### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = POU3F3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "POU3F3" "POU class 3 homeobox 3" "2" "q12.1" "unknown" "NC_000002.11" "UD_136090212945" "" "https://www.LOVD.nl/POU3F3" "" "1" "9216" "5455" "602480" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/POU3F3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-08-08 08:28:34" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00016573" "POU3F3" "POU class 3 homeobox 3" "001" "NM_006236.1" "" "NP_006227.1" "" "" "" "1" "1503" "1503" "105471969" "105473471" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06487" "SNIBFIS" "Snijders Blok-Fisher syndrome" "AD" "618604" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "POU3F3" "05611" "POU3F3" "06487" ## Individuals ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00260807" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat1" "00260808" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat2" "00260809" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat3" "00260810" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat4" "00260811" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat5" "00260812" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat6" "00260813" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat7" "00260814" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat8" "00260815" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat9" "00260816" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat10" "00260817" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat11" "00260818" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat12" "00260819" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat13" "00260820" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "F" "" "" "" "0" "" "" "" "Pat14" "00260821" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat15" "00260822" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat16" "00260823" "" "" "" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "" "M" "" "" "" "0" "" "" "" "Pat17" "00260824" "" "" "" "2" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "family, affected mother/daughter" "F" "" "" "" "0" "" "" "" "Pat18" "00260825" "" "" "00260824" "1" "" "00006" "{PMID:Snijders Blok 2019:31303265}" "daughter" "F" "" "" "" "0" "" "" "" "Pat19" "00458114" "" "" "" "1" "" "01164" "" "" "F" "no" "? (unknown)" "" "0" "" "" "" "312272" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 20 "{{individualid}}" "{{diseaseid}}" "00260807" "05611" "00260808" "05611" "00260809" "05611" "00260810" "05611" "00260811" "05611" "00260812" "05611" "00260813" "05611" "00260814" "05611" "00260815" "05611" "00260816" "05611" "00260817" "05611" "00260818" "05611" "00260819" "05611" "00260820" "05611" "00260821" "05611" "00260822" "05611" "00260823" "05611" "00260824" "05611" "00260825" "05611" "00458114" "06487" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 05611, 06487 ## Count = 20 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000199340" "05611" "00260807" "00006" "Isolated (sporadic)" "20y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199341" "05611" "00260808" "00006" "Isolated (sporadic)" "1y9m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199342" "05611" "00260809" "00006" "Isolated (sporadic)" "14y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199343" "05611" "00260810" "00006" "Isolated (sporadic)" "5y8m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199344" "05611" "00260811" "00006" "Isolated (sporadic)" "3y6m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199345" "05611" "00260812" "00006" "Isolated (sporadic)" "12y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199346" "05611" "00260813" "00006" "Isolated (sporadic)" "6y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199347" "05611" "00260814" "00006" "Isolated (sporadic)" "6y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199348" "05611" "00260815" "00006" "Isolated (sporadic)" "15y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199349" "05611" "00260816" "00006" "Isolated (sporadic)" "4y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199350" "05611" "00260817" "00006" "Isolated (sporadic)" "5y3m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199351" "05611" "00260818" "00006" "Isolated (sporadic)" "10y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199352" "05611" "00260819" "00006" "Isolated (sporadic)" "24y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199353" "05611" "00260820" "00006" "Isolated (sporadic)" "41y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199354" "05611" "00260821" "00006" "Isolated (sporadic)" "13m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199355" "05611" "00260822" "00006" "Isolated (sporadic)" "7y9m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199356" "05611" "00260823" "00006" "Isolated (sporadic)" "12y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199357" "05611" "00260824" "00006" "Familial, autosomal dominant" "2y2m" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000199358" "05611" "00260825" "00006" "Isolated (sporadic)" "30y" "see paper; …" "" "" "" "" "" "" "" "neurodevelopmental disorder" "0000346559" "06487" "00458114" "01164" "Unknown" "03y" "Global developmental delay" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000261912" "00260807" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261913" "00260808" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261914" "00260809" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261915" "00260810" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261916" "00260811" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261917" "00260812" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261918" "00260813" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261919" "00260814" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261920" "00260815" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261921" "00260816" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261922" "00260817" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261923" "00260818" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261924" "00260819" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261925" "00260820" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261926" "00260821" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261927" "00260822" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261928" "00260823" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261929" "00260824" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000261930" "00260825" "1" "00006" "00006" "2019-08-08 08:44:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000459733" "00458114" "1" "01164" "01164" "2024-12-02 15:00:58" "" "" "SEQ-NG-I" "DNA" "Blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 20 "{{screeningid}}" "{{geneid}}" "0000261912" "POU3F3" "0000261913" "POU3F3" "0000261914" "POU3F3" "0000261915" "POU3F3" "0000261916" "POU3F3" "0000261917" "POU3F3" "0000261918" "POU3F3" "0000261919" "POU3F3" "0000261920" "POU3F3" "0000261921" "POU3F3" "0000261922" "POU3F3" "0000261923" "POU3F3" "0000261924" "POU3F3" "0000261925" "POU3F3" "0000261926" "POU3F3" "0000261927" "POU3F3" "0000261928" "POU3F3" "0000261929" "POU3F3" "0000261930" "POU3F3" "0000459733" "POU3F3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 44 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000299065" "0" "50" "2" "105472214" "105472235" "del" "0" "02329" "POU3F3_000001" "g.105472214_105472235del" "" "" "" "POU3F3(NM_006236.3):c.246_267delGGCCGCCAGCAACGGCGGCCAT (p.M82Ifs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.104855756_104855777del" "" "VUS" "" "0000342839" "0" "50" "2" "105473187" "105473187" "subst" "0" "02327" "POU3F3_000004" "g.105473187C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.104856729C>G" "" "VUS" "" "0000344388" "0" "50" "2" "105473252" "105473252" "subst" "0" "02327" "POU3F3_000005" "g.105473252C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.104856794C>A" "" "VUS" "" "0000508829" "0" "30" "2" "105472797" "105472799" "del" "0" "02325" "POU3F3_000006" "g.105472797_105472799del" "" "" "" "POU3F3(NM_006236.3):c.829_831delCAC (p.H277del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.104856339_104856341del" "" "likely benign" "" "0000508830" "0" "50" "2" "105473271" "105473273" "del" "0" "02325" "POU3F3_000007" "g.105473271_105473273del" "" "" "" "POU3F3(NM_006236.3):c.1303_1305delGAG (p.E435del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.104856813_104856815del" "" "VUS" "" "0000592031" "0" "90" "2" "105473053" "105473053" "subst" "0" "00006" "POU3F3_000015" "g.105473053G>T" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856595G>T" "" "pathogenic (dominant)" "" "0000592032" "0" "90" "2" "105473053" "105473053" "subst" "0" "00006" "POU3F3_000015" "g.105473053G>T" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856595G>T" "" "pathogenic (dominant)" "" "0000592033" "0" "90" "2" "105473187" "105473187" "subst" "0" "00006" "POU3F3_000004" "g.105473187C>G" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856729C>G" "" "pathogenic (dominant)" "" "0000592034" "0" "90" "2" "105473188" "105473188" "subst" "0" "00006" "POU3F3_000017" "g.105473188G>T" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856730G>T" "" "pathogenic (dominant)" "" "0000592035" "0" "90" "2" "105473335" "105473335" "subst" "0" "00006" "POU3F3_000020" "g.105473335A>G" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856877A>G" "" "pathogenic (dominant)" "" "0000592036" "0" "90" "2" "105472960" "105472974" "del" "0" "00006" "POU3F3_000014" "g.105472960_105472974del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856502_104856516del" "" "pathogenic (dominant)" "" "0000592037" "0" "90" "2" "105472157" "105472157" "subst" "0" "00006" "POU3F3_000008" "g.105472157C>A" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104855699C>A" "" "pathogenic (dominant)" "" "0000592038" "0" "90" "2" "105472164" "105472165" "delins" "0" "00006" "POU3F3_000009" "g.105472164_105472165delinsT" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104855706_104855707delinsT" "" "pathogenic (dominant)" "" "0000592039" "0" "90" "2" "105472214" "105472235" "del" "0" "00006" "POU3F3_000001" "g.105472214_105472235del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104855756_104855777del" "" "pathogenic (dominant)" "" "0000592040" "0" "90" "2" "105472334" "105472335" "del" "0" "00006" "POU3F3_000003" "g.105472334_105472335del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104855876_104855877del" "" "pathogenic (dominant)" "" "0000592041" "0" "90" "2" "105472404" "105472405" "dup" "0" "00006" "POU3F3_000010" "g.105472404_105472405dup" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104855946_104855947dup" "" "pathogenic (dominant)" "" "0000592042" "0" "90" "2" "105472492" "105472492" "del" "0" "00006" "POU3F3_000011" "g.105472492del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856034del" "" "pathogenic (dominant)" "" "0000592043" "0" "90" "2" "105472636" "105472636" "subst" "0" "00006" "POU3F3_000012" "g.105472636C>A" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856178C>A" "" "pathogenic (dominant)" "" "0000592044" "0" "90" "2" "105472742" "105472742" "del" "0" "00006" "POU3F3_000013" "g.105472742del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856284del" "" "pathogenic (dominant)" "" "0000592045" "0" "90" "2" "105473165" "105473165" "del" "0" "00006" "POU3F3_000016" "g.105473165del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856707del" "" "pathogenic (dominant)" "" "0000592046" "0" "90" "2" "105473208" "105473208" "subst" "0" "00006" "POU3F3_000018" "g.105473208G>T" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856750G>T" "" "pathogenic (dominant)" "" "0000592047" "0" "90" "2" "105473252" "105473252" "subst" "0" "00006" "POU3F3_000005" "g.105473252C>A" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "De novo" "" "" "0" "" "" "g.104856794C>A" "" "pathogenic (dominant)" "" "0000592048" "21" "90" "2" "105473320" "105473330" "del" "0" "00006" "POU3F3_000019" "g.105473320_105473330del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "Germline" "" "" "0" "" "" "g.104856862_104856872del" "" "pathogenic (dominant)" "" "0000592049" "0" "90" "2" "105473320" "105473330" "del" "0" "00006" "POU3F3_000019" "g.105473320_105473330del" "" "{PMID:Snijders Blok 2019:31303265}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.104856862_104856872del" "" "pathogenic (dominant)" "" "0000606034" "0" "70" "2" "105472960" "105472974" "del" "0" "01943" "POU3F3_000014" "g.105472960_105472974del" "" "" "" "POU3F3(NM_006236.2):c.992_1006delAGCGGCGCATCAAGC (p.Q331_K335del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.104856502_104856516del" "" "likely pathogenic" "" "0000675978" "0" "50" "2" "105472705" "105472707" "dup" "0" "02325" "POU3F3_000023" "g.105472705_105472707dup" "" "" "" "POU3F3(NM_006236.3):c.737_739dupGCG (p.G246dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688274" "0" "70" "2" "105472998" "105472998" "subst" "0" "02327" "POU3F3_000024" "g.105472998G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000688275" "0" "70" "2" "105473081" "105473081" "subst" "0" "02327" "POU3F3_000025" "g.105473081G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000848899" "0" "50" "2" "105472591" "105472591" "subst" "0" "01943" "POU3F3_000026" "g.105472591C>A" "" "" "" "POU3F3(NM_006236.2):c.623C>A (p.S208Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000857658" "0" "70" "2" "105473115" "105473123" "del" "0" "02325" "POU3F3_000027" "g.105473115_105473123del" "" "" "" "POU3F3(NM_006236.3):c.1147_1155delTGGCTGGAG (p.W383_E385del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000883685" "0" "70" "2" "105472039" "105472039" "subst" "0" "02327" "POU3F3_000028" "g.105472039C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000883686" "0" "70" "2" "105472623" "105472624" "del" "0" "01804" "POU3F3_000029" "g.105472623_105472624del" "" "" "" "POU3F3(NM_006236.1):c.653_654del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000923269" "0" "50" "2" "105473259" "105473259" "subst" "0" "02329" "POU3F3_000030" "g.105473259C>G" "" "" "" "POU3F3(NM_006236.3):c.1291C>G (p.P431A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947327" "0" "50" "2" "105472989" "105472989" "subst" "0" "02327" "POU3F3_000031" "g.105472989G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000961246" "0" "30" "2" "105472577" "105472579" "del" "0" "02329" "POU3F3_000032" "g.105472577_105472579del" "" "" "" "POU3F3(NM_006236.3):c.609_611delCGC (p.A204del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991516" "0" "30" "2" "105472298" "105472300" "del" "0" "01804" "POU3F3_000033" "g.105472298_105472300del" "" "" "" "POU3F3(NM_006236.1):c.330_332delTGC (p.(Ala111del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000991517" "0" "50" "2" "105472702" "105472707" "dup" "0" "01804" "POU3F3_000034" "g.105472702_105472707dup" "" "" "" "POU3F3(NM_006236.1):c.734_739dupGCGGCG (p.(Gly245_Gly246dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000991518" "0" "50" "2" "105472812" "105472812" "subst" "0" "01804" "POU3F3_000035" "g.105472812C>G" "" "" "" "POU3F3(NM_006236.1):c.844C>G (p.(Pro282Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001017847" "0" "70" "2" "105473230" "105473230" "subst" "0" "01164" "POU3F3_000036" "g.105473230T>C" "" "" "" "" "ACMG: PP3_STR, PS2_SUP, PM2_SUP; confirmed de novo in trio exome" "De novo" "-" "" "0" "" "" "g.104856772T>C" "" "likely pathogenic (dominant)" "ACMG" "0001032287" "0" "50" "2" "105472719" "105472719" "subst" "0" "01804" "POU3F3_000037" "g.105472719G>T" "" "" "" "POU3F3(NM_006236.3):c.751G>T (p.(Ala251Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001032288" "0" "30" "2" "105472867" "105472869" "dup" "0" "01804" "POU3F3_000038" "g.105472867_105472869dup" "" "" "" "POU3F3(NM_006236.3):c.899_901dup (p.(Gly300dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001050743" "0" "30" "2" "105472843" "105472843" "subst" "0.000105654" "01804" "POU3F3_000039" "g.105472843C>A" "" "" "" "POU3F3(NM_006236.3):c.875C>A (p.(Pro292Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001050744" "0" "50" "2" "105473245" "105473245" "subst" "0" "01804" "POU3F3_000040" "g.105473245T>A" "" "" "" "POU3F3(NM_006236.3):c.1277T>A (p.(Leu426His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063487" "0" "50" "2" "105472897" "105472897" "subst" "0" "02325" "POU3F3_000041" "g.105472897C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes POU3F3 ## Count = 44 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000299065" "00016573" "50" "246" "0" "267" "0" "c.246_267del" "r.(?)" "p.(Met82IlefsTer3)" "" "0000342839" "00016573" "50" "1219" "0" "1219" "0" "c.1219C>G" "r.(?)" "p.(Arg407Gly)" "" "0000344388" "00016573" "50" "1284" "0" "1284" "0" "c.1284C>A" "r.(?)" "p.(Cys428Ter)" "" "0000508829" "00016573" "30" "829" "0" "831" "0" "c.829_831del" "r.(?)" "p.(His277del)" "" "0000508830" "00016573" "50" "1303" "0" "1305" "0" "c.1303_1305del" "r.(?)" "p.(Glu435del)" "" "0000592031" "00016573" "90" "1085" "0" "1085" "0" "c.1085G>T" "r.(?)" "p.(Arg362Leu)" "" "0000592032" "00016573" "90" "1085" "0" "1085" "0" "c.1085G>T" "r.(?)" "p.(Arg362Leu)" "" "0000592033" "00016573" "90" "1219" "0" "1219" "0" "c.1219C>G" "r.(?)" "p.(Arg407Gly)" "" "0000592034" "00016573" "90" "1220" "0" "1220" "0" "c.1220G>T" "r.(?)" "p.(Arg407Leu)" "" "0000592035" "00016573" "90" "1367" "0" "1367" "0" "c.1367A>G" "r.(?)" "p.(Asn456Ser)" "" "0000592036" "00016573" "90" "992" "0" "1006" "0" "c.992_1006del" "r.(?)" "p.(Gln331_Lys335del)" "" "0000592037" "00016573" "90" "189" "0" "189" "0" "c.189C>A" "r.(?)" "p.(Tyr63*)" "" "0000592038" "00016573" "90" "196" "0" "197" "0" "c.196_197delinsT" "r.(?)" "p.(Asp66Serfs*26)" "" "0000592039" "00016573" "90" "246" "0" "267" "0" "c.246_267del" "r.(?)" "p.(Met82Ilefs*3)" "" "0000592040" "00016573" "90" "366" "0" "367" "0" "c.366_367del" "r.(?)" "p.(Trp122Cysfs*517)" "" "0000592041" "00016573" "90" "436" "0" "437" "0" "c.436_437dup" "r.(?)" "p.(Pro147Alafs*4)" "" "0000592042" "00016573" "90" "524" "0" "524" "0" "c.524del" "r.(?)" "p.(Pro175Argfs*56)" "" "0000592043" "00016573" "90" "668" "0" "668" "0" "c.668C>A" "r.(?)" "p.(Ser223*)" "" "0000592044" "00016573" "90" "774" "0" "774" "0" "c.774del" "r.(?)" "p.(Leu259Trpfs*110)" "" "0000592045" "00016573" "90" "1197" "0" "1197" "0" "c.1197del" "r.(?)" "p.(Ile400Serfs*16)" "" "0000592046" "00016573" "90" "1240" "0" "1240" "0" "c.1240G>T" "r.(?)" "p.(Glu414*)" "" "0000592047" "00016573" "90" "1284" "0" "1284" "0" "c.1284C>A" "r.(?)" "p.(Cys428*)" "" "0000592048" "00016573" "90" "1352" "0" "1362" "0" "c.1352_1362del" "r.(?)" "p.(Arg451Leufs*185)" "" "0000592049" "00016573" "90" "1352" "0" "1362" "0" "c.1352_1362del" "r.(?)" "p.(Arg451Leufs*185)" "" "0000606034" "00016573" "70" "992" "0" "1006" "0" "c.992_1006del" "r.(?)" "p.(Gln331_Lys335del)" "" "0000675978" "00016573" "50" "737" "0" "739" "0" "c.737_739dup" "r.(?)" "p.(Gly246dup)" "" "0000688274" "00016573" "70" "1030" "0" "1030" "0" "c.1030G>C" "r.(?)" "p.(Gly344Arg)" "" "0000688275" "00016573" "70" "1113" "0" "1113" "0" "c.1113G>C" "r.(?)" "p.(Lys371Asn)" "" "0000848899" "00016573" "50" "623" "0" "623" "0" "c.623C>A" "r.(?)" "p.(Ser208Tyr)" "" "0000857658" "00016573" "70" "1147" "0" "1155" "0" "c.1147_1155del" "r.(?)" "p.(Trp383_Glu385del)" "" "0000883685" "00016573" "70" "71" "0" "71" "0" "c.71C>A" "r.(?)" "p.(Ser24*)" "" "0000883686" "00016573" "70" "655" "0" "656" "0" "c.655_656del" "r.(?)" "p.(Leu220Alafs*?)" "" "0000923269" "00016573" "50" "1291" "0" "1291" "0" "c.1291C>G" "r.(?)" "p.(Pro431Ala)" "" "0000947327" "00016573" "50" "1021" "0" "1021" "0" "c.1021G>C" "r.(?)" "p.(Ala341Pro)" "" "0000961246" "00016573" "30" "609" "0" "611" "0" "c.609_611del" "r.(?)" "p.(Ala204del)" "" "0000991516" "00016573" "30" "330" "0" "332" "0" "c.330_332del" "r.(?)" "p.(Ala115del)" "" "0000991517" "00016573" "50" "734" "0" "739" "0" "c.734_739dup" "r.(?)" "p.(Gly245_Gly246dup)" "" "0000991518" "00016573" "50" "844" "0" "844" "0" "c.844C>G" "r.(?)" "p.(Pro282Ala)" "" "0001017847" "00016573" "70" "1262" "0" "1262" "0" "c.1262T>C" "r.(?)" "p.(Leu421Pro)" "1" "0001032287" "00016573" "50" "751" "0" "751" "0" "c.751G>T" "r.(?)" "p.(Ala251Ser)" "" "0001032288" "00016573" "30" "899" "0" "901" "0" "c.899_901dup" "r.(?)" "p.(Gly300dup)" "" "0001050743" "00016573" "30" "875" "0" "875" "0" "c.875C>A" "r.(?)" "p.(Pro292Gln)" "" "0001050744" "00016573" "50" "1277" "0" "1277" "0" "c.1277T>A" "r.(?)" "p.(Leu426His)" "" "0001063487" "00016573" "50" "929" "0" "929" "0" "c.929C>T" "r.(?)" "p.(Pro310Leu)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 20 "{{screeningid}}" "{{variantid}}" "0000261912" "0000592031" "0000261913" "0000592032" "0000261914" "0000592033" "0000261915" "0000592034" "0000261916" "0000592035" "0000261917" "0000592036" "0000261918" "0000592037" "0000261919" "0000592038" "0000261920" "0000592039" "0000261921" "0000592040" "0000261922" "0000592041" "0000261923" "0000592042" "0000261924" "0000592043" "0000261925" "0000592044" "0000261926" "0000592045" "0000261927" "0000592046" "0000261928" "0000592047" "0000261929" "0000592049" "0000261930" "0000592048" "0000459733" "0001017847"