### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = POLR2A) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "POLR2A" "polymerase (RNA) II (DNA directed) polypeptide A, 220kDa" "17" "p13.1" "unknown" "NG_027747.2" "UD_132085313476" "" "https://www.LOVD.nl/POLR2A" "" "1" "9187" "5430" "180660" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/POLR2A_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-08-07 19:24:39" "00000" "2026-07-09 13:43:02" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00016501" "POLR2A" "polymerase (RNA) II (DNA directed) polypeptide A, 220kDa" "001" "NM_000937.4" "" "NP_000928.1" "" "" "" "-386" "6352" "5913" "7387698" "7417935" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05937" "NEDBASH" "neurodevelopmental disorder with behavioral abnormalities, absent speech, and hypotonia (NEDBASH)" "AR" "618718" "" "" "" "00006" "2021-05-18 14:59:04" "" "" "06383" "NEDHIB" "Neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities" "AD" "618603" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "POLR2A" "05611" "POLR2A" "06383" ## Individuals ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00260784" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat5" "00260785" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat6" "00260786" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat8" "00260787" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat12" "00260788" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat13" "00260789" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat1" "00260790" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat16" "00260791" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat4" "00260792" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat11" "00260793" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat10" "00260794" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat15" "00260795" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat9" "00260796" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat14" "00260797" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat2" "00260798" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "F" "" "" "" "0" "" "" "" "Pat7" "00260799" "" "" "" "1" "" "00006" "{PMID:Haijes 2019:31353023}" "" "M" "" "" "" "0" "" "" "" "Pat3" "00380423" "" "" "" "1" "" "02541" "" "" "" "" "" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 17 "{{individualid}}" "{{diseaseid}}" "00260784" "05611" "00260785" "05611" "00260786" "05611" "00260787" "05611" "00260788" "05611" "00260789" "05611" "00260790" "05611" "00260791" "05611" "00260792" "05611" "00260793" "05611" "00260794" "05611" "00260795" "05611" "00260796" "05611" "00260797" "05611" "00260798" "05611" "00260799" "05611" "00380423" "05937" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 05611, 05937, 06383 ## Count = 17 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000199315" "05611" "00260784" "00006" "Isolated (sporadic)" "17y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199316" "05611" "00260785" "00006" "Isolated (sporadic)" "13y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199317" "05611" "00260786" "00006" "Isolated (sporadic)" "3y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199318" "05611" "00260787" "00006" "Isolated (sporadic)" "4y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199319" "05611" "00260788" "00006" "Isolated (sporadic)" "7y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199320" "05611" "00260789" "00006" "Isolated (sporadic)" "7y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199321" "05611" "00260790" "00006" "Isolated (sporadic)" "9y" "see paper; …, mild" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199322" "05611" "00260791" "00006" "Isolated (sporadic)" "11y" "see paper; …, moderate" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199323" "05611" "00260792" "00006" "Isolated (sporadic)" "6y" "see paper; …, moderate" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199324" "05611" "00260793" "00006" "Isolated (sporadic)" "13y" "see paper; …, moderate" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199325" "05611" "00260794" "00006" "Isolated (sporadic)" "7y" "see paper; …, moderate" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199326" "05611" "00260795" "00006" "Isolated (sporadic)" "18y" "see paper; …, severe" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199327" "05611" "00260796" "00006" "Isolated (sporadic)" "6y" "see paper; …, severe" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199328" "05611" "00260797" "00006" "Isolated (sporadic)" "4y" "see paper; …, severe" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199329" "05611" "00260798" "00006" "Isolated (sporadic)" "9y" "see paper; …, profound" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000199330" "05611" "00260799" "00006" "Isolated (sporadic)" "<0d" "see paper; …" "" "" "" "" "" "" "neurodevelopmental syndrome" "0000274269" "05937" "00380423" "02541" "Isolated (sporadic)" "" "neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities" "" "" "" "" "" "NEDBASH" "" ## Screenings ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000261888" "00260784" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261889" "00260785" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261890" "00260786" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261891" "00260787" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261892" "00260788" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261893" "00260789" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261894" "00260790" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261895" "00260791" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261896" "00260792" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261897" "00260793" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261898" "00260794" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261899" "00260795" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261900" "00260796" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261901" "00260797" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261902" "00260798" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261903" "00260799" "1" "00006" "00006" "2019-08-07 19:40:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000381637" "00380423" "1" "02541" "02541" "2021-08-17 10:00:21" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{geneid}}" "0000261888" "POLR2A" "0000261889" "POLR2A" "0000261890" "POLR2A" "0000261891" "POLR2A" "0000261892" "POLR2A" "0000261893" "POLR2A" "0000261894" "POLR2A" "0000261895" "POLR2A" "0000261896" "POLR2A" "0000261897" "POLR2A" "0000261898" "POLR2A" "0000261899" "POLR2A" "0000261900" "POLR2A" "0000261901" "POLR2A" "0000261902" "POLR2A" "0000261903" "POLR2A" "0000381637" "POLR2A" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 68 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000306133" "0" "50" "17" "7404383" "7404385" "del" "0" "01943" "POLR2A_000002" "g.7404383_7404385del" "" "" "" "POLR2A(NM_000937.5):c.2006_2008delACT (p.Y669del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7501064_7501066del" "" "VUS" "" "0000308433" "0" "50" "17" "7385778" "7385778" "subst" "0.000158557" "01943" "SLC35G6_000001" "g.7385778T>G" "" "" "" "SLC35G6(NM_001102614.1):c.475T>G (p.W159G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7482459T>G" "" "VUS" "" "0000325154" "0" "50" "17" "7402707" "7402707" "subst" "0" "01804" "POLR2A_000001" "g.7402707G>A" "" "" "" "POLR2A(NM_000937.4):c.1568G>A (p.(Arg523His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7499388G>A" "" "VUS" "" "0000343581" "0" "50" "17" "7412890" "7412890" "subst" "0" "02327" "POLR2A_000003" "g.7412890A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7509571A>G" "" "VUS" "" "0000563136" "0" "50" "17" "7411700" "7411700" "subst" "0" "02327" "POLR2A_000005" "g.7411700T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7508381T>C" "" "VUS" "" "0000592008" "0" "90" "17" "7404655" "7404655" "subst" "0" "00006" "POLR2A_000009" "g.7404655C>T" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7501336C>T" "" "pathogenic (dominant)" "" "0000592009" "0" "90" "17" "7404902" "7404902" "subst" "0" "00006" "POLR2A_000010" "g.7404902C>T" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7501583C>T" "" "pathogenic (dominant)" "" "0000592010" "0" "90" "17" "7404961" "7404963" "del" "0" "00006" "POLR2A_000012" "g.7404961_7404963del" "" "{PMID:Haijes 2019:31353023}" "" "2262_2264delCTC" "" "De novo" "" "" "0" "" "" "g.7501642_7501644del" "" "pathogenic (dominant)" "" "0000592011" "0" "90" "17" "7411700" "7411700" "subst" "0" "00006" "POLR2A_000005" "g.7411700T>C" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7508381T>C" "" "pathogenic (dominant)" "" "0000592012" "0" "90" "17" "7411702" "7411704" "del" "0" "00006" "POLR2A_000016" "g.7411702_7411704del" "" "{PMID:Haijes 2019:31353023}" "" "3373_3375delAAG" "" "De novo" "" "" "0" "" "" "g.7508383_7508385del" "" "pathogenic (dominant)" "" "0000592013" "0" "90" "17" "7401099" "7401099" "subst" "0" "00006" "POLR2A_000006" "g.7401099C>T" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7497780C>T" "" "pathogenic (dominant)" "" "0000592014" "0" "90" "17" "7416881" "7416881" "dup" "0" "00006" "POLR2A_000018" "g.7416881dup" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7513562dup" "" "pathogenic (dominant)" "" "0000592015" "0" "90" "17" "7404383" "7404385" "del" "0" "00006" "POLR2A_000002" "g.7404383_7404385del" "" "{PMID:Haijes 2019:31353023}" "" "2006_2008delACT" "" "De novo" "" "" "0" "" "" "g.7501064_7501066del" "" "pathogenic (dominant)" "" "0000592016" "0" "90" "17" "7411654" "7411654" "subst" "0" "00006" "POLR2A_000015" "g.7411654T>C" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7508335T>C" "" "pathogenic (dominant)" "" "0000592017" "0" "90" "17" "7405412" "7405412" "subst" "0" "00006" "POLR2A_000014" "g.7405412T>C" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7502093T>C" "" "pathogenic (dominant)" "" "0000592018" "0" "90" "17" "7416391" "7416391" "subst" "1.27066E-5" "00006" "POLR2A_000017" "g.7416391G>A" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7513072G>A" "" "pathogenic (dominant)" "" "0000592019" "0" "90" "17" "7405005" "7405005" "subst" "0" "00006" "POLR2A_000013" "g.7405005T>C" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7501686T>C" "" "pathogenic (dominant)" "" "0000592020" "0" "90" "17" "7412890" "7412890" "subst" "0" "00006" "POLR2A_000003" "g.7412890A>G" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7509571A>G" "" "pathogenic (dominant)" "" "0000592021" "0" "90" "17" "7402392" "7402392" "subst" "0" "00006" "POLR2A_000007" "g.7402392T>C" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7499073T>C" "" "pathogenic (dominant)" "" "0000592022" "0" "90" "17" "7404906" "7404906" "subst" "0" "00006" "POLR2A_000011" "g.7404906C>T" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7501587C>T" "" "pathogenic (dominant)" "" "0000592023" "0" "90" "17" "7402731" "7402731" "subst" "0" "00006" "POLR2A_000008" "g.7402731A>G" "" "{PMID:Haijes 2019:31353023}" "" "" "" "De novo" "" "" "0" "" "" "g.7499412A>G" "" "pathogenic (dominant)" "" "0000692473" "0" "50" "17" "7402463" "7402463" "subst" "0" "02327" "POLR2A_000019" "g.7402463A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000795132" "0" "70" "17" "7414585" "7414585" "subst" "0" "02541" "POLR2A_000020" "g.7414585G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000894289" "0" "50" "17" "7417107" "7417107" "subst" "1.62466E-5" "02325" "POLR2A_000021" "g.7417107A>G" "" "" "" "POLR2A(NM_000937.5):c.5524A>G (p.T1842A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000898079" "0" "70" "17" "7405249" "7405249" "subst" "0" "03779" "POLR2A_000022" "g.7405249G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000951037" "0" "30" "17" "7415569" "7415569" "subst" "3.66074E-5" "02325" "POLR2A_000023" "g.7415569C>T" "" "" "" "POLR2A(NM_000937.5):c.4398C>T (p.A1466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951038" "0" "50" "17" "7416450" "7416450" "subst" "0" "02325" "POLR2A_000024" "g.7416450T>G" "" "" "" "POLR2A(NM_000937.5):c.4867T>G (p.S1623A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982807" "0" "30" "17" "7404605" "7404605" "subst" "0" "01804" "POLR2A_000025" "g.7404605T>C" "" "" "" "POLR2A(NM_000937.5):c.2051-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982808" "0" "50" "17" "7405903" "7405903" "subst" "0" "01804" "POLR2A_000026" "g.7405903G>A" "" "" "" "POLR2A(NM_000937.5):c.2639G>A (p.(Arg880Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982809" "0" "30" "17" "7406608" "7406608" "subst" "1.64076E-5" "01804" "POLR2A_000027" "g.7406608C>T" "" "" "" "POLR2A(NM_000937.5):c.2925C>T (p.(Ser975=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982811" "0" "30" "17" "7416578" "7416581" "del" "0" "01804" "POLR2A_000028" "g.7416578_7416581del" "" "" "" "POLR2A(NM_000937.5):c.4995_4998del (p.(Thr1667LeufsTer313))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982812" "0" "30" "17" "7416585" "7416601" "del" "0" "01804" "POLR2A_000029" "g.7416585_7416601del" "" "" "" "POLR2A(NM_000937.5):c.5002_5018del (p.(Ser1668HisfsTer11))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982813" "0" "50" "17" "7417134" "7417134" "subst" "0" "01804" "POLR2A_000030" "g.7417134C>G" "" "" "" "POLR2A(NM_000937.5):c.5551C>G (p.(Pro1851Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003671" "0" "30" "17" "7385380" "7385380" "subst" "0.000565082" "01804" "POLR2A_000031" "g.7385380G>A" "" "" "" "SLC35G6(NM_001102614.1):c.77G>A (p.(Arg26His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003679" "0" "30" "17" "7399303" "7399303" "subst" "8.12434E-6" "01804" "POLR2A_000032" "g.7399303C>T" "" "" "" "POLR2A(NM_000937.4):c.137C>T (p.(Thr46Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003680" "0" "50" "17" "7400118" "7400118" "subst" "0" "01804" "POLR2A_000033" "g.7400118C>G" "" "" "" "POLR2A(NM_000937.4):c.573C>G (p.(Ile191Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003685" "0" "50" "17" "7406771" "7406771" "subst" "0" "01804" "POLR2A_000034" "g.7406771G>T" "" "" "" "POLR2A(NM_000937.4):c.2996G>T (p.(Arg999Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003686" "0" "50" "17" "7411760" "7411760" "subst" "0" "01804" "POLR2A_000035" "g.7411760T>C" "" "" "" "POLR2A(NM_000937.4):c.3431T>C (p.(Leu1144Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003687" "0" "50" "17" "7412467" "7412467" "subst" "0" "01804" "POLR2A_000036" "g.7412467C>T" "" "" "" "POLR2A(NM_000937.4):c.3670C>T (p.(Arg1224Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003690" "0" "30" "17" "7414643" "7414643" "subst" "0.000467563" "01804" "POLR2A_000037" "g.7414643G>C" "" "" "" "POLR2A(NM_000937.4):c.3918+5G>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003694" "0" "30" "17" "7416364" "7416364" "subst" "0" "01804" "POLR2A_000038" "g.7416364C>T" "" "" "" "POLR2A(NM_000937.4):c.4781C>T (p.(Ser1594Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003695" "0" "30" "17" "7416408" "7416408" "subst" "4.07874E-6" "01804" "POLR2A_000039" "g.7416408A>G" "" "" "" "POLR2A(NM_000937.4):c.4825A>G (p.(Thr1609Ala)), POLR2A(NM_000937.5):c.4825A>G (p.T1609A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003696" "0" "30" "17" "7416512" "7416532" "del" "0" "01804" "POLR2A_000040" "g.7416512_7416532del" "" "" "" "POLR2A(NM_000937.4):c.4929_4949delTTCGCCAACGTCACCCAGCTA (p.(Ser1644_Tyr1650del)), POLR2A(NM_000937.5):c.4929_4949delTTCGCCAACGTCACCCAGCTA (p.S1740...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003697" "0" "50" "17" "7416518" "7416520" "del" "0" "01804" "POLR2A_000041" "g.7416518_7416520del" "" "" "" "POLR2A(NM_000937.4):c.4935_4937delAAC (p.(Thr1646del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003698" "0" "30" "17" "7416928" "7416928" "subst" "0" "01804" "POLR2A_000042" "g.7416928A>C" "" "" "" "POLR2A(NM_000937.4):c.5345A>C (p.(Asn1782Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003699" "0" "30" "17" "7417024" "7417024" "subst" "4.06124E-6" "01804" "POLR2A_000043" "g.7417024A>G" "" "" "" "POLR2A(NM_000937.4):c.5441A>G (p.(Gln1814Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015617" "0" "50" "17" "7416512" "7416532" "del" "0" "02325" "POLR2A_000040" "g.7416512_7416532del" "" "" "" "POLR2A(NM_000937.4):c.4929_4949delTTCGCCAACGTCACCCAGCTA (p.(Ser1644_Tyr1650del)), POLR2A(NM_000937.5):c.4929_4949delTTCGCCAACGTCACCCAGCTA (p.S1740...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042186" "0" "30" "17" "7399246" "7399251" "del" "0" "01804" "POLR2A_000044" "g.7399246_7399251del" "" "" "" "POLR2A(NM_000937.5):c.94-14_94-9del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042187" "0" "30" "17" "7401094" "7401094" "subst" "1.6243E-5" "01804" "POLR2A_000045" "g.7401094C>T" "" "" "" "POLR2A(NM_000937.5):c.1107C>T (p.(Pro369=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042189" "0" "30" "17" "7405834" "7405834" "subst" "3.25826E-5" "01804" "POLR2A_000046" "g.7405834C>G" "" "" "" "POLR2A(NM_000937.5):c.2573-3C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042190" "0" "50" "17" "7407030" "7407030" "subst" "4.06544E-6" "01804" "POLR2A_000047" "g.7407030A>G" "" "" "" "POLR2A(NM_000937.5):c.3160A>G (p.(Met1054Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042191" "0" "30" "17" "7413348" "7413348" "subst" "0" "01804" "POLR2A_000048" "g.7413348G>A" "" "" "" "POLR2A(NM_000937.5):c.3813+397G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042194" "0" "30" "17" "7416082" "7416083" "del" "0" "01804" "POLR2A_000049" "g.7416082_7416083del" "" "" "" "POLR2A(NM_000937.5):c.4607-11_4607-10del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042195" "0" "50" "17" "7416408" "7416408" "subst" "4.07874E-6" "02325" "POLR2A_000039" "g.7416408A>G" "" "" "" "POLR2A(NM_000937.4):c.4825A>G (p.(Thr1609Ala)), POLR2A(NM_000937.5):c.4825A>G (p.T1609A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042196" "0" "50" "17" "7417039" "7417039" "subst" "0" "01804" "POLR2A_000050" "g.7417039C>G" "" "" "" "POLR2A(NM_000937.5):c.5456C>G (p.(Thr1819Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046671" "0" "50" "17" "7400323" "7400323" "subst" "0" "02326" "POLR2A_000051" "g.7400323G>A" "" "" "" "POLR2A(NM_000937.5):c.778G>A (p.V260M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055802" "0" "30" "17" "7398056" "7398056" "subst" "0" "01804" "POLR2A_000052" "g.7398056T>C" "" "" "" "POLR2A(NM_000937.5):c.94-1204T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055803" "0" "30" "17" "7404436" "7404436" "subst" "0" "01804" "POLR2A_000053" "g.7404436G>A" "" "" "" "POLR2A(NM_000937.5):c.2050+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055804" "0" "50" "17" "7406736" "7406736" "subst" "0" "01804" "POLR2A_000054" "g.7406736C>G" "" "" "" "POLR2A(NM_000937.5):c.2961C>G (p.(Ile987Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055805" "0" "30" "17" "7414528" "7414528" "del" "1.62466E-5" "01804" "POLR2A_000055" "g.7414528del" "" "" "" "POLR2A(NM_000937.5):c.3814-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055806" "0" "50" "17" "7416684" "7416685" "ins" "0" "01804" "POLR2A_000056" "g.7416684_7416685insATCTCCCAGCTACTCGC" "" "" "" "POLR2A(NM_000937.5):c.5101_5102insATCTCCCAGCTACTCGC (p.(Pro1701HisfsTer286))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066611" "0" "50" "17" "7405004" "7405004" "subst" "0" "02325" "POLR2A_000057" "g.7405004A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066612" "0" "50" "17" "7406002" "7406002" "subst" "0" "01804" "POLR2A_000058" "g.7406002A>G" "" "" "" "POLR2A(NM_000937.5):c.2738A>G (p.(Asn913Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066613" "0" "50" "17" "7412393" "7412393" "subst" "0" "02325" "POLR2A_000059" "g.7412393T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066614" "0" "30" "17" "7414643" "7414643" "subst" "0.000467563" "02325" "POLR2A_000037" "g.7414643G>C" "" "" "" "POLR2A(NM_000937.4):c.3918+5G>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001066615" "0" "50" "17" "7416662" "7416682" "del" "0" "02325" "POLR2A_000060" "g.7416662_7416682del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001068092" "0" "50" "17" "7404389" "7404389" "del" "0" "03779" "POLR2A_000061" "g.7404389del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001079911" "0" "30" "17" "7416686" "7416706" "del" "0" "03779" "chr17_010881" "g.7416686_7416706del" "" "" "" "" "" "Unknown" "" "rs752219774" "0" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes POLR2A ## Count = 68 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000306133" "00016501" "50" "2006" "0" "2008" "0" "c.2006_2008del" "r.(?)" "p.(Tyr669del)" "" "0000308433" "00016501" "50" "-2306" "0" "-2306" "0" "c.-2306T>G" "r.(?)" "p.(=)" "" "0000325154" "00016501" "50" "1568" "0" "1568" "0" "c.1568G>A" "r.(?)" "p.(Arg523His)" "" "0000343581" "00016501" "50" "3752" "0" "3752" "0" "c.3752A>G" "r.(?)" "p.(Asn1251Ser)" "" "0000563136" "00016501" "50" "3371" "0" "3371" "0" "c.3371T>C" "r.(?)" "p.(Leu1124Pro)" "" "0000592008" "00016501" "90" "2098" "0" "2098" "0" "c.2098C>T" "r.(?)" "p.(Gln700*)" "" "0000592009" "00016501" "90" "2203" "0" "2203" "0" "c.2203C>T" "r.(?)" "p.(Gln735*)" "" "0000592010" "00016501" "90" "2262" "0" "2264" "0" "c.2262_2264del" "r.(?)" "p.(Ser755del)" "" "0000592011" "00016501" "90" "3371" "0" "3371" "0" "c.3371T>C" "r.(?)" "p.(Leu1124Pro)" "" "0000592012" "00016501" "90" "3373" "0" "3375" "0" "c.3373_3375del" "r.(?)" "p.(Lys1125del)" "" "0000592013" "00016501" "90" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Pro371Leu)" "" "0000592014" "00016501" "90" "5298" "0" "5298" "0" "c.5298dup" "r.(?)" "p.(Pro1767Thrfs*7)" "" "0000592015" "00016501" "90" "2006" "0" "2008" "0" "c.2006_2008del" "r.(?)" "p.(Tyr669del)" "" "0000592016" "00016501" "90" "3325" "0" "3325" "0" "c.3325T>C" "r.(?)" "p.(Tyr1109His)" "" "0000592017" "00016501" "90" "2543" "0" "2543" "0" "c.2543T>C" "r.(?)" "p.(Ile848Thr)" "" "0000592018" "00016501" "90" "4808" "0" "4808" "0" "c.4808G>A" "r.(?)" "p.(Arg1603His)" "" "0000592019" "00016501" "90" "2306" "0" "2306" "0" "c.2306T>C" "r.(?)" "p.(Met769Thr)" "" "0000592020" "00016501" "90" "3752" "0" "3752" "0" "c.3752A>G" "r.(?)" "p.(Asn1251Ser)" "" "0000592021" "00016501" "90" "1370" "0" "1370" "0" "c.1370T>C" "r.(?)" "p.(Ile457Thr)" "" "0000592022" "00016501" "90" "2207" "0" "2207" "0" "c.2207C>T" "r.(?)" "p.(Thr736Met)" "" "0000592023" "00016501" "90" "1592" "0" "1592" "0" "c.1592A>G" "r.(?)" "p.(Asn531Ser)" "" "0000692473" "00016501" "50" "1441" "0" "1441" "0" "c.1441A>G" "r.(?)" "p.(Thr481Ala)" "" "0000795132" "00016501" "70" "3865" "0" "3865" "0" "c.3865G>A" "r.(?)" "p.(Glu1289Lys)" "" "0000894289" "00016501" "50" "5524" "0" "5524" "0" "c.5524A>G" "r.(?)" "p.(Thr1842Ala)" "" "0000898079" "00016501" "70" "2380" "0" "2380" "0" "c.2380G>C" "r.(?)" "p.(Glu794Gln)" "" "0000951037" "00016501" "30" "4398" "0" "4398" "0" "c.4398C>T" "r.(?)" "p.(=)" "" "0000951038" "00016501" "50" "4867" "0" "4867" "0" "c.4867T>G" "r.(?)" "p.(Ser1623Ala)" "" "0000982807" "00016501" "30" "2051" "-3" "2051" "-3" "c.2051-3T>C" "r.spl?" "p.?" "" "0000982808" "00016501" "50" "2639" "0" "2639" "0" "c.2639G>A" "r.(?)" "p.(Arg880Gln)" "" "0000982809" "00016501" "30" "2925" "0" "2925" "0" "c.2925C>T" "r.(?)" "p.(=)" "" "0000982811" "00016501" "30" "4995" "0" "4998" "0" "c.4995_4998del" "r.(?)" "p.(Thr1667Leufs*313)" "" "0000982812" "00016501" "30" "5002" "0" "5018" "0" "c.5002_5018del" "r.(?)" "p.(Ser1668Hisfs*11)" "" "0000982813" "00016501" "50" "5551" "0" "5551" "0" "c.5551C>G" "r.(?)" "p.(Pro1851Ala)" "" "0001003671" "00016501" "30" "-2704" "0" "-2704" "0" "c.-2704G>A" "r.(?)" "p.(=)" "" "0001003679" "00016501" "30" "137" "0" "137" "0" "c.137C>T" "r.(?)" "p.(Thr46Met)" "" "0001003680" "00016501" "50" "573" "0" "573" "0" "c.573C>G" "r.(?)" "p.(Ile191Met)" "" "0001003685" "00016501" "50" "2996" "0" "2996" "0" "c.2996G>T" "r.(?)" "p.(Arg999Leu)" "" "0001003686" "00016501" "50" "3431" "0" "3431" "0" "c.3431T>C" "r.(?)" "p.(Leu1144Ser)" "" "0001003687" "00016501" "50" "3670" "0" "3670" "0" "c.3670C>T" "r.(?)" "p.(Arg1224Trp)" "" "0001003690" "00016501" "30" "3918" "5" "3918" "5" "c.3918+5G>C" "r.spl?" "p.?" "" "0001003694" "00016501" "30" "4781" "0" "4781" "0" "c.4781C>T" "r.(?)" "p.(Ser1594Leu)" "" "0001003695" "00016501" "30" "4825" "0" "4825" "0" "c.4825A>G" "r.(?)" "p.(Thr1609Ala)" "" "0001003696" "00016501" "30" "4929" "0" "4949" "0" "c.4929_4949del" "r.(?)" "p.(Ser1740_Pro1746del)" "" "0001003697" "00016501" "50" "4935" "0" "4937" "0" "c.4935_4937del" "r.(?)" "p.(Thr1646del)" "" "0001003698" "00016501" "30" "5345" "0" "5345" "0" "c.5345A>C" "r.(?)" "p.(Asn1782Thr)" "" "0001003699" "00016501" "30" "5441" "0" "5441" "0" "c.5441A>G" "r.(?)" "p.(Gln1814Arg)" "" "0001015617" "00016501" "50" "4929" "0" "4949" "0" "c.4929_4949del" "r.(?)" "p.(Ser1740_Pro1746del)" "" "0001042186" "00016501" "30" "94" "-14" "94" "-9" "c.94-14_94-9del" "r.(=)" "p.(=)" "" "0001042187" "00016501" "30" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(=)" "" "0001042189" "00016501" "30" "2573" "-3" "2573" "-3" "c.2573-3C>G" "r.spl?" "p.?" "" "0001042190" "00016501" "50" "3160" "0" "3160" "0" "c.3160A>G" "r.(?)" "p.(Met1054Val)" "" "0001042191" "00016501" "30" "3813" "397" "3813" "397" "c.3813+397G>A" "r.(=)" "p.(=)" "" "0001042194" "00016501" "30" "4607" "-11" "4607" "-10" "c.4607-11_4607-10del" "r.(=)" "p.(=)" "" "0001042195" "00016501" "50" "4825" "0" "4825" "0" "c.4825A>G" "r.(?)" "p.(Thr1609Ala)" "" "0001042196" "00016501" "50" "5456" "0" "5456" "0" "c.5456C>G" "r.(?)" "p.(Thr1819Ser)" "" "0001046671" "00016501" "50" "778" "0" "778" "0" "c.778G>A" "r.(?)" "p.(Val260Met)" "" "0001055802" "00016501" "30" "94" "-1204" "94" "-1204" "c.94-1204T>C" "r.(=)" "p.(=)" "" "0001055803" "00016501" "30" "2050" "9" "2050" "9" "c.2050+9G>A" "r.(=)" "p.(=)" "" "0001055804" "00016501" "50" "2961" "0" "2961" "0" "c.2961C>G" "r.(?)" "p.(Ile987Met)" "" "0001055805" "00016501" "30" "3814" "-6" "3814" "-6" "c.3814-6del" "r.(=)" "p.(=)" "" "0001055806" "00016501" "50" "5101" "0" "5102" "0" "c.5101_5102insATCTCCCAGCTACTCGC" "r.(?)" "p.(Pro1701Hisfs*286)" "" "0001066611" "00016501" "50" "2305" "0" "2305" "0" "c.2305A>G" "r.(?)" "p.(Met769Val)" "" "0001066612" "00016501" "50" "2738" "0" "2738" "0" "c.2738A>G" "r.(?)" "p.(Asn913Ser)" "" "0001066613" "00016501" "50" "3596" "0" "3596" "0" "c.3596T>G" "r.(?)" "p.(Met1199Arg)" "" "0001066614" "00016501" "30" "3918" "5" "3918" "5" "c.3918+5G>C" "r.spl?" "p.?" "" "0001066615" "00016501" "50" "5079" "0" "5099" "0" "c.5079_5099del" "r.(?)" "p.(Ser1740_Pro1746del)" "" "0001068092" "00016501" "50" "2012" "0" "2012" "0" "c.2012del" "r.(?)" "p.(Asn671ThrfsTer43)" "" "0001079911" "00016501" "30" "5103" "0" "5123" "0" "c.5103_5123del" "r.(?)" "p.(Ser1740_Pro1746del)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{variantid}}" "0000261888" "0000592008" "0000261889" "0000592009" "0000261890" "0000592010" "0000261891" "0000592011" "0000261892" "0000592012" "0000261893" "0000592013" "0000261894" "0000592014" "0000261895" "0000592015" "0000261896" "0000592016" "0000261897" "0000592017" "0000261898" "0000592018" "0000261899" "0000592019" "0000261900" "0000592020" "0000261901" "0000592021" "0000261902" "0000592022" "0000261903" "0000592023" "0000381637" "0000795132"