### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = POR)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"POR" "P450 (cytochrome) oxidoreductase" "7" "q11.2" "unknown" "NG_008930.1" "UD_132084457913" "" "https://www.LOVD.nl/POR" "Human Cytochrome P450 (CYP) Allele Nomenclature Committee \r\nPharmGKB POR " "1" "9208" "5447" "124015" "1" "1" "1" "1" "POR reference haplotypes\r\nFunctional analysis variants\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/POR_codingDNA.html" "1" "" "POR reference haplotypes. Functional analysis variants" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-12-17 10:55:29" "00000" "2026-01-20 18:57:21"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00016551" "POR" "P450 (cytochrome) oxidoreductase" "001" "NM_000941.2" "" "NP_000932.3" "" "" "" "-82" "2417" "2043" "75544420" "75616173" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00632" "ABS1" "Antley-Bixler syndrome, with genital anomalies and disordered steroidogenesis (ABS-1)" "AR" "201750" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"00633" "-" "steroidogenesis, disordered, due to cytochrome P450 oxidoreductase deficiency" "" "613571" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2016-12-17 13:50:16"
"04264" "DMBp" "metabolism, drug, poor" "" "" "" "" "" "00006" "2015-05-14 15:38:48" "00006" "2021-12-11 13:56:28"
"04272" "DMBr" "metabolism, drug, rapid" "" "" "" "" "" "00006" "2015-05-14 16:05:54" "00006" "2021-12-11 13:56:28"
"05597" "DSD" "disorder of sex development (DSD)" "" "" "" "" "" "00006" "2019-04-28 14:45:24" "" ""
"07052" "adrenal hyperplasia" "adrenal hyperplasia" "" "" "" "" "" "00006" "2023-12-24 11:17:16" "00006" "2025-10-31 12:56:23"
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"POR" "00632"
"POR" "00633"
## Individuals ## Do not remove or alter this header ##
## Count = 57
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00091701" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091702" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091703" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091704" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091705" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091706" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091707" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091708" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091709" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091710" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091711" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091712" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091713" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091714" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091715" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091716" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091717" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091718" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091719" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091720" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091721" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091722" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091723" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091724" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091725" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091726" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091727" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091728" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091729" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091730" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091731" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091732" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091733" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091734" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091735" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091736" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091737" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091738" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091739" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091740" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091741" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091742" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091743" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091744" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091745" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091746" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091747" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091748" "" "" "" "1" "" "01294" "" "reference haplotype" "" "" "" "" "0" "" "" "- (not applicable)" ""
"00091783" "" "" "" "1" "" "00006" "{PMID:Huang 2005:15793702}" "" "" "no" "Ireland" "" "0" "" "" "" ""
"00091786" "" "" "" "1" "" "00006" "{PMID:Huang 2005:15793702}" "" "" "no" "Australia" "" "0" "" "" "Laotian, white" ""
"00091788" "" "" "" "1" "" "00006" "{PMID:Huang 2005:15793702}" "" "" "no" "" "" "0" "" "" "white, Moroccan" ""
"00231446" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "" "" "" "" "0" "" "" "" "Pat63"
"00231528" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "" "" "" "" "0" "" "" "" "Pat247"
"00444432" "" "" "" "1" "" "00006" "{PMID:Duan 2023:37586839}" "patient" "" "" "China" "" "0" "" "" "" "Pat44"
"00444433" "" "" "" "1" "" "00006" "{PMID:Duan 2023:37586839}" "patient" "" "" "China" "" "0" "" "" "" "Pat45"
"00444434" "" "" "" "1" "" "00006" "{PMID:Duan 2023:37586839}" "patient" "" "" "China" "" "0" "" "" "" "Pat46"
"00444435" "" "" "" "1" "" "00006" "{PMID:Duan 2023:37586839}" "patient" "" "" "China" "" "0" "" "" "" "Pat47"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 57
"{{individualid}}" "{{diseaseid}}"
"00091701" "00000"
"00091702" "04264"
"00091703" "04264"
"00091704" "04264"
"00091705" "04264"
"00091706" "04264"
"00091707" "04264"
"00091708" "04264"
"00091709" "04264"
"00091710" "04264"
"00091711" "04264"
"00091712" "04264"
"00091713" "04264"
"00091714" "04264"
"00091715" "04264"
"00091716" "04264"
"00091717" "04264"
"00091718" "04264"
"00091719" "04264"
"00091720" "04264"
"00091721" "04264"
"00091722" "04264"
"00091723" "04264"
"00091724" "04264"
"00091725" "00198"
"00091726" "00198"
"00091727" "00198"
"00091728" "04272"
"00091729" "00198"
"00091730" "00198"
"00091731" "04264"
"00091732" "04264"
"00091733" "04264"
"00091734" "04264"
"00091735" "04264"
"00091736" "00198"
"00091737" "00198"
"00091738" "04264"
"00091739" "04264"
"00091740" "04264"
"00091741" "04264"
"00091742" "00198"
"00091743" "00198"
"00091744" "00198"
"00091745" "00198"
"00091746" "00198"
"00091747" "00198"
"00091748" "00198"
"00091783" "00632"
"00091786" "00632"
"00091788" "00632"
"00231446" "05597"
"00231528" "05597"
"00444432" "07052"
"00444433" "07052"
"00444434" "07052"
"00444435" "07052"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00632, 00633, 04264, 04272, 05597, 07052
## Count = 9
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000070613" "00632" "00091783" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" ""
"0000070614" "00632" "00091786" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" ""
"0000070615" "00632" "00091788" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" ""
"0000173837" "05597" "00231446" "00006" "Unknown" "" "disorder of sex development" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173919" "05597" "00231528" "00006" "Unknown" "" "hypospadias" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000333685" "07052" "00444432" "00006" "Familial, autosomal recessive" "" "small penis; skeletal malformation; no hyponatremia; no hyperkalemia; no hypoglycemia; elevated 17OHP" "1d" "" "" "" "" "" "" "" "" "childhood-onset primary adrenal insufficiency" ""
"0000333686" "07052" "00444433" "00006" "Familial, autosomal recessive" "" "clitoral hypertrophy; skeletal malformation; no hyponatremia; no hyperkalemia; no hypoglycemia; elevated 17OHP" "2y" "" "" "" "" "" "" "" "" "childhood-onset primary adrenal insufficiency" ""
"0000333687" "07052" "00444434" "00006" "Familial, autosomal recessive" "" "skeletal malformation; ambiguous external genitalia; no hyponatremia; no hyperkalemia; no hypoglycemia; elevated 17OHP" "1d" "" "" "" "" "" "" "" "" "childhood-onset primary adrenal insufficiency" ""
"0000333688" "07052" "00444435" "00006" "Familial, autosomal recessive" "" "newborn screening for elevated 17OHP; no hyponatremia; hyperkalemia; no hypoglycemia; elevated 17OHP" "1d" "" "" "" "" "" "" "" "" "childhood-onset primary adrenal insufficiency" ""
## Screenings ## Do not remove or alter this header ##
## Count = 57
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000091843" "00091701" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091844" "00091702" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091845" "00091703" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091846" "00091704" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091847" "00091705" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091848" "00091706" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091849" "00091707" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091850" "00091708" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091851" "00091709" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091852" "00091710" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091853" "00091711" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091854" "00091712" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091855" "00091713" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091856" "00091714" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091857" "00091715" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091858" "00091716" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091859" "00091717" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091860" "00091718" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091861" "00091719" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091862" "00091720" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091863" "00091721" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091864" "00091722" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091865" "00091723" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091866" "00091724" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091867" "00091725" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091868" "00091726" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091869" "00091727" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091870" "00091728" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091871" "00091729" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091872" "00091730" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091873" "00091731" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091874" "00091732" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091875" "00091733" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091876" "00091734" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091877" "00091735" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091878" "00091736" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091879" "00091737" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091880" "00091738" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091881" "00091739" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091882" "00091740" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091883" "00091741" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091884" "00091742" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091885" "00091743" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091886" "00091744" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091887" "00091745" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091888" "00091746" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091889" "00091747" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091890" "00091748" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091925" "00091783" "1" "00008" "00008" "2016-12-15 19:35:13" "00006" "2016-12-17 14:01:04" "SEQ" "DNA" "" ""
"0000091928" "00091786" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000091930" "00091788" "1" "00008" "00008" "2016-12-15 19:35:13" "" "" "SEQ" "DNA" "" ""
"0000232545" "00231446" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232627" "00231528" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000446000" "00444432" "1" "00006" "00006" "2023-12-24 11:42:22" "" "" "SEQ-NG" "DNA" "" "WES"
"0000446001" "00444433" "1" "00006" "00006" "2023-12-24 11:42:22" "" "" "PCR;SEQ" "DNA" "" ""
"0000446002" "00444434" "1" "00006" "00006" "2023-12-24 11:42:22" "" "" "SEQ-NG" "DNA" "" "WES"
"0000446003" "00444435" "1" "00006" "00006" "2023-12-24 11:42:22" "" "" "SEQ-NG" "DNA" "" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 59
"{{screeningid}}" "{{geneid}}"
"0000091843" "POR"
"0000091844" "POR"
"0000091845" "POR"
"0000091846" "POR"
"0000091847" "POR"
"0000091848" "POR"
"0000091849" "POR"
"0000091850" "POR"
"0000091851" "POR"
"0000091852" "POR"
"0000091853" "POR"
"0000091854" "POR"
"0000091855" "POR"
"0000091856" "POR"
"0000091857" "POR"
"0000091858" "POR"
"0000091859" "POR"
"0000091860" "POR"
"0000091861" "POR"
"0000091862" "POR"
"0000091863" "POR"
"0000091864" "POR"
"0000091865" "POR"
"0000091866" "POR"
"0000091867" "POR"
"0000091868" "POR"
"0000091869" "POR"
"0000091870" "POR"
"0000091871" "POR"
"0000091872" "POR"
"0000091873" "POR"
"0000091874" "POR"
"0000091875" "POR"
"0000091876" "POR"
"0000091877" "POR"
"0000091878" "POR"
"0000091879" "POR"
"0000091880" "POR"
"0000091881" "POR"
"0000091882" "POR"
"0000091883" "POR"
"0000091884" "POR"
"0000091885" "POR"
"0000091886" "POR"
"0000091887" "POR"
"0000091888" "POR"
"0000091889" "POR"
"0000091890" "POR"
"0000091925" "FGFR1"
"0000091925" "FGFR2"
"0000091925" "POR"
"0000091928" "POR"
"0000091930" "POR"
"0000232545" "POR"
"0000232627" "POR"
"0000446000" "POR"
"0000446001" "POR"
"0000446002" "POR"
"0000446003" "POR"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 295
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000150036" "1" "11" "7" "0" "0" "" "0" "01294" "POR_000000" "g.=" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "" "reference haplotype POR*1" "Germline" "yes" "" "0" "" "" "" "" "benign" ""
"0000150037" "1" "90" "7" "75614497" "75614497" "subst" "4.34292E-5" "01294" "POR_000005" "g.75614497G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31187G>A" "reference haplotype POR*2" "Germline" "" "rs28931608" "0" "" "" "g.75985179G>A" "" "pathogenic" ""
"0000150038" "1" "90" "7" "75610925" "75610925" "subst" "0" "01294" "POR_000041" "g.75610925G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "27615G>A" "reference haplotype POR*3" "Germline" "" "" "0" "" "" "g.75981607G>A" "" "pathogenic" ""
"0000150039" "1" "90" "7" "75614973" "75614973" "subst" "0" "01294" "POR_000013" "g.75614973T>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31663T>A" "reference haplotype POR*4" "Germline" "" "rs28931606" "0" "" "" "g.75985655T>A" "" "pathogenic" ""
"0000150040" "1" "90" "7" "75612866" "75612866" "subst" "0.000239682" "01294" "POR_000047" "g.75612866G>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "29556G>C" "reference haplotype POR*5" "Germline" "" "rs121912974" "0" "" "" "g.75983548G>C" "" "pathogenic" ""
"0000150041" "1" "90" "7" "75615277" "75615277" "subst" "0" "01294" "POR_000024" "g.75615277G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31967G>A" "reference haplotype POR*6" "Germline" "" "rs28931607" "0" "" "" "g.75985959G>A" "" "pathogenic" ""
"0000150042" "1" "90" "7" "75615483" "75615483" "subst" "0" "01294" "POR_000031" "g.75615483G>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "32173G>T" "reference haplotype POR*7" "Germline" "" "rs72552772" "0" "" "" "g.75986165G>T" "" "pathogenic" ""
"0000150043" "1" "90" "7" "75610390" "75610390" "subst" "0" "01294" "POR_000062" "g.75610390T>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "27080T>G" "reference haplotype POR*8" "Germline" "" "rs72552771" "0" "" "" "g.75981072T>G" "" "pathogenic" ""
"0000150044" "1" "90" "7" "75614456" "75614456" "dup" "0" "01294" "POR_000001" "g.75614456dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1329_1330insC, 31146_31147insC" "reference haplotype POR*9" "Germline" "" "" "0" "" "" "g.75985138dup" "" "pathogenic" ""
"0000150045" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*10" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150046" "1" "90" "7" "75615269" "75615269" "dup" "0" "01294" "POR_000023" "g.75615269dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1698_1699insC, 319593_1960insC" "reference haplotype POR*10" "Germline" "" "" "0" "" "" "g.75985951dup" "" "pathogenic" ""
"0000150047" "1" "90" "7" "75608875" "75608875" "subst" "0.000199754" "01294" "POR_000056" "g.75608875C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "25565C>T" "reference haplotype POR*11" "Germline" "" "" "0" "" "" "g.75979557C>T" "" "pathogenic" ""
"0000150048" "1" "90" "7" "75609714" "75609714" "subst" "4.06408E-6" "01294" "POR_000059" "g.75609714A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "26404A>G" "reference haplotype POR*12" "Germline" "" "" "0" "" "" "g.75980396A>G" "" "pathogenic" ""
"0000150049" "1" "90" "7" "75609748" "75609748" "subst" "0" "01294" "POR_000060" "g.75609748A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "26438A>G" "reference haplotype POR*13" "Germline" "" "" "0" "" "" "g.75980430A>G" "" "pathogenic" ""
"0000150050" "1" "90" "7" "75611597" "75611597" "subst" "2.46099E-5" "01294" "POR_000042" "g.75611597A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "28287A>G" "reference haplotype POR*14" "Germline" "" "" "0" "" "" "g.75982279A>G" "" "pathogenic" ""
"0000150051" "1" "90" "7" "75614502" "75614502" "subst" "0" "01294" "POR_000006" "g.75614502T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31192T>C" "reference haplotype POR*15" "Germline" "" "" "0" "" "" "g.75985184T>C" "" "pathogenic" ""
"0000150052" "1" "90" "7" "75615113" "75615113" "subst" "0" "01294" "POR_000017" "g.75615113G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31803G>A" "reference haplotype POR*16" "Germline" "" "rs121912976" "0" "" "" "g.75985795G>A" "" "pathogenic" ""
"0000150053" "1" "90" "7" "75615265" "75615265" "subst" "0" "01294" "POR_000022" "g.75615265T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31955T>C" "reference haplotype POR*17" "Germline" "" "" "0" "" "" "g.75985947T>C" "" "pathogenic" ""
"0000150054" "1" "90" "7" "75615507" "75615507" "subst" "2.04215E-5" "01294" "POR_000033" "g.75615507C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "32197C>T" "reference haplotype POR*18" "Germline" "" "" "0" "" "" "g.75986189C>T" "" "pathogenic" ""
"0000150055" "1" "90" "7" "75615693" "75615695" "del" "0" "01294" "POR_000036" "g.75615693_75615695del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1937_1939delTCT, 32383_32385delTCT" "reference haplotype POR*19" "Germline" "" "" "0" "" "" "g.75986375_75986377del" "" "pathogenic" ""
"0000150056" "1" "90" "7" "75610417" "75610429" "dup" "0" "01294" "POR_000063" "g.75610417_75610429dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "580_581insTACGTGGACAAGC, 27119_27120insTACGTGGACAAGC" "reference haplotype POR*20" "Germline" "" "" "0" "" "" "g.75981099_75981111dup" "" "pathogenic" ""
"0000150057" "1" "90" "7" "75615033" "75615049" "dup" "0" "01294" "POR_000016" "g.75615033_75615049dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1551_1552insTGCCCATGTTCGTGCGC, 31739_31740insTGCCCATGTTCGTGCGC" "reference haplotype POR*21" "Germline" "" "" "0" "" "" "g.75985715_75985731dup" "" "pathogenic" ""
"0000150058" "1" "90" "7" "75615117" "75615118" "ins" "0" "01294" "POR_000018" "g.75615117_75615118insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31807_31808insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "reference haplotype POR*22" "Germline" "" "" "0" "" "" "g.75985799_75985800insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "" "pathogenic" ""
"0000150059" "1" "90" "7" "75615120" "75615120" "dup" "0" "01294" "POR_000019" "g.75615120dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1621_1622insC, 31809_31810insC" "reference haplotype POR*23" "Germline" "" "" "0" "" "" "g.75985802dup" "" "pathogenic" ""
"0000150060" "1" "90" "7" "75614472" "75614475" "dup" "0" "01294" "POR_000003" "g.75614472_75614475dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1348_1349insGAGC, 31165_31166insGAGC" "reference haplotype POR*24" "Germline" "" "" "0" "" "" "g.75985154_75985157dup" "" "pathogenic" ""
"0000150061" "1" "50" "7" "75583457" "75583457" "subst" "4.1175E-5" "01294" "POR_000073" "g.75583457G>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "147G>C" "reference haplotype POR*25" "Germline" "" "rs56355228" "0" "" "" "g.75954139G>C" "" "VUS" ""
"0000150062" "1" "50" "7" "75614385" "75614385" "subst" "0" "01294" "POR_000054" "g.75614385C>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31075C>A" "reference haplotype POR*26" "Germline" "" "" "0" "" "" "g.75985067C>A" "" "VUS" ""
"0000150063" "1" "50" "7" "75615301" "75615301" "subst" "0.000505417" "01294" "POR_000026" "g.75615301T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31991T>C" "reference haplotype POR*27" "Germline" "" "rs56256515" "0" "" "" "g.75985983T>C" "" "VUS" ""
"0000150064" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*28" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150065" "1" "50" "7" "75610420" "75610420" "subst" "0.000317252" "01294" "POR_000064" "g.75610420G>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "27110G>C" "reference haplotype POR*29" "Germline" "" "" "0" "" "" "g.75981102G>C" "" "VUS" ""
"0000150066" "1" "50" "7" "75614466" "75614466" "subst" "0" "01294" "POR_000002" "g.75614466C>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31156C>A" "reference haplotype POR*30" "Germline" "" "" "0" "" "" "g.75985148C>A" "" "VUS" ""
"0000150067" "1" "90" "7" "75610450" "75610450" "subst" "0" "01294" "POR_000066" "g.75610450C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "27140C>T" "reference haplotype POR*31" "Germline" "" "" "0" "" "" "g.75981132C>T" "" "pathogenic" ""
"0000150068" "1" "90" "7" "75614508" "75614513" "dup" "0" "01294" "POR_000007" "g.75614508_75614513dup" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1386insATCGCC, 312003insATCGCC" "reference haplotype POR*32" "Germline" "" "" "0" "" "" "g.75985190_75985195dup" "" "pathogenic" ""
"0000150069" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*32" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150070" "1" "90" "7" "75615496" "75615519" "del" "0" "01294" "POR_000032" "g.75615496_75615519del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "32186_32210delTAAAGCAAGACCGAGAGCACCTGT" "reference haplotype POR*33" "Germline" "" "" "0" "" "" "g.75986178_75986201del" "" "pathogenic" ""
"0000150071" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*33" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150072" "1" "90" "7" "75615304" "75615304" "subst" "0" "01294" "POR_000027" "g.75615304A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31994A>G" "reference haplotype POR*34" "Germline" "" "" "0" "" "" "g.75985986A>G" "" "pathogenic" ""
"0000150073" "1" "90" "7" "75615309" "75615309" "subst" "2.74858E-5" "01294" "POR_000028" "g.75615309G>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31999G>C" "reference haplotype POR*35" "Germline" "" "" "0" "" "" "g.75985991G>C" "" "pathogenic" ""
"0000150074" "1" "50" "7" "75611756" "75611756" "subst" "0" "01294" "POR_000043" "g.75611756C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "830C>T, 28446C>T" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75982438C>T" "" "VUS" ""
"0000150075" "1" "50" "7" "75612803" "75612803" "subst" "0.302473" "01294" "POR_000044" "g.75612803C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "830C>T, 28446C>T" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75983485C>T" "" "VUS" ""
"0000150076" "1" "50" "7" "75614953" "75614953" "subst" "0.921299" "01294" "POR_000012" "g.75614953T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31643T>C" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75985635T>C" "" "VUS" ""
"0000150077" "1" "50" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "VUS" ""
"0000150078" "1" "50" "7" "75616105" "75616105" "subst" "0" "01294" "POR_000039" "g.75616105G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "2349G>A, 32795G>A" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75986787G>A" "" "VUS" ""
"0000150079" "1" "50" "7" "75609033" "75609033" "subst" "0" "01294" "POR_000057" "g.75609033C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "366C>T, 25723C>T" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75979715C>T" "" "VUS" ""
"0000150080" "1" "50" "7" "75601867" "75601867" "subst" "0" "01294" "POR_000069" "g.75601867G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "237G>A, 18557G>A" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75972549G>A" "" "VUS" ""
"0000150081" "1" "50" "7" "75610876" "75610876" "subst" "0.00246275" "01294" "POR_000040" "g.75610876C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "27566C>T" "reference haplotype POR*36" "Germline" "" "" "0" "" "" "g.75981558C>T" "" "VUS" ""
"0000150082" "1" "50" "7" "75614777" "75614777" "subst" "0" "01294" "POR_000009" "g.75614777G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1399G>A, 31467G>A" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75985459G>A" "" "VUS" ""
"0000150083" "1" "50" "7" "75614953" "75614953" "subst" "0.921299" "01294" "POR_000012" "g.75614953T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31643T>C" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75985635T>C" "" "VUS" ""
"0000150084" "1" "50" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "VUS" ""
"0000150085" "1" "50" "7" "75615552" "75615552" "subst" "0.0016508" "01294" "POR_000035" "g.75615552G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "32242G>A" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75986234G>A" "" "VUS" ""
"0000150086" "1" "50" "7" "75616105" "75616105" "subst" "0" "01294" "POR_000039" "g.75616105G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "2349G>A, 32795G>A" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75986787G>A" "" "VUS" ""
"0000150087" "1" "50" "7" "75612803" "75612803" "subst" "0.302473" "01294" "POR_000044" "g.75612803C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "830C>T, 28446C>T" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75983485C>T" "" "VUS" ""
"0000150088" "1" "50" "7" "75611756" "75611756" "subst" "0" "01294" "POR_000043" "g.75611756C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "830C>T, 28446C>T" "reference haplotype POR*37" "Germline" "" "" "0" "" "" "g.75982438C>T" "" "VUS" ""
"0000150089" "1" "90" "7" "75583453" "75583453" "del" "0" "01294" "POR_000072" "g.75583453del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "143delG, 381443delG" "reference haplotype POR*38" "Germline" "" "" "0" "" "" "g.75954135del" "" "pathogenic" ""
"0000150090" "1" "90" "7" "75615163" "75615163" "del" "0" "01294" "POR_000021" "g.75615163del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1665delG, 31853delG" "reference haplotype POR*39" "Germline" "" "" "0" "" "" "g.75985845del" "" "pathogenic" ""
"0000150091" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "01294" "POR_000014" "g.75615006C>T" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "31696C>T" "reference haplotype POR*40" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150092" "1" "90" "7" "75613150" "75613152" "del" "0" "01294" "POR_000050" "g.75613150_75613152del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "1042_1044delGTC, 29840_29842delGTC" "reference haplotype POR*40" "Germline" "" "" "0" "" "" "g.75983832_75983834del" "" "pathogenic" ""
"0000150093" "1" "90" "7" "75583306" "75615168" "del" "0" "01294" "POR_000070" "g.(75544498_75583306)_(75615168_75615240)del" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "deletion exons 2-13" "reference haplotype POR*41" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000150094" "1" "50" "7" "75609677" "75609677" "subst" "0.27453" "01294" "POR_000058" "g.75609677A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "26367G>A" "reference haplotype POR*42" "Germline" "" "" "0" "" "" "g.75980359A>G" "" "VUS" ""
"0000150095" "1" "50" "7" "75614265" "75614265" "subst" "0.000285817" "01294" "POR_000053" "g.75614265G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "30955G>A" "reference haplotype POR*42" "Germline" "" "" "0" "" "" "g.75984947G>A" "" "VUS" ""
"0000150096" "1" "50" "7" "75615731" "75615731" "subst" "2.03774E-5" "01294" "POR_000038" "g.75615731G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "32421G>A" "reference haplotype POR*43" "Germline" "" "" "0" "" "" "g.75986413G>A" "" "VUS" ""
"0000150097" "1" "50" "7" "75609677" "75609677" "subst" "0.27453" "01294" "POR_000058" "g.75609677A>G" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "26367G>A" "reference haplotype POR*43" "Germline" "" "" "0" "" "" "g.75980359A>G" "" "VUS" ""
"0000150098" "1" "50" "7" "75608835" "75608835" "subst" "3.25553E-5" "01294" "POR_000055" "g.75608835T>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "69416T>C" "reference haplotype POR*44" "Germline" "" "" "0" "" "" "g.75979517T>C" "" "VUS" ""
"0000150099" "1" "50" "7" "75609780" "75609780" "subst" "0.000345433" "01294" "POR_000061" "g.75609780G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "70361G>A" "reference haplotype POR*45" "Germline" "" "" "0" "" "" "g.75980462G>A" "" "VUS" ""
"0000150100" "1" "50" "7" "75610420" "75610420" "subst" "0.000226608" "01294" "POR_000065" "g.75610420G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "71001G>A" "reference haplotype POR*46" "Germline" "" "" "0" "" "" "g.75981102G>A" "" "VUS" ""
"0000150101" "1" "50" "7" "75613138" "75613138" "subst" "1.23254E-5" "01294" "POR_000049" "g.75613138G>A" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "73719G>A" "reference haplotype POR*47" "Germline" "" "" "0" "" "" "g.75983820G>A" "" "VUS" ""
"0000150102" "1" "50" "7" "75614221" "75614221" "subst" "0" "01294" "POR_000051" "g.75614221A>C" "" "Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee" "" "74802A>C" "reference haplotype POR*48" "Germline" "" "" "0" "" "" "g.75984903A>C" "" "VUS" ""
"0000150103" "1" "50" "7" "75583468" "75583470" "del" "0" "00006" "POR_000074" "g.75583468_75583470del" "" "{PMID:Huang 2008:18230729}" "" "E53del" "" "Germline" "" "" "0" "" "" "g.75954150_75954152del" "" "VUS" ""
"0000150104" "1" "50" "7" "75583474" "75583474" "subst" "2.49428E-5" "00006" "POR_000075" "g.75583474C>T" "" "{PMID:Huang 2008:18230729}" "" "P55L" "" "Germline" "" "" "0" "" "" "g.75954156C>T" "" "VUS" ""
"0000150105" "1" "50" "7" "75610480" "75610480" "subst" "8.61692E-5" "00006" "POR_000067" "g.75610480G>A" "" "{PMID:Huang 2008:18230729}" "" "D211N" "" "Germline" "" "" "0" "" "" "g.75981162G>A" "" "VUS" ""
"0000150106" "1" "50" "7" "75610487" "75610487" "subst" "0" "00006" "POR_000068" "g.75610487G>A" "" "{PMID:Huang 2008:18230729}" "" "G213E" "" "Germline" "" "" "0" "" "" "g.75981169G>A" "" "VUS" ""
"0000150107" "1" "50" "7" "75612858" "75612858" "subst" "4.87559E-5" "00006" "POR_000046" "g.75612858C>T" "" "{PMID:Huang 2008:18230729}" "" "P284L" "" "Germline" "" "" "0" "" "" "g.75983540C>T" "" "VUS" ""
"0000150108" "1" "50" "7" "75612857" "75612857" "subst" "3.65696E-5" "00006" "POR_000045" "g.75612857C>A" "" "{PMID:Huang 2008:18230729}" "" "P284T" "" "Germline" "" "" "0" "" "" "g.75983539C>A" "" "VUS" ""
"0000150109" "1" "50" "7" "75612905" "75612905" "subst" "0.000714941" "00006" "POR_000048" "g.75612905G>A" "" "{PMID:Huang 2008:18230729}" "" "E300K" "" "Germline" "" "rs11540674" "0" "" "" "g.75983587G>A" "" "VUS" ""
"0000150110" "1" "50" "7" "75614245" "75614245" "subst" "9.10664E-5" "00006" "POR_000052" "g.75614245G>A" "" "{PMID:Huang 2008:18230729}" "" "R406H" "" "Germline" "" "" "0" "" "" "g.75984927G>A" "" "VUS" ""
"0000150111" "1" "50" "7" "75614482" "75614482" "subst" "4.3198E-5" "00006" "POR_000004" "g.75614482C>T" "" "{PMID:Huang 2008:18230729}" "" "P452L" "" "Germline" "" "" "0" "" "" "g.75985164C>T" "" "VUS" ""
"0000150112" "1" "50" "7" "75614511" "75614511" "subst" "3.9671E-5" "00006" "POR_000008" "g.75614511G>A" "" "{PMID:Huang 2008:18230729}" "" "A462T" "" "Germline" "" "" "0" "" "" "g.75985193G>A" "" "VUS" ""
"0000150113" "1" "50" "7" "75614912" "75614912" "subst" "0.000386513" "00006" "POR_000010" "g.75614912G>A" "" "{PMID:Huang 2008:18230729}" "" "V472M" "" "Germline" "" "" "0" "" "" "g.75985594G>A" "" "VUS" ""
"0000150114" "1" "50" "7" "75614951" "75614951" "subst" "9.72069E-5" "00006" "POR_000011" "g.75614951G>A" "" "{PMID:Huang 2008:18230729}" "" "A485T" "" "Germline" "" "" "0" "" "" "g.75985633G>A" "" "VUS" ""
"0000150115" "1" "50" "7" "75615369" "75615369" "subst" "0.0004078" "00006" "POR_000029" "g.75615369C>T" "" "{PMID:Huang 2008:18230729}" "" "R600W" "" "Germline" "" "" "0" "" "" "g.75986051C>T" "" "VUS" ""
"0000150116" "1" "50" "7" "75615481" "75615481" "subst" "0.000107347" "00006" "POR_000030" "g.75615481A>G" "" "{PMID:Huang 2008:18230729}" "" "Y607C" "" "Germline" "" "" "0" "" "" "g.75986163A>G" "" "VUS" ""
"0000150117" "1" "50" "7" "75615544" "75615544" "subst" "0" "00006" "POR_000034" "g.75615544A>C" "" "{PMID:Dhir 2007:17505056}" "" "H628P" "" "Germline" "" "" "0" "" "" "g.75986226A>C" "" "VUS" ""
"0000150118" "1" "50" "7" "75615008" "75615008" "subst" "1.44442E-5" "00006" "POR_000015" "g.75615008G>A" "" "{PMID:Saito 2011:21084761}" "" "G504R" "" "Germline" "" "" "0" "" "" "g.75985690G>A" "" "VUS" ""
"0000150119" "1" "50" "7" "75615146" "75615146" "subst" "0" "00006" "POR_000020" "g.75615146C>T" "" "{PMID:Saito 2011:21084761}" "" "R550W" "" "Germline" "" "" "0" "" "" "g.75985828C>T" "" "VUS" ""
"0000150120" "1" "50" "7" "75615279" "75615279" "subst" "3.57263E-5" "00006" "POR_000025" "g.75615279C>T" "" "{PMID:Saito 2011:21084761}" "" "R570C" "" "Germline" "" "" "0" "" "" "g.75985961C>T" "" "VUS" ""
"0000150121" "1" "50" "7" "75583396" "75583396" "subst" "3.27547E-5" "00006" "POR_000071" "g.75583396C>T" "" "{PMID:Saito 2011:21084761}" "" "T29M" "" "Germline" "" "" "0" "" "" "g.75954078C>T" "" "VUS" ""
"0000150122" "1" "50" "7" "75615698" "75615698" "subst" "5.29484E-5" "00006" "POR_000037" "g.75615698G>A" "" "{PMID:Tomkova 2012:22462747}" "" "D648N" "" "Germline" "" "" "0" "" "" "g.75986380G>A" "" "VUS" ""
"0000150123" "1" "90" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Fluck 2004:14758361}, {PMID:Arlt 2004:15220035}, {PMID:Adachi 2004:15264278}, {PMID:Sandee 2010:20940534}" "" "" "" "Germline" "" "rs28931608" "0" "" "" "g.75985179G>A" "" "pathogenic" ""
"0000150124" "1" "90" "7" "75610925" "75610925" "subst" "0" "00006" "POR_000041" "g.75610925G>A" "" "{PMID:Fluck 2004:14758361}" "" "" "" "Germline" "" "" "0" "" "" "g.75981607G>A" "" "pathogenic" ""
"0000150125" "1" "90" "7" "75614973" "75614973" "subst" "0" "00006" "POR_000013" "g.75614973T>A" "" "{PMID:Fluck 2004:14758361}" "" "" "" "Germline" "" "rs28931606" "0" "" "" "g.75985655T>A" "" "pathogenic" ""
"0000150126" "1" "90" "7" "75612866" "75612866" "subst" "0.000239682" "00006" "POR_000047" "g.75612866G>C" "" "{PMID:Fluck 2004:14758361}, {PMID:Arlt 2004:15220035}, {PMID:Sandee 2010:20940534}" "" "" "" "Germline" "" "rs121912974" "0" "" "" "g.75983548G>C" "" "pathogenic" ""
"0000150127" "1" "90" "7" "75615277" "75615277" "subst" "0" "00006" "POR_000024" "g.75615277G>A" "" "{PMID:Fluck 2004:14758361}, {PMID:Arlt 2004:15220035}" "" "" "" "Germline" "" "rs28931607" "0" "" "" "g.75985959G>A" "" "pathogenic" ""
"0000150128" "1" "90" "7" "75615483" "75615483" "subst" "0" "00006" "POR_000031" "g.75615483G>T" "" "{PMID:Fluck 2004:14758361}" "" "" "" "Germline" "" "rs72552772" "0" "" "" "g.75986165G>T" "" "pathogenic" ""
"0000150129" "1" "90" "7" "75610390" "75610390" "subst" "0" "00006" "POR_000062" "g.75610390T>G" "" "{PMID:Arlt 2004:15220035}" "" "" "" "Germline" "" "rs72552771" "0" "" "" "g.75981072T>G" "" "pathogenic" ""
"0000150130" "1" "90" "7" "75614456" "75614456" "dup" "0" "00006" "POR_000001" "g.75614456dup" "" "{PMID:Adachi 2004:15264278}" "" "" "" "Germline" "" "" "0" "" "" "g.75985138dup" "" "pathogenic" ""
"0000150131" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Adachi 2004:15264278}, {PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150132" "1" "90" "7" "75615269" "75615269" "dup" "0" "00006" "POR_000023" "g.75615269dup" "" "{PMID:Adachi 2004:15264278}" "" "" "" "Germline" "" "" "0" "" "" "g.75985951dup" "" "pathogenic" ""
"0000150133" "1" "90" "7" "75608875" "75608875" "subst" "0.000199754" "00006" "POR_000056" "g.75608875C>T" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75979557C>T" "" "pathogenic" ""
"0000150134" "1" "90" "7" "75609714" "75609714" "subst" "4.06408E-6" "00006" "POR_000059" "g.75609714A>G" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75980396A>G" "" "pathogenic" ""
"0000150135" "1" "90" "7" "75609748" "75609748" "subst" "0" "00006" "POR_000060" "g.75609748A>G" "" "{PMID:Huang 2005:15793702}, {PMID:Sandee 2010:20940534}" "" "" "" "Germline" "" "" "0" "" "" "g.75980430A>G" "" "pathogenic" ""
"0000150136" "1" "90" "7" "75611597" "75611597" "subst" "2.46099E-5" "00006" "POR_000042" "g.75611597A>G" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75982279A>G" "" "pathogenic" ""
"0000150137" "1" "90" "7" "75614502" "75614502" "subst" "0" "00006" "POR_000006" "g.75614502T>C" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75985184T>C" "" "pathogenic" ""
"0000150138" "1" "90" "7" "75615113" "75615113" "subst" "0" "00006" "POR_000017" "g.75615113G>A" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "rs121912976" "0" "" "" "g.75985795G>A" "" "pathogenic" ""
"0000150139" "1" "90" "7" "75615265" "75615265" "subst" "0" "00006" "POR_000022" "g.75615265T>C" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75985947T>C" "" "pathogenic" ""
"0000150140" "1" "90" "7" "75615507" "75615507" "subst" "2.04215E-5" "00006" "POR_000033" "g.75615507C>T" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75986189C>T" "" "pathogenic" ""
"0000150141" "1" "90" "7" "75615693" "75615695" "del" "0" "00006" "POR_000036" "g.75615693_75615695del" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75986375_75986377del" "" "pathogenic" ""
"0000150142" "1" "90" "7" "75610417" "75610429" "dup" "0" "00006" "POR_000063" "g.75610417_75610429dup" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75981099_75981111dup" "" "pathogenic" ""
"0000150143" "2" "90" "7" "75615033" "75615049" "dup" "0" "00006" "POR_000016" "g.75615033_75615049dup" "" "{PMID:Huang 2005:15793702}" "" "1551-1552insTGCCCATGTTCGTGCGC" "" "Germline" "" "" "0" "" "" "g.75985715_75985731dup" "" "pathogenic" ""
"0000150144" "1" "90" "7" "75615117" "75615118" "ins" "0" "00006" "POR_000018" "g.75615117_75615118insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75985799_75985800insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "" "pathogenic" ""
"0000150145" "1" "90" "7" "75615120" "75615120" "dup" "0" "00006" "POR_000019" "g.75615120dup" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75985802dup" "" "pathogenic" ""
"0000150146" "1" "90" "7" "75614472" "75614475" "dup" "0" "00006" "POR_000003" "g.75614472_75614475dup" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75985154_75985157dup" "" "pathogenic" ""
"0000150147" "1" "50" "7" "75583457" "75583457" "subst" "4.1175E-5" "00006" "POR_000073" "g.75583457G>C" "" "{PMID:Hart 2007:17827787}" "" "" "" "Germline" "" "rs56355228" "0" "" "" "g.75954139G>C" "" "VUS" ""
"0000150148" "1" "50" "7" "75614385" "75614385" "subst" "0" "00006" "POR_000054" "g.75614385C>A" "" "{PMID:Hart 2007:17827787}" "" "" "" "Germline" "" "" "0" "" "" "g.75985067C>A" "" "VUS" ""
"0000150149" "1" "50" "7" "75615301" "75615301" "subst" "0.000505417" "00006" "POR_000026" "g.75615301T>C" "" "{PMID:Hart 2007:17827787}, {PMID:Hart 2008:18216718}" "" "" "" "Germline" "" "rs56256515" "0" "" "" "g.75985983T>C" "" "VUS" ""
"0000150150" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Huang 2005:15793702}, {PMID:Fukami 2005:15483095}, {PMID:Oneda 2009:19801957}, {PMID:Sandee 2010:20940534}, {PMID:de Jonge 2011:21770725}" "" "" "" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150151" "1" "50" "7" "75610420" "75610420" "subst" "0.000317252" "00006" "POR_000064" "g.75610420G>C" "" "{PMID:Haiman 2007:17440066}" "" "" "" "Germline" "" "" "0" "" "" "g.75981102G>C" "" "VUS" ""
"0000150152" "1" "50" "7" "75614466" "75614466" "subst" "0" "00006" "POR_000002" "g.75614466C>A" "" "{PMID:Haiman 2007:17440066}" "" "" "" "Germline" "" "" "0" "" "" "g.75985148C>A" "" "VUS" ""
"0000150153" "1" "90" "7" "75610450" "75610450" "subst" "0" "00006" "POR_000066" "g.75610450C>T" "" "{PMID:Homma 2006:16608896}" "" "" "" "Germline" "" "" "0" "" "" "g.75981132C>T" "" "pathogenic" ""
"0000150154" "1" "90" "7" "75614508" "75614513" "dup" "0" "00006" "POR_000007" "g.75614508_75614513dup" "" "{PMID:Homma 2006:16608896}, {PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "g.75985190_75985195dup" "" "pathogenic" ""
"0000150155" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Homma 2006:16608896}" "" "" "" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150156" "1" "90" "7" "75615496" "75615519" "del" "0" "00006" "POR_000032" "g.75615496_75615519del" "" "{PMID:Fukami 2005:15483095}" "" "" "" "Germline" "" "" "0" "" "" "g.75986178_75986201del" "" "pathogenic" ""
"0000150157" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Fukami 2005:15483095}" "" "" "" "Germline" "" "rs1057868" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150158" "1" "90" "7" "75615304" "75615304" "subst" "0" "00006" "POR_000027" "g.75615304A>G" "" "{PMID:Fukami 2005:15483095}" "" "" "" "Germline" "" "" "0" "" "" "g.75985986A>G" "" "pathogenic" ""
"0000150159" "1" "90" "7" "75615309" "75615309" "subst" "2.74858E-5" "00006" "POR_000028" "g.75615309G>C" "" "{PMID:Homma 2006:16608896}" "" "" "" "Germline" "" "" "0" "" "" "g.75985991G>C" "" "pathogenic" ""
"0000150160" "1" "50" "7" "75611756" "75611756" "subst" "0" "00006" "POR_000043" "g.75611756C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75982438C>T" "" "VUS" ""
"0000150161" "1" "50" "7" "75612803" "75612803" "subst" "0.302473" "00006" "POR_000044" "g.75612803C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75983485C>T" "" "VUS" ""
"0000150162" "1" "50" "7" "75614953" "75614953" "subst" "0.921299" "00006" "POR_000012" "g.75614953T>C" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75985635T>C" "" "VUS" ""
"0000150163" "1" "50" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "VUS" ""
"0000150164" "1" "50" "7" "75616105" "75616105" "subst" "0" "00006" "POR_000039" "g.75616105G>A" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75986787G>A" "" "VUS" ""
"0000150165" "1" "50" "7" "75609033" "75609033" "subst" "0" "00006" "POR_000057" "g.75609033C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75979715C>T" "" "VUS" ""
"0000150166" "1" "50" "7" "75601867" "75601867" "subst" "0" "00006" "POR_000069" "g.75601867G>A" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75972549G>A" "" "VUS" ""
"0000150167" "1" "50" "7" "75610876" "75610876" "subst" "0.00246275" "00006" "POR_000040" "g.75610876C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75981558C>T" "" "VUS" ""
"0000150168" "1" "50" "7" "75614777" "75614777" "subst" "0" "00006" "POR_000009" "g.75614777G>A" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75985459G>A" "" "VUS" ""
"0000150169" "1" "50" "7" "75614953" "75614953" "subst" "0.921299" "00006" "POR_000012" "g.75614953T>C" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75985635T>C" "" "VUS" ""
"0000150170" "1" "50" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "VUS" ""
"0000150171" "1" "50" "7" "75615552" "75615552" "subst" "0.0016508" "00006" "POR_000035" "g.75615552G>A" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75986234G>A" "" "VUS" ""
"0000150172" "1" "50" "7" "75616105" "75616105" "subst" "0" "00006" "POR_000039" "g.75616105G>A" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75986787G>A" "" "VUS" ""
"0000150173" "1" "50" "7" "75612803" "75612803" "subst" "0.302473" "00006" "POR_000044" "g.75612803C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75983485C>T" "" "VUS" ""
"0000150174" "1" "50" "7" "75611756" "75611756" "subst" "0" "00006" "POR_000043" "g.75611756C>T" "" "{PMID:Gomes 2009:19374516}" "" "" "" "Germline" "" "" "0" "" "" "g.75982438C>T" "" "VUS" ""
"0000150175" "1" "90" "7" "75583453" "75583453" "del" "0" "00006" "POR_000072" "g.75583453del" "" "{PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "g.75954135del" "" "pathogenic" ""
"0000150176" "1" "90" "7" "75615163" "75615163" "del" "0" "00006" "POR_000021" "g.75615163del" "" "{PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "g.75985845del" "" "pathogenic" ""
"0000150177" "1" "90" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "g.75985688C>T" "" "pathogenic" ""
"0000150178" "1" "90" "7" "75613150" "75613152" "del" "0" "00006" "POR_000050" "g.75613150_75613152del" "" "{PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "g.75983832_75983834del" "" "pathogenic" ""
"0000150179" "1" "90" "7" "75583306" "75615168" "del" "0" "00006" "POR_000070" "g.(75544498_75583306)_(75615168_75615240)del" "" "{PMID:Fukami 2009:19258400}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000150180" "1" "50" "7" "75609677" "75609677" "subst" "0.27453" "00006" "POR_000058" "g.75609677A>G" "" "{PMID:Saito 2011:21084761}" "" "" "" "Germline" "" "" "0" "" "" "g.75980359A>G" "" "VUS" ""
"0000150181" "1" "50" "7" "75614265" "75614265" "subst" "0.000285817" "00006" "POR_000053" "g.75614265G>A" "" "{PMID:Saito 2011:21084761}" "" "" "" "Germline" "" "" "0" "" "" "g.75984947G>A" "" "VUS" ""
"0000150182" "1" "50" "7" "75615731" "75615731" "subst" "2.03774E-5" "00006" "POR_000038" "g.75615731G>A" "" "{PMID:Saito 2011:21084761}" "" "" "" "Germline" "" "" "0" "" "" "g.75986413G>A" "" "VUS" ""
"0000150183" "1" "50" "7" "75609677" "75609677" "subst" "0.27453" "00006" "POR_000058" "g.75609677A>G" "" "{PMID:Saito 2011:21084761}" "" "" "" "Germline" "" "" "0" "" "" "g.75980359A>G" "" "VUS" ""
"0000150184" "1" "50" "7" "75608835" "75608835" "subst" "3.25553E-5" "00006" "POR_000055" "g.75608835T>C" "" "{PMID:Tomkova 2012:22462747}" "" "" "" "Germline" "" "" "0" "" "" "g.75979517T>C" "" "VUS" ""
"0000150185" "1" "50" "7" "75609780" "75609780" "subst" "0.000345433" "00006" "POR_000061" "g.75609780G>A" "" "{PMID:Tomkova 2012:22462747}" "" "" "" "Germline" "" "" "0" "" "" "g.75980462G>A" "" "VUS" ""
"0000150186" "1" "50" "7" "75610420" "75610420" "subst" "0.000226608" "00006" "POR_000065" "g.75610420G>A" "" "{PMID:Tomkova 2012:22462747}" "" "" "" "Germline" "" "" "0" "" "" "g.75981102G>A" "" "VUS" ""
"0000150187" "1" "50" "7" "75613138" "75613138" "subst" "1.23254E-5" "00006" "POR_000049" "g.75613138G>A" "" "{PMID:Tomkova 2012:22462747}" "" "" "" "Germline" "" "" "0" "" "" "g.75983820G>A" "" "VUS" ""
"0000150188" "1" "50" "7" "75614221" "75614221" "subst" "0" "00006" "POR_000051" "g.75614221A>C" "" "{PMID:Tomkova 2012:22462747}" "" "" "" "Germline" "" "" "0" "" "" "g.75984903A>C" "" "VUS" ""
"0000150697" "0" "70" "7" "75608875" "75608875" "subst" "0.000199754" "00006" "POR_000056" "g.75608875C>T" "" "{PMID:Huang 2005:15793702}" "" "A115V" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.63, NADPH oxidation 0.41" "In vitro (cloned)" "" "" "0" "" "" "g.75979557C>T" "" "NA" ""
"0000150698" "0" "70" "7" "75609714" "75609714" "subst" "4.06408E-6" "00006" "POR_000059" "g.75609714A>G" "" "{PMID:Huang 2005:15793702}" "" "T142A" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.49, NADPH oxidation 0.52" "In vitro (cloned)" "" "" "0" "" "" "g.75980396A>G" "" "NA" ""
"0000150699" "0" "90" "7" "75609748" "75609748" "subst" "0" "00006" "POR_000060" "g.75609748A>G" "" "{PMID:Huang 2005:15793702}" "" "Q153R" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.09, NADPH oxidation 0.11" "In vitro (cloned)" "" "" "0" "" "" "g.75980430A>G" "" "NA" ""
"0000150700" "0" "90" "7" "75610390" "75610390" "subst" "0" "00006" "POR_000062" "g.75610390T>G" "" "{PMID:Huang 2005:15793702}" "" "Y181D" "cDNA expression cloning in bacteria showed defective cytochrome C reduction/NADPH oxidation" "In vitro (cloned)" "" "" "0" "" "" "g.75981072T>G" "" "NA" ""
"0000150701" "0" "30" "7" "75610876" "75610876" "subst" "0.00246275" "00006" "POR_000040" "g.75610876C>T" "" "{PMID:Huang 2005:15793702}" "" "P228L" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.75, NADPH oxidation 0.72" "In vitro (cloned)" "" "" "0" "" "" "g.75981558C>T" "" "NA" ""
"0000150702" "0" "70" "7" "75611597" "75611597" "subst" "2.46099E-5" "00006" "POR_000042" "g.75611597A>G" "" "{PMID:Huang 2005:15793702}" "" "M263V" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.76, NADPH oxidation 0.57" "In vitro (cloned)" "" "" "0" "" "" "g.75982279A>G" "" "NA" ""
"0000150703" "0" "90" "7" "75612866" "75612866" "subst" "0.000239682" "00006" "POR_000047" "g.75612866G>C" "" "{PMID:Huang 2005:15793702}" "" "A287P" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.09, NADPH oxidation 0.16" "In vitro (cloned)" "" "" "0" "" "" "g.75983548G>C" "" "NA" ""
"0000150704" "0" "30" "7" "75612953" "75612953" "subst" "4.0655E-6" "00006" "POR_000076" "g.75612953A>T" "" "{PMID:Huang 2005:15793702}" "" "R316W" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.61, NADPH oxidation 0.77" "In vitro (cloned)" "" "" "0" "" "" "g.75983635A>T" "" "NA" ""
"0000150705" "0" "30" "7" "75614265" "75614265" "subst" "0.000285817" "00006" "POR_000053" "g.75614265G>A" "" "{PMID:Huang 2005:15793702}" "" "G413S" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.76, NADPH oxidation 1.00" "In vitro (cloned)" "" "" "0" "" "" "g.75984947G>A" "" "NA" ""
"0000150706" "0" "90" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Huang 2005:15793702}" "" "R457H" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.007, defective NADPH oxidation" "In vitro (cloned)" "" "" "0" "" "" "g.75985179G>A" "" "NA" ""
"0000150707" "0" "90" "7" "75614502" "75614502" "subst" "0" "00006" "POR_000006" "g.75614502T>C" "" "{PMID:Huang 2005:15793702}" "" "Y459H" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.004, defective NADPH oxidation" "In vitro (cloned)" "" "" "0" "" "" "g.75985184T>C" "" "NA" ""
"0000150708" "0" "90" "7" "75614973" "75614973" "subst" "0" "00006" "POR_000013" "g.75614973T>A" "" "{PMID:Huang 2005:15793702}" "" "V492E" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.003, defective NADPH oxidation" "In vitro (cloned)" "" "" "0" "" "" "g.75985655T>A" "" "NA" ""
"0000150709" "0" "50" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Huang 2005:15793702}" "" "A503V" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.69, NADPH oxidation 0.86" "In vitro (cloned)" "" "" "0" "" "" "g.75985688C>T" "" "NA" ""
"0000150710" "0" "70" "7" "75615008" "75615008" "subst" "1.44442E-5" "00006" "POR_000015" "g.75615008G>A" "" "{PMID:Huang 2005:15793702}" "" "G504R" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.53, NADPH oxidation 0.47" "In vitro (cloned)" "" "" "0" "" "" "g.75985690G>A" "" "NA" ""
"0000150711" "0" "90" "7" "75615113" "75615113" "subst" "0" "00006" "POR_000017" "g.75615113G>A" "" "{PMID:Huang 2005:15793702}" "" "G539R" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.09, NADPH oxidation 0.002" "In vitro (cloned)" "" "" "0" "" "" "g.75985795G>A" "" "NA" ""
"0000150712" "0" "90" "7" "75615265" "75615265" "subst" "0" "00006" "POR_000022" "g.75615265T>C" "" "{PMID:Huang 2005:15793702}" "" "L565P" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.14, NADPH oxidation 0.014" "In vitro (cloned)" "" "" "0" "" "" "g.75985947T>C" "" "NA" ""
"0000150713" "0" "90" "7" "75615277" "75615277" "subst" "0" "00006" "POR_000024" "g.75615277G>A" "" "{PMID:Huang 2005:15793702}" "" "C569Y" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.06, NADPH oxidation 0.02" "In vitro (cloned)" "" "" "0" "" "" "g.75985959G>A" "" "NA" ""
"0000150714" "0" "90" "7" "75615483" "75615483" "subst" "0" "00006" "POR_000031" "g.75615483G>T" "" "{PMID:Huang 2005:15793702}" "" "V608F" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.08, NADPH oxidation 0.03" "In vitro (cloned)" "" "" "0" "" "" "g.75986165G>T" "" "NA" ""
"0000150715" "0" "90" "7" "75615507" "75615507" "subst" "2.04215E-5" "00006" "POR_000033" "g.75615507C>T" "" "{PMID:Huang 2005:15793702}" "" "R616X" "cDNA expression cloning in bacteria showed defective cytochrome C reduction/NADPH oxidation" "In vitro (cloned)" "" "" "0" "" "" "g.75986189C>T" "" "NA" ""
"0000150716" "0" "70" "7" "75615552" "75615552" "subst" "0.0016508" "00006" "POR_000035" "g.75615552G>A" "" "{PMID:Huang 2005:15793702}" "" "V631I" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.74, NADPH oxidation 0.23" "In vitro (cloned)" "" "" "0" "" "" "g.75986234G>A" "" "NA" ""
"0000150717" "0" "50" "7" "75615693" "75615695" "del" "0" "00006" "POR_000036" "g.75615693_75615695del" "" "{PMID:Huang 2005:15793702}" "" "F646del" "cDNA expression cloning in bacteria showed cytochrome C reduction 0.36, NADPH oxidation 0.94" "In vitro (cloned)" "" "" "0" "" "" "g.75986375_75986377del" "" "NA" ""
"0000150718" "0" "70" "7" "75608875" "75608875" "subst" "0.000199754" "00006" "POR_000056" "g.75608875C>T" "" "{PMID:Huang 2005:15793702}" "" "A115V" "in vitro assay showed 17a-hydroxylase activity support 0.80, 17,20-lyase (P450c17) support 0.71" "In vitro (cloned)" "" "" "0" "" "" "g.75979557C>T" "" "NA" ""
"0000150719" "0" "70" "7" "75609714" "75609714" "subst" "4.06408E-6" "00006" "POR_000059" "g.75609714A>G" "" "{PMID:Huang 2005:15793702}" "" "T142A" "in vitro assay showed 17a-hydroxylase activity support 0.60, 17,20-lyase (P450c17) support 0.54" "In vitro (cloned)" "" "" "0" "" "" "g.75980396A>G" "" "NA" ""
"0000150720" "0" "90" "7" "75609748" "75609748" "subst" "0" "00006" "POR_000060" "g.75609748A>G" "" "{PMID:Huang 2005:15793702}" "" "Q153R" "in vitro assay showed 17a-hydroxylase activity support 0.31, 17,20-lyase (P450c17) support 0.27" "In vitro (cloned)" "" "" "0" "" "" "g.75980430A>G" "" "NA" ""
"0000150721" "0" "90" "7" "75610390" "75610390" "subst" "0" "00006" "POR_000062" "g.75610390T>G" "" "{PMID:Huang 2005:15793702}" "" "Y181D" "in vitro assay showed defective 17a-hydroxylase/17,20-lyase (P450c17) activity support" "In vitro (cloned)" "" "" "0" "" "" "g.75981072T>G" "" "NA" ""
"0000150722" "0" "30" "7" "75610876" "75610876" "subst" "0.00246275" "00006" "POR_000040" "g.75610876C>T" "" "{PMID:Huang 2005:15793702}" "" "P228L" "in vitro assay showed 17a-hydroxylase activity support 1.00, 17,20-lyase (P450c17) support 0.41" "In vitro (cloned)" "" "" "0" "" "" "g.75981558C>T" "" "NA" ""
"0000150723" "0" "90" "7" "75611597" "75611597" "subst" "2.46099E-5" "00006" "POR_000042" "g.75611597A>G" "" "{PMID:Huang 2005:15793702}" "" "M263V" "in vitro assay showed 17a-hydroxylase activity support 0.09, 17,20-lyase (P450c17) support 0.13" "In vitro (cloned)" "" "" "0" "" "" "g.75982279A>G" "" "NA" ""
"0000150724" "0" "90" "7" "75612866" "75612866" "subst" "0.000239682" "00006" "POR_000047" "g.75612866G>C" "" "{PMID:Huang 2005:15793702}" "" "A287P" "in vitro assay showed 17a-hydroxylase activity support 0.40, 17,20-lyase (P450c17) support 0.21" "In vitro (cloned)" "" "" "0" "" "" "g.75983548G>C" "" "NA" ""
"0000150725" "0" "30" "7" "75612953" "75612953" "subst" "4.0655E-6" "00006" "POR_000076" "g.75612953A>T" "" "{PMID:Huang 2005:15793702}" "" "R316W" "in vitro assay showed 17a-hydroxylase activity support 0.94, 17,20-lyase (P450c17) support 1.41" "In vitro (cloned)" "" "" "0" "" "" "g.75983635A>T" "" "NA" ""
"0000150726" "0" "30" "7" "75614265" "75614265" "subst" "0.000285817" "00006" "POR_000053" "g.75614265G>A" "" "{PMID:Huang 2005:15793702}" "" "G413S" "in vitro assay showed 17a-hydroxylase activity support 0.83, 17,20-lyase (P450c17) support 1.10" "In vitro (cloned)" "" "" "0" "" "" "g.75984947G>A" "" "NA" ""
"0000150727" "0" "90" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Huang 2005:15793702}" "" "R457H" "in vitro assay showed defective 17a-hydroxylase/17,20-lyase (P450c17) activity support" "In vitro (cloned)" "" "" "0" "" "" "g.75985179G>A" "" "NA" ""
"0000150728" "0" "90" "7" "75614502" "75614502" "subst" "0" "00006" "POR_000006" "g.75614502T>C" "" "{PMID:Huang 2005:15793702}" "" "Y459H" "in vitro assay showed defective 17a-hydroxylase/17,20-lyase (P450c17) activity support" "In vitro (cloned)" "" "" "0" "" "" "g.75985184T>C" "" "NA" ""
"0000150729" "0" "90" "7" "75614973" "75614973" "subst" "0" "00006" "POR_000013" "g.75614973T>A" "" "{PMID:Huang 2005:15793702}" "" "V492E" "in vitro assay showed defective 17a-hydroxylase/17,20-lyase (P450c17) activity support" "In vitro (cloned)" "" "" "0" "" "" "g.75985655T>A" "" "NA" ""
"0000150730" "0" "30" "7" "75615006" "75615006" "subst" "0.305407" "00006" "POR_000014" "g.75615006C>T" "" "{PMID:Huang 2005:15793702}" "" "A503V" "in vitro assay showed 17a-hydroxylase activity support 0.60, 17,20-lyase (P450c17) support 0.56" "In vitro (cloned)" "" "" "0" "" "" "g.75985688C>T" "" "NA" ""
"0000150731" "0" "30" "7" "75615008" "75615008" "subst" "1.44442E-5" "00006" "POR_000015" "g.75615008G>A" "" "{PMID:Huang 2005:15793702}" "" "G504R" "in vitro assay showed 17a-hydroxylase activity support 0.91, 17,20-lyase (P450c17) support 1.03" "In vitro (cloned)" "" "" "0" "" "" "g.75985690G>A" "" "NA" ""
"0000150732" "0" "90" "7" "75615113" "75615113" "subst" "0" "00006" "POR_000017" "g.75615113G>A" "" "{PMID:Huang 2005:15793702}" "" "G539R" "in vitro assay showed 17a-hydroxylase activity support 0.46, 17,20-lyase (P450c17) support 0.08" "In vitro (cloned)" "" "" "0" "" "" "g.75985795G>A" "" "NA" ""
"0000150733" "0" "90" "7" "75615265" "75615265" "subst" "0" "00006" "POR_000022" "g.75615265T>C" "" "{PMID:Huang 2005:15793702}" "" "L565P" "in vitro assay showed 17a-hydroxylase activity support 0.32, 17,20-lyase (P450c17) support 0.19" "In vitro (cloned)" "" "" "0" "" "" "g.75985947T>C" "" "NA" ""
"0000150734" "0" "90" "7" "75615277" "75615277" "subst" "0" "00006" "POR_000024" "g.75615277G>A" "" "{PMID:Huang 2005:15793702}" "" "C569Y" "in vitro assay showed 17a-hydroxylase activity support 0.28, 17,20-lyase (P450c17) support 0.13" "In vitro (cloned)" "" "" "0" "" "" "g.75985959G>A" "" "NA" ""
"0000150735" "0" "70" "7" "75615483" "75615483" "subst" "0" "00006" "POR_000031" "g.75615483G>T" "" "{PMID:Huang 2005:15793702}" "" "V608F" "in vitro assay showed 17a-hydroxylase activity support 0.80, 17,20-lyase (P450c17) support 0.57" "In vitro (cloned)" "" "" "0" "" "" "g.75986165G>T" "" "NA" ""
"0000150736" "0" "90" "7" "75615507" "75615507" "subst" "2.04215E-5" "00006" "POR_000033" "g.75615507C>T" "" "{PMID:Huang 2005:15793702}" "" "R616X" "in vitro assay showed defective 17a-hydroxylase/17,20-lyase (P450c17) activity support" "In vitro (cloned)" "" "" "0" "" "" "g.75986189C>T" "" "NA" ""
"0000150737" "0" "70" "7" "75615552" "75615552" "subst" "0.0016508" "00006" "POR_000035" "g.75615552G>A" "" "{PMID:Huang 2005:15793702}" "" "V631I" "in vitro assay showed 17a-hydroxylase activity support 0.51, 17,20-lyase (P450c17) support 0.40" "In vitro (cloned)" "" "" "0" "" "" "g.75986234G>A" "" "NA" ""
"0000150738" "0" "50" "7" "75615693" "75615695" "del" "0" "00006" "POR_000036" "g.75615693_75615695del" "" "{PMID:Huang 2005:15793702}" "" "F646del" "in vitro assay showed 17a-hydroxylase activity support 0.97, 17,20-lyase (P450c17) support 0.46" "In vitro (cloned)" "" "" "0" "" "" "g.75986375_75986377del" "" "NA" ""
"0000150739" "2" "90" "7" "75610417" "75610429" "dup" "0" "00006" "POR_000063" "g.75610417_75610429dup" "" "{PMID:Huang 2005:15793702}" "" "580-581insTACGTGGACAAGC" "" "Germline" "" "" "0" "" "" "g.75981099_75981111dup" "" "pathogenic" ""
"0000150741" "2" "90" "7" "75612866" "75612866" "subst" "0.000239682" "00006" "POR_000047" "g.75612866G>C" "" "{PMID:Huang 2005:15793702}" "" "A287P" "" "Germline" "" "" "0" "" "" "g.75983548G>C" "" "pathogenic" ""
"0000150742" "1" "90" "7" "75612866" "75612866" "subst" "0.000239682" "00006" "POR_000047" "g.75612866G>C" "" "{PMID:Huang 2005:15793702}" "" "" "" "Germline" "" "" "0" "" "" "g.75983548G>C" "" "pathogenic" ""
"0000248595" "0" "10" "7" "75609677" "75609677" "subst" "0.27453" "02325" "POR_000058" "g.75609677A>G" "" "" "" "POR(NM_001382658.3):c.378A>G (p.P126=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75980359A>G" "" "benign" ""
"0000297273" "0" "10" "7" "75614082" "75614082" "subst" "0.911665" "02325" "POR_000081" "g.75614082C>G" "" "" "" "POR(NM_001382658.3):c.1058-13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984764C>G" "" "benign" ""
"0000297274" "0" "10" "7" "75614288" "75614288" "subst" "0.310496" "02325" "POR_000083" "g.75614288C>T" "" "" "" "POR(NM_001382658.3):c.1239+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984970C>T" "" "benign" ""
"0000297275" "0" "10" "7" "75614296" "75614296" "subst" "0.307413" "02325" "POR_000084" "g.75614296G>A" "" "" "" "POR(NM_001382658.3):c.1239+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984978G>A" "" "benign" ""
"0000297276" "0" "10" "7" "75614953" "75614953" "subst" "0.921299" "02325" "POR_000012" "g.75614953T>C" "" "" "" "POR(NM_001382658.3):c.1446T>C (p.A482=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75985635T>C" "" "benign" ""
"0000297277" "0" "10" "7" "75615287" "75615287" "subst" "0.279358" "02325" "POR_000085" "g.75615287G>A" "" "" "" "POR(NM_001382658.3):c.1707G>A (p.S569=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75985969G>A" "" "benign" ""
"0000301145" "0" "10" "7" "75615394" "75615394" "subst" "0.000620485" "02326" "POR_000087" "g.75615394G>A" "" "" "" "POR(NM_000941.2):c.1815+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75986076G>A" "" "benign" ""
"0000306208" "0" "50" "7" "75614218" "75614218" "subst" "0.000102444" "01943" "POR_000082" "g.75614218C>T" "" "" "" "POR(NM_000941.2):c.1190C>T (p.S397L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984900C>T" "" "VUS" ""
"0000306209" "0" "30" "7" "75615356" "75615356" "subst" "9.89572E-5" "01943" "POR_000086" "g.75615356C>T" "" "" "" "POR(NM_001367562.1):c.1785C>T (p.N595=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75986038C>T" "" "likely benign" ""
"0000306210" "0" "30" "7" "75615394" "75615394" "subst" "0.000620485" "01943" "POR_000087" "g.75615394G>A" "" "" "" "POR(NM_000941.2):c.1815+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75986076G>A" "" "likely benign" ""
"0000306211" "0" "10" "7" "75609659" "75609659" "subst" "0.00185974" "01943" "POR_000077" "g.75609659C>T" "" "" "" "POR(NM_000941.2):c.369C>T (p.A123=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75980341C>T" "" "benign" ""
"0000306212" "0" "30" "7" "75610880" "75610880" "subst" "0.000570743" "01943" "POR_000079" "g.75610880C>T" "" "" "" "POR(NM_001367562.1):c.687C>T (p.A229=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75981562C>T" "" "likely benign" ""
"0000331630" "0" "30" "7" "75610362" "75610362" "subst" "0.00158013" "01804" "POR_000078" "g.75610362G>A" "" "" "" "POR(NM_000941.2):c.517-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75981044G>A" "" "likely benign" ""
"0000331631" "0" "50" "7" "75612885" "75612885" "subst" "2.4373E-5" "01804" "POR_000080" "g.75612885G>A" "" "" "" "POR(NM_000941.2):c.878G>A (p.(Arg293Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75983567G>A" "" "VUS" ""
"0000338702" "0" "10" "7" "75544455" "75544455" "subst" "0" "02327" "POR_000088" "g.75544455A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75915137A>C" "" "benign" ""
"0000338703" "0" "10" "7" "75614082" "75614082" "subst" "0.911665" "02327" "POR_000081" "g.75614082C>G" "" "" "" "POR(NM_001382658.3):c.1058-13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984764C>G" "" "benign" ""
"0000338704" "0" "10" "7" "75614288" "75614288" "subst" "0.310496" "02327" "POR_000083" "g.75614288C>T" "" "" "" "POR(NM_001382658.3):c.1239+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984970C>T" "" "benign" ""
"0000338705" "0" "10" "7" "75614296" "75614296" "subst" "0.307413" "02327" "POR_000084" "g.75614296G>A" "" "" "" "POR(NM_001382658.3):c.1239+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75984978G>A" "" "benign" ""
"0000340433" "0" "10" "7" "75609677" "75609677" "subst" "0.27453" "02327" "POR_000058" "g.75609677A>G" "" "" "" "POR(NM_001382658.3):c.378A>G (p.P126=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75980359A>G" "" "benign" ""
"0000340434" "0" "30" "7" "75613092" "75613092" "subst" "0.00117131" "02327" "POR_000090" "g.75613092C>T" "" "" "" "POR(NM_001367562.1):c.984C>T (p.A328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75983774C>T" "" "likely benign" ""
"0000340435" "0" "10" "7" "75614953" "75614953" "subst" "0.921299" "02327" "POR_000012" "g.75614953T>C" "" "" "" "POR(NM_001382658.3):c.1446T>C (p.A482=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75985635T>C" "" "benign" ""
"0000340436" "0" "10" "7" "75615287" "75615287" "subst" "0.279358" "02327" "POR_000085" "g.75615287G>A" "" "" "" "POR(NM_001382658.3):c.1707G>A (p.S569=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75985969G>A" "" "benign" ""
"0000341474" "0" "10" "7" "75615006" "75615006" "subst" "0.305407" "02327" "POR_000014" "g.75615006C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75985688C>T" "" "benign" ""
"0000342300" "0" "90" "7" "75610860" "75610860" "subst" "8.22172E-6" "02327" "POR_000089" "g.75610860C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75981542C>T" "" "pathogenic" ""
"0000475044" "3" "90" "7" "75615113" "75615113" "subst" "0" "00006" "POR_000017" "g.75615113G>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.75985795G>A" "" "pathogenic" ""
"0000475045" "3" "70" "7" "75613108" "75613108" "subst" "0.000825339" "00006" "POR_000090" "g.75613108G>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.75983790G>A" "" "likely pathogenic" ""
"0000532641" "0" "30" "7" "75583383" "75583383" "subst" "1.64212E-5" "01804" "POR_000091" "g.75583383C>T" "" "" "" "POR(NM_000941.2):c.73C>T (p.(Leu25Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75954065C>T" "" "likely benign" ""
"0000532642" "0" "50" "7" "75583468" "75583470" "del" "0" "01943" "POR_000092" "g.75583468_75583470del" "" "" "" "POR(NM_000941.2):c.158_160delAAG (p.E53del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75954150_75954152del" "" "VUS" ""
"0000532643" "0" "50" "7" "75608803" "75608803" "subst" "2.03985E-5" "01943" "POR_000093" "g.75608803C>T" "" "" "" "POR(NM_000941.2):c.272C>T (p.T91M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75979485C>T" "" "VUS" ""
"0000532644" "0" "50" "7" "75609699" "75609699" "subst" "0" "02329" "POR_000094" "g.75609699G>T" "" "" "" "POR(NM_000941.2):c.409G>T (p.V137F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75980381G>T" "" "VUS" ""
"0000532645" "0" "50" "7" "75610876" "75610876" "subst" "0.00246275" "01943" "POR_000040" "g.75610876C>T" "" "" "" "POR(NM_000941.2):c.683C>T (p.(Pro228Leu)), POR(NM_001367562.1):c.683C>T (p.P228L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75981558C>T" "" "VUS" ""
"0000532647" "0" "50" "7" "75611623" "75611623" "subst" "4.96907E-5" "01943" "POR_000096" "g.75611623C>A" "" "" "" "POR(NM_000941.2):c.813C>A (p.S271R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75982305C>A" "" "VUS" ""
"0000532648" "0" "90" "7" "75612866" "75612866" "subst" "0.000239682" "01804" "POR_000047" "g.75612866G>C" "" "" "" "POR(NM_001382655.1):c.913G>C (p.(Ala305Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75983548G>C" "" "pathogenic" ""
"0000532649" "0" "30" "7" "75614286" "75614309" "del" "0" "01804" "POR_000097" "g.75614286_75614309del" "" "" "" "POR(NM_000941.2):c.1248+10_1248+33del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75984968_75984991del" "" "likely benign" ""
"0000532651" "0" "30" "7" "75616507" "75616507" "subst" "0.000230379" "01943" "POR_000098" "g.75616507C>T" "" "" "" "TMEM120A(NM_031925.3):c.1015G>A (p.G339R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75987189C>T" "" "likely benign" ""
"0000532652" "0" "50" "7" "75617418" "75617418" "subst" "4.62189E-5" "01943" "POR_000099" "g.75617418C>T" "" "" "" "TMEM120A(NM_031925.3):c.612G>A (p.S204=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75988100C>T" "" "VUS" ""
"0000532653" "0" "30" "7" "75618514" "75618514" "subst" "0.000821982" "01804" "POR_000100" "g.75618514C>T" "" "" "" "TMEM120A(NM_031925.2):c.346G>A (p.(Val116Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75989196C>T" "" "likely benign" ""
"0000611192" "0" "30" "7" "75613137" "75613137" "subst" "2.46392E-5" "01943" "POR_000101" "g.75613137C>T" "" "" "" "POR(NM_000941.2):c.1029C>T (p.A343=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75983819C>T" "" "likely benign" ""
"0000611193" "0" "30" "7" "75613149" "75613149" "subst" "7.0429E-5" "01943" "POR_000102" "g.75613149C>T" "" "" "" "POR(NM_000941.2):c.1041C>T (p.V347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75983831C>T" "" "likely benign" ""
"0000611194" "0" "90" "7" "75613161" "75613161" "del" "1.68114E-5" "02327" "POR_000103" "g.75613161del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75983843del" "" "pathogenic" ""
"0000611195" "0" "30" "7" "75616408" "75616408" "subst" "0.000145605" "01943" "POR_000104" "g.75616408G>A" "" "" "" "TMEM120A(NM_001317803.1):c.1052C>T (p.A351V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75987090G>A" "" "likely benign" ""
"0000621923" "0" "30" "7" "75615552" "75615552" "subst" "0.0016508" "01943" "POR_000035" "g.75615552G>A" "" "" "" "POR(NM_000941.2):c.1891G>A (p.(Val631Ile)), POR(NM_001367562.1):c.1891G>A (p.V631I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75986234G>A" "" "likely benign" ""
"0000655887" "0" "50" "7" "75615280" "75615280" "subst" "0.000178814" "01943" "POR_000105" "g.75615280G>A" "" "" "" "POR(NM_000941.2):c.1709G>A (p.R570H, p.(Arg570His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75985962G>A" "" "VUS" ""
"0000678172" "0" "30" "7" "75608804" "75608804" "subst" "2.44754E-5" "01943" "POR_000106" "g.75608804G>A" "" "" "" "POR(NM_000941.2):c.273G>A (p.T91=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000678173" "0" "30" "7" "75613092" "75613092" "subst" "0.00117131" "01943" "POR_000090" "g.75613092C>T" "" "" "" "POR(NM_001367562.1):c.984C>T (p.A328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000678174" "0" "90" "7" "75614456" "75614456" "del" "0" "01943" "POR_000107" "g.75614456del" "" "" "" "POR(NM_000941.2):c.1329delC (p.I444Sfs*101)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000690069" "0" "30" "7" "75611562" "75611562" "subst" "0" "01804" "POR_000108" "g.75611562T>C" "" "" "" "POR(NM_000941.2):c.752T>C (p.(Val251Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000690070" "0" "50" "7" "75614391" "75614391" "subst" "4.69484E-5" "01943" "POR_000109" "g.75614391T>G" "" "" "" "POR(NM_000941.2):c.1264T>G (p.W422G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000690071" "0" "30" "7" "75615787" "75615787" "subst" "8.2752E-6" "01943" "POR_000110" "g.75615787C>T" "" "" "" "POR(NM_001367562.1):c.2031C>T (p.D677=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000721547" "0" "30" "7" "75609782" "75609782" "subst" "8.12817E-6" "01943" "POR_000111" "g.75609782G>A" "" "" "" "POR(NM_000941.2):c.492G>A (p.V164=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000721548" "0" "50" "7" "75611634" "75611634" "subst" "4.18036E-6" "01943" "POR_000112" "g.75611634A>G" "" "" "" "POR(NM_001367562.1):c.824A>G (p.Q275R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000721549" "0" "50" "7" "75614143" "75614143" "subst" "0.000183173" "01804" "POR_000113" "g.75614143C>T" "" "" "" "POR(NM_000941.2):c.1115C>T (p.(Thr372Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000721550" "0" "70" "7" "75614203" "75614203" "dup" "0" "02327" "POR_000114" "g.75614203dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000721551" "0" "50" "7" "75615242" "75615242" "subst" "3.00882E-5" "01943" "POR_000115" "g.75615242C>T" "" "" "" "POR(NM_001367562.1):c.1671C>T (p.G557=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000803241" "0" "50" "7" "75608875" "75608875" "subst" "0.000199754" "01943" "POR_000056" "g.75608875C>T" "" "" "" "POR(NM_000941.2):c.344C>T (p.A115V), POR(NM_001382655.1):c.398C>T (p.(Ala133Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000803242" "0" "30" "7" "75610876" "75610876" "subst" "0.00246275" "01804" "POR_000040" "g.75610876C>T" "" "" "" "POR(NM_000941.2):c.683C>T (p.(Pro228Leu)), POR(NM_001367562.1):c.683C>T (p.P228L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000803243" "0" "30" "7" "75612914" "75612914" "subst" "5.28095E-5" "01804" "POR_000116" "g.75612914C>T" "" "" "" "POR(NM_000941.2):c.907C>T (p.(Leu303Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000803244" "0" "50" "7" "75614912" "75614912" "subst" "0.000386513" "01943" "POR_000010" "g.75614912G>A" "" "" "" "POR(NM_000941.2):c.1414G>A (p.V472M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000851664" "0" "30" "7" "75609659" "75609659" "subst" "0.00185974" "01804" "POR_000077" "g.75609659C>T" "" "" "" "POR(NM_000941.2):c.369C>T (p.A123=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000851665" "0" "30" "7" "75609689" "75609689" "subst" "0.000268371" "01943" "POR_000118" "g.75609689C>T" "" "" "" "POR(NM_000941.2):c.399C>T (p.N133=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000851666" "0" "50" "7" "75611613" "75611613" "subst" "2.88111E-5" "01943" "POR_000120" "g.75611613G>A" "" "" "" "POR(NM_000941.2):c.803G>A (p.R268Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000851667" "0" "30" "7" "75614999" "75614999" "subst" "2.87425E-5" "01943" "POR_000122" "g.75614999G>A" "" "" "" "POR(NM_000941.2):c.1501G>A (p.E501K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000851668" "0" "50" "7" "75615273" "75615273" "subst" "5.08611E-5" "01943" "POR_000123" "g.75615273G>A" "" "" "" "POR(NM_000941.2):c.1702G>A (p.(Gly568Ser)), POR(NM_001367562.1):c.1702G>A (p.G568S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000851669" "0" "30" "7" "75615552" "75615552" "subst" "0.0016508" "01804" "POR_000035" "g.75615552G>A" "" "" "" "POR(NM_000941.2):c.1891G>A (p.(Val631Ile)), POR(NM_001367562.1):c.1891G>A (p.V631I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000860902" "0" "50" "7" "75608844" "75608844" "subst" "3.25574E-5" "01804" "POR_000117" "g.75608844G>A" "" "" "" "POR(NM_000941.2):c.313G>A (p.(Ala105Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000860903" "0" "30" "7" "75610830" "75610830" "subst" "0.000525723" "01943" "POR_000119" "g.75610830C>G" "" "" "" "POR(NM_000941.2):c.642-5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000860904" "0" "50" "7" "75611627" "75611627" "subst" "2.9063E-5" "01943" "POR_000121" "g.75611627G>A" "" "" "" "POR(NM_000941.2):c.817G>A (p.E273K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000860905" "0" "50" "7" "75614482" "75614482" "subst" "4.3198E-5" "01943" "POR_000004" "g.75614482C>T" "" "" "" "POR(NM_000941.2):c.1355C>T (p.P452L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000887974" "0" "50" "7" "75610489" "75610489" "subst" "0" "01804" "POR_000124" "g.75610489A>G" "" "" "" "POR(NM_000941.2):c.640A>G (p.(Asn214Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000887975" "0" "50" "7" "75614097" "75614099" "del" "0" "01804" "POR_000125" "g.75614097_75614099del" "" "" "" "POR(NM_000941.2):c.1069_1071del (p.(Glu357del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000912794" "0" "30" "7" "75615319" "75615319" "subst" "0" "01804" "POR_000126" "g.75615319C>T" "" "" "" "POR(NM_000941.2):c.1748C>T (p.(Ala583Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000929375" "0" "10" "7" "75583325" "75583325" "subst" "0.0310574" "02326" "POR_000127" "g.75583325A>G" "" "" "" "POR(NM_000941.2):c.15A>G (p.G5=), POR(NM_001382655.1):c.15A>G (p.(Gly5=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000954210" "21" "70" "7" "75614224" "75614232" "del" "0" "00006" "POR_000129" "g.75614224_75614232del" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75984906_75984914del" "" "likely pathogenic" "ACMG"
"0000954211" "21" "70" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75985179G>A" "" "likely pathogenic" "ACMG"
"0000954212" "21" "90" "7" "75615049" "75615049" "dup" "0" "00006" "POR_000131" "g.75615049dup" "" "{PMID:Duan 2023:37586839}" "" "1551dupC" "" "Germline" "" "" "0" "" "" "g.75985731dup" "" "pathogenic" "ACMG"
"0000954213" "21" "70" "7" "75615134" "75615134" "subst" "5.88325E-6" "00006" "POR_000132" "g.75615134T>C" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75985816T>C" "" "likely pathogenic" "ACMG"
"0000954314" "11" "70" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75985179G>A" "" "likely pathogenic" "ACMG"
"0000954315" "11" "50" "7" "75615020" "75615020" "subst" "0" "00006" "POR_000130" "g.75615020G>A" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75985702G>A" "" "VUS" "ACMG"
"0000954316" "11" "70" "7" "75614497" "75614497" "subst" "4.34292E-5" "00006" "POR_000005" "g.75614497G>A" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75985179G>A" "" "likely pathogenic" "ACMG"
"0000954317" "11" "90" "7" "75614156" "75614156" "subst" "0" "00006" "POR_000128" "g.75614156C>A" "" "{PMID:Duan 2023:37586839}" "" "" "" "Germline" "" "" "0" "" "" "g.75984838C>A" "" "pathogenic" "ACMG"
"0000964673" "0" "50" "7" "75615273" "75615273" "subst" "5.08611E-5" "01804" "POR_000123" "g.75615273G>A" "" "" "" "POR(NM_000941.2):c.1702G>A (p.(Gly568Ser)), POR(NM_001367562.1):c.1702G>A (p.G568S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000977852" "0" "50" "7" "75614925" "75614925" "subst" "0" "01804" "POR_000133" "g.75614925C>T" "" "" "" "POR(NM_001382655.1):c.1481C>T (p.(Ala494Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996656" "0" "50" "7" "75611574" "75611574" "subst" "0" "01804" "POR_000134" "g.75611574A>G" "" "" "" "POR(NM_000941.2):c.764A>G (p.(Asp255Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996657" "0" "30" "7" "75614176" "75614176" "subst" "1.22236E-5" "01804" "POR_000135" "g.75614176C>T" "" "" "" "POR(NM_000941.2):c.1148C>T (p.(Pro383Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996658" "0" "90" "7" "75615146" "75615146" "subst" "0" "01804" "POR_000020" "g.75615146C>T" "" "" "" "POR(NM_000941.2):c.1648C>T (p.(Arg550Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000996659" "0" "50" "7" "75615280" "75615280" "subst" "0.000178814" "01804" "POR_000105" "g.75615280G>A" "" "" "" "POR(NM_000941.2):c.1709G>A (p.R570H, p.(Arg570His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996660" "0" "50" "7" "75616897" "75616897" "subst" "0" "01804" "POR_000136" "g.75616897G>A" "" "" "" "TMEM120A(NM_031925.2):c.808C>T (p.(Arg270Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036527" "0" "50" "7" "75608850" "75608850" "subst" "8.13888E-5" "01804" "POR_000137" "g.75608850C>T" "" "" "" "POR(NM_001382655.1):c.373C>T (p.(Arg125Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036528" "0" "50" "7" "75608856" "75608856" "subst" "5.69879E-5" "01804" "POR_000138" "g.75608856G>A" "" "" "" "POR(NM_001382655.1):c.379G>A (p.(Gly127Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036529" "0" "50" "7" "75608875" "75608875" "subst" "0.000199754" "01804" "POR_000056" "g.75608875C>T" "" "" "" "POR(NM_000941.2):c.344C>T (p.A115V), POR(NM_001382655.1):c.398C>T (p.(Ala133Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036530" "0" "50" "7" "75610480" "75610480" "subst" "8.61692E-5" "01804" "POR_000067" "g.75610480G>A" "" "" "" "POR(NM_001382655.1):c.685G>A (p.(Asp229Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036531" "0" "50" "7" "75610861" "75610861" "subst" "0" "01804" "POR_000139" "g.75610861G>A" "" "" "" "POR(NM_001382655.1):c.722G>A (p.(Arg241Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036532" "0" "50" "7" "75614906" "75614906" "subst" "0" "01804" "POR_000140" "g.75614906A>C" "" "" "" "POR(NM_001382655.1):c.1462A>C (p.(Asn488His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001052706" "0" "10" "7" "75583325" "75583325" "subst" "0.0310574" "01804" "POR_000127" "g.75583325A>G" "" "" "" "POR(NM_000941.2):c.15A>G (p.G5=), POR(NM_001382655.1):c.15A>G (p.(Gly5=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001052707" "0" "50" "7" "75614136" "75614136" "subst" "8.14173E-6" "01804" "POR_000141" "g.75614136T>C" "" "" "" "POR(NM_001382655.1):c.1162T>C (p.(Tyr388His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001052708" "0" "50" "7" "75615063" "75615063" "subst" "0" "01804" "POR_000142" "g.75615063G>A" "" "" "" "POR(NM_001382655.1):c.1619G>A (p.(Arg540His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001064731" "0" "70" "7" "75615481" "75615481" "subst" "0.000107347" "02327" "POR_000030" "g.75615481A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes POR
## Count = 295
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Haplotype}}"
"0000150036" "00016551" "11" "0" "0" "0" "0" "c.=" "r.=" "p.=" "_1_16_" "POR*1"
"0000150037" "00016551" "90" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "12" "POR*2"
"0000150038" "00016551" "90" "731" "1" "731" "1" "c.731+1G>A" "r.spl?" "p.?" "7i" "POR*3"
"0000150039" "00016551" "90" "1475" "0" "1475" "0" "c.1475T>A" "r.(?)" "p.(Val492Glu)" "13" "POR*4"
"0000150040" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" "POR*5"
"0000150041" "00016551" "90" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Cys569Tyr)" "14" "POR*6"
"0000150042" "00016551" "90" "1822" "0" "1822" "0" "c.1822G>T" "r.(?)" "p.(Val608Phe)" "15" "POR*7"
"0000150043" "00016551" "90" "541" "0" "541" "0" "c.541T>G" "r.(?)" "p.(Tyr181Asp)" "6" "POR*8"
"0000150044" "00016551" "90" "1329" "0" "1329" "0" "c.1329dup" "r.(?)" "p.(Ile444Hisfs*6)" "12" "POR*9"
"0000150045" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*10"
"0000150046" "00016551" "90" "1698" "0" "1698" "0" "c.1698dup" "r.(?)" "p.(Tyr567Leufs*8)" "14" "POR*10"
"0000150047" "00016551" "90" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "4" "POR*11"
"0000150048" "00016551" "90" "424" "0" "424" "0" "c.424A>G" "r.(?)" "p.(Thr142Ala)" "5" "POR*12"
"0000150049" "00016551" "90" "458" "0" "458" "0" "c.458A>G" "r.(?)" "p.(Gln153Arg)" "5" "POR*13"
"0000150050" "00016551" "90" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Met263Val)" "8" "POR*14"
"0000150051" "00016551" "90" "1375" "0" "1375" "0" "c.1375T>C" "r.(?)" "p.(Tyr459His)" "12" "POR*15"
"0000150052" "00016551" "90" "1615" "0" "1615" "0" "c.1615G>A" "r.(?)" "p.(Gly539Arg)" "13" "POR*16"
"0000150053" "00016551" "90" "1694" "0" "1694" "0" "c.1694T>C" "r.(?)" "p.(Leu565Pro)" "14" "POR*17"
"0000150054" "00016551" "90" "1846" "0" "1846" "0" "c.1846C>T" "r.(?)" "p.(Arg616*)" "15" "POR*18"
"0000150055" "00016551" "90" "1937" "0" "1939" "0" "c.1937_1939del" "r.(?)" "p.(Phe646del)" "16" "POR*19"
"0000150056" "00016551" "90" "568" "0" "580" "0" "c.568_580dup" "r.(?)" "p.(Arg194Leufs*16)" "6" "POR*20"
"0000150057" "00016551" "90" "1535" "0" "1551" "0" "c.1535_1551dup" "r.(?)" "p.(Lys518Cysfs*33)" "13" "POR*21"
"0000150058" "00016551" "90" "1619" "0" "1620" "0" "c.1619_1620insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "r.(?)" "p.(Ala541Leufs*50)" "13" "POR*22"
"0000150059" "00016551" "90" "1622" "0" "1622" "0" "c.1622dup" "r.(?)" "p.(Pro542Thrfs*33)" "13" "POR*23"
"0000150060" "00016551" "90" "1345" "0" "1348" "0" "c.1345_1348dup" "r.(?)" "p.(Leu450Argfs*126)" "12" "POR*24"
"0000150061" "00016551" "50" "147" "0" "147" "0" "c.147G>C" "r.(?)" "p.(Lys49Asn)" "2" "POR*25"
"0000150062" "00016551" "50" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Leu420Met)" "12" "POR*26"
"0000150063" "00016551" "50" "1730" "0" "1730" "0" "c.1730T>C" "r.(?)" "p.(Leu577Pro)" "14" "POR*27"
"0000150064" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*28"
"0000150065" "00016551" "50" "571" "0" "571" "0" "c.571G>C" "r.(?)" "p.(Val191Leu)" "6" "POR*29"
"0000150066" "00016551" "50" "1339" "0" "1339" "0" "c.1339C>A" "r.(?)" "p.(Leu447Met)" "12" "POR*30"
"0000150067" "00016551" "90" "601" "0" "601" "0" "c.601C>T" "r.(?)" "p.(Gln201*)" "6" "POR*31"
"0000150068" "00016551" "90" "1381" "0" "1386" "0" "c.1381_1386dup" "r.(?)" "p.(Ile461_Ala462dup)" "12" "POR*32"
"0000150069" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*32"
"0000150070" "00016551" "90" "1835" "0" "1858" "0" "c.1835_1858del" "r.(?)" "p.(Leu612_Trp620delinsArg)" "15" "POR*33"
"0000150071" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*33"
"0000150072" "00016551" "90" "1733" "0" "1733" "0" "c.1733A>G" "r.(?)" "p.(Tyr578Cys)" "14" "POR*34"
"0000150073" "00016551" "90" "1738" "0" "1738" "0" "c.1738G>C" "r.(?)" "p.(Glu580Gln)" "14" "POR*35"
"0000150074" "00016551" "50" "830" "116" "830" "116" "c.830+116C>T" "r.(=)" "p.(=)" "8i" "POR*36"
"0000150075" "00016551" "50" "831" "-35" "831" "-35" "c.831-35C>T" "r.(=)" "p.(=)" "8i" "POR*36"
"0000150076" "00016551" "50" "1455" "0" "1455" "0" "c.1455T>C" "r.(=)" "p.(=)" "13" "POR*36"
"0000150077" "00016551" "50" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*36"
"0000150078" "00016551" "50" "2349" "0" "2349" "0" "c.*306G>A" "r.(=)" "p.(=)" "16" "POR*36"
"0000150079" "00016551" "50" "366" "136" "366" "136" "c.366+136C>T" "r.(=)" "p.(=)" "4i" "POR*36"
"0000150080" "00016551" "50" "237" "88" "237" "88" "c.237+88G>A" "r.(=)" "p.(=)" "3i" "POR*36"
"0000150081" "00016551" "50" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "7" "POR*36"
"0000150082" "00016551" "50" "1399" "-120" "1399" "-120" "c.1399-120G>A" "r.(=)" "p.(=)" "12i" "POR*37"
"0000150083" "00016551" "50" "1455" "0" "1455" "0" "c.1455T>C" "r.(=)" "p.(=)" "13" "POR*37"
"0000150084" "00016551" "50" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*37"
"0000150085" "00016551" "50" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "15" "POR*37"
"0000150086" "00016551" "50" "2349" "0" "2349" "0" "c.*306G>A" "r.(=)" "p.(=)" "16" "POR*37"
"0000150087" "00016551" "50" "831" "-35" "831" "-35" "c.831-35C>T" "r.(=)" "p.(=)" "8i" "POR*37"
"0000150088" "00016551" "50" "830" "116" "830" "116" "c.830+116C>T" "r.(=)" "p.(=)" "8i" "POR*37"
"0000150089" "00016551" "90" "143" "0" "143" "0" "c.143del" "r.(?)" "p.(Arg48Lysfs*16)" "2" "POR*38"
"0000150090" "00016551" "90" "1665" "0" "1665" "0" "c.1665del" "r.(?)" "p.(Gln555Hisfs*58)" "13" "POR*39"
"0000150091" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*40"
"0000150092" "00016551" "90" "1042" "0" "1044" "0" "c.1042_1044del" "r.(?)" "p.(Val348del)" "10" "POR*40"
"0000150093" "00016551" "90" "-4" "-1" "1669" "1" "c.(-5+1_-4-1)_(1669+1_1670-1)del" "r.spl?" "p.?" "1i_13i" "POR*41"
"0000150094" "00016551" "50" "387" "0" "387" "0" "c.387A>G" "r.(=)" "p.(=)" "5" "POR*42"
"0000150095" "00016551" "50" "1237" "0" "1237" "0" "c.1237G>A" "r.(?)" "p.(Gly413Ser)" "11" "POR*42"
"0000150096" "00016551" "50" "1975" "0" "1975" "0" "c.1975G>A" "r.(?)" "p.(Ala659Thr)" "16" "POR*43"
"0000150097" "00016551" "50" "387" "0" "387" "0" "c.387A>G" "r.(=)" "p.(=)" "5" "POR*43"
"0000150098" "00016551" "50" "304" "0" "304" "0" "c.304T>C" "r.(?)" "p.(Ser102Pro)" "4" "POR*44"
"0000150099" "00016551" "50" "490" "0" "490" "0" "c.490G>A" "r.(?)" "p.(Val164Met)" "5" "POR*45"
"0000150100" "00016551" "50" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Val191Met)" "6" "POR*46"
"0000150101" "00016551" "50" "1030" "0" "1030" "0" "c.1030G>A" "r.(?)" "p.(Asp344Asn)" "10" "POR*47"
"0000150102" "00016551" "50" "1193" "0" "1193" "0" "c.1193A>C" "r.(?)" "p.(Glu398Ala)" "11" "POR*48"
"0000150103" "00016551" "50" "158" "0" "160" "0" "c.158_160del" "r.(?)" "p.(Glu53del)" "2" ""
"0000150104" "00016551" "50" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Pro55Leu)" "2" ""
"0000150105" "00016551" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Asp211Asn)" "6" ""
"0000150106" "00016551" "50" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Gly213Glu)" "6" ""
"0000150107" "00016551" "50" "851" "0" "851" "0" "c.851C>T" "r.(?)" "p.(Pro284Leu)" "9" ""
"0000150108" "00016551" "50" "850" "0" "850" "0" "c.850C>A" "r.(?)" "p.(Pro284Thr)" "9" ""
"0000150109" "00016551" "50" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Glu300Lys)" "9" ""
"0000150110" "00016551" "50" "1217" "0" "1217" "0" "c.1217G>A" "r.(?)" "p.(Arg406His)" "11" ""
"0000150111" "00016551" "50" "1355" "0" "1355" "0" "c.1355C>T" "r.(?)" "p.(Pro452Leu)" "12" ""
"0000150112" "00016551" "50" "1384" "0" "1384" "0" "c.1384G>A" "r.(?)" "p.(Ala462Thr)" "12" ""
"0000150113" "00016551" "50" "1414" "0" "1414" "0" "c.1414G>A" "r.(?)" "p.(Val472Met)" "13" ""
"0000150114" "00016551" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Ala485Thr)" "13" ""
"0000150115" "00016551" "50" "1798" "0" "1798" "0" "c.1798C>T" "r.(?)" "p.(Arg600Trp)" "14" ""
"0000150116" "00016551" "50" "1820" "0" "1820" "0" "c.1820A>G" "r.(?)" "p.(Tyr607Cys)" "15" ""
"0000150117" "00016551" "50" "1883" "0" "1883" "0" "c.1883A>C" "r.(?)" "p.(His628Pro)" "15" ""
"0000150118" "00016551" "50" "1510" "0" "1510" "0" "c.1510G>A" "r.(?)" "p.(Gly504Arg)" "13" ""
"0000150119" "00016551" "50" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(Arg550Trp)" "13" ""
"0000150120" "00016551" "50" "1708" "0" "1708" "0" "c.1708C>T" "r.(?)" "p.(Arg570Cys)" "14" ""
"0000150121" "00016551" "50" "86" "0" "86" "0" "c.86C>T" "r.(?)" "p.(Thr29Met)" "2" ""
"0000150122" "00016551" "50" "1942" "0" "1942" "0" "c.1942G>A" "r.(?)" "p.(Asp648Asn)" "16" ""
"0000150123" "00016551" "90" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "12" "POR*2"
"0000150124" "00016551" "90" "731" "1" "731" "1" "c.731+1G>A" "r.spl?" "p.?" "7i" "POR*3"
"0000150125" "00016551" "90" "1475" "0" "1475" "0" "c.1475T>A" "r.(?)" "p.(Val492Glu)" "13" "POR*4"
"0000150126" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" "POR*5"
"0000150127" "00016551" "90" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Cys569Tyr)" "14" "POR*6"
"0000150128" "00016551" "90" "1822" "0" "1822" "0" "c.1822G>T" "r.(?)" "p.(Val608Phe)" "15" "POR*7"
"0000150129" "00016551" "90" "541" "0" "541" "0" "c.541T>G" "r.(?)" "p.(Tyr181Asp)" "6" "POR*8"
"0000150130" "00016551" "90" "1329" "0" "1329" "0" "c.1329dup" "r.(?)" "p.(Ile444Hisfs*6)" "12" "POR*9"
"0000150131" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*10"
"0000150132" "00016551" "90" "1698" "0" "1698" "0" "c.1698dup" "r.(?)" "p.(Tyr567Leufs*8)" "14" "POR*10"
"0000150133" "00016551" "90" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "4" "POR*11"
"0000150134" "00016551" "90" "424" "0" "424" "0" "c.424A>G" "r.(?)" "p.(Thr142Ala)" "5" "POR*12"
"0000150135" "00016551" "90" "458" "0" "458" "0" "c.458A>G" "r.(?)" "p.(Gln153Arg)" "5" "POR*13"
"0000150136" "00016551" "90" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Met263Val)" "8" "POR*14"
"0000150137" "00016551" "90" "1375" "0" "1375" "0" "c.1375T>C" "r.(?)" "p.(Tyr459His)" "12" "POR*15"
"0000150138" "00016551" "90" "1615" "0" "1615" "0" "c.1615G>A" "r.(?)" "p.(Gly539Arg)" "13" ""
"0000150139" "00016551" "90" "1694" "0" "1694" "0" "c.1694T>C" "r.(?)" "p.(Leu565Pro)" "14" "POR*17"
"0000150140" "00016551" "90" "1846" "0" "1846" "0" "c.1846C>T" "r.(?)" "p.(Arg616*)" "15" "POR*18"
"0000150141" "00016551" "90" "1937" "0" "1939" "0" "c.1937_1939del" "r.(?)" "p.(Phe646del)" "16" ""
"0000150142" "00016551" "90" "568" "0" "580" "0" "c.568_580dup" "r.(?)" "p.(Arg194Leufs*16)" "6" "POR*20"
"0000150143" "00016551" "90" "1535" "0" "1551" "0" "c.1535_1551dup" "r.(?)" "p.(Lys518Cysfs*33)" "13" ""
"0000150144" "00016551" "90" "1619" "0" "1620" "0" "c.1619_1620insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT" "r.(?)" "p.(Ala541Leufs*50)" "13" "POR*22"
"0000150145" "00016551" "90" "1622" "0" "1622" "0" "c.1622dup" "r.(?)" "p.(Pro542Thrfs*33)" "13" "POR*23"
"0000150146" "00016551" "90" "1345" "0" "1348" "0" "c.1345_1348dup" "r.(?)" "p.(Leu450Argfs*126)" "12" "POR*24"
"0000150147" "00016551" "50" "147" "0" "147" "0" "c.147G>C" "r.(?)" "p.(Lys49Asn)" "2" "POR*25"
"0000150148" "00016551" "50" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Leu420Met)" "12" "POR*26"
"0000150149" "00016551" "50" "1730" "0" "1730" "0" "c.1730T>C" "r.(?)" "p.(Leu577Pro)" "14" "POR*27"
"0000150150" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*28"
"0000150151" "00016551" "50" "571" "0" "571" "0" "c.571G>C" "r.(?)" "p.(Val191Leu)" "6" "POR*29"
"0000150152" "00016551" "50" "1339" "0" "1339" "0" "c.1339C>A" "r.(?)" "p.(Leu447Met)" "12" "POR*30"
"0000150153" "00016551" "90" "601" "0" "601" "0" "c.601C>T" "r.(?)" "p.(Gln201*)" "6" "POR*31"
"0000150154" "00016551" "90" "1381" "0" "1386" "0" "c.1381_1386dup" "r.(?)" "p.(Ile461_Ala462dup)" "12" "POR*32"
"0000150155" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*32"
"0000150156" "00016551" "90" "1835" "0" "1858" "0" "c.1835_1858del" "r.(?)" "p.(Leu612_Trp620delinsArg)" "15" "POR*33"
"0000150157" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*33"
"0000150158" "00016551" "90" "1733" "0" "1733" "0" "c.1733A>G" "r.(?)" "p.(Tyr578Cys)" "14" "POR*34"
"0000150159" "00016551" "90" "1738" "0" "1738" "0" "c.1738G>C" "r.(?)" "p.(Glu580Gln)" "14" "POR*35"
"0000150160" "00016551" "50" "830" "116" "830" "116" "c.830+116C>T" "r.(=)" "p.(=)" "8i" "POR*36"
"0000150161" "00016551" "50" "831" "-35" "831" "-35" "c.831-35C>T" "r.(=)" "p.(=)" "8i" "POR*36"
"0000150162" "00016551" "50" "1455" "0" "1455" "0" "c.1455T>C" "r.(=)" "p.(=)" "13" "POR*36"
"0000150163" "00016551" "50" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*36"
"0000150164" "00016551" "50" "2349" "0" "2349" "0" "c.*306G>A" "r.(=)" "p.(=)" "16" "POR*36"
"0000150165" "00016551" "50" "366" "136" "366" "136" "c.366+136C>T" "r.(=)" "p.(=)" "4i" "POR*36"
"0000150166" "00016551" "50" "237" "88" "237" "88" "c.237+88G>A" "r.(=)" "p.(=)" "3i" "POR*36"
"0000150167" "00016551" "50" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "7" "POR*36"
"0000150168" "00016551" "50" "1399" "-120" "1399" "-120" "c.1399-120G>A" "r.(=)" "p.(=)" "12i" "POR*37"
"0000150169" "00016551" "50" "1455" "0" "1455" "0" "c.1455T>C" "r.(=)" "p.(=)" "13" "POR*37"
"0000150170" "00016551" "50" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*37"
"0000150171" "00016551" "50" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "15" "POR*37"
"0000150172" "00016551" "50" "2349" "0" "2349" "0" "c.*306G>A" "r.(=)" "p.(=)" "16" "POR*37"
"0000150173" "00016551" "50" "831" "-35" "831" "-35" "c.831-35C>T" "r.(=)" "p.(=)" "8i" "POR*37"
"0000150174" "00016551" "50" "830" "116" "830" "116" "c.830+116C>T" "r.(=)" "p.(=)" "8i" "POR*37"
"0000150175" "00016551" "90" "143" "0" "143" "0" "c.143del" "r.(?)" "p.(Arg48Lysfs*16)" "2" "POR*38"
"0000150176" "00016551" "90" "1665" "0" "1665" "0" "c.1665del" "r.(?)" "p.(Gln555Hisfs*58)" "13" "POR*39"
"0000150177" "00016551" "90" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" "POR*40"
"0000150178" "00016551" "90" "1042" "0" "1044" "0" "c.1042_1044del" "r.(?)" "p.(Val348del)" "10" "POR*40"
"0000150179" "00016551" "90" "-4" "-1" "1669" "1" "c.(-5+1_-4-1)_(1669+1_1670-1)del" "r.spl?" "p.?" "1i_13i" "POR*41"
"0000150180" "00016551" "50" "387" "0" "387" "0" "c.387A>G" "r.(=)" "p.(=)" "5" "POR*42"
"0000150181" "00016551" "50" "1237" "0" "1237" "0" "c.1237G>A" "r.(?)" "p.(Gly413Ser)" "11" "POR*42"
"0000150182" "00016551" "50" "1975" "0" "1975" "0" "c.1975G>A" "r.(?)" "p.(Ala659Thr)" "16" "POR*43"
"0000150183" "00016551" "50" "387" "0" "387" "0" "c.387A>G" "r.(=)" "p.(=)" "5" "POR*43"
"0000150184" "00016551" "50" "304" "0" "304" "0" "c.304T>C" "r.(?)" "p.(Ser102Pro)" "4" "POR*44"
"0000150185" "00016551" "50" "490" "0" "490" "0" "c.490G>A" "r.(?)" "p.(Val164Met)" "5" "POR*45"
"0000150186" "00016551" "50" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Val191Met)" "6" "POR*46"
"0000150187" "00016551" "50" "1030" "0" "1030" "0" "c.1030G>A" "r.(?)" "p.(Asp344Asn)" "10" "POR*47"
"0000150188" "00016551" "50" "1193" "0" "1193" "0" "c.1193A>C" "r.(?)" "p.(Glu398Ala)" "11" "POR*48"
"0000150697" "00016551" "70" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "4" ""
"0000150698" "00016551" "70" "424" "0" "424" "0" "c.424A>G" "r.(?)" "p.(Thr142Ala)" "5" ""
"0000150699" "00016551" "90" "458" "0" "458" "0" "c.458A>G" "r.(?)" "p.(Gln153Arg)" "5" ""
"0000150700" "00016551" "90" "541" "0" "541" "0" "c.541T>G" "r.(?)" "p.(Tyr181Asp)" "6" ""
"0000150701" "00016551" "30" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "7" ""
"0000150702" "00016551" "70" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Met263Val)" "8" ""
"0000150703" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" ""
"0000150704" "00016551" "30" "946" "0" "946" "0" "c.946A>T" "r.(?)" "p.(Arg316Trp)" "9" ""
"0000150705" "00016551" "30" "1237" "0" "1237" "0" "c.1237G>A" "r.(?)" "p.(Gly413Ser)" "11" ""
"0000150706" "00016551" "90" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "12" ""
"0000150707" "00016551" "90" "1375" "0" "1375" "0" "c.1375T>C" "r.(?)" "p.(Tyr459His)" "12" ""
"0000150708" "00016551" "90" "1475" "0" "1475" "0" "c.1475T>A" "r.(?)" "p.(Val492Glu)" "13" ""
"0000150709" "00016551" "50" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" ""
"0000150710" "00016551" "70" "1510" "0" "1510" "0" "c.1510G>A" "r.(?)" "p.(Gly504Arg)" "13" ""
"0000150711" "00016551" "90" "1615" "0" "1615" "0" "c.1615G>A" "r.(?)" "p.(Gly539Arg)" "13" ""
"0000150712" "00016551" "90" "1694" "0" "1694" "0" "c.1694T>C" "r.(?)" "p.(Leu565Pro)" "14" ""
"0000150713" "00016551" "90" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Cys569Tyr)" "14" ""
"0000150714" "00016551" "90" "1822" "0" "1822" "0" "c.1822G>T" "r.(?)" "p.(Val608Phe)" "15" ""
"0000150715" "00016551" "90" "1846" "0" "1846" "0" "c.1846C>T" "r.(?)" "p.(Arg616*)" "15" ""
"0000150716" "00016551" "70" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "15" ""
"0000150717" "00016551" "50" "1937" "0" "1939" "0" "c.1937_1939del" "r.(?)" "p.(Phe646del)" "16" ""
"0000150718" "00016551" "70" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "4" ""
"0000150719" "00016551" "70" "424" "0" "424" "0" "c.424A>G" "r.(?)" "p.(Thr142Ala)" "5" ""
"0000150720" "00016551" "90" "458" "0" "458" "0" "c.458A>G" "r.(?)" "p.(Gln153Arg)" "5" ""
"0000150721" "00016551" "90" "541" "0" "541" "0" "c.541T>G" "r.(?)" "p.(Tyr181Asp)" "6" ""
"0000150722" "00016551" "30" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "7" ""
"0000150723" "00016551" "90" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Met263Val)" "8" ""
"0000150724" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" ""
"0000150725" "00016551" "30" "946" "0" "946" "0" "c.946A>T" "r.(?)" "p.(Arg316Trp)" "9" ""
"0000150726" "00016551" "30" "1237" "0" "1237" "0" "c.1237G>A" "r.(?)" "p.(Gly413Ser)" "11" ""
"0000150727" "00016551" "90" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "12" ""
"0000150728" "00016551" "90" "1375" "0" "1375" "0" "c.1375T>C" "r.(?)" "p.(Tyr459His)" "12" ""
"0000150729" "00016551" "90" "1475" "0" "1475" "0" "c.1475T>A" "r.(?)" "p.(Val492Glu)" "13" ""
"0000150730" "00016551" "30" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "13" ""
"0000150731" "00016551" "30" "1510" "0" "1510" "0" "c.1510G>A" "r.(?)" "p.(Gly504Arg)" "13" ""
"0000150732" "00016551" "90" "1615" "0" "1615" "0" "c.1615G>A" "r.(?)" "p.(Gly539Arg)" "13" ""
"0000150733" "00016551" "90" "1694" "0" "1694" "0" "c.1694T>C" "r.(?)" "p.(Leu565Pro)" "14" ""
"0000150734" "00016551" "90" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Cys569Tyr)" "14" ""
"0000150735" "00016551" "70" "1822" "0" "1822" "0" "c.1822G>T" "r.(?)" "p.(Val608Phe)" "15" ""
"0000150736" "00016551" "90" "1846" "0" "1846" "0" "c.1846C>T" "r.(?)" "p.(Arg616*)" "15" ""
"0000150737" "00016551" "70" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "15" ""
"0000150738" "00016551" "50" "1937" "0" "1939" "0" "c.1937_1939del" "r.(?)" "p.(Phe646del)" "16" ""
"0000150739" "00016551" "90" "568" "0" "580" "0" "c.568_580dup" "r.(?)" "p.(Arg194Leufs*16)" "6" ""
"0000150741" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" ""
"0000150742" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "9" ""
"0000248595" "00016551" "10" "387" "0" "387" "0" "c.387A>G" "r.(?)" "p.(Pro129=)" "" ""
"0000297273" "00016551" "10" "1067" "-13" "1067" "-13" "c.1067-13C>G" "r.(=)" "p.(=)" "" ""
"0000297274" "00016551" "10" "1248" "12" "1248" "12" "c.1248+12C>T" "r.(=)" "p.(=)" "" ""
"0000297275" "00016551" "10" "1248" "20" "1248" "20" "c.1248+20G>A" "r.(=)" "p.(=)" "" ""
"0000297276" "00016551" "10" "1455" "0" "1455" "0" "c.1455T>C" "r.(?)" "p.(Ala485=)" "" ""
"0000297277" "00016551" "10" "1716" "0" "1716" "0" "c.1716G>A" "r.(?)" "p.(Ser572=)" "" ""
"0000301145" "00016551" "10" "1815" "8" "1815" "8" "c.1815+8G>A" "r.(=)" "p.(=)" "" ""
"0000306208" "00016551" "50" "1190" "0" "1190" "0" "c.1190C>T" "r.(?)" "p.(Ser397Leu)" "" ""
"0000306209" "00016551" "30" "1785" "0" "1785" "0" "c.1785C>T" "r.(?)" "p.(Asn595=)" "" ""
"0000306210" "00016551" "30" "1815" "8" "1815" "8" "c.1815+8G>A" "r.(=)" "p.(=)" "" ""
"0000306211" "00016551" "10" "369" "0" "369" "0" "c.369C>T" "r.(?)" "p.(Ala123=)" "" ""
"0000306212" "00016551" "30" "687" "0" "687" "0" "c.687C>T" "r.(?)" "p.(Ala229=)" "" ""
"0000331630" "00016551" "30" "517" "-4" "517" "-4" "c.517-4G>A" "r.spl?" "p.?" "" ""
"0000331631" "00016551" "50" "878" "0" "878" "0" "c.878G>A" "r.(?)" "p.(Arg293Gln)" "" ""
"0000338702" "00016551" "10" "-47" "0" "-47" "0" "c.-47A>C" "r.(?)" "p.(=)" "" ""
"0000338703" "00016551" "10" "1067" "-13" "1067" "-13" "c.1067-13C>G" "r.(=)" "p.(=)" "" ""
"0000338704" "00016551" "10" "1248" "12" "1248" "12" "c.1248+12C>T" "r.(=)" "p.(=)" "" ""
"0000338705" "00016551" "10" "1248" "20" "1248" "20" "c.1248+20G>A" "r.(=)" "p.(=)" "" ""
"0000340433" "00016551" "10" "387" "0" "387" "0" "c.387A>G" "r.(?)" "p.(Pro129=)" "" ""
"0000340434" "00016551" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(Ala328=)" "" ""
"0000340435" "00016551" "10" "1455" "0" "1455" "0" "c.1455T>C" "r.(?)" "p.(Ala485=)" "" ""
"0000340436" "00016551" "10" "1716" "0" "1716" "0" "c.1716G>A" "r.(?)" "p.(Ser572=)" "" ""
"0000341474" "00016551" "10" "1508" "0" "1508" "0" "c.1508C>T" "r.(?)" "p.(Ala503Val)" "" ""
"0000342300" "00016551" "90" "667" "0" "667" "0" "c.667C>T" "r.(?)" "p.(Arg223Ter)" "" ""
"0000475044" "00016551" "90" "1615" "0" "1615" "0" "c.1615G>A" "r.(?)" "p.(Gly539Arg)" "" ""
"0000475045" "00016551" "70" "1000" "0" "1000" "0" "c.1000G>A" "r.(?)" "p.(Val334Ile)" "" ""
"0000532641" "00016551" "30" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Leu25Phe)" "" ""
"0000532642" "00016551" "50" "158" "0" "160" "0" "c.158_160del" "r.(?)" "p.(Glu53del)" "" ""
"0000532643" "00016551" "50" "272" "0" "272" "0" "c.272C>T" "r.(?)" "p.(Thr91Met)" "" ""
"0000532644" "00016551" "50" "409" "0" "409" "0" "c.409G>T" "r.(?)" "p.(Val137Phe)" "" ""
"0000532645" "00016551" "50" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "" ""
"0000532647" "00016551" "50" "813" "0" "813" "0" "c.813C>A" "r.(?)" "p.(Ser271Arg)" "" ""
"0000532648" "00016551" "90" "859" "0" "859" "0" "c.859G>C" "r.(?)" "p.(Ala287Pro)" "" ""
"0000532649" "00016551" "30" "1248" "10" "1248" "33" "c.1248+10_1248+33del" "r.(=)" "p.(=)" "" ""
"0000532651" "00016551" "30" "2751" "0" "2751" "0" "c.*708C>T" "r.(=)" "p.(=)" "" ""
"0000532652" "00016551" "50" "3662" "0" "3662" "0" "c.*1619C>T" "r.(=)" "p.(=)" "" ""
"0000532653" "00016551" "30" "4758" "0" "4758" "0" "c.*2715C>T" "r.(=)" "p.(=)" "" ""
"0000611192" "00016551" "30" "1029" "0" "1029" "0" "c.1029C>T" "r.(?)" "p.(Ala343=)" "" ""
"0000611193" "00016551" "30" "1041" "0" "1041" "0" "c.1041C>T" "r.(?)" "p.(Val347=)" "" ""
"0000611194" "00016551" "90" "1053" "0" "1053" "0" "c.1053del" "r.(?)" "p.(Asn352ThrfsTer69)" "" ""
"0000611195" "00016551" "30" "2652" "0" "2652" "0" "c.*609G>A" "r.(=)" "p.(=)" "" ""
"0000621923" "00016551" "30" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "" ""
"0000655887" "00016551" "50" "1709" "0" "1709" "0" "c.1709G>A" "r.(?)" "p.(Arg570His)" "" ""
"0000678172" "00016551" "30" "273" "0" "273" "0" "c.273G>A" "r.(?)" "p.(Thr91=)" "" ""
"0000678173" "00016551" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(Ala328=)" "" ""
"0000678174" "00016551" "90" "1329" "0" "1329" "0" "c.1329del" "r.(?)" "p.(Ile444SerfsTer101)" "" ""
"0000690069" "00016551" "30" "752" "0" "752" "0" "c.752T>C" "r.(?)" "p.(Val251Ala)" "" ""
"0000690070" "00016551" "50" "1264" "0" "1264" "0" "c.1264T>G" "r.(?)" "p.(Trp422Gly)" "" ""
"0000690071" "00016551" "30" "2031" "0" "2031" "0" "c.2031C>T" "r.(?)" "p.(Asp677=)" "" ""
"0000721547" "00016551" "30" "492" "0" "492" "0" "c.492G>A" "r.(?)" "p.(Val164=)" "" ""
"0000721548" "00016551" "50" "824" "0" "824" "0" "c.824A>G" "r.(?)" "p.(Gln275Arg)" "" ""
"0000721549" "00016551" "50" "1115" "0" "1115" "0" "c.1115C>T" "r.(?)" "p.(Thr372Met)" "" ""
"0000721550" "00016551" "70" "1175" "0" "1175" "0" "c.1175dup" "r.(?)" "p.(Ala393Glyfs*57)" "" ""
"0000721551" "00016551" "50" "1671" "0" "1671" "0" "c.1671C>T" "r.(?)" "p.(Gly557=)" "" ""
"0000803241" "00016551" "50" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "" ""
"0000803242" "00016551" "30" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Pro228Leu)" "" ""
"0000803243" "00016551" "30" "907" "0" "907" "0" "c.907C>T" "r.(?)" "p.(Leu303Phe)" "" ""
"0000803244" "00016551" "50" "1414" "0" "1414" "0" "c.1414G>A" "r.(?)" "p.(Val472Met)" "" ""
"0000851664" "00016551" "30" "369" "0" "369" "0" "c.369C>T" "r.(?)" "p.(Ala123=)" "" ""
"0000851665" "00016551" "30" "399" "0" "399" "0" "c.399C>T" "r.(?)" "p.(Asn133=)" "" ""
"0000851666" "00016551" "50" "803" "0" "803" "0" "c.803G>A" "r.(?)" "p.(Arg268Gln)" "" ""
"0000851667" "00016551" "30" "1501" "0" "1501" "0" "c.1501G>A" "r.(?)" "p.(Glu501Lys)" "" ""
"0000851668" "00016551" "50" "1702" "0" "1702" "0" "c.1702G>A" "r.(?)" "p.(Gly568Ser)" "" ""
"0000851669" "00016551" "30" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Val631Ile)" "" ""
"0000860902" "00016551" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Ala105Thr)" "" ""
"0000860903" "00016551" "30" "642" "-5" "642" "-5" "c.642-5C>G" "r.spl?" "p.?" "" ""
"0000860904" "00016551" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Glu273Lys)" "" ""
"0000860905" "00016551" "50" "1355" "0" "1355" "0" "c.1355C>T" "r.(?)" "p.(Pro452Leu)" "" ""
"0000887974" "00016551" "50" "640" "0" "640" "0" "c.640A>G" "r.(?)" "p.(Asn214Asp)" "" ""
"0000887975" "00016551" "50" "1069" "0" "1071" "0" "c.1069_1071del" "r.(?)" "p.(Glu357del)" "" ""
"0000912794" "00016551" "30" "1748" "0" "1748" "0" "c.1748C>T" "r.(?)" "p.(Ala583Val)" "" ""
"0000929375" "00016551" "10" "15" "0" "15" "0" "c.15A>G" "r.(?)" "p.(=)" "" ""
"0000954210" "00016551" "70" "1196" "0" "1204" "0" "c.1196_1204del" "r.(?)" "p.(Pro399_Glu401del)" "" ""
"0000954211" "00016551" "70" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "" ""
"0000954212" "00016551" "90" "1551" "0" "1551" "0" "c.1551dup" "r.(?)" "p.(Lys518GlnfsTer57)" "" ""
"0000954213" "00016551" "70" "1636" "0" "1636" "0" "c.1636T>C" "r.(?)" "p.(Phe546Leu)" "" ""
"0000954314" "00016551" "70" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "" ""
"0000954315" "00016551" "50" "1522" "0" "1522" "0" "c.1522G>A" "r.(?)" "p.(Gly508Ser)" "" ""
"0000954316" "00016551" "70" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457His)" "" ""
"0000954317" "00016551" "90" "1128" "0" "1128" "0" "c.1128C>A" "r.(?)" "p.(Tyr376Ter)" "" ""
"0000964673" "00016551" "50" "1702" "0" "1702" "0" "c.1702G>A" "r.(?)" "p.(Gly568Ser)" "" ""
"0000977852" "00016551" "50" "1427" "0" "1427" "0" "c.1427C>T" "r.(?)" "p.(Ala476Val)" "" ""
"0000996656" "00016551" "50" "764" "0" "764" "0" "c.764A>G" "r.(?)" "p.(Asp255Gly)" "" ""
"0000996657" "00016551" "30" "1148" "0" "1148" "0" "c.1148C>T" "r.(?)" "p.(Pro383Leu)" "" ""
"0000996658" "00016551" "90" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(Arg550Trp)" "" ""
"0000996659" "00016551" "50" "1709" "0" "1709" "0" "c.1709G>A" "r.(?)" "p.(Arg570His)" "" ""
"0000996660" "00016551" "50" "3141" "0" "3141" "0" "c.*1098G>A" "r.(=)" "p.(=)" "" ""
"0001036527" "00016551" "50" "319" "0" "319" "0" "c.319C>T" "r.(?)" "p.(Arg107Cys)" "" ""
"0001036528" "00016551" "50" "325" "0" "325" "0" "c.325G>A" "r.(?)" "p.(Gly109Arg)" "" ""
"0001036529" "00016551" "50" "344" "0" "344" "0" "c.344C>T" "r.(?)" "p.(Ala115Val)" "" ""
"0001036530" "00016551" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Asp211Asn)" "" ""
"0001036531" "00016551" "50" "668" "0" "668" "0" "c.668G>A" "r.(?)" "p.(Arg223Gln)" "" ""
"0001036532" "00016551" "50" "1408" "0" "1408" "0" "c.1408A>C" "r.(?)" "p.(Asn470His)" "" ""
"0001052706" "00016551" "10" "15" "0" "15" "0" "c.15A>G" "r.(?)" "p.(=)" "" ""
"0001052707" "00016551" "50" "1108" "0" "1108" "0" "c.1108T>C" "r.(?)" "p.(Tyr370His)" "" ""
"0001052708" "00016551" "50" "1565" "0" "1565" "0" "c.1565G>A" "r.(?)" "p.(Arg522His)" "" ""
"0001064731" "00016551" "70" "1820" "0" "1820" "0" "c.1820A>G" "r.(?)" "p.(Tyr607Cys)" "" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 83
"{{screeningid}}" "{{variantid}}"
"0000091843" "0000150036"
"0000091844" "0000150037"
"0000091845" "0000150038"
"0000091846" "0000150039"
"0000091847" "0000150040"
"0000091848" "0000150041"
"0000091849" "0000150042"
"0000091850" "0000150043"
"0000091851" "0000150044"
"0000091852" "0000150045"
"0000091852" "0000150046"
"0000091853" "0000150047"
"0000091854" "0000150048"
"0000091855" "0000150049"
"0000091856" "0000150050"
"0000091857" "0000150051"
"0000091858" "0000150052"
"0000091859" "0000150053"
"0000091860" "0000150054"
"0000091861" "0000150055"
"0000091862" "0000150056"
"0000091863" "0000150057"
"0000091864" "0000150058"
"0000091865" "0000150059"
"0000091866" "0000150060"
"0000091867" "0000150061"
"0000091868" "0000150062"
"0000091869" "0000150063"
"0000091870" "0000150064"
"0000091871" "0000150065"
"0000091872" "0000150066"
"0000091873" "0000150067"
"0000091874" "0000150068"
"0000091874" "0000150069"
"0000091875" "0000150070"
"0000091875" "0000150071"
"0000091876" "0000150072"
"0000091877" "0000150073"
"0000091878" "0000150074"
"0000091878" "0000150075"
"0000091878" "0000150076"
"0000091878" "0000150077"
"0000091878" "0000150078"
"0000091878" "0000150079"
"0000091878" "0000150080"
"0000091878" "0000150081"
"0000091879" "0000150082"
"0000091879" "0000150083"
"0000091879" "0000150084"
"0000091879" "0000150085"
"0000091879" "0000150086"
"0000091879" "0000150087"
"0000091879" "0000150088"
"0000091880" "0000150089"
"0000091881" "0000150090"
"0000091882" "0000150091"
"0000091882" "0000150092"
"0000091883" "0000150093"
"0000091884" "0000150094"
"0000091884" "0000150095"
"0000091885" "0000150096"
"0000091885" "0000150097"
"0000091886" "0000150098"
"0000091887" "0000150099"
"0000091888" "0000150100"
"0000091889" "0000150101"
"0000091890" "0000150102"
"0000091925" "0000150138"
"0000091925" "0000150739"
"0000091928" "0000150141"
"0000091928" "0000150741"
"0000091930" "0000150143"
"0000091930" "0000150742"
"0000232545" "0000475044"
"0000232627" "0000475045"
"0000446000" "0000954210"
"0000446000" "0000954314"
"0000446001" "0000954211"
"0000446001" "0000954315"
"0000446002" "0000954212"
"0000446002" "0000954316"
"0000446003" "0000954213"
"0000446003" "0000954317"