804671" "88804671" "subst" "5.11113E-5" "01943" "PIEZO1_000035" "g.88804671G>A" "" "" "" "PIEZO1(NM_001142864.4):c.812C>T (p.A271V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88738263G>A" "" "VUS" "" "0000305594" "0" "30" "16" "88804364" "88804364" "subst" "0.00561442" "01943" "PIEZO1_000034" "g.88804364C>T" "" "" "" "PIEZO1(NM_001142864.2):c.998G>A (p.(Arg333His)), PIEZO1(NM_001142864.4):c.998G>A (p.R333H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88737956C>T" "" "likely benign" "" "0000324975" "0" "50" "16" "88776390" "88776390" "subst" "0.000796017" "01804" "CTU2_000002" "g.88776390T>C" "" "" "" "CTU2(NM_001012759.1):c.188T>C (p.(Leu63Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88709982T>C" "" "VUS" "" "0000324977" "0" "50" "16" "88779817" "88779817" "subst" "1.70174E-5" "01804" "CTU2_000005" "g.88779817C>G" "" "" "" "CTU2(NM_001012759.1):c.835C>G (p.(Leu279Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88713409C>G" "" "VUS" "" "0000324978" "0" "50" "16" "88780104" "88780104" "subst" "8.15089E-6" "01804" "CTU2_000006" "g.88780104G>A" "" "" "" "CTU2(NM_001012759.1):c.923G>A (p.(Arg308Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88713696G>A" "" "VUS" "" "0000324979" "0" "30" "16" "88780649" "88780658" "del" "0" "01804" "CTU2_000007" "g.88780649_88780658del" "" "" "" "CTU2(NM_001012759.1):c.1097+1_1097+10del (p.?), CTU2(NM_001012759.3):c.1097+14_1097+23delTGGGTGTGTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88714241_88714250del" "" "likely benign" "" "0000324980" "0" "30" "16" "88782636" "88782636" "subst" "4.65012E-5" "01804" "PIEZO1_000013" "g.88782636C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7099G>A (p.(Glu2367Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88716228C>T" "" "likely benign" "" "0000324981" "0" "50" "16" "88786649" "88786649" "subst" "6.63649E-6" "01804" "PIEZO1_000015" "g.88786649C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5992G>A (p.(Asp1998Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88720241C>T" "" "VUS" "" "0000324983" "0" "30" "16" "88788235" "88788235" "subst" "0.011208" "01804" "PIEZO1_000018" "g.88788235G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5195C>T (p.(Thr1732Met)), PIEZO1(NM_001142864.4):c.5195C>T (p.T1732M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88721827G>A" "" "likely benign" "" "0000324984" "0" "50" "16" "88788473" "88788473" "subst" "0.000141042" "01804" "PIEZO1_000021" "g.88788473G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4957C>T (p.(Arg1653Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88722065G>A" "" "VUS" "" "0000324985" "0" "30" "16" "88789499" "88789499" "subst" "0.00387772" "01804" "PIEZO1_000024" "g.88789499G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4495+4C>T (p.?), PIEZO1(NM_001142864.4):c.4495+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88723091G>A" "" "likely benign" "" "0000324986" "0" "30" "16" "88793155" "88793155" "subst" "0.00283678" "01804" "PIEZO1_000027" "g.88793155C>T" "" "" "" "PIEZO1(NM_001142864.2):c.3667G>A (p.(Val1223Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88726747C>T" "" "likely benign" "" "0000324987" "0" "30" "16" "88804221" "88804221" "subst" "0" "01804" "PIEZO1_000033" "g.88804221C>A" "" "" "" "PIEZO1(NM_001142864.2):c.1022G>T (p.(Arg341Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.88737813C>A" "" "likely benign" "" "0000559565" "0" "30" "16" "88778082" "88778082" "subst" "0" "01804" "PIEZO1_000040" "g.88778082G>A" "" "" "" "CTU2(NM_001012759.1):c.322G>A (p.(Ala108Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88711674G>A" "" "likely benign" "" "0000559566" "0" "30" "16" "88779320" "88779320" "subst" "0" "01804" "PIEZO1_000041" "g.88779320C>A" "" "" "" "CTU2(NM_001012759.1):c.737+7C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88712912C>A" "" "likely benign" "" "0000559567" "0" "30" "16" "88779323" "88779365" "del" "0.0661559" "01804" "PIEZO1_000042" "g.88779323_88779365del" "" "" "" "CTU2(NM_001012759.1):c.737+7_737+49del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88712915_88712957del" "" "likely benign" "" "0000559573" "0" "30" "16" "88781082" "88781082" "subst" "0.00275178" "01804" "PIEZO1_000048" "g.88781082C>T" "" "" "" "CTU2(NM_001012759.1):c.1289C>T (p.(Pro430Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88714674C>T" "" "likely benign" "" "0000559575" "0" "30" "16" "88781132" "88781132" "subst" "0.000269088" "01804" "PIEZO1_000050" "g.88781132G>A" "" "" "" "CTU2(NM_001012759.1):c.1339G>A (p.(Gly447Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88714724G>A" "" "likely benign" "" "0000559576" "0" "50" "16" "88781342" "88781342" "subst" "2.05261E-5" "01804" "PIEZO1_000051" "g.88781342C>A" "" "" "" "CTU2(NM_001012759.1):c.1419+8C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88714934C>A" "" "VUS" "" "0000559577" "0" "30" "16" "88781468" "88781468" "subst" "0" "01943" "PIEZO1_000052" "g.88781468C>A" "" "" "" "CTU2(NM_001318507.1):c.1645C>A (p.P549T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715060C>A" "" "likely benign" "" "0000559578" "0" "50" "16" "88781621" "88781621" "subst" "0.000110245" "01943" "PIEZO1_000053" "g.88781621C>G" "" "" "" "CTU2(NM_001318507.1):c.1723C>G (p.L575V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715213C>G" "" "VUS" "" "0000559579" "0" "50" "16" "88782029" "88782029" "subst" "0.000364284" "01804" "PIEZO1_000012" "g.88782029G>C" "" "" "" "PIEZO1(NM_001142864.2):c.7550C>G (p.(Thr2517Ser)), PIEZO1(NM_001142864.4):c.7550C>G (p.T2517S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715621G>C" "" "VUS" "" "0000559580" "0" "10" "16" "88782049" "88782049" "subst" "0.00178108" "02330" "PIEZO1_000054" "g.88782049C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7530G>A (p.P2510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715641C>T" "" "benign" "" "0000559581" "0" "30" "16" "88782050" "88782050" "subst" "0.00722271" "01804" "PIEZO1_000055" "g.88782050G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7529C>T (p.(Pro2510Leu)), PIEZO1(NM_001142864.4):c.7529C>T (p.P2510L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715642G>A" "" "likely benign" "" "0000559582" "0" "50" "16" "88782056" "88782056" "subst" "0" "01943" "PIEZO1_000056" "g.88782056C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7523G>A (p.R2508H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715648C>T" "" "VUS" "" "0000559583" "0" "10" "16" "88782079" "88782079" "subst" "0.120133" "02330" "PIEZO1_000057" "g.88782079G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7500C>T (p.Y2500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715671G>A" "" "benign" "" "0000559584" "0" "30" "16" "88782152" "88782152" "subst" "3.30609E-5" "01804" "PIEZO1_000058" "g.88782152C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7427G>A (p.(Arg2476His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715744C>T" "" "likely benign" "" "0000559585" "0" "10" "16" "88782217" "88782217" "subst" "0.085806" "02330" "PIEZO1_000059" "g.88782217G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7362C>T (p.F2454=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715809G>A" "" "benign" "" "0000559586" "0" "30" "16" "88782337" "88782340" "del" "0" "01804" "PIEZO1_000060" "g.88782337_88782340del" "" "" "" "PIEZO1(NM_001142864.2):c.7316+8_7316+11del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715929_88715932del" "" "likely benign" "" "0000559587" "0" "50" "16" "88782342" "88782342" "subst" "4.74165E-5" "01804" "PIEZO1_000061" "g.88782342C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7315G>A (p.(Gly2439Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715934C>T" "" "VUS" "" "0000559588" "0" "30" "16" "88782417" "88782417" "subst" "0.00110682" "01804" "PIEZO1_000062" "g.88782417C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7240G>A (p.(Asp2414Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716009C>T" "" "likely benign" "" "0000559589" "0" "10" "16" "88782463" "88782463" "subst" "0.0017584" "02330" "PIEZO1_000063" "g.88782463G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7194C>T (p.T2398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716055G>A" "" "benign" "" "0000559590" "0" "30" "16" "88782644" "88782644" "subst" "0" "01804" "PIEZO1_000064" "g.88782644T>C" "" "" "" "PIEZO1(NM_001142864.2):c.7091A>G (p.(Asn2364Ser)), PIEZO1(NM_001142864.4):c.7091A>G (p.N2364S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716236T>C" "" "likely benign" "" "0000559591" "0" "10" "16" "88782676" "88782676" "subst" "0.882126" "02330" "PIEZO1_000065" "g.88782676A>G" "" "" "" "PIEZO1(NM_001142864.4):c.7059T>C (p.P2353=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716268A>G" "" "benign" "" "0000559593" "0" "10" "16" "88783002" "88783002" "subst" "0.00238128" "01943" "PIEZO1_000067" "g.88783002G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6891C>T (p.A2297=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716594G>A" "" "benign" "" "0000559594" "0" "30" "16" "88783064" "88783064" "subst" "0.00637451" "01804" "PIEZO1_000068" "g.88783064G>T" "" "" "" "PIEZO1(NM_001142864.2):c.6829C>A (p.(Leu2277Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716656G>T" "" "likely benign" "" "0000559595" "0" "10" "16" "88783100" "88783100" "subst" "0.263897" "02330" "PIEZO1_000069" "g.88783100T>C" "" "" "" "PIEZO1(NM_001142864.4):c.6793A>G (p.I2265V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716692T>C" "" "benign" "" "0000559596" "0" "10" "16" "88783449" "88783449" "subst" "0.624285" "02330" "PIEZO1_000070" "g.88783449C>G" "" "" "" "PIEZO1(NM_001142864.4):c.6642G>C (p.L2214=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88717041C>G" "" "benign" "" "0000559597" "0" "10" "16" "88783521" "88783521" "subst" "0.898967" "02330" "PIEZO1_000071" "g.88783521T>C" "" "" "" "PIEZO1(NM_001142864.4):c.6570A>G (p.P2190=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88717113T>C" "" "benign" "" "0000559598" "0" "30" "16" "88783572" "88783572" "subst" "0" "01943" "PIEZO1_000072" "g.88783572G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6519C>T (p.Y2173=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88717164G>A" "" "likely benign" "" "0000559599" "0" "50" "16" "88786328" "88786328" "subst" "0.00106291" "01943" "PIEZO1_000073" "g.88786328C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6205G>A (p.V2069M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88719920C>T" "" "VUS" "" "0000559600" "0" "30" "16" "88786910" "88786910" "subst" "1.32693E-5" "01943" "PIEZO1_000074" "g.88786910G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5832C>T (p.R1944=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720502G>A" "" "likely benign" "" "0000559601" "0" "10" "16" "88787056" "88787056" "subst" "0.00248951" "02330" "PIEZO1_000075" "g.88787056G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5769C>T (p.A1923=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720648G>A" "" "benign" "" "0000559602" "0" "10" "16" "88787082" "88787082" "subst" "0.00083597" "01943" "PIEZO1_000076" "g.88787082G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5743C>T (p.R1915C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720674G>A" "" "benign" "" "0000559603" "0" "10" "16" "88787082" "88787082" "subst" "0.0023421" "01943" "PIEZO1_000077" "g.88787082G>T" "" "" "" "PIEZO1(NM_001142864.4):c.5743C>A (p.R1915S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720674G>T" "" "benign" "" "0000559604" "0" "30" "16" "88787087" "88787087" "subst" "0" "01943" "PIEZO1_000078" "g.88787087G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5738C>T (p.P1913L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720679G>A" "" "likely benign" "" "0000559605" "0" "30" "16" "88787097" "88787097" "subst" "0.00198567" "01804" "PIEZO1_000017" "g.88787097C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5728G>A (p.(Glu1910Lys)), PIEZO1(NM_001142864.4):c.5728G>A (p.E1910K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88720689C>T" "" "likely benign" "" "0000559606" "0" "10" "16" "88787612" "88787614" "del" "0" "02330" "PIEZO1_000079" "g.88787612_88787614del" "" "" "" "PIEZO1(NM_001142864.4):c.5632_5634delAAG (p.K1878del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721204_88721206del" "" "benign" "" "0000559607" "0" "30" "16" "88787615" "88787615" "subst" "0.00312656" "01804" "PIEZO1_000080" "g.88787615C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5627G>A (p.(Arg1876Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721207C>T" "" "likely benign" "" "0000559608" "0" "10" "16" "88787673" "88787673" "subst" "0.254692" "02330" "PIEZO1_000081" "g.88787673G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5569C>T (p.P1857S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721265G>A" "" "benign" "" "0000559609" "0" "10" "16" "88787704" "88787704" "subst" "0.862362" "02330" "PIEZO1_000082" "g.88787704G>C" "" "" "" "PIEZO1(NM_001142864.4):c.5538C>G (p.A1846=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721296G>C" "" "benign" "" "0000559611" "0" "30" "16" "88787778" "88787778" "subst" "0.000294114" "01943" "PIEZO1_000084" "g.88787778C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5464G>A (p.(Glu1822Lys)), PIEZO1(NM_001142864.4):c.5464G>A (p.E1822K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721370C>T" "" "likely benign" "" "0000559612" "0" "30" "16" "88787778" "88787778" "subst" "0.000294114" "01804" "PIEZO1_000084" "g.88787778C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5464G>A (p.(Glu1822Lys)), PIEZO1(NM_001142864.4):c.5464G>A (p.E1822K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721370C>T" "" "likely benign" "" "0000559615" "0" "50" "16" "88788058" "88788058" "subst" "0.00016763" "01943" "PIEZO1_000087" "g.88788058T>G" "" "" "" "PIEZO1(NM_001142864.2):c.5291A>C (p.(Glu1764Ala)), PIEZO1(NM_001142864.4):c.5291A>C (p.E1764A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721650T>G" "" "VUS" "" "0000559616" "0" "50" "16" "88788058" "88788058" "subst" "0.00016763" "01804" "PIEZO1_000087" "g.88788058T>G" "" "" "" "PIEZO1(NM_001142864.2):c.5291A>C (p.(Glu1764Ala)), PIEZO1(NM_001142864.4):c.5291A>C (p.E1764A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721650T>G" "" "VUS" "" "0000559617" "0" "90" "16" "88788059" "88788059" "subst" "6.71339E-6" "02329" "PIEZO1_000088" "g.88788059C>A" "" "" "" "PIEZO1(NM_001142864.4):c.5290G>T (p.E1764*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721651C>A" "" "pathogenic" "" "0000559618" "0" "10" "16" "88788235" "88788235" "subst" "0.011208" "02330" "PIEZO1_000018" "g.88788235G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5195C>T (p.(Thr1732Met)), PIEZO1(NM_001142864.4):c.5195C>T (p.T1732M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721827G>A" "" "benign" "" "0000559619" "0" "30" "16" "88788297" "88788297" "subst" "0.000176698" "02330" "PIEZO1_000089" "g.88788297G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5133C>T (p.P1711=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721889G>A" "" "likely benign" "" "0000559620" "0" "50" "16" "88788415" "88788415" "subst" "0" "01804" "PIEZO1_000090" "g.88788415G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5015C>T (p.(Ala1672Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722007G>A" "" "VUS" "" "0000559621" "0" "30" "16" "88788461" "88788461" "subst" "0.000146818" "01943" "PIEZO1_000091" "g.88788461G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4969C>T (p.(Pro1657Ser)), PIEZO1(NM_001142864.4):c.4969C>T (p.P1657S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722053G>A" "" "likely benign" "" "0000559622" "0" "30" "16" "88788461" "88788461" "subst" "0.000146818" "01804" "PIEZO1_000091" "g.88788461G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4969C>T (p.(Pro1657Ser)), PIEZO1(NM_001142864.4):c.4969C>T (p.P1657S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722053G>A" "" "likely benign" "" "0000559623" "0" "30" "16" "88788467" "88788467" "subst" "6.35459E-5" "01943" "PIEZO1_000092" "g.88788467G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4963C>T (p.R1655C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722059G>A" "" "likely benign" "" "0000559624" "0" "10" "16" "88788477" "88788477" "subst" "0.864975" "02330" "PIEZO1_000093" "g.88788477A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4956-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722069A>G" "" "benign" "" "0000559625" "0" "50" "16" "88788741" "88788741" "subst" "0.000568481" "01943" "PIEZO1_000094" "g.88788741C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4840G>A (p.G1614S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722333C>T" "" "VUS" "" "0000559626" "0" "30" "16" "88788805" "88788805" "subst" "0.000448936" "01943" "PIEZO1_000095" "g.88788805A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4776T>C (p.S1592=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722397A>G" "" "likely benign" "" "0000559627" "0" "30" "16" "88789000" "88789000" "subst" "0.000532737" "01943" "PIEZO1_000096" "g.88789000G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4766C>T (p.(Thr1589Ile)), PIEZO1(NM_001142864.4):c.4766C>T (p.T1589I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722592G>A" "" "likely benign" "" "0000559628" "0" "30" "16" "88789053" "88789053" "subst" "0.000273798" "01804" "PIEZO1_000097" "g.88789053G>C" "" "" "" "PIEZO1(NM_001142864.2):c.4713C>G (p.(Ser1571Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722645G>C" "" "likely benign" "" "0000559630" "0" "30" "16" "88789499" "88789499" "subst" "0.00387772" "02330" "PIEZO1_000024" "g.88789499G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4495+4C>T (p.?), PIEZO1(NM_001142864.4):c.4495+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723091G>A" "" "likely benign" "" "0000559631" "0" "10" "16" "88789523" "88789523" "subst" "0.00233066" "02330" "PIEZO1_000099" "g.88789523C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4475G>A (p.G1492D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723115C>T" "" "benign" "" "0000559634" "0" "10" "16" "88789679" "88789684" "dup" "0" "02330" "PIEZO1_000102" "g.88789679_88789684dup" "" "" "" "PIEZO1(NM_001142864.4):c.4400_4405dupAGCAGG (p.E1467_Q1468dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723271_88723276dup" "" "benign" "" "0000559635" "0" "10" "16" "88789687" "88789687" "subst" "0.00828773" "02330" "PIEZO1_000103" "g.88789687C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4385G>A (p.(Arg1462Gln)), PIEZO1(NM_001142864.4):c.4385G>A (p.R1462Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723279C>T" "" "benign" "" "0000559636" "0" "30" "16" "88789687" "88789687" "subst" "0.00828773" "01804" "PIEZO1_000103" "g.88789687C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4385G>A (p.(Arg1462Gln)), PIEZO1(NM_001142864.4):c.4385G>A (p.R1462Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723279C>T" "" "likely benign" "" "0000559637" "0" "30" "16" "88789716" "88789716" "subst" "0.000580456" "02330" "PIEZO1_000104" "g.88789716C>G" "" "" "" "PIEZO1(NM_001142864.4):c.4356G>C (p.V1452=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723308C>G" "" "likely benign" "" "0000559638" "0" "30" "16" "88790340" "88790340" "subst" "0.000512261" "01804" "PIEZO1_000105" "g.88790340C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4274G>A (p.(Ser1425Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723932C>T" "" "likely benign" "" "0000559639" "0" "10" "16" "88791458" "88791458" "subst" "0.267738" "02330" "PIEZO1_000106" "g.88791458G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4193C>T (p.P1398L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88725050G>A" "" "benign" "" "0000559640" "0" "50" "16" "88791471" "88791471" "subst" "1.85395E-5" "01943" "PIEZO1_000107" "g.88791471C>A" "" "" "" "PIEZO1(NM_001142864.4):c.4180G>T (p.G1394C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88725063C>A" "" "VUS" "" "0000559641" "0" "10" "16" "88792047" "88792047" "subst" "0.857472" "02330" "PIEZO1_000108" "g.88792047A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4014T>C (p.F1338=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88725639A>G" "" "benign" "" "0000559642" "0" "10" "16" "88792097" "88792097" "subst" "0.857028" "02330" "PIEZO1_000109" "g.88792097A>G" "" "" "" "PIEZO1(NM_001142864.4):c.3969-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88725689A>G" "" "benign" "" "0000559643" "0" "30" "16" "88792725" "88792725" "subst" "0.000774411" "01804" "PIEZO1_000110" "g.88792725G>A" "" "" "" "PIEZO1(NM_001142864.2):c.3935C>T (p.(Ala1312Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726317G>A" "" "likely benign" "" "0000559644" "0" "10" "16" "88792732" "88792732" "subst" "0.000645343" "02330" "PIEZO1_000111" "g.88792732C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3928G>A (p.V1310I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726324C>T" "" "benign" "" "0000559645" "0" "30" "16" "88792939" "88792939" "subst" "0.00298699" "02330" "PIEZO1_000112" "g.88792939C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3796+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726531C>T" "" "likely benign" "" "0000559646" "0" "10" "16" "88793063" "88793063" "subst" "0.00204125" "02330" "PIEZO1_000113" "g.88793063C>A" "" "" "" "PIEZO1(NM_001142864.4):c.3700-12G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726655C>A" "" "benign" "" "0000559647" "0" "10" "16" "88793079" "88793087" "dup" "0" "02330" "PIEZO1_000114" "g.88793079_88793087dup" "" "" "" "PIEZO1(NM_001142864.4):c.3700-26_3700-18dupGCCCCGCTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726671_88726679dup" "" "benign" "" "0000559648" "0" "10" "16" "88793103" "88793103" "subst" "0.868749" "02330" "PIEZO1_000115" "g.88793103C>G" "" "" "" "PIEZO1(NM_001142864.4):c.3699+20G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726695C>G" "" "benign" "" "0000559650" "0" "10" "16" "88793948" "88793948" "subst" "0" "02330" "PIEZO1_000117" "g.88793948T>G" "" "" "" "PIEZO1(NM_001142864.4):c.3301+17A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88727540T>G" "" "benign" "" "0000559651" "0" "30" "16" "88793951" "88793951" "subst" "0" "02330" "PIEZO1_000118" "g.88793951T>G" "" "" "" "PIEZO1(NM_001142864.4):c.3301+14A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88727543T>G" "" "likely benign" "" "0000559652" "0" "30" "16" "88793958" "88793958" "subst" "0" "02330" "PIEZO1_000119" "g.88793958C>G" "" "" "" "PIEZO1(NM_001142864.4):c.3301+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88727550C>G" "" "likely benign" "" "0000559653" "0" "30" "16" "88798256" "88798256" "subst" "6.72522E-6" "01943" "PIEZO1_000120" "g.88798256G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3054C>T (p.H1018=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731848G>A" "" "likely benign" "" "0000559655" "0" "10" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000122" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGAGAGGGCGGGGCATGGGGATGCACTGAGTCTGGGGATGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-15_2992-14ins69" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGGGAGAGGGCGGGGCATGGGGATGCACTGAGTCTGGGGATGGGCGGGG" "" "benign" "" "0000559656" "0" "10" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000123" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGAGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-12_2992-11ins33" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGGGAGGGCGGGG" "" "benign" "" "0000559657" "0" "30" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000124" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGAGGGGGGGGTGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-12_2992-11ins68" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGGGAGGGGGGGGTGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGG" "" "likely benign" "" "0000559658" "0" "10" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000125" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGATGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-15_2992-14ins34" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGGGATGGGCGGGG" "" "benign" "" "0000559659" "0" "30" "16" "88798869" "88798869" "subst" "0.00750616" "02330" "PIEZO1_000126" "g.88798869C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2865G>A (p.(Gln955=)), PIEZO1(NM_001142864.4):c.2865G>A (p.Q955=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88732461C>T" "" "likely benign" "" "0000559660" "0" "30" "16" "88799680" "88799680" "subst" "1.33996E-5" "01804" "PIEZO1_000127" "g.88799680C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2664+6G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733272C>T" "" "likely benign" "" "0000559661" "0" "30" "16" "88799702" "88799702" "subst" "1.32931E-5" "01804" "PIEZO1_000128" "g.88799702G>C" "" "" "" "PIEZO1(NM_001142864.2):c.2648C>G (p.(Ser883Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733294G>C" "" "likely benign" "" "0000559662" "0" "30" "16" "88799728" "88799728" "subst" "4.64E-5" "01943" "PIEZO1_000129" "g.88799728G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2622C>T (p.L874=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733320G>A" "" "likely benign" "" "0000559663" "0" "30" "16" "88799737" "88799737" "subst" "1.32533E-5" "02330" "PIEZO1_000130" "g.88799737C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2613G>A (p.L871=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733329C>T" "" "likely benign" "" "0000559664" "0" "30" "16" "88799760" "88799760" "subst" "0.000284927" "02330" "PIEZO1_000131" "g.88799760C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2590G>A (p.V864I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733352C>T" "" "likely benign" "" "0000559665" "0" "50" "16" "88799838" "88799838" "subst" "0" "02325" "PIEZO1_000132" "g.88799838C>G" "" "" "" "PIEZO1(NM_001142864.4):c.2512G>C (p.V838L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733430C>G" "" "VUS" "" "0000559666" "0" "30" "16" "88800060" "88800060" "subst" "0.0038099" "01804" "PIEZO1_000133" "g.88800060C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2423G>A (p.(Arg808Gln)), PIEZO1(NM_001142864.4):c.2423G>A (p.R808Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733652C>T" "" "likely benign" "" "0000559667" "0" "30" "16" "88800139" "88800139" "subst" "0.00380375" "01804" "PIEZO1_000134" "g.88800139C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2344G>A (p.(Gly782Ser)), PIEZO1(NM_001142864.4):c.2344G>A (p.G782S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733731C>T" "" "likely benign" "" "0000559668" "0" "10" "16" "88800295" "88800295" "subst" "0.289574" "02330" "PIEZO1_000135" "g.88800295C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2329+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733887C>T" "" "benign" "" "0000559669" "0" "30" "16" "88800369" "88800369" "subst" "0" "01943" "PIEZO1_000136" "g.88800369G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2274C>T (p.S758=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733961G>A" "" "likely benign" "" "0000559671" "0" "10" "16" "88800395" "88800397" "dup" "0" "02330" "PIEZO1_000138" "g.88800395_88800397dup" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270dupGGA (p.(Glu756dup)), PIEZO1(NM_001142864.4):c.2268_2270dupGGA (p.E756dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733987_88733989dup" "" "benign" "" "0000559672" "0" "10" "16" "88800395" "88800397" "dup" "0" "01943" "PIEZO1_000138" "g.88800395_88800397dup" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270dupGGA (p.(Glu756dup)), PIEZO1(NM_001142864.4):c.2268_2270dupGGA (p.E756dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733987_88733989dup" "" "benign" "" "0000559673" "0" "10" "16" "88800408" "88800410" "del" "0" "02330" "PIEZO1_000139" "g.88800408_88800410del" "" "" "" "PIEZO1(NM_001142864.4):c.2245_2247delCAG (p.Q749del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734000_88734002del" "" "benign" "" "0000559674" "0" "10" "16" "88800477" "88800477" "subst" "0.0785377" "02330" "PIEZO1_000140" "g.88800477G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2181-15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734069G>A" "" "benign" "" "0000559675" "0" "10" "16" "88800785" "88800785" "subst" "0.0911899" "02330" "PIEZO1_000141" "g.88800785C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2159G>A (p.R720H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734377C>T" "" "benign" "" "0000559676" "0" "30" "16" "88800802" "88800802" "subst" "0" "01943" "PIEZO1_000142" "g.88800802C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2142G>A (p.V714=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734394C>T" "" "likely benign" "" "0000559677" "0" "10" "16" "88800814" "88800814" "subst" "0.0917474" "02330" "PIEZO1_000143" "g.88800814G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2130C>T (p.D710=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734406G>A" "" "benign" "" "0000559678" "0" "50" "16" "88800834" "88800834" "subst" "2.70303E-5" "02325" "PIEZO1_000144" "g.88800834G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2110C>T (p.P704S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734426G>A" "" "VUS" "" "0000559679" "0" "70" "16" "88800909" "88800909" "subst" "2.05942E-5" "01804" "PIEZO1_000145" "g.88800909C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2035G>A (p.(Glu679Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734501C>T" "" "likely pathogenic" "" "0000559680" "0" "10" "16" "88800913" "88800913" "subst" "0.0986298" "02330" "PIEZO1_000146" "g.88800913C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2031G>A (p.V677=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734505C>T" "" "benign" "" "0000559681" "0" "30" "16" "88800951" "88800951" "subst" "0.000769102" "01804" "PIEZO1_000147" "g.88800951G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1998-5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734543G>A" "" "likely benign" "" "0000559682" "0" "30" "16" "88801212" "88801212" "subst" "0.000714381" "01804" "PIEZO1_000148" "g.88801212G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1849-6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734804G>A" "" "likely benign" "" "0000559683" "0" "50" "16" "88801466" "88801467" "ins" "6.67485E-6" "01943" "PIEZO1_000149" "g.88801466_88801467insT" "" "" "" "PIEZO1(NM_001142864.4):c.1670-6_1670-5insA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88735058_88735059insT" "" "VUS" "" "0000559684" "0" "30" "16" "88801467" "88801467" "subst" "6.68021E-6" "01943" "PIEZO1_000150" "g.88801467G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1670-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88735059G>A" "" "likely benign" "" "0000559685" "0" "50" "16" "88801621" "88801621" "subst" "0.000423191" "01804" "PIEZO1_000151" "g.88801621G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1591C>T (p.(Arg531Cys)), PIEZO1(NM_001142864.4):c.1591C>T (p.R531C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88735213G>A" "" "VUS" "" "0000559686" "0" "10" "16" "88802540" "88802540" "subst" "0.266446" "02330" "PIEZO1_000152" "g.88802540G>C" "" "" "" "PIEZO1(NM_001142864.4):c.1557+16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736132G>C" "" "benign" "" "0000559687" "0" "10" "16" "88802573" "88802573" "subst" "0.0874292" "02330" "PIEZO1_000153" "g.88802573G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1540C>T (p.L514=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736165G>A" "" "benign" "" "0000559688" "0" "10" "16" "88802586" "88802586" "subst" "0.0182747" "02330" "PIEZO1_000154" "g.88802586G>T" "" "" "" "PIEZO1(NM_001142864.2):c.1527C>A (p.(=)), PIEZO1(NM_001142864.4):c.1527C>A (p.T509=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736178G>T" "" "benign" "" "0000559689" "0" "30" "16" "88802618" "88802618" "subst" "0.000676544" "01943" "PIEZO1_000155" "g.88802618C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1495G>A (p.(Val499Ile)), PIEZO1(NM_001142864.4):c.1495G>A (p.V499I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736210C>T" "" "likely benign" "" "0000559690" "0" "30" "16" "88802618" "88802618" "subst" "0.000676544" "01804" "PIEZO1_000155" "g.88802618C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1495G>A (p.(Val499Ile)), PIEZO1(NM_001142864.4):c.1495G>A (p.V499I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736210C>T" "" "likely benign" "" "0000559692" "0" "30" "16" "88802712" "88802712" "subst" "6.71862E-5" "01943" "PIEZO1_000157" "g.88802712C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1401G>A (p.S467=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736304C>T" "" "likely benign" "" "0000559693" "0" "10" "16" "88802832" "88802832" "subst" "0.106167" "02330" "PIEZO1_000158" "g.88802832G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1297-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736424G>A" "" "benign" "" "0000559694" "0" "10" "16" "88803124" "88803124" "subst" "0.375684" "02330" "PIEZO1_000159" "g.88803124T>C" "" "" "" "PIEZO1(NM_001142864.4):c.1219A>G (p.R407G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736716T>C" "" "benign" "" "0000559696" "0" "30" "16" "88803975" "88803975" "subst" "0.000375122" "01804" "PIEZO1_000161" "g.88803975C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1187G>A (p.(Arg396Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737567C>T" "" "likely benign" "" "0000559697" "0" "10" "16" "88803982" "88803982" "subst" "0.724156" "02330" "PIEZO1_000162" "g.88803982C>G" "" "" "" "PIEZO1(NM_001142864.4):c.1180G>C (p.V394L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737574C>G" "" "benign" "" "0000559698" "0" "10" "16" "88804020" "88804022" "del" "0" "02330" "PIEZO1_000163" "g.88804020_88804022del" "" "" "" "PIEZO1(NM_001142864.4):c.1141_1143delGAT (p.D381del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737612_88737614del" "" "benign" "" "0000559699" "0" "30" "16" "88804150" "88804150" "subst" "5.74515E-5" "01804" "PIEZO1_000164" "g.88804150G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1093C>T (p.(Arg365Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737742G>A" "" "likely benign" "" "0000559700" "0" "30" "16" "88804349" "88804349" "subst" "0.039529" "01804" "PIEZO1_000165" "g.88804349G>T" "" "" "" "LOC100289580(NR_103774.1):n.390G>T (-), PIEZO1(NM_001142864.4):c.1013C>A (p.S338Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737941G>T" "" "likely benign" "" "0000559701" "0" "30" "16" "88804353" "88804353" "subst" "0.000415527" "01804" "PIEZO1_000166" "g.88804353G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1009C>T (p.(Pro337Ser)), PIEZO1(NM_001142864.4):c.1009C>T (p.P337S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737945G>A" "" "likely benign" "" "0000559702" "0" "30" "16" "88804361" "88804361" "subst" "0.000399831" "01804" "PIEZO1_000167" "g.88804361G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1001C>T (p.(Ala334Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737953G>A" "" "likely benign" "" "0000559703" "0" "10" "16" "88804364" "88804364" "subst" "0.00561442" "02330" "PIEZO1_000034" "g.88804364C>T" "" "" "" "PIEZO1(NM_001142864.2):c.998G>A (p.(Arg333His)), PIEZO1(NM_001142864.4):c.998G>A (p.R333H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737956C>T" "" "benign" "" "0000559704" "0" "30" "16" "88804523" "88804523" "subst" "0.000950751" "01943" "PIEZO1_000168" "g.88804523G>A" "" "" "" "PIEZO1(NM_001142864.4):c.849-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738115G>A" "" "likely benign" "" "0000559705" "0" "10" "16" "88804618" "88804618" "subst" "0.262296" "02330" "PIEZO1_000169" "g.88804618G>A" "" "" "" "PIEZO1(NM_001142864.4):c.848+17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738210G>A" "" "benign" "" "0000559706" "0" "30" "16" "88804732" "88804732" "subst" "2.91779E-5" "01943" "PIEZO1_000170" "g.88804732C>T" "" "" "" "PIEZO1(NM_001142864.4):c.751G>A (p.A251T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738324C>T" "" "likely benign" "" "0000559707" "0" "10" "16" "88804734" "88804734" "subst" "0.827928" "02330" "PIEZO1_000171" "g.88804734A>G" "" "" "" "PIEZO1(NM_001142864.4):c.749T>C (p.V250A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738326A>G" "" "benign" "" "0000559708" "0" "10" "16" "88804856" "88804856" "subst" "0.248391" "02330" "PIEZO1_000172" "g.88804856G>A" "" "" "" "PIEZO1(NM_001142864.4):c.635-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738448G>A" "" "benign" "" "0000559709" "0" "30" "16" "88804983" "88804983" "subst" "0.00365046" "02330" "PIEZO1_000036" "g.88804983T>C" "" "" "" "PIEZO1(NM_001142864.4):c.627A>G (p.A209=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738575T>C" "" "likely benign" "" "0000559710" "0" "10" "16" "88805055" "88805055" "subst" "0.00373977" "02330" "PIEZO1_000173" "g.88805055G>A" "" "" "" "PIEZO1(NM_001142864.4):c.555C>T (p.A185=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738647G>A" "" "benign" "" "0000559711" "0" "10" "16" "88807878" "88807878" "subst" "0.248462" "02330" "PIEZO1_000174" "g.88807878G>A" "" "" "" "PIEZO1(NM_001142864.4):c.465+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88741470G>A" "" "benign" "" "0000559712" "0" "10" "16" "88807896" "88807896" "subst" "0.130927" "02330" "PIEZO1_000175" "g.88807896G>A" "" "" "" "PIEZO1(NM_001142864.4):c.455C>T (p.P152L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88741488G>A" "" "benign" "" "0000559713" "0" "30" "16" "88808507" "88808507" "subst" "0.000459344" "01804" "PIEZO1_000176" "g.88808507C>T" "" "" "" "PIEZO1(NM_001142864.2):c.284-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88742099C>T" "" "likely benign" "" "0000559714" "0" "30" "16" "88808728" "88808728" "subst" "0.00237222" "01804" "PIEZO1_000177" "g.88808728T>C" "" "" "" "PIEZO1(NM_001142864.2):c.263A>G (p.(Asp88Gly)), PIEZO1(NM_001142864.4):c.263A>G (p.D88G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88742320T>C" "" "likely benign" "" "0000559715" "0" "10" "16" "88808743" "88808743" "subst" "0.887588" "02330" "PIEZO1_000178" "g.88808743A>G" "" "" "" "PIEZO1(NM_001142864.4):c.248T>C (p.I83T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88742335A>G" "" "benign" "" "0000559716" "0" "10" "16" "88851310" "88851310" "subst" "0.347487" "02330" "PIEZO1_000179" "g.88851310A>C" "" "" "" "PIEZO1(NM_001142864.4):c.63T>G (p.A21=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88784902A>C" "" "benign" "" "0000602992" "3" "50" "16" "88782108" "88782108" "dup" "0" "01164" "PIEZO1_000180" "g.88782108dup" "" "" "" "" "ACMG: PVS1,PM2; deteced in prenatal testing - parents are consanguinous - interpreted as possibly causal for prenatal phenotype\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000616207" "0" "50" "16" "88780999" "88780999" "dup" "0" "02327" "PIEZO1_000181" "g.88780999dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88714591dup" "" "VUS" "" "0000616208" "0" "30" "16" "88782505" "88782505" "subst" "0.00253547" "02330" "PIEZO1_000183" "g.88782505G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7152C>T (p.G2384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716097G>A" "" "likely benign" "" "0000616209" "0" "30" "16" "88782777" "88782777" "subst" "0.00565798" "02330" "PIEZO1_000184" "g.88782777G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7041C>T (p.(=)), PIEZO1(NM_001142864.4):c.7041C>T (p.D2347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716369G>A" "" "likely benign" "" "0000616210" "0" "30" "16" "88782777" "88782777" "subst" "0.00565798" "01804" "PIEZO1_000184" "g.88782777G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7041C>T (p.(=)), PIEZO1(NM_001142864.4):c.7041C>T (p.D2347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88716369G>A" "" "likely benign" "" "0000616211" "0" "30" "16" "88783506" "88783506" "subst" "0.000183215" "01943" "PIEZO1_000186" "g.88783506C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6585G>A (p.S2195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88717098C>T" "" "likely benign" "" "0000616212" "0" "10" "16" "88786063" "88786063" "subst" "0.0284249" "01804" "PIEZO1_000187" "g.88786063C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6390G>A (p.(Thr2130=)), PIEZO1(NM_001142864.4):c.6390G>A (p.T2130=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88719655C>T" "" "benign" "" "0000616213" "0" "90" "16" "88786073" "88786073" "subst" "0" "02327" "PIEZO1_000188" "g.88786073G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88719665G>A" "" "pathogenic" "" "0000616214" "0" "10" "16" "88786245" "88786245" "subst" "0.0180648" "02330" "PIEZO1_000189" "g.88786245C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6288G>A (p.K2096=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88719837C>T" "" "benign" "" "0000616215" "0" "10" "16" "88787737" "88787737" "subst" "0.0181384" "02330" "PIEZO1_000190" "g.88787737C>T" "" "" "" "PIEZO1(NM_001142864.4):c.5505G>A (p.A1835=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721329C>T" "" "benign" "" "0000616216" "0" "30" "16" "88788060" "88788060" "subst" "0.026214" "01804" "PIEZO1_000191" "g.88788060G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5289C>T (p.(Tyr1763=)), PIEZO1(NM_001142864.4):c.5289C>T (p.Y1763=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721652G>A" "" "likely benign" "" "0000616217" "0" "10" "16" "88788309" "88788309" "subst" "0.0043382" "02330" "PIEZO1_000192" "g.88788309C>G" "" "" "" "PIEZO1(NM_001142864.2):c.5121G>C (p.(Ser1707=)), PIEZO1(NM_001142864.4):c.5121G>C (p.S1707=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721901C>G" "" "benign" "" "0000616218" "0" "10" "16" "88789333" "88789333" "subst" "0.00226583" "01804" "PIEZO1_000193" "g.88789333C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4580G>A (p.(Arg1527His)), PIEZO1(NM_001142864.4):c.4580G>A (p.R1527H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722925C>T" "" "benign" "" "0000616219" "0" "30" "16" "88789491" "88789495" "dup" "0" "02330" "PIEZO1_000194" "g.88789491_88789495dup" "" "" "" "PIEZO1(NM_001142864.4):c.4495+10_4495+14dupCCCGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723083_88723087dup" "" "likely benign" "" "0000616220" "0" "30" "16" "88789677" "88789678" "ins" "0" "01804" "PIEZO1_000195" "g.88789677_88789678insCCCTGC" "" "" "" "PIEZO1(NM_001142864.2):c.4399_4400insGGCAGG (p.(Gln1466_Glu1467insGlyGln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723269_88723270insCCCTGC" "" "likely benign" "" "0000616221" "0" "50" "16" "88793224" "88793224" "subst" "8.07363E-5" "02325" "PIEZO1_000196" "g.88793224C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3598G>A (p.G1200S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726816C>T" "" "VUS" "" "0000616222" "0" "10" "16" "88793377" "88793377" "subst" "0.00643188" "02330" "PIEZO1_000197" "g.88793377G>A" "" "" "" "PIEZO1(NM_001142864.2):c.3456-11C>T (p.(=)), PIEZO1(NM_001142864.4):c.3456-11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726969G>A" "" "benign" "" "0000616223" "0" "10" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000199" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGAGGGAGGGGGGGGTGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-12_2992-11ins70" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGAGGGAGGGGGGGGTGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGG" "" "benign" "" "0000616224" "0" "10" "16" "88798731" "88798731" "subst" "0.0126722" "02330" "PIEZO1_000200" "g.88798731T>C" "" "" "" "PIEZO1(NM_001142864.2):c.2991+12A>G (p.(=)), PIEZO1(NM_001142864.4):c.2991+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88732323T>C" "" "benign" "" "0000616225" "0" "10" "16" "88799005" "88799005" "subst" "0.0127501" "02330" "PIEZO1_000202" "g.88799005T>C" "" "" "" "PIEZO1(NM_001142864.2):c.2790+10A>G (p.(=)), PIEZO1(NM_001142864.4):c.2790+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88732597T>C" "" "benign" "" "0000616226" "0" "10" "16" "88799674" "88799674" "subst" "0.0126026" "02330" "PIEZO1_000203" "g.88799674G>C" "" "" "" "PIEZO1(NM_001142864.2):c.2664+12C>G (p.(=)), PIEZO1(NM_001142864.4):c.2664+12C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733266G>C" "" "benign" "" "0000616227" "0" "10" "16" "88800122" "88800122" "subst" "0.0120597" "02330" "PIEZO1_000205" "g.88800122C>G" "" "" "" "PIEZO1(NM_001142864.2):c.2361G>C (p.(=)), PIEZO1(NM_001142864.4):c.2361G>C (p.R787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733714C>G" "" "benign" "" "0000616228" "0" "10" "16" "88800395" "88800397" "del" "0" "02330" "PIEZO1_000030" "g.88800395_88800397del" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270del (p.(Glu756del)), PIEZO1(NM_001142864.4):c.2268_2270delGGA (p.E756del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733987_88733989del" "" "benign" "" "0000616229" "0" "30" "16" "88800805" "88800805" "subst" "0.00554646" "01804" "PIEZO1_000206" "g.88800805G>A" "" "" "" "PIEZO1(NM_001142864.2):c.2139C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88734397G>A" "" "likely benign" "" "0000616230" "0" "10" "16" "88801457" "88801457" "subst" "0.00789375" "02330" "PIEZO1_000207" "g.88801457G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1674C>T (p.(Pro558=)), PIEZO1(NM_001142864.4):c.1674C>T (p.P558=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88735049G>A" "" "benign" "" "0000616231" "0" "10" "16" "88802748" "88802748" "subst" "0.019632" "02330" "PIEZO1_000208" "g.88802748C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1365G>A (p.(Thr455=)), PIEZO1(NM_001142864.4):c.1365G>A (p.T455=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736340C>T" "" "benign" "" "0000616232" "0" "10" "16" "88802830" "88802830" "subst" "0.00601067" "02330" "PIEZO1_000209" "g.88802830A>G" "" "" "" "PIEZO1(NM_001142864.4):c.1297-14T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736422A>G" "" "benign" "" "0000616233" "0" "30" "16" "88804408" "88804408" "subst" "0.000273479" "01804" "PIEZO1_000210" "g.88804408G>A" "" "" "" "PIEZO1(NM_001142864.2):c.954C>T (p.(=)), PIEZO1(NM_001142864.4):c.954C>T (p.V318=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738000G>A" "" "likely benign" "" "0000616234" "0" "30" "16" "88804765" "88804765" "subst" "0.000817423" "02330" "PIEZO1_000212" "g.88804765T>C" "" "" "" "PIEZO1(NM_001142864.4):c.718A>G (p.I240V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738357T>C" "" "likely benign" "" "0000616235" "0" "10" "16" "88805022" "88805022" "subst" "0.0157896" "02330" "PIEZO1_000213" "g.88805022C>A" "" "" "" "LOC100289580(NR_103774.1):n.965C>A (-), PIEZO1(NM_001142864.4):c.588G>T (p.L196=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738614C>A" "" "benign" "" "0000623561" "0" "10" "16" "88782074" "88782074" "subst" "0.00612514" "02330" "PIEZO1_000182" "g.88782074T>C" "" "" "" "PIEZO1(NM_001142864.2):c.7505A>G (p.(Lys2502Arg)), PIEZO1(NM_001142864.4):c.7505A>G (p.K2502R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715666T>C" "" "benign" "" "0000623562" "0" "10" "16" "88783414" "88783414" "subst" "0.0378071" "02330" "PIEZO1_000185" "g.88783414G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6660+17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88717006G>A" "" "benign" "" "0000623563" "0" "10" "16" "88787781" "88787781" "subst" "0.0112781" "02330" "PIEZO1_000085" "g.88787781C>T" "" "" "" "PIEZO1(NM_001142864.4):c.5461G>A (p.G1821S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88721373C>T" "" "benign" "" "0000623564" "0" "10" "16" "88798095" "88798095" "subst" "0.0129674" "02330" "PIEZO1_000198" "g.88798095C>A" "" "" "" "PIEZO1(NM_001142864.4):c.3196+19G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731687C>A" "" "benign" "" "0000623566" "0" "30" "16" "88799901" "88799932" "dup" "0" "02330" "PIEZO1_000204" "g.88799901_88799932dup" "" "" "" "PIEZO1(NM_001142864.4):c.2488-34_2488-3dupCCCAAGCCCAGCCCCACGTGCCCACTGCCCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733493_88733524dup" "" "likely benign" "" "0000623568" "0" "10" "16" "88815820" "88815820" "subst" "0.00366608" "02330" "PIEZO1_000214" "g.88815820G>A" "" "" "" "PIEZO1(NM_001142864.4):c.132C>T (p.F44=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88749412G>A" "" "benign" "" "0000649433" "1" "50" "16" "88800060" "88800060" "subst" "0.0038099" "03575" "PIEZO1_000133" "g.88800060C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs202103485}" "Germline" "" "rs202103485" "0" "" "" "g.88733652C>T" "" "VUS" "" "0000649434" "1" "50" "16" "88800139" "88800139" "subst" "0.00380375" "03575" "PIEZO1_000134" "g.88800139C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs200970763}" "Germline" "" "rs200970763" "0" "" "" "g.88733731C>T" "" "VUS" "" "0000657969" "0" "30" "16" "88781314" "88781314" "subst" "0.000747384" "01804" "PIEZO1_000215" "g.88781314C>T" "" "" "" "CTU2(NM_001012759.1):c.1399C>T (p.(Arg467Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88714906C>T" "" "likely benign" "" "0000657970" "0" "30" "16" "88782226" "88782226" "subst" "0.000212469" "02330" "PIEZO1_000216" "g.88782226G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7353C>T (p.I2451=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88715818G>A" "" "likely benign" "" "0000657971" "0" "30" "16" "88788618" "88788618" "subst" "0.000226635" "01804" "PIEZO1_000022" "g.88788618G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4955+8C>T (p.(=)), PIEZO1(NM_001142864.4):c.4955+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722210G>A" "" "likely benign" "" "0000657972" "0" "30" "16" "88788996" "88788996" "subst" "0.00123188" "02330" "PIEZO1_000217" "g.88788996C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4770G>A (p.V1590=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722588C>T" "" "likely benign" "" "0000657973" "0" "90" "16" "88789251" "88789300" "del" "0" "01943" "PIEZO1_000218" "g.88789251_88789300del" "" "" "" "PIEZO1(NM_001142864.4):c.4614_4663del (p.M1539Afs*67)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88722843_88722892del" "" "pathogenic" "" "0000657974" "0" "30" "16" "88789620" "88789620" "subst" "0.000254596" "02330" "PIEZO1_000219" "g.88789620G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4438+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88723212G>A" "" "likely benign" "" "0000657975" "0" "30" "16" "88793071" "88793072" "ins" "0" "02330" "PIEZO1_000220" "g.88793071_88793072insTGGGGCCAG" "" "" "" "PIEZO1(NM_001142864.4):c.3700-17_3700-16insCCCCACTGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88726663_88726664insTGGGGCCAG" "" "likely benign" "" "0000657976" "0" "30" "16" "88793514" "88793514" "subst" "8.94159E-5" "01943" "PIEZO1_000221" "g.88793514C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3388G>A (p.V1130I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88727106C>T" "" "likely benign" "" "0000657977" "0" "50" "16" "88794069" "88794069" "subst" "0" "01943" "PIEZO1_000222" "g.88794069T>A" "" "" "" "PIEZO1(NM_001142864.4):c.3197A>T (p.D1066V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88727661T>A" "" "VUS" "" "0000657978" "0" "10" "16" "88798340" "88798341" "ins" "0" "02330" "PIEZO1_000223" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGGTGTGGGGATGCACTGAGTCTGGGGGAGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-12_2992-11ins69" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88731932_88731933insCGTGGGGATGCACTGAGTCTGGGGGGAGGGCGGGGTGTGGGGATGCACTGAGTCTGGGGGAGGGCGGGG" "" "benign" "" "0000657979" "0" "30" "16" "88799063" "88799063" "subst" "0.000183683" "02330" "PIEZO1_000224" "g.88799063G>T" "" "" "" "PIEZO1(NM_001142864.4):c.2742C>A (p.A914=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88732655G>T" "" "likely benign" "" "0000657980" "0" "30" "16" "88800060" "88800060" "subst" "0.0038099" "02330" "PIEZO1_000133" "g.88800060C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2423G>A (p.(Arg808Gln)), PIEZO1(NM_001142864.4):c.2423G>A (p.R808Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733652C>T" "" "likely benign" "" "0000657981" "0" "30" "16" "88800139" "88800139" "subst" "0.00380375" "02330" "PIEZO1_000134" "g.88800139C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2344G>A (p.(Gly782Ser)), PIEZO1(NM_001142864.4):c.2344G>A (p.G782S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88733731C>T" "" "likely benign" "" "0000657982" "0" "30" "16" "88802586" "88802586" "subst" "0.0182747" "01804" "PIEZO1_000154" "g.88802586G>T" "" "" "" "PIEZO1(NM_001142864.2):c.1527C>A (p.(=)), PIEZO1(NM_001142864.4):c.1527C>A (p.T509=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88736178G>T" "" "likely benign" "" "0000657983" "0" "30" "16" "88804363" "88804363" "subst" "0.000339402" "02330" "PIEZO1_000225" "g.88804363G>A" "" "" "" "PIEZO1(NM_001142864.4):c.999C>T (p.R333=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737955G>A" "" "likely benign" "" "0000657984" "0" "30" "16" "88804364" "88804364" "subst" "0.00561442" "01804" "PIEZO1_000034" "g.88804364C>T" "" "" "" "PIEZO1(NM_001142864.2):c.998G>A (p.(Arg333His)), PIEZO1(NM_001142864.4):c.998G>A (p.R333H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88737956C>T" "" "likely benign" "" "0000657985" "0" "30" "16" "88804736" "88804736" "subst" "4.3765E-5" "01943" "PIEZO1_000226" "g.88804736G>A" "" "" "" "PIEZO1(NM_001142864.4):c.747C>T (p.C249=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738328G>A" "" "likely benign" "" "0000657986" "0" "30" "16" "88805022" "88805022" "subst" "0.0157896" "01804" "PIEZO1_000213" "g.88805022C>A" "" "" "" "LOC100289580(NR_103774.1):n.965C>A (-), PIEZO1(NM_001142864.4):c.588G>T (p.L196=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.88738614C>A" "" "likely benign" "" "0000663633" "1" "50" "16" "88782205" "88782205" "subst" "0.00107996" "00006" "PIEZO1_000003" "g.88782205G>C" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.88715797G>C" "" "VUS" "" "0000663634" "0" "50" "16" "88789499" "88789499" "subst" "0.00387772" "00006" "PIEZO1_000024" "g.88789499G>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.88723091G>A" "" "VUS" "" "0000663635" "0" "50" "16" "88798919" "88798919" "subst" "0.00107697" "00006" "PIEZO1_000010" "g.88798919G>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.88732511G>T" "" "VUS" "" "0000667939" "0" "30" "16" "88782532" "88782532" "subst" "1.3837E-5" "03694" "PIEZO1_000227" "g.88782532G>T" "" "" "" "" "" "Germline" "-" "rs1357808025" "0" "" "" "g.88716124G>T" "" "VUS" "ACMG" "0000680703" "0" "30" "16" "88782050" "88782050" "subst" "0.00722271" "02326" "PIEZO1_000055" "g.88782050G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7529C>T (p.(Pro2510Leu)), PIEZO1(NM_001142864.4):c.7529C>T (p.P2510L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680704" "0" "70" "16" "88782650" "88782650" "dup" "0" "01943" "PIEZO1_000228" "g.88782650dup" "" "" "" "PIEZO1(NM_001142864.4):c.7089dupC (p.N2364Qfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000680705" "0" "50" "16" "88782988" "88782988" "subst" "0.000440802" "02325" "PIEZO1_000229" "g.88782988C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6905G>A (p.R2302H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000680706" "0" "30" "16" "88783075" "88783075" "subst" "0" "01943" "PIEZO1_000230" "g.88783075C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6818G>A (p.(Ser2273Asn)), PIEZO1(NM_001142864.4):c.6818G>A (p.S2273N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680707" "0" "30" "16" "88783112" "88783112" "subst" "0.000475666" "01804" "PIEZO1_000231" "g.88783112T>C" "" "" "" "PIEZO1(NM_001142864.2):c.6781A>G (p.(Ser2261Gly)), PIEZO1(NM_001142864.4):c.6781A>G (p.S2261G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680708" "0" "10" "16" "88788309" "88788309" "subst" "0.0043382" "01804" "PIEZO1_000192" "g.88788309C>G" "" "" "" "PIEZO1(NM_001142864.2):c.5121G>C (p.(Ser1707=)), PIEZO1(NM_001142864.4):c.5121G>C (p.S1707=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680709" "0" "30" "16" "88793377" "88793377" "subst" "0.00643188" "01804" "PIEZO1_000197" "g.88793377G>A" "" "" "" "PIEZO1(NM_001142864.2):c.3456-11C>T (p.(=)), PIEZO1(NM_001142864.4):c.3456-11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680710" "0" "30" "16" "88798731" "88798731" "subst" "0.0126722" "01804" "PIEZO1_000200" "g.88798731T>C" "" "" "" "PIEZO1(NM_001142864.2):c.2991+12A>G (p.(=)), PIEZO1(NM_001142864.4):c.2991+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680711" "0" "30" "16" "88798869" "88798869" "subst" "0.00750616" "01804" "PIEZO1_000126" "g.88798869C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2865G>A (p.(Gln955=)), PIEZO1(NM_001142864.4):c.2865G>A (p.Q955=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680712" "0" "10" "16" "88799005" "88799005" "subst" "0.0127501" "01804" "PIEZO1_000202" "g.88799005T>C" "" "" "" "PIEZO1(NM_001142864.2):c.2790+10A>G (p.(=)), PIEZO1(NM_001142864.4):c.2790+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680713" "0" "10" "16" "88799674" "88799674" "subst" "0.0126026" "01804" "PIEZO1_000203" "g.88799674G>C" "" "" "" "PIEZO1(NM_001142864.2):c.2664+12C>G (p.(=)), PIEZO1(NM_001142864.4):c.2664+12C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680714" "0" "30" "16" "88799901" "88799932" "del" "0" "01804" "PIEZO1_000232" "g.88799901_88799932del" "" "" "" "PIEZO1(NM_001142864.2):c.2488-34_2488-3del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680715" "0" "10" "16" "88800122" "88800122" "subst" "0.0120597" "01804" "PIEZO1_000205" "g.88800122C>G" "" "" "" "PIEZO1(NM_001142864.2):c.2361G>C (p.(=)), PIEZO1(NM_001142864.4):c.2361G>C (p.R787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680716" "0" "10" "16" "88800395" "88800397" "del" "0" "01804" "PIEZO1_000030" "g.88800395_88800397del" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270del (p.(Glu756del)), PIEZO1(NM_001142864.4):c.2268_2270delGGA (p.E756del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680717" "0" "50" "16" "88800395" "88800397" "dup" "0" "01804" "PIEZO1_000138" "g.88800395_88800397dup" "" "" "" "PIEZO1(NM_001142864.2):c.2268_2270dupGGA (p.(Glu756dup)), PIEZO1(NM_001142864.4):c.2268_2270dupGGA (p.E756dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000680718" "0" "30" "16" "88800395" "88800400" "del" "0" "01804" "PIEZO1_000233" "g.88800395_88800400del" "" "" "" "PIEZO1(NM_001142864.2):c.2245_2250del (p.(Gln749_Glu750del)), PIEZO1(NM_001142864.4):c.2245_2250delCAGGAG (p.Q749_E750del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680719" "0" "10" "16" "88801457" "88801457" "subst" "0.00789375" "01804" "PIEZO1_000207" "g.88801457G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1674C>T (p.(Pro558=)), PIEZO1(NM_001142864.4):c.1674C>T (p.P558=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000680720" "0" "30" "16" "88802822" "88802822" "subst" "0.000439313" "01804" "PIEZO1_000234" "g.88802822C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1297-6G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680721" "0" "30" "16" "88803062" "88803062" "subst" "0.00217349" "01804" "PIEZO1_000235" "g.88803062C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1281G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680722" "0" "30" "16" "88804171" "88804171" "subst" "0.00076038" "01804" "PIEZO1_000236" "g.88804171G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1072C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680723" "0" "30" "16" "88804726" "88804726" "subst" "0.000313727" "01804" "PIEZO1_000237" "g.88804726C>T" "" "" "" "PIEZO1(NM_001142864.2):c.757G>A (p.(Gly253Arg)), PIEZO1(NM_001142864.4):c.757G>A (p.G253R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680724" "0" "30" "16" "88808697" "88808697" "subst" "1.51256E-5" "01804" "PIEZO1_000238" "g.88808697C>G" "" "" "" "PIEZO1(NM_001142864.2):c.283+11G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692178" "0" "30" "16" "88782074" "88782074" "subst" "0.00612514" "01804" "PIEZO1_000182" "g.88782074T>C" "" "" "" "PIEZO1(NM_001142864.2):c.7505A>G (p.(Lys2502Arg)), PIEZO1(NM_001142864.4):c.7505A>G (p.K2502R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692179" "0" "50" "16" "88782103" "88782108" "dup" "0" "01943" "PIEZO1_000239" "g.88782103_88782108dup" "" "" "" "PIEZO1(NM_001142864.4):c.7472_7477dup (p.(Arg2491_Glu2492dup)), PIEZO1(NM_001142864.4):c.7472_7477dupGGGAGC (p.R2491_E2492dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692180" "0" "10" "16" "88782247" "88782247" "subst" "0.00576751" "01804" "PIEZO1_000240" "g.88782247G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7332C>T (p.(Tyr2444=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692181" "0" "30" "16" "88782644" "88782644" "subst" "0" "01943" "PIEZO1_000064" "g.88782644T>C" "" "" "" "PIEZO1(NM_001142864.2):c.7091A>G (p.(Asn2364Ser)), PIEZO1(NM_001142864.4):c.7091A>G (p.N2364S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692182" "0" "10" "16" "88782855" "88782855" "subst" "0.00653701" "02330" "PIEZO1_000241" "g.88782855G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6963C>T (p.(Asn2321=)), PIEZO1(NM_001142864.4):c.6963C>T (p.N2321=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692183" "0" "10" "16" "88783289" "88783289" "subst" "0.025075" "02330" "PIEZO1_000014" "g.88783289G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6678C>T (p.(Ser2226=)), PIEZO1(NM_001142864.4):c.6678C>T (p.S2226=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692184" "0" "10" "16" "88783289" "88783289" "subst" "0.025075" "01804" "PIEZO1_000014" "g.88783289G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6678C>T (p.(Ser2226=)), PIEZO1(NM_001142864.4):c.6678C>T (p.S2226=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692185" "0" "10" "16" "88783440" "88783440" "subst" "0.00587022" "02330" "PIEZO1_000242" "g.88783440G>T" "" "" "" "PIEZO1(NM_001142864.2):c.6651C>A (p.(Gly2217=)), PIEZO1(NM_001142864.4):c.6651C>A (p.G2217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692186" "0" "10" "16" "88786063" "88786063" "subst" "0.0284249" "02330" "PIEZO1_000187" "g.88786063C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6390G>A (p.(Thr2130=)), PIEZO1(NM_001142864.4):c.6390G>A (p.T2130=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692187" "0" "30" "16" "88786911" "88786911" "subst" "2.65421E-5" "01943" "PIEZO1_000243" "g.88786911C>T" "" "" "" "PIEZO1(NM_001142864.4):c.5831G>A (p.R1944H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692188" "0" "50" "16" "88788037" "88788037" "subst" "0.000452977" "02325" "PIEZO1_000244" "g.88788037G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5312C>T (p.P1771L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692189" "0" "30" "16" "88788069" "88788069" "subst" "6.74573E-6" "02330" "PIEZO1_000245" "g.88788069C>A" "" "" "" "PIEZO1(NM_001142864.4):c.5280G>T (p.L1760=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692190" "0" "30" "16" "88788461" "88788461" "subst" "0.000146818" "02326" "PIEZO1_000091" "g.88788461G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4969C>T (p.(Pro1657Ser)), PIEZO1(NM_001142864.4):c.4969C>T (p.P1657S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692191" "0" "50" "16" "88789313" "88789313" "subst" "8.91156E-5" "01943" "PIEZO1_000246" "g.88789313G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4600C>T (p.R1534W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692192" "0" "30" "16" "88793186" "88793186" "subst" "0.00056072" "01943" "PIEZO1_000247" "g.88793186G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3636C>T (p.L1212=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692193" "0" "50" "16" "88799018" "88799018" "subst" "0" "01943" "PIEZO1_000248" "g.88799018G>C" "" "" "" "PIEZO1(NM_001142864.4):c.2787C>G (p.I929M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692194" "0" "30" "16" "88802618" "88802618" "subst" "0.000676544" "02326" "PIEZO1_000155" "g.88802618C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1495G>A (p.(Val499Ile)), PIEZO1(NM_001142864.4):c.1495G>A (p.V499I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692195" "0" "10" "16" "88803164" "88803164" "subst" "0.023675" "02330" "PIEZO1_000249" "g.88803164C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1196-17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692196" "0" "30" "16" "88803974" "88803974" "subst" "7.5057E-6" "01943" "PIEZO1_000250" "g.88803974C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1188G>A (p.R396=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692197" "0" "10" "16" "88804349" "88804349" "subst" "0.039529" "02330" "PIEZO1_000165" "g.88804349G>T" "" "" "" "LOC100289580(NR_103774.1):n.390G>T (-), PIEZO1(NM_001142864.4):c.1013C>A (p.S338Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726031" "0" "30" "16" "88782205" "88782205" "subst" "0.00107996" "02326" "PIEZO1_000003" "g.88782205G>C" "" "" "" "PIEZO1(NM_001142864.4):c.7374C>G (p.F2458L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726032" "0" "90" "16" "88782212" "88782212" "subst" "0" "02326" "PIEZO1_000251" "g.88782212C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7367G>A (p.R2456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726033" "0" "10" "16" "88782855" "88782855" "subst" "0.00653701" "01804" "PIEZO1_000241" "g.88782855G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6963C>T (p.(Asn2321=)), PIEZO1(NM_001142864.4):c.6963C>T (p.N2321=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726034" "0" "30" "16" "88783071" "88783071" "subst" "0.00168542" "02326" "PIEZO1_000252" "g.88783071G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6822C>T (p.S2274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726035" "0" "30" "16" "88783112" "88783112" "subst" "0.000475666" "01943" "PIEZO1_000231" "g.88783112T>C" "" "" "" "PIEZO1(NM_001142864.2):c.6781A>G (p.(Ser2261Gly)), PIEZO1(NM_001142864.4):c.6781A>G (p.S2261G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726036" "0" "10" "16" "88783440" "88783440" "subst" "0.00587022" "01804" "PIEZO1_000242" "g.88783440G>T" "" "" "" "PIEZO1(NM_001142864.2):c.6651C>A (p.(Gly2217=)), PIEZO1(NM_001142864.4):c.6651C>A (p.G2217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726037" "0" "30" "16" "88787136" "88787136" "subst" "0" "01943" "PIEZO1_000253" "g.88787136C>G" "" "" "" "PIEZO1(NM_001142864.4):c.5689G>C (p.E1897Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726038" "0" "30" "16" "88787761" "88787761" "subst" "8.71057E-5" "01943" "PIEZO1_000254" "g.88787761G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5481C>T (p.A1827=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726039" "0" "50" "16" "88791455" "88791455" "subst" "3.04637E-5" "01943" "PIEZO1_000255" "g.88791455C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4196G>A (p.R1399Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726040" "0" "50" "16" "88791467" "88791467" "subst" "0" "02325" "PIEZO1_000256" "g.88791467G>T" "" "" "" "PIEZO1(NM_001142864.4):c.4184C>A (p.S1395Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726041" "0" "30" "16" "88798919" "88798919" "subst" "0.00107697" "02326" "PIEZO1_000010" "g.88798919G>T" "" "" "" "PIEZO1(NM_001142864.4):c.2815C>A (p.L939M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726042" "0" "30" "16" "88800956" "88800956" "subst" "0.000378241" "01943" "PIEZO1_000257" "g.88800956G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1998-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726043" "0" "50" "16" "88803066" "88803066" "subst" "7.47272E-6" "01943" "PIEZO1_000258" "g.88803066C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1277G>A (p.C426Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726044" "0" "90" "16" "88808480" "88808480" "subst" "0" "02329" "PIEZO1_000038" "g.88808480G>A" "" "" "" "PIEZO1(NM_001142864.4):c.307C>T (p.R103*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807670" "0" "90" "16" "88782212" "88782212" "subst" "0" "02327" "PIEZO1_000251" "g.88782212C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7367G>A (p.R2456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807671" "0" "30" "16" "88782477" "88782477" "subst" "0.00109643" "01943" "PIEZO1_000259" "g.88782477C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7180G>A (p.(Gly2394Ser)), PIEZO1(NM_001142864.4):c.7180G>A (p.G2394S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807672" "0" "10" "16" "88783002" "88783002" "subst" "0.00238128" "02330" "PIEZO1_000067" "g.88783002G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6891C>T (p.A2297=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807673" "0" "50" "16" "88783601" "88783601" "subst" "0.000332947" "01943" "PIEZO1_000260" "g.88783601C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6490G>A (p.G2164R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807674" "0" "50" "16" "88786328" "88786328" "subst" "0.00106291" "02325" "PIEZO1_000073" "g.88786328C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6205G>A (p.V2069M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807675" "0" "30" "16" "88786467" "88786467" "subst" "0.00118278" "01943" "PIEZO1_000261" "g.88786467G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6164+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807676" "0" "30" "16" "88786877" "88786877" "subst" "0.000569054" "01943" "PIEZO1_000262" "g.88786877G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5865C>T (p.R1955=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807677" "0" "50" "16" "88786879" "88786879" "subst" "0.000277936" "01943" "PIEZO1_000263" "g.88786879G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5863C>T (p.R1955C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807678" "0" "50" "16" "88787024" "88787024" "subst" "0.000153971" "02325" "PIEZO1_000016" "g.88787024A>T" "" "" "" "PIEZO1(NM_001142864.4):c.5801T>A (p.L1934Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807679" "0" "10" "16" "88787690" "88787690" "subst" "0.00168409" "02330" "PIEZO1_000264" "g.88787690G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5552C>T (p.T1851M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807680" "0" "30" "16" "88788008" "88788008" "subst" "1.99103E-5" "01943" "PIEZO1_000265" "g.88788008C>A" "" "" "" "PIEZO1(NM_001142864.4):c.5341G>T (p.G1781C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807681" "0" "70" "16" "88788060" "88788060" "subst" "6.71465E-5" "02330" "PIEZO1_000266" "g.88788060G>C" "" "" "" "PIEZO1(NM_001142864.4):c.5289C>G (p.Y1763*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000807682" "0" "50" "16" "88788216" "88788216" "subst" "0" "02330" "PIEZO1_000267" "g.88788216C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5214G>A (p.(Glu1738Glu)), PIEZO1(NM_001142864.4):c.5214G>A (p.E1738=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807683" "0" "30" "16" "88788282" "88788282" "subst" "0.000845954" "01943" "PIEZO1_000268" "g.88788282C>A" "" "" "" "PIEZO1(NM_001142864.4):c.5148G>T (p.L1716=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807684" "0" "10" "16" "88788709" "88788709" "subst" "0.00399808" "02330" "PIEZO1_000269" "g.88788709T>C" "" "" "" "PIEZO1(NM_001142864.4):c.4872A>G (p.A1624=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807685" "0" "30" "16" "88789012" "88789012" "subst" "0.00356978" "01804" "PIEZO1_000270" "g.88789012T>C" "" "" "" "PIEZO1(NM_001142864.2):c.4754A>G (p.(Asn1585Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807686" "0" "30" "16" "88789333" "88789333" "subst" "0.00226583" "01943" "PIEZO1_000193" "g.88789333C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4580G>A (p.(Arg1527His)), PIEZO1(NM_001142864.4):c.4580G>A (p.R1527H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807687" "0" "10" "16" "88789574" "88789574" "subst" "0.00349922" "02330" "PIEZO1_000271" "g.88789574C>A" "" "" "" "PIEZO1(NM_001142864.4):c.4439-15G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807688" "0" "30" "16" "88789722" "88789722" "subst" "1.47647E-5" "01943" "PIEZO1_000272" "g.88789722T>C" "" "" "" "PIEZO1(NM_001142864.4):c.4350A>G (p.A1450=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807689" "0" "50" "16" "88790362" "88790362" "subst" "0.000358909" "02325" "PIEZO1_000273" "g.88790362A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4252T>C (p.(Tyr1418His), p.Y1418H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807690" "0" "10" "16" "88798181" "88798181" "subst" "0.00482822" "02330" "PIEZO1_000274" "g.88798181G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3129C>T (p.L1043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807691" "0" "10" "16" "88800169" "88800169" "subst" "0.00345036" "02330" "PIEZO1_000275" "g.88800169G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2330-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807692" "0" "10" "16" "88800395" "88800395" "subst" "0" "02330" "PIEZO1_000276" "g.88800395C>G" "" "" "" "PIEZO1(NM_001142864.4):c.2248G>C (p.E750Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000807693" "0" "30" "16" "88800398" "88800398" "subst" "0" "01943" "PIEZO1_000277" "g.88800398G>C" "" "" "" "PIEZO1(NM_001142864.4):c.2245C>G (p.Q749E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807694" "0" "30" "16" "88804039" "88804039" "subst" "7.32182E-6" "01943" "PIEZO1_000278" "g.88804039C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1123G>A (p.A375T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807695" "0" "30" "16" "88804408" "88804408" "subst" "0.000273479" "01943" "PIEZO1_000210" "g.88804408G>A" "" "" "" "PIEZO1(NM_001142864.2):c.954C>T (p.(=)), PIEZO1(NM_001142864.4):c.954C>T (p.V318=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000826640" "0" "30" "16" "88787976" "88787976" "subst" "0" "00006" "PIEZO1_000279" "g.88787976C>A" "" "{PMID:Milev 2018:30120216}" "" "G5373T" "" "De novo" "" "" "0" "" "" "" "" "likely benign" "" "0000826643" "3" "30" "16" "88793220" "88793220" "subst" "0.000794303" "00006" "PIEZO1_000280" "g.88793220G>A" "" "{PMID:Al-Deri 2021:32843486}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000826731" "3" "30" "16" "88793220" "88793220" "subst" "0.000794303" "00006" "PIEZO1_000280" "g.88793220G>A" "" "{PMID:Al-Deri 2021:32843486}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000826734" "3" "30" "16" "88793220" "88793220" "subst" "0.000794303" "00006" "PIEZO1_000280" "g.88793220G>A" "" "{PMID:Al-Deri 2021:32843486}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000854696" "0" "30" "16" "88779260" "88779260" "subst" "0.00016621" "01943" "PIEZO1_000283" "g.88779260G>C" "" "" "" "CTU2(NM_001318507.1):c.897G>C (p.L299=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854697" "0" "30" "16" "88781638" "88781638" "subst" "8.5924E-5" "01943" "PIEZO1_000284" "g.88781638C>T" "" "" "" "CTU2(NM_001318507.1):c.1740C>T (p.D580=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854698" "0" "10" "16" "88788235" "88788235" "subst" "0.011208" "02326" "PIEZO1_000018" "g.88788235G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5195C>T (p.(Thr1732Met)), PIEZO1(NM_001142864.4):c.5195C>T (p.T1732M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000854699" "0" "30" "16" "88789491" "88789495" "dup" "0" "02326" "PIEZO1_000194" "g.88789491_88789495dup" "" "" "" "PIEZO1(NM_001142864.4):c.4495+10_4495+14dupCCCGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854700" "0" "30" "16" "88789709" "88789709" "subst" "0.00168409" "01943" "PIEZO1_000289" "g.88789709C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4363G>A (p.A1455T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854701" "0" "50" "16" "88798129" "88798129" "subst" "0.000146714" "02325" "PIEZO1_000292" "g.88798129G>C" "" "" "" "PIEZO1(NM_001142864.4):c.3181C>G (p.P1061A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854702" "0" "30" "16" "88800060" "88800060" "subst" "0.0038099" "02326" "PIEZO1_000133" "g.88800060C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2423G>A (p.(Arg808Gln)), PIEZO1(NM_001142864.4):c.2423G>A (p.R808Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854703" "0" "30" "16" "88800139" "88800139" "subst" "0.00380375" "02326" "PIEZO1_000134" "g.88800139C>T" "" "" "" "PIEZO1(NM_001142864.2):c.2344G>A (p.(Gly782Ser)), PIEZO1(NM_001142864.4):c.2344G>A (p.G782S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854704" "0" "50" "16" "88802579" "88802579" "subst" "7.69446E-5" "02325" "PIEZO1_000296" "g.88802579G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1534C>T (p.(Pro512Ser), p.P512S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854705" "0" "30" "16" "88808701" "88808701" "subst" "3.01341E-5" "01943" "PIEZO1_000300" "g.88808701G>A" "" "" "" "PIEZO1(NM_001142864.4):c.283+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864975" "0" "50" "16" "88776362" "88776362" "subst" "0" "01943" "PIEZO1_000281" "g.88776362T>G" "" "" "" "CTU2(NM_001318507.1):c.160T>G (p.F54V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864976" "0" "50" "16" "88776363" "88776363" "subst" "0" "01943" "PIEZO1_000282" "g.88776363T>C" "" "" "" "CTU2(NM_001318507.1):c.161T>C (p.F54S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864977" "0" "50" "16" "88782103" "88782108" "dup" "0" "02325" "PIEZO1_000239" "g.88782103_88782108dup" "" "" "" "PIEZO1(NM_001142864.4):c.7472_7477dup (p.(Arg2491_Glu2492dup)), PIEZO1(NM_001142864.4):c.7472_7477dupGGGAGC (p.R2491_E2492dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864978" "0" "30" "16" "88783097" "88783097" "subst" "0.000196522" "01943" "PIEZO1_000285" "g.88783097C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6796G>A (p.V2266I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864979" "0" "10" "16" "88786314" "88786314" "subst" "0.00645009" "01804" "PIEZO1_000286" "g.88786314G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6219C>T (p.(Tyr2073=)), PIEZO1(NM_001142864.4):c.6219C>T (p.Y2073=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000864980" "0" "50" "16" "88786375" "88786375" "subst" "0.000492917" "01943" "PIEZO1_000287" "g.88786375C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6165-7G>A (p.?), PIEZO1(NM_001142864.4):c.6165-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864981" "0" "30" "16" "88787097" "88787097" "subst" "0.00198567" "02326" "PIEZO1_000017" "g.88787097C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5728G>A (p.(Glu1910Lys)), PIEZO1(NM_001142864.4):c.5728G>A (p.E1910K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864982" "0" "30" "16" "88787652" "88787652" "subst" "0.000184646" "01943" "PIEZO1_000288" "g.88787652G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5590C>T (p.R1864C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864983" "0" "30" "16" "88788291" "88788291" "subst" "0.00210347" "02326" "PIEZO1_000019" "g.88788291G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5139C>T (p.L1713=, p.(Leu1713=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864984" "0" "30" "16" "88792104" "88792104" "subst" "0.00243662" "02326" "PIEZO1_000290" "g.88792104C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3969-12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864985" "0" "50" "16" "88793562" "88793562" "subst" "0.000462631" "01943" "PIEZO1_000291" "g.88793562G>C" "" "" "" "PIEZO1(NM_001142864.4):c.3340C>G (p.Q1114E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864986" "0" "50" "16" "88798865" "88798865" "subst" "0" "01943" "PIEZO1_000293" "g.88798865G>T" "" "" "" "PIEZO1(NM_001142864.4):c.2869C>A (p.Q957K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864987" "0" "50" "16" "88800392" "88800397" "dup" "0" "01943" "PIEZO1_000294" "g.88800392_88800397dup" "" "" "" "PIEZO1(NM_001142864.4):c.2265_2270dupGGAGGA (p.E755_E756dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864988" "0" "30" "16" "88801452" "88801452" "subst" "9.98296E-5" "01943" "PIEZO1_000295" "g.88801452C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1679G>A (p.R560Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864989" "0" "50" "16" "88802579" "88802579" "subst" "5.59597E-5" "02325" "PIEZO1_000297" "g.88802579G>T" "" "" "" "PIEZO1(NM_001142864.4):c.1534C>A (p.P512T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864990" "0" "10" "16" "88802748" "88802748" "subst" "0.019632" "01804" "PIEZO1_000208" "g.88802748C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1365G>A (p.(Thr455=)), PIEZO1(NM_001142864.4):c.1365G>A (p.T455=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000864991" "0" "50" "16" "88804726" "88804726" "subst" "0.000313727" "01943" "PIEZO1_000237" "g.88804726C>T" "" "" "" "PIEZO1(NM_001142864.2):c.757G>A (p.(Gly253Arg)), PIEZO1(NM_001142864.4):c.757G>A (p.G253R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864992" "0" "30" "16" "88805009" "88805009" "subst" "3.74717E-5" "01943" "PIEZO1_000298" "g.88805009G>T" "" "" "" "PIEZO1(NM_001142864.4):c.601C>A (p.R201=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864993" "0" "30" "16" "88807988" "88807988" "subst" "0" "01943" "PIEZO1_000299" "g.88807988C>G" "" "" "" "PIEZO1(NM_001142864.4):c.363G>C (p.L121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864994" "0" "30" "16" "88851292" "88851292" "subst" "0.00160868" "02326" "PIEZO1_000301" "g.88851292G>A" "" "" "" "PIEZO1(NM_001142864.4):c.64+17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000872159" "0" "50" "16" "88783081" "88783081" "subst" "0" "03779" "PIEZO1_000302" "g.88783081T>C" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000872160" "0" "30" "16" "88801125" "88801125" "subst" "2.65979E-5" "03779" "PIEZO1_000304" "g.88801125C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs1314158150" "0" "" "" "" "" "likely benign" "" "0000872161" "0" "50" "16" "88787575" "88787575" "subst" "2.54729E-5" "03779" "PIEZO1_000303" "g.88787575G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs764786894" "0" "" "" "" "" "VUS" "" "0000873888" "0" "50" "16" "88783595" "88783597" "del" "0" "03779" "PIEZO1_000305" "g.88783595_88783597del" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000873890" "0" "50" "16" "88783595" "88783597" "del" "0" "03779" "PIEZO1_000305" "g.88783595_88783597del" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000874458" "0" "50" "16" "88804168" "88804168" "subst" "7.17257E-6" "03779" "PIEZO1_000307" "g.88804168C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs759245322" "0" "" "" "" "" "VUS" "" "0000874760" "0" "50" "16" "88798827" "88798827" "subst" "1.34869E-5" "03779" "PIEZO1_000306" "g.88798827G>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs754595848" "0" "" "" "" "" "VUS" "" "0000877200" "0" "50" "16" "88799061" "88799061" "subst" "0.000149572" "03779" "PIEZO1_000308" "g.88799061T>C" "" "" "" "" "" "CLASSIFICATION record" "" "rs543115615" "0" "" "" "" "" "VUS" "" "0000877506" "0" "50" "16" "88793220" "88793220" "subst" "0.000794303" "03779" "PIEZO1_000280" "g.88793220G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs372935580" "0" "" "" "" "" "VUS" "" "0000879146" "0" "50" "16" "88782193" "88782193" "subst" "0" "03779" "PIEZO1_000309" "g.88782193G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000893218" "0" "90" "16" "88782101" "88782106" "dup" "0" "02326" "PIEZO1_000310" "g.88782101_88782106dup" "" "" "" "PIEZO1(NM_001142864.4):c.7483_7488dupCTGGAG (p.L2495_E2496dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893219" "0" "30" "16" "88790234" "88790262" "dup" "0" "02330" "PIEZO1_000311" "g.88790234_88790262dup" "" "" "" "PIEZO1(NM_001142864.4):c.4335+17_4335+45dupCCGTCGGCCCCACTCCAACCACAGAGCTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893220" "0" "50" "16" "88792738" "88792738" "subst" "0.000194573" "02325" "PIEZO1_000312" "g.88792738G>C" "" "" "" "PIEZO1(NM_001142864.4):c.3922C>G (p.L1308V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893221" "0" "50" "16" "88798218" "88798218" "subst" "6.72314E-5" "02325" "PIEZO1_000313" "g.88798218C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3092G>A (p.R1031H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893222" "0" "50" "16" "88798310" "88798310" "subst" "0.000287545" "02325" "PIEZO1_000314" "g.88798310G>T" "" "" "" "PIEZO1(NM_001142864.2):c.3000C>A (p.(Phe1000Leu)), PIEZO1(NM_001142864.4):c.3000C>A (p.F1000L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893223" "0" "30" "16" "88799116" "88799116" "subst" "0.00480351" "02326" "PIEZO1_000315" "g.88799116G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2689C>T (p.L897=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893224" "0" "50" "16" "88803111" "88803111" "subst" "0.000254073" "02325" "PIEZO1_000316" "g.88803111G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1232C>T (p.P411L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893225" "0" "30" "16" "88815904" "88815904" "subst" "0.00225429" "02326" "PIEZO1_000317" "g.88815904G>C" "" "" "" "PIEZO1(NM_001142864.4):c.65-17C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000899340" "0" "50" "16" "88799777" "88799777" "subst" "0" "03779" "PIEZO1_000318" "g.88799777G>C" "" "" "" "" "" "Unknown" "" "rs1425974957" "0" "" "" "" "" "VUS" "" "0000914707" "0" "50" "16" "88782116" "88782116" "subst" "0" "02325" "PIEZO1_000319" "g.88782116C>G" "" "" "" "PIEZO1(NM_001142864.4):c.7463G>C (p.R2488P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914708" "0" "50" "16" "88782507" "88782507" "subst" "3.38359E-5" "02325" "PIEZO1_000320" "g.88782507C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7150G>A (p.G2384S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914709" "0" "30" "16" "88789333" "88789333" "subst" "0.00226583" "02326" "PIEZO1_000193" "g.88789333C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4580G>A (p.(Arg1527His)), PIEZO1(NM_001142864.4):c.4580G>A (p.R1527H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914710" "0" "50" "16" "88801317" "88801317" "subst" "0" "02327" "PIEZO1_000321" "g.88801317A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000920366" "1" "70" "16" "88799740" "88799740" "subst" "0" "00006" "PIEZO1_000322" "g.88799740C>T" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "main disease-related variant" "De novo" "" "" "0" "" "" "g.88733332C>T" "" "likely pathogenic" "ACMG" "0000926364" "0" "30" "16" "88782108" "88782108" "subst" "0.000291348" "02326" "PIEZO1_000323" "g.88782108G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7471C>T (p.R2491W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926365" "0" "30" "16" "88782477" "88782477" "subst" "0.00109643" "02326" "PIEZO1_000259" "g.88782477C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7180G>A (p.(Gly2394Ser)), PIEZO1(NM_001142864.4):c.7180G>A (p.G2394S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926366" "0" "30" "16" "88783418" "88783418" "subst" "0.00540885" "02326" "PIEZO1_000324" "g.88783418C>A" "" "" "" "PIEZO1(NM_001142864.4):c.6660+13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926367" "0" "30" "16" "88804353" "88804353" "subst" "0.000415527" "02326" "PIEZO1_000166" "g.88804353G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1009C>T (p.(Pro337Ser)), PIEZO1(NM_001142864.4):c.1009C>T (p.P337S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927789" "0" "30" "16" "88788996" "88788996" "subst" "0.00123188" "03779" "PIEZO1_000217" "g.88788996C>T" "" "" "" "" "" "Unknown" "" "rs183221795" "0" "" "" "" "" "likely benign" "" "0000927815" "0" "30" "16" "88782247" "88782247" "subst" "0.00576751" "03779" "PIEZO1_000240" "g.88782247G>A" "" "" "" "" "" "Unknown" "" "rs140778010" "0" "" "" "" "" "likely benign" "" "0000932974" "0" "70" "16" "88786583" "88786583" "subst" "0" "03779" "PIEZO1_000325" "g.88786583C>T" "" "" "" "" "" "Unknown" "" "rs587776989" "0" "" "" "" "" "likely pathogenic" "" "0000950751" "0" "30" "16" "88782505" "88782505" "subst" "0.00253547" "02326" "PIEZO1_000183" "g.88782505G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7152C>T (p.G2384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950752" "0" "30" "16" "88786314" "88786314" "subst" "0.00645009" "02330" "PIEZO1_000286" "g.88786314G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6219C>T (p.(Tyr2073=)), PIEZO1(NM_001142864.4):c.6219C>T (p.Y2073=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950753" "0" "10" "16" "88788060" "88788060" "subst" "0.026214" "02330" "PIEZO1_000191" "g.88788060G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5289C>T (p.(Tyr1763=)), PIEZO1(NM_001142864.4):c.5289C>T (p.Y1763=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000950754" "0" "50" "16" "88788296" "88788296" "subst" "2.72053E-5" "02325" "PIEZO1_000326" "g.88788296C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5134G>A (p.(Val1712Met)), PIEZO1(NM_001142864.4):c.5134G>A (p.V1712M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950755" "0" "30" "16" "88788618" "88788618" "subst" "0.000226635" "02326" "PIEZO1_000022" "g.88788618G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4955+8C>T (p.(=)), PIEZO1(NM_001142864.4):c.4955+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950756" "0" "30" "16" "88788996" "88788996" "subst" "0.00123188" "02326" "PIEZO1_000217" "g.88788996C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4770G>A (p.V1590=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950757" "0" "50" "16" "88789334" "88789334" "subst" "7.54779E-5" "02325" "PIEZO1_000327" "g.88789334G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4579C>T (p.R1527C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950758" "0" "50" "16" "88793220" "88793220" "subst" "0.000794303" "02325" "PIEZO1_000280" "g.88793220G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3602C>T (p.T1201M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950759" "0" "50" "16" "88793452" "88793452" "subst" "0" "02325" "PIEZO1_000328" "g.88793452G>T" "" "" "" "PIEZO1(NM_001142864.4):c.3450C>A (p.H1150Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950760" "0" "30" "16" "88800169" "88800169" "subst" "0.00345036" "02326" "PIEZO1_000275" "g.88800169G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2330-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950761" "0" "50" "16" "88800395" "88800400" "del" "0" "02325" "PIEZO1_000233" "g.88800395_88800400del" "" "" "" "PIEZO1(NM_001142864.2):c.2245_2250del (p.(Gln749_Glu750del)), PIEZO1(NM_001142864.4):c.2245_2250delCAGGAG (p.Q749_E750del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950762" "0" "50" "16" "88807975" "88807975" "subst" "0.000233676" "02325" "PIEZO1_000329" "g.88807975G>C" "" "" "" "PIEZO1(NM_001142864.4):c.376C>G (p.L126V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000959785" "0" "30" "16" "88804353" "88804353" "subst" "0.000415527" "03779" "PIEZO1_000166" "g.88804353G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs556220156" "0" "" "" "" "" "likely benign" "" "0000959834" "0" "50" "16" "88792084" "88792084" "subst" "0" "03779" "PIEZO1_000330" "g.88792084G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1904372282" "0" "" "" "" "" "VUS" "" "0000968568" "0" "30" "16" "88781272" "88781272" "subst" "0.0012289" "02326" "PIEZO1_000331" "g.88781272G>A" "" "" "" "CTU2(NM_001012759.3):c.1357G>A (p.D453N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968570" "0" "30" "16" "88782049" "88782049" "subst" "0.00178108" "02326" "PIEZO1_000054" "g.88782049C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7530G>A (p.P2510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968571" "0" "70" "16" "88782256" "88782256" "del" "0" "02329" "PIEZO1_000333" "g.88782256del" "" "" "" "PIEZO1(NM_001142864.4):c.7326delG (p.L2443Cfs*71)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000968572" "0" "30" "16" "88782418" "88782418" "subst" "0.000167655" "02326" "PIEZO1_000334" "g.88782418G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7239C>T (p.T2413=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968573" "0" "30" "16" "88782463" "88782463" "subst" "0.0017584" "02326" "PIEZO1_000063" "g.88782463G>A" "" "" "" "PIEZO1(NM_001142864.4):c.7194C>T (p.T2398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968574" "0" "70" "16" "88783118" "88783118" "subst" "0" "02329" "PIEZO1_000335" "g.88783118G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6775C>T (p.Q2259*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000968575" "0" "50" "16" "88786640" "88786640" "subst" "0" "02330" "PIEZO1_000336" "g.88786640G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6001C>T (p.P2001S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968576" "0" "30" "16" "88788045" "88788045" "subst" "0" "02326" "PIEZO1_000337" "g.88788045G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5304C>T (p.Y1768=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968578" "0" "30" "16" "88793063" "88793063" "subst" "0.00204125" "02326" "PIEZO1_000113" "g.88793063C>A" "" "" "" "PIEZO1(NM_001142864.4):c.3700-12G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968580" "0" "30" "16" "88801352" "88801352" "subst" "7.94281E-5" "02326" "PIEZO1_000338" "g.88801352G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1779C>T (p.F593=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968581" "0" "30" "16" "88801408" "88801408" "subst" "0.00113916" "02326" "PIEZO1_000339" "g.88801408C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1723G>A (p.V575M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968584" "0" "30" "16" "88804852" "88804852" "subst" "0.00086245" "02326" "PIEZO1_000340" "g.88804852C>T" "" "" "" "PIEZO1(NM_001142864.4):c.635-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968586" "0" "30" "16" "88808728" "88808728" "subst" "0.00237222" "02326" "PIEZO1_000177" "g.88808728T>C" "" "" "" "PIEZO1(NM_001142864.2):c.263A>G (p.(Asp88Gly)), PIEZO1(NM_001142864.4):c.263A>G (p.D88G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000972107" "0" "30" "16" "88800395" "88800400" "del" "0" "03779" "PIEZO1_000233" "g.88800395_88800400del" "" "" "" "" "" "CLASSIFICATION record" "" "rs144269709" "0" "" "" "" "" "likely benign" "" "0000982151" "0" "30" "16" "88776624" "88776624" "subst" "0.000475401" "01804" "PIEZO1_000341" "g.88776624C>T" "" "" "" "CTU2(NM_001012759.3):c.223-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982152" "0" "50" "16" "88778573" "88778573" "subst" "9.01413E-5" "01804" "PIEZO1_000342" "g.88778573C>T" "" "" "" "CTU2(NM_001318507.2):c.448C>T (p.(Arg150Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982153" "0" "50" "16" "88779746" "88779746" "subst" "0" "01804" "PIEZO1_000343" "g.88779746G>C" "" "" "" "CTU2(NM_001012759.3):c.764G>C (p.(Arg255Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982154" "0" "50" "16" "88782103" "88782108" "dup" "0" "01804" "PIEZO1_000239" "g.88782103_88782108dup" "" "" "" "PIEZO1(NM_001142864.4):c.7472_7477dup (p.(Arg2491_Glu2492dup)), PIEZO1(NM_001142864.4):c.7472_7477dupGGGAGC (p.R2491_E2492dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982155" "0" "10" "16" "88782205" "88782205" "subst" "0.00107996" "02330" "PIEZO1_000003" "g.88782205G>C" "" "" "" "PIEZO1(NM_001142864.4):c.7374C>G (p.F2458L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982156" "0" "30" "16" "88782477" "88782477" "subst" "0.00109643" "01804" "PIEZO1_000259" "g.88782477C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7180G>A (p.(Gly2394Ser)), PIEZO1(NM_001142864.4):c.7180G>A (p.G2394S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982157" "0" "30" "16" "88783310" "88783310" "subst" "0" "02326" "PIEZO1_000344" "g.88783310G>C" "" "" "" "PIEZO1(NM_001142864.4):c.6661-4C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982158" "0" "70" "16" "88786125" "88786125" "subst" "0" "01804" "PIEZO1_000345" "g.88786125G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6328C>T (p.(Arg2110Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000982159" "0" "50" "16" "88787052" "88787052" "subst" "0.000577447" "01804" "PIEZO1_000346" "g.88787052G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5773C>T (p.(Arg1925Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982160" "0" "30" "16" "88788066" "88788066" "subst" "0.000626305" "01804" "PIEZO1_000347" "g.88788066C>T" "" "" "" "PIEZO1(NM_001142864.4):c.5283G>A (p.(Arg1761=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982161" "0" "30" "16" "88788291" "88788291" "subst" "0.00210347" "01804" "PIEZO1_000019" "g.88788291G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5139C>T (p.L1713=, p.(Leu1713=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982162" "0" "30" "16" "88788354" "88788354" "subst" "0.000223006" "02326" "PIEZO1_000348" "g.88788354G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5076C>T (p.Y1692=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982163" "0" "30" "16" "88788617" "88788617" "subst" "0" "01804" "PIEZO1_000349" "g.88788617C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4955+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982164" "0" "30" "16" "88789569" "88789569" "subst" "3.40493E-5" "01804" "PIEZO1_000350" "g.88789569G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4439-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982165" "0" "30" "16" "88790309" "88790309" "subst" "2.67451E-5" "01804" "PIEZO1_000351" "g.88790309G>A" "" "" "" "PIEZO1(NM_001142864.4):c.4305C>T (p.(Asp1435=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982166" "0" "50" "16" "88790362" "88790362" "subst" "0.000358909" "01804" "PIEZO1_000273" "g.88790362A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4252T>C (p.(Tyr1418His), p.Y1418H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982167" "0" "30" "16" "88793117" "88793117" "subst" "0.000557199" "01804" "PIEZO1_000352" "g.88793117G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3699+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982168" "0" "50" "16" "88793369" "88793369" "subst" "0" "01804" "PIEZO1_000353" "g.88793369G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3456-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982169" "0" "30" "16" "88793539" "88793539" "subst" "0.00189745" "01804" "PIEZO1_000354" "g.88793539T>C" "" "" "" "PIEZO1(NM_001142864.4):c.3363A>G (p.(Thr1121=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982170" "0" "50" "16" "88798255" "88798255" "subst" "9.82511E-5" "01804" "PIEZO1_000355" "g.88798255C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3055G>A (p.(Gly1019Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982171" "0" "10" "16" "88798919" "88798919" "subst" "0.00107697" "02330" "PIEZO1_000010" "g.88798919G>T" "" "" "" "PIEZO1(NM_001142864.4):c.2815C>A (p.L939M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982172" "0" "50" "16" "88799047" "88799047" "subst" "2.03395E-5" "01804" "PIEZO1_000356" "g.88799047G>A" "" "" "" "PIEZO1(NM_001142864.4):c.2758C>T (p.(Arg920Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982173" "0" "30" "16" "88800812" "88800812" "subst" "0.000353064" "01804" "PIEZO1_000357" "g.88800812A>T" "" "" "" "PIEZO1(NM_001142864.4):c.2132T>A (p.(Met711Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982174" "0" "50" "16" "88801402" "88801402" "subst" "5.95884E-5" "02325" "PIEZO1_000358" "g.88801402C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1729G>A (p.A577T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982175" "0" "50" "16" "88801621" "88801621" "subst" "0.000423191" "02325" "PIEZO1_000151" "g.88801621G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1591C>T (p.(Arg531Cys)), PIEZO1(NM_001142864.4):c.1591C>T (p.R531C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982176" "0" "50" "16" "88802579" "88802579" "subst" "7.69446E-5" "01804" "PIEZO1_000296" "g.88802579G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1534C>T (p.(Pro512Ser), p.P512S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982177" "0" "50" "16" "88802632" "88802632" "subst" "6.80004E-6" "01804" "PIEZO1_000359" "g.88802632G>T" "" "" "" "PIEZO1(NM_001142864.4):c.1481C>A (p.(Thr494Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982178" "0" "30" "16" "88804648" "88804648" "subst" "0.00147154" "01804" "PIEZO1_000360" "g.88804648C>T" "" "" "" "PIEZO1(NM_001142864.4):c.835G>A (p.(Gly279Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000989148" "0" "50" "16" "88793514" "88793514" "subst" "8.94159E-5" "03779" "PIEZO1_000221" "g.88793514C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs939031047" "0" "" "" "" "" "VUS" "" "0001002671" "0" "30" "16" "88776402" "88776402" "subst" "0.00067825" "01804" "PIEZO1_000361" "g.88776402G>A" "" "" "" "CTU2(NM_001012759.1):c.200G>A (p.(Arg67Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002672" "0" "10" "16" "88782050" "88782050" "subst" "0.00722271" "02330" "PIEZO1_000055" "g.88782050G>A" "" "" "" "PIEZO1(NM_001142864.2):c.7529C>T (p.(Pro2510Leu)), PIEZO1(NM_001142864.4):c.7529C>T (p.P2510L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001002673" "0" "30" "16" "88782198" "88782198" "subst" "0.00132438" "01804" "PIEZO1_000362" "g.88782198C>T" "" "" "" "PIEZO1(NM_001142864.2):c.7381G>A (p.(Glu2461Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002674" "0" "30" "16" "88782778" "88782778" "subst" "0" "01804" "PIEZO1_000363" "g.88782778T>G" "" "" "" "PIEZO1(NM_001142864.2):c.7040A>C (p.(Asp2347Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002675" "0" "30" "16" "88782962" "88782962" "subst" "4.94595E-5" "01804" "PIEZO1_000364" "g.88782962C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6926+5G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002676" "0" "50" "16" "88783075" "88783075" "subst" "0" "01804" "PIEZO1_000230" "g.88783075C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6818G>A (p.(Ser2273Asn)), PIEZO1(NM_001142864.4):c.6818G>A (p.S2273N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002677" "0" "50" "16" "88783116" "88783116" "subst" "0" "01804" "PIEZO1_000365" "g.88783116C>A" "" "" "" "PIEZO1(NM_001142864.2):c.6777G>T (p.(Gln2259His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002678" "0" "30" "16" "88783607" "88783607" "subst" "0" "01804" "PIEZO1_000366" "g.88783607G>C" "" "" "" "PIEZO1(NM_001142864.2):c.6484C>G (p.(Pro2162Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002679" "0" "50" "16" "88783612" "88783612" "subst" "2.68424E-5" "01804" "PIEZO1_000367" "g.88783612G>A" "" "" "" "PIEZO1(NM_001142864.2):c.6479C>T (p.(Pro2160Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002680" "0" "50" "16" "88786301" "88786301" "subst" "6.72558E-6" "01804" "PIEZO1_000368" "g.88786301C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6232G>A (p.(Ala2078Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002681" "0" "30" "16" "88786375" "88786375" "subst" "0.000492917" "01804" "PIEZO1_000287" "g.88786375C>T" "" "" "" "PIEZO1(NM_001142864.2):c.6165-7G>A (p.?), PIEZO1(NM_001142864.4):c.6165-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002682" "0" "30" "16" "88786467" "88786467" "subst" "0.00118278" "02326" "PIEZO1_000261" "g.88786467G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6164+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002683" "0" "30" "16" "88786914" "88786914" "subst" "0.0015807" "01804" "PIEZO1_000369" "g.88786914C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5828G>A (p.(Arg1943Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002684" "0" "30" "16" "88786915" "88786915" "subst" "1.32837E-5" "01804" "PIEZO1_000370" "g.88786915G>A" "" "" "" "PIEZO1(NM_001142864.2):c.5827C>T (p.(Arg1943Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002685" "0" "70" "16" "88787698" "88787710" "del" "0" "01804" "PIEZO1_000371" "g.88787698_88787710del" "" "" "" "PIEZO1(NM_001142864.2):c.5535_5547delAGCCAGGGTCGGA (p.(Glu1845fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002686" "0" "70" "16" "88788216" "88788216" "subst" "0" "01804" "PIEZO1_000267" "g.88788216C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5214G>A (p.(Glu1738Glu)), PIEZO1(NM_001142864.4):c.5214G>A (p.E1738=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002687" "0" "50" "16" "88788296" "88788296" "subst" "2.72053E-5" "01804" "PIEZO1_000326" "g.88788296C>T" "" "" "" "PIEZO1(NM_001142864.2):c.5134G>A (p.(Val1712Met)), PIEZO1(NM_001142864.4):c.5134G>A (p.V1712M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002688" "0" "50" "16" "88788642" "88788642" "subst" "1.38756E-5" "01804" "PIEZO1_000372" "g.88788642C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4939G>A (p.(Glu1647Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002689" "0" "50" "16" "88788700" "88788700" "subst" "2.05336E-5" "01804" "PIEZO1_000373" "g.88788700G>T" "" "" "" "PIEZO1(NM_001142864.2):c.4881C>A (p.(Asp1627Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002690" "0" "30" "16" "88788718" "88788718" "subst" "8.96218E-5" "01804" "PIEZO1_000374" "g.88788718A>C" "" "" "" "PIEZO1(NM_001142864.2):c.4863T>G (p.(Ser1621Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002691" "0" "30" "16" "88788731" "88788731" "subst" "0" "01804" "PIEZO1_000375" "g.88788731G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4850C>T (p.(Thr1617Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002692" "0" "30" "16" "88788998" "88788998" "subst" "0" "01804" "PIEZO1_000376" "g.88788998C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4768G>A (p.(Val1590Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002693" "0" "30" "16" "88789000" "88789000" "subst" "0.000532737" "01804" "PIEZO1_000096" "g.88789000G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4766C>T (p.(Thr1589Ile)), PIEZO1(NM_001142864.4):c.4766C>T (p.T1589I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002694" "0" "50" "16" "88789282" "88789282" "subst" "0" "01804" "PIEZO1_000377" "g.88789282C>G" "" "" "" "PIEZO1(NM_001142864.2):c.4631G>C (p.(Arg1544Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002695" "0" "50" "16" "88789305" "88789305" "subst" "0" "01804" "PIEZO1_000378" "g.88789305G>C" "" "" "" "PIEZO1(NM_001142864.2):c.4608C>G (p.(His1536Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002696" "0" "50" "16" "88789357" "88789357" "subst" "0.000386676" "01804" "PIEZO1_000023" "g.88789357T>G" "" "" "" "PIEZO1(NM_001142864.2):c.4556A>C (p.(Gln1519Pro)), PIEZO1(NM_001142864.4):c.4556A>C (p.Q1519P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002697" "0" "50" "16" "88789652" "88789652" "subst" "0" "01804" "PIEZO1_000379" "g.88789652C>T" "" "" "" "PIEZO1(NM_001142864.2):c.4420G>A (p.(Ala1474Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002698" "0" "30" "16" "88789702" "88789702" "subst" "0.000160186" "01804" "PIEZO1_000380" "g.88789702G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4370C>T (p.(Ala1457Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002699" "0" "30" "16" "88791456" "88791456" "subst" "0" "01804" "PIEZO1_000381" "g.88791456G>A" "" "" "" "PIEZO1(NM_001142864.2):c.4195C>T (p.(Arg1399Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002700" "0" "30" "16" "88792742" "88792742" "subst" "4.69471E-5" "02326" "PIEZO1_000382" "g.88792742G>A" "" "" "" "PIEZO1(NM_001142864.4):c.3918C>T (p.Y1306=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002701" "0" "50" "16" "88793320" "88793320" "subst" "5.30941E-5" "01804" "PIEZO1_000383" "g.88793320A>C" "" "" "" "PIEZO1(NM_001142864.2):c.3502T>G (p.(Trp1168Gly)), PIEZO1(NM_001142864.4):c.3502T>G (p.W1168G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002702" "0" "30" "16" "88793468" "88793468" "subst" "0.000407371" "01804" "PIEZO1_000384" "g.88793468A>G" "" "" "" "PIEZO1(NM_001142864.2):c.3434T>C (p.(Val1145Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002703" "0" "50" "16" "88793540" "88793540" "subst" "0" "01804" "PIEZO1_000385" "g.88793540G>A" "" "" "" "PIEZO1(NM_001142864.2):c.3362C>T (p.(Thr1121Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002704" "0" "30" "16" "88793988" "88793988" "subst" "0" "01804" "PIEZO1_000386" "g.88793988G>A" "" "" "" "PIEZO1(NM_001142864.2):c.3278C>T (p.(Ala1093Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002705" "0" "30" "16" "88798310" "88798310" "subst" "0.000287545" "01804" "PIEZO1_000314" "g.88798310G>T" "" "" "" "PIEZO1(NM_001142864.2):c.3000C>A (p.(Phe1000Leu)), PIEZO1(NM_001142864.4):c.3000C>A (p.F1000L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002706" "0" "70" "16" "88798768" "88798770" "del" "0" "01804" "PIEZO1_000387" "g.88798768_88798770del" "" "" "" "PIEZO1(NM_001142864.2):c.2972_2974delTCT (p.(Phe991del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002707" "0" "50" "16" "88798802" "88798802" "subst" "0.000153205" "01804" "PIEZO1_000388" "g.88798802C>G" "" "" "" "PIEZO1(NM_001142864.2):c.2932G>C (p.(Asp978His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002708" "0" "30" "16" "88799150" "88799150" "subst" "7.47362E-6" "02326" "PIEZO1_000389" "g.88799150G>C" "" "" "" "PIEZO1(NM_001142864.4):c.2665-10C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002709" "0" "50" "16" "88799767" "88799767" "subst" "1.98799E-5" "01804" "PIEZO1_000390" "g.88799767C>A" "" "" "" "PIEZO1(NM_001142864.2):c.2583G>T (p.(Trp861Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002710" "0" "50" "16" "88799805" "88799805" "subst" "6.64266E-6" "01804" "PIEZO1_000391" "g.88799805G>A" "" "" "" "PIEZO1(NM_001142864.2):c.2545C>T (p.(Arg849Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002711" "0" "50" "16" "88800777" "88800777" "subst" "0.000166151" "01804" "PIEZO1_000031" "g.88800777G>A" "" "" "" "PIEZO1(NM_001142864.2):c.2167C>T (p.(Arg723Cys)), PIEZO1(NM_001142864.4):c.2167C>T (p.R723C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002712" "0" "30" "16" "88801125" "88801125" "subst" "2.65979E-5" "01804" "PIEZO1_000304" "g.88801125C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1930G>A (p.(Val644Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002713" "0" "30" "16" "88801177" "88801177" "subst" "0" "02326" "PIEZO1_000392" "g.88801177G>C" "" "" "" "PIEZO1(NM_001142864.4):c.1878C>G (p.L626=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002714" "0" "50" "16" "88801396" "88801396" "subst" "0" "01804" "PIEZO1_000393" "g.88801396A>G" "" "" "" "PIEZO1(NM_001142864.2):c.1735T>C (p.(Tyr579His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002715" "0" "30" "16" "88801555" "88801555" "subst" "5.97983E-5" "01804" "PIEZO1_000394" "g.88801555C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1657G>A (p.(Val553Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002716" "0" "30" "16" "88801571" "88801571" "subst" "0.000106105" "02326" "PIEZO1_000395" "g.88801571C>T" "" "" "" "PIEZO1(NM_001142864.4):c.1641G>A (p.A547=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002717" "0" "50" "16" "88802740" "88802740" "subst" "1.34398E-5" "01804" "PIEZO1_000396" "g.88802740C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1373G>A (p.(Ser458Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002718" "0" "30" "16" "88803144" "88803144" "subst" "0.00132185" "01804" "PIEZO1_000397" "g.88803144C>T" "" "" "" "PIEZO1(NM_001142864.2):c.1199G>A (p.(Arg400Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002719" "0" "50" "16" "88803999" "88803999" "subst" "2.22114E-5" "01804" "PIEZO1_000398" "g.88803999A>G" "" "" "" "PIEZO1(NM_001142864.2):c.1163T>C (p.(Leu388Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002720" "0" "30" "16" "88804030" "88804030" "subst" "0" "01804" "PIEZO1_000399" "g.88804030T>C" "" "" "" "PIEZO1(NM_001142864.2):c.1132A>G (p.(Thr378Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002721" "0" "30" "16" "88804194" "88804194" "subst" "1.43451E-5" "01804" "PIEZO1_000400" "g.88804194G>A" "" "" "" "PIEZO1(NM_001142864.2):c.1049C>T (p.(Ala350Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002722" "0" "30" "16" "88804443" "88804443" "subst" "0.000300459" "01804" "PIEZO1_000401" "g.88804443C>T" "" "" "" "PIEZO1(NM_001142864.2):c.919G>A (p.(Gly307Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002723" "0" "50" "16" "88805002" "88805002" "subst" "3.74543E-5" "01804" "PIEZO1_000402" "g.88805002A>G" "" "" "" "PIEZO1(NM_001142864.2):c.608T>C (p.(Leu203Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002724" "0" "50" "16" "88805016" "88805025" "del" "0" "01804" "PIEZO1_000403" "g.88805016_88805025del" "" "" "" "PIEZO1(NM_001142864.2):c.590_599delTGGCGGCTGG (p.(Val197fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015441" "0" "50" "16" "88782205" "88782205" "subst" "0.00107996" "02325" "PIEZO1_000003" "g.88782205G>C" "" "" "" "PIEZO1(NM_001142864.4):c.7374C>G (p.F2458L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015442" "0" "30" "16" "88782891" "88782891" "subst" "0.00023638" "02326" "PIEZO1_000404" "g.88782891C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6927G>A (p.R2309=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015443" "0" "50" "16" "88786678" "88786678" "subst" "0.000304813" "02325" "PIEZO1_000405" "g.88786678G>A" "" "" "" "PIEZO1(NM_001142864.4):c.5963C>T (p.A1988V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015444" "0" "50" "16" "88792955" "88792955" "subst" "2.69585E-5" "02325" "PIEZO1_000406" "g.88792955G>T" "" "" "" "PIEZO1(NM_001142864.4):c.3796C>A (p.P1266T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015445" "0" "50" "16" "88798919" "88798919" "subst" "0.00107697" "02325" "PIEZO1_000010" "g.88798919G>T" "" "" "" "PIEZO1(NM_001142864.4):c.2815C>A (p.L939M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001017865" "0" "90" "16" "88791913" "88791913" "subst" "0" "03779" "PIEZO1_000408" "g.88791913C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs587776990" "0" "" "" "" "" "pathogenic" "" "0001017879" "0" "50" "16" "88782159" "88782159" "subst" "0.000152098" "03779" "PIEZO1_000407" "g.88782159C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs200243384" "0" "" "" "" "" "VUS" "" "0001017894" "0" "50" "16" "88815867" "88815867" "subst" "0" "03779" "PIEZO1_000409" "g.88815867C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs987409464" "0" "" "" "" "" "VUS" "" "0001026784" "0" "30" "16" "88779714" "88779714" "subst" "0.000515813" "02325" "CTU2_000004" "g.88779714C>T" "" "" "" "CTU2(NM_001012759.3):c.738-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026785" "0" "90" "16" "88788059" "88788059" "subst" "6.71339E-6" "02325" "PIEZO1_000088" "g.88788059C>A" "" "" "" "PIEZO1(NM_001142864.4):c.5290G>T (p.E1764*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026786" "0" "50" "16" "88792054" "88792054" "subst" "1.99877E-5" "02325" "PIEZO1_000410" "g.88792054A>G" "" "" "" "PIEZO1(NM_001142864.4):c.4007T>C (p.I1336T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026787" "0" "50" "16" "88793190" "88793190" "subst" "8.782E-5" "02325" "PIEZO1_000411" "g.88793190C>T" "" "" "" "PIEZO1(NM_001142864.4):c.3632G>A (p.R1211H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026788" "0" "50" "16" "88793320" "88793320" "subst" "5.30941E-5" "02325" "PIEZO1_000383" "g.88793320A>C" "" "" "" "PIEZO1(NM_001142864.2):c.3502T>G (p.(Trp1168Gly)), PIEZO1(NM_001142864.4):c.3502T>G (p.W1168G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026789" "0" "30" "16" "88803092" "88803092" "subst" "0.000908509" "02326" "PIEZO1_000032" "g.88803092G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1251C>T (p.H417=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026790" "0" "50" "16" "88804135" "88804135" "subst" "0.00026616" "02325" "PIEZO1_000412" "g.88804135C>G" "" "" "" "PIEZO1(NM_001142864.4):c.1107+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001029950" "0" "50" "16" "88799820" "88799820" "subst" "0" "03779" "PIEZO1_000413" "g.88799820C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs920924223" "0" "" "" "" "" "VUS" "" "0001041431" "0" "50" "16" "88773594" "88773594" "subst" "0.000178833" "01804" "PIEZO1_000414" "g.88773594T>A" "" "" "" "CTU2(NM_001012759.3):c.119T>A (p.(Ile40Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041432" "0" "50" "16" "88773596" "88773596" "subst" "0.000178834" "01804" "PIEZO1_000415" "g.88773596C>G" "" "" "" "CTU2(NM_001012759.3):c.121C>G (p.(Arg41Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041433" "0" "30" "16" "88779714" "88779714" "subst" "0.000515813" "02326" "CTU2_000004" "g.88779714C>T" "" "" "" "CTU2(NM_001012759.3):c.738-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041434" "0" "50" "16" "88780617" "88780617" "subst" "4.07957E-6" "01804" "PIEZO1_000416" "g.88780617C>T" "" "" "" "CTU2(NM_001012759.3):c.1079C>T (p.(Thr360Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041435" "0" "50" "16" "88780983" "88780986" "del" "0" "01804" "PIEZO1_000417" "g.88780983_88780986del" "" "" "" "CTU2(NM_001012759.3):c.1202-12_1202-9del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041436" "0" "50" "16" "88781113" "88781114" "del" "0" "01804" "PIEZO1_000418" "g.88781113_88781114del" "" "" "" "CTU2(NM_001012759.3):c.1320_1321del (p.(Trp440Cysfs*19))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041437" "0" "50" "16" "88781116" "88781125" "del" "2.52347E-5" "01804" "PIEZO1_000419" "g.88781116_88781125del" "" "" "" "CTU2(NM_001012759.3):c.1323_1332del (p.(Gln442Alafs*24))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041438" "0" "50" "16" "88782216" "88782216" "subst" "0.000172487" "01804" "PIEZO1_000420" "g.88782216C>T" "" "" "" "PIEZO1(NM_001142864.4):c.7363G>A (p.(Val2455Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041439" "0" "50" "16" "88782500" "88782500" "subst" "0" "02325" "PIEZO1_000421" "g.88782500C>G" "" "" "" "PIEZO1(NM_001142864.4):c.7157G>C (p.R2386P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041440" "0" "50" "16" "88782643" "88782643" "subst" "0" "01804" "PIEZO1_000422" "g.88782643G>C" "" "" "" "PIEZO1(NM_001142864.4):c.7092C>G (p.(Asn2364Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041441" "0" "50" "16" "88783234" "88783234" "subst" "2.69796E-5" "01804" "PIEZO1_000423" "g.88783234G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6733C>T (p.(Arg2245Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041442" "0" "50" "16" "88783287" "88783287" "subst" "6.75101E-6" "01804" "PIEZO1_000424" "g.88783287G>A" "" "" "" "PIEZO1(NM_001142864.4):c.6680C>T (p.(Ala2227Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041443" "0" "30" "16" "88786310" "88786310" "subst" "0.000154718" "01804" "PIEZO1_000425" "g.88786310C>T" "" "" "" "PIEZO1(NM_001142864.4):c.6223G>A (p.(Ala2075Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041444" "0" "50" "16" "88786653" "88786653" "subst" "0.000251956" "01804" "PIEZO1_000426" "g.88786653T>C" "" "" "" "PIEZO1(NM_001142864.4):c.5988A>G (p.(Ser1996=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041445" "0" "30" "16" "88787785" "88787785" "subst" "6.67878E-6" "01804" "PIEZO1_000427" "g.88787785C>G" "" "" "" "PIEZO1(NM_001142864.4):c.5457G>C (p.(Lys1819Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041446" "0" "30" "16" "88788982" "88788982" "subst" "0.000110328" "01804" "PIEZO1_000428" "g.88788982C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4775+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041447" "0" "50" "16" "88792737" "88792737" "subst" "0.000100667" "01804" "PIEZO1_000429" "g.88792737A>G" "" "" "" "PIEZO1(NM_001142864.4):c.3923T>C (p.(Leu1308Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041448" "0" "30" "16" "88798340" "88798341" "ins" "0" "01804" "PIEZO1_000430" "g.88798340_88798341insCGTGGGGATGCACTGAGTCTGGGGAGAGGGCGGGG" "" "" "" "PIEZO1(NM_001142864.4):c.2992-8_2992-7insAGACTCAGTGCATCCCCACGCCCCGCCCTCTCCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041449" "0" "30" "16" "88800392" "88800397" "del" "0" "01804" "PIEZO1_000431" "g.88800392_88800397del" "" "" "" "PIEZO1(NM_001142864.4):c.2265_2270del (p.(Glu755_Glu756del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041450" "0" "50" "16" "88800868" "88800868" "subst" "6.7563E-6" "01804" "PIEZO1_000432" "g.88800868C>T" "" "" "" "PIEZO1(NM_001142864.4):c.2076G>A (p.(Leu692=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041451" "0" "50" "16" "88802617" "88802617" "subst" "0" "01804" "PIEZO1_000433" "g.88802617A>C" "" "" "" "PIEZO1(NM_001142864.4):c.1496T>G (p.(Val499Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041452" "0" "30" "16" "88803157" "88803157" "subst" "0" "01804" "PIEZO1_000434" "g.88803157G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1196-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041453" "0" "30" "16" "88803958" "88803958" "subst" "5.33463E-5" "01804" "PIEZO1_000435" "g.88803958G>A" "" "" "" "PIEZO1(NM_001142864.4):c.1195+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001045500" "0" "30" "16" "88804898" "88804898" "subst" "0" "03779" "PIEZO1_000436" "g.88804898C>T" "" "" "" "" "" "Unknown" "" "rs1420419999" "0" "" "" "" "" "likely benign" "" "0001046584" "0" "50" "16" "88789312" "88789312" "subst" "1.37219E-5" "02325" "PIEZO1_000437" "g.88789312C>T" "" "" "" "PIEZO1(NM_001142864.4):c.4601G>A (p.R1534Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046585" "0" "30" "16" "88800074" "88800074" "subst" "0.00103137" "02325" "PIEZO1_000438" "g.88800074C>G" "" "" "" "PIEZO1(NM_001142864.4):c.2409G>C (p.Q803H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001049437" "0" "90" "16" "88782212" "88782212" "subst" "0" "03779" "PIEZO1_000251" "g.88782212C>T" "" "" "" "" "" "Unknown" "" "rs587776988" "0" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PIEZO1 ## Count = 547 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000013615" "00001687" "30" "64" "8356" "64" "8356" "c.64+8356C>T" "r.(?)" "p.(=)" "1i" "0000071864" "00001687" "70" "4888" "0" "4888" "0" "c.4888G>T" "r.(?)" "p.(Glu1630*)" "36" "0000071865" "00001687" "70" "4888" "0" "4888" "0" "c.4888G>T" "r.(?)" "p.(Glu1630*)" "36" "0000071867" "00001687" "70" "2263" "0" "2263" "0" "c.2263G>T" "r.(?)" "p.(Glu755*)" "17" "0000071868" "00001687" "70" "6682" "0" "6682" "0" "c.6682C>T" "r.(?)" "p.(Gln2228*)" "46" "0000071870" "00001687" "70" "2263" "0" "2263" "0" "c.2263G>T" "r.(?)" "p.(Glu755*)" "17" "0000071871" "00001687" "70" "6682" "0" "6682" "0" "c.6682C>T" "r.(?)" "p.(Gln2228*)" "46" "0000071872" "00001687" "70" "3796" "1" "3796" "1" "c.3796+1G>A" "r.spl?" "p.?" "26i" "0000071873" "00001687" "70" "6511" "0" "6511" "0" "c.6511G>T" "r.(?)" "p.(Val2171Phe)" "45" "0000071874" "00001687" "70" "1669" "1" "1669" "1" "c.1669+1G>A" "r.spl?" "p.?" "13i" "0000071875" "00001687" "70" "7289" "0" "7289" "0" "c.7289C>T" "r.(?)" "p.(Pro2430Leu)" "50" "0000071876" "00001687" "70" "1669" "1" "1669" "1" "c.1669+1G>A" "r.spl?" "p.?" "13i" "0000071877" "00001687" "70" "7289" "0" "7289" "0" "c.7289C>T" "r.(?)" "p.(Pro2430Leu)" "50" "0000071878" "00001687" "70" "4888" "0" "4888" "0" "c.4888G>T" "r.(?)" "p.(Glu1630*)" "36" "0000071879" "00001687" "70" "7366" "0" "7366" "0" "c.7366C>T" "r.(?)" "p.(Arg2456Cys)" "51" "0000071880" "00001687" "50" "7374" "0" "7374" "0" "c.7374C>G" "r.(?)" "p.(Phe2458Leu)" "51" "0000071881" "00001687" "50" "2815" "0" "2815" "0" "c.2815C>A" "r.(?)" "p.(Leu939Met)" "21" "0000274612" "00001687" "10" "8934" "0" "8943" "0" "c.*1368_*1377del" "r.(=)" "p.(=)" "" "0000274613" "00001687" "30" "8075" "0" "8075" "0" "c.*509G>A" "r.(=)" "p.(=)" "" "0000274614" "00001687" "30" "16594" "0" "16594" "0" "c.*9028G>T" "r.(=)" "p.(=)" "" "0000274615" "00001687" "30" "10272" "0" "10272" "0" "c.*2706G>T" "r.(=)" "p.(=)" "" "0000305575" "00001687" "30" "1251" "0" "1251" "0" "c.1251C>T" "r.(?)" "p.(His417=)" "" "0000305576" "00001687" "50" "173" "0" "173" "0" "c.173G>A" "r.(?)" "p.(Arg58His)" "" "0000305577" "00001687" "30" "2167" "0" "2167" "0" "c.2167C>T" "r.(?)" "p.(Arg723Cys)" "" "0000305578" "00001687" "10" "2268" "0" "2270" "0" "c.2268_2270del" "r.(?)" "p.(Glu756del)" "" "0000305579" "00001687" "30" "2844" "0" "2844" "0" "c.2844C>G" "r.(?)" "p.(Arg948=)" "" "0000305580" "00001687" "50" "3562" "0" "3562" "0" "c.3562G>T" "r.(?)" "p.(Gly1188Cys)" "" "0000305581" "00001687" "30" "4089" "0" "4089" "0" "c.4089G>A" "r.(?)" "p.(Lys1363=)" "" "0000305582" "00001687" "30" "4371" "0" "4371" "0" "c.4371G>A" "r.(?)" "p.(Ala1457=)" "" "0000305583" "00001687" "30" "4495" "4" "4495" "4" "c.4495+4C>T" "r.spl?" "p.?" "" "0000305584" "00001687" "50" "4556" "0" "4556" "0" "c.4556A>C" "r.(?)" "p.(Gln1519Pro)" "" "0000305585" "00001687" "30" "4955" "8" "4955" "8" "c.4955+8C>T" "r.(=)" "p.(=)" "" "0000305586" "00001687" "50" "5054" "0" "5054" "0" "c.5054C>T" "r.(?)" "p.(Ala1685Val)" "" "0000305587" "00001687" "30" "5139" "0" "5139" "0" "c.5139C>T" "r.(?)" "p.(Leu1713=)" "" "0000305588" "00001687" "30" "566" "0" "566" "0" "c.566G>A" "r.(?)" "p.(Arg189Gln)" "" "0000305589" "00001687" "30" "5728" "0" "5728" "0" "c.5728G>A" "r.(?)" "p.(Glu1910Lys)" "" "0000305590" "00001687" "10" "627" "0" "627" "0" "c.627A>G" "r.(?)" "p.(Ala209=)" "" "0000305591" "00001687" "10" "6678" "0" "6678" "0" "c.6678C>T" "r.(?)" "p.(Ser2226=)" "" "0000305592" "00001687" "50" "7550" "0" "7550" "0" "c.7550C>G" "r.(?)" "p.(Thr2517Ser)" "" "0000305593" "00001687" "50" "812" "0" "812" "0" "c.812C>T" "r.(?)" "p.(Ala271Val)" "" "0000305594" "00001687" "30" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000324975" "00001687" "50" "13189" "0" "13189" "0" "c.*5623A>G" "r.(=)" "p.(=)" "" "0000324977" "00001687" "50" "9762" "0" "9762" "0" "c.*2196G>C" "r.(=)" "p.(=)" "" "0000324978" "00001687" "50" "9475" "0" "9475" "0" "c.*1909C>T" "r.(=)" "p.(=)" "" "0000324979" "00001687" "30" "8934" "0" "8943" "0" "c.*1368_*1377del" "r.(=)" "p.(=)" "" "0000324980" "00001687" "30" "7099" "0" "7099" "0" "c.7099G>A" "r.(?)" "p.(Glu2367Lys)" "" "0000324981" "00001687" "50" "5992" "0" "5992" "0" "c.5992G>A" "r.(?)" "p.(Asp1998Asn)" "" "0000324983" "00001687" "30" "5195" "0" "5195" "0" "c.5195C>T" "r.(?)" "p.(Thr1732Met)" "" "0000324984" "00001687" "50" "4957" "0" "4957" "0" "c.4957C>T" "r.(?)" "p.(Arg1653Cys)" "" "0000324985" "00001687" "30" "4495" "4" "4495" "4" "c.4495+4C>T" "r.spl?" "p.?" "" "0000324986" "00001687" "30" "3667" "0" "3667" "0" "c.3667G>A" "r.(?)" "p.(Val1223Ile)" "" "0000324987" "00001687" "30" "1022" "0" "1022" "0" "c.1022G>T" "r.(?)" "p.(Arg341Met)" "" "0000559565" "00001687" "30" "11497" "0" "11497" "0" "c.*3931C>T" "r.(=)" "p.(=)" "" "0000559566" "00001687" "30" "10259" "0" "10259" "0" "c.*2693G>T" "r.(=)" "p.(=)" "" "0000559567" "00001687" "30" "10217" "0" "10259" "0" "c.*2651_*2693del" "r.(=)" "p.(=)" "" "0000559573" "00001687" "30" "8497" "0" "8497" "0" "c.*931G>A" "r.(=)" "p.(=)" "" "0000559575" "00001687" "30" "8447" "0" "8447" "0" "c.*881C>T" "r.(=)" "p.(=)" "" "0000559576" "00001687" "50" "8237" "0" "8237" "0" "c.*671G>T" "r.(=)" "p.(=)" "" "0000559577" "00001687" "30" "8111" "0" "8111" "0" "c.*545G>T" "r.(=)" "p.(=)" "" "0000559578" "00001687" "50" "7958" "0" "7958" "0" "c.*392G>C" "r.(=)" "p.(=)" "" "0000559579" "00001687" "50" "7550" "0" "7550" "0" "c.7550C>G" "r.(?)" "p.(Thr2517Ser)" "" "0000559580" "00001687" "10" "7530" "0" "7530" "0" "c.7530G>A" "r.(?)" "p.(Pro2510=)" "" "0000559581" "00001687" "30" "7529" "0" "7529" "0" "c.7529C>T" "r.(?)" "p.(Pro2510Leu)" "" "0000559582" "00001687" "50" "7523" "0" "7523" "0" "c.7523G>A" "r.(?)" "p.(Arg2508His)" "" "0000559583" "00001687" "10" "7500" "0" "7500" "0" "c.7500C>T" "r.(?)" "p.(Tyr2500=)" "" "0000559584" "00001687" "30" "7427" "0" "7427" "0" "c.7427G>A" "r.(?)" "p.(Arg2476His)" "" "0000559585" "00001687" "10" "7362" "0" "7362" "0" "c.7362C>T" "r.(?)" "p.(Phe2454=)" "" "0000559586" "00001687" "30" "7316" "8" "7316" "11" "c.7316+8_7316+11del" "r.(=)" "p.(=)" "" "0000559587" "00001687" "50" "7315" "0" "7315" "0" "c.7315G>A" "r.(?)" "p.(Gly2439Ser)" "" "0000559588" "00001687" "30" "7240" "0" "7240" "0" "c.7240G>A" "r.(?)" "p.(Asp2414Asn)" "" "0000559589" "00001687" "10" "7194" "0" "7194" "0" "c.7194C>T" "r.(?)" "p.(Thr2398=)" "" "0000559590" "00001687" "30" "7091" "0" "7091" "0" "c.7091A>G" "r.(?)" "p.(Asn2364Ser)" "" "0000559591" "00001687" "10" "7059" "0" "7059" "0" "c.7059T>C" "r.(?)" "p.(Pro2353=)" "" "0000559593" "00001687" "10" "6891" "0" "6891" "0" "c.6891C>T" "r.(?)" "p.(Ala2297=)" "" "0000559594" "00001687" "30" "6829" "0" "6829" "0" "c.6829C>A" "r.(?)" "p.(Leu2277Met)" "" "0000559595" "00001687" "10" "6793" "0" "6793" "0" "c.6793A>G" "r.(?)" "p.(Ile2265Val)" "" "0000559596" "00001687" "10" "6642" "0" "6642" "0" "c.6642G>C" "r.(?)" "p.(Leu2214=)" "" "0000559597" "00001687" "10" "6570" "0" "6570" "0" "c.6570A>G" "r.(?)" "p.(Pro2190=)" "" "0000559598" "00001687" "30" "6519" "0" "6519" "0" "c.6519C>T" "r.(?)" "p.(Tyr2173=)" "" "0000559599" "00001687" "50" "6205" "0" "6205" "0" "c.6205G>A" "r.(?)" "p.(Val2069Met)" "" "0000559600" "00001687" "30" "5832" "0" "5832" "0" "c.5832C>T" "r.(?)" "p.(Arg1944=)" "" "0000559601" "00001687" "10" "5769" "0" "5769" "0" "c.5769C>T" "r.(?)" "p.(Ala1923=)" "" "0000559602" "00001687" "10" "5743" "0" "5743" "0" "c.5743C>T" "r.(?)" "p.(Arg1915Cys)" "" "0000559603" "00001687" "10" "5743" "0" "5743" "0" "c.5743C>A" "r.(?)" "p.(Arg1915Ser)" "" "0000559604" "00001687" "30" "5738" "0" "5738" "0" "c.5738C>T" "r.(?)" "p.(Pro1913Leu)" "" "0000559605" "00001687" "30" "5728" "0" "5728" "0" "c.5728G>A" "r.(?)" "p.(Glu1910Lys)" "" "0000559606" "00001687" "10" "5632" "0" "5634" "0" "c.5632_5634del" "r.(?)" "p.(Lys1878del)" "" "0000559607" "00001687" "30" "5627" "0" "5627" "0" "c.5627G>A" "r.(?)" "p.(Arg1876Lys)" "" "0000559608" "00001687" "10" "5569" "0" "5569" "0" "c.5569C>T" "r.(?)" "p.(Pro1857Ser)" "" "0000559609" "00001687" "10" "5538" "0" "5538" "0" "c.5538C>G" "r.(?)" "p.(Ala1846=)" "" "0000559611" "00001687" "30" "5464" "0" "5464" "0" "c.5464G>A" "r.(?)" "p.(Glu1822Lys)" "" "0000559612" "00001687" "30" "5464" "0" "5464" "0" "c.5464G>A" "r.(?)" "p.(Glu1822Lys)" "" "0000559615" "00001687" "50" "5291" "0" "5291" "0" "c.5291A>C" "r.(?)" "p.(Glu1764Ala)" "" "0000559616" "00001687" "50" "5291" "0" "5291" "0" "c.5291A>C" "r.(?)" "p.(Glu1764Ala)" "" "0000559617" "00001687" "90" "5290" "0" "5290" "0" "c.5290G>T" "r.(?)" "p.(Glu1764Ter)" "" "0000559618" "00001687" "10" "5195" "0" "5195" "0" "c.5195C>T" "r.(?)" "p.(Thr1732Met)" "" "0000559619" "00001687" "30" "5133" "0" "5133" "0" "c.5133C>T" "r.(?)" "p.(Pro1711=)" "" "0000559620" "00001687" "50" "5015" "0" "5015" "0" "c.5015C>T" "r.(?)" "p.(Ala1672Val)" "" "0000559621" "00001687" "30" "4969" "0" "4969" "0" "c.4969C>T" "r.(?)" "p.(Pro1657Ser)" "" "0000559622" "00001687" "30" "4969" "0" "4969" "0" "c.4969C>T" "r.(?)" "p.(Pro1657Ser)" "" "0000559623" "00001687" "30" "4963" "0" "4963" "0" "c.4963C>T" "r.(?)" "p.(Arg1655Cys)" "" "0000559624" "00001687" "10" "4956" "-3" "4956" "-3" "c.4956-3T>C" "r.spl?" "p.?" "" "0000559625" "00001687" "50" "4840" "0" "4840" "0" "c.4840G>A" "r.(?)" "p.(Gly1614Ser)" "" "0000559626" "00001687" "30" "4776" "0" "4776" "0" "c.4776T>C" "r.(?)" "p.(Ser1592=)" "" "0000559627" "00001687" "30" "4766" "0" "4766" "0" "c.4766C>T" "r.(?)" "p.(Thr1589Ile)" "" "0000559628" "00001687" "30" "4713" "0" "4713" "0" "c.4713C>G" "r.(?)" "p.(Ser1571Arg)" "" "0000559630" "00001687" "30" "4495" "4" "4495" "4" "c.4495+4C>T" "r.spl?" "p.?" "" "0000559631" "00001687" "10" "4475" "0" "4475" "0" "c.4475G>A" "r.(?)" "p.(Gly1492Asp)" "" "0000559634" "00001687" "10" "4400" "0" "4405" "0" "c.4400_4405dup" "r.(?)" "p.(Glu1467_Gln1468dup)" "" "0000559635" "00001687" "10" "4385" "0" "4385" "0" "c.4385G>A" "r.(?)" "p.(Arg1462Gln)" "" "0000559636" "00001687" "30" "4385" "0" "4385" "0" "c.4385G>A" "r.(?)" "p.(Arg1462Gln)" "" "0000559637" "00001687" "30" "4356" "0" "4356" "0" "c.4356G>C" "r.(?)" "p.(Val1452=)" "" "0000559638" "00001687" "30" "4274" "0" "4274" "0" "c.4274G>A" "r.(?)" "p.(Ser1425Asn)" "" "0000559639" "00001687" "10" "4193" "0" "4193" "0" "c.4193C>T" "r.(?)" "p.(Pro1398Leu)" "" "0000559640" "00001687" "50" "4180" "0" "4180" "0" "c.4180G>T" "r.(?)" "p.(Gly1394Cys)" "" "0000559641" "00001687" "10" "4014" "0" "4014" "0" "c.4014T>C" "r.(?)" "p.(Phe1338=)" "" "0000559642" "00001687" "10" "3969" "-5" "3969" "-5" "c.3969-5T>C" "r.spl?" "p.?" "" "0000559643" "00001687" "30" "3935" "0" "3935" "0" "c.3935C>T" "r.(?)" "p.(Ala1312Val)" "" "0000559644" "00001687" "10" "3928" "0" "3928" "0" "c.3928G>A" "r.(?)" "p.(Val1310Ile)" "" "0000559645" "00001687" "30" "3796" "16" "3796" "16" "c.3796+16G>A" "r.(=)" "p.(=)" "" "0000559646" "00001687" "10" "3700" "-12" "3700" "-12" "c.3700-12G>T" "r.(=)" "p.(=)" "" "0000559647" "00001687" "10" "3700" "-26" "3700" "-18" "c.3700-26_3700-18dup" "r.(=)" "p.(=)" "" "0000559648" "00001687" "10" "3699" "20" "3699" "20" "c.3699+20G>C" "r.(=)" "p.(=)" "" "0000559650" "00001687" "10" "3301" "17" "3301" "17" "c.3301+17A>C" "r.(=)" "p.(=)" "" "0000559651" "00001687" "30" "3301" "14" "3301" "14" "c.3301+14A>C" "r.(=)" "p.(=)" "" "0000559652" "00001687" "30" "3301" "7" "3301" "7" "c.3301+7G>C" "r.(=)" "p.(=)" "" "0000559653" "00001687" "30" "3054" "0" "3054" "0" "c.3054C>T" "r.(?)" "p.(His1018=)" "" "0000559655" "00001687" "10" "2992" "-15" "2992" "-14" "c.2992-15_2992-14insATCCCCAGACTCAGTGCATCCCCATGCCCCGCCCTCTCCCCAGACTCAGTGCATCCCCACGCCCCGCCC" "r.(=)" "p.(=)" "" "0000559656" "00001687" "10" "2992" "-13" "2992" "-12" "c.2992-13_2992-12insCCCAGACTCAGTGCATCCCCACGCCCCGCCCTC" "r.(=)" "p.(=)" "" "0000559657" "00001687" "30" "2992" "-13" "2992" "-12" "c.2992-13_2992-12insCCCCCAGACTCAGTGCATCCCCACACCCCCCCCTCCCCAGACTCAGTGCATCCCCACGCCCCGCCCTC" "r.(=)" "p.(=)" "" "0000559658" "00001687" "10" "2992" "-15" "2992" "-14" "c.2992-15_2992-14insATCCCCAGACTCAGTGCATCCCCACGCCCCGCCC" "r.(=)" "p.(=)" "" "0000559659" "00001687" "30" "2865" "0" "2865" "0" "c.2865G>A" "r.(?)" "p.(Gln955=)" "" "0000559660" "00001687" "30" "2664" "6" "2664" "6" "c.2664+6G>A" "r.(=)" "p.(=)" "" "0000559661" "00001687" "30" "2648" "0" "2648" "0" "c.2648C>G" "r.(?)" "p.(Ser883Cys)" "" "0000559662" "00001687" "30" "2622" "0" "2622" "0" "c.2622C>T" "r.(?)" "p.(Leu874=)" "" "0000559663" "00001687" "30" "2613" "0" "2613" "0" "c.2613G>A" "r.(?)" "p.(Leu871=)" "" "0000559664" "00001687" "30" "2590" "0" "2590" "0" "c.2590G>A" "r.(?)" "p.(Val864Ile)" "" "0000559665" "00001687" "50" "2512" "0" "2512" "0" "c.2512G>C" "r.(?)" "p.(Val838Leu)" "" "0000559666" "00001687" "30" "2423" "0" "2423" "0" "c.2423G>A" "r.(?)" "p.(Arg808Gln)" "" "0000559667" "00001687" "30" "2344" "0" "2344" "0" "c.2344G>A" "r.(?)" "p.(Gly782Ser)" "" "0000559668" "00001687" "10" "2329" "19" "2329" "19" "c.2329+19G>A" "r.(=)" "p.(=)" "" "0000559669" "00001687" "30" "2274" "0" "2274" "0" "c.2274C>T" "r.(?)" "p.(Ser758=)" "" "0000559671" "00001687" "10" "2268" "0" "2270" "0" "c.2268_2270dup" "r.(?)" "p.(Glu756dup)" "" "0000559672" "00001687" "10" "2268" "0" "2270" "0" "c.2268_2270dup" "r.(?)" "p.(Glu756dup)" "" "0000559673" "00001687" "10" "2245" "0" "2247" "0" "c.2245_2247del" "r.(?)" "p.(Gln749del)" "" "0000559674" "00001687" "10" "2181" "-15" "2181" "-15" "c.2181-15C>T" "r.(=)" "p.(=)" "" "0000559675" "00001687" "10" "2159" "0" "2159" "0" "c.2159G>A" "r.(?)" "p.(Arg720His)" "" "0000559676" "00001687" "30" "2142" "0" "2142" "0" "c.2142G>A" "r.(?)" "p.(Val714=)" "" "0000559677" "00001687" "10" "2130" "0" "2130" "0" "c.2130C>T" "r.(?)" "p.(Asp710=)" "" "0000559678" "00001687" "50" "2110" "0" "2110" "0" "c.2110C>T" "r.(?)" "p.(Pro704Ser)" "" "0000559679" "00001687" "70" "2035" "0" "2035" "0" "c.2035G>A" "r.(?)" "p.(Glu679Lys)" "" "0000559680" "00001687" "10" "2031" "0" "2031" "0" "c.2031G>A" "r.(?)" "p.(Val677=)" "" "0000559681" "00001687" "30" "1998" "-5" "1998" "-5" "c.1998-5C>T" "r.spl?" "p.?" "" "0000559682" "00001687" "30" "1849" "-6" "1849" "-6" "c.1849-6C>T" "r.(=)" "p.(=)" "" "0000559683" "00001687" "50" "1670" "-6" "1670" "-5" "c.1670-6_1670-5insA" "r.spl?" "p.?" "" "0000559684" "00001687" "30" "1670" "-6" "1670" "-6" "c.1670-6C>T" "r.(=)" "p.(=)" "" "0000559685" "00001687" "50" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Arg531Cys)" "" "0000559686" "00001687" "10" "1557" "16" "1557" "16" "c.1557+16C>G" "r.(=)" "p.(=)" "" "0000559687" "00001687" "10" "1540" "0" "1540" "0" "c.1540C>T" "r.(?)" "p.(Leu514=)" "" "0000559688" "00001687" "10" "1527" "0" "1527" "0" "c.1527C>A" "r.(?)" "p.(Thr509=)" "" "0000559689" "00001687" "30" "1495" "0" "1495" "0" "c.1495G>A" "r.(?)" "p.(Val499Ile)" "" "0000559690" "00001687" "30" "1495" "0" "1495" "0" "c.1495G>A" "r.(?)" "p.(Val499Ile)" "" "0000559692" "00001687" "30" "1401" "0" "1401" "0" "c.1401G>A" "r.(?)" "p.(Ser467=)" "" "0000559693" "00001687" "10" "1297" "-16" "1297" "-16" "c.1297-16C>T" "r.(=)" "p.(=)" "" "0000559694" "00001687" "10" "1219" "0" "1219" "0" "c.1219A>G" "r.(?)" "p.(Arg407Gly)" "" "0000559696" "00001687" "30" "1187" "0" "1187" "0" "c.1187G>A" "r.(?)" "p.(Arg396Gln)" "" "0000559697" "00001687" "10" "1180" "0" "1180" "0" "c.1180G>C" "r.(?)" "p.(Val394Leu)" "" "0000559698" "00001687" "10" "1141" "0" "1143" "0" "c.1141_1143del" "r.(?)" "p.(Asp381del)" "" "0000559699" "00001687" "30" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Arg365Trp)" "" "0000559700" "00001687" "30" "1013" "0" "1013" "0" "c.1013C>A" "r.(?)" "p.(Ser338Tyr)" "" "0000559701" "00001687" "30" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Pro337Ser)" "" "0000559702" "00001687" "30" "1001" "0" "1001" "0" "c.1001C>T" "r.(?)" "p.(Ala334Val)" "" "0000559703" "00001687" "10" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000559704" "00001687" "30" "849" "-10" "849" "-10" "c.849-10C>T" "r.(=)" "p.(=)" "" "0000559705" "00001687" "10" "848" "17" "848" "17" "c.848+17C>T" "r.(=)" "p.(=)" "" "0000559706" "00001687" "30" "751" "0" "751" "0" "c.751G>A" "r.(?)" "p.(Ala251Thr)" "" "0000559707" "00001687" "10" "749" "0" "749" "0" "c.749T>C" "r.(?)" "p.(Val250Ala)" "" "0000559708" "00001687" "10" "635" "-8" "635" "-8" "c.635-8C>T" "r.(=)" "p.(=)" "" "0000559709" "00001687" "30" "627" "0" "627" "0" "c.627A>G" "r.(?)" "p.(Ala209=)" "" "0000559710" "00001687" "10" "555" "0" "555" "0" "c.555C>T" "r.(?)" "p.(Ala185=)" "" "0000559711" "00001687" "10" "465" "8" "465" "8" "c.465+8C>T" "r.(=)" "p.(=)" "" "0000559712" "00001687" "10" "455" "0" "455" "0" "c.455C>T" "r.(?)" "p.(Pro152Leu)" "" "0000559713" "00001687" "30" "284" "-4" "284" "-4" "c.284-4G>A" "r.spl?" "p.?" "" "0000559714" "00001687" "30" "263" "0" "263" "0" "c.263A>G" "r.(?)" "p.(Asp88Gly)" "" "0000559715" "00001687" "10" "248" "0" "248" "0" "c.248T>C" "r.(?)" "p.(Ile83Thr)" "" "0000559716" "00001687" "10" "63" "0" "63" "0" "c.63T>G" "r.(?)" "p.(Ala21=)" "" "0000602992" "00001687" "50" "7468" "0" "7471" "0" "c.7468_7471dup" "r.(?)" "p.(Arg2491Hisfs*30)" "" "0000616207" "00001687" "50" "8580" "0" "8580" "0" "c.*1014dup" "r.(?)" "p.(=)" "" "0000616208" "00001687" "30" "7152" "0" "7152" "0" "c.7152C>T" "r.(?)" "p.(Gly2384=)" "" "0000616209" "00001687" "30" "7041" "0" "7041" "0" "c.7041C>T" "r.(?)" "p.(Asp2347=)" "" "0000616210" "00001687" "30" "7041" "0" "7041" "0" "c.7041C>T" "r.(?)" "p.(Asp2347=)" "" "0000616211" "00001687" "30" "6585" "0" "6585" "0" "c.6585G>A" "r.(?)" "p.(Ser2195=)" "" "0000616212" "00001687" "10" "6390" "0" "6390" "0" "c.6390G>A" "r.(?)" "p.(Thr2130=)" "" "0000616213" "00001687" "90" "6380" "0" "6380" "0" "c.6380C>T" "r.(?)" "p.(Thr2127Met)" "" "0000616214" "00001687" "10" "6288" "0" "6288" "0" "c.6288G>A" "r.(?)" "p.(Lys2096=)" "" "0000616215" "00001687" "10" "5505" "0" "5505" "0" "c.5505G>A" "r.(?)" "p.(Ala1835=)" "" "0000616216" "00001687" "30" "5289" "0" "5289" "0" "c.5289C>T" "r.(?)" "p.(Tyr1763=)" "" "0000616217" "00001687" "10" "5121" "0" "5121" "0" "c.5121G>C" "r.(?)" "p.(Ser1707=)" "" "0000616218" "00001687" "10" "4580" "0" "4580" "0" "c.4580G>A" "r.(?)" "p.(Arg1527His)" "" "0000616219" "00001687" "30" "4495" "10" "4495" "14" "c.4495+10_4495+14dup" "r.(=)" "p.(=)" "" "0000616220" "00001687" "30" "4399" "0" "4400" "0" "c.4399_4400insGGCAGG" "r.(?)" "p.(Gln1466_Glu1467insGlyGln)" "" "0000616221" "00001687" "50" "3598" "0" "3598" "0" "c.3598G>A" "r.(?)" "p.(Gly1200Ser)" "" "0000616222" "00001687" "10" "3456" "-11" "3456" "-11" "c.3456-11C>T" "r.(=)" "p.(=)" "" "0000616223" "00001687" "10" "2992" "-13" "2992" "-12" "c.2992-13_2992-12insCCCCCAGACTCAGTGCATCCCCACACCCCCCCCTCCCTCCAGACTCAGTGCATCCCCACGCCCCGCCCTC" "r.(=)" "p.(=)" "" "0000616224" "00001687" "10" "2991" "12" "2991" "12" "c.2991+12A>G" "r.(=)" "p.(=)" "" "0000616225" "00001687" "10" "2790" "10" "2790" "10" "c.2790+10A>G" "r.(=)" "p.(=)" "" "0000616226" "00001687" "10" "2664" "12" "2664" "12" "c.2664+12C>G" "r.(=)" "p.(=)" "" "0000616227" "00001687" "10" "2361" "0" "2361" "0" "c.2361G>C" "r.(?)" "p.(Arg787=)" "" "0000616228" "00001687" "10" "2268" "0" "2270" "0" "c.2268_2270del" "r.(?)" "p.(Glu756del)" "" "0000616229" "00001687" "30" "2139" "0" "2139" "0" "c.2139C>T" "r.(?)" "p.(His713=)" "" "0000616230" "00001687" "10" "1674" "0" "1674" "0" "c.1674C>T" "r.(?)" "p.(Pro558=)" "" "0000616231" "00001687" "10" "1365" "0" "1365" "0" "c.1365G>A" "r.(?)" "p.(Thr455=)" "" "0000616232" "00001687" "10" "1297" "-14" "1297" "-14" "c.1297-14T>C" "r.(=)" "p.(=)" "" "0000616233" "00001687" "30" "954" "0" "954" "0" "c.954C>T" "r.(?)" "p.(Val318=)" "" "0000616234" "00001687" "30" "718" "0" "718" "0" "c.718A>G" "r.(?)" "p.(Ile240Val)" "" "0000616235" "00001687" "10" "588" "0" "588" "0" "c.588G>T" "r.(?)" "p.(Leu196=)" "" "0000623561" "00001687" "10" "7505" "0" "7505" "0" "c.7505A>G" "r.(?)" "p.(Lys2502Arg)" "" "0000623562" "00001687" "10" "6660" "17" "6660" "17" "c.6660+17C>T" "r.(=)" "p.(=)" "" "0000623563" "00001687" "10" "5461" "0" "5461" "0" "c.5461G>A" "r.(?)" "p.(Gly1821Ser)" "" "0000623564" "00001687" "10" "3196" "19" "3196" "19" "c.3196+19G>T" "r.(=)" "p.(=)" "" "0000623566" "00001687" "30" "2488" "-34" "2488" "-3" "c.2488-34_2488-3dup" "r.spl?" "p.?" "" "0000623568" "00001687" "10" "132" "0" "132" "0" "c.132C>T" "r.(?)" "p.(Phe44=)" "" "0000649433" "00001687" "50" "2423" "0" "2423" "0" "c.2423G>A" "r.(?)" "p.(Arg808Gln)" "" "0000649434" "00001687" "50" "2344" "0" "2344" "0" "c.2344G>A" "r.(?)" "p.(Gly782Ser)" "" "0000657969" "00001687" "30" "8265" "0" "8265" "0" "c.*699G>A" "r.(=)" "p.(=)" "" "0000657970" "00001687" "30" "7353" "0" "7353" "0" "c.7353C>T" "r.(?)" "p.(Ile2451=)" "" "0000657971" "00001687" "30" "4955" "8" "4955" "8" "c.4955+8C>T" "r.(=)" "p.(=)" "" "0000657972" "00001687" "30" "4770" "0" "4770" "0" "c.4770G>A" "r.(?)" "p.(Val1590=)" "" "0000657973" "00001687" "90" "4614" "0" "4663" "0" "c.4614_4663del" "r.(?)" "p.(Met1539AlafsTer67)" "" "0000657974" "00001687" "30" "4438" "14" "4438" "14" "c.4438+14C>T" "r.(=)" "p.(=)" "" "0000657975" "00001687" "30" "3700" "-18" "3700" "-17" "c.3700-18_3700-17insGCCCCACTG" "r.(=)" "p.(=)" "" "0000657976" "00001687" "30" "3388" "0" "3388" "0" "c.3388G>A" "r.(?)" "p.(Val1130Ile)" "" "0000657977" "00001687" "50" "3197" "0" "3197" "0" "c.3197A>T" "r.(?)" "p.(Asp1066Val)" "" "0000657978" "00001687" "10" "2992" "-13" "2992" "-12" "c.2992-13_2992-12insCCCCAGACTCAGTGCATCCCCACACCCCGCCCTCCCCCCAGACTCAGTGCATCCCCACGCCCCGCCCTC" "r.(=)" "p.(=)" "" "0000657979" "00001687" "30" "2742" "0" "2742" "0" "c.2742C>A" "r.(?)" "p.(Ala914=)" "" "0000657980" "00001687" "30" "2423" "0" "2423" "0" "c.2423G>A" "r.(?)" "p.(Arg808Gln)" "" "0000657981" "00001687" "30" "2344" "0" "2344" "0" "c.2344G>A" "r.(?)" "p.(Gly782Ser)" "" "0000657982" "00001687" "30" "1527" "0" "1527" "0" "c.1527C>A" "r.(?)" "p.(Thr509=)" "" "0000657983" "00001687" "30" "999" "0" "999" "0" "c.999C>T" "r.(?)" "p.(Arg333=)" "" "0000657984" "00001687" "30" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000657985" "00001687" "30" "747" "0" "747" "0" "c.747C>T" "r.(?)" "p.(Cys249=)" "" "0000657986" "00001687" "30" "588" "0" "588" "0" "c.588G>T" "r.(?)" "p.(Leu196=)" "" "0000663633" "00001687" "50" "7374" "0" "7374" "0" "c.7374C>G" "r.(?)" "p.(Phe2458Leu)" "" "0000663634" "00001687" "50" "4495" "4" "4495" "4" "c.4495+4C>T" "r.spl?" "p.?" "" "0000663635" "00001687" "50" "2815" "0" "2815" "0" "c.2815C>A" "r.(?)" "p.(Leu939Met)" "" "0000667939" "00001687" "30" "7130" "-5" "7130" "-5" "c.7130-5C>A" "r.spl?" "p.?" "50" "0000680703" "00001687" "30" "7529" "0" "7529" "0" "c.7529C>T" "r.(?)" "p.(Pro2510Leu)" "" "0000680704" "00001687" "70" "7089" "0" "7089" "0" "c.7089dup" "r.(?)" "p.(Asn2364GlnfsTer15)" "" "0000680705" "00001687" "50" "6905" "0" "6905" "0" "c.6905G>A" "r.(?)" "p.(Arg2302His)" "" "0000680706" "00001687" "30" "6818" "0" "6818" "0" "c.6818G>A" "r.(?)" "p.(Ser2273Asn)" "" "0000680707" "00001687" "30" "6781" "0" "6781" "0" "c.6781A>G" "r.(?)" "p.(Ser2261Gly)" "" "0000680708" "00001687" "10" "5121" "0" "5121" "0" "c.5121G>C" "r.(?)" "p.(Ser1707=)" "" "0000680709" "00001687" "30" "3456" "-11" "3456" "-11" "c.3456-11C>T" "r.(=)" "p.(=)" "" "0000680710" "00001687" "30" "2991" "12" "2991" "12" "c.2991+12A>G" "r.(=)" "p.(=)" "" "0000680711" "00001687" "30" "2865" "0" "2865" "0" "c.2865G>A" "r.(?)" "p.(Gln955=)" "" "0000680712" "00001687" "10" "2790" "10" "2790" "10" "c.2790+10A>G" "r.(=)" "p.(=)" "" "0000680713" "00001687" "10" "2664" "12" "2664" "12" "c.2664+12C>G" "r.(=)" "p.(=)" "" "0000680714" "00001687" "30" "2488" "-34" "2488" "-3" "c.2488-34_2488-3del" "r.spl?" "p.?" "" "0000680715" "00001687" "10" "2361" "0" "2361" "0" "c.2361G>C" "r.(?)" "p.(Arg787=)" "" "0000680716" "00001687" "10" "2268" "0" "2270" "0" "c.2268_2270del" "r.(?)" "p.(Glu756del)" "" "0000680717" "00001687" "50" "2268" "0" "2270" "0" "c.2268_2270dup" "r.(?)" "p.(Glu756dup)" "" "0000680718" "00001687" "30" "2245" "0" "2250" "0" "c.2245_2250del" "r.(?)" "p.(Gln749_Glu750del)" "" "0000680719" "00001687" "10" "1674" "0" "1674" "0" "c.1674C>T" "r.(?)" "p.(Pro558=)" "" "0000680720" "00001687" "30" "1297" "-6" "1297" "-6" "c.1297-6G>A" "r.(=)" "p.(=)" "" "0000680721" "00001687" "30" "1281" "0" "1281" "0" "c.1281G>A" "r.(?)" "p.(Ala427=)" "" "0000680722" "00001687" "30" "1072" "0" "1072" "0" "c.1072C>T" "r.(?)" "p.(Leu358=)" "" "0000680723" "00001687" "30" "757" "0" "757" "0" "c.757G>A" "r.(?)" "p.(Gly253Arg)" "" "0000680724" "00001687" "30" "283" "11" "283" "11" "c.283+11G>C" "r.(=)" "p.(=)" "" "0000692178" "00001687" "30" "7505" "0" "7505" "0" "c.7505A>G" "r.(?)" "p.(Lys2502Arg)" "" "0000692179" "00001687" "50" "7472" "0" "7477" "0" "c.7472_7477dup" "r.(?)" "p.(Arg2491_Glu2492dup)" "" "0000692180" "00001687" "10" "7332" "0" "7332" "0" "c.7332C>T" "r.(?)" "p.(Tyr2444=)" "" "0000692181" "00001687" "30" "7091" "0" "7091" "0" "c.7091A>G" "r.(?)" "p.(Asn2364Ser)" "" "0000692182" "00001687" "10" "6963" "0" "6963" "0" "c.6963C>T" "r.(?)" "p.(Asn2321=)" "" "0000692183" "00001687" "10" "6678" "0" "6678" "0" "c.6678C>T" "r.(?)" "p.(Ser2226=)" "" "0000692184" "00001687" "10" "6678" "0" "6678" "0" "c.6678C>T" "r.(?)" "p.(Ser2226=)" "" "0000692185" "00001687" "10" "6651" "0" "6651" "0" "c.6651C>A" "r.(?)" "p.(Gly2217=)" "" "0000692186" "00001687" "10" "6390" "0" "6390" "0" "c.6390G>A" "r.(?)" "p.(Thr2130=)" "" "0000692187" "00001687" "30" "5831" "0" "5831" "0" "c.5831G>A" "r.(?)" "p.(Arg1944His)" "" "0000692188" "00001687" "50" "5312" "0" "5312" "0" "c.5312C>T" "r.(?)" "p.(Pro1771Leu)" "" "0000692189" "00001687" "30" "5280" "0" "5280" "0" "c.5280G>T" "r.(?)" "p.(Leu1760=)" "" "0000692190" "00001687" "30" "4969" "0" "4969" "0" "c.4969C>T" "r.(?)" "p.(Pro1657Ser)" "" "0000692191" "00001687" "50" "4600" "0" "4600" "0" "c.4600C>T" "r.(?)" "p.(Arg1534Trp)" "" "0000692192" "00001687" "30" "3636" "0" "3636" "0" "c.3636C>T" "r.(?)" "p.(Leu1212=)" "" "0000692193" "00001687" "50" "2787" "0" "2787" "0" "c.2787C>G" "r.(?)" "p.(Ile929Met)" "" "0000692194" "00001687" "30" "1495" "0" "1495" "0" "c.1495G>A" "r.(?)" "p.(Val499Ile)" "" "0000692195" "00001687" "10" "1196" "-17" "1196" "-17" "c.1196-17G>A" "r.(=)" "p.(=)" "" "0000692196" "00001687" "30" "1188" "0" "1188" "0" "c.1188G>A" "r.(?)" "p.(Arg396=)" "" "0000692197" "00001687" "10" "1013" "0" "1013" "0" "c.1013C>A" "r.(?)" "p.(Ser338Tyr)" "" "0000726031" "00001687" "30" "7374" "0" "7374" "0" "c.7374C>G" "r.(?)" "p.(Phe2458Leu)" "" "0000726032" "00001687" "90" "7367" "0" "7367" "0" "c.7367G>A" "r.(?)" "p.(Arg2456His)" "" "0000726033" "00001687" "10" "6963" "0" "6963" "0" "c.6963C>T" "r.(?)" "p.(Asn2321=)" "" "0000726034" "00001687" "30" "6822" "0" "6822" "0" "c.6822C>T" "r.(?)" "p.(Ser2274=)" "" "0000726035" "00001687" "30" "6781" "0" "6781" "0" "c.6781A>G" "r.(?)" "p.(Ser2261Gly)" "" "0000726036" "00001687" "10" "6651" "0" "6651" "0" "c.6651C>A" "r.(?)" "p.(Gly2217=)" "" "0000726037" "00001687" "30" "5689" "0" "5689" "0" "c.5689G>C" "r.(?)" "p.(Glu1897Gln)" "" "0000726038" "00001687" "30" "5481" "0" "5481" "0" "c.5481C>T" "r.(?)" "p.(Ala1827=)" "" "0000726039" "00001687" "50" "4196" "0" "4196" "0" "c.4196G>A" "r.(?)" "p.(Arg1399Gln)" "" "0000726040" "00001687" "50" "4184" "0" "4184" "0" "c.4184C>A" "r.(?)" "p.(Ser1395Tyr)" "" "0000726041" "00001687" "30" "2815" "0" "2815" "0" "c.2815C>A" "r.(?)" "p.(Leu939Met)" "" "0000726042" "00001687" "30" "1998" "-10" "1998" "-10" "c.1998-10C>T" "r.(=)" "p.(=)" "" "0000726043" "00001687" "50" "1277" "0" "1277" "0" "c.1277G>A" "r.(?)" "p.(Cys426Tyr)" "" "0000726044" "00001687" "90" "307" "0" "307" "0" "c.307C>T" "r.(?)" "p.(Arg103Ter)" "" "0000807670" "00001687" "90" "7367" "0" "7367" "0" "c.7367G>A" "r.(?)" "p.(Arg2456His)" "" "0000807671" "00001687" "30" "7180" "0" "7180" "0" "c.7180G>A" "r.(?)" "p.(Gly2394Ser)" "" "0000807672" "00001687" "10" "6891" "0" "6891" "0" "c.6891C>T" "r.(?)" "p.(Ala2297=)" "" "0000807673" "00001687" "50" "6490" "0" "6490" "0" "c.6490G>A" "r.(?)" "p.(Gly2164Arg)" "" "0000807674" "00001687" "50" "6205" "0" "6205" "0" "c.6205G>A" "r.(?)" "p.(Val2069Met)" "" "0000807675" "00001687" "30" "6164" "10" "6164" "10" "c.6164+10C>T" "r.(=)" "p.(=)" "" "0000807676" "00001687" "30" "5865" "0" "5865" "0" "c.5865C>T" "r.(?)" "p.(Arg1955=)" "" "0000807677" "00001687" "50" "5863" "0" "5863" "0" "c.5863C>T" "r.(?)" "p.(Arg1955Cys)" "" "0000807678" "00001687" "50" "5801" "0" "5801" "0" "c.5801T>A" "r.(?)" "p.(Leu1934Gln)" "" "0000807679" "00001687" "10" "5552" "0" "5552" "0" "c.5552C>T" "r.(?)" "p.(Thr1851Met)" "" "0000807680" "00001687" "30" "5341" "0" "5341" "0" "c.5341G>T" "r.(?)" "p.(Gly1781Cys)" "" "0000807681" "00001687" "70" "5289" "0" "5289" "0" "c.5289C>G" "r.(?)" "p.(Tyr1763*)" "" "0000807682" "00001687" "50" "5214" "0" "5214" "0" "c.5214G>A" "r.(?)" "p.(Glu1738=)" "" "0000807683" "00001687" "30" "5148" "0" "5148" "0" "c.5148G>T" "r.(?)" "p.(Leu1716=)" "" "0000807684" "00001687" "10" "4872" "0" "4872" "0" "c.4872A>G" "r.(?)" "p.(Ala1624=)" "" "0000807685" "00001687" "30" "4754" "0" "4754" "0" "c.4754A>G" "r.(?)" "p.(Asn1585Ser)" "" "0000807686" "00001687" "30" "4580" "0" "4580" "0" "c.4580G>A" "r.(?)" "p.(Arg1527His)" "" "0000807687" "00001687" "10" "4439" "-15" "4439" "-15" "c.4439-15G>T" "r.(=)" "p.(=)" "" "0000807688" "00001687" "30" "4350" "0" "4350" "0" "c.4350A>G" "r.(?)" "p.(Ala1450=)" "" "0000807689" "00001687" "50" "4252" "0" "4252" "0" "c.4252T>C" "r.(?)" "p.(Tyr1418His)" "" "0000807690" "00001687" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.(?)" "p.(Leu1043=)" "" "0000807691" "00001687" "10" "2330" "-16" "2330" "-16" "c.2330-16C>T" "r.(=)" "p.(=)" "" "0000807692" "00001687" "10" "2248" "0" "2248" "0" "c.2248G>C" "r.(?)" "p.(Glu750Gln)" "" "0000807693" "00001687" "30" "2245" "0" "2245" "0" "c.2245C>G" "r.(?)" "p.(Gln749Glu)" "" "0000807694" "00001687" "30" "1123" "0" "1123" "0" "c.1123G>A" "r.(?)" "p.(Ala375Thr)" "" "0000807695" "00001687" "30" "954" "0" "954" "0" "c.954C>T" "r.(?)" "p.(Val318=)" "" "0000826640" "00001687" "30" "5373" "0" "5373" "0" "c.5373G>T" "r.(?)" "p.(Met1791Ile)" "" "0000826643" "00001687" "30" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Thr1201Met)" "" "0000826731" "00001687" "30" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Thr1201Met)" "" "0000826734" "00001687" "30" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Thr1201Met)" "" "0000854696" "00001687" "30" "10319" "0" "10319" "0" "c.*2753C>G" "r.(=)" "p.(=)" "" "0000854697" "00001687" "30" "7941" "0" "7941" "0" "c.*375G>A" "r.(=)" "p.(=)" "" "0000854698" "00001687" "10" "5195" "0" "5195" "0" "c.5195C>T" "r.(?)" "p.(Thr1732Met)" "" "0000854699" "00001687" "30" "4495" "10" "4495" "14" "c.4495+10_4495+14dup" "r.(=)" "p.(=)" "" "0000854700" "00001687" "30" "4363" "0" "4363" "0" "c.4363G>A" "r.(?)" "p.(Ala1455Thr)" "" "0000854701" "00001687" "50" "3181" "0" "3181" "0" "c.3181C>G" "r.(?)" "p.(Pro1061Ala)" "" "0000854702" "00001687" "30" "2423" "0" "2423" "0" "c.2423G>A" "r.(?)" "p.(Arg808Gln)" "" "0000854703" "00001687" "30" "2344" "0" "2344" "0" "c.2344G>A" "r.(?)" "p.(Gly782Ser)" "" "0000854704" "00001687" "50" "1534" "0" "1534" "0" "c.1534C>T" "r.(?)" "p.(Pro512Ser)" "" "0000854705" "00001687" "30" "283" "7" "283" "7" "c.283+7C>T" "r.(=)" "p.(=)" "" "0000864975" "00001687" "50" "13217" "0" "13217" "0" "c.*5651A>C" "r.(=)" "p.(=)" "" "0000864976" "00001687" "50" "13216" "0" "13216" "0" "c.*5650A>G" "r.(=)" "p.(=)" "" "0000864977" "00001687" "50" "7472" "0" "7477" "0" "c.7472_7477dup" "r.(?)" "p.(Arg2491_Glu2492dup)" "" "0000864978" "00001687" "30" "6796" "0" "6796" "0" "c.6796G>A" "r.(?)" "p.(Val2266Ile)" "" "0000864979" "00001687" "10" "6219" "0" "6219" "0" "c.6219C>T" "r.(?)" "p.(Tyr2073=)" "" "0000864980" "00001687" "50" "6165" "-7" "6165" "-7" "c.6165-7G>A" "r.(=)" "p.(=)" "" "0000864981" "00001687" "30" "5728" "0" "5728" "0" "c.5728G>A" "r.(?)" "p.(Glu1910Lys)" "" "0000864982" "00001687" "30" "5590" "0" "5590" "0" "c.5590C>T" "r.(?)" "p.(Arg1864Cys)" "" "0000864983" "00001687" "30" "5139" "0" "5139" "0" "c.5139C>T" "r.(?)" "p.(Leu1713=)" "" "0000864984" "00001687" "30" "3969" "-12" "3969" "-12" "c.3969-12G>A" "r.(=)" "p.(=)" "" "0000864985" "00001687" "50" "3340" "0" "3340" "0" "c.3340C>G" "r.(?)" "p.(Gln1114Glu)" "" "0000864986" "00001687" "50" "2869" "0" "2869" "0" "c.2869C>A" "r.(?)" "p.(Gln957Lys)" "" "0000864987" "00001687" "50" "2265" "0" "2270" "0" "c.2265_2270dup" "r.(?)" "p.(Glu755_Glu756dup)" "" "0000864988" "00001687" "30" "1679" "0" "1679" "0" "c.1679G>A" "r.(?)" "p.(Arg560Gln)" "" "0000864989" "00001687" "50" "1534" "0" "1534" "0" "c.1534C>A" "r.(?)" "p.(Pro512Thr)" "" "0000864990" "00001687" "10" "1365" "0" "1365" "0" "c.1365G>A" "r.(?)" "p.(Thr455=)" "" "0000864991" "00001687" "50" "757" "0" "757" "0" "c.757G>A" "r.(?)" "p.(Gly253Arg)" "" "0000864992" "00001687" "30" "601" "0" "601" "0" "c.601C>A" "r.(?)" "p.(Arg201=)" "" "0000864993" "00001687" "30" "363" "0" "363" "0" "c.363G>C" "r.(?)" "p.(Leu121=)" "" "0000864994" "00001687" "30" "64" "17" "64" "17" "c.64+17C>T" "r.(=)" "p.(=)" "" "0000872159" "00001687" "50" "6812" "0" "6812" "0" "c.6812A>G" "r.(?)" "p.(Glu2271Gly)" "" "0000872160" "00001687" "30" "1930" "0" "1930" "0" "c.1930G>A" "r.(?)" "p.(Val644Ile)" "" "0000872161" "00001687" "50" "5667" "0" "5667" "0" "c.5667C>T" "r.(?)" "p.(Ile1889=)" "" "0000873888" "00001687" "50" "6506" "0" "6508" "0" "c.6506_6508del" "r.(?)" "p.(Lys2169del)" "" "0000873890" "00001687" "50" "6506" "0" "6508" "0" "c.6506_6508del" "r.(?)" "p.(Lys2169del)" "" "0000874458" "00001687" "50" "1075" "0" "1075" "0" "c.1075G>A" "r.(?)" "p.(Asp359Asn)" "" "0000874760" "00001687" "50" "2907" "0" "2907" "0" "c.2907C>A" "r.(?)" "p.(Ser969Arg)" "" "0000877200" "00001687" "50" "2744" "0" "2744" "0" "c.2744A>G" "r.(?)" "p.(Asn915Ser)" "" "0000877506" "00001687" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Thr1201Met)" "" "0000879146" "00001687" "50" "7386" "0" "7386" "0" "c.7386C>G" "r.(?)" "p.(Ile2462Met)" "" "0000893218" "00001687" "90" "7483" "0" "7488" "0" "c.7483_7488dup" "r.(?)" "p.(Leu2495_Glu2496dup)" "" "0000893219" "00001687" "30" "4335" "17" "4335" "45" "c.4335+17_4335+45dup" "r.(=)" "p.(=)" "" "0000893220" "00001687" "50" "3922" "0" "3922" "0" "c.3922C>G" "r.(?)" "p.(Leu1308Val)" "" "0000893221" "00001687" "50" "3092" "0" "3092" "0" "c.3092G>A" "r.(?)" "p.(Arg1031His)" "" "0000893222" "00001687" "50" "3000" "0" "3000" "0" "c.3000C>A" "r.(?)" "p.(Phe1000Leu)" "" "0000893223" "00001687" "30" "2689" "0" "2689" "0" "c.2689C>T" "r.(?)" "p.(Leu897=)" "" "0000893224" "00001687" "50" "1232" "0" "1232" "0" "c.1232C>T" "r.(?)" "p.(Pro411Leu)" "" "0000893225" "00001687" "30" "65" "-17" "65" "-17" "c.65-17C>G" "r.(=)" "p.(=)" "" "0000899340" "00001687" "50" "2573" "0" "2573" "0" "c.2573C>G" "r.(?)" "p.(Ser858Cys)" "" "0000914707" "00001687" "50" "7463" "0" "7463" "0" "c.7463G>C" "r.(?)" "p.(Arg2488Pro)" "" "0000914708" "00001687" "50" "7150" "0" "7150" "0" "c.7150G>A" "r.(?)" "p.(Gly2384Ser)" "" "0000914709" "00001687" "30" "4580" "0" "4580" "0" "c.4580G>A" "r.(?)" "p.(Arg1527His)" "" "0000914710" "00001687" "50" "1814" "0" "1814" "0" "c.1814T>C" "r.(?)" "p.(Met605Thr)" "" "0000920366" "00001687" "70" "2610" "0" "2610" "0" "c.2610G>A" "r.(?)" "p.(Met870Ile)" "19" "0000926364" "00001687" "30" "7471" "0" "7471" "0" "c.7471C>T" "r.(?)" "p.(Arg2491Trp)" "" "0000926365" "00001687" "30" "7180" "0" "7180" "0" "c.7180G>A" "r.(?)" "p.(Gly2394Ser)" "" "0000926366" "00001687" "30" "6660" "13" "6660" "13" "c.6660+13G>T" "r.(=)" "p.(=)" "" "0000926367" "00001687" "30" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Pro337Ser)" "" "0000927789" "00001687" "30" "4770" "0" "4770" "0" "c.4770G>A" "r.(?)" "p.(Val1590=)" "" "0000927815" "00001687" "30" "7332" "0" "7332" "0" "c.7332C>T" "r.(?)" "p.(Tyr2444=)" "" "0000932974" "00001687" "70" "6058" "0" "6058" "0" "c.6058G>A" "r.(?)" "p.(Ala2020Thr)" "" "0000950751" "00001687" "30" "7152" "0" "7152" "0" "c.7152C>T" "r.(?)" "p.(Gly2384=)" "" "0000950752" "00001687" "30" "6219" "0" "6219" "0" "c.6219C>T" "r.(?)" "p.(Tyr2073=)" "" "0000950753" "00001687" "10" "5289" "0" "5289" "0" "c.5289C>T" "r.(?)" "p.(Tyr1763=)" "" "0000950754" "00001687" "50" "5134" "0" "5134" "0" "c.5134G>A" "r.(?)" "p.(Val1712Met)" "" "0000950755" "00001687" "30" "4955" "8" "4955" "8" "c.4955+8C>T" "r.(=)" "p.(=)" "" "0000950756" "00001687" "30" "4770" "0" "4770" "0" "c.4770G>A" "r.(?)" "p.(Val1590=)" "" "0000950757" "00001687" "50" "4579" "0" "4579" "0" "c.4579C>T" "r.(?)" "p.(Arg1527Cys)" "" "0000950758" "00001687" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Thr1201Met)" "" "0000950759" "00001687" "50" "3450" "0" "3450" "0" "c.3450C>A" "r.(?)" "p.(His1150Gln)" "" "0000950760" "00001687" "30" "2330" "-16" "2330" "-16" "c.2330-16C>T" "r.(=)" "p.(=)" "" "0000950761" "00001687" "50" "2245" "0" "2250" "0" "c.2245_2250del" "r.(?)" "p.(Gln749_Glu750del)" "" "0000950762" "00001687" "50" "376" "0" "376" "0" "c.376C>G" "r.(?)" "p.(Leu126Val)" "" "0000959785" "00001687" "30" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Pro337Ser)" "" "0000959834" "00001687" "50" "3977" "0" "3977" "0" "c.3977C>T" "r.(?)" "p.(Ala1326Val)" "" "0000968568" "00001687" "30" "8307" "0" "8307" "0" "c.*741C>T" "r.(=)" "p.(=)" "" "0000968570" "00001687" "30" "7530" "0" "7530" "0" "c.7530G>A" "r.(?)" "p.(Pro2510=)" "" "0000968571" "00001687" "70" "7326" "0" "7326" "0" "c.7326del" "r.(?)" "p.(Leu2443Cysfs*71)" "" "0000968572" "00001687" "30" "7239" "0" "7239" "0" "c.7239C>T" "r.(?)" "p.(=)" "" "0000968573" "00001687" "30" "7194" "0" "7194" "0" "c.7194C>T" "r.(?)" "p.(Thr2398=)" "" "0000968574" "00001687" "70" "6775" "0" "6775" "0" "c.6775C>T" "r.(?)" "p.(Gln2259*)" "" "0000968575" "00001687" "50" "6001" "0" "6001" "0" "c.6001C>T" "r.(?)" "p.(Pro2001Ser)" "" "0000968576" "00001687" "30" "5304" "0" "5304" "0" "c.5304C>T" "r.(?)" "p.(=)" "" "0000968578" "00001687" "30" "3700" "-12" "3700" "-12" "c.3700-12G>T" "r.(=)" "p.(=)" "" "0000968580" "00001687" "30" "1779" "0" "1779" "0" "c.1779C>T" "r.(?)" "p.(=)" "" "0000968581" "00001687" "30" "1723" "0" "1723" "0" "c.1723G>A" "r.(?)" "p.(Val575Met)" "" "0000968584" "00001687" "30" "635" "-4" "635" "-4" "c.635-4G>A" "r.spl?" "p.?" "" "0000968586" "00001687" "30" "263" "0" "263" "0" "c.263A>G" "r.(?)" "p.(Asp88Gly)" "" "0000972107" "00001687" "30" "2245" "0" "2250" "0" "c.2245_2250del" "r.(?)" "p.(Gln749_Glu750del)" "" "0000982151" "00001687" "30" "12955" "0" "12955" "0" "c.*5389G>A" "r.(=)" "p.(=)" "" "0000982152" "00001687" "50" "11006" "0" "11006" "0" "c.*3440G>A" "r.(=)" "p.(=)" "" "0000982153" "00001687" "50" "9833" "0" "9833" "0" "c.*2267C>G" "r.(=)" "p.(=)" "" "0000982154" "00001687" "50" "7472" "0" "7477" "0" "c.7472_7477dup" "r.(?)" "p.(Arg2491_Glu2492dup)" "" "0000982155" "00001687" "10" "7374" "0" "7374" "0" "c.7374C>G" "r.(?)" "p.(Phe2458Leu)" "" "0000982156" "00001687" "30" "7180" "0" "7180" "0" "c.7180G>A" "r.(?)" "p.(Gly2394Ser)" "" "0000982157" "00001687" "30" "6661" "-4" "6661" "-4" "c.6661-4C>G" "r.spl?" "p.?" "" "0000982158" "00001687" "70" "6328" "0" "6328" "0" "c.6328C>T" "r.(?)" "p.(Arg2110Trp)" "" "0000982159" "00001687" "50" "5773" "0" "5773" "0" "c.5773C>T" "r.(?)" "p.(Arg1925Trp)" "" "0000982160" "00001687" "30" "5283" "0" "5283" "0" "c.5283G>A" "r.(?)" "p.(=)" "" "0000982161" "00001687" "30" "5139" "0" "5139" "0" "c.5139C>T" "r.(?)" "p.(Leu1713=)" "" "0000982162" "00001687" "30" "5076" "0" "5076" "0" "c.5076C>T" "r.(?)" "p.(=)" "" "0000982163" "00001687" "30" "4955" "9" "4955" "9" "c.4955+9G>A" "r.(=)" "p.(=)" "" "0000982164" "00001687" "30" "4439" "-10" "4439" "-10" "c.4439-10C>T" "r.(=)" "p.(=)" "" "0000982165" "00001687" "30" "4305" "0" "4305" "0" "c.4305C>T" "r.(?)" "p.(=)" "" "0000982166" "00001687" "50" "4252" "0" "4252" "0" "c.4252T>C" "r.(?)" "p.(Tyr1418His)" "" "0000982167" "00001687" "30" "3699" "6" "3699" "6" "c.3699+6C>T" "r.(=)" "p.(=)" "" "0000982168" "00001687" "50" "3456" "-3" "3456" "-3" "c.3456-3C>T" "r.spl?" "p.?" "" "0000982169" "00001687" "30" "3363" "0" "3363" "0" "c.3363A>G" "r.(?)" "p.(=)" "" "0000982170" "00001687" "50" "3055" "0" "3055" "0" "c.3055G>A" "r.(?)" "p.(Gly1019Ser)" "" "0000982171" "00001687" "10" "2815" "0" "2815" "0" "c.2815C>A" "r.(?)" "p.(Leu939Met)" "" "0000982172" "00001687" "50" "2758" "0" "2758" "0" "c.2758C>T" "r.(?)" "p.(Arg920Trp)" "" "0000982173" "00001687" "30" "2132" "0" "2132" "0" "c.2132T>A" "r.(?)" "p.(Met711Lys)" "" "0000982174" "00001687" "50" "1729" "0" "1729" "0" "c.1729G>A" "r.(?)" "p.(Ala577Thr)" "" "0000982175" "00001687" "50" "1591" "0" "1591" "0" "c.1591C>T" "r.(?)" "p.(Arg531Cys)" "" "0000982176" "00001687" "50" "1534" "0" "1534" "0" "c.1534C>T" "r.(?)" "p.(Pro512Ser)" "" "0000982177" "00001687" "50" "1481" "0" "1481" "0" "c.1481C>A" "r.(?)" "p.(Thr494Asn)" "" "0000982178" "00001687" "30" "835" "0" "835" "0" "c.835G>A" "r.(?)" "p.(Gly279Ser)" "" "0000989148" "00001687" "50" "3388" "0" "3388" "0" "c.3388G>A" "r.(?)" "p.(Val1130Ile)" "" "0001002671" "00001687" "30" "13177" "0" "13177" "0" "c.*5611C>T" "r.(=)" "p.(=)" "" "0001002672" "00001687" "10" "7529" "0" "7529" "0" "c.7529C>T" "r.(?)" "p.(Pro2510Leu)" "" "0001002673" "00001687" "30" "7381" "0" "7381" "0" "c.7381G>A" "r.(?)" "p.(Glu2461Lys)" "" "0001002674" "00001687" "30" "7040" "0" "7040" "0" "c.7040A>C" "r.(?)" "p.(Asp2347Ala)" "" "0001002675" "00001687" "30" "6926" "5" "6926" "5" "c.6926+5G>A" "r.spl?" "p.?" "" "0001002676" "00001687" "50" "6818" "0" "6818" "0" "c.6818G>A" "r.(?)" "p.(Ser2273Asn)" "" "0001002677" "00001687" "50" "6777" "0" "6777" "0" "c.6777G>T" "r.(?)" "p.(Gln2259His)" "" "0001002678" "00001687" "30" "6484" "0" "6484" "0" "c.6484C>G" "r.(?)" "p.(Pro2162Ala)" "" "0001002679" "00001687" "50" "6479" "0" "6479" "0" "c.6479C>T" "r.(?)" "p.(Pro2160Leu)" "" "0001002680" "00001687" "50" "6232" "0" "6232" "0" "c.6232G>A" "r.(?)" "p.(Ala2078Thr)" "" "0001002681" "00001687" "30" "6165" "-7" "6165" "-7" "c.6165-7G>A" "r.(=)" "p.(=)" "" "0001002682" "00001687" "30" "6164" "10" "6164" "10" "c.6164+10C>T" "r.(=)" "p.(=)" "" "0001002683" "00001687" "30" "5828" "0" "5828" "0" "c.5828G>A" "r.(?)" "p.(Arg1943Gln)" "" "0001002684" "00001687" "30" "5827" "0" "5827" "0" "c.5827C>T" "r.(?)" "p.(Arg1943Trp)" "" "0001002685" "00001687" "70" "5535" "0" "5547" "0" "c.5535_5547del" "r.(?)" "p.(Glu1845Aspfs*72)" "" "0001002686" "00001687" "70" "5214" "0" "5214" "0" "c.5214G>A" "r.(?)" "p.(Glu1738=)" "" "0001002687" "00001687" "50" "5134" "0" "5134" "0" "c.5134G>A" "r.(?)" "p.(Val1712Met)" "" "0001002688" "00001687" "50" "4939" "0" "4939" "0" "c.4939G>A" "r.(?)" "p.(Glu1647Lys)" "" "0001002689" "00001687" "50" "4881" "0" "4881" "0" "c.4881C>A" "r.(?)" "p.(Asp1627Glu)" "" "0001002690" "00001687" "30" "4863" "0" "4863" "0" "c.4863T>G" "r.(?)" "p.(Ser1621Arg)" "" "0001002691" "00001687" "30" "4850" "0" "4850" "0" "c.4850C>T" "r.(?)" "p.(Thr1617Met)" "" "0001002692" "00001687" "30" "4768" "0" "4768" "0" "c.4768G>A" "r.(?)" "p.(Val1590Met)" "" "0001002693" "00001687" "30" "4766" "0" "4766" "0" "c.4766C>T" "r.(?)" "p.(Thr1589Ile)" "" "0001002694" "00001687" "50" "4631" "0" "4631" "0" "c.4631G>C" "r.(?)" "p.(Arg1544Pro)" "" "0001002695" "00001687" "50" "4608" "0" "4608" "0" "c.4608C>G" "r.(?)" "p.(His1536Gln)" "" "0001002696" "00001687" "50" "4556" "0" "4556" "0" "c.4556A>C" "r.(?)" "p.(Gln1519Pro)" "" "0001002697" "00001687" "50" "4420" "0" "4420" "0" "c.4420G>A" "r.(?)" "p.(Ala1474Thr)" "" "0001002698" "00001687" "30" "4370" "0" "4370" "0" "c.4370C>T" "r.(?)" "p.(Ala1457Val)" "" "0001002699" "00001687" "30" "4195" "0" "4195" "0" "c.4195C>T" "r.(?)" "p.(Arg1399Trp)" "" "0001002700" "00001687" "30" "3918" "0" "3918" "0" "c.3918C>T" "r.(?)" "p.(=)" "" "0001002701" "00001687" "50" "3502" "0" "3502" "0" "c.3502T>G" "r.(?)" "p.(Trp1168Gly)" "" "0001002702" "00001687" "30" "3434" "0" "3434" "0" "c.3434T>C" "r.(?)" "p.(Val1145Ala)" "" "0001002703" "00001687" "50" "3362" "0" "3362" "0" "c.3362C>T" "r.(?)" "p.(Thr1121Ile)" "" "0001002704" "00001687" "30" "3278" "0" "3278" "0" "c.3278C>T" "r.(?)" "p.(Ala1093Val)" "" "0001002705" "00001687" "30" "3000" "0" "3000" "0" "c.3000C>A" "r.(?)" "p.(Phe1000Leu)" "" "0001002706" "00001687" "70" "2972" "0" "2974" "0" "c.2972_2974del" "r.(?)" "p.(Phe991del)" "" "0001002707" "00001687" "50" "2932" "0" "2932" "0" "c.2932G>C" "r.(?)" "p.(Asp978His)" "" "0001002708" "00001687" "30" "2665" "-10" "2665" "-10" "c.2665-10C>G" "r.(=)" "p.(=)" "" "0001002709" "00001687" "50" "2583" "0" "2583" "0" "c.2583G>T" "r.(?)" "p.(Trp861Cys)" "" "0001002710" "00001687" "50" "2545" "0" "2545" "0" "c.2545C>T" "r.(?)" "p.(Arg849Cys)" "" "0001002711" "00001687" "50" "2167" "0" "2167" "0" "c.2167C>T" "r.(?)" "p.(Arg723Cys)" "" "0001002712" "00001687" "30" "1930" "0" "1930" "0" "c.1930G>A" "r.(?)" "p.(Val644Ile)" "" "0001002713" "00001687" "30" "1878" "0" "1878" "0" "c.1878C>G" "r.(?)" "p.(=)" "" "0001002714" "00001687" "50" "1735" "0" "1735" "0" "c.1735T>C" "r.(?)" "p.(Tyr579His)" "" "0001002715" "00001687" "30" "1657" "0" "1657" "0" "c.1657G>A" "r.(?)" "p.(Val553Met)" "" "0001002716" "00001687" "30" "1641" "0" "1641" "0" "c.1641G>A" "r.(?)" "p.(=)" "" "0001002717" "00001687" "50" "1373" "0" "1373" "0" "c.1373G>A" "r.(?)" "p.(Ser458Asn)" "" "0001002718" "00001687" "30" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0001002719" "00001687" "50" "1163" "0" "1163" "0" "c.1163T>C" "r.(?)" "p.(Leu388Pro)" "" "0001002720" "00001687" "30" "1132" "0" "1132" "0" "c.1132A>G" "r.(?)" "p.(Thr378Ala)" "" "0001002721" "00001687" "30" "1049" "0" "1049" "0" "c.1049C>T" "r.(?)" "p.(Ala350Val)" "" "0001002722" "00001687" "30" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "" "0001002723" "00001687" "50" "608" "0" "608" "0" "c.608T>C" "r.(?)" "p.(Leu203Pro)" "" "0001002724" "00001687" "50" "590" "0" "599" "0" "c.590_599del" "r.(?)" "p.(Val197Glyfs*6)" "" "0001015441" "00001687" "50" "7374" "0" "7374" "0" "c.7374C>G" "r.(?)" "p.(Phe2458Leu)" "" "0001015442" "00001687" "30" "6927" "0" "6927" "0" "c.6927G>A" "r.(?)" "p.(=)" "" "0001015443" "00001687" "50" "5963" "0" "5963" "0" "c.5963C>T" "r.(?)" "p.(Ala1988Val)" "" "0001015444" "00001687" "50" "3796" "0" "3796" "0" "c.3796C>A" "r.(?)" "p.(Pro1266Thr)" "" "0001015445" "00001687" "50" "2815" "0" "2815" "0" "c.2815C>A" "r.(?)" "p.(Leu939Met)" "" "0001017865" "00001687" "90" "4073" "0" "4073" "0" "c.4073G>C" "r.(?)" "p.(Arg1358Pro)" "" "0001017879" "00001687" "50" "7420" "0" "7420" "0" "c.7420G>A" "r.(?)" "p.(Val2474Met)" "" "0001017894" "00001687" "50" "85" "0" "85" "0" "c.85G>A" "r.(?)" "p.(Gly29Arg)" "" "0001026784" "00001687" "30" "9865" "0" "9865" "0" "c.*2299G>A" "r.(=)" "p.(=)" "" "0001026785" "00001687" "90" "5290" "0" "5290" "0" "c.5290G>T" "r.(?)" "p.(Glu1764Ter)" "" "0001026786" "00001687" "50" "4007" "0" "4007" "0" "c.4007T>C" "r.(?)" "p.(Ile1336Thr)" "" "0001026787" "00001687" "50" "3632" "0" "3632" "0" "c.3632G>A" "r.(?)" "p.(Arg1211His)" "" "0001026788" "00001687" "50" "3502" "0" "3502" "0" "c.3502T>G" "r.(?)" "p.(Trp1168Gly)" "" "0001026789" "00001687" "30" "1251" "0" "1251" "0" "c.1251C>T" "r.(?)" "p.(His417=)" "" "0001026790" "00001687" "50" "1107" "1" "1107" "1" "c.1107+1G>C" "r.spl?" "p.?" "" "0001029950" "00001687" "50" "2530" "0" "2530" "0" "c.2530G>A" "r.(?)" "p.(Ala844Thr)" "" "0001041431" "00001687" "50" "15985" "0" "15985" "0" "c.*8419A>T" "r.(=)" "p.(=)" "" "0001041432" "00001687" "50" "15983" "0" "15983" "0" "c.*8417G>C" "r.(=)" "p.(=)" "" "0001041433" "00001687" "30" "9865" "0" "9865" "0" "c.*2299G>A" "r.(=)" "p.(=)" "" "0001041434" "00001687" "50" "8962" "0" "8962" "0" "c.*1396G>A" "r.(=)" "p.(=)" "" "0001041435" "00001687" "50" "8595" "0" "8598" "0" "c.*1029_*1032del" "r.(=)" "p.(=)" "" "0001041436" "00001687" "50" "8466" "0" "8467" "0" "c.*900_*901del" "r.(=)" "p.(=)" "" "0001041437" "00001687" "50" "8454" "0" "8463" "0" "c.*888_*897del" "r.(=)" "p.(=)" "" "0001041438" "00001687" "50" "7363" "0" "7363" "0" "c.7363G>A" "r.(?)" "p.(Val2455Met)" "" "0001041439" "00001687" "50" "7157" "0" "7157" "0" "c.7157G>C" "r.(?)" "p.(Arg2386Pro)" "" "0001041440" "00001687" "50" "7092" "0" "7092" "0" "c.7092C>G" "r.(?)" "p.(Asn2364Lys)" "" "0001041441" "00001687" "50" "6733" "0" "6733" "0" "c.6733C>T" "r.(?)" "p.(Arg2245Trp)" "" "0001041442" "00001687" "50" "6680" "0" "6680" "0" "c.6680C>T" "r.(?)" "p.(Ala2227Val)" "" "0001041443" "00001687" "30" "6223" "0" "6223" "0" "c.6223G>A" "r.(?)" "p.(Ala2075Thr)" "" "0001041444" "00001687" "50" "5988" "0" "5988" "0" "c.5988A>G" "r.(?)" "p.(=)" "" "0001041445" "00001687" "30" "5457" "0" "5457" "0" "c.5457G>C" "r.(?)" "p.(Lys1819Asn)" "" "0001041446" "00001687" "30" "4775" "9" "4775" "9" "c.4775+9G>A" "r.(=)" "p.(=)" "" "0001041447" "00001687" "50" "3923" "0" "3923" "0" "c.3923T>C" "r.(?)" "p.(Leu1308Pro)" "" "0001041448" "00001687" "30" "2992" "-8" "2992" "-7" "c.2992-8_2992-7insAGACTCAGTGCATCCCCACGCCCCGCCCTCTCCCC" "r.(=)" "p.(=)" "" "0001041449" "00001687" "30" "2265" "0" "2270" "0" "c.2265_2270del" "r.(?)" "p.(Glu755_Glu756del)" "" "0001041450" "00001687" "50" "2076" "0" "2076" "0" "c.2076G>A" "r.(?)" "p.(=)" "" "0001041451" "00001687" "50" "1496" "0" "1496" "0" "c.1496T>G" "r.(?)" "p.(Val499Gly)" "" "0001041452" "00001687" "30" "1196" "-10" "1196" "-10" "c.1196-10C>T" "r.(=)" "p.(=)" "" "0001041453" "00001687" "30" "1195" "9" "1195" "9" "c.1195+9C>T" "r.(=)" "p.(=)" "" "0001045500" "00001687" "30" "635" "-50" "635" "-50" "c.635-50G>A" "r.(?)" "p.(?)" "" "0001046584" "00001687" "50" "4601" "0" "4601" "0" "c.4601G>A" "r.(?)" "p.(Arg1534Gln)" "" "0001046585" "00001687" "30" "2409" "0" "2409" "0" "c.2409G>C" "r.(?)" "p.(Gln803His)" "" "0001049437" "00001687" "90" "7367" "0" "7367" "0" "c.7367G>A" "r.(?)" "p.(Arg2456His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 29 "{{screeningid}}" "{{variantid}}" "0000000210" "0000013615" "0000044059" "0000071864" "0000044060" "0000071865" "0000044061" "0000071867" "0000044061" "0000071868" "0000044062" "0000071870" "0000044062" "0000071871" "0000044063" "0000071872" "0000044063" "0000071873" "0000044064" "0000071874" "0000044064" "0000071875" "0000044065" "0000071876" "0000044065" "0000071877" "0000044066" "0000071878" "0000044067" "0000071879" "0000044067" "0000071880" "0000044067" "0000071881" "0000270252" "0000602992" "0000292744" "0000649433" "0000292745" "0000649434" "0000300751" "0000663633" "0000300751" "0000663634" "0000300751" "0000663635" "0000304495" "0000667939" "0000395374" "0000826640" "0000395376" "0000826643" "0000395377" "0000826731" "0000395378" "0000826734" "0000434571" "0000920366"