### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = PRDM13)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"PRDM13"	"PR domain containing 13"	"6"	"q16.2"	"unknown"	"NC_000006.11"	"UD_136090282970"	""	"https://www.LOVD.nl/PRDM13"	""	"1"	"13998"	"59336"	"616741"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/PRDM13_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2021-01-28 14:01:53"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00016784"	"PRDM13"	"PR domain containing 13"	"001"	"NM_021620.3"	""	"NP_067633.2"	""	""	""	"-261"	"2943"	"2124"	"100054650"	"100063454"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 9
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"04249"	"macular dystrophy"	"dystrophy, macular"	""	""	""	""	""	"00006"	"2015-05-04 22:10:58"	"00006"	"2024-02-15 21:18:39"
"05331"	"PCH"	"hypoplasia, pontocerebellar (PCH)"	"AD;AR"	""	"cerebellum"	""	"non-degenerative form of pontocerebellar hypoplasia"	"00001"	"2017-09-25 12:19:57"	"00006"	"2021-12-10 21:51:32"
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"
"05957"	"MCDR1"	"dystrophy, macular, type 1, North Carolina type  (MCDR1)"	"AD"	"136550"	""	""	""	"00006"	"2021-07-27 12:53:42"	""	""
"06936"	"CDIDHH"	"cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism"	"AR"	"619761"	""	""	""	"00006"	"2022-04-18 11:49:00"	""	""
"06972"	"PCH17"	"hypoplasia, pontocerebellar, type 17"	"AR"	"619909"	""	""	""	"00006"	"2022-10-17 11:06:47"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"PRDM13"	"06936"
"PRDM13"	"06972"


## Individuals ## Do not remove or alter this header ##
## Count = 77
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00309303"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00333735"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"F"	""	"(United States)"	""	"0"	""	""	""	"916"
"00333736"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"917"
"00377571"	""	""	""	"51"	""	"00006"	"{PMID:Small 2016:26507665}"	"8-generation family, 51 affected"	"F;M"	""	"United States"	""	"0"	""	""	""	"FamA"
"00377572"	""	""	""	"13"	""	"00006"	"{PMID:Small 2016:26507665}"	"5-generation family, 13 affected (5F, 8M)"	"F;M"	""	"United States"	""	"0"	""	""	""	"FamB"
"00377573"	""	""	""	"18"	""	"00006"	"{PMID:Small 2016:26507665}"	"6-generation family, 18 affected (12F, 3M)"	"F;M"	""	"United States"	""	"0"	""	""	""	"FamC"
"00377574"	""	""	""	"7"	""	"00006"	"{PMID:Small 2016:26507665}"	"3-generation family, 7 affected (2F, 5M)"	"F;M"	""	"United States"	""	"0"	""	""	""	"FamD"
"00377575"	""	""	""	"4"	""	"00006"	"{PMID:Small 2016:26507665}"	"3-generation family, 4 affected (2F, 2M)"	"F;M"	""	"United States"	""	"0"	""	""	""	"FamE"
"00377576"	""	""	""	"8"	""	"00006"	"{PMID:Small 2016:26507665}"	"4-generation family, 8 affected (3F, 5M)"	"F;M"	""	""	""	"0"	""	""	""	"FamF"
"00377577"	""	""	""	"15"	""	"00006"	"{PMID:Small 2016:26507665}"	"5-generation family, 15 affected (8F, 7M)"	"F;M"	""	"France"	""	"0"	""	""	""	"FamG"
"00377578"	""	""	""	"5"	""	"00006"	"{PMID:Small 2016:26507665}"	"3-generation family, 5 affected (3F, 2M)"	"F;M"	""	""	""	"0"	""	""	""	"FamH"
"00377579"	""	""	""	"14"	""	"00006"	"{PMID:Small 2016:26507665}"	"5-generation family, 14 affected (4F, 10M)"	"F;M"	""	""	""	"0"	""	""	""	"FamI"
"00377580"	""	""	""	"3"	""	"00006"	"{PMID:Small 2016:26507665}"	"3-generation family, 11 affected (3F)"	"F"	""	""	""	"0"	""	""	""	"FamJ"
"00377581"	""	""	""	"17"	""	"00006"	"{PMID:Small 2016:26507665}"	"5-generation family, 17 affected (11F, 6M)"	"F;M"	""	"Belize"	""	"0"	""	""	""	"FamK"
"00377587"	""	""	""	"6"	""	"00006"	"{PMID:Namburi 2020:32476814}"	"4-generation family, 6 affected (6F)"	"F"	""	"Georgia"	""	"0"	""	""	"Jewish"	"MOL1154"
"00380104"	""	""	""	"1"	""	"00000"	"{PMID:Kersten 2018:30215852}"	""	"M"	""	""	""	"0"	""	""	""	"?"
"00408252"	""	""	""	"2"	""	"00006"	"{PMID:Whittaker 2021:34730112}"	"2-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives"	"F;M"	"yes"	"Malta"	""	"0"	""	""	""	"FamPatVI3/4"
"00408253"	""	""	""	"1"	""	"00006"	"{PMID:Whittaker 2021:34730112}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"M"	""	"Malta"	""	"0"	""	""	""	"Pat3"
"00408254"	""	""	""	"3"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"2-generation family, 3 affected, unaffected heterozygous carrier parents"	"F"	"yes"	"Tunisia"	"25m"	"0"	""	""	""	"Fam1PatII1"
"00408255"	""	""	"00408254"	"1"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"fetus"	"F"	"yes"	"Tunisia"	"<0d"	"0"	""	""	""	"Fam1PatII4"
"00408256"	""	""	"00408254"	"1"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"brother"	"M"	"yes"	"Tunisia"	"4m"	"0"	""	""	""	"Fam1PatII6"
"00408257"	""	""	""	"2"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"2-generation family, 2 affected, unaffected heterozygous carrier parents; fetus"	"F"	"yes"	"Algeria"	"<0d"	"0"	""	""	""	"Fam2PatII1"
"00408258"	""	""	"00408257"	"1"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"brother"	"M"	"yes"	"Algeria"	"22d"	"0"	""	""	""	"Fam2PatII2"
"00408259"	""	""	""	"2"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"2-generation family, 2 affected sisters, unaffected heterozygous carrier parents"	"F"	""	"Pakistan"	""	"0"	""	""	""	"Fam3PatII1"
"00408260"	""	""	"00408259"	"1"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"sister"	"F"	""	"Pakistan"	""	"0"	""	""	""	"Fam3PatII2"
"00408261"	""	""	""	"1"	""	"00006"	"{PMID:Coolen 2022:35390279}"	"2-generation family, 1 affected, unaffected parents"	"M"	"yes"	""	"16m"	"0"	""	""	"Arab"	"Fam4PatII3"
"00415386"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"M"	""	""	""	"0"	""	""	""	"8603"
"00415387"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"M"	""	""	""	"0"	""	""	""	"8687"
"00415388"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"M"	""	""	""	"0"	""	""	""	"8602"
"00415389"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"M"	""	""	""	"0"	""	""	""	"8686"
"00415390"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"F"	""	""	""	"0"	""	""	""	"9395"
"00415391"	""	""	""	"1"	""	"00000"	"{PMID:Bowne 2016:27777503}"	"family RFS355; four-generation family"	"F"	""	""	""	"0"	""	""	""	"8688"
"00415415"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC4059, patient III:9 (proband)"	"M"	""	""	""	"0"	""	""	""	"III:9"
"00415416"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC4059, patient IV:1"	"F"	""	""	""	"0"	""	""	""	"IV:1"
"00415417"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC4059, patient IV:5"	"M"	""	""	""	"0"	""	""	""	"IV:5"
"00415418"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC4059, patient IV:7"	"F"	""	""	""	"0"	""	""	""	"IV:7"
"00415419"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC21086, patient II:2 (proband)"	"M"	""	""	""	"0"	""	""	""	"II:2"
"00415420"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC21086, patient III:2"	"F"	""	""	""	"0"	""	""	""	"III:2"
"00415421"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC21086, patient III:3"	"F"	""	""	""	"0"	""	""	""	"III:3"
"00415422"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC21086, patient IV:1"	"M"	""	""	""	"0"	""	""	""	"IV:1"
"00415423"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC21086, patient IV:2"	"M"	""	""	""	"0"	""	""	""	"IV:2"
"00415424"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC20008, patient II:2"	"F"	""	""	""	"0"	""	""	"East Asian/Caucasian"	"II:2"
"00415425"	""	""	""	"1"	""	"00000"	"{PMID:Silva 2019:30710461}"	"family GC20008, patient III:1"	"M"	""	""	""	"0"	""	""	""	"III:1"
"00415512"	""	""	""	"1"	""	"00000"	"{PMID:Small 2019:31043363}"	"family 731, patient 1 (IV:2, proband)"	"M"	""	"United States"	""	"0"	""	""	"Californian"	"1"
"00415513"	""	""	""	"1"	""	"00000"	"{PMID:Small 2019:31043363}"	"family 731, patient 104 (V:2, proband\'s son)"	"M"	""	"United States"	""	"0"	""	""	"Californian"	"104"
"00415514"	""	""	""	"1"	""	"00000"	"{PMID:Small 2019:31043363}"	"family 731, patient 8000 (III:3, proband\'s father)"	"M"	""	"United States"	""	"0"	""	""	"Californian"	"8000"
"00423305"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family A, individual I:2"	"F"	""	""	""	"0"	""	""	""	"A.I:2"
"00423306"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family A, individual I:3"	"F"	""	""	""	"0"	""	""	""	"A.I:3"
"00423307"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family A, individual II:1"	"F"	""	""	""	"0"	""	""	""	"A.II:1"
"00423308"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family A, individual II:3"	"F"	""	""	""	"0"	""	""	""	"A.II:3"
"00423309"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family A, individual II:4"	"F"	""	""	""	"0"	""	""	""	"A.II:4"
"00423310"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family B, individual I:1"	"F"	""	""	""	"0"	""	""	""	"B.I:1"
"00423311"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family B, individual II:1"	"M"	""	""	""	"0"	""	""	""	"B.II:1"
"00423312"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family B, individual II:2"	"F"	""	""	""	"0"	""	""	""	"B.II:2"
"00423313"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family B, individual III:1"	"M"	""	""	""	"0"	""	""	""	"B.III:1"
"00423314"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family B, individual III:2"	"M"	""	""	""	"0"	""	""	""	"B.III:2"
"00423315"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family C, individual I:1"	"F"	""	""	""	"0"	""	""	""	"C.I:1"
"00423316"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family C, individual II:1"	"F"	""	""	""	"0"	""	""	""	"C.II:1"
"00423317"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family C, individual II:2"	"M"	""	""	""	"0"	""	""	""	"C.II:2"
"00423318"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family D, individual I:1"	"M"	""	""	""	"0"	""	""	""	"D.I:1"
"00423319"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family D, individual II:1"	"F"	""	""	""	"0"	""	""	""	"D.II:1"
"00423320"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family D, individual III:1"	"F"	""	""	""	"0"	""	""	""	"D.III:1"
"00423321"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family E, individual I:1; also sister and her daughter affected but not tested"	"F"	""	""	""	"0"	""	""	""	"E.I:1"
"00423322"	""	""	""	"1"	""	"00000"	"{PMID:Birtel 2021:33785507}"	"Family F, individual I:1"	""	""	""	""	"0"	""	""	""	"F.I:1"
"00423323"	""	""	""	"1"	""	"00000"	"{PMID:Green 2021:34125159}"	"Family 123660, individual II:2"	"F"	""	""	""	"0"	""	""	""	"123660"
"00423324"	""	""	""	"1"	""	"00000"	"{PMID:Green 2021:34125159}"	"Family 89794, individual II:2, brother of II:3"	"M"	""	""	""	"0"	""	""	""	"89794"
"00423325"	""	""	""	"1"	""	"00000"	"{PMID:Green 2021:34125159}"	"Family 89794, individual II:3, brother of II:2"	"M"	""	""	""	"0"	""	""	""	"89794"
"00423326"	""	""	""	"1"	""	"00000"	"{PMID:Green 2021:34125159}"	"Family 75898, individual III:2; mother and maternal grandmother previously described in Manes et al.., 2017"	"M"	""	""	""	"0"	""	""	""	"75898"
"00426189"	""	""	""	"1"	""	"00006"	"{PMID:Al-Kasbi 2022:36344539}"	"patient, no other affecteds in family"	"M"	"yes"	"Oman"	""	"0"	""	""	""	"10DK3900"
"00433782"	""	""	""	"1"	""	"03508"	""	""	"F"	"no"	"Korea, South (Republic)"	""	"0"	""	""	"Asian"	""
"00433866"	""	""	""	"1"	""	"03508"	""	""	"M"	"no"	"Korea, South (Republic)"	""	"0"	""	""	"Asian"	""
"00434135"	""	""	""	"2"	""	"00006"	"{PMID:Cipriani 2017:28790370}"	"2-generation family, affected father/daughter"	"F;M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"GC15416"
"00434136"	""	""	""	"12"	""	"00006"	"{PMID:Cipriani 2017:28790370}"	"5-generation family, 12 affected"	"F;M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"GC3722"
"00434147"	""	""	""	"2"	""	"00006"	"{PMID:Ellingford 2017:27551809}"	"2-generation family, affected mother/daughter"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"family"
"00447659"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"BVMD-115"
"00450909"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"071783"
"00450910"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	""	""	"0"	""	""	""	"071999"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 77
"{{individualid}}"	"{{diseaseid}}"
"00309303"	"04214"
"00333735"	"04214"
"00333736"	"04214"
"00377571"	"04249"
"00377572"	"04249"
"00377573"	"04249"
"00377574"	"04249"
"00377575"	"04249"
"00377576"	"04249"
"00377577"	"04249"
"00377578"	"04249"
"00377579"	"04249"
"00377580"	"04249"
"00377581"	"04249"
"00377587"	"04249"
"00380104"	"04214"
"00408252"	"05611"
"00408253"	"05611"
"00408254"	"05331"
"00408255"	"05331"
"00408256"	"05331"
"00408257"	"05331"
"00408258"	"05331"
"00408259"	"05331"
"00408260"	"05331"
"00408261"	"05331"
"00415386"	"04214"
"00415387"	"04214"
"00415388"	"04214"
"00415389"	"04214"
"00415390"	"04214"
"00415391"	"04214"
"00415415"	"04214"
"00415416"	"04214"
"00415417"	"04214"
"00415418"	"04214"
"00415419"	"04214"
"00415420"	"04214"
"00415421"	"04214"
"00415422"	"04214"
"00415423"	"04214"
"00415424"	"04214"
"00415425"	"04214"
"00415512"	"04214"
"00415513"	"04214"
"00415514"	"04214"
"00423305"	"04214"
"00423306"	"04214"
"00423307"	"04214"
"00423308"	"04214"
"00423309"	"04214"
"00423310"	"04214"
"00423311"	"04214"
"00423312"	"04214"
"00423313"	"04214"
"00423314"	"04214"
"00423315"	"04214"
"00423316"	"04214"
"00423317"	"04214"
"00423318"	"04214"
"00423319"	"04214"
"00423320"	"04214"
"00423321"	"04214"
"00423322"	"04214"
"00423323"	"04214"
"00423324"	"04214"
"00423325"	"04214"
"00423326"	"04214"
"00426189"	"00139"
"00433782"	"05957"
"00433866"	"05957"
"00434135"	"05957"
"00434136"	"05957"
"00434147"	"05957"
"00447659"	"00198"
"00450909"	"04249"
"00450910"	"04249"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 04214, 04249, 05331, 05611, 05957, 06936, 06972
## Count = 77
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000234623"	"04214"	"00309303"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"maculopathy"	""
"0000251919"	"04214"	"00333735"	"00000"	"Familial, autosomal dominant"	"58y"	"clinical category IIG"	""	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""
"0000251920"	"04214"	"00333736"	"00000"	"Familial, autosomal dominant"	"42y"	"clinical category IIG"	""	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""
"0000272725"	"04249"	"00377571"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272726"	"04249"	"00377572"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272727"	"04249"	"00377573"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272728"	"04249"	"00377574"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272729"	"04249"	"00377575"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272730"	"04249"	"00377576"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272731"	"04249"	"00377577"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272732"	"04249"	"00377578"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272733"	"04249"	"00377579"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272734"	"04249"	"00377580"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272735"	"04249"	"00377581"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000272741"	"04249"	"00377587"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	""
"0000273958"	"04214"	"00380104"	"00000"	"Unknown"	"74y"	"Numerous small hard (cuticular) drusen throughout the macula extending beyond the vascular arches"	""	""	""	""	""	""	""	""	""	"age-related macular degeneration"	""
"0000300380"	"05611"	"00408252"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., intellectual disability, ataxia with cerebellar hypoplasia, scoliosis, delayed puberty with congenital hypogonadotropic hypogonadism"	""	""	""	""	""	""	""	""	"CDIDHH"	"neurodevelopmental delay"	""
"0000300381"	"05611"	"00408253"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., intellectual disability, ataxia with cerebellar hypoplasia, scoliosis, delayed puberty with congenital hypogonadotropic hypogonadism"	""	""	""	""	""	""	""	""	"CDIDHH"	"neurodevelopmental delay"	""
"0000300382"	"05331"	"00408254"	"00006"	"Familial, autosomal recessive"	"7m"	"deceased 25m; birth 39w; no prenatal growth retardation; cerebellar vermis hypoplasia; profound hypotonia; swallowing defect, desaturation, respiratory distress, bradypnea; weight 7kg (-0.8 SD); height 42cm (-0.9 SD); dysphagia, nasogastric tube feeding; absent motor milestones; severe/profound global developmental delay; axial hypotonia; distal hypertonia; spastic tetraplegia; normal deep tendon reflexes; no seizure; MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; abnormal ocular movement, suspicion of papillary edema or hypoplasia; microretrognathia; posterior cleft palate; no cardiac abnormalities; no gastrointestinal abnormalities; oxygen therapy required (nasal canula)"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300383"	"05331"	"00408255"	"00006"	"Familial, autosomal recessive"	"<0d"	"deceased 24w gestation; birth 24w; no prenatal growth retardation; cerebellar vermis hypoplasia; MRI brain supratentorial normal, no cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; no facial dysmorphism; posterior cleft palate; trabecular ventricular septal defect; no gastrointestinal abnormalities; no respiratory system anomalies; mild extremity malpositions"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300384"	"05331"	"00408256"	"00006"	"Familial, autosomal recessive"	"1d"	"deceased 4m; birth 37w; no prenatal growth retardation; cerebellar vermis hypoplasia; profound hypotonia; swallowing defect, respiratory distress, no cough reflex, bradycardia; dysphagia, nasogastric tube feeding; absent motor milestones; axial hypotonia; distal hypertonia; no seizure; MRI brain supratentorial normal, no cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; bilateral retinal hemorrhages; no facial dysmorphism; no oral cavity findings; ostium secundum atrial septal defect, patent ductus arteriosus; gastroesophageal reflux; oxygen therapy, base of the tongue ptosis, no cough reflex; mild feet malpositions"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300385"	"05331"	"00408257"	"00006"	"Familial, autosomal recessive"	"<0d"	"deceased 31w gestation; no prenatal growth retardation; cerebellar vermis hypoplasia; MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; no facial dysmorphism; no oral cavity findings; no cardiac abnormalities; no gastrointestinal abnormalities; no respiratory system anomalies"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300386"	"05331"	"00408258"	"00006"	"Familial, autosomal recessive"	"2d"	"deceased 22d; birth 34w; no prenatal growth retardation; cerebellar vermis hypoplasia; respiratory distress, axial hypotonia; swallowing defect, respiratory distress, recurrent apnea, bradycardia; 1d-height 33.5cm (+1.3 SD); dysphagia, nasogastric tube feeding; absent motor milestones; axial hypotonia; distal hypertonia; no seizure; MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, no brainstem hypoplasia; no eye tracking; hypertelorism, epicanthic fold; no oral cavity findings; no gastrointestinal abnormalities; apnea, oxygen therapy required in the context of prematurity"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300387"	"05331"	"00408259"	"00006"	"Familial, autosomal recessive"	"4y6m"	"birth 39w; prenatal growth retardation; temperature, HR and BP fluctuations; seizures; temperature, HR and BP fluctuations, respiratory distress; 4y6m-weight 12.2kg (<-2 SD); 44y6m height 46.4cn (-2.7 SD); no dysphagia; delayed motor milestones; severe global developmental delay; axial hypotonia; distal hypertonia; no spastic tetraplegia; reduced deep tendon reflexes; neonatal period focal seizures (on levetiracetam); MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; nystagmus with horizontal gaze, short sighted; no facial dysmorphism; no oral cavity findings; sinus rhythm with occasional marked sinus arrhythmia; no gastrointestinal abnormalities; respiratory distress; postural kyphosis"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300388"	"05331"	"00408260"	"00006"	"Familial, autosomal recessive"	"11m"	"birth 37w; prenatal growth retardation; temperature, HR and BP fluctuations; temperature, HR and BP fluctuations; 7.7m weight 5kg (-3 SD); 33w5d height 38.3cm (-4.7 SD); no dysphagia; delayed motor milestones; mild global developmental delay; axial hypotonia; distal hypertonia; no spastic tetraplegia; normal deep tendon reflexes; one seizure, on levetiracetam since; MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, no cerebellar vermis hypoplasia, no brainstem hypoplasia; no ophthalmological findings; no facial dysmorphism; no oral cavity findings; no cardiac abnormalities; no gastrointestinal abnormalities; no respiratory system anomalies; episodic dystonia"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000300389"	"05331"	"00408261"	"00006"	"Familial, autosomal recessive"	"12m"	"deceased 16m; birth 40w; no prenatal growth retardation; respiratory distress, recurrent apnea; respiratory distress, recurrent apnea; weight 5.2kg (-4.5 SD); 1d-height 34cm (-1 SD); height 38cm (-7 SD); dysphagia, nasogastric tube feeding; absent motor milestones; severe global developmental delay; axial hypotonia; distal hypertonia; spastic tetraplegia; reduced deep tendon reflexes; neonatal seizure; MRI brain supratentorial normal, cerebellar hemisphere hypoplasia, cerebellar vermis hypoplasia, brainstem hypoplasia; no ophthalmological findings; hypertrichosis, low anterior hairline, upslanting palpebral fissures, epicanthic folds; no oral cavity findings; no cardiac abnormalities; recurrent vomiting, gastroesophageal reflux; poor respiratory effort, ventilation dependence"	""	""	""	""	""	""	""	""	""	"pontocerebellar hypoplasia"	""
"0000307180"	"04214"	"00415386"	"00000"	"Familial, autosomal dominant"	"5y"	"best corrected visual acuity right, left eye: 20/80, 20/50; optical coherence tomography focus diopter: 1.61, 1.71; caldera (grade 3) height: 3549, 2930, width: 4170, 3617; depth:671, 398; papillo-caldera distance:2784, 3137"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307181"	"04214"	"00415387"	"00000"	"Familial, autosomal dominant"	"7y"	"best corrected visual acuity right, left eye: 20/80, 20/63; optical coherence tomography focus diopter: N/A, 0.31; caldera (grade 3) height: 5095, 4889, width: 6617, 6302; depth:approx. 1191+, approx. 1195+; papillo-caldera distance:3087 (distance measure on fundus color image, no OCT scan available), 3585"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307182"	"04214"	"00415388"	"00000"	"Familial, autosomal dominant"	"39y"	"best corrected visual acuity right, left eye: 20/63, 20/63; optical coherence tomography focus diopter: 0.58, 1.07; caldera (grade 3) height: 3990, 4309, width: 5028, 4987; depth:1098, 1222; papillo-caldera distance:2170, 2041"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307183"	"04214"	"00415389"	"00000"	"Familial, autosomal dominant"	"39y"	"best corrected visual acuity right, left eye: 20/80, 20/63; optical coherence tomography focus diopter: 0.72, 0.24; caldera (grade 3) height: 3802, 3304, width: 4289, 3498; depth:611, 379; papillo-caldera distance:2292, 2612"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307184"	"04214"	"00415390"	"00000"	"Familial, autosomal dominant"	"44y"	"best corrected visual acuity right, left eye: 20/100, 20/16; optical coherence tomography focus diopter: -0.91, -0.15; caldera (grade 3) height: 3468, Grade 1, width: 3083; depth:669; papillo-caldera distance:1968"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307185"	"04214"	"00415391"	"00000"	"Familial, autosomal dominant"	"68y"	"best corrected visual acuity right, left eye: 20/63, 20/125; optical coherence tomography focus diopter: 0.91, 1.14; caldera (grade 3) height: 2666, Grade 2, width: 3219; depth:570; papillo-caldera distance:2490"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307209"	"04214"	"00415415"	"00000"	"Familial, autosomal dominant"	""	"clinical phenotypes of 15 affected members of Family 1 (GC4059) have been previously described (Godley et al., 1996)"	""	""	""	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307210"	"04214"	"00415416"	"00000"	"Familial, autosomal dominant"	""	"clinical phenotypes of 15 affected members of Family 1 (GC4059) have been previously described (Godley et al., 1996)"	""	""	""	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307211"	"04214"	"00415417"	"00000"	"Familial, autosomal dominant"	""	"clinical phenotypes of 15 affected members of Family 1 (GC4059) have been previously described (Godley et al., 1996)"	""	""	""	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307212"	"04214"	"00415418"	"00000"	"Familial, autosomal dominant"	""	"clinical phenotypes of 15 affected members of Family 1 (GC4059) have been previously described (Godley et al., 1996)"	""	""	""	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307213"	"04214"	"00415419"	"00000"	"Familial, autosomal dominant"	""	"whole family description: main lesion of the fundus located in the macular region, limited to within the retinal vascular arcades of the posterior pole (Stage 1); further smaller atrophic lesions develop progressively around this central lesion; in Stage 2, slow progression of the chorioretinal atrophy with structurally intact retina remaining at the peripapillary region and at the extreme periphery; second smaller focus of chorioretinal atrophy presents later in the second decade of life and overtime there is further progression of the atrophic lesions during Stage 3 of disease"	"0m"	""	"significant visual impairment, photophobia, and nystagmus"	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307214"	"04214"	"00415420"	"00000"	"Familial, autosomal dominant"	""	"whole family description: main lesion of the fundus located in the macular region, limited to within the retinal vascular arcades of the posterior pole (Stage 1); further smaller atrophic lesions develop progressively around this central lesion; in Stage 2, slow progression of the chorioretinal atrophy with structurally intact retina remaining at the peripapillary region and at the extreme periphery; second smaller focus of chorioretinal atrophy presents later in the second decade of life and overtime there is further progression of the atrophic lesions during Stage 3 of disease"	"0m"	""	"significant visual impairment, photophobia, and nystagmus"	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307215"	"04214"	"00415421"	"00000"	"Familial, autosomal dominant"	""	"whole family description: main lesion of the fundus located in the macular region, limited to within the retinal vascular arcades of the posterior pole (Stage 1); further smaller atrophic lesions develop progressively around this central lesion; in Stage 2, slow progression of the chorioretinal atrophy with structurally intact retina remaining at the peripapillary region and at the extreme periphery; second smaller focus of chorioretinal atrophy presents later in the second decade of life and overtime there is further progression of the atrophic lesions during Stage 3 of disease"	"0m"	""	"significant visual impairment, photophobia, and nystagmus"	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307216"	"04214"	"00415422"	"00000"	"Familial, autosomal dominant"	""	"whole family description: main lesion of the fundus located in the macular region, limited to within the retinal vascular arcades of the posterior pole (Stage 1); further smaller atrophic lesions develop progressively around this central lesion; in Stage 2, slow progression of the chorioretinal atrophy with structurally intact retina remaining at the peripapillary region and at the extreme periphery; second smaller focus of chorioretinal atrophy presents later in the second decade of life and overtime there is further progression of the atrophic lesions during Stage 3 of disease"	"0m"	""	"significant visual impairment, photophobia, and nystagmus"	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307217"	"04214"	"00415423"	"00000"	"Familial, autosomal dominant"	""	"whole family description: main lesion of the fundus located in the macular region, limited to within the retinal vascular arcades of the posterior pole (Stage 1); further smaller atrophic lesions develop progressively around this central lesion; in Stage 2, slow progression of the chorioretinal atrophy with structurally intact retina remaining at the peripapillary region and at the extreme periphery; second smaller focus of chorioretinal atrophy presents later in the second decade of life and overtime there is further progression of the atrophic lesions during Stage 3 of disease"	"0m"	""	"significant visual impairment, photophobia, and nystagmus"	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307218"	"04214"	"00415424"	"00000"	"Familial, autosomal dominant"	"38y"	"typical features of NCMD"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307219"	"04214"	"00415425"	"00000"	"Familial, autosomal dominant"	"3y"	"had more severe macular atrophy with associated nystagmus, altogether findings more typical of PBCRA;3y: developed a retinal detachment requiring surgical repair; no observed progression of the macular lesion"	""	""	""	""	""	""	""	""	"progressive bifocal chorioretinal atrophy (PBCRA)"	""	""
"0000307297"	"04214"	"00415512"	"00000"	"Familial, autosomal dominant"	"35y"	"grade 3 coloboma-like lesion of both maculae resulting in best corrected visual acuity right, left eye: counting fingers, 20/20; fundus photographs show a bilateral grade 3 coloboma-like lesion more severe right > left eye; misdiagnosed in childhood as having congenital toxoplasmosis; right macula - submacular fibrosis extending under the nasal macula and superior to the optic nerve, suggesting a previous episode of an actively leaking choroidal neovascularization (CNVM); spectral domain optical coherence tomography, right eye: macular colobomalike lesion with a discrete, well-demarcated absence of the photoreceptors and retinal pigment epithelium, choroid encircled by subretinal fibrosis - because of the nasal macular location of the fibrosis and the loss of the inner segment and outer segment photoreceptor junction within the lesion, significant vision loss in the right eye is not mirrored in the left eye; if the CNVM in the nasal macula right eye occurred early in life, the poor vision in the right eye may be in part due to induced amblyopia from the better left eye having a competitive advantage over the right eye as well. Left eye: a grade 3 classic North Carolina macular dystrophy lesion, with its appearance being more dramatic than the severity of vision loss; center of the macula appears to be rotated inferiorly; spectral domain optical coherence tomography: intrachoroidal fluid containing spaces which are not vascular, as evidenced on optical coherence tomography angiogram and intravenous fluorescein angiograms; nasal edge of the lesion - preserved inner segment and outer segment junction where slightly eccentric fixation is located, as evidenced on microperimetry results, there, preserved choroid and all layers of the retina; within the lesion, total disruption and loss of organized structure to the retina and choroid; microperimetry and multifocal electroretinography: little, if any, function of the retina within the lesion results; optical coherence tomography angiogram: retinal vasculature relatively intact despite the disruption of the other retinal layers; foveal avascular zone enlarged and irregular, retinal vasculature atypical, not seen on standard fluorescein angiograms - prominent choroidal vasculature with absence of the choriocapilaris within the lesion on OCTAs and intravenous fluorescein angiograms, along with an absence of retinal pigment epithelium; spectral domain optical coherence tomography: absence of the typical layers of the neurosensory retina within the lesion, suggesting complete disorganization of the maculae, choroid absent completely posterior to the disorganized macula; microperimetry and multifocal electroretinography: eccentric fixation worse in the right eye (poor, consistent with no central macular function and with loss of the retinal pigment epithelium in the nasal macula) than in the left fixation in right eye is. This level of severity in NCMD in the right eye is unusual and is consistent with a history of previous leakage from a CNVM in the nasal macula, which is typically the region of good vision and fixation in persons with NCMD; left eye shows fixation at the nasal edge of the lesion, which is a typical finding in NCMD cases and is consistent with the intact retinal inner segment and outer segment junction and good vision; full-field electroretinogram: right eye depressed in all functions, consistent with the large area of retinal scarring, atrophy, or fibrosis, or a combination of these, from a probable CNVM leak in the past; full-field ERG left eye: normal"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307298"	"04214"	"00415513"	"00000"	"Familial, autosomal dominant"	"5y"	"grade 2 North Carolina macular dystrophy retinal changes; best-corrected visual acuity: 20/40 in each eye; fundus: confluent bilaterally symmetrical macular yellow drusen-like lesions; spectral domain optical coherence tomography: intact inner segment and outer segment photoreceptor junction with mild irregularities more concentrated temporal to the fovea in each eye; poor cooperation and longer acquisition times - no results from other examinations; phenotype is consistent with torpedo maculopathy"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000307299"	"04214"	"00415514"	"00000"	"Familial, autosomal dominant"	"64y"	"grade 1 NCMD retinal changes with best-corrected visual acuity: 20/25 both eyes; asymptomatic, previously told he had macular abnormalities; fundus: classic yellow intermediate-size drusen characteristic of grade 1 lesions. spectral domain optical coherence tomography:fine depositions at the level of the retinal pigment epithelium with overlying intact inner segment and outer segment photoreceptor junctions; inner retina and specifically the amacrine cells in the inner nuclear layer: normal; optical coherence tomography angiograms: no choroidal neovascularization , choroid normal, retinal vasculature shows an absence of the foveal avascular zone along with an absence of the umbo that is cDonsistent with fovea plana; autofluorescence: normal appearing; minimally reduced foveal sensitivity on microperimetry results, slight eccentric fixation in the left eye; multifocal electroretinography: mildly to moderately reduced amplitudes throughout the maculae; full-field electroretinography: normal, including the oscillatory potentials"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314512"	"04214"	"00423305"	"00000"	"Familial, autosomal dominant"	"48y"	"age at 1st examination (years): 44; retinal phenotype (1st examination): drusen, inactive macular neovascularization/fibrosis; best corrected visual acuity right, left eye: 20/320, 20/32; refraction spherical equivalent right, left eye: +3.00/.25/170deg, -0.50/-0.50/25deg; best corrected visual acuity right, left eye last visit: 20/400, 20/32; additional ophthalmic findings: left eye - anti-VEGF treatment (10x)"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314513"	"04214"	"00423306"	"00000"	"Familial, autosomal dominant"	"52y"	"age at 1st examination (years): 41; retinal phenotype (1st examination): drusen, inactive macular neovascularization/fibrosis; best corrected visual acuity right, left eye: 20/50, 20/25; refraction spherical equivalent right, left eye: +1.00/0.00/<1deg, +0.25/-0.25/158deg; best corrected visual acuity right, left eye last visit: 20/200, 20/32"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314514"	"04214"	"00423307"	"00000"	"Familial, autosomal dominant"	"23y"	"age at 1st examination (years): 20; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/16, 20/16; best corrected visual acuity right, left eye last visit: 20116, 20/16"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314515"	"04214"	"00423308"	"00000"	"Familial, autosomal dominant"	"13y"	"age at 1st examination (years): 11; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/16; refraction spherical equivalent right, left eye: +0.50/0.00/<1deg, +0.25/--0.25/158deg; best corrected visual acuity right, left eye last visit: 20/20, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314516"	"04214"	"00423309"	"00000"	"Familial, autosomal dominant"	"24y"	"age at 1st examination (years): 13; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/20; refraction spherical equivalent right, left eye: +0.50/-0.25/121deg, 0.00/-0.25/20deg; best corrected visual acuity right, left eye last visit: 20/20, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314517"	"04214"	"00423310"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 81; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/25, 20/25; additional ophthalmic findings: both eyes  pseudophakia"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314518"	"04214"	"00423311"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 58; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/20; refraction spherical equivalent right, left eye: +2.25/-0.50/60deg, +2.5/--0.75/20deg"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314519"	"04214"	"00423312"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 52; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20.r.m; refraction spherical equivalent right, left eye: +0.25/-0.751174., +0.25/-1.25/174deg"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314520"	"04214"	"00423313"	"00000"	"Familial, autosomal dominant"	"27y"	"age at 1st examination (years): 26; retinal phenotype (1st examination): drusen, atrophy; best corrected visual acuity right, left eye: 20/25, 20/25; refraction spherical equivalent right, left eye: -4.751-1.25/175deg, -5.50/-1.50/177deg; best corrected visual acuity right, left eye last visit: 20/32, 20/25"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314521"	"04214"	"00423314"	"00000"	"Familial, autosomal dominant"	"20y"	"age at 1st examination (years): 20; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/20; refraction spherical equivalent right, left eye: 0.00/-0.25/19deg, 0.00/-0.50/152deg; best corrected visual acuity right, left eye last visit: 20/20, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314522"	"04214"	"00423315"	"00000"	"Familial, autosomal dominant"	"66y"	"age at 1st examination (years): 53; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/20; refraction spherical equivalent right, left eye: +1.25/-0.25/165deg, +0.25/-0.50/24deg; best corrected visual acuity right, left eye last visit: 20/20, 20/32; additional ophthalmic findings: left eye - macular neovascularization at last visit - anti-VEGF treatment"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314523"	"04214"	"00423316"	"00000"	"Familial, autosomal dominant"	"31y"	"age at 1st examination (years): 16; retinal phenotype (1st examination): drusen, atrophy; best corrected visual acuity right, left eye: 20/50, 20/50; refraction spherical equivalent right, left eye: 0.00/-0.25/50deg, 0.00/-0.50/10deg; best corrected visual acuity right, left eye last visit: 20/50, 20/80"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314524"	"04214"	"00423317"	"00000"	"Familial, autosomal dominant"	"30y"	"age at 1st examination (years): 18; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/16, 20/16; refraction spherical equivalent right, left eye: +1.50/-0.25/151deg, +1.25/-0.50/60deg; best corrected visual acuity right, left eye last visit: 20/20, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314525"	"04214"	"00423318"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 78; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye:"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314526"	"04214"	"00423319"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 41; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/25, 20/25"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314527"	"04214"	"00423320"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 16; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/32, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314528"	"04214"	"00423321"	"00000"	"Familial, autosomal dominant"	""	"age at 1st examination (years): 49; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/20, 20/20; refraction spherical equivalent right, left eye: -2.00/-0.75/95deg, -2.75/-0.75185deg"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314529"	"04214"	"00423322"	"00000"	"Familial, autosomal dominant"	"32y"	"age at 1st examination (years): 31; retinal phenotype (1st examination): drusen; best corrected visual acuity right, left eye: 20/16, 20/20; refraction spherical equivalent right, left eye: +0.25/-0.50/4deg, 0.00/-0.25/180deg; best corrected visual acuity right, left eye last visit: 20/20, 20/20"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314530"	"04214"	"00423323"	"00000"	"Familial, autosomal dominant"	"37y"	"age (at presentation; at last examination): 35; 37; logMAR vision at last examination (right; left eye): 0.0; 0.0; main fundoscopic findings: macular and peripheral drusenoid lesions"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314531"	"04214"	"00423324"	"00000"	"Familial, autosomal dominant"	"50y"	"age (at presentation; at last examination): 44; 50; logMAR vision at last examination (right; left eye): 0.0; 0.0; main fundoscopic findings: macular and peripheral drusenoid lesions"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314532"	"04214"	"00423325"	"00000"	"Familial, autosomal dominant"	"52y"	"age (at presentation; at last examination): 46; 52; logMAR vision at last examination (right; left eye): 0.0; 0.0; main fundoscopic findings: macular and peripheral drusenoid lesions"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000314533"	"04214"	"00423326"	"00000"	"Familial, autosomal dominant"	"7y"	"age (at presentation; at last examination): 3; 7; logMAR vision at last examination (right; left eye): 0.5; 1.6; main fundoscopic findings: coloboma-like macular lesions; subfoveal scarring and fluid owing to neovascularization; subtle peripheral drusenoid lesions"	""	""	""	""	""	""	""	""	"North Carolina macular dystrophy"	""	""
"0000317339"	"00139"	"00426189"	"00006"	"Familial, autosomal recessive"	"2y"	"Central hypoventilation and apnea, seizures, cerebellar vermis hypoplasia and early death"	""	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000324243"	"05957"	"00433782"	"03508"	"Familial, autosomal dominant"	""	"Drusen(HP:0011510), Macular dystrophy(HP:0007754)"	""	""	""	""	""	""	""	""	"NCMD"	"NCMD"	""
"0000324244"	"05957"	"00433866"	"03508"	"Familial, autosomal dominant"	"17y"	"Drusen (HP:0011510); Macular dystrophy (HP:0007754)"	""	"17y"	""	""	""	""	""	""	"NCMD"	"NCMD"	""
"0000324489"	"05957"	"00434135"	"00006"	"Familial, autosomal dominant"	""	"see paper"	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000324490"	"05957"	"00434136"	"00006"	"Familial, autosomal dominant"	""	"see paper"	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000324501"	"05957"	"00434147"	"00006"	"Familial, autosomal dominant"	""	"see paper"	""	""	""	""	""	""	""	""	"MCDR1"	"North Carolina macular dystrophy"	""
"0000336858"	"00198"	"00447659"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Best vitelliform macular dystrophy"	""
"0000339964"	"04249"	"00450909"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339965"	"04249"	"00450910"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""


## Screenings ## Do not remove or alter this header ##
## Count = 77
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000310448"	"00309303"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000334961"	"00333735"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334962"	"00333736"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000378775"	"00377571"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000378776"	"00377572"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378777"	"00377573"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378778"	"00377574"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378779"	"00377575"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378780"	"00377576"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378781"	"00377577"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378782"	"00377578"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378783"	"00377579"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378784"	"00377580"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ"	"DNA"	""	""
"0000378785"	"00377581"	"1"	"00006"	"00006"	"2021-07-27 16:02:26"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000378791"	"00377587"	"1"	"00006"	"00006"	"2021-07-28 14:44:35"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES, targeted"
"0000381305"	"00380104"	"1"	"00000"	"03840"	"2021-08-10 09:32:07"	""	""	"SEQ-NG"	"DNA"	""	"Whole-exome sequencing"
"0000409507"	"00408252"	"1"	"00006"	"00006"	"2022-04-18 11:57:16"	""	""	"SEQ"	"DNA"	""	"WES"
"0000409508"	"00408253"	"1"	"00006"	"00006"	"2022-04-18 12:03:59"	""	""	"SEQ"	"DNA"	""	"WES"
"0000409509"	"00408254"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409510"	"00408255"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409511"	"00408256"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409512"	"00408257"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409513"	"00408258"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409514"	"00408259"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409515"	"00408260"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000409516"	"00408261"	"1"	"00006"	"00006"	"2022-04-18 12:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000416667"	"00415386"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416668"	"00415387"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416669"	"00415388"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416670"	"00415389"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416671"	"00415390"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416672"	"00415391"	"1"	"00000"	"03840"	"2022-08-13 11:35:42"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416696"	"00415415"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416697"	"00415416"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416698"	"00415417"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416699"	"00415418"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416700"	"00415419"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416701"	"00415420"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416702"	"00415421"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416703"	"00415422"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416704"	"00415423"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000416705"	"00415424"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416706"	"00415425"	"1"	"00000"	"03840"	"2022-08-13 21:02:16"	""	""	"arraySNP;SEQ-NG-I;SEQ"	"DNA"	"blood"	"whole genome sequencing"
"0000416793"	"00415512"	"1"	"00000"	"03840"	"2022-08-14 16:47:31"	""	""	"?"	"DNA"	"blood"	"retrospective study"
"0000416794"	"00415513"	"1"	"00000"	"03840"	"2022-08-14 16:47:31"	""	""	"?"	"DNA"	"blood"	"retrospective study"
"0000416795"	"00415514"	"1"	"00000"	"03840"	"2022-08-14 16:47:31"	""	""	"?"	"DNA"	"blood"	"retrospective study"
"0000424615"	"00423305"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424616"	"00423306"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424617"	"00423307"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424618"	"00423308"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424619"	"00423309"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424620"	"00423310"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424621"	"00423311"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424622"	"00423312"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424623"	"00423313"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424624"	"00423314"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424625"	"00423315"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424626"	"00423316"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424627"	"00423317"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424628"	"00423318"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424629"	"00423319"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424630"	"00423320"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424631"	"00423321"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424632"	"00423322"	"1"	"00000"	"03840"	"2022-11-15 13:15:34"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"gene panel: genes involved in developmental and progressive inherited retinal diseases"
"0000424633"	"00423323"	"1"	"00000"	"03840"	"2022-11-15 13:35:33"	""	""	"?"	"DNA"	""	""
"0000424634"	"00423324"	"1"	"00000"	"03840"	"2022-11-15 13:35:33"	""	""	"?"	"DNA"	""	""
"0000424635"	"00423325"	"1"	"00000"	"03840"	"2022-11-15 13:35:33"	""	""	"?"	"DNA"	""	""
"0000424636"	"00423326"	"1"	"00000"	"03840"	"2022-11-15 13:35:33"	""	""	"?"	"DNA"	""	""
"0000427509"	"00426189"	"1"	"00006"	"00006"	"2022-11-28 11:02:11"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000435245"	"00433782"	"1"	"03508"	"03508"	"2023-03-15 10:57:47"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000435329"	"00433866"	"1"	"03508"	"03508"	"2023-03-15 12:44:10"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000435602"	"00434135"	"1"	"00006"	"00006"	"2023-03-20 17:46:25"	"00006"	"2023-10-21 22:17:41"	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000435603"	"00434136"	"1"	"00006"	"00006"	"2023-03-20 17:46:25"	"00006"	"2023-10-21 22:17:41"	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000435614"	"00434147"	"1"	"00006"	"00006"	"2023-03-20 18:14:11"	"00006"	"2023-10-21 22:17:41"	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000449236"	"00447659"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000452507"	"00450909"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452508"	"00450910"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 47
"{{screeningid}}"	"{{geneid}}"
"0000310448"	"PRDM13"
"0000334961"	"PRDM13"
"0000334962"	"PRDM13"
"0000416667"	"PRDM13"
"0000416668"	"PRDM13"
"0000416669"	"PRDM13"
"0000416670"	"PRDM13"
"0000416671"	"PRDM13"
"0000416672"	"PRDM13"
"0000416696"	"PRDM13"
"0000416697"	"PRDM13"
"0000416698"	"PRDM13"
"0000416699"	"PRDM13"
"0000416700"	"PRDM13"
"0000416701"	"PRDM13"
"0000416702"	"PRDM13"
"0000416703"	"PRDM13"
"0000416704"	"PRDM13"
"0000416705"	"PRDM13"
"0000416706"	"PRDM13"
"0000416793"	"PRDM13"
"0000416794"	"PRDM13"
"0000416795"	"PRDM13"
"0000424615"	"PRDM13"
"0000424616"	"PRDM13"
"0000424617"	"PRDM13"
"0000424618"	"PRDM13"
"0000424619"	"PRDM13"
"0000424620"	"PRDM13"
"0000424621"	"PRDM13"
"0000424622"	"PRDM13"
"0000424623"	"PRDM13"
"0000424624"	"PRDM13"
"0000424625"	"PRDM13"
"0000424626"	"PRDM13"
"0000424627"	"PRDM13"
"0000424628"	"PRDM13"
"0000424629"	"PRDM13"
"0000424630"	"PRDM13"
"0000424631"	"PRDM13"
"0000424632"	"PRDM13"
"0000424633"	"PRDM13"
"0000424634"	"PRDM13"
"0000424635"	"PRDM13"
"0000424636"	"PRDM13"
"0000435245"	"PRDM13"
"0000435329"	"PRDM13"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 108
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000246514"	"0"	"30"	"6"	"100061914"	"100061914"	"subst"	"6.77759E-5"	"02330"	"PRDM13_000005"	"g.100061914A>C"	""	""	""	"PRDM13(NM_021620.3):c.1403A>C (p.E468A), PRDM13(NM_021620.4):c.1403A>C (p.E468A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99614038A>C"	""	"likely benign"	""
"0000294279"	"0"	"30"	"6"	"100062483"	"100062483"	"subst"	"0.000535048"	"02330"	"PRDM13_000006"	"g.100062483C>G"	""	""	""	"PRDM13(NM_021620.4):c.1972C>G (p.L658V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99614607C>G"	""	"likely benign"	""
"0000294280"	"0"	"10"	"6"	"100057044"	"100057044"	"subst"	"2.4476E-5"	"02330"	"PRDM13_000002"	"g.100057044T>A"	""	""	""	"PRDM13(NM_021620.4):c.277-19T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99609168T>A"	""	"benign"	""
"0000294281"	"0"	"10"	"6"	"100061120"	"100061120"	"subst"	"0.00813356"	"02330"	"PRDM13_000003"	"g.100061120C>T"	""	""	""	"PRDM13(NM_021620.3):c.609C>T (p.S203=), PRDM13(NM_021620.4):c.609C>T (p.S203=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99613244C>T"	""	"benign"	""
"0000294282"	"0"	"10"	"6"	"100054916"	"100054916"	"subst"	"0.000433637"	"02330"	"PRDM13_000001"	"g.100054916C>T"	""	""	""	"PRDM13(NM_021620.4):c.6C>T (p.H2=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99607040C>T"	""	"benign"	""
"0000294283"	"0"	"10"	"6"	"100061221"	"100061221"	"subst"	"0.00404055"	"02330"	"PRDM13_000004"	"g.100061221C>T"	""	""	""	"PRDM13(NM_021620.3):c.710C>T (p.A237V), PRDM13(NM_021620.4):c.710C>T (p.A237V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99613345C>T"	""	"benign"	""
"0000306252"	"0"	"30"	"6"	"100061221"	"100061221"	"subst"	"0.00404055"	"01943"	"PRDM13_000004"	"g.100061221C>T"	""	""	""	"PRDM13(NM_021620.3):c.710C>T (p.A237V), PRDM13(NM_021620.4):c.710C>T (p.A237V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99613345C>T"	""	"likely benign"	""
"0000526526"	"0"	"30"	"6"	"100061003"	"100061003"	"subst"	"2.0471E-5"	"01943"	"PRDM13_000007"	"g.100061003C>T"	""	""	""	"PRDM13(NM_021620.3):c.492C>T (p.G164=), PRDM13(NM_021620.4):c.492C>T (p.G164=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613127C>T"	""	"likely benign"	""
"0000526527"	"0"	"30"	"6"	"100061120"	"100061120"	"subst"	"0.00813356"	"01943"	"PRDM13_000003"	"g.100061120C>T"	""	""	""	"PRDM13(NM_021620.3):c.609C>T (p.S203=), PRDM13(NM_021620.4):c.609C>T (p.S203=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613244C>T"	""	"likely benign"	""
"0000526528"	"0"	"30"	"6"	"100061145"	"100061145"	"subst"	"1.94326E-5"	"01943"	"PRDM13_000008"	"g.100061145C>G"	""	""	""	"PRDM13(NM_021620.3):c.634C>G (p.P212A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613269C>G"	""	"likely benign"	""
"0000526529"	"0"	"50"	"6"	"100061159"	"100061162"	"dup"	"0"	"01943"	"PRDM13_000009"	"g.100061159_100061162dup"	""	""	""	"PRDM13(NM_021620.3):c.648_651dupACCA (p.V218Tfs*235)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613283_99613286dup"	""	"VUS"	""
"0000526530"	"0"	"10"	"6"	"100061375"	"100061375"	"subst"	"0.00178962"	"01943"	"PRDM13_000010"	"g.100061375C>T"	""	""	""	"PRDM13(NM_021620.3):c.864C>T (p.Y288=), PRDM13(NM_021620.4):c.864C>T (p.Y288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613499C>T"	""	"benign"	""
"0000526531"	"0"	"50"	"6"	"100061914"	"100061914"	"subst"	"6.77759E-5"	"01943"	"PRDM13_000005"	"g.100061914A>C"	""	""	""	"PRDM13(NM_021620.3):c.1403A>C (p.E468A), PRDM13(NM_021620.4):c.1403A>C (p.E468A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99614038A>C"	""	"VUS"	""
"0000526532"	"0"	"50"	"6"	"100062616"	"100062616"	"subst"	"0"	"01943"	"PRDM13_000011"	"g.100062616G>A"	""	""	""	"PRDM13(NM_021620.3):c.2105G>A (p.G702D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99614740G>A"	""	"VUS"	""
"0000526533"	"0"	"50"	"6"	"100062617"	"100062617"	"subst"	"0"	"01943"	"PRDM13_000012"	"g.100062617C>T"	""	""	""	"PRDM13(NM_021620.3):c.2106C>T (p.G702=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99614741C>T"	""	"VUS"	""
"0000609878"	"0"	"50"	"6"	"100054980"	"100054980"	"subst"	"0.000163359"	"01943"	"PRDM13_000013"	"g.100054980C>G"	""	""	""	"PRDM13(NM_021620.3):c.70C>G (p.L24V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99607104C>G"	""	"VUS"	""
"0000609879"	"0"	"10"	"6"	"100061429"	"100061429"	"subst"	"8.64753E-5"	"02330"	"PRDM13_000015"	"g.100061429C>G"	""	""	""	"PRDM13(NM_021620.4):c.918C>G (p.A306=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613553C>G"	""	"benign"	""
"0000609880"	"0"	"10"	"6"	"100061505"	"100061505"	"subst"	"0.00243199"	"02330"	"PRDM13_000016"	"g.100061505G>A"	""	""	""	"PRDM13(NM_021620.4):c.994G>A (p.G332R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613629G>A"	""	"benign"	""
"0000621606"	"0"	"30"	"6"	"100061144"	"100061144"	"subst"	"4.86703E-6"	"02330"	"PRDM13_000014"	"g.100061144C>A"	""	""	""	"PRDM13(NM_021620.4):c.633C>A (p.H211Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613268C>A"	""	"likely benign"	""
"0000621607"	"0"	"30"	"6"	"100061375"	"100061375"	"subst"	"0.00178962"	"02330"	"PRDM13_000010"	"g.100061375C>T"	""	""	""	"PRDM13(NM_021620.3):c.864C>T (p.Y288=), PRDM13(NM_021620.4):c.864C>T (p.Y288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99613499C>T"	""	"likely benign"	""
"0000685359"	"0"	"70"	"6"	"100040974"	"100040974"	"subst"	"0"	"00004"	"PRDM13_000017"	"g.100040974A>C"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000720576"	"0"	"50"	"6"	"100061674"	"100061674"	"subst"	"0"	"01943"	"PRDM13_000018"	"g.100061674G>A"	""	""	""	"PRDM13(NM_021620.3):c.1163G>A (p.G388D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000720577"	"0"	"30"	"6"	"100062188"	"100062188"	"subst"	"0"	"01943"	"PRDM13_000019"	"g.100062188C>T"	""	""	""	"PRDM13(NM_021620.3):c.1677C>T (p.G559=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000732968"	"0"	"70"	"6"	"100040906"	"100040906"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Stone 2017:28559085}"	""	"promoter chr6:100040906G>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000732969"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Stone 2017:28559085}"	""	"promoter chr6:100040987G>C"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000791667"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791668"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791669"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791670"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791671"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791672"	"1"	"90"	"6"	"100040906"	"100040906"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040906G>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-14005G>T"	""	"Germline"	"yes"	"rs1554264612"	"0"	""	""	"g.99593030G>T"	""	"pathogenic (dominant)"	""
"0000791673"	"1"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2016:26507665}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"pathogenic (dominant)"	""
"0000791674"	"1"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2016:26507665}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"pathogenic (dominant)"	""
"0000791675"	"1"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2016:26507665}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"pathogenic (dominant)"	""
"0000791676"	"1"	"90"	"6"	"100041040"	"100041040"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100041040C>T"	""	"{PMID:Small 2016:26507665}"	""	"c.-13871C>T"	""	"Germline"	"yes"	""	"0"	""	""	"g.99593164C>T"	""	"pathogenic (dominant)"	""
"0000791677"	"1"	"90"	"6"	"100143306"	"100143307"	"ins"	"0"	"00006"	"PRDM13_000020"	"g.100143306_100143307ins[ATTTACTTTATGTGTTTGCATG;100020205_100143306]"	""	"{PMID:Small 2016:26507665}"	""	"100020205-100143306dup"	"123 kb duplication"	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000791685"	"1"	"70"	"6"	"100040974"	"100040974"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040974A>C"	""	"{PMID:Namburi 2020:32476814}"	""	"c.-13937A>C"	"variant notfound in one questionably unaffected child (IV:3)"	"Germline"	"yes"	""	"0"	""	""	""	""	"likely pathogenic (dominant)"	""
"0000794704"	"0"	"70"	"6"	"100055023"	"100055023"	"subst"	"0.000415309"	"00000"	"PRDM13_000021"	"g.100055023C>T"	""	"{PMID:Kersten 2018:30215852}"	""	"c.113C>T;  p.S38?L"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.99607147C>T"	""	"likely pathogenic"	""
"0000802244"	"0"	"30"	"6"	"100055044"	"100055044"	"subst"	"0.000623843"	"02330"	"PRDM13_000022"	"g.100055044C>T"	""	""	""	"PRDM13(NM_021620.4):c.134C>T (p.P45L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000846686"	"3"	"90"	"6"	"100060907"	"100060919"	"del"	"0"	"00006"	"PRDM13_000023"	"g.100060907_100060919del"	""	"{PMID:Whittaker 2021:34730112}"	""	"398-3_407delCAGGGGAGGAGCG"	""	"Germline"	"yes"	""	"0"	""	""	"g.99613031_99613043del"	""	"pathogenic (recessive)"	""
"0000846687"	"3"	"90"	"6"	"100060907"	"100060919"	"del"	"0"	"00006"	"PRDM13_000023"	"g.100060907_100060919del"	""	"{PMID:Whittaker 2021:34730112}"	""	"398-3_407delCAGGGGAGGAGCG"	""	"Germline"	""	""	"0"	""	""	"g.99613031_99613043del"	""	"pathogenic (recessive)"	""
"0000846688"	"3"	"90"	"6"	"100061350"	"100061350"	"del"	"0"	"00006"	"PRDM13_000025"	"g.100061350del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99613474del"	""	"pathogenic (recessive)"	""
"0000846689"	"3"	"90"	"6"	"100061350"	"100061350"	"del"	"0"	"00006"	"PRDM13_000025"	"g.100061350del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99613474del"	""	"pathogenic (recessive)"	""
"0000846690"	"3"	"90"	"6"	"100061350"	"100061350"	"del"	"0"	"00006"	"PRDM13_000025"	"g.100061350del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99613474del"	""	"pathogenic (recessive)"	""
"0000846691"	"3"	"90"	"6"	"100061355"	"100061355"	"del"	"0"	"00006"	"PRDM13_000026"	"g.100061355del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99613479del"	""	"pathogenic (recessive)"	""
"0000846692"	"3"	"90"	"6"	"100061355"	"100061355"	"del"	"0"	"00006"	"PRDM13_000026"	"g.100061355del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99613479del"	""	"pathogenic (recessive)"	""
"0000846693"	"3"	"90"	"6"	"100062367"	"100062367"	"subst"	"8.20217E-6"	"00006"	"PRDM13_000027"	"g.100062367A>T"	""	"{PMID:Coolen 2022:35390279}"	""	"544delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.99614491A>T"	""	"pathogenic (recessive)"	""
"0000846694"	"3"	"90"	"6"	"100062367"	"100062367"	"subst"	"8.20217E-6"	"00006"	"PRDM13_000027"	"g.100062367A>T"	""	"{PMID:Coolen 2022:35390279}"	""	"545delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.99614491A>T"	""	"pathogenic (recessive)"	""
"0000846695"	"3"	"90"	"6"	"100061311"	"100061311"	"del"	"0"	"00006"	"PRDM13_000024"	"g.100061311del"	""	"{PMID:Coolen 2022:35390279}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99613435del"	""	"pathogenic (recessive)"	""
"0000851013"	"0"	"30"	"6"	"100061003"	"100061003"	"subst"	"2.0471E-5"	"02330"	"PRDM13_000007"	"g.100061003C>T"	""	""	""	"PRDM13(NM_021620.3):c.492C>T (p.G164=), PRDM13(NM_021620.4):c.492C>T (p.G164=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000860049"	"0"	"30"	"6"	"100061483"	"100061483"	"subst"	"0.000184249"	"01943"	"PRDM13_000028"	"g.100061483C>G"	""	""	""	"PRDM13(NM_021620.3):c.972C>G (p.L324=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000874912"	"11"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000874913"	"11"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000874914"	"21"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000874915"	"10"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000874916"	"21"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000874917"	"10"	"90"	"6"	"99996220"	"100065140"	"dup"	"0"	"00000"	"PRDM13_000017"	"g.99996220_100065140dup"	""	"{PMID:Bowne 2016:27777503}"	""	"duplication 99,996,220-100,065,1"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99548344_99617264dup"	""	"pathogenic"	""
"0000876107"	"10"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876108"	"21"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876109"	"11"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876110"	"11"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876111"	"0"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876112"	"11"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876113"	"11"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876114"	"21"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876115"	"21"	"70"	"6"	"100046804"	"100046804"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046804T>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8107T>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598928T>C"	""	"likely pathogenic"	""
"0000876116"	"0"	"70"	"6"	"100046783"	"100046783"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046783A>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8128A>C"	""	"De novo"	"yes"	""	"0"	""	""	"g.99598907A>C"	""	"likely pathogenic (dominant)"	""
"0000876117"	"21"	"70"	"6"	"100046783"	"100046783"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100046783A>C"	""	"{PMID:Silva 2019:30710461}"	""	"c.-8128A>C"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598907A>C"	""	"likely pathogenic (dominant)"	""
"0000876238"	"20"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2019:31043363}"	""	"variant 2 (V2) point mutation (Chr6: 99593111)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000876239"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2019:31043363}"	""	"variant 2 (V2) point mutation (Chr6: 99593111)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000876240"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Small 2019:31043363}"	""	"variant 2 (V2) point mutation (Chr6: 99593111)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000886963"	"0"	"30"	"6"	"100061843"	"100061843"	"subst"	"0.00254441"	"02330"	"PRDM13_000030"	"g.100061843C>G"	""	""	""	"PRDM13(NM_021620.4):c.1332C>G (p.L444=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000900697"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900698"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900699"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900700"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900701"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900702"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900703"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900704"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900705"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900706"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900707"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900708"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900709"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900710"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900711"	"11"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900712"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900713"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900714"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Birtel 2021:33785507}"	""	"single nucleotide variant upstream of the PRDM13 gene (V2) (c.-13924G>C; chr6:100040987)"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900715"	"0"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Green 2021:34125159}"	""	"PRDM13 chr6:100,040,987G>C"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900716"	"10"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Green 2021:34125159}"	""	"PRDM13 chr6:100,040,987G>C"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900717"	"10"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Green 2021:34125159}"	""	"PRDM13 chr6:100,040,987G>C"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000900718"	"21"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"00000"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Green 2021:34125159}"	""	"PRDM13 chr6:100,040,987G>C"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	""
"0000904869"	"3"	"70"	"6"	"100061311"	"100061311"	"del"	"0"	"00006"	"PRDM13_000024"	"g.100061311del"	""	"{PMID:Al-Kasbi 2022:36344539}"	""	""	"reported as candidate disease gene"	"Germline"	""	""	"0"	""	""	"g.99613435del"	""	"VUS"	""
"0000921301"	"11"	"70"	"6"	"100046790"	"100046790"	"subst"	"0"	"03508"	"PRDM13_000017"	"g.100046790T>C"	""	""	""	"c.-8121T>C"	""	"Germline"	"?"	""	"0"	""	""	"g.99598914T>C"	""	"likely pathogenic"	""
"0000921302"	"11"	"70"	"6"	"100046802"	"100046802"	"subst"	"0"	"03508"	"PRDM13_000017"	"g.100046802G>A"	""	""	""	"c.-8109G>A"	""	"Germline"	"yes"	""	"0"	""	""	"g.99598926G>A"	""	"likely pathogenic"	""
"0000921752"	"11"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Cipriani 2017:28790370}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000921753"	"11"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Cipriani 2017:28790370}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000921764"	"21"	"90"	"6"	"100040987"	"100040987"	"subst"	"0"	"00006"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Ellingford 2017:27551809}"	""	"c.-13924G>C"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000959446"	"0"	"50"	"6"	"100062486"	"100062486"	"subst"	"8.43704E-6"	"00006"	"PRDM13_000031"	"g.100062486C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, BP4; no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.99614610C>T"	""	"VUS"	"ACMG"
"0000976904"	"0"	"30"	"6"	"100057187"	"100057187"	"subst"	"0"	"01804"	"PRDM13_000032"	"g.100057187C>T"	""	""	""	"PRDM13(NM_021620.4):c.397+4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000986490"	"1"	"70"	"6"	"100040987"	"100040987"	"subst"	"0"	"04405"	"PRDM13_000017"	"g.100040987G>C"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"c.-13924G>C"	""	"Germline"	""	""	"0"	""	""	"g.99593111G>C"	""	"likely pathogenic"	"ACMG"
"0000986491"	"1"	"50"	"6"	"100055023"	"100055023"	"subst"	"0.000415309"	"04405"	"PRDM13_000021"	"g.100055023C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99607147C>T"	""	"VUS"	"ACMG"
"0000995217"	"0"	"50"	"6"	"100061821"	"100061821"	"subst"	"9.45269E-6"	"01804"	"PRDM13_000033"	"g.100061821C>G"	""	""	""	"PRDM13(NM_021620.3):c.1310C>G (p.(Pro437Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001014154"	"0"	"30"	"6"	"100057187"	"100057187"	"subst"	"0"	"02325"	"PRDM13_000032"	"g.100057187C>T"	""	""	""	"PRDM13(NM_021620.4):c.397+4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001035378"	"0"	"50"	"6"	"100061735"	"100061752"	"del"	"0"	"01804"	"PRDM13_000034"	"g.100061735_100061752del"	""	""	""	"PRDM13(NM_021620.4):c.1224_1241del (p.(Pro409_Ala414del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001035379"	"0"	"50"	"6"	"100062001"	"100062003"	"del"	"0"	"01804"	"PRDM13_000035"	"g.100062001_100062003del"	""	""	""	"PRDM13(NM_021620.4):c.1490_1492del (p.(Ser497del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes PRDM13
## Count = 108
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000246514"	"00016784"	"30"	"1403"	"0"	"1403"	"0"	"c.1403A>C"	"r.(?)"	"p.(Glu468Ala)"	""
"0000294279"	"00016784"	"30"	"1972"	"0"	"1972"	"0"	"c.1972C>G"	"r.(?)"	"p.(Leu658Val)"	""
"0000294280"	"00016784"	"10"	"277"	"-19"	"277"	"-19"	"c.277-19T>A"	"r.(=)"	"p.(=)"	""
"0000294281"	"00016784"	"10"	"609"	"0"	"609"	"0"	"c.609C>T"	"r.(?)"	"p.(Ser203=)"	""
"0000294282"	"00016784"	"10"	"6"	"0"	"6"	"0"	"c.6C>T"	"r.(?)"	"p.(His2=)"	""
"0000294283"	"00016784"	"10"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	""
"0000306252"	"00016784"	"30"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	""
"0000526526"	"00016784"	"30"	"492"	"0"	"492"	"0"	"c.492C>T"	"r.(?)"	"p.(Gly164=)"	""
"0000526527"	"00016784"	"30"	"609"	"0"	"609"	"0"	"c.609C>T"	"r.(?)"	"p.(Ser203=)"	""
"0000526528"	"00016784"	"30"	"634"	"0"	"634"	"0"	"c.634C>G"	"r.(?)"	"p.(Pro212Ala)"	""
"0000526529"	"00016784"	"50"	"648"	"0"	"651"	"0"	"c.648_651dup"	"r.(?)"	"p.(Val218ThrfsTer235)"	""
"0000526530"	"00016784"	"10"	"864"	"0"	"864"	"0"	"c.864C>T"	"r.(?)"	"p.(Tyr288=)"	""
"0000526531"	"00016784"	"50"	"1403"	"0"	"1403"	"0"	"c.1403A>C"	"r.(?)"	"p.(Glu468Ala)"	""
"0000526532"	"00016784"	"50"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Gly702Asp)"	""
"0000526533"	"00016784"	"50"	"2106"	"0"	"2106"	"0"	"c.2106C>T"	"r.(?)"	"p.(Gly702=)"	""
"0000609878"	"00016784"	"50"	"70"	"0"	"70"	"0"	"c.70C>G"	"r.(?)"	"p.(Leu24Val)"	""
"0000609879"	"00016784"	"10"	"918"	"0"	"918"	"0"	"c.918C>G"	"r.(?)"	"p.(Ala306=)"	""
"0000609880"	"00016784"	"10"	"994"	"0"	"994"	"0"	"c.994G>A"	"r.(?)"	"p.(Gly332Arg)"	""
"0000621606"	"00016784"	"30"	"633"	"0"	"633"	"0"	"c.633C>A"	"r.(?)"	"p.(His211Gln)"	""
"0000621607"	"00016784"	"30"	"864"	"0"	"864"	"0"	"c.864C>T"	"r.(?)"	"p.(Tyr288=)"	""
"0000685359"	"00016784"	"70"	""	"0"	""	"0"	"-"	"r.?"	"p.?"	""
"0000720576"	"00016784"	"50"	"1163"	"0"	"1163"	"0"	"c.1163G>A"	"r.(?)"	"p.(Gly388Asp)"	""
"0000720577"	"00016784"	"30"	"1677"	"0"	"1677"	"0"	"c.1677C>T"	"r.(?)"	"p.(Gly559=)"	""
"0000732968"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.(?)"	""
"0000732969"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.(?)"	""
"0000791667"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791668"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791669"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791670"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791671"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791672"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791673"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791674"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791675"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791676"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000791677"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.-261_*819{2}"	"r.?"	"p.?"	"_1_4_"
"0000791685"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000794704"	"00016784"	"70"	"113"	"0"	"113"	"0"	"c.113C>T"	"r.(?)"	"p.(Ser38Leu)"	""
"0000802244"	"00016784"	"30"	"134"	"0"	"134"	"0"	"c.134C>T"	"r.(?)"	"p.(Pro45Leu)"	""
"0000846686"	"00016784"	"90"	"398"	"-2"	"408"	"0"	"c.398-2_408del"	"r.spl"	"p.?"	""
"0000846687"	"00016784"	"90"	"398"	"-2"	"408"	"0"	"c.398-2_408del"	"r.spl"	"p.?"	""
"0000846688"	"00016784"	"90"	"839"	"0"	"839"	"0"	"c.839del"	"r.(?)"	"p.(Ala280GlyfsTer21)"	""
"0000846689"	"00016784"	"90"	"839"	"0"	"839"	"0"	"c.839del"	"r.(?)"	"p.(Ala280GlyfsTer21)"	""
"0000846690"	"00016784"	"90"	"839"	"0"	"839"	"0"	"c.839del"	"r.(?)"	"p.(Ala280GlyfsTer21)"	""
"0000846691"	"00016784"	"90"	"844"	"0"	"844"	"0"	"c.844del"	"r.(?)"	"p.(Val282SerfsTer19)"	""
"0000846692"	"00016784"	"90"	"844"	"0"	"844"	"0"	"c.844del"	"r.(?)"	"p.(Val282SerfsTer19)"	""
"0000846693"	"00016784"	"90"	"1856"	"0"	"1856"	"0"	"c.1856A>T"	"r.(?)"	"p.(His619Leu)"	""
"0000846694"	"00016784"	"90"	"1856"	"0"	"1856"	"0"	"c.1856A>T"	"r.(?)"	"p.(His619Leu)"	""
"0000846695"	"00016784"	"90"	"800"	"0"	"800"	"0"	"c.800del"	"r.(?)"	"p.(Gly267AspfsTer34)"	""
"0000851013"	"00016784"	"30"	"492"	"0"	"492"	"0"	"c.492C>T"	"r.(?)"	"p.(Gly164=)"	""
"0000860049"	"00016784"	"30"	"972"	"0"	"972"	"0"	"c.972C>G"	"r.(?)"	"p.(Leu324=)"	""
"0000874912"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000874913"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000874914"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000874915"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000874916"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000874917"	"00016784"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000876107"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876108"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876109"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876110"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876111"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876112"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876113"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876114"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876115"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000876116"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000876117"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000876238"	"00016784"	"70"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000876239"	"00016784"	"70"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000876240"	"00016784"	"70"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000886963"	"00016784"	"30"	"1332"	"0"	"1332"	"0"	"c.1332C>G"	"r.(?)"	"p.(Leu444=)"	""
"0000900697"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900698"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900699"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900700"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900701"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900702"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900703"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900704"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900705"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900706"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900707"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900708"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900709"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900710"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900711"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900712"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900713"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900714"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900715"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900716"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900717"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000900718"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"-"	"r.(?)"	"p.?"	"_1"
"0000904869"	"00016784"	"70"	"800"	"0"	"800"	"0"	"c.800del"	"r.(?)"	"p.(Gly267AspfsTer34)"	""
"0000921301"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000921302"	"00016784"	"70"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000921752"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000921753"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000921764"	"00016784"	"90"	"0"	"0"	"0"	"0"	"-"	"r.(=)"	"p.(=)"	"_1"
"0000959446"	"00016784"	"50"	"1975"	"0"	"1975"	"0"	"c.1975C>T"	"r.(?)"	"p.(Leu659Phe)"	""
"0000976904"	"00016784"	"30"	"397"	"4"	"397"	"4"	"c.397+4C>T"	"r.spl?"	"p.?"	""
"0000986490"	"00016784"	"70"	"-13924"	"0"	"-13924"	"0"	"c.-13924G>C"	"r.(?)"	"p.(?)"	"_1"
"0000986491"	"00016784"	"50"	"113"	"0"	"113"	"0"	"c.113C>T"	"r.(?)"	"p.(Ser38Leu)"	"1"
"0000995217"	"00016784"	"50"	"1310"	"0"	"1310"	"0"	"c.1310C>G"	"r.(?)"	"p.(Pro437Arg)"	""
"0001014154"	"00016784"	"30"	"397"	"4"	"397"	"4"	"c.397+4C>T"	"r.spl?"	"p.?"	""
"0001035378"	"00016784"	"50"	"1224"	"0"	"1241"	"0"	"c.1224_1241del"	"r.(?)"	"p.(Pro409_Ala414del)"	""
"0001035379"	"00016784"	"50"	"1490"	"0"	"1492"	"0"	"c.1490_1492del"	"r.(?)"	"p.(Ser497del)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 77
"{{screeningid}}"	"{{variantid}}"
"0000310448"	"0000685359"
"0000334961"	"0000732968"
"0000334962"	"0000732969"
"0000378775"	"0000791667"
"0000378776"	"0000791668"
"0000378777"	"0000791669"
"0000378778"	"0000791670"
"0000378779"	"0000791671"
"0000378780"	"0000791672"
"0000378781"	"0000791673"
"0000378782"	"0000791674"
"0000378783"	"0000791675"
"0000378784"	"0000791676"
"0000378785"	"0000791677"
"0000378791"	"0000791685"
"0000381305"	"0000794704"
"0000409507"	"0000846686"
"0000409508"	"0000846687"
"0000409509"	"0000846688"
"0000409510"	"0000846689"
"0000409511"	"0000846690"
"0000409512"	"0000846691"
"0000409513"	"0000846692"
"0000409514"	"0000846693"
"0000409515"	"0000846694"
"0000409516"	"0000846695"
"0000416667"	"0000874912"
"0000416668"	"0000874913"
"0000416669"	"0000874914"
"0000416670"	"0000874915"
"0000416671"	"0000874916"
"0000416672"	"0000874917"
"0000416696"	"0000876107"
"0000416697"	"0000876108"
"0000416698"	"0000876109"
"0000416699"	"0000876110"
"0000416700"	"0000876111"
"0000416701"	"0000876112"
"0000416702"	"0000876113"
"0000416703"	"0000876114"
"0000416704"	"0000876115"
"0000416705"	"0000876116"
"0000416706"	"0000876117"
"0000416793"	"0000876238"
"0000416794"	"0000876239"
"0000416795"	"0000876240"
"0000424615"	"0000900697"
"0000424616"	"0000900698"
"0000424617"	"0000900699"
"0000424618"	"0000900700"
"0000424619"	"0000900701"
"0000424620"	"0000900702"
"0000424621"	"0000900703"
"0000424622"	"0000900704"
"0000424623"	"0000900705"
"0000424624"	"0000900706"
"0000424625"	"0000900707"
"0000424626"	"0000900708"
"0000424627"	"0000900709"
"0000424628"	"0000900710"
"0000424629"	"0000900711"
"0000424630"	"0000900712"
"0000424631"	"0000900713"
"0000424632"	"0000900714"
"0000424633"	"0000900715"
"0000424634"	"0000900716"
"0000424635"	"0000900717"
"0000424636"	"0000900718"
"0000427509"	"0000904869"
"0000435245"	"0000921301"
"0000435329"	"0000921302"
"0000435602"	"0000921752"
"0000435603"	"0000921753"
"0000435614"	"0000921764"
"0000449236"	"0000959446"
"0000452507"	"0000986490"
"0000452508"	"0000986491"