### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = POLG) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "POLG" "polymerase (DNA directed), gamma" "15" "q24" "unknown" "LRG_765" "UD_132118832376" "" "https://www.LOVD.nl/POLG" "" "1" "9179" "5428" "174763" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/POLG_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2011-04-05 00:00:00" "00006" "2017-06-26 22:46:34" "00006" "2025-11-29 09:26:55" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00023868" "POLG" "transcript variant 1" "002" "NM_002693.2" "" "NP_002684.1" "" "" "" "-282" "4166" "3720" "89878026" "89859536" "00008" "2013-11-25 16:45:50" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 24 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00043" "SANDO;SCAE" "mitochondrial recessive ataxia syndrome" "AR" "607459" "" "" "" "00008" "2012-08-30 16:47:27" "00006" "2025-11-29 09:19:00" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00353" "DRVT" "Dravet syndrome" "AD" "607208" "" "short stature; microcephaly; neurological abnormalities; seizures; 1y-onset seizures; seizure triggered by fever; psychomotor development stagnates; stagnates.; mental decline; behavioral problems; learning disabilities; MRI global brain atrophy; EEG irregular generalized spike and wave complexes; microcephaly; ataxia; limited knee extension; muscle weakness; dysgenesis hippocampus" "" "00006" "2014-03-14 16:15:34" "00006" "2023-01-10 16:00:58" "01442" "PEOA1" "ophthalmoplegia, external, progressive, with mitochondrial DNA deletions, autosomal dominant, type 1" "AD" "157640" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-11-28 09:26:13" "01641" "MTDPS4A" "mitochondrial DNA depletion syndrome, type 1 (MTDPS-4A, progressive sclerosing poliodystrophy)" "AR" "203700" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01982" "PEOB1" "ophthalmoplegia, external, progressive, with mitochondrial DNA deletions, autosomal recessive, type 1" "AR" "258450" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-11-28 09:25:25" "03384" "MTDPS4B" "mitochondrial DNA depletion syndrome, type 4B (MTDPS-4B, MNGIE type)" "AR" "613662" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04245" "PEOA" "ophthalmoplegia, external, progressive, with mitochondrial DNA deletions, autosomal dominant (PEOA)" "" "" "" "" "" "00006" "2015-05-01 19:52:34" "" "" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05113" "CMT" "Charcot-Marie-Tooth disease (CMT)" "" "" "" "" "" "00006" "2016-01-11 01:40:57" "" "" "05122" "HSN" "neuropathy, sensory, hereditary (HSN)" "" "" "" "" "" "00006" "2016-01-24 01:36:12" "00006" "2020-04-22 19:42:45" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05147" "CPEO" "ophthalmoplegia, external, progressive, chronic (CPEO)" "" "" "" "" "" "00006" "2016-03-27 15:38:04" "" "" "05356" "ataxia" "ataxia" "" "" "" "" "" "00006" "2017-12-21 19:14:03" "" "" "05374" "MTDPS" "mitochondrial DNA depletion syndrome (MTDPS)" "" "" "" "" "" "00006" "2018-01-01 15:41:06" "" "" "05534" "mitochondrial" "mitochondrial disorder" "" "" "" "maternal mitochondrial" "" "00006" "2018-12-22 14:29:23" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05786" "leukoencephalopathy" "leukoencephalopathy" "" "" "" "" "" "00006" "2020-07-13 16:56:51" "" "" "06495" "RLSDF" "Rhizomelic limb shortening with dysmorphic features" "AR" "618821" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "POLG" "00043" "POLG" "01442" "POLG" "01641" "POLG" "01982" "POLG" "03384" ## Individuals ## Do not remove or alter this header ## ## Count = 204 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000042" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000046" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000078" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000085" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000086" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000088" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00016320" "" "" "" "1" "" "00681" "" "" "M" "no" "Italy" "" "0" "" "" "" "" "00036538" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036539" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036540" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036541" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036542" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036543" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036544" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036545" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036546" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036547" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036548" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036549" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036550" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036551" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036552" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036553" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036554" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036555" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036556" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036557" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036558" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036559" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036560" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036561" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036562" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036563" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036564" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036565" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036566" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036567" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036568" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036569" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036570" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036571" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036572" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036573" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036574" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036575" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036576" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00080863" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00105903" "" "" "" "1" "" "02119" "Castiglioni, submitted" "" "F" "no" "Chile" "" "0" "" "" "" "" "00105904" "" "" "" "1" "" "02119" "Castiglioni, submitted" "" "F" "no" "Chile" "" "0" "" "" "" "" "00105907" "" "" "" "1" "" "02119" "Castiglioni, submitted" "" "M" "no" "Italy" "" "0" "" "" "" "" "00177006" "" "" "" "1" "" "02552" "" "" "M" "no" "Switzerland" "" "0" "" "" "" "71693" "00207382" "" "" "" "3" "" "03113" "" "also has a dominant MYH7 mutation with cardiomyopathy" "F" "no" "Portugal" ">52y" "0" "" "ubiquinone 200 mg daily" "white" "" "00209012" "" "" "" "1" "" "00006" "{PMID:Lionel 2018:28771251}" "" "F" "" "Canada" "" "0" "" "" "" "28771251-Pat14" "00210176" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00219070" "" "" "" "1" "" "00006" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "analysis 612 patients" "F" "" "(Germany)" "" "0" "" "" "" "28902413-Pat80" "00219071" "" "" "" "1" "" "00006" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "analysis 612 patients" "F" "" "(Germany)" "" "0" "" "" "" "28902413-Pat81" "00248133" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00269588" "" "" "" "1" "" "03508" "" "" "M" "no" "Korea" "" "0" "" "" "" "" "00274205" "" "" "" "1" "" "00006" "{PMID:Pronicka 2016:27290639}" "no family history" "M" "" "Poland" "" "0" "" "" "" "Pat113" "00291319" "" "" "" "90" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291320" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291321" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291322" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291323" "" "" "" "65" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291324" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291325" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291326" "" "" "" "12" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291327" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291328" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291329" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291330" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291331" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291332" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291333" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296539" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00299686" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00301394" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00304485" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00307458" "" "" "" "1" "" "00006" "{PMID:Stalke 2018:28776642}" "" "" "" "Germany" "" "0" "" "" "" "Fam32PatLP149" "00308747" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00309883" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00314395" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00324340" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00324868" "" "" "" "1" "" "00006" "{DOI:Schalk 2020:10.1101/2020.12.23.424103}, {PMID:Schalk 2022:34930816}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "United States" "" "0" "" "" "" "Fam1" "00334900" "" "" "" "3" "" "00006" "{PMID:Tao 2011:21276947}, {PMID:Sandford 2016:26942291}" "2-generation family, affected sister/brother and sibling (of sister)" "F" "" "United States" "" "0" "" "" "" "Pat4" "00334912" "" "" "00334900" "1" "" "00006" "{PMID:Sandford 2016:26942291}" "sibling patient 4" "M" "" "United States" "" "0" "" "" "" "Pat4-sib" "00374447" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1439" "00374767" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5822" "00384650" "" "" "" "1" "" "04132" "{PMID:Lin 2021:34189666}" "2-generation family, 1 affected, unaffected heterozygous carrier mother" "M" "no" "China" "" "0" "" "" "" "patient" "00387997" "" "" "" "1" "" "04132" "{PMID:Hedberg-Oldfors 2020:32042919}" "2-generation family, 1 affected, unaffected heterozygous carrier relatives" "M" "no" "Sweden" "" "0" "" "" "" "patient" "00388005" "" "" "" "1" "" "04132" "{PMID:Phillips 2019:30843307}" "2-generation family, 1 affected, unaffected heterozygous carrier mother/relatives" "F" "no" "Germany" "" "0" "" "" "" "Fam1PatII1" "00388009" "" "" "" "1" "" "04132" "{PMID:Phillips 2019:30843307}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "United States" "" "0" "" "" "" "Fam2PatII1" "00388180" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "" "M" "" "Korea" "" "0" "" "" "" "37" "00396466" "" "" "" "1" "" "00000" "{PMID:Sudha 2017:28574807}" "" "M" "" "(United States)" "" "0" "" "" "" "101" "00402846" "" "" "" "2" "" "04266" "" "" "M" "no" "United States" "" "" "" "" "white" "199792" "00428413" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "208205" "00435463" "" "" "" "1" "" "00006" "{PMID:Sajan 2019:30478137}" "-generation family, 1 affected, unaffected heterozygous parents" "" "" "United States" "" "0" "" "" "" "Pat1" "00438678" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0652" "00453109" "" "" "" "1" "" "00006" "{PMID:Rots 2024:39013459}, {DOI:Rots 2024:10.1016/j.ajhg.2024.06.009}" "" "M" "" "" "" "0" "" "" "" "Pat65" "00454711" "" "" "" "3" "" "00095" "{PMID:Legati 2016:26968897}" "2-generation family, affected patient, mother and brother" "M" "" "" "" "0" "" "" "" "NGSP98" "00454712" "" "" "" "1" "" "00095" "{PMID:Legati 2016:26968897}" "" "F" "" "" "" "0" "" "" "" "NGSP60" "00454713" "" "" "" "1" "" "00095" "{PMID:Legati 2016:26968897}" "" "M" "" "" "" "0" "" "" "" "NGSP1" "00454714" "" "" "" "1" "" "00095" "{PMID:Legati 2016:26968897}" "" "M" "" "" "" "0" "" "" "" "NGSP48" "00464071" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00467550" "" "" "" "1" "" "03676" "" "" "M" "no" "Egypt" "5 years" "" "" "" "" "" "00468033" "" "" "" "1" "" "00006" "{PMID:Ohba 2013:24091540}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Japan" "" "0" "" "" "" "Pat5" "00469239" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00469240" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470152" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatA" "00470153" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatB" "00470154" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatC" "00470155" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatD" "00470156" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatE" "00470157" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatF" "00470158" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatG" "00470159" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatH" "00470160" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatI" "00470161" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatJ" "00470162" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatK" "00470163" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatL" "00470164" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatM" "00470165" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatN" "00470166" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatO" "00470167" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatP" "00470168" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatQ" "00470169" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatR" "00470170" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatS" "00470171" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatT" "00470172" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatU" "00470173" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatV" "00470174" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatW" "00470175" "" "" "" "1" "" "00006" "{PMID:Ashley 2008:18487244}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatX" "00470177" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "2-generation family, affected brother/sister" "M" "" "Norway" "" "0" "" "" "" "FamBIII1;FamAPat1" "00470178" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "sister" "F" "" "Norway" "" "0" "" "" "" "FamBIII2;FamAPat2" "00470179" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "2-generation family, affected brother/sister" "M" "" "Norway" "55y" "0" "" "" "" "FamAIII1;FamBPat1" "00470180" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "sister" "F" "" "Norway" "" "0" "" "" "" "FamAIII3;FamBPat2" "00470181" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat5" "00470182" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "20y" "0" "" "" "" "Pat6" "00470183" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "FamGPat7" "00470184" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "10y" "0" "" "" "" "Pat8" "00470185" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "19y" "0" "" "" "" "FamCPat9" "00470186" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "FamCPat10" "00470187" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "21y" "0" "" "" "" "FamDPat11" "00470188" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "23y" "0" "" "" "" "FamDPat12" "00470189" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "9y" "0" "" "" "" "Pat13" "00470190" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "13y" "0" "" "" "" "Pat15" "00470191" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat16" "00470192" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat17" "00470193" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "30y" "0" "" "" "" "FamFPat18" "00470194" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "22y" "0" "" "" "" "FamFPat19" "00470195" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "57y" "0" "" "" "" "Pat20" "00470196" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat21" "00470197" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat22" "00470198" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat23" "00470199" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat24" "00470200" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat25" "00470201" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "Pat26" "00470202" "" "" "" "1" "" "00006" "{PMID:Tzoulis 2006:16638794}" "" "" "" "Norway" "" "0" "" "" "" "FamGPat27" "00470203" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}" "" "M" "" "Norway" "" "0" "" "" "" "FamCPatIII1" "00470204" "" "" "" "1" "" "00006" "{PMID:Winterthun 2005:15824347}" "adopted" "F" "" "Norway" "" "0" "" "" "" "PatS1" "00470205" "" "" "" "1" "" "00006" "{PMID:Sato 2011:21301859}" "2-generation family, 1 affected" "M" "no" "Japan" "" "0" "" "" "" "FamAPatII2" "00470206" "" "" "" "1" "" "00006" "{PMID:McKelvie 2012:22357363}" "" "F" "" "Australia" "66y" "0" "" "" "" "patient" "00470207" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat1" "00470208" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat2" "00470209" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat3" "00470210" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat4" "00470211" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat5" "00470212" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat6" "00470213" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat7" "00470214" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat8" "00470215" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat9" "00470216" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat10" "00470217" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat11" "00470218" "" "" "" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "" "" "" "Australia" "" "0" "" "" "" "Pat12" "00470219" "" "" "" "2" "" "00006" "{PMID:Hunter 2011:22000311}" "family, 2 affected brothers" "M" "" "Australia" "<3m" "0" "" "" "" "Pat13" "00470220" "" "" "00470219" "1" "" "00006" "{PMID:Hunter 2011:22000311}" "brother" "M" "" "Australia" "<3m" "0" "" "" "" "Pat14" "00470221" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat1" "00470222" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat2" "00470223" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat3" "00470224" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat4" "00470225" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat5" "00470226" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat6" "00470227" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat7" "00470228" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat8" "00470229" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat9" "00470230" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat10" "00470231" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat11" "00470232" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat12" "00470233" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat13" "00470234" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat14" "00470235" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat15" "00470236" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat16" "00470237" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat17" "00470238" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat18" "00470239" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat19" "00470240" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat20" "00470241" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat21" "00470242" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat22" "00470243" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat23" "00470244" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat24" "00470245" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat25" "00470246" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat26" "00470247" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat27" "00470248" "" "" "" "1" "" "00006" "{PMID:Bereau 2016:27538604}" "" "" "" "France" "" "0" "" "" "" "Pat28" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 168 "{{individualid}}" "{{diseaseid}}" "00016320" "00353" "00036540" "00198" "00036546" "00198" "00036549" "00198" "00036551" "00198" "00036554" "00198" "00036556" "00198" "00036557" "00198" "00036564" "00198" "00036566" "00198" "00036575" "00198" "00036576" "00198" "00080863" "01982" "00105903" "00198" "00105904" "00198" "00105907" "00198" "00177006" "00344" "00207382" "05147" "00209012" "00198" "00219070" "05122" "00219071" "05122" "00269588" "04210" "00274205" "00198" "00291319" "00198" "00291320" "00198" "00291321" "00198" "00291322" "00198" "00291323" "00198" "00291324" "00198" "00291325" "00198" "00291326" "00198" "00291327" "00198" "00291328" "00198" "00291329" "00198" "00291330" "00198" "00291331" "00198" "00291332" "00198" "00291333" "00198" "00296539" "00198" "00299686" "00198" "00301394" "00198" "00304485" "00198" "00307458" "05374" "00308747" "00000" "00309883" "00198" "00314395" "05126" "00324340" "00198" "00324868" "05611" "00334900" "04270" "00334912" "04270" "00374447" "00198" "00374767" "00198" "00384650" "05147" "00387997" "04245" "00388005" "05113" "00388009" "05113" "00388180" "04214" "00396466" "04214" "00402846" "03384" "00428413" "01641" "00435463" "06495" "00438678" "06906" "00453109" "05611" "00454711" "05534" "00454712" "05534" "00454713" "05534" "00454714" "05534" "00464071" "05786" "00467550" "01641" "00468033" "00198" "00469239" "00198" "00469240" "00198" "00470152" "05374" "00470153" "05374" "00470154" "05374" "00470155" "05374" "00470156" "05374" "00470157" "05374" "00470158" "05374" "00470159" "05374" "00470160" "05374" "00470161" "05374" "00470162" "05374" "00470163" "05374" "00470164" "05374" "00470165" "05374" "00470166" "05374" "00470167" "05374" "00470168" "05374" "00470169" "05374" "00470170" "05374" "00470171" "05374" "00470172" "05374" "00470173" "05374" "00470174" "05374" "00470175" "05374" "00470177" "00198" "00470178" "00198" "00470179" "00198" "00470180" "00198" "00470181" "00198" "00470182" "00198" "00470183" "00198" "00470184" "00198" "00470185" "00198" "00470186" "00198" "00470187" "00198" "00470188" "00198" "00470189" "00198" "00470190" "00198" "00470191" "00198" "00470192" "00198" "00470193" "00198" "00470194" "00198" "00470195" "00198" "00470196" "00198" "00470197" "00198" "00470198" "00198" "00470199" "00198" "00470200" "00198" "00470201" "00198" "00470202" "00198" "00470203" "05356" "00470204" "00198" "00470205" "00198" "00470206" "00198" "00470207" "00198" "00470208" "00198" "00470209" "00198" "00470210" "00198" "00470211" "00198" "00470212" "00198" "00470213" "00198" "00470214" "00198" "00470215" "00198" "00470216" "00198" "00470217" "00198" "00470218" "00198" "00470219" "00198" "00470220" "00198" "00470221" "00198" "00470222" "00198" "00470223" "00198" "00470224" "00198" "00470225" "00198" "00470226" "00198" "00470227" "00198" "00470228" "00198" "00470229" "00198" "00470230" "00198" "00470231" "00198" "00470232" "00198" "00470233" "00198" "00470234" "00198" "00470235" "00198" "00470236" "00198" "00470237" "00198" "00470238" "00198" "00470239" "00198" "00470240" "00198" "00470241" "00198" "00470242" "00198" "00470243" "00198" "00470244" "00198" "00470245" "00198" "00470246" "00198" "00470247" "00198" "00470248" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00043, 00198, 00344, 00353, 01442, 01641, 01982, 03384, 04210, 04214, 04245, 04270, 05113, 05122, 05126, 05147, 05356, 05374, 05534, 05611, 05786, 06495, 06906 ## Count = 150 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000014934" "00353" "00016320" "00681" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060432" "01982" "00080863" "01758" "Familial, autosomal recessive" "" "Progressive external ophthalmoplegia, autosomal recessive 1 (OMIM:258450)" "" "" "" "" "" "" "" "" "" "" "" "0000083826" "00198" "00105907" "02119" "Familial, autosomal recessive" "" "mitochondrial distal myopathy with cachexia, sensory-motor neuropathy, mitochondrial myopathy, congenital cataracts and glaucoma" "" "" "" "" "" "" "" "" "" "" "" "0000083828" "00198" "00105903" "02119" "Familial, autosomal recessive" "" "mitochondrial distal myopathy with cachexia, sensory-motor neuropathy, mitochondrial myopathy, congenital cataracts and glaucoma" "" "" "" "" "" "" "" "" "" "" "" "0000084484" "00198" "00105904" "02119" "Familial, autosomal recessive" "" "generalized muscle wasting with distal tetraparesis,acute glaucoma, secondary myelin abnormalities" "" "" "" "" "" "" "" "" "" "" "" "0000141824" "00344" "00177006" "02552" "Familial, autosomal recessive" "" "HP:0008936\r\nHP:0002078\r\nHP:0002066\r\nHP:0002522\r\nHP:0001761\r\nHP:0000154\r\nHP:0004533" "01y06m" "" "" "" "" "" "" "" "" "" "" "0000155153" "05147" "00207382" "03113" "Familial, autosomal recessive" "52y" "" "45y" "48y" "" "" "" "" "" "" "" "" "" "0000156572" "00198" "00036540" "01164" "Unknown" "" "Leigh syndrome" "" "" "" "" "" "" "" "" "" "Leigh syndrome" "" "0000156573" "00198" "00036546" "01164" "Unknown" "" "FIRES" "" "" "" "" "" "" "" "" "" "FIRES" "" "0000156574" "00198" "00036549" "01164" "Unknown" "" "suspected CPEO, since 3-4 years impaired vision (flickering before the eyes, double vision), ptosis left>right" "" "" "" "" "" "" "" "" "" "CPEO?" "" "0000156575" "00198" "00036551" "01164" "Unknown" "" "epileptic encephalopathy , cardiopulmonary reanimation perinatal, ventilation, dysphagia, ASD II; family history: brother died (same disease)" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000156576" "00198" "00036554" "01164" "Unknown" "" "cerebellar syndrome" "" "" "" "" "" "" "" "" "" "cerebellar syndrome" "" "0000156577" "00198" "00036556" "01164" "Unknown" "" "suspected SANDO syndrome, epilepsy, mental retardation, ataxia, dysarthria" "" "" "" "" "" "" "" "" "" "SANDO syndrome?" "" "0000156578" "00198" "00036557" "01164" "Unknown" "" "suspected Alpers syndrome, occipital epilepsy" "" "" "" "" "" "" "" "" "" "Alpers syndrome?" "" "0000156579" "00198" "00036564" "01164" "Unknown" "" "suspected progressive myoklonic epilepsiy (Unverricht-Lundborg-disease), since the seventh year of life disorders of psychological development , epilepsy with myoklonic and grand-mal-seizures , hepatomegaly with cholestatic hepatitis, diabetes mellitus type 2, ataxia -mild pyramidalsyndrome, strabismus with diplopia and mild extrapyramidal symptomatology, family history:cousin of father died from hepatic disease at the age of 38" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000156580" "00198" "00036566" "01164" "Unknown" "" "severe abnormal development with Myelinisierungsstörung, progressive brain atrophy and epilepsy,Valproat-Therapy is planned" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000156581" "00198" "00036575" "01164" "Unknown" "" "ptosis and mild CPEO; suspected autosomal dominant inheritance, sister of index ptosis, mild tetraparesis and white matter lesions in cMRT,father of index and his sister affected with CPEO; other patient: neonatal myoklonic seizures" "" "" "" "" "" "" "" "" "" "CPEO" "" "0000156582" "00198" "00036576" "01164" "Unknown" "" "ptosis and mild CPEO; suspected autosomal dominant inheritance, sister of index ptosis, mild tetraparesis and white matter lesions in cMRT,father of index and his sister affected with CPEO; other patient: neonatal myoklonic seizures" "" "" "" "" "" "" "" "" "" "CPEO" "" "0000157617" "00198" "00209012" "00006" "Familial, autosomal recessive" "" "Complex neurological phenotype" "" "" "" "" "" "" "" "" "SANDO" "complex neurological phenotype" "" "0000158748" "00198" "00210176" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0011805 (Abnormality of muscle morphology)" "" "" "" "" "" "" "" "" "" "" "" "0000167627" "05122" "00219070" "00006" "Unknown" "" "PEO, MERRF, sensory ataxic neuropathy; no family history" "" "" "" "" "" "" "" "" "" "hereditary sensory neuropathy" "" "0000167628" "05122" "00219071" "00006" "Unknown" "" "PEO, MERRF, sensory ataxic neuropathy; no family history" "" "" "" "" "" "" "" "" "" "hereditary sensory neuropathy" "" "0000187136" "00198" "00248133" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0001324 (Muscle weakness); HP:0011804 (Abnormality of muscle physiology)" "" "" "" "" "" "" "" "" "" "" "" "0000209150" "00198" "00274205" "00006" "Familial, autosomal recessive" "" "deceased; mitochondrial disease criteria score 4; muscle biopsy" "" "" "" "" "" "" "" "" "" "expected mitochondrial disorder" "" "0000223946" "00198" "00296539" "01164" "Unknown" "" "Sensorimotor neuropathy (HP:0007141)" "" "" "" "" "" "" "" "" "" "" "" "0000226991" "00198" "00299686" "01164" "Unknown" "" "Seizures (HP:0001250)" "" "" "" "" "" "" "" "" "" "" "" "0000228572" "00198" "00301394" "01164" "Unknown" "" "Ataxia (HP:0001251); Tremor (HP:0001337)" "" "" "" "" "" "" "" "" "" "" "" "0000233172" "05374" "00307458" "00006" "Unknown" "17y" "liver fibrosis with portal hypertension" "" "" "" "" "" "" "" "" "" "mitochondrial DNA depletion syndromes" "" "0000235200" "00198" "00309883" "01164" "Unknown" "" "Ptosis (HP:0000508)" "" "" "" "" "" "" "" "" "" "" "" "0000242883" "00198" "00324340" "01807" "Unknown" "" "Mitochondrial inheritance (HP:0001427); Mitochondrial myopathy (HP:0003737); Mitochondrial encephalopathy (HP:0006789); Epilepsia partialis continua (HP:0012847)" "" "" "" "" "" "" "" "" "" "" "" "0000243364" "05611" "00324868" "00006" "Isolated (sporadic)" "10y10m" "see paper; ..., birth 41w, weight -0.3SD, length -0.3SD; weight +0SD, length +0.6SD, OFC +0.6SD; mild intellectual disability/developemental delay; seizures; motor delay; speech delay; 12-24m-first words; autistic behaviour; stereotypies with echolalia; hyperactivity; anxiety; aggressiveness; no feeding difficulties; sleeping disturbance; no prominent forehead; no prominent forehead; no flat nasal bridge; no thin upper lip; hypothyroidy, growth hormone deficiency" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000252685" "04270" "00334900" "00006" "Unknown" "" "myoclonic seizures, generalized EEG pattern, ataxia; brother with same variants and similar clinical phenotype with myoclonic seizures and generalized discharges" "" "" "" "" "" "" "" "" "" "" "" "0000252688" "04270" "00334912" "00006" "Unknown" "" "see paper; ..., atypical Unverricht Lundborg disease (early-onset myoclonus epilepsy, ataxia)" "" "" "" "" "" "" "" "" "" "" "" "0000269657" "00198" "00374447" "00006" "Familial, autosomal recessive" "" "Mitochondrial cytopathy, basal ganglia abnormality, cerebral atrophy, encephalopathy, generalized seizures, epilepsy, delayed motor development, failure to thrive, regression of milestones since 15 months of age, hypotonia, and attention and cognitive deficit" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000269977" "00198" "00374767" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "epilepsy, ataxia" "" "0000281503" "05147" "00384650" "04132" "Familial, autosomal recessive" "33y" "strabismus (HP:0000486), ophthalmoplegia (HP:0000602), bilateral ptosis (HP:0001488), exotropia ( HP:0000577), ophthalmoparesis ( HP:0000597), Abnormality of eye movement ( HP:0000496)" "" "33y" "" "" "" "" "" "" "progressive external ophthalmoplegia (HP:0000590)" "" "" "0000281591" "04245" "00387997" "04132" "Familial, autosomal recessive" "69y" "bilateral ptosis (HP:0001488), horizontal ophthalmoplegia (HP:0000602), slight bilateral sensory-neuronal hearing impairment (HP:0008619), atrophy of the mesencephalon pedunculus cerebelli superior (HP:0001272), frontotemporal parts of the brain (HP:0006892)" "" "69y" "" "" "" "" "" "" "Progressive external ophthalmoplegia (HP:0000544)" "" "" "0000281601" "05113" "00388005" "04132" "Familial, autosomal recessive" "" "Impaired vibration sensation in the lower limbs (HP:0002166), Impaired pain sensation (HP:0007328), Ophthalmoparesis (HP:0000597), Decreased amplitude of sensory action potentials (HP:0007078), normal to reduced motor responses in the feet\r\nChronic denervation signs (HP:0003444), Postural instability (HP:0002172)" "49y" "54y" "" "" "" "" "" "" "" "Charcot-Marie-Tooth disease" "" "0000281604" "05113" "00388009" "04132" "Familial, autosomal recessive" "06y" "Global developmental delay (HP:0001263), delayed speech), Postural instability (HP:0002172), Abnormality of the Achilles tendon (HP:0005109), Achalasia (HP:0002571), Ankle weakness (HP:0031374), Weakness of the intrinsic hand muscles (HP:0009005), Proximal muscle weakness (HP:0003701), Impaired vibratory sensation (HP:0002495), Impaired pain sensation (HP:0007328), EMG: chronic denervation signs (HP:0003444)" "" "" "" "" "" "" "" "" "" "Charcot-Marie-Tooth disease" "" "0000281773" "04214" "00388180" "00000" "Unknown" "4y10m" "Nystagmus: Wandering eye movement, best corrected visual acuity right eye/left eye: FC/FC, fundus: Pigmentary retinopathy, Marbled fundus, ERG: Extinguished, additional features: Chronic pancreatitis, Nephronophthisis, Caroli disease, Hypotonia, Mental retardation, Leigh-like syndrome" "" "" "" "" "" "" "" "" "Senior Loken syndrome" "Senior Loken syndrome" "" "0000289627" "04214" "00396466" "00000" "Familial, X-linked recessive" "" "retinoschisis with developmental delay, sensorineural hearing loss, and reduced axial tone" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000295607" "03384" "00402846" "04266" "Unknown" "" "Multiple autoimmune diagnoses (psoriasis, eosinophilic colitis, inflammatory arthritis)" "03y" "10y" "" "" "" "" "" "" "DNA Polymerase Gamma1 genetic testing (174763)" "lactate deposits on brain MRI; abnormal muscle biopsy" "" "0000319318" "01641" "00428413" "01164" "Unknown" "01y" "Status epilepticus, Refractory drug response, Developmental stagnation at onset of\r\nseizures, Hemiparesis, Myoclonus, Decreased liver function, Fatal liver failure in\r\ninfancy, Seizure, Developmental stagnation at onset of seizures, Infantile muscular\r\nhypotonia" "" "" "" "" "" "" "" "" "" "" "" "0000325653" "06495" "00435463" "00006" "Familial, autosomal recessive" "" "see paper; ..., birth weight 3.18kg (32nd), length 50.8cm (69th); weight 73.6kg (92nd), height 156.7 cm (17th), OFC 55.4 cm (84th), body mass index 30 kg/m2 (96th); Rhizomelic shortening and milder mesomelic shortening upper and lower extremities, short thumbs, bilateral short 5th fingers, hyperextensible fingers, bilateral middle finger clinodactyly, limited range of motion shoulder joints, chronic joint pain, juvenile idiopathic arthritis, bilateral patellofemoral joint dislocation; prominent forehead, downslanting palpebral fissures, broad nasal bridge, long philtrum; obesity, left-sided headaches, acanthosis nigricans, chronic stage 1 kidney disease, café au lait macule on upper right arm, depressed mood, occasional abdominal pain, dizziness, nausea, left-sided small branchial cleft defect covered with skin without an obvious fistula; no cardiac anomalirs" "" "<00y06m" "" "" "" "" "" "" "RLSDF" "rhizomelic shortening of limbs, dysmorphic features" "" "0000328581" "06906" "00438678" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000341754" "05611" "00453109" "00006" "Isolated (sporadic)" "20y" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "KLEFS2" "neurodevelopmental disorder" "" "0000343339" "05534" "00454711" "00095" "Familial, autosomal dominant" "" "myopathy" "30y" "" "" "" "" "" "" "" "" "" "" "0000343340" "05534" "00454712" "00095" "Unknown" "" "progressive external ophtalmoparesis" "38y" "" "" "" "" "" "" "" "" "multiple RC complex defect" "" "0000343341" "05534" "00454713" "00095" "Unknown" "" "pshycomotor delay, epileptic encephalopathy" "<6m" "" "" "" "" "" "" "" "" "pyruvate dehydrogenase complex deficiency" "" "0000343342" "05534" "00454714" "00095" "Unknown" "" "pshycomotor delay, epilepsy, leukoencephalopathy" "<1y" "" "" "" "" "" "" "" "" "multiple RC complex defect" "" "0000350133" "05786" "00464071" "03544" "Isolated (sporadic)" "" "HP:0002352, HP:0002180" "" "" "" "" "" "" "" "" "POLG-related" "neurodegeneration" "" "0000353185" "00198" "00468033" "00006" "Familial, autosomal recessive" "8y" "see paper; ..., ataxia; no dysmetria; no oculomotor apraxia; no intention tremor;  ; developmental delay; intellectual disability; hypotonia; no pyramidal sign; no extrapyramidal sign; no epileptic seizure;  ; MRI cerebellar atrophy/hypoplasia, no brainstem atrophy" "6m" "" "hypotonia" "" "" "" "" "" "" "hypotonia" "" "0000354392" "00198" "00469239" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000354393" "00198" "00469240" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000355297" "05374" "00470152" "00006" "Familial, autosomal recessive" "<1y" "see paper; ..., epilepsy; hepatopathy; mild movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355298" "05374" "00470153" "00006" "Familial, autosomal recessive" "6m" "see paper; ..., epilepsy; hepatopathy" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355299" "05374" "00470154" "00006" "Familial, autosomal recessive" "5m" "see paper; ..., epilepsy; hepatopathy" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355300" "05374" "00470155" "00006" "Familial, autosomal recessive" "5m" "see paper; ..., epilepsy; hepatopathy" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355301" "05374" "00470156" "00006" "Familial, autosomal recessive" "Birth" "see paper; ..., epilepsy; hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355302" "05374" "00470157" "00006" "Familial, autosomal recessive" "1y" "see paper; ..., epilepsy; hepatopathy; mild movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355303" "05374" "00470158" "00006" "Familial, autosomal recessive" "2y3m" "see paper; ..., epilepsy; hepatopathy; no movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355304" "05374" "00470159" "00006" "Familial, autosomal recessive" "7m" "see paper; ..., epilepsy; hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355305" "05374" "00470160" "00006" "Familial, autosomal recessive" "4y" "see paper; ..., epilepsy; hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355306" "05374" "00470161" "00006" "Familial, autosomal recessive" "18m" "see paper; ..., epilepsy; hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355307" "05374" "00470162" "00006" "Familial, autosomal recessive" "7m" "see paper; ..., epilepsy; hepatopathy; mild movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355308" "05374" "00470163" "00006" "Familial, autosomal recessive" "16y" "see paper; ..., epilepsy; mild hepatopathy; mild movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355309" "05374" "00470164" "00006" "Familial, autosomal recessive" "10y" "see paper; ..., no epilepsy; no hepatopathy; no movement disorder" "" "" "" "" "" "" "" "" "" "" "" "0000355310" "05374" "00470165" "00006" "Familial, autosomal recessive" "13m" "see paper; ..., epilepsy; hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355311" "05374" "00470166" "00006" "Familial, autosomal recessive" "6y" "see paper; ..., epilepsy; no hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355312" "05374" "00470167" "00006" "Familial, autosomal recessive" "15y" "see paper; ..., hepatopathy" "" "" "" "" "" "" "" "" "" "" "" "0000355313" "05374" "00470168" "00006" "Familial, autosomal recessive" "18m" "see paper; ..., epilepsy; mild hepatopathy; no movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355314" "05374" "00470169" "00006" "Familial, autosomal recessive" "4y" "see paper; ..., epilepsy; no movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355315" "05374" "00470170" "00006" "Familial, autosomal recessive" "4m" "see paper; ..., epilepsy; hepatopathy; mild movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355316" "05374" "00470171" "00006" "Familial, autosomal recessive" "2y" "see paper; ..., no hepatopathy" "" "" "" "" "" "" "" "" "" "" "" "0000355317" "05374" "00470172" "00006" "Familial, autosomal recessive" "15y" "see paper; ..., no epilepsy; no hepatopathy" "" "" "" "" "" "" "" "" "" "" "" "0000355318" "05374" "00470173" "00006" "Familial, autosomal recessive" "17y" "see paper; ..., epilepsy; no hepatopathy" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355319" "05374" "00470174" "00006" "Familial, autosomal dominant" "16y" "see paper; ..., epilepsy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355320" "05374" "00470175" "00006" "Familial, autosomal dominant" "3y" "see paper; ..., epilepsy; no hepatopathy; movement disorder" "" "" "" "" "" "" "" "" "MTDPS4A" "Alpert syndrome" "" "0000355322" "00198" "00470177" "00006" "Familial, autosomal recessive" "45y" "see paper; ..., ataxia; epilepsy; no status epilepticus; headache; nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 30y-ptosis" "8y" "" "headache" "" "" "" "" "" "" "headache" "" "0000355323" "00198" "00470178" "00006" "Familial, autosomal recessive" "41y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus, focal motor activity; headache; nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 26y-ptosis" "17y" "" "epilepsy, migraine-like headache" "" "" "" "" "" "" "epilepsy, migraine-like headache" "" "0000355324" "00198" "00470179" "00006" "Familial, autosomal recessive" "55y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus; headache; no nystagmus; myoclonus; muscle biopsy normal; neuropathy; 35y-ptosis" "5y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355325" "00198" "00470180" "00006" "Familial, autosomal recessive" "50y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus, focal motor activity; headache; no nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 32y-ptosis" "17y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355326" "00198" "00470181" "00006" "Familial, autosomal recessive" "20y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; headache; nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; no ptosis" "15y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355327" "00198" "00470182" "00006" "Familial, autosomal recessive" "20y" "see paper; ..., no ataxia; epilepsy; status epilepticus; headache; nystagmus; no myoclonus; muscle biopsy normal; neuropathy; no ptosis" "20y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355328" "00198" "00470183" "00006" "Familial, autosomal recessive" "43y" "see paper; ..., ataxia; no epilepsy; no status epilepticus; headache; no nystagmus; no myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 25y-ptosis" "24y" "" "progressive gait unsteadiness" "" "" "" "" "" "" "progressive gait unsteadiness" "" "0000355329" "00198" "00470184" "00006" "Familial, autosomal recessive" "10y" "see paper; ..., ataxia; epilepsy; status epilepticus; headache; no nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "10y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355330" "00198" "00470185" "00006" "Familial, autosomal recessive" "19y" "see paper; ..., ataxia; epilepsy; status epilepticus; headache; nystagmus; myoclonus; neuropathy; no ptosis" "19y" "" "headache, epilepsy" "" "" "" "" "" "" "headache, epilepsy" "" "0000355331" "00198" "00470186" "00006" "Familial, autosomal recessive" "50y" "see paper; ..., ataxia; no epilepsy; no status epilepticus; headache; no nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 44y-ptosis" "36y" "" "progressive gait unsteadiness" "" "" "" "" "" "" "progressive gait unsteadiness" "" "0000355332" "00198" "00470187" "00006" "Familial, autosomal recessive" "21y" "see paper; ..., no ataxia; epilepsy; status epilepticus, focal motor activity; headache; nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "15y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355333" "00198" "00470188" "00006" "Familial, autosomal recessive" "23y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus; headache; no nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "14y" "" "headache, epilepsy" "" "" "" "" "" "" "headache, epilepsy" "" "0000355334" "00198" "00470189" "00006" "Familial, autosomal recessive" "9y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus; headache; nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "8y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355335" "00198" "00470190" "00006" "Familial, autosomal recessive" "13y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; no nystagmus; no myoclonus; muscle biopsy normal; no neuropathy; no ptosis" "2y" "" "speech delay" "" "" "" "" "" "" "speech delay" "" "0000355336" "00198" "00470191" "00006" "Familial, autosomal recessive" "38y" "see paper; ..., ataxia; no epilepsy; no status epilepticus; headache; no nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 26y-ptosis" "06y-07y" "" "progressive gait unsteadiness" "" "" "" "" "" "" "progressive gait unsteadiness" "" "0000355337" "00198" "00470192" "00006" "Familial, autosomal recessive" "18y" "see paper; ..., no ataxia; epilepsy; status epilepticus, focal motor activity; no headache; nystagmus; no myoclonus; muscle biopsy normal; neuropathy; no ptosis" "17y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355338" "00198" "00470193" "00006" "Familial, autosomal recessive" "30y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus, focal motor activity; headache; no nystagmus; myoclonus; neuropathy; 30y-ptosis" "4y" "" "progressive gait unsteadiness" "" "" "" "" "" "" "progressive gait unsteadiness" "" "0000355339" "00198" "00470194" "00006" "Familial, autosomal recessive" "22y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; headache; nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "10y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355340" "00198" "00470195" "00006" "Familial, autosomal recessive" "57y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; headache; nystagmus; neuropathy" "15y" "" "headache, progressive gait unsteadiness" "" "" "" "" "" "" "headache, progressive gait unsteadiness" "" "0000355341" "00198" "00470196" "00006" "Familial, autosomal recessive" "38y" "see paper; ..., ataxia; no epilepsy; no status epilepticus; headache; nystagmus; no myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; >30y-ptosis" "12y-13y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355342" "00198" "00470197" "00006" "Familial, autosomal recessive" "19y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; headache; no nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "18y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355343" "00198" "00470198" "00006" "Familial, autosomal recessive" "21y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus, focal motor activity; headache; nystagmus; myoclonus; muscle biopsy normal; neuropathy; no ptosis" "16y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355344" "00198" "00470199" "00006" "Familial, autosomal recessive" "27y" "see paper; ..., ataxia; epilepsy (continuous visual phenomena); status epilepticus; headache; nystagmus; no myoclonus; muscle biopsy normal; neuropathy; no ptosis" "17y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355345" "00198" "00470200" "00006" "Familial, autosomal recessive" "38y" "see paper; ..., ataxia; epilepsy; status epilepticus; headache; nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 26y-ptosis" "17y" "" "migraine-like headache" "" "" "" "" "" "" "migraine-like headache" "" "0000355346" "00198" "00470201" "00006" "Familial, autosomal recessive" "33y" "see paper; ..., ataxia; epilepsy; status epilepticus, focal motor activity; headache; no nystagmus; myoclonus; muscle biopsy cytochrome oxidase negative fibres; neuropathy; 28y-ptosis" "19y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355347" "00198" "00470202" "00006" "Familial, autosomal recessive" "74y" "see paper; ..., ataxia; epilepsy; no status epilepticus; no headache; nystagmus; no myoclonus; neuropathy; 65y-ptosis" "55y" "" "epilepsy" "" "" "" "" "" "" "epilepsy" "" "0000355348" "05356" "00470203" "00006" "Familial, autosomal recessive" "36y" "see paper; ..., ataxic gait, cerebellar dysarthria,\r\nmyoclonic jerks head/facial muscles, mild limitation horizontal eye movement, horizontal nystagmus in direction of gaze, distal amyotrophy, absent reflexes legs, symmetric loss all sensory modalities below knee; 31y-complete ophthalmoplegia, cerebellar dysarthria, myoclonus involving face/arms, truncal ataxia, symmetric dysmetria" "23y" "" "unsteadiness" "" "" "" "" "" "" "ataxia" "" "0000355349" "00198" "00470204" "00006" "Familial, autosomal recessive" "18y" "see paper; ..., headache preceded by visual symptoms, nausea, vomiting; yonic-clonic seizures\r\npreceded by headache" "15y" "" "headache" "" "" "" "" "" "" "migraine" "" "0000355350" "00198" "00470205" "00006" "Familial, autosomal recessive" "78y" "see paper; ..., slowly progressive bilateral ptosis; 60y-left dominant hemi-parkinsonian features (rigidity, cogwheel phenomenon, bradykinesia, gait disturbance, resting tremor, postural instability); bradykinesia" "50y-54y" "" "" "" "" "" "" "" "PEOB1" "ptosis" "" "0000355351" "00198" "00470206" "00006" "Familial, autosomal recessive" "66y" "see paper; ..., 46y-ataxia all limbs, moderate neuropathy, depressed/absent reflexes all limbs, distal weakness, distal sensory loss proprioception/vibration; dysarthria, slowing with fatigability, urinary stress incontinence, diplopia leading to prism lenses; bilateral total hip replacements; 66y-deceased" "46y" "" "" "" "" "" "" "" "" "ataxia" "" "0000355352" "00198" "00470207" "00006" "Familial, autosomal recessive" "24m" "see paper; ..., myoclonic seizures; generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; no visual disturbance; no motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355353" "00198" "00470208" "00006" "Familial, autosomal recessive" "72m" "see paper; ..., myoclonic seizures; generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; no visual disturbance; no motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355354" "00198" "00470209" "00006" "Familial, autosomal recessive" "6m" "see paper; ..., myoclonic seizures; no generalized tonic-clonic seizures; no focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; no visual disturbance; no motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355355" "00198" "00470210" "00006" "Familial, autosomal recessive" "10m" "see paper; ..., myoclonic seizures; generalized tonic-clonic seizures; focal motor seizures; no epilepsia partialis continua/status; developmental delay or regression; no ataxia; no visual disturbance; no motor paresis; hypotonia; tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355356" "00198" "00470211" "00006" "Familial, autosomal recessive" "60m" "see paper; ..., myoclonic seizures; no generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; no ataxia; no visual disturbance; no motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355357" "00198" "00470212" "00006" "Familial, autosomal recessive" "6m" "see paper; ..., no myoclonic seizures; no generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; no visual disturbance; no motor paresis; no hypotonia; tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355358" "00198" "00470213" "00006" "Familial, autosomal recessive" "16m" "see paper; ..., myoclonic seizures; no generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; visual disturbance; motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355359" "00198" "00470214" "00006" "Familial, autosomal recessive" "36m" "see paper; ..., myoclonic seizures; no generalized tonic-clonic seizures; focal motor seizures; no epilepsia partialis continua/status; developmental delay or regression; no ataxia; visual disturbance; no motor paresis; no hypotonia; no tremor; multiorgan failure, pancreatitis" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355360" "00198" "00470215" "00006" "Familial, autosomal recessive" "9m" "see paper; ..., no myoclonic seizures; generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; no ataxia; visual disturbance; no motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355361" "00198" "00470216" "00006" "Familial, autosomal recessive" "20m" "see paper; ..., myoclonic seizures; no generalized tonic-clonic seizures; no focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; ataxia; visual disturbance; no motor paresis; no hypotonia; no tremor; vomiting, migraine" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355362" "00198" "00470217" "00006" "Familial, autosomal recessive" "17m" "see paper; ..., myoclonic seizures; generalized tonic-clonic seizures; focal motor seizures; no epilepsia partialis continua/status; developmental delay or regression; ataxia; no visual disturbance; motor paresis; no hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355363" "00198" "00470218" "00006" "Familial, autosomal recessive" "17m" "see paper; ..., no myoclonic seizures; no generalized tonic-clonic seizures; focal motor seizures; epilepsia partialis continua/status; developmental delay or regression; no ataxia; no visual disturbance; motor paresis; no hypotonia; tremor" "" "" "" "" "" "" "" "" "" "Alpers syndrome" "" "0000355364" "00198" "00470219" "00006" "Familial, autosomal recessive" "2m" "see paper; ..., <3m-deceased; no myoclonic seizures; no generalized tonic-clonic seizures; no focal motor seizures; no epilepsia partialis continua/status; developmental delay or regression; no ataxia; no visual disturbance; motor paresis; hypotonia; no tremor; vomiting" "" "" "" "" "" "" "" "" "" "infantile hepatopathy" "" "0000355365" "00198" "00470220" "00006" "Familial, autosomal recessive" "1.5m" "see paper; ..., <3m-deceased; no myoclonic seizures; no generalized tonic-clonic seizures; no focal motor seizures; no epilepsia partialis continua/status; developmental delay or regression; no ataxia; no visual disturbance; no motor paresis; hypotonia; no tremor" "" "" "" "" "" "" "" "" "" "infantile hepatopathy" "" "0000355366" "00198" "00470221" "00006" "Familial, autosomal recessive" "59y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; proximal muscle weakness; exercise intolerance; no deafness; no migraine; cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "9y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355367" "00198" "00470222" "00006" "Familial, autosomal recessive" "45y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; no seizure; deafness; migraine; no cognitive impairment; chorea; depression; no gastro-intestinal dysmotility" "10y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355368" "00198" "00470223" "00006" "Familial, autosomal recessive" "23y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; no ptosis; no ophthalmoparesis; no dysarthria; no dysphagia; seizure; no deafness; migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "10y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355369" "00198" "00470224" "00006" "Familial, autosomal recessive" "22y" "see paper; ..., cerebellar ataxia; no pure sensory polyneuropathy; no ptosis; no ophthalmoparesis; no dysphagia; seizure; no proximal muscle weakness; no exercise intolerance; deafness; migraine; no cognitive impairment; dystonia; no gastro-intestinal dysmotility" "16y" "" "" "" "" "" "" "" "SANDO" "" "" "0000355370" "00198" "00470225" "00006" "Familial, autosomal recessive" "" "see paper; ..., no ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; gastro-intestinal dysmotility" "17y" "" "" "" "" "" "" "" "MTDPS4B" "ataxia" "" "0000355371" "00198" "00470226" "00006" "Familial, autosomal recessive" "" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ophthalmoparesis; dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "20y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355372" "00198" "00470227" "00006" "Familial, autosomal recessive" "57y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; proximal muscle weakness; no deafness; no migraine; no movement disorders; no depression; no gastro-intestinal dysmotility" "20y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355373" "00198" "00470228" "00006" "Familial, autosomal recessive" "35y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; dysphagia; seizure; cognitive impairment; no gastro-intestinal dysmotility" "21y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355374" "00198" "00470229" "00006" "Familial, autosomal recessive" "" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; dysphagia; no seizure; proximal muscle weakness; no exercise intolerance; no deafness; migraine; no movement disorders; no gastro-intestinal dysmotility" "26y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355375" "00198" "00470230" "00006" "Familial, autosomal recessive" "" "see paper; ..., no ataxia; no pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "30y" "" "" "" "" "" "" "" "PEOB1" "" "" "0000355376" "00198" "00470231" "00006" "Familial, autosomal recessive" "41y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; migraine; no cognitive impairment; no movement disorders; depression; no gastro-intestinal dysmotility" "34y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355377" "00198" "00470232" "00006" "Familial, autosomal recessive" "61y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; dysphagia; no seizure; proximal muscle weakness; exercise intolerance; no deafness; no migraine; no cognitive impairment; chorea; depression; no gastro-intestinal dysmotility" "35y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355378" "00198" "00470233" "00006" "Familial, autosomal recessive" "" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; seizure; exercise intolerance; no deafness; migraine; no movement disorders; depression; no gastro-intestinal dysmotility" "36y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355379" "00198" "00470234" "00006" "Familial, autosomal recessive" "53y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; Parkinsonism; no depression; no gastro-intestinal dysmotility" "37y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355380" "00198" "00470235" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; no migraine; cognitive impairment; no movement disorders; depression; no gastro-intestinal dysmotility" "38y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355381" "00198" "00470236" "00006" "Familial, autosomal recessive" "" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; no seizure; no gastro-intestinal dysmotility" "40y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355382" "00198" "00470237" "00006" "Familial, autosomal recessive" "57y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; no ptosis; ophthalmoparesis; dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "47y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355383" "00198" "00470238" "00006" "Familial, autosomal recessive" "y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; dysphagia; no seizure; proximal muscle weakness; exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "50y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355384" "00198" "00470239" "00006" "Familial, autosomal recessive" "60y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; migraine; cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "50y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355385" "00198" "00470240" "00006" "Familial, autosomal recessive" "66y" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; dysphagia; no seizure; proximal muscle weakness; no gastro-intestinal dysmotility" "50y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355386" "00198" "00470241" "00006" "Familial, autosomal recessive" "" "see paper; ..., no ataxia; no pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; dysphagia; no seizure; proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "56y" "" "" "" "" "" "" "" "PEOB1" "" "" "0000355387" "00198" "00470242" "00006" "Familial, autosomal recessive" "66y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; no ptosis; ophthalmoparesis; no dysarthria; dysphagia; no seizure; no deafness; no movement disorders; no depression" "58y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355388" "00198" "00470243" "00006" "Familial, autosomal recessive" "68y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; no proximal muscle weakness; exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "62y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355389" "00198" "00470244" "00006" "Familial, autosomal recessive" "" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; no dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no gastro-intestinal dysmotility" "66y" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355390" "00198" "00470245" "00006" "Familial, autosomal recessive" "82y" "see paper; ..., no ataxia; no pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; dysphagia; no seizure; proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; depression; no gastro-intestinal dysmotility" "71y" "" "" "" "" "" "" "" "PEOB1" "" "" "0000355391" "00198" "00470246" "00006" "Familial, autosomal recessive" "" "see paper; ..., no ataxia; no pure sensory polyneuropathy; ptosis; no ophthalmoparesis; no dysarthria; dysphagia; no seizure; no proximal muscle weakness; no exercise intolerance; no deafness; no migraine; no cognitive impairment; no movement disorders; no depression; no gastro-intestinal dysmotility" "" "" "" "" "" "" "" "" "PEOB1" "" "" "0000355392" "00198" "00470247" "00006" "Familial, autosomal recessive" "" "see paper; ..., mixed ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; dysarthria; no proximal muscle weakness; no gastro-intestinal dysmotility" "" "" "" "" "" "" "" "" "SANDO" "ataxia" "" "0000355393" "00198" "00470248" "00006" "Familial, autosomal recessive" "57y" "see paper; ..., prorioceptive ataxia; pure sensory polyneuropathy; ptosis; ophthalmoparesis; no dysarthria; dysphagia; no seizure; no proximal muscle weakness; exercise intolerance; deafness; no migraine; no movement disorders; no depression; no gastro-intestinal dysmotility" "" "" "" "" "" "" "" "" "SANDO" "ataxia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 204 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000042" "00000042" "1" "00004" "" "2012-05-11 13:18:46" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000046" "00000046" "1" "00004" "" "2012-05-11 13:18:48" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000078" "00000078" "1" "00004" "" "2012-05-11 13:19:04" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000085" "00000085" "1" "00004" "" "2012-05-11 13:19:11" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000086" "00000086" "1" "00004" "" "2012-05-11 13:19:14" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000088" "00000088" "1" "00004" "" "2012-05-11 13:19:14" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000016249" "00016320" "1" "00681" "00681" "2014-03-12 11:58:38" "00006" "2014-03-14 16:20:01" "SEQ-NG-I" "DNA" "" "" "0000036608" "00036538" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036609" "00036539" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036610" "00036540" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036611" "00036541" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036612" "00036542" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036613" "00036543" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036614" "00036544" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036615" "00036545" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036616" "00036546" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036617" "00036547" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036618" "00036548" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036619" "00036549" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036620" "00036550" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036621" "00036551" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036622" "00036552" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036623" "00036553" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036624" "00036554" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036625" "00036555" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036626" "00036556" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036627" "00036557" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036628" "00036558" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036629" "00036559" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036630" "00036560" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036631" "00036561" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036632" "00036562" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036633" "00036563" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036634" "00036564" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036635" "00036565" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036636" "00036566" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036637" "00036567" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036638" "00036568" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036639" "00036569" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036640" "00036570" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036641" "00036571" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036642" "00036572" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036643" "00036573" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036644" "00036574" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036645" "00036575" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036646" "00036576" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000080975" "00080863" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000106374" "00105904" "1" "02119" "02119" "2017-06-26 14:36:14" "" "" "SEQ-NG" "DNA" "blood" "" "0000106377" "00105907" "1" "02119" "02119" "2017-06-26 15:28:48" "" "" "SEQ-NG" "DNA" "blood" "" "0000106378" "00105903" "1" "02119" "02119" "2017-06-26 15:45:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000177899" "00177006" "1" "02552" "02552" "2018-08-16 10:54:38" "" "" "SEQ-NG-I" "DNA" "blood" "WES" "0000208419" "00207382" "1" "03113" "03113" "2018-11-20 17:50:45" "" "" "SEQ" "DNA" "blood" "" "0000210069" "00209012" "1" "00006" "00006" "2018-12-22 15:10:51" "" "" "SEQ-NG" "DNA" "" "WGS" "0000211252" "00210176" "1" "01164" "01164" "2018-12-27 15:47:32" "" "" "SEQ-NG" "DNA" "" "" "0000220142" "00219070" "1" "00006" "00006" "2019-02-05 12:23:36" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted multigene panel" "0000220143" "00219071" "1" "00006" "00006" "2019-02-05 12:23:36" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted multigene panel" "0000249238" "00248133" "1" "01164" "01164" "2019-07-19 11:42:59" "" "" "SEQ-NG-S" "DNA" "" "" "0000270745" "00269588" "1" "03508" "03508" "2019-12-01 07:42:31" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000275360" "00274205" "1" "00006" "00006" "2019-12-24 17:05:37" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000292487" "00291319" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292488" "00291320" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292489" "00291321" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292490" "00291322" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292491" "00291323" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292492" "00291324" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292493" "00291325" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292494" "00291326" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292495" "00291327" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292496" "00291328" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292497" "00291329" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292498" "00291330" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292499" "00291331" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292500" "00291332" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292501" "00291333" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297649" "00296539" "1" "01164" "01164" "2020-04-08 09:49:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000300796" "00299686" "1" "01164" "01164" "2020-04-20 10:22:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000302515" "00301394" "1" "01164" "01164" "2020-05-15 11:21:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000305614" "00304485" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000308597" "00307458" "1" "00006" "00006" "2020-08-13 16:04:48" "" "" "SEQ" "DNA" "" "" "0000309892" "00308747" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000311027" "00309883" "1" "01164" "01164" "2020-09-04 17:21:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000315568" "00314395" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000325530" "00324340" "1" "01807" "01807" "2020-12-07 15:29:01" "" "" "SEQ" "DNA" "" "" "0000326075" "00324868" "1" "00006" "00006" "2020-12-24 15:03:09" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000336141" "00334912" "1" "00006" "00006" "2021-03-02 12:59:04" "" "" "SEQ" "DNA" "" "" "0000336142" "00334900" "1" "00006" "00006" "2021-03-02 13:04:07" "" "" "SEQ" "DNA" "" "" "0000375641" "00374447" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375961" "00374767" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000389169" "00384650" "1" "04132" "04132" "2021-10-31 18:23:31" "" "" "SEQ;SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000389234" "00387997" "1" "04132" "04132" "2021-11-01 16:52:20" "" "" "SEQ-NG-I" "DNA;protein" "" "WES" "0000389246" "00388005" "1" "04132" "04132" "2021-11-01 18:43:51" "" "" "SEQ;SEQ-NG-I" "DNA" "" "WES" "0000389248" "00388009" "1" "04132" "04132" "2021-11-01 19:33:34" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000389419" "00388180" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing" "0000397707" "00396466" "1" "00000" "03840" "2021-12-15 20:02:57" "" "" "SEQ-NG" "DNA" "blood" "targeted next generation sequencing panel consisted of 550 genes implicated in several other rare inherited diseases" "0000404087" "00402846" "1" "04266" "04266" "2022-02-11 18:50:18" "" "" "PCR" "DNA" "" "DNA Polymerase Gamma1 sequencing" "0000429825" "00428413" "1" "01164" "01164" "2023-01-03 09:40:14" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000436941" "00435463" "1" "00006" "00006" "2023-07-31 11:07:23" "" "" "SEQ-NG" "DNA" "" "trio WES" "0000440160" "00438678" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000454720" "00453109" "1" "00006" "00006" "2024-08-15 19:46:57" "" "" "arrayCGH" "DNA" "" "" "0000456324" "00454711" "1" "00095" "00006" "2024-09-25 11:50:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000456325" "00454712" "1" "00095" "00006" "2024-09-25 11:50:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000456326" "00454713" "1" "00095" "00006" "2024-09-25 11:50:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000456327" "00454714" "1" "00095" "00006" "2024-09-25 11:50:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000465702" "00464071" "1" "03544" "03544" "2025-02-20 14:15:11" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000469214" "00467550" "1" "03676" "03676" "2025-10-17 10:14:39" "" "" "SEQ-NG" "DNA" "Blood" "" "0000469699" "00468033" "1" "00006" "00006" "2025-11-07 09:37:50" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470907" "00469239" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470908" "00469240" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000471820" "00470152" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471821" "00470153" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471822" "00470154" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471823" "00470155" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471824" "00470156" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471825" "00470157" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471826" "00470158" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471827" "00470159" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471828" "00470160" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471829" "00470161" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471830" "00470162" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471831" "00470163" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471832" "00470164" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471833" "00470165" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471834" "00470166" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471835" "00470167" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471836" "00470168" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471837" "00470169" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471838" "00470170" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471839" "00470171" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471840" "00470172" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471841" "00470173" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471842" "00470174" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471843" "00470175" "1" "00006" "00006" "2025-11-27 18:16:07" "" "" "SEQ" "DNA" "" "" "0000471845" "00470177" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471846" "00470178" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471847" "00470179" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471848" "00470180" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471849" "00470181" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471850" "00470182" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471851" "00470183" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471852" "00470184" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471853" "00470185" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471854" "00470186" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471855" "00470187" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471856" "00470188" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471857" "00470189" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471858" "00470190" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471859" "00470191" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471860" "00470192" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471861" "00470193" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471862" "00470194" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471863" "00470195" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471864" "00470196" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471865" "00470197" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471866" "00470198" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471867" "00470199" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471868" "00470200" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471869" "00470201" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471870" "00470202" "1" "00006" "00006" "2025-11-28 09:01:23" "" "" "SEQ" "DNA" "" "" "0000471871" "00470203" "1" "00006" "00006" "2025-11-28 09:08:22" "" "" "SEQ" "DNA" "" "" "0000471872" "00470204" "1" "00006" "00006" "2025-11-28 09:15:18" "" "" "SEQ" "DNA" "" "" "0000471873" "00470205" "1" "00006" "00006" "2025-11-28 09:28:55" "" "" "SEQ" "DNA" "" "" "0000471874" "00470206" "1" "00006" "00006" "2025-11-28 09:37:01" "" "" "SEQ" "DNA" "" "" "0000471875" "00470207" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471876" "00470208" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471877" "00470209" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471878" "00470210" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471879" "00470211" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471880" "00470212" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471881" "00470213" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471882" "00470214" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471883" "00470215" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471884" "00470216" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471885" "00470217" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471886" "00470218" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471887" "00470219" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471888" "00470220" "1" "00006" "00006" "2025-11-28 11:03:05" "" "" "SEQ" "DNA" "" "" "0000471889" "00470221" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471890" "00470222" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471891" "00470223" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471892" "00470224" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471893" "00470225" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471894" "00470226" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471895" "00470227" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471896" "00470228" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471897" "00470229" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471898" "00470230" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471899" "00470231" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471900" "00470232" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471901" "00470233" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471902" "00470234" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471903" "00470235" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471904" "00470236" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471905" "00470237" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471906" "00470238" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471907" "00470239" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471908" "00470240" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471909" "00470241" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471910" "00470242" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471911" "00470243" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471912" "00470244" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471913" "00470245" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471914" "00470246" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471915" "00470247" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" "0000471916" "00470248" "1" "00006" "00006" "2025-11-29 09:23:48" "" "" "SEQ" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 234 "{{screeningid}}" "{{geneid}}" "0000000042" "ATP7B" "0000000042" "DPYD" "0000000042" "ETFB" "0000000042" "GLB1" "0000000042" "IGHMBP2" "0000000042" "JAK3" "0000000042" "NPHP4" "0000000042" "NPHS1" "0000000042" "POLG" "0000000042" "QARS" "0000000042" "SERPINA1" "0000000042" "SLC26A2" "0000000042" "SMPD1" "0000000046" "AGXT" "0000000046" "ATP7B" "0000000046" "CFTR" "0000000046" "CYP27A1" "0000000046" "DPYD" "0000000046" "EHMT1" "0000000046" "GLB1" "0000000046" "IGHMBP2" "0000000046" "NPHS1" "0000000046" "POLG" "0000000046" "SERPINA1" "0000000046" "SMPD1" "0000000078" "ATP7B" "0000000078" "CDH23" "0000000078" "CFTR" "0000000078" "ETFB" "0000000078" "GLB1" "0000000078" "IGHMBP2" "0000000078" "NPHS1" "0000000078" "PMM2" "0000000078" "POLG" "0000000078" "RAG1" "0000000078" "SERPINA1" "0000000078" "SLC26A2" "0000000085" "ADA" "0000000085" "ATP7B" "0000000085" "ETFB" "0000000085" "FGG" "0000000085" "FKTN" "0000000085" "HEXB" "0000000085" "IGHMBP2" "0000000085" "MYO5A" "0000000085" "NHLRC1" "0000000085" "PKHD1" "0000000085" "POLG" "0000000085" "SERPINA1" "0000000085" "SGSH" "0000000086" "ARSB" "0000000086" "ATP7B" "0000000086" "BTD" "0000000086" "ETFB" "0000000086" "GLB1" "0000000086" "HEXB" "0000000086" "HPRT1" "0000000086" "IGHMBP2" "0000000086" "NHLRC1" "0000000086" "POLG" "0000000086" "SERPINA1" "0000000086" "SLC26A2" "0000000088" "ATP7B" "0000000088" "CFTR" "0000000088" "ETFB" "0000000088" "FKRP" "0000000088" "GALC" "0000000088" "GLB1" "0000000088" "HEXB" "0000000088" "IGHMBP2" "0000000088" "NHLRC1" "0000000088" "NPHS1" "0000000088" "POLG" "0000000088" "SBDS" "0000000088" "SERPINA1" "0000016249" "POLG" "0000016249" "SCN1A" "0000036608" "POLG" "0000036609" "POLG" "0000036610" "POLG" "0000036611" "POLG" "0000036612" "POLG" "0000036613" "POLG" "0000036614" "POLG" "0000036615" "POLG" "0000036616" "POLG" "0000036617" "POLG" "0000036618" "POLG" "0000036619" "POLG" "0000036620" "POLG" "0000036621" "POLG" "0000036622" "POLG" "0000036623" "POLG" "0000036624" "POLG" "0000036625" "POLG" "0000036626" "POLG" "0000036627" "POLG" "0000036628" "POLG" "0000036629" "POLG" "0000036630" "POLG" "0000036631" "POLG" "0000036632" "POLG" "0000036633" "POLG" "0000036634" "POLG" "0000036635" "POLG" "0000036636" "POLG" "0000036637" "POLG" "0000036638" "POLG" "0000036639" "POLG" "0000036640" "POLG" "0000036641" "POLG" "0000036642" "POLG" "0000036643" "POLG" "0000036644" "POLG" "0000036645" "POLG" "0000036646" "POLG" "0000080975" "POLG" "0000208419" "POLG" "0000210069" "POLG" "0000220142" "POLG" "0000220143" "POLG" "0000275360" "POLG" "0000308597" "POLG" "0000309892" "POLG" "0000315568" "POLG" "0000326075" "EIF2C1" "0000336141" "POLG" "0000336141" "PRICKLE2" "0000336142" "POLG" "0000375641" "POLG" "0000375961" "ITPR1" "0000389234" "POLG" "0000389246" "POLG" "0000389248" "POLG" "0000389419" "WDR19" "0000397707" "NSD1" "0000429825" "POLG" "0000469214" "POLG" "0000471820" "POLG" "0000471821" "POLG" "0000471822" "POLG" "0000471823" "POLG" "0000471824" "POLG" "0000471825" "POLG" "0000471826" "POLG" "0000471827" "POLG" "0000471828" "POLG" "0000471829" "POLG" "0000471830" "POLG" "0000471831" "POLG" "0000471832" "POLG" "0000471833" "POLG" "0000471834" "POLG" "0000471835" "POLG" "0000471836" "POLG" "0000471837" "POLG" "0000471838" "POLG" "0000471839" "POLG" "0000471840" "POLG" "0000471841" "POLG" "0000471842" "POLG" "0000471843" "POLG" "0000471845" "POLG" "0000471846" "POLG" "0000471847" "POLG" "0000471848" "POLG" "0000471849" "POLG" "0000471850" "POLG" "0000471851" "POLG" "0000471852" "POLG" "0000471853" "POLG" "0000471854" "POLG" "0000471855" "POLG" "0000471856" "POLG" "0000471857" "POLG" "0000471858" "POLG" "0000471859" "POLG" "0000471860" "POLG" "0000471861" "POLG" "0000471862" "POLG" "0000471863" "POLG" "0000471864" "POLG" "0000471865" "POLG" "0000471866" "POLG" "0000471867" "POLG" "0000471868" "POLG" "0000471869" "POLG" "0000471870" "POLG" "0000471871" "POLG" "0000471872" "POLG" "0000471873" "POLG" "0000471874" "POLG" "0000471875" "POLG" "0000471876" "POLG" "0000471877" "POLG" "0000471878" "POLG" "0000471879" "POLG" "0000471880" "POLG" "0000471881" "POLG" "0000471882" "POLG" "0000471883" "POLG" "0000471884" "POLG" "0000471885" "POLG" "0000471886" "POLG" "0000471887" "POLG" "0000471888" "POLG" "0000471889" "POLG" "0000471890" "POLG" "0000471891" "POLG" "0000471892" "POLG" "0000471893" "POLG" "0000471894" "POLG" "0000471895" "POLG" "0000471896" "POLG" "0000471897" "POLG" "0000471898" "POLG" "0000471899" "POLG" "0000471900" "POLG" "0000471901" "POLG" "0000471902" "POLG" "0000471903" "POLG" "0000471904" "POLG" "0000471905" "POLG" "0000471906" "POLG" "0000471907" "POLG" "0000471908" "POLG" "0000471909" "POLG" "0000471910" "POLG" "0000471911" "POLG" "0000471912" "POLG" "0000471913" "POLG" "0000471914" "POLG" "0000471915" "POLG" "0000471916" "POLG" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 750 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000000594" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000000595" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000000596" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000000597" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000000598" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000000599" "0" "50" "15" "89861826" "89861826" "subst" "0.028747" "00002" "POLG_000001" "g.89861826T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.89318595T>C" "" "VUS" "" "0000035989" "11" "35" "15" "89864482" "89864482" "subst" "0" "00681" "POLG_000002" "g.89864482C>T" "" "{PMID:Della Mina et al 2014:Submitted}" "" "" "" "Germline" "-" "" "0" "" "" "g.89321251C>T" "" "likely benign" "" "0000063733" "1" "10" "15" "89859982" "89859982" "subst" "0" "01164" "POLG_000037" "g.89859982C>T" "" "" "" "" "" "Germline" "" "rs3087376" "0" "" "" "g.89316751C>T" "" "benign" "" "0000063734" "1" "10" "15" "89872249" "89872249" "subst" "0.00434968" "01164" "POLG_000022" "g.89872249C>T" "" "" "" "" "" "Germline" "" "rs17566401" "0" "" "" "g.89329018C>T" "" "benign" "" "0000063735" "1" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "01164" "POLG_000023" "g.89873472C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89330241C>T" "" "pathogenic" "" "0000063736" "1" "10" "15" "89876849" "89876849" "subst" "0" "01164" "POLG_000030" "g.89876849T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89333618T>C" "" "benign" "" "0000063737" "1" "50" "15" "89862465" "89862465" "subst" "0.000255842" "01164" "POLG_000031" "g.89862465G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89319234G>A" "" "VUS" "" "0000063738" "1" "10" "15" "89860808" "89860808" "subst" "0.0107925" "01164" "POLG_000039" "g.89860808T>G" "" "" "" "" "" "Germline" "" "rs2307436" "0" "" "" "g.89317577T>G" "" "benign" "" "0000063739" "1" "50" "15" "89869915" "89869915" "subst" "0" "01164" "POLG_000017" "g.89869915G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89326684G>T" "" "VUS" "" "0000063740" "1" "10" "15" "89876852" "89876852" "subst" "0" "01164" "POLG_000003" "g.89876852T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89333621T>C" "" "benign" "" "0000063741" "1" "50" "15" "89871937" "89871937" "subst" "4.46762E-5" "01164" "POLG_000021" "g.89871937C>T" "" "" "" "" "Pat 65192" "Germline" "" "" "0" "" "" "g.89328706C>T" "" "VUS" "" "0000063742" "1" "10" "15" "89866646" "89866646" "subst" "0.0131109" "01164" "POLG_000013" "g.89866646G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89323415G>A" "" "benign" "" "0000063743" "1" "10" "15" "89865692" "89865692" "subst" "0" "01164" "POLG_000011" "g.89865692T>C" "global frequency uo to 51%" "" "" "" "" "Germline" "" "rs3176205" "0" "" "" "g.89322461T>C" "" "benign" "" "0000063744" "1" "50" "15" "89864250" "89864250" "subst" "0.00109972" "01164" "POLG_000007" "g.89864250G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89321019G>C" "" "VUS" "" "0000063745" "1" "10" "15" "89869833" "89869833" "subst" "0.00135844" "01164" "POLG_000016" "g.89869833C>T" "" "" "" "" "" "Germline" "" "rs55962804" "0" "" "" "g.89326602C>T" "" "benign" "" "0000063746" "1" "50" "15" "89862201" "89862201" "subst" "4.06825E-6" "01164" "POLG_000034" "g.89862201G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89318970G>A" "" "VUS" "" "0000063747" "1" "90" "15" "89870429" "89870429" "subst" "0.000471032" "01164" "POLG_000019" "g.89870429T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89327198T>C" "" "pathogenic" "" "0000063748" "1" "50" "15" "89876281" "89876281" "subst" "0" "01164" "POLG_000026" "g.89876281C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89333050C>G" "" "VUS" "" "0000063749" "1" "50" "15" "89864343" "89864343" "subst" "4.06507E-5" "01164" "POLG_000009" "g.89864343G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89321112G>A" "" "VUS" "" "0000063750" "1" "10" "15" "89866209" "89866209" "subst" "0" "01164" "POLG_000012" "g.89866209A>G" "" "" "" "" "" "Germline" "" "rs3176203" "0" "" "" "g.89322978A>G" "" "benign" "" "0000063751" "1" "50" "15" "89864125" "89864125" "subst" "0.00104899" "01164" "POLG_000033" "g.89864125G>A" "frequency up to 1%" "" "" "" "" "Germline" "" "rs41546712" "0" "" "" "g.89320894G>A" "" "VUS" "" "0000063752" "1" "50" "15" "89870132" "89870132" "subst" "0.00154737" "01164" "POLG_000018" "g.89870132A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89326901A>G" "" "VUS" "" "0000063753" "1" "10" "15" "89865199" "89865199" "subst" "1.21819E-5" "01164" "POLG_000010" "g.89865199A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89321968A>G" "" "benign" "" "0000063754" "1" "50" "15" "89876166" "89876166" "subst" "0" "01164" "POLG_000024" "g.89876166A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89332935A>G" "" "VUS" "" "0000063755" "1" "10" "15" "89878618" "89878618" "subst" "0" "01164" "POLG_000005" "g.89878618G>A" "MAF 0,001" "" "" "" "" "Germline" "" "rs182136781" "0" "" "" "g.89335387G>A" "" "benign" "" "0000063756" "1" "10" "15" "89866707" "89866707" "subst" "0" "01164" "POLG_000014" "g.89866707G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89323476G>A" "" "benign" "" "0000063757" "1" "10" "15" "89876859" "89876859" "" "0" "01164" "POLG_000004" "g.89876859CAG(8_12)" "" "" "" "" "c.127GCA[8]+[10]+[11]+[12] = c.156-158dupGCA = c.158-159insGCAGCA, GCAs" "Germline" "" "rs35424491" "0" "" "" "" "" "benign" "" "0000063758" "1" "10" "15" "89876236" "89876236" "subst" "0" "01164" "POLG_000025" "g.89876236C>A" "global frequency uo to 50%" "" "" "" "" "Germline" "" "rs2283430" "0" "" "" "g.89333005C>A" "" "benign" "" "0000063759" "1" "90" "15" "89870562" "89870563" "del" "0" "01164" "POLG_000020" "g.89870562_89870563del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89327331_89327332del" "" "pathogenic" "" "0000063760" "1" "10" "15" "89864294" "89864294" "subst" "0.00546172" "01164" "POLG_000008" "g.89864294T>C" "frequency up to 1,3%" "" "" "" "" "Germline" "" "rs2074883" "0" "" "" "g.89321063T>C" "" "benign" "" "0000063761" "1" "50" "15" "89876855" "89876860" "del" "0" "01164" "POLG_000029" "g.89876855_89876860del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89333624_89333629del" "" "VUS" "" "0000063762" "1" "10" "15" "89876316" "89876316" "subst" "0.000354783" "01164" "POLG_000027" "g.89876316C>A" "frequency up to 1,3%" "" "" "" "" "Germline" "" "rs3087379" "0" "" "" "g.89333085C>A" "" "benign" "" "0000063763" "1" "10" "15" "89859934" "89859934" "dup" "0" "01164" "POLG_000041" "g.89859934dup" "global frequency uo to 42%; 3720+49dupG" "" "" "" "" "Germline" "" "rs3087377" "0" "" "" "g.89316703dup" "" "benign" "" "0000063764" "1" "10" "15" "89860786" "89860786" "subst" "0.421364" "01164" "POLG_000038" "g.89860786A>C" "global frequency uo to 55%" "" "" "" "" "Germline" "" "rs2307438" "0" "" "" "g.89317555A>C" "" "benign" "" "0000063765" "1" "10" "15" "89862366" "89862366" "subst" "0.375558" "01164" "POLG_000036" "g.89862366T>C" "global frequency uo to 44%" "" "" "" "" "Germline" "" "rs2302084" "0" "" "" "g.89319135T>C" "" "benign" "" "0000063766" "1" "10" "15" "89862341" "89862341" "subst" "0.377959" "01164" "POLG_000035" "g.89862341A>G" "global frequency uo to 49%" "" "" "" "" "Germline" "" "rs2246900" "0" "" "" "g.89319110A>G" "" "benign" "" "0000063767" "1" "10" "15" "89864020" "89864020" "subst" "0.00769087" "01164" "POLG_000032" "g.89864020G>A" "frequency 2-18%" "" "" "" "" "Germline" "" "rs2307431" "0" "" "" "g.89320789G>A" "" "benign" "" "0000063768" "1" "10" "15" "89867154" "89867154" "subst" "0.488143" "01164" "POLG_000015" "g.89867154A>G" "frequency up to 59%" "" "" "" "" "Germline" "" "rs2072267" "0" "" "" "g.89323923A>G" "" "benign" "" "0000063769" "1" "50" "15" "89878703" "89878703" "del" "0" "01164" "POLG_000006" "g.89878703del" "" "" "" "" "c.-200delG" "Germline" "" "" "0" "" "" "g.89335472del" "" "VUS" "" "0000063770" "1" "50" "15" "89861960" "89861960" "subst" "7.71824E-5" "01164" "POLG_000040" "g.89861960A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89318729A>G" "" "VUS" "" "0000063771" "1" "50" "15" "89876827" "89876829" "dup" "0" "01164" "POLG_000028" "g.89876827_89876829dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89333596_89333598dup" "" "VUS" "" "0000130061" "3" "90" "15" "89872286" "89872286" "subst" "5.77844E-5" "01758" "POLG_000042" "g.89872286A>C" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.89329055A>C" "" "pathogenic" "ACMG" "0000171972" "21" "90" "15" "89868870" "89868870" "subst" "0.00152881" "02119" "POLG_000046" "g.89868870G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "yes" "rs113994096" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000171973" "11" "90" "15" "89864151" "89864151" "subst" "0" "02119" "POLG_000045" "g.89864151G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.89320920G>A" "" "pathogenic" "" "0000171974" "21" "70" "15" "89873415" "89873415" "subst" "0.00153175" "02119" "POLG_000047" "g.89873415G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "yes" "" "0" "" "" "g.89330184G>A" "" "likely pathogenic" "" "0000171976" "21" "90" "15" "89868687" "89868687" "subst" "8.43035E-6" "02119" "POLG_000044" "g.89868687G>C" "" "Castiglioni, submitted" "" "" "" "Germline" "-" "" "0" "" "" "g.89325456G>C" "" "pathogenic" "" "0000171977" "11" "90" "15" "89864184" "89864184" "subst" "0" "02119" "POLG_000043" "g.89864184G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.89320953G>A" "" "pathogenic" "" "0000171986" "21" "70" "15" "89873415" "89873415" "subst" "0.00153175" "02119" "POLG_000047" "g.89873415G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "likely pathogenic" "" "0000171987" "21" "90" "15" "89868870" "89868870" "subst" "0.00152881" "02119" "POLG_000046" "g.89868870G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000171988" "11" "90" "15" "89864151" "89864151" "subst" "0" "02119" "POLG_000045" "g.89864151G>A" "" "Castiglioni, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.89320920G>A" "" "pathogenic" "" "0000249568" "0" "30" "15" "89870132" "89870132" "subst" "0.00154737" "02325" "POLG_000018" "g.89870132A>G" "" "" "" "POLG(NM_002693.2):c.1585+11T>C, POLG(NM_002693.3):c.1585+11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89326901A>G" "" "likely benign" "" "0000249927" "0" "10" "15" "89860786" "89860786" "subst" "0.421364" "02329" "POLG_000038" "g.89860786A>C" "" "" "" "POLG(NM_002693.2):c.3483-19T>G, POLG(NM_002693.3):c.3483-19T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89317555A>C" "" "benign" "" "0000250355" "0" "30" "15" "89811688" "89811688" "subst" "0" "02329" "FANCI_000034" "g.89811688A>T" "" "" "" "FANCI(NM_001113378.1):c.814A>T (p.I272F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89268457A>T" "" "likely benign" "" "0000253151" "0" "10" "15" "89860786" "89860786" "subst" "0.421364" "01943" "POLG_000038" "g.89860786A>C" "" "" "" "POLG(NM_002693.2):c.3483-19T>G, POLG(NM_002693.3):c.3483-19T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89317555A>C" "" "benign" "" "0000256176" "0" "50" "15" "89801971" "89801971" "subst" "0" "01943" "FANCI_000031" "g.89801971A>G" "" "" "" "FANCI(NM_001113378.1):c.121A>G (p.K41E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89258740A>G" "" "VUS" "" "0000256681" "0" "50" "15" "89834857" "89834857" "subst" "2.43873E-5" "01943" "FANCI_000043" "g.89834857A>G" "" "" "" "FANCI(NM_001113378.1):c.1904A>G (p.Y635C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89291626A>G" "" "VUS" "" "0000280727" "0" "10" "15" "89838236" "89838236" "subst" "0.956685" "02325" "FANCI_000047" "g.89838236G>A" "" "" "" "FANCI(NM_001113378.2):c.2547G>A (p.K849=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89295005=" "" "benign" "" "0000280728" "0" "90" "15" "89858549" "89858549" "subst" "4.46722E-5" "02325" "FANCI_000014" "g.89858549C>T" "" "" "" "FANCI(NM_001113378.1):c.3853C>T (p.R1285*), FANCI(NM_001113378.2):c.3853C>T (p.R1285*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89315318C>T" "" "pathogenic" "" "0000282975" "0" "10" "15" "89819943" "89819943" "subst" "0.00380634" "02329" "FANCI_000038" "g.89819943G>A" "" "" "" "FANCI(NM_001113378.1):c.1114G>A (p.V372I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89276712G>A" "" "benign" "" "0000282976" "0" "30" "15" "89826497" "89826497" "subst" "0.000670367" "02329" "FANCI_000039" "g.89826497G>A" "" "" "" "FANCI(NM_001113378.1):c.1698+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283266G>A" "" "likely benign" "" "0000282977" "0" "30" "15" "89828362" "89828362" "subst" "5.27902E-5" "02329" "FANCI_000040" "g.89828362C>T" "" "" "" "FANCI(NM_001113378.1):c.1734C>T (p.V578=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285131C>T" "" "likely benign" "" "0000282978" "0" "10" "15" "89828441" "89828441" "subst" "0.00665638" "02329" "FANCI_000041" "g.89828441C>T" "" "" "" "FANCI(NM_001113378.1):c.1813C>T (p.L605F, p.(Leu605Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285210C>T" "" "benign" "" "0000282979" "0" "30" "15" "89828457" "89828457" "subst" "4.06157E-6" "02329" "FANCI_000042" "g.89828457C>T" "" "" "" "FANCI(NM_001113378.1):c.1821+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285226C>T" "" "likely benign" "" "0000282980" "0" "30" "15" "89838176" "89838176" "subst" "0.00204846" "02329" "FANCI_000046" "g.89838176T>G" "" "" "" "FANCI(NM_001113378.1):c.2487T>G (p.(Leu829=), p.L829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89294945T>G" "" "likely benign" "" "0000282981" "0" "30" "15" "89844664" "89844664" "subst" "0.00302127" "02329" "FANCI_000049" "g.89844664C>T" "" "" "" "FANCI(NM_001113378.1):c.2997C>T (p.S999=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89301433C>T" "" "likely benign" "" "0000282982" "0" "10" "15" "89850836" "89850836" "subst" "0.0022985" "02329" "FANCI_000052" "g.89850836T>C" "" "" "" "FANCI(NM_001113378.1):c.3592-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89307605T>C" "" "benign" "" "0000282983" "0" "10" "15" "89850922" "89850922" "subst" "0.00405358" "02329" "FANCI_000053" "g.89850922G>A" "" "" "" "FANCI(NM_001113378.1):c.3651+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89307691G>A" "" "benign" "" "0000282984" "0" "30" "15" "89807836" "89807836" "subst" "0.00079081" "02329" "FANCI_000033" "g.89807836C>T" "" "" "" "FANCI(NM_001113378.1):c.753C>T (p.D251=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89264605C>T" "" "likely benign" "" "0000282985" "0" "30" "15" "89811698" "89811698" "subst" "0.000540123" "02329" "FANCI_000035" "g.89811698T>C" "" "" "" "FANCI(NM_001113378.1):c.824T>C (p.(Ile275Thr), p.I275T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89268467T>C" "" "likely benign" "" "0000282986" "0" "10" "15" "89811742" "89811742" "subst" "0.00372019" "02329" "FANCI_000036" "g.89811742G>A" "" "" "" "FANCI(NM_001113378.1):c.868G>A (p.V290M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89268511G>A" "" "benign" "" "0000283824" "0" "90" "15" "89847147" "89847147" "subst" "8.12262E-6" "02326" "FANCI_000018" "g.89847147G>A" "" "" "" "FANCI(NM_001113378.1):c.3058+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89303916G>A" "" "pathogenic" "" "0000287096" "0" "30" "15" "89828441" "89828441" "subst" "0.00665638" "01943" "FANCI_000041" "g.89828441C>T" "" "" "" "FANCI(NM_001113378.1):c.1813C>T (p.L605F, p.(Leu605Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285210C>T" "" "likely benign" "" "0000287097" "0" "30" "15" "89844664" "89844664" "subst" "0.00302127" "01943" "FANCI_000049" "g.89844664C>T" "" "" "" "FANCI(NM_001113378.1):c.2997C>T (p.S999=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89301433C>T" "" "likely benign" "" "0000287098" "0" "30" "15" "89848401" "89848401" "subst" "6.49767E-5" "01943" "FANCI_000050" "g.89848401G>A" "" "" "" "FANCI(NM_001113378.1):c.3114G>A (p.S1038=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89305170G>A" "" "likely benign" "" "0000287099" "0" "30" "15" "89850836" "89850836" "subst" "0.0022985" "01943" "FANCI_000052" "g.89850836T>C" "" "" "" "FANCI(NM_001113378.1):c.3592-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89307605T>C" "" "likely benign" "" "0000287100" "0" "30" "15" "89806689" "89806689" "subst" "0" "01943" "FANCI_000032" "g.89806689C>T" "" "" "" "FANCI(NM_001113378.1):c.543C>T (p.F181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89263458C>T" "" "likely benign" "" "0000287101" "0" "30" "15" "89807836" "89807836" "subst" "0.00079081" "01943" "FANCI_000033" "g.89807836C>T" "" "" "" "FANCI(NM_001113378.1):c.753C>T (p.D251=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89264605C>T" "" "likely benign" "" "0000297220" "0" "30" "15" "89871960" "89871960" "subst" "0.000775698" "02325" "POLG_000083" "g.89871960G>A" "" "" "" "POLG(NM_002693.2):c.1126C>T (p.L376=), POLG(NM_002693.3):c.1126C>T (p.L376=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89328729G>A" "" "likely benign" "" "0000297221" "0" "10" "15" "89876858" "89876860" "dup" "0" "02325" "POLG_000102" "g.89876858_89876860dup" "" "" "" "POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.3):c.125delGinsGGCA (p.Q55dup), POLG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629dup" "" "benign" "" "0000297222" "0" "10" "15" "89876855" "89876860" "dup" "0" "02325" "POLG_000110" "g.89876855_89876860dup" "" "" "" "POLG(NM_002693.2):c.141_146dupGCAGCA (p.(Gln48_Gln49dup)), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333624_89333629dup" "" "benign" "" "0000297224" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "02325" "POLG_000080" "g.89870432C>T" "" "" "" "POLG(NM_001126131.1):c.1399G>A (p.(Ala467Thr)), POLG(NM_002693.2):c.1399G>A (p.A467T), POLG(NM_002693.3):c.1399G>A (p.A467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic" "" "0000297227" "0" "30" "15" "89876852" "89876860" "del" "0" "02325" "POLG_000096" "g.89876852_89876860del" "" "" "" "POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del), POLG(NM_002693.3):c.150_158delGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333621_89333629del" "" "likely benign" "" "0000297228" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "02325" "POLG_000079" "g.89870178C>A" "" "" "" "POLG(NM_002693.2):c.1550G>T (p.G517V, p.(Gly517Val)), POLG(NM_002693.3):c.1550G>T (p.G517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89326947C>A" "" "likely benign" "" "0000297229" "0" "10" "15" "89876858" "89876860" "del" "0" "02325" "POLG_000095" "g.89876858_89876860del" "" "" "" "POLG(NM_002693.2):c.156_158delGCA (p.Q55del), POLG(NM_002693.3):c.156_158delGCA (p.Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629del" "" "benign" "" "0000297231" "0" "10" "15" "89869919" "89869919" "subst" "0.00149079" "02325" "POLG_000078" "g.89869919G>A" "" "" "" "POLG(NM_002693.2):c.1636C>T (p.R546C), POLG(NM_002693.3):c.1636C>T (p.R546C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89326688G>A" "" "benign" "" "0000297232" "0" "10" "15" "89867094" "89867094" "subst" "0.00270439" "02325" "POLG_000072" "g.89867094G>T" "" "" "" "POLG(NM_002693.3):c.2109C>A (p.A703=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323863G>T" "" "benign" "" "0000297233" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "02325" "POLG_000070" "g.89866657C>G" "" "" "" "POLG(NM_002693.2):c.2243G>C (p.W748S), POLG(NM_002693.3):c.2243G>C (p.(Trp748Ser), p.W748S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic" "" "0000297234" "0" "30" "15" "89866646" "89866646" "subst" "0.0131109" "02325" "POLG_000013" "g.89866646G>A" "" "" "" "POLG(NM_002693.2):c.2254C>T (p.L752=), POLG(NM_002693.3):c.2254C>T (p.L752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323415G>A" "" "likely benign" "" "0000297235" "0" "10" "15" "89865073" "89865073" "subst" "0.00671313" "02325" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321842T>C" "" "benign" "" "0000297236" "0" "30" "15" "89876722" "89876722" "subst" "0.00176606" "02325" "POLG_000092" "g.89876722G>A" "" "" "" "POLG(NM_002693.2):c.264C>T (p.F88=), POLG(NM_002693.3):c.264C>T (p.F88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333491G>A" "" "likely benign" "" "0000297237" "0" "90" "15" "89864238" "89864238" "subst" "0.000101796" "02325" "POLG_000063" "g.89864238T>G" "" "" "" "POLG(NM_002693.2):c.2740A>C (p.T914P, p.(Thr914Pro)), POLG(NM_002693.3):c.2740A>C (p.T914P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic" "" "0000297238" "0" "30" "15" "89864125" "89864125" "subst" "0.00104899" "02325" "POLG_000033" "g.89864125G>A" "" "" "" "POLG(NM_002693.2):c.2853C>T (p.Y951=), POLG(NM_002693.3):c.2853C>T (p.Y951=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89320894G>A" "" "likely benign" "" "0000297239" "0" "30" "15" "89862237" "89862237" "subst" "0.00604391" "02325" "POLG_000057" "g.89862237C>T" "" "" "" "POLG(NM_002693.2):c.3198G>A (p.T1066=), POLG(NM_002693.3):c.3198G>A (p.T1066=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89319006C>T" "" "likely benign" "" "0000297240" "0" "30" "15" "89861826" "89861826" "subst" "0.028747" "02325" "POLG_000001" "g.89861826T>C" "" "" "" "POLG(NM_001126131.2):c.3428A>G (p.E1143G), POLG(NM_002693.2):c.3428A>G (p.E1143G), POLG(NM_002693.3):c.3428A>G (p.E1143G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318595T>C" "" "likely benign" "" "0000297241" "0" "50" "15" "89861811" "89861811" "subst" "8.12519E-6" "02325" "POLG_000053" "g.89861811C>T" "" "" "" "POLG(NM_002693.3):c.3443G>A (p.R1148H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318580C>T" "" "VUS" "" "0000297242" "0" "30" "15" "89860653" "89860653" "subst" "0.0078533" "02325" "POLG_000051" "g.89860653G>T" "" "" "" "POLG(NM_002693.2):c.3597C>A (p.T1199=), POLG(NM_002693.3):c.3597C>A (p.T1199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89317422G>T" "" "likely benign" "" "0000297243" "0" "10" "15" "89859994" "89859994" "subst" "0.0620257" "02325" "POLG_000049" "g.89859994C>A" "" "" "" "POLG(NM_002693.2):c.3708G>T (p.Q1236H), POLG(NM_002693.3):c.3708G>T (p.Q1236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316763C>A" "" "benign" "" "0000297244" "0" "50" "15" "89873364" "89873364" "subst" "0.00343715" "02325" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330133C>G" "" "VUS" "" "0000297245" "0" "30" "15" "89872249" "89872249" "subst" "0.00434968" "02325" "POLG_000022" "g.89872249C>T" "" "" "" "POLG(NM_002693.2):c.948G>A (p.K316=), POLG(NM_002693.3):c.948G>A (p.K316=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89329018C>T" "" "likely benign" "" "0000297246" "0" "30" "15" "89872227" "89872227" "subst" "0.000289898" "02325" "POLG_000084" "g.89872227G>A" "" "" "" "POLG(NM_002693.2):c.970C>T (p.P324S), POLG(NM_002693.3):c.970C>T (p.P324S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89328996G>A" "" "likely benign" "" "0000299041" "0" "10" "15" "89876858" "89876860" "del" "0" "02329" "POLG_000095" "g.89876858_89876860del" "" "" "" "POLG(NM_002693.2):c.156_158delGCA (p.Q55del), POLG(NM_002693.3):c.156_158delGCA (p.Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629del" "" "benign" "" "0000299043" "0" "30" "15" "89865073" "89865073" "subst" "0.00671313" "02329" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321842T>C" "" "likely benign" "" "0000299044" "0" "50" "15" "89865011" "89865011" "subst" "4.46744E-5" "02329" "POLG_000065" "g.89865011G>A" "" "" "" "POLG(NM_002693.2):c.2554C>T (p.R852C), POLG(NM_002693.3):c.2554C>T (p.R852C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321780G>A" "" "VUS" "" "0000299045" "0" "50" "15" "89876954" "89876954" "subst" "0.000174697" "02329" "POLG_000112" "g.89876954C>T" "" "" "" "POLG(NM_002693.2):c.32G>A (p.G11D), POLG(NM_002693.3):c.32G>A (p.(Gly11Asp), p.G11D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333723C>T" "" "VUS" "" "0000299046" "0" "10" "15" "89861826" "89861826" "subst" "0.028747" "02329" "POLG_000001" "g.89861826T>C" "" "" "" "POLG(NM_001126131.2):c.3428A>G (p.E1143G), POLG(NM_002693.2):c.3428A>G (p.E1143G), POLG(NM_002693.3):c.3428A>G (p.E1143G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318595T>C" "" "benign" "" "0000299047" "0" "10" "15" "89859994" "89859994" "subst" "0.0620257" "02329" "POLG_000049" "g.89859994C>A" "" "" "" "POLG(NM_002693.2):c.3708G>T (p.Q1236H), POLG(NM_002693.3):c.3708G>T (p.Q1236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316763C>A" "" "benign" "" "0000301113" "0" "10" "15" "89876858" "89876860" "del" "0" "02326" "POLG_000095" "g.89876858_89876860del" "" "" "" "POLG(NM_002693.2):c.156_158delGCA (p.Q55del), POLG(NM_002693.3):c.156_158delGCA (p.Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629del" "" "benign" "" "0000301114" "0" "30" "15" "89868732" "89868732" "subst" "0.000469341" "02326" "POLG_000075" "g.89868732T>G" "" "" "" "POLG(NM_002693.2):c.1898A>C (p.K633T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89325501T>G" "" "likely benign" "" "0000301115" "0" "30" "15" "89867424" "89867424" "subst" "0.0100612" "02326" "POLG_000074" "g.89867424C>T" "" "" "" "POLG(NM_002693.2):c.1984G>A (p.E662K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89324193C>T" "" "likely benign" "" "0000301116" "0" "10" "15" "89866646" "89866646" "subst" "0.0131109" "02326" "POLG_000013" "g.89866646G>A" "" "" "" "POLG(NM_002693.2):c.2254C>T (p.L752=), POLG(NM_002693.3):c.2254C>T (p.L752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323415G>A" "" "benign" "" "0000301117" "0" "30" "15" "89865091" "89865091" "subst" "0.00253022" "02326" "POLG_000068" "g.89865091G>A" "" "" "" "POLG(NM_001126131.1):c.2481-7C>T (p.(=)), POLG(NM_002693.2):c.2481-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321860G>A" "" "likely benign" "" "0000301118" "0" "30" "15" "89865073" "89865073" "subst" "0.00671313" "02326" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321842T>C" "" "likely benign" "" "0000301119" "0" "30" "15" "89865024" "89865024" "subst" "0.000487325" "02326" "POLG_000066" "g.89865024G>A" "" "" "" "POLG(NM_002693.2):c.2541C>T (p.A847=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321793G>A" "" "likely benign" "" "0000301120" "0" "30" "15" "89862346" "89862347" "del" "0" "02326" "POLG_000059" "g.89862346_89862347del" "" "" "" "POLG(NM_002693.2):c.3105-16_3105-15delGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89319115_89319116del" "" "likely benign" "" "0000301121" "0" "10" "15" "89861826" "89861826" "subst" "0.028747" "02326" "POLG_000001" "g.89861826T>C" "" "" "" "POLG(NM_001126131.2):c.3428A>G (p.E1143G), POLG(NM_002693.2):c.3428A>G (p.E1143G), POLG(NM_002693.3):c.3428A>G (p.E1143G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318595T>C" "" "benign" "" "0000301122" "0" "10" "15" "89859994" "89859994" "subst" "0.0620257" "02326" "POLG_000049" "g.89859994C>A" "" "" "" "POLG(NM_002693.2):c.3708G>T (p.Q1236H), POLG(NM_002693.3):c.3708G>T (p.Q1236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316763C>A" "" "benign" "" "0000301123" "0" "30" "15" "89873489" "89873489" "subst" "0.000399243" "02326" "POLG_000089" "g.89873489C>G" "" "" "" "POLG(NM_002693.2):c.678G>C (p.Q226H), POLG(NM_002693.3):c.678G>C (p.(Gln226His), p.Q226H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330258C>G" "" "likely benign" "" "0000301124" "0" "30" "15" "89872356" "89872358" "del" "0" "02326" "POLG_000086" "g.89872356_89872358del" "" "" "" "POLG(NM_002693.2):c.856-5_856-3delCTC, POLG(NM_002693.3):c.856-5_856-3delCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89329125_89329127del" "" "likely benign" "" "0000306080" "0" "10" "15" "89871960" "89871960" "subst" "0.000775698" "01943" "POLG_000083" "g.89871960G>A" "" "" "" "POLG(NM_002693.2):c.1126C>T (p.L376=), POLG(NM_002693.3):c.1126C>T (p.L376=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89328729G>A" "" "benign" "" "0000306082" "0" "30" "15" "89876861" "89876861" "subst" "0" "01943" "POLG_000111" "g.89876861C>T" "" "" "" "POLG(NM_002693.2):c.125G>A (p.R42Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333630C>T" "" "likely benign" "" "0000306083" "0" "90" "15" "89870555" "89870555" "subst" "2.03485E-5" "01943" "POLG_000082" "g.89870555C>T" "" "" "" "POLG(NM_002693.2):c.1276G>A (p.G426S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327324C>T" "" "pathogenic" "" "0000306084" "0" "50" "15" "89876858" "89876858" "subst" "0" "01943" "POLG_000107" "g.89876858T>C" "" "" "" "POLG(NM_002693.2):c.128A>G (p.Q43R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627T>C" "" "VUS" "" "0000306085" "0" "30" "15" "89870445" "89870445" "subst" "0.000134005" "01943" "POLG_000081" "g.89870445C>T" "" "" "" "POLG(NM_002693.2):c.1386G>A (p.S462=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327214C>T" "" "likely benign" "" "0000306086" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "01943" "POLG_000080" "g.89870432C>T" "" "" "" "POLG(NM_001126131.1):c.1399G>A (p.(Ala467Thr)), POLG(NM_002693.2):c.1399G>A (p.A467T), POLG(NM_002693.3):c.1399G>A (p.A467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic" "" "0000306087" "0" "90" "15" "89870429" "89870429" "subst" "0.000471032" "01943" "POLG_000019" "g.89870429T>C" "" "" "" "POLG(NM_002693.2):c.1402A>G (p.N468D, p.(Asn468Asp)), POLG(NM_002693.3):c.1402A>G (p.N468D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327198T>C" "" "pathogenic" "" "0000306088" "0" "50" "15" "89876843" "89876860" "del" "0" "01943" "POLG_000098" "g.89876843_89876860del" "" "" "" "POLG(NM_002693.2):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del), POLG(NM_002693.3):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333612_89333629del" "" "VUS" "" "0000306089" "0" "30" "15" "89876846" "89876860" "del" "0" "01943" "POLG_000097" "g.89876846_89876860del" "" "" "" "POLG(NM_002693.2):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del), POLG(NM_002693.3):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333615_89333629del" "" "likely benign" "" "0000306090" "0" "10" "15" "89876852" "89876860" "del" "0" "01943" "POLG_000096" "g.89876852_89876860del" "" "" "" "POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del), POLG(NM_002693.3):c.150_158delGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333621_89333629del" "" "benign" "" "0000306091" "0" "30" "15" "89876855" "89876860" "del" "0" "01943" "POLG_000029" "g.89876855_89876860del" "" "" "" "POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333624_89333629del" "" "likely benign" "" "0000306093" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "01943" "POLG_000079" "g.89870178C>A" "" "" "" "POLG(NM_002693.2):c.1550G>T (p.G517V, p.(Gly517Val)), POLG(NM_002693.3):c.1550G>T (p.G517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89326947C>A" "" "likely benign" "" "0000306094" "0" "10" "15" "89876858" "89876860" "del" "0" "01943" "POLG_000095" "g.89876858_89876860del" "" "" "" "POLG(NM_002693.2):c.156_158delGCA (p.Q55del), POLG(NM_002693.3):c.156_158delGCA (p.Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629del" "" "benign" "" "0000306097" "0" "30" "15" "89876830" "89876830" "subst" "0" "01943" "POLG_000101" "g.89876830C>T" "" "" "" "POLG(NM_002693.2):c.156G>A (p.Q52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333599C>T" "" "likely benign" "" "0000306098" "0" "30" "15" "89869867" "89869867" "subst" "4.06474E-6" "01943" "POLG_000077" "g.89869867G>A" "" "" "" "POLG(NM_002693.2):c.1688C>T (p.P563L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89326636G>A" "" "likely benign" "" "0000306099" "0" "30" "15" "89868740" "89868740" "subst" "0.0003163" "01943" "POLG_000076" "g.89868740G>A" "" "" "" "POLG(NM_002693.2):c.1890C>T (p.N630=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89325509G>A" "" "likely benign" "" "0000306100" "0" "30" "15" "89867424" "89867424" "subst" "0.0100612" "01943" "POLG_000074" "g.89867424C>T" "" "" "" "POLG(NM_002693.2):c.1984G>A (p.E662K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89324193C>T" "" "likely benign" "" "0000306101" "0" "50" "15" "89867339" "89867339" "subst" "4.87682E-5" "01943" "POLG_000073" "g.89867339G>A" "" "" "" "POLG(NM_002693.2):c.2069C>T (p.T690M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89324108G>A" "" "VUS" "" "0000306102" "0" "30" "15" "89866680" "89866680" "subst" "9.74881E-5" "01943" "POLG_000071" "g.89866680G>A" "" "" "" "POLG(NM_002693.2):c.2220C>T (p.N740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323449G>A" "" "likely benign" "" "0000306103" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "01943" "POLG_000070" "g.89866657C>G" "" "" "" "POLG(NM_002693.2):c.2243G>C (p.W748S), POLG(NM_002693.3):c.2243G>C (p.(Trp748Ser), p.W748S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic" "" "0000306104" "0" "30" "15" "89866646" "89866646" "subst" "0.0131109" "01943" "POLG_000013" "g.89866646G>A" "" "" "" "POLG(NM_002693.2):c.2254C>T (p.L752=), POLG(NM_002693.3):c.2254C>T (p.L752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89323415G>A" "" "likely benign" "" "0000306105" "0" "30" "15" "89865264" "89865264" "subst" "3.65577E-5" "01943" "POLG_000069" "g.89865264G>A" "" "" "" "POLG(NM_002693.2):c.2427-18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89322033G>A" "" "likely benign" "" "0000306106" "0" "30" "15" "89865091" "89865091" "subst" "0.00253022" "01943" "POLG_000068" "g.89865091G>A" "" "" "" "POLG(NM_001126131.1):c.2481-7C>T (p.(=)), POLG(NM_002693.2):c.2481-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321860G>A" "" "likely benign" "" "0000306107" "0" "50" "15" "89865011" "89865011" "subst" "4.46744E-5" "01943" "POLG_000065" "g.89865011G>A" "" "" "" "POLG(NM_002693.2):c.2554C>T (p.R852C), POLG(NM_002693.3):c.2554C>T (p.R852C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321780G>A" "" "VUS" "" "0000306108" "0" "30" "15" "89876722" "89876722" "subst" "0.00176606" "01943" "POLG_000092" "g.89876722G>A" "" "" "" "POLG(NM_002693.2):c.264C>T (p.F88=), POLG(NM_002693.3):c.264C>T (p.F88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333491G>A" "" "likely benign" "" "0000306109" "0" "30" "15" "89864125" "89864125" "subst" "0.00104899" "01943" "POLG_000033" "g.89864125G>A" "" "" "" "POLG(NM_002693.2):c.2853C>T (p.Y951=), POLG(NM_002693.3):c.2853C>T (p.Y951=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89320894G>A" "" "likely benign" "" "0000306110" "0" "70" "15" "89864088" "89864088" "subst" "0.000670846" "01943" "POLG_000062" "g.89864088G>A" "" "" "" "POLG(NM_002693.2):c.2890C>T (p.R964C), POLG(NM_002693.3):c.2890C>T (p.(Arg964Cys), p.R964C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89320857G>A" "" "likely pathogenic" "" "0000306111" "0" "30" "15" "89876693" "89876693" "subst" "0" "01943" "POLG_000091" "g.89876693G>A" "" "" "" "POLG(NM_002693.2):c.293C>T (p.A98V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333462G>A" "" "likely benign" "" "0000306112" "0" "10" "15" "89864020" "89864020" "subst" "0.00769087" "01943" "POLG_000032" "g.89864020G>A" "" "" "" "POLG(NM_002693.2):c.2958C>T (p.Y986=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89320789G>A" "" "benign" "" "0000306113" "0" "30" "15" "89862569" "89862569" "subst" "0.000410786" "01943" "POLG_000060" "g.89862569C>G" "" "" "" "POLG(NM_002693.2):c.2994G>C (p.S998=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89319338C>G" "" "likely benign" "" "0000306114" "0" "50" "15" "89862259" "89862259" "subst" "9.35423E-5" "01943" "POLG_000058" "g.89862259T>C" "" "" "" "POLG(NM_002693.2):c.3176A>G (p.N1059S), POLG(NM_002693.3):c.3176A>G (p.(Asn1059Ser), p.N1059S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89319028T>C" "" "VUS" "" "0000306115" "0" "10" "15" "89862237" "89862237" "subst" "0.00604391" "01943" "POLG_000057" "g.89862237C>T" "" "" "" "POLG(NM_002693.2):c.3198G>A (p.T1066=), POLG(NM_002693.3):c.3198G>A (p.T1066=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89319006C>T" "" "benign" "" "0000306116" "0" "30" "15" "89862213" "89862213" "subst" "2.84877E-5" "01943" "POLG_000056" "g.89862213C>A" "" "" "" "POLG(NM_002693.2):c.3222G>T (p.V1074=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318982C>A" "" "likely benign" "" "0000306117" "0" "30" "15" "89862202" "89862202" "subst" "4.06924E-6" "01943" "POLG_000055" "g.89862202C>G" "" "" "" "POLG(NM_002693.2):c.3233G>C (p.C1078S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318971C>G" "" "likely benign" "" "0000306118" "0" "50" "15" "89876954" "89876954" "subst" "0.000174697" "01943" "POLG_000112" "g.89876954C>T" "" "" "" "POLG(NM_002693.2):c.32G>A (p.G11D), POLG(NM_002693.3):c.32G>A (p.(Gly11Asp), p.G11D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333723C>T" "" "VUS" "" "0000306119" "0" "50" "15" "89861871" "89861871" "subst" "8.12269E-6" "01943" "POLG_000054" "g.89861871C>T" "" "" "" "POLG(NM_001126131.1):c.3383G>A (p.(Arg1128His)), POLG(NM_002693.2):c.3383G>A (p.R1128H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318640C>T" "" "VUS" "" "0000306120" "0" "10" "15" "89861826" "89861826" "subst" "0.028747" "01943" "POLG_000001" "g.89861826T>C" "" "" "" "POLG(NM_001126131.2):c.3428A>G (p.E1143G), POLG(NM_002693.2):c.3428A>G (p.E1143G), POLG(NM_002693.3):c.3428A>G (p.E1143G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318595T>C" "" "benign" "" "0000306121" "0" "50" "15" "89860691" "89860691" "subst" "0.000998952" "01943" "POLG_000052" "g.89860691G>A" "" "" "" "POLG(NM_002693.2):c.3559C>T (p.R1187W), POLG(NM_002693.3):c.3559C>T (p.R1187W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89317460G>A" "" "VUS" "" "0000306122" "0" "10" "15" "89860653" "89860653" "subst" "0.0078533" "01943" "POLG_000051" "g.89860653G>T" "" "" "" "POLG(NM_002693.2):c.3597C>A (p.T1199=), POLG(NM_002693.3):c.3597C>A (p.T1199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89317422G>T" "" "benign" "" "0000306123" "0" "30" "15" "89860050" "89860050" "subst" "7.31362E-5" "01943" "POLG_000050" "g.89860050G>A" "" "" "" "POLG(NM_002693.2):c.3652C>T (p.L1218=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316819G>A" "" "likely benign" "" "0000306124" "0" "10" "15" "89859994" "89859994" "subst" "0.0620257" "01943" "POLG_000049" "g.89859994C>A" "" "" "" "POLG(NM_002693.2):c.3708G>T (p.Q1236H), POLG(NM_002693.3):c.3708G>T (p.Q1236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316763C>A" "" "benign" "" "0000306125" "0" "50" "15" "89876498" "89876498" "subst" "5.98193E-6" "01943" "POLG_000090" "g.89876498G>A" "" "" "" "POLG(NM_002693.2):c.488C>T (p.P163L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333267G>A" "" "VUS" "" "0000306126" "0" "30" "15" "89873369" "89873369" "subst" "0.000373841" "01943" "POLG_000088" "g.89873369C>A" "" "" "" "POLG(NM_002693.2):c.798G>T (p.V266=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330138C>A" "" "likely benign" "" "0000306127" "0" "30" "15" "89873364" "89873364" "subst" "0.00343715" "01943" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330133C>G" "" "likely benign" "" "0000306128" "0" "10" "15" "89872227" "89872227" "subst" "0.000289898" "01943" "POLG_000084" "g.89872227G>A" "" "" "" "POLG(NM_002693.2):c.970C>T (p.P324S), POLG(NM_002693.3):c.970C>T (p.P324S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89328996G>A" "" "benign" "" "0000324267" "0" "50" "15" "89837191" "89837191" "subst" "4.06134E-6" "01804" "FANCI_000045" "g.89837191A>G" "" "" "" "FANCI(NM_001113378.1):c.2419A>G (p.(Met807Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89293960A>G" "" "VUS" "" "0000324268" "0" "30" "15" "89838293" "89838293" "subst" "0.00467499" "01804" "FANCI_000048" "g.89838293A>C" "" "" "" "FANCI(NM_001113378.1):c.2604A>C (p.(Glu868Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89295062A>C" "" "likely benign" "" "0000324271" "0" "50" "15" "89859675" "89859677" "del" "0" "01804" "POLG_000048" "g.89859675_89859677del" "" "" "" "FANCI(NM_001113378.1):c.3967_3969del (p.(Lys1323del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316444_89316446del" "" "VUS" "" "0000324273" "0" "30" "15" "89864968" "89864968" "subst" "2.43728E-5" "01804" "POLG_000064" "g.89864968C>T" "" "" "" "POLG(NM_001126131.1):c.2597G>A (p.(Arg866Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321737C>T" "" "likely benign" "" "0000324274" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "01804" "POLG_000046" "g.89868870G>A" "" "" "" "POLG(NM_002693.2):c.1760C>T (p.P587L), POLG(NM_002693.3):c.1760C>T (p.(Pro587Leu), p.P587L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000324276" "0" "50" "15" "89872271" "89872271" "subst" "1.64631E-5" "01804" "POLG_000085" "g.89872271C>T" "" "" "" "POLG(NM_001126131.1):c.926G>A (p.(Arg309His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89329040C>T" "" "VUS" "" "0000324277" "0" "30" "15" "89873364" "89873364" "subst" "0.00343715" "01804" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330133C>G" "" "likely benign" "" "0000324278" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "01804" "POLG_000194" "g.89873415G>A" "" "" "" "POLG(NM_001126131.2):c.752C>T (p.T251I), POLG(NM_002693.2):c.752C>T (p.T251I), POLG(NM_002693.3):c.752C>T (p.(Thr251Ile), p.T251I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic" "" "0000324280" "0" "30" "15" "89876855" "89876860" "del" "0" "01804" "POLG_000029" "g.89876855_89876860del" "" "" "" "POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333624_89333629del" "" "likely benign" "" "0000324281" "0" "50" "15" "89876858" "89876860" "dup" "0" "01804" "POLG_000102" "g.89876858_89876860dup" "" "" "" "POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.3):c.125delGinsGGCA (p.Q55dup), POLG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333627_89333629dup" "" "VUS" "" "0000324283" "0" "50" "15" "89876989" "89876992" "del" "0" "01804" "POLG_000113" "g.89876989_89876992del" "" "" "" "POLG(NM_002693.2):c.-3_1del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89333758_89333761del" "" "VUS" "" "0000341047" "0" "10" "15" "89864020" "89864020" "subst" "0.00769087" "02327" "POLG_000032" "g.89864020G>A" "" "" "" "POLG(NM_002693.2):c.2958C>T (p.Y986=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89320789G>A" "" "benign" "" "0000341459" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "02327" "POLG_000080" "g.89870432C>T" "" "" "" "POLG(NM_001126131.1):c.1399G>A (p.(Ala467Thr)), POLG(NM_002693.2):c.1399G>A (p.A467T), POLG(NM_002693.3):c.1399G>A (p.A467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic" "" "0000341707" "0" "50" "15" "89861968" "89861968" "subst" "8.1275E-6" "02327" "POLG_000114" "g.89861968G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89318737G>A" "" "VUS" "" "0000343767" "0" "90" "15" "89870429" "89870429" "subst" "0.000471032" "02327" "POLG_000019" "g.89870429T>C" "" "" "" "POLG(NM_002693.2):c.1402A>G (p.N468D, p.(Asn468Asp)), POLG(NM_002693.3):c.1402A>G (p.N468D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89327198T>C" "" "pathogenic" "" "0000344522" "0" "10" "15" "89859994" "89859994" "subst" "0.0620257" "02327" "POLG_000049" "g.89859994C>A" "" "" "" "POLG(NM_002693.2):c.3708G>T (p.Q1236H), POLG(NM_002693.3):c.3708G>T (p.Q1236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89316763C>A" "" "benign" "" "0000350202" "0" "30" "15" "89865073" "89865073" "subst" "0.00671313" "02327" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89321842T>C" "" "likely benign" "" "0000400774" "10" "90" "15" "89865023" "89865023" "subst" "0.000154326" "02552" "POLG_000116" "g.89865023C>T" "" "{PMID:Papuc 2019:30552426}" "" "" "" "Germline" "yes" "" "0" "" "" "g.89321792C>T" "" "pathogenic" "" "0000400775" "21" "90" "15" "89873343" "89873343" "subst" "0" "02552" "POLG_000117" "g.89873343C>T" "" "{PMID:Papuc 2019:30552426}" "" "" "" "Germline" "yes" "" "0" "" "" "g.89330112C>T" "" "pathogenic (dominant)" "" "0000438270" "11" "90" "15" "89868687" "89868687" "subst" "8.43035E-6" "03113" "POLG_000044" "g.89868687G>C" "" "" "" "" "variant associated with CPEO phenotype" "Germline" "" "" "0" "" "" "g.89325456G>C" "" "pathogenic (recessive)" "" "0000438271" "20" "90" "15" "89873415" "89873415" "subst" "0.00153175" "03113" "POLG_000046" "g.89873415G>A" "" "" "" "" "variant associated with CPEO phenotype" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic" "" "0000438272" "20" "90" "15" "89868870" "89868870" "subst" "0.00152881" "03113" "POLG_000046" "g.89868870G>A" "" "" "" "" "in cis mutation c.752C>T, variant associated with CPEO phenotype" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000441243" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Lionel 2018:28771251}" "" "" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0000442719" "0" "50" "15" "89869828" "89869868" "del" "0" "01164" "POLG_000118" "g.89869828_89869868del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89326597_89326637del" "" "VUS" "ACMG" "0000455046" "3" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "" "" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000455047" "3" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "" "" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic" "" "0000455048" "1" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "" "" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic" "" "0000455049" "1" "90" "15" "89865002" "89865002" "subst" "8.12255E-6" "00006" "POLG_000119" "g.89865002C>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "" "" "Germline" "" "" "0" "" "" "g.89321771C>A" "" "pathogenic" "" "0000455050" "1" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "p.(Val855Leu)" "" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic" "" "0000555981" "0" "30" "15" "89807836" "89807836" "subst" "0.00079081" "01804" "FANCI_000033" "g.89807836C>T" "" "" "" "FANCI(NM_001113378.1):c.753C>T (p.D251=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89264605C>T" "" "likely benign" "" "0000555982" "0" "50" "15" "89811698" "89811698" "subst" "0.000540123" "01804" "FANCI_000035" "g.89811698T>C" "" "" "" "FANCI(NM_001113378.1):c.824T>C (p.(Ile275Thr), p.I275T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89268467T>C" "" "VUS" "" "0000555983" "0" "30" "15" "89816710" "89816710" "dup" "0" "02329" "POLG_000120" "g.89816710dup" "" "" "" "FANCI(NM_001113378.1):c.975+10dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89273479dup" "" "likely benign" "" "0000555984" "0" "30" "15" "89824460" "89824460" "subst" "4.06279E-6" "01943" "POLG_000121" "g.89824460G>A" "" "" "" "FANCI(NM_001113378.1):c.1441G>A (p.V481I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281229G>A" "" "likely benign" "" "0000555985" "0" "50" "15" "89825000" "89825000" "subst" "0" "01804" "POLG_000122" "g.89825000T>G" "" "" "" "FANCI(NM_001113378.1):c.1517T>G (p.(Leu506Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281769T>G" "" "VUS" "" "0000555986" "0" "50" "15" "89825056" "89825056" "subst" "0.00228426" "01943" "POLG_000123" "g.89825056A>G" "" "" "" "FANCI(NM_001113378.1):c.1573A>G (p.M525V, p.(Met525Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281825A>G" "" "VUS" "" "0000555987" "0" "30" "15" "89825056" "89825056" "subst" "0.00228426" "02329" "POLG_000123" "g.89825056A>G" "" "" "" "FANCI(NM_001113378.1):c.1573A>G (p.M525V, p.(Met525Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281825A>G" "" "likely benign" "" "0000555988" "0" "30" "15" "89828441" "89828441" "subst" "0.00665638" "01804" "FANCI_000041" "g.89828441C>T" "" "" "" "FANCI(NM_001113378.1):c.1813C>T (p.L605F, p.(Leu605Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285210C>T" "" "likely benign" "" "0000555989" "0" "50" "15" "89833459" "89833459" "subst" "0" "01943" "POLG_000124" "g.89833459C>T" "" "" "" "FANCI(NM_001113378.1):c.1837C>T (p.L613F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89290228C>T" "" "VUS" "" "0000555990" "0" "50" "15" "89837113" "89837113" "subst" "4.87361E-5" "01943" "POLG_000125" "g.89837113C>A" "" "" "" "FANCI(NM_001113378.1):c.2341C>A (p.L781I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89293882C>A" "" "VUS" "" "0000555991" "0" "30" "15" "89848853" "89848853" "subst" "8.12143E-6" "01943" "POLG_000126" "g.89848853G>A" "" "" "" "FANCI(NM_001113378.1):c.3273G>A (p.Q1091=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89305622G>A" "" "likely benign" "" "0000555992" "0" "30" "15" "89850836" "89850836" "subst" "0.0022985" "02327" "FANCI_000052" "g.89850836T>C" "" "" "" "FANCI(NM_001113378.1):c.3592-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89307605T>C" "" "likely benign" "" "0000555993" "0" "30" "15" "89856189" "89856189" "subst" "0.000121828" "02329" "POLG_000127" "g.89856189G>A" "" "" "" "FANCI(NM_001113378.1):c.3706G>A (p.V1236I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89312958G>A" "" "likely benign" "" "0000555994" "0" "30" "15" "89858592" "89858592" "subst" "8.12282E-6" "01943" "POLG_000128" "g.89858592G>A" "" "" "" "FANCI(NM_001113378.1):c.3896G>A (p.R1299Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89315361G>A" "" "likely benign" "" "0000555995" "0" "30" "15" "89860051" "89860051" "subst" "2.43793E-5" "01943" "POLG_000129" "g.89860051C>T" "" "" "" "POLG(NM_002693.2):c.3651G>A (p.A1217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89316820C>T" "" "likely benign" "" "0000555997" "0" "10" "15" "89860067" "89860067" "subst" "0.0016829" "01943" "POLG_000131" "g.89860067T>C" "" "" "" "POLG(NM_002693.2):c.3644-9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89316836T>C" "" "benign" "" "0000555998" "0" "10" "15" "89860653" "89860653" "subst" "0.0078533" "02327" "POLG_000051" "g.89860653G>T" "" "" "" "POLG(NM_002693.2):c.3597C>A (p.T1199=), POLG(NM_002693.3):c.3597C>A (p.T1199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89317422G>T" "" "benign" "" "0000555999" "0" "10" "15" "89860689" "89860689" "subst" "0.00166489" "01943" "POLG_000132" "g.89860689C>G" "" "" "" "POLG(NM_002693.2):c.3561G>C (p.R1187=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89317458C>G" "" "benign" "" "0000556000" "0" "50" "15" "89861821" "89861821" "subst" "0" "01943" "POLG_000133" "g.89861821C>G" "" "" "" "POLG(NM_002693.2):c.3433G>C (p.D1145H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89318590C>G" "" "VUS" "" "0000556001" "0" "50" "15" "89861822" "89861822" "subst" "0" "01943" "POLG_000134" "g.89861822C>G" "" "" "" "POLG(NM_002693.2):c.3432G>C (p.E1144D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89318591C>G" "" "VUS" "" "0000556003" "0" "30" "15" "89861829" "89861829" "subst" "1.21856E-5" "01943" "POLG_000135" "g.89861829C>T" "" "" "" "POLG(NM_002693.2):c.3425G>A (p.R1142Q), POLG(NM_002693.3):c.3425G>A (p.R1142Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89318598C>T" "" "likely benign" "" "0000556004" "0" "30" "15" "89861999" "89861999" "subst" "0.000615437" "02326" "POLG_000136" "g.89861999C>T" "" "" "" "POLG(NM_002693.2):c.3274-19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89318768C>T" "" "likely benign" "" "0000556005" "0" "50" "15" "89862296" "89862296" "subst" "3.65669E-5" "01943" "POLG_000137" "g.89862296G>A" "" "" "" "POLG(NM_002693.2):c.3139C>T (p.R1047W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319065G>A" "" "VUS" "" "0000556007" "0" "50" "15" "89862304" "89862304" "subst" "0.000645853" "01943" "POLG_000138" "g.89862304A>G" "" "" "" "POLG(NM_002693.2):c.3131T>C (p.V1044A, p.(Val1044Ala)), POLG(NM_002693.3):c.3131T>C (p.V1044A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319073A>G" "" "VUS" "" "0000556008" "0" "30" "15" "89862304" "89862304" "subst" "0.000645853" "02327" "POLG_000138" "g.89862304A>G" "" "" "" "POLG(NM_002693.2):c.3131T>C (p.V1044A, p.(Val1044Ala)), POLG(NM_002693.3):c.3131T>C (p.V1044A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319073A>G" "" "likely benign" "" "0000556009" "0" "30" "15" "89862304" "89862304" "subst" "0.000645853" "02325" "POLG_000138" "g.89862304A>G" "" "" "" "POLG(NM_002693.2):c.3131T>C (p.V1044A, p.(Val1044Ala)), POLG(NM_002693.3):c.3131T>C (p.V1044A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319073A>G" "" "likely benign" "" "0000556010" "0" "10" "15" "89862341" "89862341" "subst" "0.377959" "01943" "POLG_000035" "g.89862341A>G" "" "" "" "POLG(NM_002693.2):c.3105-11T>C, POLG(NM_002693.3):c.3105-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319110A>G" "" "benign" "" "0000556011" "0" "10" "15" "89862341" "89862341" "subst" "0.377959" "02329" "POLG_000035" "g.89862341A>G" "" "" "" "POLG(NM_002693.2):c.3105-11T>C, POLG(NM_002693.3):c.3105-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319110A>G" "" "benign" "" "0000556012" "0" "90" "15" "89862458" "89862458" "subst" "4.06111E-6" "02325" "POLG_000139" "g.89862458C>T" "" "" "" "POLG(NM_002693.3):c.3104+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319227C>T" "" "pathogenic" "" "0000556013" "0" "50" "15" "89862465" "89862465" "subst" "0.000255842" "02325" "POLG_000031" "g.89862465G>A" "" "" "" "POLG(NM_002693.3):c.3098C>T (p.(Ala1033Val), p.A1033V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319234G>A" "" "VUS" "" "0000556014" "0" "30" "15" "89862569" "89862569" "subst" "8.13438E-6" "01943" "POLG_000140" "g.89862569C>T" "" "" "" "POLG(NM_002693.2):c.2994G>A (p.S998=), POLG(NM_002693.3):c.2994G>A (p.S998=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319338C>T" "" "likely benign" "" "0000556015" "0" "30" "15" "89862569" "89862569" "subst" "8.13438E-6" "02325" "POLG_000140" "g.89862569C>T" "" "" "" "POLG(NM_002693.2):c.2994G>A (p.S998=), POLG(NM_002693.3):c.2994G>A (p.S998=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319338C>T" "" "likely benign" "" "0000556016" "0" "50" "15" "89864034" "89864034" "subst" "0" "01943" "POLG_000141" "g.89864034C>T" "" "" "" "POLG(NM_002693.2):c.2944G>A (p.A982T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320803C>T" "" "VUS" "" "0000556017" "0" "50" "15" "89864087" "89864087" "subst" "4.47194E-5" "01943" "POLG_000142" "g.89864087C>T" "" "" "" "POLG(NM_002693.2):c.2891G>A (p.R964H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320856C>T" "" "VUS" "" "0000556018" "0" "30" "15" "89864098" "89864098" "subst" "6.91023E-5" "01943" "POLG_000143" "g.89864098G>A" "" "" "" "POLG(NM_002693.2):c.2880C>T (p.P960=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320867G>A" "" "likely benign" "" "0000556019" "0" "90" "15" "89864109" "89864109" "subst" "4.06441E-6" "02327" "POLG_000144" "g.89864109C>G" "" "" "" "POLG(NM_002693.2):c.2869G>C (p.A957P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320878C>G" "" "pathogenic" "" "0000556020" "0" "90" "15" "89864114" "89864114" "subst" "0" "02327" "POLG_000145" "g.89864114T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320883T>C" "" "pathogenic" "" "0000556021" "0" "30" "15" "89864125" "89864125" "subst" "0.00104899" "02326" "POLG_000033" "g.89864125G>A" "" "" "" "POLG(NM_002693.2):c.2853C>T (p.Y951=), POLG(NM_002693.3):c.2853C>T (p.Y951=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320894G>A" "" "likely benign" "" "0000556022" "0" "50" "15" "89864129" "89864129" "subst" "0" "02325" "POLG_000146" "g.89864129T>C" "" "" "" "POLG(NM_002693.3):c.2849A>G (p.N950S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320898T>C" "" "VUS" "" "0000556023" "0" "90" "15" "89864238" "89864238" "subst" "0.000101796" "01804" "POLG_000063" "g.89864238T>G" "" "" "" "POLG(NM_002693.2):c.2740A>C (p.T914P, p.(Thr914Pro)), POLG(NM_002693.3):c.2740A>C (p.T914P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321007T>G" "" "pathogenic" "" "0000556024" "0" "10" "15" "89864250" "89864250" "subst" "0.00109972" "02326" "POLG_000007" "g.89864250G>C" "" "" "" "POLG(NM_002693.2):c.2735-7C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321019G>C" "" "benign" "" "0000556025" "0" "30" "15" "89864258" "89864258" "subst" "0.000924222" "02326" "POLG_000147" "g.89864258G>A" "" "" "" "POLG(NM_002693.2):c.2735-15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321027G>A" "" "likely benign" "" "0000556026" "0" "30" "15" "89864369" "89864369" "subst" "1.21939E-5" "02325" "POLG_000148" "g.89864369A>G" "" "" "" "POLG(NM_002693.2):c.2721T>C (p.F907=), POLG(NM_002693.3):c.2721T>C (p.F907=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321138A>G" "" "likely benign" "" "0000556027" "0" "70" "15" "89865008" "89865008" "subst" "1.21847E-5" "02327" "POLG_000149" "g.89865008G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321777G>A" "" "likely pathogenic" "" "0000556028" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "02325" "POLG_000116" "g.89865023C>T" "" "" "" "POLG(NM_001126131.2):c.2542G>A (p.G848S), POLG(NM_002693.2):c.2542G>A (p.G848S), POLG(NM_002693.3):c.2542G>A (p.(Gly848Ser), p.G848S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321792C>T" "" "pathogenic" "" "0000556029" "0" "30" "15" "89865091" "89865091" "subst" "0.00253022" "01804" "POLG_000068" "g.89865091G>A" "" "" "" "POLG(NM_001126131.1):c.2481-7C>T (p.(=)), POLG(NM_002693.2):c.2481-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321860G>A" "" "likely benign" "" "0000556030" "0" "30" "15" "89865091" "89865091" "subst" "0.00253022" "02327" "POLG_000068" "g.89865091G>A" "" "" "" "POLG(NM_001126131.1):c.2481-7C>T (p.(=)), POLG(NM_002693.2):c.2481-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89321860G>A" "" "likely benign" "" "0000556031" "0" "70" "15" "89866000" "89866000" "subst" "0" "02327" "POLG_000150" "g.89866000A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89322769A>C" "" "likely pathogenic" "" "0000556033" "0" "70" "15" "89866012" "89866012" "subst" "0" "02327" "POLG_000152" "g.89866012T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89322781T>C" "" "likely pathogenic" "" "0000556034" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "01804" "POLG_000070" "g.89866657C>G" "" "" "" "POLG(NM_002693.2):c.2243G>C (p.W748S), POLG(NM_002693.3):c.2243G>C (p.(Trp748Ser), p.W748S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323426C>G" "" "pathogenic" "" "0000556035" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "02326" "POLG_000070" "g.89866657C>G" "" "" "" "POLG(NM_002693.2):c.2243G>C (p.W748S), POLG(NM_002693.3):c.2243G>C (p.(Trp748Ser), p.W748S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323426C>G" "" "pathogenic" "" "0000556036" "0" "50" "15" "89866679" "89866679" "subst" "3.24952E-5" "02325" "POLG_000153" "g.89866679C>T" "" "" "" "POLG(NM_002693.3):c.2221G>A (p.D741N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323448C>T" "" "VUS" "" "0000556037" "0" "50" "15" "89866693" "89866693" "subst" "0.00032496" "01943" "POLG_000154" "g.89866693T>C" "" "" "" "POLG(NM_002693.2):c.2207A>G (p.N736S), POLG(NM_002693.3):c.2207A>G (p.N736S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323462T>C" "" "VUS" "" "0000556038" "0" "50" "15" "89866693" "89866693" "subst" "0.00032496" "02325" "POLG_000154" "g.89866693T>C" "" "" "" "POLG(NM_002693.2):c.2207A>G (p.N736S), POLG(NM_002693.3):c.2207A>G (p.N736S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323462T>C" "" "VUS" "" "0000556039" "0" "30" "15" "89867082" "89867082" "subst" "4.06065E-5" "01943" "POLG_000155" "g.89867082G>T" "" "" "" "POLG(NM_002693.2):c.2121C>A (p.N707K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323851G>T" "" "likely benign" "" "0000556040" "0" "50" "15" "89867146" "89867146" "subst" "0.000219398" "01943" "POLG_000156" "g.89867146A>C" "" "" "" "POLG(NM_002693.2):c.2071-14T>G, POLG(NM_002693.3):c.2071-14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323915A>C" "" "VUS" "" "0000556041" "0" "30" "15" "89867146" "89867146" "subst" "0.000219398" "02325" "POLG_000156" "g.89867146A>C" "" "" "" "POLG(NM_002693.2):c.2071-14T>G, POLG(NM_002693.3):c.2071-14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89323915A>C" "" "likely benign" "" "0000556042" "0" "30" "15" "89867380" "89867380" "subst" "0.000292754" "01943" "POLG_000157" "g.89867380C>T" "" "" "" "POLG(NM_002693.2):c.2028G>A (p.A676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89324149C>T" "" "likely benign" "" "0000556043" "0" "30" "15" "89868740" "89868740" "subst" "0.0003163" "02326" "POLG_000076" "g.89868740G>A" "" "" "" "POLG(NM_002693.2):c.1890C>T (p.N630=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325509G>A" "" "likely benign" "" "0000556044" "0" "50" "15" "89868760" "89868760" "subst" "0" "02327" "POLG_000158" "g.89868760C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325529C>T" "" "VUS" "" "0000556045" "0" "50" "15" "89868793" "89868793" "subst" "0.000459791" "01943" "POLG_000159" "g.89868793G>A" "" "" "" "POLG(NM_002693.2):c.1837C>T (p.H613Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325562G>A" "" "VUS" "" "0000556047" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "01943" "POLG_000046" "g.89868870G>A" "" "" "" "POLG(NM_002693.2):c.1760C>T (p.P587L), POLG(NM_002693.3):c.1760C>T (p.(Pro587Leu), p.P587L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325639G>A" "" "pathogenic" "" "0000556049" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "02325" "POLG_000046" "g.89868870G>A" "" "" "" "POLG(NM_002693.2):c.1760C>T (p.P587L), POLG(NM_002693.3):c.1760C>T (p.(Pro587Leu), p.P587L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325639G>A" "" "pathogenic" "" "0000556050" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "02326" "POLG_000046" "g.89868870G>A" "" "" "" "POLG(NM_002693.2):c.1760C>T (p.P587L), POLG(NM_002693.3):c.1760C>T (p.(Pro587Leu), p.P587L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325639G>A" "" "pathogenic" "" "0000556051" "0" "50" "15" "89868894" "89868894" "subst" "2.47631E-5" "02329" "POLG_000160" "g.89868894C>T" "" "" "" "POLG(NM_002693.3):c.1736G>A (p.R579Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325663C>T" "" "VUS" "" "0000556052" "0" "50" "15" "89868909" "89868909" "subst" "4.58112E-5" "01943" "POLG_000161" "g.89868909C>T" "" "" "" "POLG(NM_002693.2):c.1721G>A (p.R574Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325678C>T" "" "VUS" "" "0000556053" "0" "30" "15" "89870132" "89870132" "subst" "0.00154737" "02326" "POLG_000018" "g.89870132A>G" "" "" "" "POLG(NM_002693.2):c.1585+11T>C, POLG(NM_002693.3):c.1585+11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89326901A>G" "" "likely benign" "" "0000556055" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "01804" "POLG_000079" "g.89870178C>A" "" "" "" "POLG(NM_002693.2):c.1550G>T (p.G517V, p.(Gly517Val)), POLG(NM_002693.3):c.1550G>T (p.G517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89326947C>A" "" "likely benign" "" "0000556056" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "02326" "POLG_000079" "g.89870178C>A" "" "" "" "POLG(NM_002693.2):c.1550G>T (p.G517V, p.(Gly517Val)), POLG(NM_002693.3):c.1550G>T (p.G517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89326947C>A" "" "likely benign" "" "0000556057" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "01804" "POLG_000080" "g.89870432C>T" "" "" "" "POLG(NM_001126131.1):c.1399G>A (p.(Ala467Thr)), POLG(NM_002693.2):c.1399G>A (p.A467T), POLG(NM_002693.3):c.1399G>A (p.A467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327201C>T" "" "pathogenic" "" "0000556058" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "02329" "POLG_000080" "g.89870432C>T" "" "" "" "POLG(NM_001126131.1):c.1399G>A (p.(Ala467Thr)), POLG(NM_002693.2):c.1399G>A (p.A467T), POLG(NM_002693.3):c.1399G>A (p.A467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327201C>T" "" "pathogenic" "" "0000556059" "0" "90" "15" "89870538" "89870538" "del" "0" "02327" "POLG_000162" "g.89870538del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327307del" "" "pathogenic" "" "0000556060" "0" "30" "15" "89870556" "89870556" "subst" "0.00033374" "01943" "POLG_000163" "g.89870556G>A" "" "" "" "POLG(NM_002693.2):c.1275C>T (p.A425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327325G>A" "" "likely benign" "" "0000556062" "0" "50" "15" "89871763" "89871763" "subst" "0.00178029" "01943" "POLG_000164" "g.89871763G>C" "" "" "" "POLG(NM_002693.2):c.1174C>G (p.L392V), POLG(NM_002693.3):c.1174C>G (p.L392V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328532G>C" "" "VUS" "" "0000556063" "0" "30" "15" "89871763" "89871763" "subst" "0.00178029" "02327" "POLG_000164" "g.89871763G>C" "" "" "" "POLG(NM_002693.2):c.1174C>G (p.L392V), POLG(NM_002693.3):c.1174C>G (p.L392V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328532G>C" "" "likely benign" "" "0000556064" "0" "50" "15" "89871763" "89871763" "subst" "0.00178029" "02325" "POLG_000164" "g.89871763G>C" "" "" "" "POLG(NM_002693.2):c.1174C>G (p.L392V), POLG(NM_002693.3):c.1174C>G (p.L392V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328532G>C" "" "VUS" "" "0000556066" "0" "30" "15" "89872227" "89872227" "subst" "8.57444E-5" "01943" "POLG_000166" "g.89872227G>T" "" "" "" "POLG(NM_002693.2):c.970C>A (p.P324T), POLG(NM_002693.3):c.970C>A (p.P324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328996G>T" "" "likely benign" "" "0000556067" "0" "50" "15" "89872227" "89872227" "subst" "8.57444E-5" "02325" "POLG_000166" "g.89872227G>T" "" "" "" "POLG(NM_002693.2):c.970C>A (p.P324T), POLG(NM_002693.3):c.970C>A (p.P324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328996G>T" "" "VUS" "" "0000556068" "0" "30" "15" "89872227" "89872227" "subst" "8.57444E-5" "02326" "POLG_000166" "g.89872227G>T" "" "" "" "POLG(NM_002693.2):c.970C>A (p.P324T), POLG(NM_002693.3):c.970C>A (p.P324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328996G>T" "" "likely benign" "" "0000556069" "0" "90" "15" "89872227" "89872227" "del" "0" "01943" "POLG_000167" "g.89872227del" "" "" "" "POLG(NM_002693.2):c.975delC (p.T326Qfs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328996del" "" "pathogenic" "" "0000556070" "0" "10" "15" "89872249" "89872249" "subst" "0.00434968" "01943" "POLG_000022" "g.89872249C>T" "" "" "" "POLG(NM_002693.2):c.948G>A (p.K316=), POLG(NM_002693.3):c.948G>A (p.K316=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89329018C>T" "" "benign" "" "0000556071" "0" "30" "15" "89872249" "89872249" "subst" "0.00434968" "02326" "POLG_000022" "g.89872249C>T" "" "" "" "POLG(NM_002693.2):c.948G>A (p.K316=), POLG(NM_002693.3):c.948G>A (p.K316=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89329018C>T" "" "likely benign" "" "0000556072" "0" "30" "15" "89872356" "89872358" "del" "0" "01943" "POLG_000086" "g.89872356_89872358del" "" "" "" "POLG(NM_002693.2):c.856-5_856-3delCTC, POLG(NM_002693.3):c.856-5_856-3delCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89329125_89329127del" "" "likely benign" "" "0000556073" "0" "30" "15" "89872356" "89872358" "del" "0" "02325" "POLG_000086" "g.89872356_89872358del" "" "" "" "POLG(NM_002693.2):c.856-5_856-3delCTC, POLG(NM_002693.3):c.856-5_856-3delCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89329125_89329127del" "" "likely benign" "" "0000556074" "0" "30" "15" "89873315" "89873315" "subst" "0.000829903" "02326" "POLG_000168" "g.89873315G>A" "" "" "" "POLG(NM_002693.2):c.852C>T (p.I284=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330084G>A" "" "likely benign" "" "0000556075" "0" "30" "15" "89873369" "89873369" "subst" "0.000373841" "02326" "POLG_000088" "g.89873369C>A" "" "" "" "POLG(NM_002693.2):c.798G>T (p.V266=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330138C>A" "" "likely benign" "" "0000556077" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "01943" "POLG_000194" "g.89873415G>A" "" "" "" "POLG(NM_001126131.2):c.752C>T (p.T251I), POLG(NM_002693.2):c.752C>T (p.T251I), POLG(NM_002693.3):c.752C>T (p.(Thr251Ile), p.T251I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330184G>A" "" "pathogenic" "" "0000556079" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "02325" "POLG_000194" "g.89873415G>A" "" "" "" "POLG(NM_001126131.2):c.752C>T (p.T251I), POLG(NM_002693.2):c.752C>T (p.T251I), POLG(NM_002693.3):c.752C>T (p.(Thr251Ile), p.T251I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330184G>A" "" "pathogenic" "" "0000556080" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "02326" "POLG_000194" "g.89873415G>A" "" "" "" "POLG(NM_001126131.2):c.752C>T (p.T251I), POLG(NM_002693.2):c.752C>T (p.T251I), POLG(NM_002693.3):c.752C>T (p.(Thr251Ile), p.T251I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330184G>A" "" "pathogenic" "" "0000556081" "0" "30" "15" "89873474" "89873474" "subst" "0" "01804" "POLG_000169" "g.89873474C>G" "" "" "" "POLG(NM_001126131.1):c.693G>C (p.(Glu231Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330243C>G" "" "likely benign" "" "0000556082" "0" "30" "15" "89873489" "89873489" "subst" "0.000399243" "02325" "POLG_000089" "g.89873489C>G" "" "" "" "POLG(NM_002693.2):c.678G>C (p.Q226H), POLG(NM_002693.3):c.678G>C (p.(Gln226His), p.Q226H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330258C>G" "" "likely benign" "" "0000556084" "0" "50" "15" "89876439" "89876439" "subst" "1.42064E-5" "02327" "POLG_000170" "g.89876439C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333208C>G" "" "VUS" "" "0000556085" "0" "70" "15" "89876690" "89876712" "dup" "0" "02329" "POLG_000171" "g.89876690_89876712dup" "" "" "" "POLG(NM_002693.3):c.276_298dupGGAGATGCCTGGCGAGGCCGCGG (p.V100Gfs*174)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333459_89333481dup" "" "likely pathogenic" "" "0000556086" "0" "30" "15" "89876733" "89876733" "subst" "4.09353E-6" "01804" "POLG_000172" "g.89876733C>G" "" "" "" "POLG(NM_001126131.1):c.253G>C (p.(Glu85Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333502C>G" "" "likely benign" "" "0000556091" "0" "50" "15" "89876849" "89876860" "del" "0" "01943" "POLG_000177" "g.89876849_89876860del" "" "" "" "POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del), POLG(NM_002693.3):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333618_89333629del" "" "VUS" "" "0000556092" "0" "30" "15" "89876849" "89876860" "del" "0" "02325" "POLG_000177" "g.89876849_89876860del" "" "" "" "POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del), POLG(NM_002693.3):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333618_89333629del" "" "likely benign" "" "0000556093" "0" "30" "15" "89876852" "89876860" "del" "0" "01804" "POLG_000096" "g.89876852_89876860del" "" "" "" "POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del), POLG(NM_002693.3):c.150_158delGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333621_89333629del" "" "likely benign" "" "0000556094" "0" "30" "15" "89876852" "89876860" "del" "0" "02326" "POLG_000096" "g.89876852_89876860del" "" "" "" "POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del), POLG(NM_002693.3):c.150_158delGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333621_89333629del" "" "likely benign" "" "0000556095" "0" "30" "15" "89876852" "89876860" "dup" "0" "02326" "POLG_000178" "g.89876852_89876860dup" "" "" "" "POLG(NM_002693.2):c.150_158dupGCAGCAGCA (p.Q53_Q55dup), POLG(NM_002693.3):c.150_158dupGCAGCAGCA (p.Q53_Q55dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333621_89333629dup" "" "likely benign" "" "0000556096" "0" "30" "15" "89876855" "89876860" "dup" "0" "02326" "POLG_000110" "g.89876855_89876860dup" "" "" "" "POLG(NM_002693.2):c.141_146dupGCAGCA (p.(Gln48_Gln49dup)), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333624_89333629dup" "" "likely benign" "" "0000556098" "0" "10" "15" "89876855" "89876860" "dup" "0" "01943" "POLG_000110" "g.89876855_89876860dup" "" "" "" "POLG(NM_002693.2):c.141_146dupGCAGCA (p.(Gln48_Gln49dup)), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333624_89333629dup" "" "benign" "" "0000556101" "0" "10" "15" "89876858" "89876860" "dup" "0" "01943" "POLG_000102" "g.89876858_89876860dup" "" "" "" "POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.3):c.125delGinsGGCA (p.Q55dup), POLG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333627_89333629dup" "" "benign" "" "0000556102" "0" "10" "15" "89876858" "89876860" "dup" "0" "02329" "POLG_000102" "g.89876858_89876860dup" "" "" "" "POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.3):c.125delGinsGGCA (p.Q55dup), POLG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333627_89333629dup" "" "benign" "" "0000556103" "0" "10" "15" "89876858" "89876860" "dup" "0" "02326" "POLG_000102" "g.89876858_89876860dup" "" "" "" "POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.3):c.125delGinsGGCA (p.Q55dup), POLG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333627_89333629dup" "" "benign" "" "0000556104" "0" "10" "15" "89876860" "89876861" "ins" "0" "02325" "POLG_000179" "g.89876860_89876861insTGCCGC" "" "" "" "POLG(NM_002693.2):c.127_128insGGCAGC (p.R42_Q43insRQ), POLG(NM_002693.3):c.127_128insGGCAGC (p.R42_Q43insRQ)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333629_89333630insTGCCGC" "" "benign" "" "0000556105" "0" "30" "15" "89876867" "89876869" "dup" "0" "01943" "POLG_000180" "g.89876867_89876869dup" "" "" "" "POLG(NM_002693.2):c.125_127dupGGC (p.(Arg42dup)), POLG(NM_002693.2):c.125_127dupGGC (p.R42dup), POLG(NM_002693.3):c.125_127dupGGC (p.R42dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333636_89333638dup" "" "likely benign" "" "0000556106" "0" "50" "15" "89876867" "89876869" "dup" "0" "02325" "POLG_000180" "g.89876867_89876869dup" "" "" "" "POLG(NM_002693.2):c.125_127dupGGC (p.(Arg42dup)), POLG(NM_002693.2):c.125_127dupGGC (p.R42dup), POLG(NM_002693.3):c.125_127dupGGC (p.R42dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333636_89333638dup" "" "VUS" "" "0000577964" "0" "30" "15" "89873364" "89873364" "subst" "0.00343715" "01164" "POLG_000087" "g.89873364C>G" "" "" "" "" "variant in Cruz 2017. Muscle&Nerve 56: 868" "Germline" "" "rs61752784" "0" "" "" "g.89330133C>G" "" "likely benign" "ACMG" "0000604560" "21" "70" "15" "89864088" "89864088" "subst" "0.000670846" "03508" "POLG_000062" "g.89864088G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89320857G>A" "" "VUS" "" "0000604561" "21" "50" "15" "89871973" "89871973" "subst" "0" "03508" "POLG_000181" "g.89871973C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89328742C>A" "" "likely pathogenic (recessive)" "" "0000615609" "0" "50" "15" "89849424" "89849424" "subst" "0" "01804" "POLG_000182" "g.89849424A>G" "" "" "" "FANCI(NM_001113378.1):c.3536A>G (p.(Tyr1179Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89306193A>G" "" "VUS" "" "0000615610" "0" "30" "15" "89859986" "89859986" "subst" "0" "01943" "POLG_000183" "g.89859986G>C" "" "" "" "POLG(NM_002693.2):c.3716C>G (p.P1239R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89316755G>C" "" "likely benign" "" "0000615611" "0" "50" "15" "89860619" "89860619" "subst" "1.21822E-5" "02325" "POLG_000185" "g.89860619C>T" "" "" "" "POLG(NM_002693.3):c.3631G>A (p.G1211R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89317388C>T" "" "VUS" "" "0000615612" "0" "50" "15" "89861871" "89861871" "subst" "8.12269E-6" "01804" "POLG_000054" "g.89861871C>T" "" "" "" "POLG(NM_001126131.1):c.3383G>A (p.(Arg1128His)), POLG(NM_002693.2):c.3383G>A (p.R1128H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89318640C>T" "" "VUS" "" "0000615613" "0" "50" "15" "89862259" "89862259" "subst" "9.35423E-5" "02325" "POLG_000058" "g.89862259T>C" "" "" "" "POLG(NM_002693.2):c.3176A>G (p.N1059S), POLG(NM_002693.3):c.3176A>G (p.(Asn1059Ser), p.N1059S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319028T>C" "" "VUS" "" "0000615614" "0" "30" "15" "89862336" "89862336" "subst" "0" "01943" "POLG_000186" "g.89862336G>A" "" "" "" "POLG(NM_002693.2):c.3105-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319105G>A" "" "likely benign" "" "0000615615" "0" "50" "15" "89862499" "89862499" "subst" "0" "02325" "POLG_000187" "g.89862499G>C" "" "" "" "POLG(NM_002693.3):c.3064C>G (p.L1022V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319268G>C" "" "VUS" "" "0000615616" "0" "50" "15" "89864088" "89864088" "subst" "0.000670846" "02325" "POLG_000062" "g.89864088G>A" "" "" "" "POLG(NM_002693.2):c.2890C>T (p.R964C), POLG(NM_002693.3):c.2890C>T (p.(Arg964Cys), p.R964C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89320857G>A" "" "VUS" "" "0000615620" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "02329" "POLG_000046" "g.89868870G>A" "" "" "" "POLG(NM_002693.2):c.1760C>T (p.P587L), POLG(NM_002693.3):c.1760C>T (p.(Pro587Leu), p.P587L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325639G>A" "" "pathogenic" "" "0000615621" "0" "30" "15" "89870556" "89870556" "subst" "0.00033374" "02326" "POLG_000163" "g.89870556G>A" "" "" "" "POLG(NM_002693.2):c.1275C>T (p.A425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327325G>A" "" "likely benign" "" "0000615622" "0" "30" "15" "89872227" "89872227" "subst" "0.000289898" "02326" "POLG_000084" "g.89872227G>A" "" "" "" "POLG(NM_002693.2):c.970C>T (p.P324S), POLG(NM_002693.3):c.970C>T (p.P324S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89328996G>A" "" "likely benign" "" "0000615623" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "02329" "POLG_000194" "g.89873415G>A" "" "" "" "POLG(NM_001126131.2):c.752C>T (p.T251I), POLG(NM_002693.2):c.752C>T (p.T251I), POLG(NM_002693.3):c.752C>T (p.(Thr251Ile), p.T251I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89330184G>A" "" "pathogenic" "" "0000615624" "0" "30" "15" "89876840" "89876860" "dup" "0" "02325" "POLG_000192" "g.89876840_89876860dup" "" "" "" "POLG(NM_002693.3):c.138_158dupGCAGCAGCAGCAGCAGCAGCA (p.Q49_Q55dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89333609_89333629dup" "" "likely benign" "" "0000623322" "0" "30" "15" "89816710" "89816710" "dup" "0" "01943" "POLG_000120" "g.89816710dup" "" "" "" "FANCI(NM_001113378.1):c.975+10dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89273479dup" "" "likely benign" "" "0000623323" "0" "30" "15" "89860074" "89860074" "subst" "7.32005E-5" "02326" "POLG_000184" "g.89860074A>G" "" "" "" "POLG(NM_002693.2):c.3644-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89316843A>G" "" "likely benign" "" "0000623327" "0" "50" "15" "89870461" "89870461" "subst" "3.24857E-5" "02325" "POLG_000191" "g.89870461C>T" "" "" "" "POLG(NM_002693.3):c.1370G>A (p.R457Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89327230C>T" "" "VUS" "" "0000629324" "11" "90" "15" "89864451" "89864451" "subst" "0" "00006" "POLG_000193" "g.89864451G>T" "1/113 cases" "{PMID:Pronicka 2016:27290639}" "" "" "" "Germline" "" "" "0" "" "" "g.89321220G>T" "" "pathogenic" "" "0000629360" "21" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "1/113 cases" "{PMID:Pronicka 2016:27290639}" "" "" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic" "" "0000649176" "1" "30" "15" "89859994" "89859994" "subst" "0.0620257" "03575" "POLG_000049" "g.89859994C>A" "90/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "90 heterozygous; {DB:CLININrs3087374}" "Germline" "" "rs3087374" "0" "" "" "g.89316763C>A" "" "likely benign" "" "0000649177" "1" "70" "15" "89861784" "89861784" "subst" "2.03224E-5" "03575" "POLG_000195" "g.89861784T>C" "1/2790 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs548076633}" "Germline" "" "rs548076633" "0" "" "" "g.89318553T>C" "" "likely pathogenic" "" "0000649178" "1" "50" "15" "89861812" "89861812" "subst" "4.87496E-5" "03575" "POLG_000196" "g.89861812G>A" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs149099318}" "Germline" "" "rs149099318" "0" "" "" "g.89318581G>A" "" "VUS" "" "0000649179" "1" "50" "15" "89861818" "89861818" "subst" "0.000182803" "03575" "POLG_000197" "g.89861818G>A" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs2307440}" "Germline" "" "rs2307440" "0" "" "" "g.89318587G>A" "" "VUS" "" "0000649180" "1" "30" "15" "89861826" "89861826" "subst" "0.028747" "03575" "POLG_000001" "g.89861826T>C" "65/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "65 heterozygous, no homozygous; {DB:CLININrs2307441}" "Germline" "" "rs2307441" "0" "" "" "g.89318595T>C" "" "likely benign" "" "0000649181" "1" "50" "15" "89861872" "89861872" "subst" "2.03065E-5" "03575" "POLG_000198" "g.89861872G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs755544706}" "Germline" "" "rs755544706" "0" "" "" "g.89318641G>A" "" "VUS" "" "0000649182" "1" "50" "15" "89864063" "89864063" "subst" "0.000105753" "03575" "POLG_000199" "g.89864063C>T" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs200309005}" "Germline" "" "rs200309005" "0" "" "" "g.89320832C>T" "" "VUS" "" "0000649183" "1" "50" "15" "89864088" "89864088" "subst" "0.000670846" "03575" "POLG_000062" "g.89864088G>A" "12/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 12 heterozygous, no homozygous; {DB:CLININrs201477273}" "Germline" "" "rs201477273" "0" "" "" "g.89320857G>A" "" "VUS" "" "0000649184" "1" "70" "15" "89864229" "89864229" "subst" "0" "03575" "POLG_000200" "g.89864229C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs796052890}" "Germline" "" "rs796052890" "0" "" "" "g.89320998C>T" "" "likely pathogenic" "" "0000649185" "1" "90" "15" "89865011" "89865011" "subst" "4.46744E-5" "03575" "POLG_000065" "g.89865011G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs144500145}" "Germline" "" "rs144500145" "0" "" "" "g.89321780G>A" "" "pathogenic" "" "0000649186" "1" "50" "15" "89866657" "89866657" "subst" "0.00101979" "03575" "POLG_000070" "g.89866657C>G" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs113994097}" "Germline" "" "rs113994097" "0" "" "" "g.89323426C>G" "" "VUS" "" "0000649187" "1" "50" "15" "89868870" "89868870" "subst" "0.00152881" "03575" "POLG_000046" "g.89868870G>A" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs113994096}" "Germline" "" "rs113994096" "0" "" "" "g.89325639G>A" "" "VUS" "" "0000649188" "1" "30" "15" "89869919" "89869919" "subst" "0.00149079" "03575" "POLG_000078" "g.89869919G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs2307447}" "Germline" "" "rs2307447" "0" "" "" "g.89326688G>A" "" "likely benign" "" "0000649189" "1" "50" "15" "89873364" "89873364" "subst" "0.00343715" "03575" "POLG_000087" "g.89873364C>G" "2/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs61752784}" "Germline" "" "rs61752784" "0" "" "" "g.89330133C>G" "" "VUS" "" "0000649190" "1" "50" "15" "89876498" "89876498" "subst" "5.98193E-6" "03575" "POLG_000090" "g.89876498G>A" "4/2777 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; {DB:CLININrs752892262}" "Germline" "" "rs752892262" "0" "" "" "g.89333267G>A" "" "VUS" "" "0000657690" "0" "30" "15" "89824510" "89824510" "subst" "0.000987163" "01804" "POLG_000201" "g.89824510A>G" "" "" "" "FANCI(NM_001113378.1):c.1491A>G (p.(=), p.Q497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281279A>G" "" "likely benign" "" "0000657691" "0" "50" "15" "89825056" "89825056" "subst" "0.00228426" "01804" "POLG_000123" "g.89825056A>G" "" "" "" "FANCI(NM_001113378.1):c.1573A>G (p.M525V, p.(Met525Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281825A>G" "" "VUS" "" "0000657692" "0" "30" "15" "89838176" "89838176" "subst" "0.00204846" "01804" "FANCI_000046" "g.89838176T>G" "" "" "" "FANCI(NM_001113378.1):c.2487T>G (p.(Leu829=), p.L829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89294945T>G" "" "likely benign" "" "0000657693" "0" "50" "15" "89862487" "89862487" "subst" "1.62463E-5" "01943" "POLG_000202" "g.89862487G>A" "" "" "" "POLG(NM_002693.2):c.3076C>T (p.R1026C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89319256G>A" "" "VUS" "" "0000657694" "0" "70" "15" "89868829" "89868829" "subst" "0" "01943" "POLG_000203" "g.89868829T>A" "" "" "" "POLG(NM_002693.2):c.1801A>T (p.K601*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89325598T>A" "" "likely pathogenic" "" "0000657695" "0" "30" "15" "89869833" "89869833" "subst" "0.00135844" "02326" "POLG_000016" "g.89869833C>T" "" "" "" "POLG(NM_002693.2):c.1712+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89326602C>T" "" "likely benign" "" "0000660255" "0" "50" "15" "89862304" "89862304" "subst" "0.000645853" "01164" "POLG_000138" "g.89862304A>G" "" "" "" "" "Isohanni et al. 2011. Neurology 76: 811" "Germline" "" "rs150233690" "0" "" "" "g.89319073A>G" "" "VUS" "" "0000663693" "0" "50" "15" "89876939" "89876939" "subst" "7.76108E-6" "01164" "POLG_000204" "g.89876939G>A" "" "Loke et al. 2019. J Pain Res 27: 1977" "" "" "ACMG grading: BP4,PM2" "Germline" "" "" "0" "" "" "g.89333708G>A" "" "VUS" "ACMG" "0000665804" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "01164" "POLG_000070" "g.89866657C>G" "" "" "" "" "VanGoethem et al. 2004. Neurol 63: 1251; Calvo et al. 2010. NatGenet 42: 851; Chan et al. 2006. HumMolGenet 15: 3473; Gaily et al. 2013. Epilepsie 54: 1577; Uusimaa et al. 2013. Epilepsia 54: 1002" "Germline" "" "rs113994097" "0" "" "" "g.89323426C>G" "" "pathogenic" "" "0000669302" "3" "30" "15" "89859994" "89859994" "subst" "0.0620257" "03575" "POLG_000049" "g.89859994C>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs3087374}" "Germline" "" "rs3087374" "0" "" "" "g.89316763C>A" "" "likely benign" "" "0000680331" "0" "50" "15" "89849345" "89849345" "subst" "2.03034E-5" "01804" "POLG_000205" "g.89849345C>G" "" "" "" "FANCI(NM_001113378.1):c.3457C>G (p.(Leu1153Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682998" "1" "50" "15" "89876722" "89876722" "subst" "0.00176606" "00006" "POLG_000092" "g.89876722G>A" "" "{PMID:Stalke 2018:28776642}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000683009" "2" "50" "15" "89862304" "89862304" "subst" "0.000645853" "00006" "POLG_000138" "g.89862304A>G" "" "{PMID:Stalke 2018:28776642}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000684794" "0" "30" "15" "89864088" "89864088" "subst" "0.000670846" "00004" "POLG_000062" "g.89864088G>A" "frequency 0.024" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.89320857G>A" "" "likely benign" "" "0000686197" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "01164" "POLG_000046" "g.89868870G>A" "" "Van Goethem et al. 2003. EurJHumGenet 11: 547; Filosto et al. 2003. ArchNeurol 609: 1279-84; Ferrari et al. 2005. Brain 128: 723-31; Lamantea et al. 2004. AnnNeurol 56: 454-5" "" "" "" "Germline" "" "rs113994096" "0" "" "" "" "" "pathogenic" "" "0000686198" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "01164" "POLG_000046" "g.89873415G>A" "" "Van Goethem et al. 2003. EurJHumGenet 11: 547; Filosto et al. 20013. ArchNeurol 609: 1279-84; Ferrari et al. 2005. Brain 128: 723-31; Lamantea et al. 2004. AnnNeurol 56: 454-5" "" "" "ACMG grading: PS3,PM2,PM3,PP1,PP2,PP4" "Germline" "" "rs113994094" "0" "" "" "" "" "pathogenic" "ACMG" "0000686199" "0" "90" "15" "89868750" "89868750" "subst" "3.68378E-5" "01164" "POLG_000208" "g.89868750C>T" "" "Luoma et al. 2005. Hum Mol Genet 14: 1907; Gebus et al. 2018. Eur J Neurol 25: 118-9; Sun et al. 2019. Genet Med 21: 195; Horvath et al. 2006. Brain 129: 1674-84" "" "" "ACMG grading: PS3,PM2,PM5,PP3" "Germline" "" "rs375305567" "0" "" "" "g.89325519C>T" "" "pathogenic" "ACMG" "0000691898" "0" "90" "15" "89816692" "89816692" "subst" "0" "02327" "POLG_000209" "g.89816692C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000691899" "0" "30" "15" "89825056" "89825056" "subst" "0.00228426" "02327" "POLG_000123" "g.89825056A>G" "" "" "" "FANCI(NM_001113378.1):c.1573A>G (p.M525V, p.(Met525Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691900" "0" "90" "15" "89858549" "89858549" "subst" "4.46722E-5" "01943" "FANCI_000014" "g.89858549C>T" "" "" "" "FANCI(NM_001113378.1):c.3853C>T (p.R1285*), FANCI(NM_001113378.2):c.3853C>T (p.R1285*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000691901" "0" "50" "15" "89863992" "89863992" "subst" "0" "02325" "POLG_000210" "g.89863992C>G" "" "" "" "POLG(NM_002693.3):c.2981+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691902" "0" "50" "15" "89864190" "89864190" "subst" "0" "01943" "POLG_000211" "g.89864190C>T" "" "" "" "POLG(NM_002693.2):c.2788G>A (p.D930N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691903" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "01943" "POLG_000116" "g.89865023C>T" "" "" "" "POLG(NM_001126131.2):c.2542G>A (p.G848S), POLG(NM_002693.2):c.2542G>A (p.G848S), POLG(NM_002693.3):c.2542G>A (p.(Gly848Ser), p.G848S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000691904" "0" "90" "15" "89865220" "89865220" "dup" "0" "02325" "POLG_000212" "g.89865220dup" "" "" "" "POLG(NM_002693.3):c.2454dupG (p.S819Vfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000691905" "0" "50" "15" "89871733" "89871733" "subst" "0" "01943" "POLG_000213" "g.89871733C>T" "" "" "" "POLG(NM_002693.2):c.1204G>A (p.A402T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691906" "0" "30" "15" "89876836" "89876836" "subst" "0" "01943" "POLG_000214" "g.89876836C>T" "" "" "" "POLG(NM_002693.2):c.150G>A (p.Q50=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691907" "0" "10" "15" "89876852" "89876860" "dup" "0" "01943" "POLG_000178" "g.89876852_89876860dup" "" "" "" "POLG(NM_002693.2):c.150_158dupGCAGCAGCA (p.Q53_Q55dup), POLG(NM_002693.3):c.150_158dupGCAGCAGCA (p.Q53_Q55dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000697657" "0" "70" "15" "89864403" "89864403" "subst" "0" "00006" "POLG_000215" "g.89864403A>C" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.89321172A>C" "" "likely pathogenic" "" "0000708545" "0" "50" "15" "89862242" "89862242" "subst" "0" "01807" "POLG_000216" "g.89862242C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000725356" "0" "50" "15" "89820103" "89820103" "subst" "4.06128E-6" "01943" "POLG_000217" "g.89820103T>C" "" "" "" "FANCI(NM_001113378.1):c.1274T>C (p.I425T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725357" "0" "50" "15" "89860708" "89860708" "subst" "3.24847E-5" "01943" "POLG_000218" "g.89860708C>T" "" "" "" "POLG(NM_002693.2):c.3542G>A (p.S1181N), POLG(NM_002693.3):c.3542G>A (p.S1181N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725358" "0" "30" "15" "89861766" "89861766" "subst" "0.000248337" "01943" "POLG_000219" "g.89861766G>A" "" "" "" "POLG(NM_002693.2):c.3482+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000725359" "0" "90" "15" "89864109" "89864109" "subst" "4.06441E-6" "01943" "POLG_000144" "g.89864109C>G" "" "" "" "POLG(NM_002693.2):c.2869G>C (p.A957P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000725360" "0" "70" "15" "89864193" "89864193" "subst" "0" "02329" "POLG_000189" "g.89864193T>G" "" "" "" "POLG(NM_001126131.2):c.2785A>C (p.T929P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000725361" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "02329" "POLG_000116" "g.89865023C>T" "" "" "" "POLG(NM_001126131.2):c.2542G>A (p.G848S), POLG(NM_002693.2):c.2542G>A (p.G848S), POLG(NM_002693.3):c.2542G>A (p.(Gly848Ser), p.G848S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000725362" "0" "70" "15" "89866691" "89866691" "subst" "0.000662101" "02327" "POLG_000220" "g.89866691C>G" "" "" "" "POLG(NM_002693.3):c.2209G>C (p.G737R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000725363" "0" "90" "15" "89871995" "89871995" "dup" "0" "02329" "POLG_000165" "g.89871995dup" "" "" "" "POLG(NM_002693.3):c.1091dupT (p.G365Rfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000725364" "0" "30" "15" "89873364" "89873364" "subst" "0.00343715" "02326" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000725365" "0" "50" "15" "89873364" "89873364" "subst" "0.00343715" "02329" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725366" "0" "30" "15" "89876722" "89876722" "subst" "0.00176606" "02326" "POLG_000092" "g.89876722G>A" "" "" "" "POLG(NM_002693.2):c.264C>T (p.F88=), POLG(NM_002693.3):c.264C>T (p.F88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000725367" "0" "10" "15" "89876852" "89876860" "dup" "0" "02325" "POLG_000178" "g.89876852_89876860dup" "" "" "" "POLG(NM_002693.2):c.150_158dupGCAGCAGCA (p.Q53_Q55dup), POLG(NM_002693.3):c.150_158dupGCAGCAGCA (p.Q53_Q55dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000725368" "0" "30" "15" "89876898" "89876898" "subst" "0" "01943" "POLG_000221" "g.89876898C>T" "" "" "" "POLG(NM_002693.2):c.88G>A (p.V30I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000735220" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000735221" "2" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000735222" "1" "90" "15" "89870237" "89870237" "subst" "0.000125879" "00006" "POLG_000222" "g.89870237C>G" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000735223" "1" "50" "15" "89870237" "89870237" "subst" "0.000125879" "00006" "POLG_000222" "g.89870237C>G" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000735224" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000735226" "2" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Sandford 2016:26942291}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000786992" "3" "90" "15" "89872286" "89872286" "subst" "5.77844E-5" "00006" "POLG_000042" "g.89872286A>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.89329055A>C" "" "pathogenic" "" "0000787596" "3" "50" "15" "89865056" "89865056" "subst" "3.65485E-5" "00000" "POLG_000223" "g.89865056A>G" "" "0" "" "" "" "Germline" "" "rs544828395" "0" "" "" "g.89321825A>G" "{CV-RCV:000518238.1}" "VUS" "" "0000806993" "0" "10" "15" "89850836" "89850836" "subst" "0.0022985" "02326" "FANCI_000052" "g.89850836T>C" "" "" "" "FANCI(NM_001113378.1):c.3592-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000806994" "0" "50" "15" "89861818" "89861818" "subst" "0.000182803" "02325" "POLG_000197" "g.89861818G>A" "" "" "" "POLG(NM_002693.3):c.3436C>T (p.(Arg1146Cys), p.R1146C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806995" "0" "70" "15" "89864238" "89864238" "subst" "0.000101796" "01943" "POLG_000063" "g.89864238T>G" "" "" "" "POLG(NM_002693.2):c.2740A>C (p.T914P, p.(Thr914Pro)), POLG(NM_002693.3):c.2740A>C (p.T914P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000806996" "0" "30" "15" "89864366" "89864366" "subst" "0.000113823" "01943" "POLG_000224" "g.89864366G>A" "" "" "" "POLG(NM_002693.2):c.2724C>T (p.A908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806997" "0" "30" "15" "89864369" "89864369" "subst" "1.21939E-5" "01943" "POLG_000148" "g.89864369A>G" "" "" "" "POLG(NM_002693.2):c.2721T>C (p.F907=), POLG(NM_002693.3):c.2721T>C (p.F907=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806998" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "02327" "POLG_000116" "g.89865023C>T" "" "" "" "POLG(NM_001126131.2):c.2542G>A (p.G848S), POLG(NM_002693.2):c.2542G>A (p.G848S), POLG(NM_002693.3):c.2542G>A (p.(Gly848Ser), p.G848S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000806999" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "02327" "POLG_000070" "g.89866657C>G" "" "" "" "POLG(NM_002693.2):c.2243G>C (p.W748S), POLG(NM_002693.3):c.2243G>C (p.(Trp748Ser), p.W748S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807000" "0" "50" "15" "89867128" "89867130" "del" "0" "01943" "POLG_000225" "g.89867128_89867130del" "" "" "" "POLG(NM_002693.2):c.2077_2079delGAA (p.E693del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807001" "0" "30" "15" "89868896" "89868896" "subst" "0" "01943" "POLG_000226" "g.89868896G>C" "" "" "" "POLG(NM_002693.2):c.1734C>G (p.P578=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807002" "0" "50" "15" "89870561" "89870561" "subst" "0" "02325" "POLG_000227" "g.89870561G>C" "" "" "" "POLG(NM_002693.3):c.1270C>G (p.L424V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807003" "0" "30" "15" "89873489" "89873489" "subst" "0.000399243" "01943" "POLG_000089" "g.89873489C>G" "" "" "" "POLG(NM_002693.2):c.678G>C (p.Q226H), POLG(NM_002693.3):c.678G>C (p.(Gln226His), p.Q226H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807004" "0" "50" "15" "89876860" "89876861" "ins" "0" "01943" "POLG_000179" "g.89876860_89876861insTGCCGC" "" "" "" "POLG(NM_002693.2):c.127_128insGGCAGC (p.R42_Q43insRQ), POLG(NM_002693.3):c.127_128insGGCAGC (p.R42_Q43insRQ)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000818139" "11" "70" "15" "89868834" "89868834" "subst" "0" "00006" "POLG_000228" "g.89868834G>A" "" "{PMID:Lin 2021:34189666}" "" "" "" "Germline" "" "" "0" "" "" "g.89325603G>A" "" "likely pathogenic (recessive)" "" "0000818142" "0" "90" "15" "89861596" "89870890" "del" "0" "00006" "POLG_000229" "g.89861596_89870890del" "" "" "" "hg38 89,861,596-89,870,890del" "9223-bp deletion exon 7-21" "De novo" "" "" "0" "" "" "g.89318365_89327659del" "" "pathogenic (recessive)" "" "0000818145" "2" "90" "15" "89876396" "89876396" "subst" "1.01367E-5" "04132" "POLG_000230" "g.89876396A>G" "" "{PMID:Hedberg-Oldfors 2020:32042919}" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.89333165A>G" "" "pathogenic (recessive)" "ACMG" "0000818146" "1" "90" "15" "89864238" "89864238" "subst" "0.000101796" "04132" "POLG_000063" "g.89864238T>G" "" "{PMID:Hedberg-Oldfors 2020:32042919}" "" "" "" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0000818158" "21" "90" "15" "89866657" "89866657" "subst" "0.00101979" "04132" "POLG_000070" "g.89866657C>G" "" "{PMID:Phillips 2019:30843307}" "" "" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "ACMG" "0000818160" "11" "90" "15" "89872271" "89872271" "subst" "1.64631E-5" "04132" "POLG_000085" "g.89872271C>T" "" "{PMID:Phillips 2019:30843307}" "" "" "" "Germline" "" "" "0" "" "" "g.89329040C>T" "" "pathogenic (recessive)" "ACMG" "0000818161" "21" "90" "15" "89866691" "89866691" "subst" "0.000662101" "04132" "POLG_000220" "g.89866691C>G" "" "{PMID:Phillips 2019:30843307}" "" "" "" "Germline" "" "" "0" "" "" "g.89323460C>G" "" "pathogenic (recessive)" "ACMG" "0000818468" "11" "50" "15" "89864088" "89864088" "subst" "0.000670846" "00000" "POLG_000062" "g.89864088G>A" "" "{PMID:Surl 2020:32165824}" "" "c.2890C>T:p.(Arg964Cys)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.89320857G>A" "" "VUS" "ACMG" "0000818469" "21" "50" "15" "89871973" "89871973" "subst" "0" "00000" "POLG_000181" "g.89871973C>A" "" "{PMID:Surl 2020:32165824}" "" "c.1113G>T:p.(Lys371Asn)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.89328742C>A" "" "VUS" "ACMG" "0000818991" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "04132" "POLG_000070" "g.89866657C>G" "" "{PMID:Phillips 2019:30843307}" "" "" "uniparental isodisomy chr15: 43804173–102359499" "Uniparental disomy, maternal allele" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0000829775" "11" "50" "15" "89866735" "89866735" "subst" "0.00099162" "00000" "POLG_000231" "g.89866735C>T" "" "{PMID:Sudha 2017:28574807}" "" "c.2165G>A (p.Arg722His)" "" "Germline" "?" "" "0" "" "" "g.89323504C>T" "" "VUS" "" "0000839674" "20" "70" "15" "89870542" "89870542" "subst" "0" "04266" "POLG_000232" "g.89870542A>G" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.89327311A>G" "" "likely pathogenic (dominant)" "" "0000854231" "0" "50" "15" "89821940" "89821940" "subst" "2.43805E-5" "01943" "POLG_000233" "g.89821940A>C" "" "" "" "FANCI(NM_001113378.1):c.1316A>C (p.E439A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854232" "0" "30" "15" "89836314" "89836314" "subst" "0" "02326" "POLG_000235" "g.89836314C>G" "" "" "" "FANCI(NM_001113378.1):c.2291+20C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854233" "0" "30" "15" "89838176" "89838176" "subst" "0.00204846" "02326" "FANCI_000046" "g.89838176T>G" "" "" "" "FANCI(NM_001113378.1):c.2487T>G (p.(Leu829=), p.L829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854234" "0" "30" "15" "89848591" "89848591" "subst" "1.21847E-5" "01943" "POLG_000238" "g.89848591C>G" "" "" "" "FANCI(NM_001113378.1):c.3206C>G (p.T1069R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854235" "0" "30" "15" "89861951" "89861951" "subst" "1.62475E-5" "01943" "POLG_000241" "g.89861951T>G" "" "" "" "POLG(NM_002693.2):c.3303A>C (p.V1101=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854236" "0" "50" "15" "89864019" "89864019" "subst" "1.62872E-5" "02327" "POLG_000242" "g.89864019C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854237" "0" "70" "15" "89865979" "89865979" "subst" "0" "01943" "POLG_000244" "g.89865979C>G" "" "" "" "POLG(NM_002693.2):c.2420G>C (p.R807P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000854238" "0" "50" "15" "89873460" "89873460" "subst" "0" "01943" "POLG_000245" "g.89873460G>A" "" "" "" "POLG(NM_002693.2):c.707C>T (p.T236I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854239" "0" "90" "15" "89876880" "89876892" "del" "0" "02327" "POLG_000246" "g.89876880_89876892del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000854240" "0" "30" "15" "89876912" "89876912" "subst" "0" "01943" "POLG_000247" "g.89876912C>G" "" "" "" "POLG(NM_002693.2):c.74G>C (p.W25S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864146" "0" "10" "15" "89826352" "89826352" "subst" "0.000507701" "02326" "POLG_000234" "g.89826352C>G" "" "" "" "FANCI(NM_001113378.1):c.1584-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000864147" "0" "10" "15" "89837139" "89837139" "subst" "0.0243242" "01804" "POLG_000236" "g.89837139G>T" "" "" "" "FANCI(NM_001113378.1):c.2367G>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000864148" "0" "90" "15" "89848433" "89848433" "subst" "8.12156E-6" "01943" "POLG_000237" "g.89848433T>A" "" "" "" "FANCI(NM_001113378.1):c.3146T>A (p.L1049*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000864149" "0" "30" "15" "89860620" "89860620" "subst" "2.03034E-5" "01943" "POLG_000239" "g.89860620G>A" "" "" "" "POLG(NM_002693.2):c.3630C>T (p.Y1210=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864150" "0" "30" "15" "89860691" "89860691" "subst" "0.000998952" "02326" "POLG_000052" "g.89860691G>A" "" "" "" "POLG(NM_002693.2):c.3559C>T (p.R1187W), POLG(NM_002693.3):c.3559C>T (p.R1187W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864151" "0" "30" "15" "89861765" "89861765" "subst" "5.69921E-5" "01943" "POLG_000240" "g.89861765C>T" "" "" "" "POLG(NM_002693.2):c.3482+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864152" "0" "50" "15" "89861829" "89861829" "subst" "1.21856E-5" "02325" "POLG_000135" "g.89861829C>T" "" "" "" "POLG(NM_002693.2):c.3425G>A (p.R1142Q), POLG(NM_002693.3):c.3425G>A (p.R1142Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864153" "0" "30" "15" "89865078" "89865078" "subst" "4.06128E-5" "01943" "POLG_000243" "g.89865078G>A" "" "" "" "POLG(NM_002693.2):c.2487C>T (p.P829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864154" "0" "30" "15" "89873364" "89873364" "subst" "0.00343715" "02327" "POLG_000087" "g.89873364C>G" "" "" "" "POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A), POLG(NM_002693.3):c.803G>C (p.G268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864155" "0" "30" "15" "89876846" "89876860" "del" "0" "02325" "POLG_000097" "g.89876846_89876860del" "" "" "" "POLG(NM_002693.2):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del), POLG(NM_002693.3):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000880083" "11" "90" "15" "89869910" "89869910" "del" "0" "00006" "POLG_000248" "g.89869910del" "" "{PMID:Schalk 2022:34930816}" "" "1646delT" "" "Germline" "" "" "0" "" "" "g.89326679del" "" "VUS" "" "0000892402" "0" "30" "15" "89805046" "89805046" "subst" "0.000296497" "02326" "POLG_000249" "g.89805046T>G" "" "" "" "FANCI(NM_001113378.1):c.446-6T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000892403" "0" "90" "15" "89826418" "89826418" "del" "0" "02325" "POLG_000250" "g.89826418del" "" "" "" "FANCI(NM_001113378.2):c.1635delG (p.N546Tfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000892404" "0" "50" "15" "89843582" "89843582" "subst" "8.12341E-6" "02325" "POLG_000251" "g.89843582C>T" "" "" "" "FANCI(NM_001113378.2):c.2855C>T (p.T952I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892405" "0" "30" "15" "89861766" "89861766" "subst" "0.000248337" "02326" "POLG_000219" "g.89861766G>A" "" "" "" "POLG(NM_002693.2):c.3482+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000892406" "0" "50" "15" "89862191" "89862191" "subst" "4.06785E-6" "02325" "POLG_000252" "g.89862191C>T" "" "" "" "POLG(NM_002693.3):c.3244G>A (p.A1082T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892407" "0" "50" "15" "89862295" "89862295" "subst" "8.12519E-6" "02325" "POLG_000253" "g.89862295C>T" "" "" "" "POLG(NM_002693.3):c.3140G>A (p.R1047Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892408" "0" "90" "15" "89862458" "89862458" "subst" "4.06111E-6" "02327" "POLG_000139" "g.89862458C>T" "" "" "" "POLG(NM_002693.3):c.3104+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000892409" "0" "70" "15" "89866634" "89866634" "subst" "0" "02329" "POLG_000254" "g.89866634C>T" "" "" "" "POLG(NM_001126131.2):c.2265+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000892410" "0" "50" "15" "89868748" "89868748" "subst" "5.32809E-5" "02325" "POLG_000255" "g.89868748G>A" "" "" "" "POLG(NM_002693.3):c.1882C>T (p.R628W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892411" "0" "50" "15" "89870416" "89870416" "subst" "0" "02327" "POLG_000256" "g.89870416T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000892412" "0" "90" "15" "89870429" "89870429" "subst" "0.000471032" "02325" "POLG_000019" "g.89870429T>C" "" "" "" "POLG(NM_002693.2):c.1402A>G (p.N468D, p.(Asn468Asp)), POLG(NM_002693.3):c.1402A>G (p.N468D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000892413" "0" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "02327" "POLG_000023" "g.89873472C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000892414" "0" "50" "15" "89876843" "89876860" "del" "0" "02325" "POLG_000098" "g.89876843_89876860del" "" "" "" "POLG(NM_002693.2):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del), POLG(NM_002693.3):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000909454" "0" "90" "15" "89865979" "89865979" "subst" "0" "01164" "POLG_000257" "g.89865979C>T" "" "PMID: 21880868, 29302508" "" "" "ACMG: PP3_STR, PS4_MOD, PM5, PM2_SUP, PM3_SUP (class 5); REVEL: 0,975 (PP3_STR)" "Germline" "?" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000909455" "0" "70" "15" "89865041" "89865041" "subst" "0" "01164" "POLG_000258" "g.89865041G>A" "" "" "" "" "ACMG: PP3_STR, PM2_SUP, PM3_SUP (class 4); REVEL: 0,96 (PP3_STR)" "Germline" "?" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000914412" "0" "10" "15" "89826496" "89826496" "subst" "0.412497" "02325" "POLG_000259" "g.89826496C>T" "" "" "" "FANCI(NM_001113378.2):c.1698+15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914413" "0" "10" "15" "89844688" "89844688" "subst" "0.394361" "02325" "POLG_000260" "g.89844688A>C" "" "" "" "FANCI(NM_001113378.2):c.3006+15A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914414" "0" "10" "15" "89858602" "89858602" "subst" "0.410079" "02325" "POLG_000261" "g.89858602T>C" "" "" "" "FANCI(NM_001113378.2):c.3906T>C (p.G1302=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914415" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "02327" "POLG_000079" "g.89870178C>A" "" "" "" "POLG(NM_002693.2):c.1550G>T (p.G517V, p.(Gly517Val)), POLG(NM_002693.3):c.1550G>T (p.G517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926079" "0" "30" "15" "89821953" "89821953" "subst" "0" "02329" "POLG_000262" "g.89821953G>A" "" "" "" "FANCI(NM_001113378.1):c.1329G>A (p.Q443=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930469" "0" "30" "15" "89836024" "89836024" "subst" "1.63463E-5" "02326" "POLG_000263" "g.89836024G>A" "" "" "" "FANCI(NM_001113378.1):c.2098G>A (p.E700K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930470" "0" "30" "15" "89843610" "89843610" "subst" "0.000849386" "02326" "POLG_000264" "g.89843610A>G" "" "" "" "FANCI(NM_001113378.1):c.2883A>G (p.Q961=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930471" "0" "90" "15" "89860605" "89860605" "subst" "4.06088E-6" "02327" "POLG_000265" "g.89860605A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000930472" "0" "50" "15" "89865055" "89865055" "subst" "2.03047E-5" "02327" "POLG_000266" "g.89865055T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000930473" "0" "50" "15" "89865989" "89865989" "subst" "4.06673E-6" "02327" "POLG_000267" "g.89865989C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931639" "21" "30" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Sajan 2019:30478137}" "" "" "" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "likely benign" "" "0000932949" "0" "50" "15" "89862665" "89862665" "subst" "0" "03779" "POLG_000269" "g.89862665C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000936455" "0" "50" "15" "89862576" "89862576" "subst" "7.72377E-5" "00006" "POLG_000270" "g.89862576C>T" "" "{PMID:Hamdan 2017:29100083}" "" "NM_002693:c.G2987A (R996Q)" "" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000950475" "0" "50" "15" "89859680" "89859680" "subst" "0" "01804" "POLG_000271" "g.89859680G>A" "" "" "" "FANCI(NM_001113378.1):c.3977G>A (p.(Arg1326Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950476" "0" "50" "15" "89860691" "89860691" "subst" "0.000998952" "02325" "POLG_000052" "g.89860691G>A" "" "" "" "POLG(NM_002693.2):c.3559C>T (p.R1187W), POLG(NM_002693.3):c.3559C>T (p.R1187W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950477" "0" "70" "15" "89860747" "89860747" "subst" "4.06105E-6" "02327" "POLG_000272" "g.89860747A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000950478" "0" "50" "15" "89868894" "89868894" "subst" "2.47631E-5" "02325" "POLG_000160" "g.89868894C>T" "" "" "" "POLG(NM_002693.3):c.1736G>A (p.R579Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968026" "0" "30" "15" "89869919" "89869919" "subst" "0.00149079" "02326" "POLG_000078" "g.89869919G>A" "" "" "" "POLG(NM_002693.2):c.1636C>T (p.R546C), POLG(NM_002693.3):c.1636C>T (p.R546C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968028" "0" "30" "15" "89871763" "89871763" "subst" "0.00178029" "02326" "POLG_000164" "g.89871763G>C" "" "" "" "POLG(NM_002693.2):c.1174C>G (p.L392V), POLG(NM_002693.3):c.1174C>G (p.L392V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968033" "0" "50" "15" "89876591" "89876591" "subst" "0" "02327" "POLG_000273" "g.89876591C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968034" "0" "30" "15" "89876827" "89876832" "dup" "0" "02325" "POLG_000274" "g.89876827_89876832dup" "" "" "" "POLG(NM_002693.3):c.159_164dupACAGCA (p.Q54_Q55dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968035" "0" "30" "15" "89876855" "89876860" "del" "0" "02326" "POLG_000029" "g.89876855_89876860del" "" "" "" "POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981488" "0" "50" "15" "89811621" "89811621" "subst" "4.0622E-6" "02327" "POLG_000275" "g.89811621A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981489" "0" "50" "15" "89816700" "89816700" "subst" "0" "01804" "POLG_000276" "g.89816700G>C" "" "" "" "FANCI(NM_001113378.2):c.975G>C (p.(Gln325His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981490" "0" "70" "15" "89820093" "89820093" "subst" "0.000121844" "02327" "FANCI_000028" "g.89820093G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000981491" "0" "30" "15" "89824390" "89824391" "del" "0" "01804" "POLG_000277" "g.89824390_89824391del" "" "" "" "FANCI(NM_001113378.2):c.1382-11_1382-10del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981492" "0" "30" "15" "89833517" "89833517" "subst" "0" "01804" "POLG_000278" "g.89833517A>C" "" "" "" "FANCI(NM_001113378.2):c.1890+5A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981493" "0" "30" "15" "89834846" "89834846" "subst" "0.00158933" "01804" "POLG_000279" "g.89834846A>C" "" "" "" "FANCI(NM_001113378.2):c.1893A>C (p.(Leu631Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981494" "0" "50" "15" "89836299" "89836299" "subst" "4.06752E-6" "01804" "POLG_000280" "g.89836299G>A" "" "" "" "FANCI(NM_001113378.2):c.2291+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981495" "0" "90" "15" "89850874" "89850875" "del" "2.84266E-5" "01804" "FANCI_000012" "g.89850874_89850875del" "" "" "" "FANCI(NM_001113378.2):c.3622_3623del (p.(Leu1208Valfs*11))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981496" "0" "90" "15" "89862284" "89862284" "subst" "1.62542E-5" "01804" "POLG_000281" "g.89862284C>G" "" "" "" "POLG(NM_002693.3):c.3151G>C (p.(Gly1051Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981497" "0" "50" "15" "89864001" "89864001" "subst" "0.00010606" "01804" "POLG_000282" "g.89864001G>A" "" "" "" "POLG(NM_002693.3):c.2977C>T (p.(Arg993Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981498" "0" "90" "15" "89864088" "89864088" "subst" "0.000670846" "01804" "POLG_000062" "g.89864088G>A" "" "" "" "POLG(NM_002693.2):c.2890C>T (p.R964C), POLG(NM_002693.3):c.2890C>T (p.(Arg964Cys), p.R964C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981499" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "01804" "POLG_000116" "g.89865023C>T" "" "" "" "POLG(NM_001126131.2):c.2542G>A (p.G848S), POLG(NM_002693.2):c.2542G>A (p.G848S), POLG(NM_002693.3):c.2542G>A (p.(Gly848Ser), p.G848S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981500" "0" "50" "15" "89867118" "89867118" "subst" "3.24863E-5" "02325" "POLG_000283" "g.89867118A>C" "" "" "" "POLG(NM_002693.3):c.2085T>G (p.D695E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981501" "0" "50" "15" "89867379" "89867379" "subst" "0" "01804" "POLG_000284" "g.89867379C>G" "" "" "" "POLG(NM_002693.3):c.2029G>C (p.(Glu677Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981502" "0" "50" "15" "89870473" "89870473" "subst" "0" "01804" "POLG_000285" "g.89870473T>G" "" "" "" "POLG(NM_002693.3):c.1358A>C (p.(Glu453Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981503" "0" "50" "15" "89870554" "89870554" "subst" "0" "01804" "POLG_000286" "g.89870554C>T" "" "" "" "POLG(NM_002693.3):c.1277G>A (p.(Gly426Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981504" "0" "90" "15" "89871712" "89871712" "subst" "0" "02329" "POLG_000287" "g.89871712G>A" "" "" "" "POLG(NM_002693.3):c.1225C>T (p.Q409*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981505" "0" "50" "15" "89872335" "89872335" "subst" "0.000112855" "01804" "POLG_000288" "g.89872335G>A" "" "" "" "POLG(NM_002693.3):c.862C>T (p.(Arg288Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981506" "0" "50" "15" "89876349" "89876349" "subst" "0" "02325" "POLG_000289" "g.89876349C>T" "" "" "" "POLG(NM_002693.3):c.637G>A (p.V213M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981507" "0" "50" "15" "89876528" "89876528" "subst" "0" "01804" "POLG_000290" "g.89876528G>C" "" "" "" "POLG(NM_002693.3):c.458C>G (p.(Ala153Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981508" "0" "30" "15" "89876725" "89876725" "subst" "0" "01804" "POLG_000291" "g.89876725G>T" "" "" "" "POLG(NM_002693.3):c.261C>A (p.(Ile87=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981509" "0" "50" "15" "89876867" "89876869" "dup" "0" "01804" "POLG_000180" "g.89876867_89876869dup" "" "" "" "POLG(NM_002693.2):c.125_127dupGGC (p.(Arg42dup)), POLG(NM_002693.2):c.125_127dupGGC (p.R42dup), POLG(NM_002693.3):c.125_127dupGGC (p.R42dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000989361" "0" "50" "15" "89876442" "89876442" "subst" "4.72822E-6" "03779" "POLG_000293" "g.89876442C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs768242927" "0" "" "" "" "" "VUS" "" "0000989366" "0" "70" "15" "89872328" "89872328" "subst" "3.74934E-5" "03779" "POLG_000292" "g.89872328C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs146603953" "0" "" "" "" "" "likely pathogenic" "" "0001001765" "0" "30" "15" "89824418" "89824418" "subst" "0.000227524" "01804" "POLG_000294" "g.89824418G>A" "" "" "" "FANCI(NM_001113378.1):c.1399G>A (p.(Val467Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001766" "0" "50" "15" "89860043" "89860043" "subst" "0" "01804" "POLG_000295" "g.89860043A>G" "" "" "" "POLG(NM_002693.2):c.3659T>C (p.(Ile1220Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001768" "0" "50" "15" "89860708" "89860708" "subst" "3.24847E-5" "02326" "POLG_000218" "g.89860708C>T" "" "" "" "POLG(NM_002693.2):c.3542G>A (p.S1181N), POLG(NM_002693.3):c.3542G>A (p.S1181N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001769" "0" "50" "15" "89861872" "89861872" "subst" "2.03065E-5" "01804" "POLG_000198" "g.89861872G>A" "" "" "" "POLG(NM_002693.2):c.3382C>T (p.(Arg1128Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001770" "0" "50" "15" "89862284" "89862284" "subst" "3.25084E-5" "01804" "POLG_000297" "g.89862284C>A" "" "" "" "POLG(NM_002693.2):c.3151G>T (p.(Gly1051Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001771" "0" "50" "15" "89862304" "89862304" "subst" "0.000645853" "01804" "POLG_000138" "g.89862304A>G" "" "" "" "POLG(NM_002693.2):c.3131T>C (p.V1044A, p.(Val1044Ala)), POLG(NM_002693.3):c.3131T>C (p.V1044A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001772" "0" "30" "15" "89865073" "89865073" "subst" "0.00671313" "01804" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001773" "0" "70" "15" "89866691" "89866691" "subst" "0.000662101" "02325" "POLG_000220" "g.89866691C>G" "" "" "" "POLG(NM_002693.3):c.2209G>C (p.G737R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001001774" "0" "30" "15" "89869958" "89869958" "subst" "0" "01804" "POLG_000298" "g.89869958A>G" "" "" "" "POLG(NM_002693.2):c.1597T>C (p.(Cys533Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001775" "0" "90" "15" "89870429" "89870429" "subst" "0.000471032" "01804" "POLG_000019" "g.89870429T>C" "" "" "" "POLG(NM_002693.2):c.1402A>G (p.N468D, p.(Asn468Asp)), POLG(NM_002693.3):c.1402A>G (p.N468D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001001776" "0" "50" "15" "89876595" "89876595" "subst" "0.000192721" "01804" "POLG_000299" "g.89876595A>G" "" "" "" "POLG(NM_002693.2):c.391T>C (p.(Tyr131His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001777" "0" "50" "15" "89876855" "89876860" "dup" "0" "01804" "POLG_000110" "g.89876855_89876860dup" "" "" "" "POLG(NM_002693.2):c.141_146dupGCAGCA (p.(Gln48_Gln49dup)), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGC..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001008570" "21" "90" "15" "89870504" "89870504" "subst" "8.12189E-6" "00095" "POLG_000300" "g.89870504G>A" "" "{PMID:Legati 2016:26968897}" "" "R443C" "" "Germline" "" "" "0" "" "" "g.89327273G>A" "" "pathogenic" "" "0001008571" "11" "30" "15" "89865073" "89865073" "subst" "0.00671313" "00095" "POLG_000067" "g.89865073T>C" "" "{PMID:Legati 2016:26968897}" "" "Y831C" "" "Germline" "" "" "0" "" "" "g.89321842T>C" "" "likely benign" "" "0001008572" "0" "30" "15" "89870178" "89870178" "subst" "0.00475324" "00095" "POLG_000079" "g.89870178C>A" "" "{PMID:Legati 2016:26968897}" "" "G517V" "" "Germline" "" "" "0" "" "" "g.89326947C>A" "" "likely benign" "" "0001008573" "0" "30" "15" "89868748" "89868748" "subst" "5.32809E-5" "00095" "POLG_000255" "g.89868748G>A" "" "{PMID:Legati 2016:26968897}" "" "R628W" "" "Germline" "" "" "0" "" "" "g.89325517G>A" "" "likely benign" "" "0001011156" "0" "70" "15" "89868781" "89868781" "subst" "1.22168E-5" "00006" "POLG_000301" "g.89868781G>A" "" "{PMID:Rots 2024:39013459}, {DOI:Rots 2024:10.1016/j.ajhg.2024.06.009}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.89325550G>A" "" "VUS" "" "0001015267" "0" "30" "15" "89843213" "89843213" "subst" "0" "02329" "POLG_000302" "g.89843213T>G" "" "" "" "FANCI(NM_001113378.1):c.2803+16T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015268" "0" "50" "15" "89860708" "89860708" "subst" "3.24847E-5" "02325" "POLG_000218" "g.89860708C>T" "" "" "" "POLG(NM_002693.2):c.3542G>A (p.S1181N), POLG(NM_002693.3):c.3542G>A (p.S1181N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015269" "0" "50" "15" "89861978" "89861978" "subst" "0" "02327" "POLG_000303" "g.89861978A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015270" "0" "50" "15" "89873353" "89873353" "subst" "0" "02327" "POLG_000304" "g.89873353A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015271" "0" "30" "15" "89873393" "89873393" "subst" "0" "02327" "POLG_000305" "g.89873393C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015272" "0" "50" "15" "89876840" "89876860" "del" "0" "02325" "POLG_000306" "g.89876840_89876860del" "" "" "" "POLG(NM_002693.3):c.138_158delGCAGCAGCAGCAGCAGCAGCA (p.Q49_Q55del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026535" "0" "30" "15" "89824510" "89824510" "subst" "0.000987163" "02329" "POLG_000201" "g.89824510A>G" "" "" "" "FANCI(NM_001113378.1):c.1491A>G (p.(=), p.Q497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026536" "0" "30" "15" "89843040" "89843040" "subst" "7.72038E-5" "02329" "POLG_000307" "g.89843040A>G" "" "" "" "FANCI(NM_001113378.1):c.2646A>G (p.L882=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026537" "0" "30" "15" "89856111" "89856111" "subst" "1.22308E-5" "02329" "POLG_000308" "g.89856111G>A" "" "" "" "FANCI(NM_001113378.1):c.3652-24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026538" "0" "90" "15" "89861848" "89861848" "subst" "0" "02327" "POLG_000309" "g.89861848C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026539" "0" "50" "15" "89865073" "89865073" "subst" "0.00671313" "01943" "POLG_000067" "g.89865073T>C" "" "" "" "POLG(NM_002693.2):c.2492A>G (p.Y831C, p.(Tyr831Cys)), POLG(NM_002693.3):c.2492A>G (p.Y831C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026540" "0" "30" "15" "89865094" "89865094" "subst" "0.000377686" "02326" "POLG_000310" "g.89865094T>G" "" "" "" "POLG(NM_002693.2):c.2481-10A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026541" "0" "30" "15" "89867103" "89867103" "subst" "1.2182E-5" "02326" "POLG_000311" "g.89867103C>T" "" "" "" "POLG(NM_002693.2):c.2100G>A (p.E700=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026542" "0" "30" "15" "89868450" "89868453" "del" "0" "02326" "POLG_000312" "g.89868450_89868453del" "" "" "" "POLG(NM_002693.2):c.1949+239_1949+242delACTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026543" "0" "30" "15" "89869974" "89869974" "del" "0.00237718" "02326" "POLG_000313" "g.89869974del" "" "" "" "POLG(NM_002693.2):c.1586-5delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026544" "0" "30" "15" "89872483" "89872483" "subst" "0" "02326" "POLG_000314" "g.89872483C>T" "" "" "" "POLG(NM_002693.2):c.856-142G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001029399" "0" "90" "15" "89876558" "89876558" "subst" "0" "03544" "POLG_000315" "g.89876558G>A" "" "" "" "" "detected in compound heterozygosity with other pathogenic variant in trans" "Germline" "yes" "rs796052899" "0" "" "" "g.89333327G>A" "{CV:206577}" "pathogenic" "ACMG" "0001040653" "0" "50" "15" "89801946" "89801948" "del" "0" "01804" "POLG_000316" "g.89801946_89801948del" "" "" "" "FANCI(NM_001113378.2):c.96_98del (p.(Leu33del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040654" "0" "50" "15" "89843054" "89843054" "subst" "8.12579E-6" "01804" "POLG_000317" "g.89843054C>T" "" "" "" "FANCI(NM_001113378.2):c.2660C>T (p.(Ser887Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040655" "0" "50" "15" "89861818" "89861818" "subst" "0.000182803" "01804" "POLG_000197" "g.89861818G>A" "" "" "" "POLG(NM_002693.3):c.3436C>T (p.(Arg1146Cys), p.R1146C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040656" "0" "50" "15" "89862259" "89862259" "subst" "9.35423E-5" "01804" "POLG_000058" "g.89862259T>C" "" "" "" "POLG(NM_002693.2):c.3176A>G (p.N1059S), POLG(NM_002693.3):c.3176A>G (p.(Asn1059Ser), p.N1059S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040657" "0" "50" "15" "89862501" "89862501" "subst" "0" "01804" "POLG_000318" "g.89862501G>A" "" "" "" "POLG(NM_002693.3):c.3062C>T (p.(Ser1021Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040658" "0" "50" "15" "89862559" "89862559" "subst" "1.21923E-5" "01804" "POLG_000319" "g.89862559C>T" "" "" "" "POLG(NM_002693.3):c.3004G>A (p.(Glu1002Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040659" "0" "50" "15" "89866712" "89866712" "subst" "0" "01804" "POLG_000320" "g.89866712G>T" "" "" "" "POLG(NM_002693.3):c.2188C>A (p.(Pro730Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040660" "0" "50" "15" "89867387" "89867387" "subst" "0.000573478" "01804" "POLG_000321" "g.89867387C>T" "" "" "" "POLG(NM_002693.3):c.2021G>A (p.(Gly674Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040661" "0" "90" "15" "89873337" "89873337" "subst" "0.000369853" "01804" "POLG_000268" "g.89873337T>A" "" "" "" "POLG(NM_002693.3):c.830A>T (p.(His277Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001040662" "0" "50" "15" "89873438" "89873438" "subst" "4.06848E-6" "01804" "POLG_000322" "g.89873438G>T" "" "" "" "POLG(NM_002693.3):c.729C>A (p.(Asp243Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040663" "0" "50" "15" "89873489" "89873489" "subst" "0.000399243" "01804" "POLG_000089" "g.89873489C>G" "" "" "" "POLG(NM_002693.2):c.678G>C (p.Q226H), POLG(NM_002693.3):c.678G>C (p.(Gln226His), p.Q226H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040664" "0" "50" "15" "89876384" "89876384" "subst" "5.38196E-6" "01804" "POLG_000323" "g.89876384A>C" "" "" "" "POLG(NM_002693.3):c.602T>G (p.(Val201Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040665" "0" "50" "15" "89876619" "89876619" "subst" "0" "01804" "POLG_000324" "g.89876619C>G" "" "" "" "POLG(NM_002693.3):c.367G>C (p.(Val123Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040666" "0" "50" "15" "89876954" "89876954" "subst" "0.000174697" "01804" "POLG_000112" "g.89876954C>T" "" "" "" "POLG(NM_002693.2):c.32G>A (p.G11D), POLG(NM_002693.3):c.32G>A (p.(Gly11Asp), p.G11D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040667" "0" "50" "15" "89876969" "89876969" "subst" "7.95773E-6" "01804" "POLG_000325" "g.89876969C>G" "" "" "" "POLG(NM_002693.3):c.17G>C (p.(Trp6Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001049424" "1" "70" "15" "89862457" "89862463" "delins" "0" "03676" "POLG_000327" "g.89862457_89862463delinsTG" "" "" "" "" "variant is strongly predicted as affecting splicing with a SpliceAI score of 0.99" "Germline" "?" "" "0" "" "" "g.89319226_89319232delinsTG" "" "likely pathogenic (recessive)" "ACMG" "0001049425" "2" "90" "15" "89860651" "89860651" "subst" "0" "03676" "POLG_000326" "g.89860651G>T" "" "" "" "" "ACMG PM1, PM2, PP2, PP3" "Germline" "?" "" "0" "" "" "g.89317420G>T" "" "likely pathogenic" "ACMG" "0001055237" "0" "50" "15" "89828438" "89828438" "subst" "6.09167E-5" "01804" "POLG_000328" "g.89828438A>G" "" "" "" "FANCI(NM_001113378.2):c.1810A>G (p.(Met604Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055238" "0" "50" "15" "89835943" "89835943" "subst" "2.87704E-5" "01804" "POLG_000329" "g.89835943C>T" "" "" "" "FANCI(NM_001113378.2):c.2017C>T (p.(His673Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055239" "0" "50" "15" "89849361" "89849361" "subst" "0.000109643" "01804" "POLG_000330" "g.89849361G>T" "" "" "" "FANCI(NM_001113378.2):c.3473G>T (p.(Cys1158Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055240" "0" "50" "15" "89849420" "89849420" "subst" "4.4674E-5" "01804" "POLG_000331" "g.89849420A>G" "" "" "" "FANCI(NM_001113378.2):c.3532A>G (p.(Arg1178Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055241" "0" "50" "15" "89862259" "89862259" "subst" "9.35423E-5" "02327" "POLG_000058" "g.89862259T>C" "" "" "" "POLG(NM_002693.2):c.3176A>G (p.N1059S), POLG(NM_002693.3):c.3176A>G (p.(Asn1059Ser), p.N1059S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055242" "0" "50" "15" "89862315" "89862315" "subst" "4.06161E-5" "01804" "POLG_000332" "g.89862315C>G" "" "" "" "POLG(NM_002693.3):c.3120G>C (p.(Lys1040Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055243" "0" "50" "15" "89862465" "89862465" "subst" "0.000255842" "01804" "POLG_000031" "g.89862465G>A" "" "" "" "POLG(NM_002693.3):c.3098C>T (p.(Ala1033Val), p.A1033V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055244" "0" "90" "15" "89866654" "89866654" "subst" "4.46911E-5" "01804" "POLG_000333" "g.89866654A>G" "" "" "" "POLG(NM_002693.3):c.2246T>C (p.(Phe749Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055245" "0" "50" "15" "89873423" "89873423" "subst" "2.43877E-5" "01804" "POLG_000334" "g.89873423C>G" "" "" "" "POLG(NM_002693.3):c.744G>C (p.(Glu248Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055246" "0" "50" "15" "89876631" "89876631" "subst" "0" "01804" "POLG_000335" "g.89876631G>A" "" "" "" "POLG(NM_002693.3):c.355C>T (p.(Pro119Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055247" "0" "50" "15" "89876722" "89876722" "subst" "2.45855E-5" "01804" "POLG_000336" "g.89876722G>C" "" "" "" "POLG(NM_002693.3):c.264C>G (p.(Phe88Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057732" "11" "90" "15" "89876827" "89876835" "dup" "0" "00006" "POLG_000337" "g.89876827_89876835dup" "" "{PMID:Ohba 2013:24091540}" "" "" "" "Germline" "" "" "0" "" "" "g.89333596_89333604dup" "" "pathogenic (recessive)" "" "0001057740" "21" "90" "15" "89864088" "89864088" "subst" "0.000670846" "00006" "POLG_000062" "g.89864088G>A" "" "{PMID:Ohba 2013:24091540}" "" "" "" "Germline" "" "" "0" "" "" "g.89320857G>A" "" "pathogenic (recessive)" "" "0001059029" "0" "90" "15" "89870548" "89870548" "subst" "4.06544E-6" "00006" "POLG_000338" "g.89870548A>G" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.89327317A>G" "" "pathogenic" "" "0001059030" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic" "" "0001060105" "1" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060106" "1" "90" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Ashley 2008:18487244}, corrected in {DOI:Ashley 2009:10.1093/hmg/ddp458}" "" "H277 L (publ. as H277C)" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "pathogenic (recessive)" "" "0001060107" "3" "90" "15" "89861968" "89861968" "subst" "8.1275E-6" "00006" "POLG_000114" "g.89861968G>A" "" "{PMID:Ashley 2008:18487244}" "" "R1096C" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89318737G>A" "" "pathogenic (recessive)" "" "0001060108" "1" "90" "15" "89873473" "89873473" "subst" "0" "00006" "POLG_000362" "g.89873473G>C" "" "{PMID:Ashley 2008:18487244}" "" "R232G" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89330242G>C" "" "pathogenic (recessive)" "" "0001060109" "1" "90" "15" "89868751" "89868751" "subst" "0" "00006" "POLG_000352" "g.89868751G>A" "" "{PMID:Ashley 2008:18487244}" "" "R627W" "borderline cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89325520G>A" "" "pathogenic (recessive)" "" "0001060110" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060111" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060112" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060113" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060114" "1" "90" "15" "89864473" "89864473" "subst" "0" "00006" "POLG_000348" "g.89864473C>A" "" "{PMID:Ashley 2008:18487244}" "" "E873X" "borderline cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321242C>A" "" "pathogenic (recessive)" "" "0001060115" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060116" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060117" "3" "90" "15" "89872286" "89872286" "subst" "5.77844E-5" "00006" "POLG_000042" "g.89872286A>C" "" "{PMID:Ashley 2008:18487244}" "" "L304R" "" "Germline" "" "" "0" "" "" "g.89329055A>C" "" "pathogenic (recessive)" "" "0001060118" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060119" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060120" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060121" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060122" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060123" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060124" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060125" "3" "90" "15" "89869848" "89869848" "subst" "0" "00006" "POLG_000355" "g.89869848G>T" "" "{PMID:Ashley 2008:18487244}" "" "H569Q" "" "Germline" "" "" "0" "" "" "g.89326617G>T" "" "pathogenic (recessive)" "" "0001060126" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060127" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060128" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060129" "2" "90" "15" "89861968" "89861968" "subst" "8.1275E-6" "00006" "POLG_000114" "g.89861968G>A" "" "{PMID:Ashley 2008:18487244}" "" "R1096C" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89318737G>A" "" "pathogenic (recessive)" "" "0001060130" "2" "90" "15" "89865014" "89865014" "subst" "4.06128E-6" "00006" "POLG_000349" "g.89865014T>C" "" "{PMID:Ashley 2008:18487244}" "" "T851A" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321783T>C" "" "pathogenic (recessive)" "" "0001060131" "2" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Ashley 2008:18487244}" "" "[T251I;P587L]" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060132" "2" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "borderline cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060133" "2" "50" "15" "89865011" "89865011" "subst" "4.46744E-5" "00006" "POLG_000065" "g.89865011G>A" "" "{PMID:Ashley 2008:18487244}" "" "[R852C;G11D]" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321780G>A" "" "VUS" "" "0001060134" "2" "50" "15" "89865011" "89865011" "subst" "4.46744E-5" "00006" "POLG_000065" "g.89865011G>A" "" "{PMID:Ashley 2008:18487244}" "" "[R852C;G11D]" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321780G>A" "" "VUS" "" "0001060135" "2" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060136" "2" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060137" "2" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "borderline cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060138" "2" "90" "15" "89872018" "89872047" "del" "0" "00006" "POLG_000339" "g.89872018_89872047del" "" "{PMID:Ashley 2008:18487244}, corrected in {DOI:Ashley 2009:10.1093/hmg/ddp458}" "" "W347_L356del (publ. as W347_L365del)" "" "Germline" "" "" "0" "" "" "g.89328787_89328816del" "" "pathogenic (recessive)" "" "0001060139" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Ashley 2008:18487244}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060140" "2" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060141" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Ashley 2008:18487244}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060142" "2" "90" "15" "89864238" "89864238" "subst" "0.000101796" "00006" "POLG_000063" "g.89864238T>G" "" "{PMID:Ashley 2008:18487244}" "" "T914P" "" "Germline" "" "" "0" "" "" "g.89321007T>G" "" "pathogenic (recessive)" "" "0001060143" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Ashley 2008:18487244}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060144" "2" "90" "15" "89864081" "89864081" "subst" "8.12975E-6" "00006" "POLG_000346" "g.89864081A>C" "" "{PMID:Ashley 2008:18487244}" "" "L966R" "" "Germline" "" "" "0" "" "" "g.89320850A>C" "" "pathogenic (recessive)" "" "0001060145" "2" "90" "15" "89871966" "89871966" "subst" "0" "00006" "POLG_000359" "g.89871966G>A" "" "{PMID:Ashley 2008:18487244}" "" "R374X" "" "Germline" "" "" "0" "" "" "g.89328735G>A" "" "pathogenic (recessive)" "" "0001060146" "2" "90" "15" "89871687" "89871687" "subst" "0" "00006" "POLG_000358" "g.89871687C>G" "" "{PMID:Ashley 2008:18487244}" "" "R417T" "" "Germline" "" "" "0" "" "" "g.89328456C>G" "" "pathogenic (recessive)" "" "0001060147" "2" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Ashley 2008:18487244}" "" "[P587L,P589L]" "" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060148" "2" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Ashley 2008:18487244}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060149" "2" "90" "15" "89870579" "89870579" "subst" "0" "00006" "POLG_000357" "g.89870579A>G" "" "{PMID:Ashley 2008:18487244}" "" "C418R" "" "Germline" "" "" "0" "" "" "g.89327348A>G" "" "pathogenic (recessive)" "" "0001060150" "2" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Ashley 2008:18487244}" "" "[T251I;P587L]" "cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060151" "2" "50" "15" "89876954" "89876954" "subst" "0.000174697" "00006" "POLG_000112" "g.89876954C>T" "" "{PMID:Ashley 2008:18487244}" "" "[R852C;G11D]" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89333723C>T" "" "VUS" "" "0001060152" "2" "50" "15" "89876954" "89876954" "subst" "0.000174697" "00006" "POLG_000112" "g.89876954C>T" "" "{PMID:Ashley 2008:18487244}" "" "[R852C;G11D]" "no cellular mtDNA depletion" "Germline" "" "" "0" "" "" "g.89333723C>T" "" "VUS" "" "0001060153" "2" "50" "15" "89868864" "89868864" "subst" "0" "00006" "POLG_000354" "g.89868864G>A" "" "{PMID:Ashley 2008:18487244}" "" "[P587L,P589L]" "" "Germline" "" "" "0" "" "" "g.89325633G>A" "" "VUS" "" "0001060155" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060156" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060157" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060158" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Winterthun 2005:15824347}, {PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060159" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060160" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060161" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060162" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060163" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060164" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060165" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060166" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Tzoulis 2006:16638794}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060167" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060168" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060169" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060170" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060171" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060172" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060173" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060174" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060175" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060176" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060177" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060178" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060179" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060180" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060181" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060182" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060183" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060184" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060185" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060186" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060187" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Tzoulis 2006:16638794}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060188" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Winterthun 2005:15824347}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060189" "2" "90" "15" "89870237" "89870237" "subst" "0.000125879" "00006" "POLG_000222" "g.89870237C>G" "" "{PMID:Winterthun 2005:15824347}" "" "Q497H" "" "Germline" "" "" "0" "" "" "g.89327006C>G" "" "pathogenic (recessive)" "" "0001060190" "1" "90" "15" "89870237" "89870237" "subst" "0.000125879" "00006" "POLG_000222" "g.89870237C>G" "" "{PMID:Winterthun 2005:15824347}" "" "Q497H" "" "Germline" "" "" "0" "" "" "g.89327006C>G" "" "pathogenic (recessive)" "" "0001060191" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Winterthun 2005:15824347}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060192" "1" "90" "15" "89864151" "89864151" "subst" "0" "00006" "POLG_000045" "g.89864151G>A" "" "{PMID:Sato 2011:21301859}" "" "" "" "Germline" "" "" "0" "" "" "g.89320920G>A" "" "pathogenic (recessive)" "" "0001060193" "2" "90" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Sato 2011:21301859}" "" "" "" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "pathogenic (recessive)" "" "0001060194" "1" "90" "15" "89864981" "89864981" "subst" "4.06177E-6" "00006" "POLG_000340" "g.89864981C>T" "" "{PMID:McKelvie 2012:22357363}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.89321750C>T" "" "pathogenic (recessive)" "" "0001060195" "2" "90" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:McKelvie 2012:22357363}" "" "" "" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "pathogenic (recessive)" "" "0001060196" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Hunter 2011:22000311}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060197" "1" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Hunter 2011:22000311}" "" "W748S" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060198" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060199" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060200" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060201" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060202" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060203" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060204" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060205" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060206" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060207" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060208" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060209" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Hunter 2011:22000311}" "" "A467T" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060210" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Hunter 2011:22000311}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060211" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Hunter 2011:22000311}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060212" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Hunter 2011:22000311}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060213" "2" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Hunter 2011:22000311}" "" "G848S" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060214" "2" "90" "15" "89865972" "89865972" "subst" "0" "00006" "POLG_000350" "g.89865972C>T" "" "{PMID:Hunter 2011:22000311}" "" "IVS14+1G>A" "" "Germline" "" "" "0" "" "" "g.89322741C>T" "" "pathogenic (recessive)" "" "0001060215" "2" "90" "15" "89865011" "89865011" "subst" "4.46744E-5" "00006" "POLG_000065" "g.89865011G>A" "" "{PMID:Hunter 2011:22000311}" "" "R852C" "" "Germline" "" "" "0" "" "" "g.89321780G>A" "" "pathogenic (recessive)" "" "0001060216" "2" "90" "15" "89872282" "89872282" "subst" "1.2377E-5" "00006" "POLG_000361" "g.89872282G>C" "" "{PMID:Hunter 2011:22000311}" "" "S305R" "" "Germline" "" "" "0" "" "" "g.89329051G>C" "" "pathogenic (recessive)" "" "0001060217" "2" "90" "15" "89864081" "89864081" "subst" "8.12975E-6" "00006" "POLG_000346" "g.89864081A>C" "" "{PMID:Hunter 2011:22000311}" "" "L966R" "" "Germline" "" "" "0" "" "" "g.89320850A>C" "" "pathogenic (recessive)" "" "0001060218" "2" "90" "15" "89872013" "89872013" "del" "4.06227E-6" "00006" "POLG_000360" "g.89872013del" "" "{PMID:Hunter 2011:22000311}" "" "E358 (A) Del-364X" "" "Germline" "" "" "0" "" "" "g.89328782del" "" "pathogenic (recessive)" "" "0001060219" "2" "90" "15" "89872013" "89872013" "del" "4.06227E-6" "00006" "POLG_000360" "g.89872013del" "" "{PMID:Hunter 2011:22000311}" "" "E358 (A) Del-364X" "" "Germline" "" "" "0" "" "" "g.89328782del" "" "pathogenic (recessive)" "" "0001060220" "2" "90" "15" "89864081" "89864081" "subst" "8.12975E-6" "00006" "POLG_000346" "g.89864081A>C" "" "{PMID:Hunter 2011:22000311}" "" "L966R" "" "Germline" "" "" "0" "" "" "g.89320850A>C" "" "pathogenic (recessive)" "" "0001060221" "2" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "00006" "POLG_000023" "g.89873472C>T" "" "{PMID:Hunter 2011:22000311}" "" "R232H (and H277L)" "" "Germline" "" "" "0" "" "" "g.89330241C>T" "" "pathogenic (recessive)" "" "0001060222" "2" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "00006" "POLG_000023" "g.89873472C>T" "" "{PMID:Hunter 2011:22000311}" "" "R232H (and H277L)" "" "Germline" "" "" "0" "" "" "g.89330241C>T" "" "pathogenic (recessive)" "" "0001060223" "2" "90" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Hunter 2011:22000311}" "" "R232H (and H277L)" "" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "pathogenic (recessive)" "" "0001060224" "2" "90" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Hunter 2011:22000311}" "" "R232H (and H277L)" "" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "pathogenic (recessive)" "" "0001060231" "1" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[G848S]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060232" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[W748S]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060233" "3" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[A467T]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060234" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[W748S;E1143G]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060235" "3" "90" "15" "89866112" "89866112" "subst" "0" "00006" "POLG_000351" "g.89866112C>K" "" "{PMID:Bereau 2016:27538604}" "" "p.[G763R]+[G763R]" "" "Germline" "" "" "0" "" "" "g.89322881C>K" "" "pathogenic (recessive)" "" "0001060236" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[R597W]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060237" "1" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060238" "1" "90" "15" "89872286" "89872286" "subst" "5.77844E-5" "00006" "POLG_000042" "g.89872286A>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[L304R]+[W748S]" "" "Germline" "" "" "0" "" "" "g.89329055A>C" "" "pathogenic (recessive)" "" "0001060239" "1" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "00006" "POLG_000023" "g.89873472C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330241C>T" "" "pathogenic (recessive)" "" "0001060240" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060241" "1" "90" "15" "89864022" "89864022" "subst" "0" "00006" "POLG_000345" "g.89864022A>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[Y986D](+)[M919T]" "" "Germline" "" "" "0" "" "" "g.89320791A>C" "" "pathogenic (recessive)" "" "0001060242" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[R1138C]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060243" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[W748S;E1143G]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060244" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[W748S]+[W748S]" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060245" "1" "90" "15" "89868750" "89868750" "subst" "3.68378E-5" "00006" "POLG_000208" "g.89868750C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325519C>T" "" "pathogenic (recessive)" "" "0001060246" "1" "90" "15" "89873472" "89873472" "subst" "1.23051E-5" "00006" "POLG_000023" "g.89873472C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330241C>T" "" "pathogenic (recessive)" "" "0001060247" "1" "90" "15" "89868750" "89868750" "subst" "3.68378E-5" "00006" "POLG_000208" "g.89868750C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325519C>T" "" "pathogenic (recessive)" "" "0001060248" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[R852C]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060249" "3" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[W748S]+[W748S]" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060250" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[L559P]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060251" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[T251I;P587L]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060252" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060253" "1" "90" "15" "89873343" "89873343" "subst" "0" "00006" "POLG_000117" "g.89873343C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R275Q](+)[A467T]" "" "Germline" "" "" "0" "" "" "g.89330112C>T" "" "pathogenic (recessive)" "" "0001060254" "0" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060255" "1" "90" "15" "89862265" "89862265" "subst" "0" "00006" "POLG_000344" "g.89862265A>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[M1057T](+)[F1164I]" "" "Germline" "" "" "0" "" "" "g.89319034A>G" "" "pathogenic (recessive)" "" "0001060256" "3" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060257" "1" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[G848S]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060258" "1" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060259" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[G848S]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060260" "0" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[W748S]" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060261" "0" "90" "15" "89868841" "89868841" "subst" "2.0357E-5" "00006" "POLG_000353" "g.89868841G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[R597W]" "" "Germline" "" "" "0" "" "" "g.89325610G>A" "" "pathogenic (recessive)" "" "0001060262" "2" "90" "15" "89861969" "89861969" "subst" "0" "00006" "POLG_000343" "g.89861969G>Y" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "" "Germline" "" "" "0" "" "" "g.89318738G>Y" "" "pathogenic (recessive)" "" "0001060263" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[L304R]+[W748S]" "" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060264" "2" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060265" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060266" "0" "90" "15" "89864222" "89864222" "subst" "0" "00006" "POLG_000347" "g.89864222A>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[Y986D](+)[M919T]" "" "Germline" "" "" "0" "" "" "g.89320991A>G" "" "pathogenic (recessive)" "" "0001060267" "0" "90" "15" "89861842" "89861842" "subst" "4.06171E-6" "00006" "POLG_000342" "g.89861842G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[R1138C]" "" "Germline" "" "" "0" "" "" "g.89318611G>A" "" "pathogenic (recessive)" "" "0001060268" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060269" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060270" "2" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060271" "2" "90" "15" "89866657" "89866657" "subst" "0.00101979" "00006" "POLG_000070" "g.89866657C>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89323426C>G" "" "pathogenic (recessive)" "" "0001060272" "0" "90" "15" "89865011" "89865011" "subst" "4.46744E-5" "00006" "POLG_000065" "g.89865011G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[R852C]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89321780G>A" "" "pathogenic (recessive)" "" "0001060273" "0" "90" "15" "89869879" "89869879" "subst" "4.06276E-6" "00006" "POLG_000356" "g.89869879A>G" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[L559P]" "" "Germline" "" "" "0" "" "" "g.89326648A>G" "" "pathogenic (recessive)" "" "0001060274" "2" "90" "15" "89873415" "89873415" "subst" "0.00153175" "00006" "POLG_000046" "g.89873415G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330184G>A" "" "pathogenic (recessive)" "" "0001060275" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060276" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[R275Q](+)[A467T]" "" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060277" "0" "90" "15" "89870432" "89870432" "subst" "0.000487286" "00006" "POLG_000080" "g.89870432C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89327201C>T" "" "pathogenic (recessive)" "" "0001060278" "0" "90" "15" "89860760" "89860760" "subst" "4.06184E-6" "00006" "POLG_000341" "g.89860760A>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[M1057T](+)[F1164I]" "" "Germline" "" "" "0" "" "" "g.89317529A>T" "" "pathogenic (recessive)" "" "0001060279" "0" "90" "15" "89865023" "89865023" "subst" "0.000154326" "00006" "POLG_000116" "g.89865023C>T" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T](+)[G848S]" "" "Germline" "" "" "0" "" "" "g.89321792C>T" "" "pathogenic (recessive)" "" "0001060280" "2" "90" "15" "89861969" "89861969" "subst" "0" "00006" "POLG_000343" "g.89861969G>Y" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "" "Germline" "" "" "0" "" "" "g.89318738G>Y" "" "pathogenic (recessive)" "" "0001060281" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[G848S]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060282" "1" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060283" "1" "50" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "VUS" "" "0001060284" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060285" "1" "50" "15" "89873337" "89873337" "subst" "0.000369853" "00006" "POLG_000268" "g.89873337T>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89330106T>A" "" "VUS" "" "0001060286" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[R852C]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060287" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060288" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I](+)[P587L](+)[A467T]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060289" "1" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[S1095R]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060290" "2" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060291" "2" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R232H;H277L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060292" "2" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060293" "3" "50" "15" "89861826" "89861826" "subst" "0.028747" "00006" "POLG_000001" "g.89861826T>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[W748S;E1143G]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89318595T>C" "" "VUS" "" "0001060294" "1" "50" "15" "89859994" "89859994" "subst" "0.0620257" "00006" "POLG_000049" "g.89859994C>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89316763C>A" "" "VUS" "" "0001060295" "2" "50" "15" "89861826" "89861826" "subst" "0.028747" "00006" "POLG_000001" "g.89861826T>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89318595T>C" "" "VUS" "" "0001060296" "1" "50" "15" "89859994" "89859994" "subst" "0.0620257" "00006" "POLG_000049" "g.89859994C>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89316763C>A" "" "VUS" "" "0001060297" "2" "50" "15" "89861826" "89861826" "subst" "0.028747" "00006" "POLG_000001" "g.89861826T>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[R627Q;Q1236H]+[W748S;E1143G]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89318595T>C" "" "VUS" "" "0001060298" "0" "90" "15" "89868870" "89868870" "subst" "0.00152881" "00006" "POLG_000046" "g.89868870G>A" "" "{PMID:Bereau 2016:27538604}" "" "p.[T251I;P587L]+[T251I;P587L]" "classification individual variants not reported" "Germline" "" "" "0" "" "" "g.89325639G>A" "" "pathogenic (recessive)" "" "0001060299" "2" "50" "15" "89861826" "89861826" "subst" "0.028747" "00006" "POLG_000001" "g.89861826T>C" "" "{PMID:Bereau 2016:27538604}" "" "p.[A467T]+[W748S;E1143G]" "" "Germline" "" "" "0" "" "" "g.89318595T>C" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes POLG ## Count = 750 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000000594" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000000595" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000000596" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000000597" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000000598" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000000599" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000035989" "00023868" "35" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Val870Ile)" "17" "0000063733" "00023868" "10" "3720" "0" "3720" "0" "c.3720G>A" "r.(=)" "p.(=)" "" "0000063734" "00023868" "10" "948" "0" "948" "0" "c.948G>A" "r.(=)" "p.(=)" "" "0000063735" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0000063736" "00023868" "10" "137" "0" "137" "0" "c.137A>G" "r.(?)" "p.(Gln46Arg)" "" "0000063737" "00023868" "50" "3098" "0" "3098" "0" "c.3098C>T" "r.(?)" "p.(Ala1033Val)" "" "0000063738" "00023868" "10" "3483" "-41" "3483" "-41" "c.3483-41A>C" "r.(=)" "p.(=)" "" "0000063739" "00023868" "50" "1640" "0" "1640" "0" "c.1640C>A" "r.(?)" "p.(Ala547Asp)" "" "0000063740" "00023868" "10" "134" "0" "134" "0" "c.134A>G" "r.(?)" "p.(Gln45Arg)" "" "0000063741" "00023868" "50" "1149" "0" "1149" "0" "c.1149G>A" "r.(=)" "p.(=)" "" "0000063742" "00023868" "10" "2254" "0" "2254" "0" "c.2254C>T" "r.(=)" "p.(=)" "" "0000063743" "00023868" "10" "2426" "281" "2426" "281" "c.2426+281A>G" "r.(=)" "p.(=)" "" "0000063744" "00023868" "50" "2735" "-7" "2735" "-7" "c.2735-7C>G" "r.(=)" "p.(=)" "" "0000063745" "00023868" "10" "1712" "10" "1712" "10" "c.1712+10G>A" "r.(=)" "p.(=)" "" "0000063746" "00023868" "50" "3234" "0" "3234" "0" "c.3234C>T" "r.(=)" "p.(=)" "" "0000063747" "00023868" "90" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" "0000063748" "00023868" "50" "659" "46" "659" "46" "c.659+46G>C" "r.(=)" "p.(=)" "" "0000063749" "00023868" "50" "2734" "13" "2734" "13" "c.2734+13C>T" "r.(=)" "p.(=)" "" "0000063750" "00023868" "10" "2266" "-76" "2266" "-76" "c.2266-76T>C" "r.(=)" "p.(=)" "" "0000063751" "00023868" "50" "2853" "0" "2853" "0" "c.2853C>T" "r.(=)" "p.(=)" "" "0000063752" "00023868" "50" "1585" "11" "1585" "11" "c.1585+11T>C" "r.(=)" "p.(=)" "" "0000063753" "00023868" "10" "2474" "0" "2474" "0" "c.2474T>C" "r.(?)" "p.(Val825Ala)" "" "0000063754" "00023868" "50" "659" "161" "659" "161" "c.659+161T>C" "r.(=)" "p.(=)" "" "0000063755" "00023868" "10" "-874" "0" "-874" "0" "c.-874C>T" "r.(=)" "p.(=)" "" "0000063756" "00023868" "10" "2193" "0" "2193" "0" "c.2193C>T" "r.(=)" "p.(=)" "" "0000063757" "00023868" "10" "127" "0" "127" "0" "c.127CAG(8_12)" "r.(=)" "p.(gln55(8_12))" "" "0000063758" "00023868" "10" "659" "91" "659" "91" "c.659+91G>T" "r.(=)" "p.(=)" "" "0000063759" "00023868" "90" "1270" "0" "1271" "0" "c.1270_1271del" "r.(?)" "p.(Leu424Glyfs*29)" "" "0000063760" "00023868" "10" "2735" "-51" "2735" "-51" "c.2735-51A>G" "r.(=)" "p.(=)" "" "0000063761" "00023868" "50" "153" "0" "158" "0" "c.153_158del" "r.(?)" "p.(Gln54_Gln55del)" "" "0000063762" "00023868" "10" "659" "11" "659" "11" "c.659+11G>T" "r.(=)" "p.(=)" "" "0000063763" "00023868" "10" "3769" "0" "3769" "0" "c.*49dup" "r.(=)" "p.(=)" "" "0000063764" "00023868" "10" "3483" "-19" "3483" "-19" "c.3483-19T>G" "r.(=)" "p.(=)" "" "0000063765" "00023868" "10" "3105" "-36" "3105" "-36" "c.3105-36A>G" "r.(=)" "p.(=)" "" "0000063766" "00023868" "10" "3105" "-11" "3105" "-11" "c.3105-11T>C" "r.(=)" "p.(=)" "" "0000063767" "00023868" "10" "2958" "0" "2958" "0" "c.2958C>T" "r.(=)" "p.(=)" "" "0000063768" "00023868" "10" "2071" "-22" "2071" "-22" "c.2071-22T>C" "r.(=)" "p.(=)" "" "0000063769" "00023868" "50" "-957" "0" "-957" "0" "c.-957del" "r.(=)" "p.(=)" "" "0000063770" "00023868" "50" "3294" "0" "3294" "0" "c.3294T>C" "r.(=)" "p.(=)" "" "0000063771" "00023868" "50" "159" "0" "161" "0" "c.159_161dup" "r.(?)" "p.(Gln55dup)" "" "0000130061" "00023868" "90" "911" "0" "911" "0" "c.911T>G" "r.(?)" "p.(Leu304Arg)" "" "0000171972" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000171973" "00023868" "90" "2827" "0" "2827" "0" "c.2827C>T" "r.(?)" "p.(Arg943Cys)" "" "0000171974" "00023868" "70" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000171976" "00023868" "90" "1943" "0" "1943" "0" "c.1943C>G" "r.(?)" "p.(Pro648Arg)" "10" "0000171977" "00023868" "90" "2794" "0" "2794" "0" "c.2794C>T" "r.(?)" "p.(His932Tyr)" "18" "0000171986" "00023868" "70" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000171987" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000171988" "00023868" "90" "2827" "0" "2827" "0" "c.2827C>T" "r.(?)" "p.(Arg943Cys)" "" "0000249568" "00023868" "30" "1585" "11" "1585" "11" "c.1585+11T>C" "r.(=)" "p.(=)" "" "0000249927" "00023868" "10" "3483" "-19" "3483" "-19" "c.3483-19T>G" "r.(=)" "p.(=)" "" "0000250355" "00023868" "30" "52014" "0" "52014" "0" "c.*48294T>A" "r.(=)" "p.(=)" "" "0000253151" "00023868" "10" "3483" "-19" "3483" "-19" "c.3483-19T>G" "r.(=)" "p.(=)" "" "0000256176" "00023868" "50" "61731" "0" "61731" "0" "c.*58011T>C" "r.(=)" "p.(=)" "" "0000256681" "00023868" "50" "28845" "0" "28845" "0" "c.*25125T>C" "r.(=)" "p.(=)" "" "0000280727" "00023868" "10" "25466" "0" "25466" "0" "c.*21746C>T" "r.(=)" "p.(=)" "" "0000280728" "00023868" "90" "5153" "0" "5153" "0" "c.*1433G>A" "r.(=)" "p.(=)" "" "0000282975" "00023868" "10" "43759" "0" "43759" "0" "c.*40039C>T" "r.(=)" "p.(=)" "" "0000282976" "00023868" "30" "37205" "0" "37205" "0" "c.*33485C>T" "r.(=)" "p.(=)" "" "0000282977" "00023868" "30" "35340" "0" "35340" "0" "c.*31620G>A" "r.(=)" "p.(=)" "" "0000282978" "00023868" "10" "35261" "0" "35261" "0" "c.*31541G>A" "r.(=)" "p.(=)" "" "0000282979" "00023868" "30" "35245" "0" "35245" "0" "c.*31525G>A" "r.(=)" "p.(=)" "" "0000282980" "00023868" "30" "25526" "0" "25526" "0" "c.*21806A>C" "r.(=)" "p.(=)" "" "0000282981" "00023868" "30" "19038" "0" "19038" "0" "c.*15318G>A" "r.(=)" "p.(=)" "" "0000282982" "00023868" "10" "12866" "0" "12866" "0" "c.*9146A>G" "r.(=)" "p.(=)" "" "0000282983" "00023868" "10" "12780" "0" "12780" "0" "c.*9060C>T" "r.(=)" "p.(=)" "" "0000282984" "00023868" "30" "55866" "0" "55866" "0" "c.*52146G>A" "r.(=)" "p.(=)" "" "0000282985" "00023868" "30" "52004" "0" "52004" "0" "c.*48284A>G" "r.(=)" "p.(=)" "" "0000282986" "00023868" "10" "51960" "0" "51960" "0" "c.*48240C>T" "r.(=)" "p.(=)" "" "0000283824" "00023868" "90" "16555" "0" "16555" "0" "c.*12835C>T" "r.(=)" "p.(=)" "" "0000287096" "00023868" "30" "35261" "0" "35261" "0" "c.*31541G>A" "r.(=)" "p.(=)" "" "0000287097" "00023868" "30" "19038" "0" "19038" "0" "c.*15318G>A" "r.(=)" "p.(=)" "" "0000287098" "00023868" "30" "15301" "0" "15301" "0" "c.*11581C>T" "r.(=)" "p.(=)" "" "0000287099" "00023868" "30" "12866" "0" "12866" "0" "c.*9146A>G" "r.(=)" "p.(=)" "" "0000287100" "00023868" "30" "57013" "0" "57013" "0" "c.*53293G>A" "r.(=)" "p.(=)" "" "0000287101" "00023868" "30" "55866" "0" "55866" "0" "c.*52146G>A" "r.(=)" "p.(=)" "" "0000297220" "00023868" "30" "1126" "0" "1126" "0" "c.1126C>T" "r.(?)" "p.(Leu376=)" "" "0000297221" "00023868" "10" "156" "0" "158" "0" "c.156_158dup" "r.(?)" "p.(Gln55dup)" "" "0000297222" "00023868" "10" "153" "0" "158" "0" "c.153_158dup" "r.(?)" "p.(Gln54_Gln55dup)" "" "0000297224" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000297227" "00023868" "30" "150" "0" "158" "0" "c.150_158del" "r.(?)" "p.(Gln53_Gln55del)" "" "0000297228" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0000297229" "00023868" "10" "156" "0" "158" "0" "c.156_158del" "r.(?)" "p.(Gln55del)" "" "0000297231" "00023868" "10" "1636" "0" "1636" "0" "c.1636C>T" "r.(?)" "p.(Arg546Cys)" "" "0000297232" "00023868" "10" "2109" "0" "2109" "0" "c.2109C>A" "r.(?)" "p.(Ala703=)" "" "0000297233" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000297234" "00023868" "30" "2254" "0" "2254" "0" "c.2254C>T" "r.(?)" "p.(Leu752=)" "" "0000297235" "00023868" "10" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0000297236" "00023868" "30" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(Phe88=)" "" "0000297237" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0000297238" "00023868" "30" "2853" "0" "2853" "0" "c.2853C>T" "r.(?)" "p.(Tyr951=)" "" "0000297239" "00023868" "30" "3198" "0" "3198" "0" "c.3198G>A" "r.(?)" "p.(Thr1066=)" "" "0000297240" "00023868" "30" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000297241" "00023868" "50" "3443" "0" "3443" "0" "c.3443G>A" "r.(?)" "p.(Arg1148His)" "" "0000297242" "00023868" "30" "3597" "0" "3597" "0" "c.3597C>A" "r.(?)" "p.(Thr1199=)" "" "0000297243" "00023868" "10" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000297244" "00023868" "50" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000297245" "00023868" "30" "948" "0" "948" "0" "c.948G>A" "r.(?)" "p.(Lys316=)" "" "0000297246" "00023868" "30" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" "" "0000299041" "00023868" "10" "156" "0" "158" "0" "c.156_158del" "r.(?)" "p.(Gln55del)" "" "0000299043" "00023868" "30" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0000299044" "00023868" "50" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0000299045" "00023868" "50" "32" "0" "32" "0" "c.32G>A" "r.(?)" "p.(Gly11Asp)" "" "0000299046" "00023868" "10" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000299047" "00023868" "10" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000301113" "00023868" "10" "156" "0" "158" "0" "c.156_158del" "r.(?)" "p.(Gln55del)" "" "0000301114" "00023868" "30" "1898" "0" "1898" "0" "c.1898A>C" "r.(?)" "p.(Lys633Thr)" "" "0000301115" "00023868" "30" "1984" "0" "1984" "0" "c.1984G>A" "r.(?)" "p.(Glu662Lys)" "" "0000301116" "00023868" "10" "2254" "0" "2254" "0" "c.2254C>T" "r.(?)" "p.(Leu752=)" "" "0000301117" "00023868" "30" "2481" "-7" "2481" "-7" "c.2481-7C>T" "r.(=)" "p.(=)" "" "0000301118" "00023868" "30" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0000301119" "00023868" "30" "2541" "0" "2541" "0" "c.2541C>T" "r.(?)" "p.(Ala847=)" "" "0000301120" "00023868" "30" "3105" "-16" "3105" "-15" "c.3105-16_3105-15del" "r.(=)" "p.(=)" "" "0000301121" "00023868" "10" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000301122" "00023868" "10" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000301123" "00023868" "30" "678" "0" "678" "0" "c.678G>C" "r.(?)" "p.(Gln226His)" "" "0000301124" "00023868" "30" "856" "-5" "856" "-3" "c.856-5_856-3del" "r.spl?" "p.?" "" "0000306080" "00023868" "10" "1126" "0" "1126" "0" "c.1126C>T" "r.(?)" "p.(Leu376=)" "" "0000306082" "00023868" "30" "125" "0" "125" "0" "c.125G>A" "r.(?)" "p.(Arg42Gln)" "" "0000306083" "00023868" "90" "1276" "0" "1276" "0" "c.1276G>A" "r.(?)" "p.(Gly426Ser)" "" "0000306084" "00023868" "50" "128" "0" "128" "0" "c.128A>G" "r.(?)" "p.(Gln43Arg)" "" "0000306085" "00023868" "30" "1386" "0" "1386" "0" "c.1386G>A" "r.(?)" "p.(Ser462=)" "" "0000306086" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000306087" "00023868" "90" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" "0000306088" "00023868" "50" "141" "0" "158" "0" "c.141_158del" "r.(?)" "p.(Gln50_Gln55del)" "" "0000306089" "00023868" "30" "144" "0" "158" "0" "c.144_158del" "r.(?)" "p.(Gln51_Gln55del)" "" "0000306090" "00023868" "10" "150" "0" "158" "0" "c.150_158del" "r.(?)" "p.(Gln53_Gln55del)" "" "0000306091" "00023868" "30" "153" "0" "158" "0" "c.153_158del" "r.(?)" "p.(Gln54_Gln55del)" "" "0000306093" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0000306094" "00023868" "10" "156" "0" "158" "0" "c.156_158del" "r.(?)" "p.(Gln55del)" "" "0000306097" "00023868" "30" "156" "0" "156" "0" "c.156G>A" "r.(?)" "p.(Gln52=)" "" "0000306098" "00023868" "30" "1688" "0" "1688" "0" "c.1688C>T" "r.(?)" "p.(Pro563Leu)" "" "0000306099" "00023868" "30" "1890" "0" "1890" "0" "c.1890C>T" "r.(?)" "p.(Asn630=)" "" "0000306100" "00023868" "30" "1984" "0" "1984" "0" "c.1984G>A" "r.(?)" "p.(Glu662Lys)" "" "0000306101" "00023868" "50" "2069" "0" "2069" "0" "c.2069C>T" "r.(?)" "p.(Thr690Met)" "" "0000306102" "00023868" "30" "2220" "0" "2220" "0" "c.2220C>T" "r.(?)" "p.(Asn740=)" "" "0000306103" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000306104" "00023868" "30" "2254" "0" "2254" "0" "c.2254C>T" "r.(?)" "p.(Leu752=)" "" "0000306105" "00023868" "30" "2427" "-18" "2427" "-18" "c.2427-18C>T" "r.(=)" "p.(=)" "" "0000306106" "00023868" "30" "2481" "-7" "2481" "-7" "c.2481-7C>T" "r.(=)" "p.(=)" "" "0000306107" "00023868" "50" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0000306108" "00023868" "30" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(Phe88=)" "" "0000306109" "00023868" "30" "2853" "0" "2853" "0" "c.2853C>T" "r.(?)" "p.(Tyr951=)" "" "0000306110" "00023868" "70" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000306111" "00023868" "30" "293" "0" "293" "0" "c.293C>T" "r.(?)" "p.(Ala98Val)" "" "0000306112" "00023868" "10" "2958" "0" "2958" "0" "c.2958C>T" "r.(?)" "p.(Tyr986=)" "" "0000306113" "00023868" "30" "2994" "0" "2994" "0" "c.2994G>C" "r.(?)" "p.(Ser998=)" "" "0000306114" "00023868" "50" "3176" "0" "3176" "0" "c.3176A>G" "r.(?)" "p.(Asn1059Ser)" "" "0000306115" "00023868" "10" "3198" "0" "3198" "0" "c.3198G>A" "r.(?)" "p.(Thr1066=)" "" "0000306116" "00023868" "30" "3222" "0" "3222" "0" "c.3222G>T" "r.(?)" "p.(Val1074=)" "" "0000306117" "00023868" "30" "3233" "0" "3233" "0" "c.3233G>C" "r.(?)" "p.(Cys1078Ser)" "" "0000306118" "00023868" "50" "32" "0" "32" "0" "c.32G>A" "r.(?)" "p.(Gly11Asp)" "" "0000306119" "00023868" "50" "3383" "0" "3383" "0" "c.3383G>A" "r.(?)" "p.(Arg1128His)" "" "0000306120" "00023868" "10" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000306121" "00023868" "50" "3559" "0" "3559" "0" "c.3559C>T" "r.(?)" "p.(Arg1187Trp)" "" "0000306122" "00023868" "10" "3597" "0" "3597" "0" "c.3597C>A" "r.(?)" "p.(Thr1199=)" "" "0000306123" "00023868" "30" "3652" "0" "3652" "0" "c.3652C>T" "r.(?)" "p.(Leu1218=)" "" "0000306124" "00023868" "10" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000306125" "00023868" "50" "488" "0" "488" "0" "c.488C>T" "r.(?)" "p.(Pro163Leu)" "" "0000306126" "00023868" "30" "798" "0" "798" "0" "c.798G>T" "r.(?)" "p.(Val266=)" "" "0000306127" "00023868" "30" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000306128" "00023868" "10" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" "" "0000324267" "00023868" "50" "26511" "0" "26511" "0" "c.*22791T>C" "r.(=)" "p.(=)" "" "0000324268" "00023868" "30" "25409" "0" "25409" "0" "c.*21689T>G" "r.(=)" "p.(=)" "" "0000324271" "00023868" "50" "4030" "0" "4032" "0" "c.*310_*312del" "r.(=)" "p.(=)" "" "0000324273" "00023868" "30" "2597" "0" "2597" "0" "c.2597G>A" "r.(?)" "p.(Arg866Gln)" "" "0000324274" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000324276" "00023868" "50" "926" "0" "926" "0" "c.926G>A" "r.(?)" "p.(Arg309His)" "" "0000324277" "00023868" "30" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000324278" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000324280" "00023868" "30" "153" "0" "158" "0" "c.153_158del" "r.(?)" "p.(Gln54_Gln55del)" "" "0000324281" "00023868" "50" "156" "0" "158" "0" "c.156_158dup" "r.(?)" "p.(Gln55dup)" "" "0000324283" "00023868" "50" "-3" "0" "1" "0" "c.-3_1del" "r.(?)" "p.(Met1?)" "" "0000341047" "00023868" "10" "2958" "0" "2958" "0" "c.2958C>T" "r.(?)" "p.(Tyr986=)" "" "0000341459" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000341707" "00023868" "50" "3286" "0" "3286" "0" "c.3286C>T" "r.(?)" "p.(Arg1096Cys)" "" "0000343767" "00023868" "90" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" "0000344522" "00023868" "10" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000350202" "00023868" "30" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0000400774" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000400775" "00023868" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Arg275Gln)" "" "0000438270" "00023868" "90" "1943" "0" "1943" "0" "c.1943C>G" "r.(?)" "p.(Pro648Arg)" "" "0000438271" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000438272" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000441243" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000442719" "00023868" "50" "1695" "0" "1712" "23" "c.1695_1712+23del" "r.(?)" "p.His565_Gly571delinsGln" "" "0000455046" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000455047" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000455048" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000455049" "00023868" "90" "2563" "0" "2563" "0" "c.2563G>T" "r.(?)" "p.(Val855Leu)" "" "0000455050" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000555981" "00023868" "30" "55866" "0" "55866" "0" "c.*52146G>A" "r.(=)" "p.(=)" "" "0000555982" "00023868" "50" "52004" "0" "52004" "0" "c.*48284A>G" "r.(=)" "p.(=)" "" "0000555983" "00023868" "30" "46998" "0" "46998" "0" "c.*43278dup" "r.(?)" "p.(=)" "" "0000555984" "00023868" "30" "39242" "0" "39242" "0" "c.*35522C>T" "r.(=)" "p.(=)" "" "0000555985" "00023868" "50" "38702" "0" "38702" "0" "c.*34982A>C" "r.(=)" "p.(=)" "" "0000555986" "00023868" "50" "38646" "0" "38646" "0" "c.*34926T>C" "r.(=)" "p.(=)" "" "0000555987" "00023868" "30" "38646" "0" "38646" "0" "c.*34926T>C" "r.(=)" "p.(=)" "" "0000555988" "00023868" "30" "35261" "0" "35261" "0" "c.*31541G>A" "r.(=)" "p.(=)" "" "0000555989" "00023868" "50" "30243" "0" "30243" "0" "c.*26523G>A" "r.(=)" "p.(=)" "" "0000555990" "00023868" "50" "26589" "0" "26589" "0" "c.*22869G>T" "r.(=)" "p.(=)" "" "0000555991" "00023868" "30" "14849" "0" "14849" "0" "c.*11129C>T" "r.(=)" "p.(=)" "" "0000555992" "00023868" "30" "12866" "0" "12866" "0" "c.*9146A>G" "r.(=)" "p.(=)" "" "0000555993" "00023868" "30" "7513" "0" "7513" "0" "c.*3793C>T" "r.(=)" "p.(=)" "" "0000555994" "00023868" "30" "5110" "0" "5110" "0" "c.*1390C>T" "r.(=)" "p.(=)" "" "0000555995" "00023868" "30" "3651" "0" "3651" "0" "c.3651G>A" "r.(?)" "p.(Ala1217=)" "" "0000555997" "00023868" "10" "3644" "-9" "3644" "-9" "c.3644-9A>G" "r.(=)" "p.(=)" "" "0000555998" "00023868" "10" "3597" "0" "3597" "0" "c.3597C>A" "r.(?)" "p.(Thr1199=)" "" "0000555999" "00023868" "10" "3561" "0" "3561" "0" "c.3561G>C" "r.(?)" "p.(Arg1187=)" "" "0000556000" "00023868" "50" "3433" "0" "3433" "0" "c.3433G>C" "r.(?)" "p.(Asp1145His)" "" "0000556001" "00023868" "50" "3432" "0" "3432" "0" "c.3432G>C" "r.(?)" "p.(Glu1144Asp)" "" "0000556003" "00023868" "30" "3425" "0" "3425" "0" "c.3425G>A" "r.(?)" "p.(Arg1142Gln)" "" "0000556004" "00023868" "30" "3274" "-19" "3274" "-19" "c.3274-19G>A" "r.(=)" "p.(=)" "" "0000556005" "00023868" "50" "3139" "0" "3139" "0" "c.3139C>T" "r.(?)" "p.(Arg1047Trp)" "" "0000556007" "00023868" "50" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0000556008" "00023868" "30" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0000556009" "00023868" "30" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0000556010" "00023868" "10" "3105" "-11" "3105" "-11" "c.3105-11T>C" "r.(=)" "p.(=)" "" "0000556011" "00023868" "10" "3105" "-11" "3105" "-11" "c.3105-11T>C" "r.(=)" "p.(=)" "" "0000556012" "00023868" "90" "3104" "1" "3104" "1" "c.3104+1G>A" "r.spl?" "p.?" "" "0000556013" "00023868" "50" "3098" "0" "3098" "0" "c.3098C>T" "r.(?)" "p.(Ala1033Val)" "" "0000556014" "00023868" "30" "2994" "0" "2994" "0" "c.2994G>A" "r.(?)" "p.(Ser998=)" "" "0000556015" "00023868" "30" "2994" "0" "2994" "0" "c.2994G>A" "r.(?)" "p.(Ser998=)" "" "0000556016" "00023868" "50" "2944" "0" "2944" "0" "c.2944G>A" "r.(?)" "p.(Ala982Thr)" "" "0000556017" "00023868" "50" "2891" "0" "2891" "0" "c.2891G>A" "r.(?)" "p.(Arg964His)" "" "0000556018" "00023868" "30" "2880" "0" "2880" "0" "c.2880C>T" "r.(?)" "p.(Pro960=)" "" "0000556019" "00023868" "90" "2869" "0" "2869" "0" "c.2869G>C" "r.(?)" "p.(Ala957Pro)" "" "0000556020" "00023868" "90" "2864" "0" "2864" "0" "c.2864A>G" "r.(?)" "p.(Tyr955Cys)" "" "0000556021" "00023868" "30" "2853" "0" "2853" "0" "c.2853C>T" "r.(?)" "p.(Tyr951=)" "" "0000556022" "00023868" "50" "2849" "0" "2849" "0" "c.2849A>G" "r.(?)" "p.(Asn950Ser)" "" "0000556023" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0000556024" "00023868" "10" "2735" "-7" "2735" "-7" "c.2735-7C>G" "r.(=)" "p.(=)" "" "0000556025" "00023868" "30" "2735" "-15" "2735" "-15" "c.2735-15C>T" "r.(=)" "p.(=)" "" "0000556026" "00023868" "30" "2721" "0" "2721" "0" "c.2721T>C" "r.(?)" "p.(Phe907=)" "" "0000556027" "00023868" "70" "2557" "0" "2557" "0" "c.2557C>T" "r.(?)" "p.(Arg853Trp)" "" "0000556028" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000556029" "00023868" "30" "2481" "-7" "2481" "-7" "c.2481-7C>T" "r.(=)" "p.(=)" "" "0000556030" "00023868" "30" "2481" "-7" "2481" "-7" "c.2481-7C>T" "r.(=)" "p.(=)" "" "0000556031" "00023868" "70" "2399" "0" "2399" "0" "c.2399T>G" "r.(?)" "p.(Phe800Cys)" "" "0000556033" "00023868" "70" "2387" "0" "2387" "0" "c.2387A>G" "r.(?)" "p.(Lys796Arg)" "" "0000556034" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000556035" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000556036" "00023868" "50" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Asp741Asn)" "" "0000556037" "00023868" "50" "2207" "0" "2207" "0" "c.2207A>G" "r.(?)" "p.(Asn736Ser)" "" "0000556038" "00023868" "50" "2207" "0" "2207" "0" "c.2207A>G" "r.(?)" "p.(Asn736Ser)" "" "0000556039" "00023868" "30" "2121" "0" "2121" "0" "c.2121C>A" "r.(?)" "p.(Asn707Lys)" "" "0000556040" "00023868" "50" "2071" "-14" "2071" "-14" "c.2071-14T>G" "r.(=)" "p.(=)" "" "0000556041" "00023868" "30" "2071" "-14" "2071" "-14" "c.2071-14T>G" "r.(=)" "p.(=)" "" "0000556042" "00023868" "30" "2028" "0" "2028" "0" "c.2028G>A" "r.(?)" "p.(Ala676=)" "" "0000556043" "00023868" "30" "1890" "0" "1890" "0" "c.1890C>T" "r.(?)" "p.(Asn630=)" "" "0000556044" "00023868" "50" "1870" "0" "1870" "0" "c.1870G>A" "r.(?)" "p.(Val624Met)" "" "0000556045" "00023868" "50" "1837" "0" "1837" "0" "c.1837C>T" "r.(?)" "p.(His613Tyr)" "" "0000556047" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000556049" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000556050" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000556051" "00023868" "50" "1736" "0" "1736" "0" "c.1736G>A" "r.(?)" "p.(Arg579Gln)" "" "0000556052" "00023868" "50" "1721" "0" "1721" "0" "c.1721G>A" "r.(?)" "p.(Arg574Gln)" "" "0000556053" "00023868" "30" "1585" "11" "1585" "11" "c.1585+11T>C" "r.(=)" "p.(=)" "" "0000556055" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0000556056" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0000556057" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000556058" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000556059" "00023868" "90" "1293" "0" "1293" "0" "c.1293del" "r.(?)" "p.(Val432SerfsTer28)" "" "0000556060" "00023868" "30" "1275" "0" "1275" "0" "c.1275C>T" "r.(?)" "p.(Ala425=)" "" "0000556062" "00023868" "50" "1174" "0" "1174" "0" "c.1174C>G" "r.(?)" "p.(Leu392Val)" "" "0000556063" "00023868" "30" "1174" "0" "1174" "0" "c.1174C>G" "r.(?)" "p.(Leu392Val)" "" "0000556064" "00023868" "50" "1174" "0" "1174" "0" "c.1174C>G" "r.(?)" "p.(Leu392Val)" "" "0000556066" "00023868" "30" "970" "0" "970" "0" "c.970C>A" "r.(?)" "p.(Pro324Thr)" "" "0000556067" "00023868" "50" "970" "0" "970" "0" "c.970C>A" "r.(?)" "p.(Pro324Thr)" "" "0000556068" "00023868" "30" "970" "0" "970" "0" "c.970C>A" "r.(?)" "p.(Pro324Thr)" "" "0000556069" "00023868" "90" "975" "0" "975" "0" "c.975del" "r.(?)" "p.(Thr326GlnfsTer39)" "" "0000556070" "00023868" "10" "948" "0" "948" "0" "c.948G>A" "r.(?)" "p.(Lys316=)" "" "0000556071" "00023868" "30" "948" "0" "948" "0" "c.948G>A" "r.(?)" "p.(Lys316=)" "" "0000556072" "00023868" "30" "856" "-5" "856" "-3" "c.856-5_856-3del" "r.spl?" "p.?" "" "0000556073" "00023868" "30" "856" "-5" "856" "-3" "c.856-5_856-3del" "r.spl?" "p.?" "" "0000556074" "00023868" "30" "852" "0" "852" "0" "c.852C>T" "r.(?)" "p.(Ile284=)" "" "0000556075" "00023868" "30" "798" "0" "798" "0" "c.798G>T" "r.(?)" "p.(Val266=)" "" "0000556077" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000556079" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000556080" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000556081" "00023868" "30" "693" "0" "693" "0" "c.693G>C" "r.(?)" "p.(Glu231Asp)" "" "0000556082" "00023868" "30" "678" "0" "678" "0" "c.678G>C" "r.(?)" "p.(Gln226His)" "" "0000556084" "00023868" "50" "547" "0" "547" "0" "c.547G>C" "r.(?)" "p.(Glu183Gln)" "" "0000556085" "00023868" "70" "276" "0" "298" "0" "c.276_298dup" "r.(?)" "p.(Val100GlyfsTer174)" "" "0000556086" "00023868" "30" "253" "0" "253" "0" "c.253G>C" "r.(?)" "p.(Glu85Gln)" "" "0000556091" "00023868" "50" "147" "0" "158" "0" "c.147_158del" "r.(?)" "p.(Gln52_Gln55del)" "" "0000556092" "00023868" "30" "147" "0" "158" "0" "c.147_158del" "r.(?)" "p.(Gln52_Gln55del)" "" "0000556093" "00023868" "30" "150" "0" "158" "0" "c.150_158del" "r.(?)" "p.(Gln53_Gln55del)" "" "0000556094" "00023868" "30" "150" "0" "158" "0" "c.150_158del" "r.(?)" "p.(Gln53_Gln55del)" "" "0000556095" "00023868" "30" "150" "0" "158" "0" "c.150_158dup" "r.(?)" "p.(Gln53_Gln55dup)" "" "0000556096" "00023868" "30" "153" "0" "158" "0" "c.153_158dup" "r.(?)" "p.(Gln54_Gln55dup)" "" "0000556098" "00023868" "10" "153" "0" "158" "0" "c.153_158dup" "r.(?)" "p.(Gln54_Gln55dup)" "" "0000556101" "00023868" "10" "156" "0" "158" "0" "c.156_158dup" "r.(?)" "p.(Gln55dup)" "" "0000556102" "00023868" "10" "156" "0" "158" "0" "c.156_158dup" "r.(?)" "p.(Gln55dup)" "" "0000556103" "00023868" "10" "156" "0" "158" "0" "c.156_158dup" "r.(?)" "p.(Gln55dup)" "" "0000556104" "00023868" "10" "127" "0" "128" "0" "c.127_128insGGCAGC" "r.(?)" "p.(Arg42_Gln43insArgGln)" "" "0000556105" "00023868" "30" "125" "0" "127" "0" "c.125_127dup" "r.(?)" "p.(Arg42dup)" "" "0000556106" "00023868" "50" "125" "0" "127" "0" "c.125_127dup" "r.(?)" "p.(Arg42dup)" "" "0000577964" "00023868" "30" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000604560" "00023868" "70" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "18" "0000604561" "00023868" "50" "1113" "0" "1113" "0" "c.1113G>T" "r.(?)" "p.(Lys371Asn)" "5" "0000615609" "00023868" "50" "14278" "0" "14278" "0" "c.*10558T>C" "r.(=)" "p.(=)" "" "0000615610" "00023868" "30" "3716" "0" "3716" "0" "c.3716C>G" "r.(?)" "p.(Pro1239Arg)" "" "0000615611" "00023868" "50" "3631" "0" "3631" "0" "c.3631G>A" "r.(?)" "p.(Gly1211Arg)" "" "0000615612" "00023868" "50" "3383" "0" "3383" "0" "c.3383G>A" "r.(?)" "p.(Arg1128His)" "" "0000615613" "00023868" "50" "3176" "0" "3176" "0" "c.3176A>G" "r.(?)" "p.(Asn1059Ser)" "" "0000615614" "00023868" "30" "3105" "-6" "3105" "-6" "c.3105-6C>T" "r.(=)" "p.(=)" "" "0000615615" "00023868" "50" "3064" "0" "3064" "0" "c.3064C>G" "r.(?)" "p.(Leu1022Val)" "" "0000615616" "00023868" "50" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000615620" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000615621" "00023868" "30" "1275" "0" "1275" "0" "c.1275C>T" "r.(?)" "p.(Ala425=)" "" "0000615622" "00023868" "30" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" "" "0000615623" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000615624" "00023868" "30" "138" "0" "158" "0" "c.138_158dup" "r.(?)" "p.(Gln49_Gln55dup)" "" "0000623322" "00023868" "30" "46998" "0" "46998" "0" "c.*43278dup" "r.(?)" "p.(=)" "" "0000623323" "00023868" "30" "3644" "-16" "3644" "-16" "c.3644-16T>C" "r.(=)" "p.(=)" "" "0000623327" "00023868" "50" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457Gln)" "" "0000629324" "00023868" "90" "2639" "0" "2639" "0" "c.2639C>A" "r.(?)" "p.(Ala880Asp)" "" "0000629360" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000649176" "00023868" "30" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000649177" "00023868" "70" "3470" "0" "3470" "0" "c.3470A>G" "r.(?)" "p.(Asn1157Ser)" "" "0000649178" "00023868" "50" "3442" "0" "3442" "0" "c.3442C>T" "r.(?)" "p.(Arg1148Cys)" "" "0000649179" "00023868" "50" "3436" "0" "3436" "0" "c.3436C>T" "r.(?)" "p.(Arg1146Cys)" "" "0000649180" "00023868" "30" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0000649181" "00023868" "50" "3382" "0" "3382" "0" "c.3382C>T" "r.(?)" "p.(Arg1128Cys)" "" "0000649182" "00023868" "50" "2915" "0" "2915" "0" "c.2915G>A" "r.(?)" "p.(Arg972Gln)" "" "0000649183" "00023868" "50" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000649184" "00023868" "70" "2749" "0" "2749" "0" "c.2749G>A" "r.(?)" "p.(Gly917Arg)" "" "0000649185" "00023868" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0000649186" "00023868" "50" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000649187" "00023868" "50" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000649188" "00023868" "30" "1636" "0" "1636" "0" "c.1636C>T" "r.(?)" "p.(Arg546Cys)" "" "0000649189" "00023868" "50" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000649190" "00023868" "50" "488" "0" "488" "0" "c.488C>T" "r.(?)" "p.(Pro163Leu)" "" "0000657690" "00023868" "30" "39192" "0" "39192" "0" "c.*35472T>C" "r.(=)" "p.(=)" "" "0000657691" "00023868" "50" "38646" "0" "38646" "0" "c.*34926T>C" "r.(=)" "p.(=)" "" "0000657692" "00023868" "30" "25526" "0" "25526" "0" "c.*21806A>C" "r.(=)" "p.(=)" "" "0000657693" "00023868" "50" "3076" "0" "3076" "0" "c.3076C>T" "r.(?)" "p.(Arg1026Cys)" "" "0000657694" "00023868" "70" "1801" "0" "1801" "0" "c.1801A>T" "r.(?)" "p.(Lys601Ter)" "" "0000657695" "00023868" "30" "1712" "10" "1712" "10" "c.1712+10G>A" "r.(=)" "p.(=)" "" "0000660255" "00023868" "50" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0000663693" "00023868" "50" "47" "0" "47" "0" "c.47C>T" "r.(?)" "p.(Pro16Leu)" "" "0000665804" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000669302" "00023868" "30" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0000680331" "00023868" "50" "14357" "0" "14357" "0" "c.*10637G>C" "r.(=)" "p.(=)" "" "0000682998" "00023868" "50" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(=)" "" "0000683009" "00023868" "50" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0000684794" "00023868" "30" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000686197" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0000686198" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0000686199" "00023868" "90" "1880" "0" "1880" "0" "c.1880G>A" "r.(?)" "p.(Arg627Gln)" "" "0000691898" "00023868" "90" "47010" "0" "47010" "0" "c.*43290G>A" "r.(=)" "p.(=)" "" "0000691899" "00023868" "30" "38646" "0" "38646" "0" "c.*34926T>C" "r.(=)" "p.(=)" "" "0000691900" "00023868" "90" "5153" "0" "5153" "0" "c.*1433G>A" "r.(=)" "p.(=)" "" "0000691901" "00023868" "50" "2981" "5" "2981" "5" "c.2981+5G>C" "r.spl?" "p.?" "" "0000691902" "00023868" "50" "2788" "0" "2788" "0" "c.2788G>A" "r.(?)" "p.(Asp930Asn)" "" "0000691903" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000691904" "00023868" "90" "2454" "0" "2454" "0" "c.2454dup" "r.(?)" "p.(Ser819ValfsTer14)" "" "0000691905" "00023868" "50" "1204" "0" "1204" "0" "c.1204G>A" "r.(?)" "p.(Ala402Thr)" "" "0000691906" "00023868" "30" "150" "0" "150" "0" "c.150G>A" "r.(?)" "p.(Gln50=)" "" "0000691907" "00023868" "10" "150" "0" "158" "0" "c.150_158dup" "r.(?)" "p.(Gln53_Gln55dup)" "" "0000697657" "00023868" "70" "2687" "0" "2687" "0" "c.2687T>G" "r.(?)" "p.(Leu896Arg)" "" "0000708545" "00023868" "50" "3193" "0" "3193" "0" "c.3193G>C" "r.(?)" "p.(Ala1065Pro)" "" "0000725356" "00023868" "50" "43599" "0" "43599" "0" "c.*39879A>G" "r.(=)" "p.(=)" "" "0000725357" "00023868" "50" "3542" "0" "3542" "0" "c.3542G>A" "r.(?)" "p.(Ser1181Asn)" "" "0000725358" "00023868" "30" "3482" "6" "3482" "6" "c.3482+6C>T" "r.(=)" "p.(=)" "" "0000725359" "00023868" "90" "2869" "0" "2869" "0" "c.2869G>C" "r.(?)" "p.(Ala957Pro)" "" "0000725360" "00023868" "70" "2785" "0" "2785" "0" "c.2785A>C" "r.(?)" "p.(Thr929Pro)" "" "0000725361" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000725362" "00023868" "70" "2209" "0" "2209" "0" "c.2209G>C" "r.(?)" "p.(Gly737Arg)" "" "0000725363" "00023868" "90" "1091" "0" "1091" "0" "c.1091dup" "r.(?)" "p.(Gly365ArgfsTer23)" "" "0000725364" "00023868" "30" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000725365" "00023868" "50" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000725366" "00023868" "30" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(Phe88=)" "" "0000725367" "00023868" "10" "150" "0" "158" "0" "c.150_158dup" "r.(?)" "p.(Gln53_Gln55dup)" "" "0000725368" "00023868" "30" "88" "0" "88" "0" "c.88G>A" "r.(?)" "p.(Val30Ile)" "" "0000735220" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000735221" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000735222" "00023868" "90" "1491" "0" "1491" "0" "c.1491G>C" "r.(?)" "p.(Gln497His)" "" "0000735223" "00023868" "50" "1491" "0" "1491" "0" "c.1491G>C" "r.(?)" "p.(Gln497His)" "" "0000735224" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000735226" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0000786992" "00023868" "90" "911" "0" "911" "0" "c.911T>G" "r.(?)" "p.(Leu304Arg)" "4" "0000787596" "00023868" "50" "2509" "0" "2509" "0" "c.2509T>C" "r.(?)" "p.(Tyr837His)" "16" "0000806993" "00023868" "10" "12866" "0" "12866" "0" "c.*9146A>G" "r.(=)" "p.(=)" "" "0000806994" "00023868" "50" "3436" "0" "3436" "0" "c.3436C>T" "r.(?)" "p.(Arg1146Cys)" "" "0000806995" "00023868" "70" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0000806996" "00023868" "30" "2724" "0" "2724" "0" "c.2724C>T" "r.(?)" "p.(Ala908=)" "" "0000806997" "00023868" "30" "2721" "0" "2721" "0" "c.2721T>C" "r.(?)" "p.(Phe907=)" "" "0000806998" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000806999" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000807000" "00023868" "50" "2077" "0" "2079" "0" "c.2077_2079del" "r.(?)" "p.(Glu693del)" "" "0000807001" "00023868" "30" "1734" "0" "1734" "0" "c.1734C>G" "r.(?)" "p.(Pro578=)" "" "0000807002" "00023868" "50" "1270" "0" "1270" "0" "c.1270C>G" "r.(?)" "p.(Leu424Val)" "" "0000807003" "00023868" "30" "678" "0" "678" "0" "c.678G>C" "r.(?)" "p.(Gln226His)" "" "0000807004" "00023868" "50" "127" "0" "128" "0" "c.127_128insGGCAGC" "r.(?)" "p.(Arg42_Gln43insArgGln)" "" "0000818139" "00023868" "70" "1796" "0" "1796" "0" "c.1796C>T" "r.(?)" "p.(Thr599Ile)" "" "0000818142" "00023868" "90" "1251" "-310" "3482" "176" "c.1251-310_3482+176del" "r.(?)" "p.(Pro419_Cys1162del)" "6i_" "0000818145" "00023868" "90" "590" "0" "590" "0" "c.590T>C" "r.(?)" "p.(Phe197Ser)" "" "0000818146" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0000818158" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000818160" "00023868" "90" "926" "0" "926" "0" "c.926G>A" "r.(?)" "p.(Arg309His)" "" "0000818161" "00023868" "90" "2209" "0" "2209" "0" "c.2209G>C" "r.(?)" "p.(Gly737Arg)" "" "0000818468" "00023868" "50" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000818469" "00023868" "50" "1113" "0" "1113" "0" "c.1113G>T" "r.(?)" "p.(Lys371Asn)" "" "0000818991" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0000829775" "00023868" "50" "2165" "0" "2165" "0" "c.2165G>A" "r.(?)" "p.(Arg722His)" "" "0000839674" "00023868" "70" "1289" "0" "1289" "0" "c.1289T>C" "r.(?)" "p.(Met430Thr)" "6" "0000854231" "00023868" "50" "41762" "0" "41762" "0" "c.*38042T>G" "r.(=)" "p.(=)" "" "0000854232" "00023868" "30" "27388" "0" "27388" "0" "c.*23668G>C" "r.(=)" "p.(=)" "" "0000854233" "00023868" "30" "25526" "0" "25526" "0" "c.*21806A>C" "r.(=)" "p.(=)" "" "0000854234" "00023868" "30" "15111" "0" "15111" "0" "c.*11391G>C" "r.(=)" "p.(=)" "" "0000854235" "00023868" "30" "3303" "0" "3303" "0" "c.3303A>C" "r.(?)" "p.(Val1101=)" "" "0000854236" "00023868" "50" "2959" "0" "2959" "0" "c.2959G>A" "r.(?)" "p.(Ala987Thr)" "" "0000854237" "00023868" "70" "2420" "0" "2420" "0" "c.2420G>C" "r.(?)" "p.(Arg807Pro)" "" "0000854238" "00023868" "50" "707" "0" "707" "0" "c.707C>T" "r.(?)" "p.(Thr236Ile)" "" "0000854239" "00023868" "90" "97" "0" "109" "0" "c.97_109del" "r.(?)" "p.(Ser33Thrfs*229)" "" "0000854240" "00023868" "30" "74" "0" "74" "0" "c.74G>C" "r.(?)" "p.(Trp25Ser)" "" "0000864146" "00023868" "10" "37350" "0" "37350" "0" "c.*33630G>C" "r.(=)" "p.(=)" "" "0000864147" "00023868" "10" "26563" "0" "26563" "0" "c.*22843C>A" "r.(=)" "p.(=)" "" "0000864148" "00023868" "90" "15269" "0" "15269" "0" "c.*11549A>T" "r.(=)" "p.(=)" "" "0000864149" "00023868" "30" "3630" "0" "3630" "0" "c.3630C>T" "r.(?)" "p.(Tyr1210=)" "" "0000864150" "00023868" "30" "3559" "0" "3559" "0" "c.3559C>T" "r.(?)" "p.(Arg1187Trp)" "" "0000864151" "00023868" "30" "3482" "7" "3482" "7" "c.3482+7G>A" "r.(=)" "p.(=)" "" "0000864152" "00023868" "50" "3425" "0" "3425" "0" "c.3425G>A" "r.(?)" "p.(Arg1142Gln)" "" "0000864153" "00023868" "30" "2487" "0" "2487" "0" "c.2487C>T" "r.(?)" "p.(Pro829=)" "" "0000864154" "00023868" "30" "803" "0" "803" "0" "c.803G>C" "r.(?)" "p.(Gly268Ala)" "" "0000864155" "00023868" "30" "144" "0" "158" "0" "c.144_158del" "r.(?)" "p.(Gln51_Gln55del)" "" "0000880083" "00023868" "90" "1646" "0" "1646" "0" "c.1646del" "r.(?)" "p.(Leu549Cysfs*4)" "" "0000892402" "00023868" "30" "58656" "0" "58656" "0" "c.*54936A>C" "r.(=)" "p.(=)" "" "0000892403" "00023868" "90" "37284" "0" "37284" "0" "c.*33564del" "r.(?)" "p.(=)" "" "0000892404" "00023868" "50" "20120" "0" "20120" "0" "c.*16400G>A" "r.(=)" "p.(=)" "" "0000892405" "00023868" "30" "3482" "6" "3482" "6" "c.3482+6C>T" "r.(=)" "p.(=)" "" "0000892406" "00023868" "50" "3244" "0" "3244" "0" "c.3244G>A" "r.(?)" "p.(Ala1082Thr)" "" "0000892407" "00023868" "50" "3140" "0" "3140" "0" "c.3140G>A" "r.(?)" "p.(Arg1047Gln)" "" "0000892408" "00023868" "90" "3104" "1" "3104" "1" "c.3104+1G>A" "r.spl?" "p.?" "" "0000892409" "00023868" "70" "2265" "1" "2265" "1" "c.2265+1G>A" "r.spl?" "p.?" "" "0000892410" "00023868" "50" "1882" "0" "1882" "0" "c.1882C>T" "r.(?)" "p.(Arg628Trp)" "" "0000892411" "00023868" "50" "1415" "0" "1415" "0" "c.1415A>C" "r.(?)" "p.(Gln472Pro)" "" "0000892412" "00023868" "90" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" "0000892413" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0000892414" "00023868" "50" "141" "0" "158" "0" "c.141_158del" "r.(?)" "p.(Gln50_Gln55del)" "" "0000909454" "00023868" "90" "2420" "0" "2420" "0" "c.2420G>A" "r.(?)" "p.(Arg807His)" "" "0000909455" "00023868" "70" "2524" "0" "2524" "0" "c.2524C>T" "r.(?)" "p.(Pro842Ser)" "" "0000914412" "00023868" "10" "37206" "0" "37206" "0" "c.*33486G>A" "r.(=)" "p.(=)" "" "0000914413" "00023868" "10" "19014" "0" "19014" "0" "c.*15294T>G" "r.(=)" "p.(=)" "" "0000914414" "00023868" "10" "5100" "0" "5100" "0" "c.*1380A>G" "r.(=)" "p.(=)" "" "0000914415" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0000926079" "00023868" "30" "41749" "0" "41749" "0" "c.*38029C>T" "r.(=)" "p.(=)" "" "0000930469" "00023868" "30" "27678" "0" "27678" "0" "c.*23958C>T" "r.(=)" "p.(=)" "" "0000930470" "00023868" "30" "20092" "0" "20092" "0" "c.*16372T>C" "r.(=)" "p.(=)" "" "0000930471" "00023868" "90" "3643" "2" "3643" "2" "c.3643+2T>C" "r.spl?" "p.?" "" "0000930472" "00023868" "50" "2510" "0" "2510" "0" "c.2510A>G" "r.(?)" "p.(Tyr837Cys)" "" "0000930473" "00023868" "50" "2410" "0" "2410" "0" "c.2410G>A" "r.(?)" "p.(Ala804Thr)" "" "0000931639" "00023868" "30" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0000932949" "00023868" "50" "2982" "-84" "2982" "-84" "c.2982-84G>A" "r.(?)" "p.(?)" "" "0000936455" "00023868" "50" "2987" "0" "2987" "0" "c.2987G>A" "r.(?)" "p.(Arg996Gln)" "" "0000950475" "00023868" "50" "4022" "0" "4022" "0" "c.*302C>T" "r.(=)" "p.(=)" "" "0000950476" "00023868" "50" "3559" "0" "3559" "0" "c.3559C>T" "r.(?)" "p.(Arg1187Trp)" "" "0000950477" "00023868" "70" "3503" "0" "3503" "0" "c.3503T>G" "r.(?)" "p.(Leu1168Arg)" "" "0000950478" "00023868" "50" "1736" "0" "1736" "0" "c.1736G>A" "r.(?)" "p.(Arg579Gln)" "" "0000968026" "00023868" "30" "1636" "0" "1636" "0" "c.1636C>T" "r.(?)" "p.(Arg546Cys)" "" "0000968028" "00023868" "30" "1174" "0" "1174" "0" "c.1174C>G" "r.(?)" "p.(Leu392Val)" "" "0000968033" "00023868" "50" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Gly132Glu)" "" "0000968034" "00023868" "30" "159" "0" "164" "0" "c.159_164dup" "r.(?)" "p.(Gln54_Gln55dup)" "" "0000968035" "00023868" "30" "153" "0" "158" "0" "c.153_158del" "r.(?)" "p.(Gln54_Gln55del)" "" "0000981488" "00023868" "50" "52081" "0" "52081" "0" "c.*48361T>C" "r.(=)" "p.(=)" "" "0000981489" "00023868" "50" "47002" "0" "47002" "0" "c.*43282C>G" "r.(=)" "p.(=)" "" "0000981490" "00023868" "70" "43609" "0" "43609" "0" "c.*39889C>T" "r.(=)" "p.(=)" "" "0000981491" "00023868" "30" "39312" "0" "39313" "0" "c.*35592_*35593del" "r.(=)" "p.(=)" "" "0000981492" "00023868" "30" "30185" "0" "30185" "0" "c.*26465T>G" "r.(=)" "p.(=)" "" "0000981493" "00023868" "30" "28856" "0" "28856" "0" "c.*25136T>G" "r.(=)" "p.(=)" "" "0000981494" "00023868" "50" "27403" "0" "27403" "0" "c.*23683C>T" "r.(=)" "p.(=)" "" "0000981495" "00023868" "90" "12827" "0" "12828" "0" "c.*9107_*9108del" "r.(=)" "p.(=)" "" "0000981496" "00023868" "90" "3151" "0" "3151" "0" "c.3151G>C" "r.(?)" "p.(Gly1051Arg)" "" "0000981497" "00023868" "50" "2977" "0" "2977" "0" "c.2977C>T" "r.(?)" "p.(Arg993Cys)" "" "0000981498" "00023868" "90" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0000981499" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0000981500" "00023868" "50" "2085" "0" "2085" "0" "c.2085T>G" "r.(?)" "p.(Asp695Glu)" "" "0000981501" "00023868" "50" "2029" "0" "2029" "0" "c.2029G>C" "r.(?)" "p.(Glu677Gln)" "" "0000981502" "00023868" "50" "1358" "0" "1358" "0" "c.1358A>C" "r.(?)" "p.(Glu453Ala)" "" "0000981503" "00023868" "50" "1277" "0" "1277" "0" "c.1277G>A" "r.(?)" "p.(Gly426Asp)" "" "0000981504" "00023868" "90" "1225" "0" "1225" "0" "c.1225C>T" "r.(?)" "p.(Gln409*)" "" "0000981505" "00023868" "50" "862" "0" "862" "0" "c.862C>T" "r.(?)" "p.(Arg288Cys)" "" "0000981506" "00023868" "50" "637" "0" "637" "0" "c.637G>A" "r.(?)" "p.(Val213Met)" "" "0000981507" "00023868" "50" "458" "0" "458" "0" "c.458C>G" "r.(?)" "p.(Ala153Gly)" "" "0000981508" "00023868" "30" "261" "0" "261" "0" "c.261C>A" "r.(?)" "p.(=)" "" "0000981509" "00023868" "50" "125" "0" "127" "0" "c.125_127dup" "r.(?)" "p.(Arg42dup)" "" "0000989361" "00023868" "50" "544" "0" "544" "0" "c.544G>C" "r.(?)" "p.(Gly182Arg)" "" "0000989366" "00023868" "70" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Arg290His)" "" "0001001765" "00023868" "30" "39284" "0" "39284" "0" "c.*35564C>T" "r.(=)" "p.(=)" "" "0001001766" "00023868" "50" "3659" "0" "3659" "0" "c.3659T>C" "r.(?)" "p.(Ile1220Thr)" "" "0001001768" "00023868" "50" "3542" "0" "3542" "0" "c.3542G>A" "r.(?)" "p.(Ser1181Asn)" "" "0001001769" "00023868" "50" "3382" "0" "3382" "0" "c.3382C>T" "r.(?)" "p.(Arg1128Cys)" "" "0001001770" "00023868" "50" "3151" "0" "3151" "0" "c.3151G>T" "r.(?)" "p.(Gly1051Trp)" "" "0001001771" "00023868" "50" "3131" "0" "3131" "0" "c.3131T>C" "r.(?)" "p.(Val1044Ala)" "" "0001001772" "00023868" "30" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0001001773" "00023868" "70" "2209" "0" "2209" "0" "c.2209G>C" "r.(?)" "p.(Gly737Arg)" "" "0001001774" "00023868" "30" "1597" "0" "1597" "0" "c.1597T>C" "r.(?)" "p.(Cys533Arg)" "" "0001001775" "00023868" "90" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" "0001001776" "00023868" "50" "391" "0" "391" "0" "c.391T>C" "r.(?)" "p.(Tyr131His)" "" "0001001777" "00023868" "50" "153" "0" "158" "0" "c.153_158dup" "r.(?)" "p.(Gln54_Gln55dup)" "" "0001008570" "00023868" "90" "1327" "0" "1327" "0" "c.1327C>T" "r.(?)" "p.(Arg443Cys)" "" "0001008571" "00023868" "30" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0001008572" "00023868" "30" "1550" "0" "1550" "0" "c.1550G>T" "r.(?)" "p.(Gly517Val)" "" "0001008573" "00023868" "30" "1882" "0" "1882" "0" "c.1882C>T" "r.(?)" "p.(Arg628Trp)" "" "0001011156" "00023868" "70" "1849" "0" "1849" "0" "c.1849C>T" "r.(?)" "p.(Arg617Cys)" "" "0001015267" "00023868" "30" "20489" "0" "20489" "0" "c.*16769A>C" "r.(=)" "p.(=)" "" "0001015268" "00023868" "50" "3542" "0" "3542" "0" "c.3542G>A" "r.(?)" "p.(Ser1181Asn)" "" "0001015269" "00023868" "50" "3276" "0" "3276" "0" "c.3276T>G" "r.(?)" "p.(Phe1092Leu)" "" "0001015270" "00023868" "50" "814" "0" "814" "0" "c.814T>C" "r.(?)" "p.(Ser272Pro)" "" "0001015271" "00023868" "30" "774" "0" "774" "0" "c.774G>T" "r.(?)" "p.(Gln258His)" "" "0001015272" "00023868" "50" "138" "0" "158" "0" "c.138_158del" "r.(?)" "p.(Gln49_Gln55del)" "" "0001026535" "00023868" "30" "39192" "0" "39192" "0" "c.*35472T>C" "r.(=)" "p.(=)" "" "0001026536" "00023868" "30" "20662" "0" "20662" "0" "c.*16942T>C" "r.(=)" "p.(=)" "" "0001026537" "00023868" "30" "7591" "0" "7591" "0" "c.*3871C>T" "r.(=)" "p.(=)" "" "0001026538" "00023868" "90" "3406" "0" "3406" "0" "c.3406G>A" "r.(?)" "p.(Glu1136Lys)" "" "0001026539" "00023868" "50" "2492" "0" "2492" "0" "c.2492A>G" "r.(?)" "p.(Tyr831Cys)" "" "0001026540" "00023868" "30" "2481" "-10" "2481" "-10" "c.2481-10A>C" "r.(=)" "p.(=)" "" "0001026541" "00023868" "30" "2100" "0" "2100" "0" "c.2100G>A" "r.(?)" "p.(=)" "" "0001026542" "00023868" "30" "1949" "239" "1949" "242" "c.1949+239_1949+242del" "r.(=)" "p.(=)" "" "0001026543" "00023868" "30" "1586" "-5" "1586" "-5" "c.1586-5del" "r.spl?" "p.?" "" "0001026544" "00023868" "30" "856" "-142" "856" "-142" "c.856-142G>A" "r.(=)" "p.(=)" "" "0001029399" "00023868" "90" "428" "0" "428" "0" "c.428C>T" "r.(?)" "p.(Ala143Val)" "2" "0001040653" "00023868" "50" "61756" "0" "61758" "0" "c.*58036_*58038del" "r.(=)" "p.(=)" "" "0001040654" "00023868" "50" "20648" "0" "20648" "0" "c.*16928G>A" "r.(=)" "p.(=)" "" "0001040655" "00023868" "50" "3436" "0" "3436" "0" "c.3436C>T" "r.(?)" "p.(Arg1146Cys)" "" "0001040656" "00023868" "50" "3176" "0" "3176" "0" "c.3176A>G" "r.(?)" "p.(Asn1059Ser)" "" "0001040657" "00023868" "50" "3062" "0" "3062" "0" "c.3062C>T" "r.(?)" "p.(Ser1021Phe)" "" "0001040658" "00023868" "50" "3004" "0" "3004" "0" "c.3004G>A" "r.(?)" "p.(Glu1002Lys)" "" "0001040659" "00023868" "50" "2188" "0" "2188" "0" "c.2188C>A" "r.(?)" "p.(Pro730Thr)" "" "0001040660" "00023868" "50" "2021" "0" "2021" "0" "c.2021G>A" "r.(?)" "p.(Gly674Asp)" "" "0001040661" "00023868" "90" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001040662" "00023868" "50" "729" "0" "729" "0" "c.729C>A" "r.(?)" "p.(Asp243Glu)" "" "0001040663" "00023868" "50" "678" "0" "678" "0" "c.678G>C" "r.(?)" "p.(Gln226His)" "" "0001040664" "00023868" "50" "602" "0" "602" "0" "c.602T>G" "r.(?)" "p.(Val201Gly)" "" "0001040665" "00023868" "50" "367" "0" "367" "0" "c.367G>C" "r.(?)" "p.(Val123Leu)" "" "0001040666" "00023868" "50" "32" "0" "32" "0" "c.32G>A" "r.(?)" "p.(Gly11Asp)" "" "0001040667" "00023868" "50" "17" "0" "17" "0" "c.17G>C" "r.(?)" "p.(Trp6Ser)" "" "0001049424" "00023868" "70" "3100" "0" "3104" "2" "c.3100_3104+2delinsCA" "r.spl" "p.?" "" "0001049425" "00023868" "90" "3599" "0" "3599" "0" "c.3599C>A" "r.(3599C>A)" "p.(Pro1200His)" "" "0001055237" "00023868" "50" "35264" "0" "35264" "0" "c.*31544T>C" "r.(=)" "p.(=)" "" "0001055238" "00023868" "50" "27759" "0" "27759" "0" "c.*24039G>A" "r.(=)" "p.(=)" "" "0001055239" "00023868" "50" "14341" "0" "14341" "0" "c.*10621C>A" "r.(=)" "p.(=)" "" "0001055240" "00023868" "50" "14282" "0" "14282" "0" "c.*10562T>C" "r.(=)" "p.(=)" "" "0001055241" "00023868" "50" "3176" "0" "3176" "0" "c.3176A>G" "r.(?)" "p.(Asn1059Ser)" "" "0001055242" "00023868" "50" "3120" "0" "3120" "0" "c.3120G>C" "r.(?)" "p.(Lys1040Asn)" "" "0001055243" "00023868" "50" "3098" "0" "3098" "0" "c.3098C>T" "r.(?)" "p.(Ala1033Val)" "" "0001055244" "00023868" "90" "2246" "0" "2246" "0" "c.2246T>C" "r.(?)" "p.(Phe749Ser)" "" "0001055245" "00023868" "50" "744" "0" "744" "0" "c.744G>C" "r.(?)" "p.(Glu248Asp)" "" "0001055246" "00023868" "50" "355" "0" "355" "0" "c.355C>T" "r.(?)" "p.(Pro119Ser)" "" "0001055247" "00023868" "50" "264" "0" "264" "0" "c.264C>G" "r.(?)" "p.(Phe88Leu)" "" "0001057732" "00023868" "90" "158" "0" "166" "0" "c.158_166dup" "r.(?)" "p.(Gln53_Gln55dup)" "" "0001057740" "00023868" "90" "2890" "0" "2890" "0" "c.2890C>T" "r.(?)" "p.(Arg964Cys)" "" "0001059029" "00023868" "90" "1283" "0" "1283" "0" "c.1283T>C" "r.(?)" "p.(Leu428Pro)" "" "0001059030" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060105" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060106" "00023868" "90" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001060107" "00023868" "90" "3286" "0" "3286" "0" "c.3286C>T" "r.(?)" "p.(Arg1096Cys)" "" "0001060108" "00023868" "90" "694" "0" "694" "0" "c.694C>G" "r.(?)" "p.(Arg232Gly)" "" "0001060109" "00023868" "90" "1879" "0" "1879" "0" "c.1879C>T" "r.(?)" "p.(Arg627Trp)" "" "0001060110" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060111" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060112" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060113" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060114" "00023868" "90" "2617" "0" "2617" "0" "c.2617G>T" "r.(?)" "p.(Glu873Ter)" "" "0001060115" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060116" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060117" "00023868" "90" "911" "0" "911" "0" "c.911T>G" "r.(?)" "p.(Leu304Arg)" "" "0001060118" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060119" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060120" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060121" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060122" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060123" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060124" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060125" "00023868" "90" "1707" "0" "1707" "0" "c.1707C>A" "r.(?)" "p.(His569Gln)" "" "0001060126" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060127" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060128" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060129" "00023868" "90" "3286" "0" "3286" "0" "c.3286C>T" "r.(?)" "p.(Arg1096Cys)" "" "0001060130" "00023868" "90" "2551" "0" "2551" "0" "c.2551A>G" "r.(?)" "p.(Thr851Ala)" "" "0001060131" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060132" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060133" "00023868" "50" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0001060134" "00023868" "50" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0001060135" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060136" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060137" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060138" "00023868" "90" "1039" "0" "1068" "0" "c.1039_1068del" "r.(?)" "p.(Trp347_Leu356del)" "" "0001060139" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060140" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060141" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060142" "00023868" "90" "2740" "0" "2740" "0" "c.2740A>C" "r.(?)" "p.(Thr914Pro)" "" "0001060143" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060144" "00023868" "90" "2897" "0" "2897" "0" "c.2897T>G" "r.(?)" "p.(Leu966Arg)" "" "0001060145" "00023868" "90" "1120" "0" "1120" "0" "c.1120C>T" "r.(?)" "p.(Arg374Ter)" "" "0001060146" "00023868" "90" "1250" "0" "1250" "0" "c.1250G>C" "r.(?)" "p.(Arg417Thr)" "" "0001060147" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060148" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060149" "00023868" "90" "1252" "0" "1252" "0" "c.1252T>C" "r.(?)" "p.(Cys418Arg)" "" "0001060150" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060151" "00023868" "50" "32" "0" "32" "0" "c.32G>A" "r.(?)" "p.(Gly11Asp)" "" "0001060152" "00023868" "50" "32" "0" "32" "0" "c.32G>A" "r.(?)" "p.(Gly11Asp)" "" "0001060153" "00023868" "50" "1766" "0" "1766" "0" "c.1766C>T" "r.(?)" "p.(Pro589Leu)" "" "0001060155" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060156" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060157" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060158" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060159" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060160" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060161" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060162" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060163" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060164" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060165" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060166" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060167" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060168" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060169" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060170" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060171" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060172" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060173" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060174" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060175" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060176" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060177" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060178" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060179" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060180" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060181" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060182" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060183" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060184" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060185" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060186" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060187" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060188" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060189" "00023868" "90" "1491" "0" "1491" "0" "c.1491G>C" "r.(?)" "p.(Gln497His)" "" "0001060190" "00023868" "90" "1491" "0" "1491" "0" "c.1491G>C" "r.(?)" "p.(Gln497His)" "" "0001060191" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060192" "00023868" "90" "2827" "0" "2827" "0" "c.2827C>T" "r.(?)" "p.(Arg943Cys)" "18" "0001060193" "00023868" "90" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "3" "0001060194" "00023868" "90" "2584" "0" "2584" "0" "c.2584G>A" "r.(?)" "p.(Ala862Thr)" "16" "0001060195" "00023868" "90" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "3" "0001060196" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060197" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060198" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060199" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060200" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060201" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060202" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060203" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060204" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060205" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060206" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060207" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060208" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060209" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060210" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060211" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060212" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060213" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060214" "00023868" "90" "2426" "1" "2426" "1" "c.2426+1G>A" "r.spl" "p.?" "" "0001060215" "00023868" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0001060216" "00023868" "90" "915" "0" "915" "0" "c.915C>G" "r.(?)" "p.(Ser305Arg)" "" "0001060217" "00023868" "90" "2897" "0" "2897" "0" "c.2897T>G" "r.(?)" "p.(Leu966Arg)" "" "0001060218" "00023868" "90" "1073" "0" "1073" "0" "c.1073del" "r.(?)" "p.(Glu358GlyfsTer7)" "" "0001060219" "00023868" "90" "1073" "0" "1073" "0" "c.1073del" "r.(?)" "p.(Glu358GlyfsTer7)" "" "0001060220" "00023868" "90" "2897" "0" "2897" "0" "c.2897T>G" "r.(?)" "p.(Leu966Arg)" "" "0001060221" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0001060222" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0001060223" "00023868" "50" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001060224" "00023868" "50" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001060231" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060232" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060233" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060234" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060235" "00023868" "90" "2287" "0" "2287" "0" "c.2287G>M" "r.(?)" "p.(Gly763Arg)" "" "0001060236" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060237" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060238" "00023868" "90" "911" "0" "911" "0" "c.911T>G" "r.(?)" "p.(Leu304Arg)" "" "0001060239" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0001060240" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060241" "00023868" "90" "2956" "0" "2956" "0" "c.2956T>G" "r.(?)" "p.(Tyr986Asp)" "" "0001060242" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060243" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060244" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060245" "00023868" "90" "1880" "0" "1880" "0" "c.1880G>A" "r.(?)" "p.(Arg627Gln)" "" "0001060246" "00023868" "90" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0001060247" "00023868" "90" "1880" "0" "1880" "0" "c.1880G>A" "r.(?)" "p.(Arg627Gln)" "" "0001060248" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060249" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060250" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060251" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060252" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060253" "00023868" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Arg275Gln)" "" "0001060254" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060255" "00023868" "90" "3170" "0" "3170" "0" "c.3170T>C" "r.(?)" "p.(Met1057Thr)" "" "0001060256" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060257" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060258" "00023868" "50" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060259" "00023868" "50" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060260" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060261" "00023868" "90" "1789" "0" "1789" "0" "c.1789C>T" "r.(?)" "p.(Arg597Trp)" "" "0001060262" "00023868" "90" "3285" "0" "3285" "0" "c.3285C>R" "r.(?)" "p.(Ser1095Arg)" "" "0001060263" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060264" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060265" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060266" "00023868" "90" "2756" "0" "2756" "0" "c.2756T>C" "r.(?)" "p.(Met919Thr)" "" "0001060267" "00023868" "90" "3412" "0" "3412" "0" "c.3412C>T" "r.(?)" "p.(Arg1138Cys)" "" "0001060268" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060269" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060270" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060271" "00023868" "90" "2243" "0" "2243" "0" "c.2243G>C" "r.(?)" "p.(Trp748Ser)" "" "0001060272" "00023868" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Cys)" "" "0001060273" "00023868" "90" "1676" "0" "1676" "0" "c.1676T>C" "r.(?)" "p.(Leu559Pro)" "" "0001060274" "00023868" "90" "752" "0" "752" "0" "c.752C>T" "r.(?)" "p.(Thr251Ile)" "" "0001060275" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060276" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060277" "00023868" "90" "1399" "0" "1399" "0" "c.1399G>A" "r.(?)" "p.(Ala467Thr)" "" "0001060278" "00023868" "90" "3490" "0" "3490" "0" "c.3490T>A" "r.(?)" "p.(Phe1164Ile)" "" "0001060279" "00023868" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Gly848Ser)" "" "0001060280" "00023868" "90" "3285" "0" "3285" "0" "c.3285C>R" "r.(?)" "p.(Ser1095Arg)" "" "0001060281" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060282" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060283" "00023868" "50" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001060284" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060285" "00023868" "50" "830" "0" "830" "0" "c.830A>T" "r.(?)" "p.(His277Leu)" "" "0001060286" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060287" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060288" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060289" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060290" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060291" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060292" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060293" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0001060294" "00023868" "50" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0001060295" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0001060296" "00023868" "50" "3708" "0" "3708" "0" "c.3708G>T" "r.(?)" "p.(Gln1236His)" "" "0001060297" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" "0001060298" "00023868" "90" "1760" "0" "1760" "0" "c.1760C>T" "r.(?)" "p.(Pro587Leu)" "" "0001060299" "00023868" "50" "3428" "0" "3428" "0" "c.3428A>G" "r.(?)" "p.(Glu1143Gly)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 324 "{{screeningid}}" "{{variantid}}" "0000000042" "0000000598" "0000000046" "0000000599" "0000000078" "0000000597" "0000000085" "0000000594" "0000000086" "0000000595" "0000000088" "0000000596" "0000016249" "0000035989" "0000036608" "0000063733" "0000036609" "0000063734" "0000036610" "0000063735" "0000036611" "0000063736" "0000036612" "0000063737" "0000036613" "0000063738" "0000036614" "0000063739" "0000036615" "0000063740" "0000036616" "0000063741" "0000036617" "0000063742" "0000036618" "0000063743" "0000036619" "0000063744" "0000036620" "0000063745" "0000036621" "0000063746" "0000036622" "0000063747" "0000036623" "0000063748" "0000036624" "0000063749" "0000036625" "0000063750" "0000036626" "0000063751" "0000036627" "0000063752" "0000036628" "0000063753" "0000036629" "0000063754" "0000036630" "0000063755" "0000036631" "0000063756" "0000036632" "0000063757" "0000036633" "0000063758" "0000036634" "0000063759" "0000036635" "0000063760" "0000036636" "0000063761" "0000036637" "0000063762" "0000036638" "0000063763" "0000036639" "0000063764" "0000036640" "0000063765" "0000036641" "0000063766" "0000036642" "0000063767" "0000036643" "0000063768" "0000036644" "0000063769" "0000036645" "0000063770" "0000036646" "0000063771" "0000080975" "0000130061" "0000106374" "0000171972" "0000106374" "0000171973" "0000106374" "0000171974" "0000106377" "0000171976" "0000106377" "0000171977" "0000106378" "0000171986" "0000106378" "0000171987" "0000106378" "0000171988" "0000177899" "0000400774" "0000177899" "0000400775" "0000208419" "0000438270" "0000208419" "0000438271" "0000208419" "0000438272" "0000210069" "0000441243" "0000211252" "0000442719" "0000220142" "0000455046" "0000220142" "0000455047" "0000220143" "0000455048" "0000220143" "0000455049" "0000220143" "0000455050" "0000249238" "0000577964" "0000270745" "0000604560" "0000270745" "0000604561" "0000275360" "0000629324" "0000275360" "0000629360" "0000292487" "0000649176" "0000292488" "0000649177" "0000292489" "0000649178" "0000292490" "0000649179" "0000292491" "0000649180" "0000292492" "0000649181" "0000292493" "0000649182" "0000292494" "0000649183" "0000292495" "0000649184" "0000292496" "0000649185" "0000292497" "0000649186" "0000292498" "0000649187" "0000292499" "0000649188" "0000292500" "0000649189" "0000292501" "0000649190" "0000297649" "0000660255" "0000300796" "0000663693" "0000302515" "0000665804" "0000305614" "0000669302" "0000308597" "0000682998" "0000308597" "0000683009" "0000309892" "0000684794" "0000311027" "0000686197" "0000311027" "0000686198" "0000311027" "0000686199" "0000315568" "0000697657" "0000325530" "0000708545" "0000326075" "0000880083" "0000336141" "0000735220" "0000336141" "0000735221" "0000336141" "0000735222" "0000336142" "0000735223" "0000336142" "0000735224" "0000336142" "0000735226" "0000375641" "0000786992" "0000375961" "0000787596" "0000389169" "0000818139" "0000389169" "0000818142" "0000389234" "0000818145" "0000389234" "0000818146" "0000389246" "0000818158" "0000389246" "0000818991" "0000389248" "0000818160" "0000389248" "0000818161" "0000389419" "0000818468" "0000389419" "0000818469" "0000397707" "0000829775" "0000404087" "0000839674" "0000429825" "0000909454" "0000429825" "0000909455" "0000436941" "0000931639" "0000440160" "0000936455" "0000454720" "0001011156" "0000456324" "0001008570" "0000456325" "0001008571" "0000456326" "0001008572" "0000456327" "0001008573" "0000465702" "0001029399" "0000469214" "0001049424" "0000469214" "0001049425" "0000469699" "0001057732" "0000469699" "0001057740" "0000470907" "0001059029" "0000470908" "0001059030" "0000471820" "0001060105" "0000471820" "0001060129" "0000471821" "0001060106" "0000471821" "0001060130" "0000471822" "0001060107" "0000471823" "0001060108" "0000471823" "0001060131" "0000471823" "0001060150" "0000471824" "0001060109" "0000471824" "0001060132" "0000471825" "0001060110" "0000471825" "0001060133" "0000471825" "0001060151" "0000471826" "0001060111" "0000471826" "0001060134" "0000471826" "0001060152" "0000471827" "0001060112" "0000471827" "0001060135" "0000471828" "0001060113" "0000471828" "0001060136" "0000471829" "0001060114" "0000471829" "0001060137" "0000471830" "0001060115" "0000471830" "0001060138" "0000471831" "0001060116" "0000471831" "0001060139" "0000471832" "0001060117" "0000471833" "0001060118" "0000471833" "0001060140" "0000471834" "0001060119" "0000471834" "0001060141" "0000471835" "0001060120" "0000471835" "0001060142" "0000471836" "0001060121" "0000471836" "0001060143" "0000471837" "0001060122" "0000471837" "0001060144" "0000471838" "0001060123" "0000471838" "0001060145" "0000471839" "0001060124" "0000471839" "0001060146" "0000471840" "0001060125" "0000471841" "0001060126" "0000471841" "0001060147" "0000471841" "0001060153" "0000471842" "0001060127" "0000471842" "0001060148" "0000471843" "0001060128" "0000471843" "0001060149" "0000471845" "0001060155" "0000471846" "0001060156" "0000471847" "0001060157" "0000471848" "0001060158" "0000471849" "0001060159" "0000471850" "0001060160" "0000471850" "0001060181" "0000471851" "0001060161" "0000471851" "0001060182" "0000471852" "0001060162" "0000471852" "0001060183" "0000471853" "0001060163" "0000471853" "0001060184" "0000471854" "0001060164" "0000471854" "0001060185" "0000471855" "0001060165" "0000471855" "0001060186" "0000471856" "0001060166" "0000471856" "0001060187" "0000471857" "0001060167" "0000471858" "0001060168" "0000471859" "0001060169" "0000471860" "0001060170" "0000471861" "0001060171" "0000471862" "0001060172" "0000471863" "0001060173" "0000471864" "0001060174" "0000471865" "0001060175" "0000471866" "0001060176" "0000471867" "0001060177" "0000471868" "0001060178" "0000471869" "0001060179" "0000471870" "0001060180" "0000471871" "0001060188" "0000471871" "0001060189" "0000471872" "0001060190" "0000471872" "0001060191" "0000471873" "0001060192" "0000471873" "0001060193" "0000471874" "0001060194" "0000471874" "0001060195" "0000471875" "0001060196" "0000471875" "0001060210" "0000471876" "0001060197" "0000471876" "0001060211" "0000471877" "0001060198" "0000471877" "0001060212" "0000471878" "0001060199" "0000471878" "0001060213" "0000471879" "0001060200" "0000471880" "0001060201" "0000471880" "0001060214" "0000471881" "0001060202" "0000471881" "0001060215" "0000471882" "0001060203" "0000471882" "0001060216" "0000471883" "0001060204" "0000471883" "0001060217" "0000471884" "0001060205" "0000471884" "0001060218" "0000471885" "0001060206" "0000471885" "0001060219" "0000471886" "0001060207" "0000471886" "0001060220" "0000471887" "0001060208" "0000471887" "0001060221" "0000471887" "0001060223" "0000471888" "0001060209" "0000471888" "0001060222" "0000471888" "0001060224" "0000471889" "0001060231" "0000471889" "0001060259" "0000471889" "0001060281" "0000471890" "0001060232" "0000471890" "0001060260" "0000471891" "0001060233" "0000471892" "0001060234" "0000471892" "0001060293" "0000471893" "0001060235" "0000471894" "0001060236" "0000471894" "0001060261" "0000471895" "0001060237" "0000471895" "0001060262" "0000471895" "0001060282" "0000471896" "0001060238" "0000471896" "0001060263" "0000471897" "0001060239" "0000471897" "0001060264" "0000471897" "0001060283" "0000471897" "0001060290" "0000471898" "0001060240" "0000471898" "0001060265" "0000471898" "0001060284" "0000471899" "0001060241" "0000471899" "0001060266" "0000471900" "0001060242" "0000471900" "0001060267" "0000471901" "0001060243" "0000471901" "0001060268" "0000471901" "0001060299" "0000471902" "0001060244" "0000471903" "0001060245" "0000471903" "0001060269" "0000471903" "0001060294" "0000471903" "0001060295" "0000471904" "0001060246" "0000471904" "0001060270" "0000471904" "0001060285" "0000471904" "0001060291" "0000471905" "0001060247" "0000471905" "0001060271" "0000471905" "0001060296" "0000471905" "0001060297" "0000471906" "0001060248" "0000471906" "0001060272" "0000471906" "0001060286" "0000471907" "0001060249" "0000471908" "0001060250" "0000471908" "0001060273" "0000471909" "0001060251" "0000471909" "0001060274" "0000471909" "0001060292" "0000471910" "0001060252" "0000471910" "0001060275" "0000471910" "0001060287" "0000471911" "0001060253" "0000471911" "0001060276" "0000471912" "0001060254" "0000471912" "0001060277" "0000471912" "0001060288" "0000471913" "0001060255" "0000471913" "0001060278" "0000471914" "0001060256" "0000471914" "0001060298" "0000471915" "0001060257" "0000471915" "0001060279" "0000471916" "0001060258" "0000471916" "0001060280" "0000471916" "0001060289"