### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PRODH) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PRODH" "proline dehydrogenase (oxidase) 1" "22" "q11.2" "unknown" "NG_008226.2" "UD_132118349030" "" "https://www.LOVD.nl/PRODH" "" "1" "9453" "5625" "606810" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/PRODH_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-10-23 21:18:15" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00016878" "PRODH" "transcript variant 1" "001" "NM_016335.4" "" "NP_057419.4" "" "" "" "-204" "2204" "1803" "18924066" "18900287" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "01858" "HYRPRO1" "Hyperprolinemia, type I" "AR" "239500" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02317" "SCZD4" "schizophrenia, type 4 (SCZD-4)" "AD" "600850" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02554" "metabolic syndrome" "metabolic syndrome" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-01-15 15:48:08" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "PRODH" "01858" "PRODH" "02317" ## Individuals ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00050438" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected father/child" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050514" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050613" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00181186" "" "" "" "1" "" "02552" "" "" "F" "no" "Switzerland" "" "0" "" "" "ancestors from Switzerland and South Italy" "62075" "00269476" "" "" "" "1" "" "03512" "{PMID:Minardi 2020:32725632}" "" "" "" "" "" "0" "" "" "" "" "00293063" "" "" "" "100" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304887" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00453666" "" "" "" "1" "" "00006" "{PMID:Navarrete 2019:30626930}" "newborn screening" "" "" "Spain" "" "0" "" "" "" "Pat82" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 8 "{{individualid}}" "{{diseaseid}}" "00050438" "00198" "00050514" "00198" "00050613" "00198" "00181186" "00344" "00269476" "00344" "00293063" "00198" "00304887" "00198" "00453666" "02554" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00344, 01858, 02317, 02554 ## Count = 6 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037050" "00198" "00050438" "00006" "Unknown" "" "sparse scalp hair, fragile nails, abnormality of limb bone morphology, alopecia of scalp, high palate, global developmental delay, global developmental delay, abnormality of the heart" "" "" "" "" "" "" "" "" "" "" "" "0000037126" "00198" "00050514" "00006" "Isolated (sporadic)" "" "agenesis of corpus callosum, periventricular gray matter heterotopia, seizures, frontal bossing, eczema" "" "" "" "" "" "" "" "" "" "" "" "0000037225" "00198" "00050613" "00006" "Isolated (sporadic)" "" "specific learning disability, congenital hypothyroidism, abnormality of metabolism/homeostasis, rhabdomyolysis, cardiomyopathy" "" "" "" "" "" "" "" "" "" "" "" "0000144012" "00344" "00181186" "02552" "Isolated (sporadic)" "" "" "00y10m" "" "" "" "" "" "" "" "" "" "" "0000207304" "00344" "00269476" "03512" "Familial, autosomal recessive" "" "Epileptic Encephalopathy (HP:0200134)" "" "" "" "" "" "" "" "" "" "" "" "0000342323" "02554" "00453666" "00006" "Familial, autosomal recessive" "" "see paper; ..., newborn screening tandem mass spectrometry dried blood spots" "" "" "" "" "" "" "" "" "HHYRPRO1" "inborn error of metabolism" "" ## Screenings ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000050383" "00050438" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050459" "00050514" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050558" "00050613" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000182144" "00181186" "1" "02552" "02552" "2018-10-02 15:30:10" "" "" "SEQ-NG-I" "DNA" "blood" "WES" "0000270622" "00269476" "1" "03512" "03512" "2019-11-28 17:16:45" "" "" "SEQ-NG-I" "DNA" "" "" "0000294231" "00293063" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306016" "00304887" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000455278" "00453666" "1" "00006" "00006" "2024-09-11 15:27:41" "" "" "SEQ;SEQ-NG" "DNA" "" "119-gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 80 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000079363" "0" "90" "22" "18889039" "21464119" "del" "0" "00006" "ARVCF_000002" "g.18889039_21464119del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000079439" "0" "90" "22" "18839287" "21830562" "dup" "0" "00006" "ARVCF_000005" "g.18839287_21830562dup" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "increased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000079538" "0" "90" "22" "18893563" "21464119" "del" "0" "00006" "ARVCF_000003" "g.18893563_21464119del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000248729" "0" "10" "22" "18904414" "18904414" "subst" "0.910502" "02325" "PRODH_000007" "g.18904414A>G" "" "" "" "PRODH(NM_016335.6):c.1515T>C (p.F505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18916901A>G" "" "benign" "" "0000248730" "0" "10" "22" "18908875" "18908875" "subst" "0.622197" "02325" "PRODH_000017" "g.18908875A>G" "" "" "" "PRODH(NM_016335.6):c.991T>C (p.L331=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18921362A>G" "" "benign" "" "0000248948" "0" "10" "22" "18912678" "18912678" "subst" "0.635548" "02325" "PRODH_000022" "g.18912678A>G" "" "" "" "PRODH(NM_016335.6):c.553T>C (p.W185R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18925165A>G" "" "benign" "" "0000249263" "0" "10" "22" "18900669" "18900669" "subst" "0.933037" "02325" "PRODH_000001" "g.18900669A>G" "" "" "" "PRODH(NM_016335.6):c.*19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18913156A>G" "" "benign" "" "0000249264" "0" "10" "22" "18910453" "18910453" "del" "0" "02325" "PRODH_000020" "g.18910453del" "" "" "" "PRODH(NM_016335.6):c.733-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18922940del" "" "benign" "" "0000256244" "0" "50" "22" "18909902" "18909902" "subst" "0.00356846" "01943" "PRODH_000019" "g.18909902A>T" "" "" "" "PRODH(NM_016335.4):c.865T>A (p.L289M), PRODH(NM_016335.6):c.865T>A (p.L289M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18922389A>T" "" "VUS" "" "0000256256" "0" "50" "22" "18905934" "18905934" "subst" "0.00521212" "01943" "PRODH_000012" "g.18905934A>G" "" "" "" "PRODH(NM_016335.4):c.1322T>C (p.L441P), PRODH(NM_016335.5):c.1322T>C (p.L441P), PRODH(NM_016335.6):c.1322T>C (p.(Leu441Pro), p.L441P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18918421A>G" "" "VUS" "" "0000297371" "0" "10" "22" "18907124" "18907124" "subst" "0.456164" "02325" "PRODH_000016" "g.18907124G>A" "" "" "" "PRODH(NM_016335.6):c.1105-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18919611G>A" "" "benign" "" "0000297372" "0" "10" "22" "18905978" "18905978" "subst" "0.144109" "02325" "PRODH_000014" "g.18905978G>A" "" "" "" "PRODH(NM_016335.6):c.1278C>T (p.D426=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18918465G>A" "" "benign" "" "0000297373" "0" "10" "22" "18901004" "18901004" "subst" "0.928193" "02325" "PRODH_000006" "g.18901004C>T" "" "" "" "PRODH(NM_016335.6):c.1562G>A (p.R521Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18913491C>T" "" "benign" "" "0000297374" "0" "10" "22" "18900750" "18900750" "subst" "0.78378" "02325" "PRODH_000002" "g.18900750G>A" "" "" "" "PRODH(NM_016335.6):c.1741C>T (p.L581=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18913237G>A" "" "benign" "" "0000297375" "0" "10" "22" "18923745" "18923745" "subst" "0.558796" "02325" "PRODH_000023" "g.18923745G>T" "" "" "" "PRODH(NM_016335.6):c.56C>A (p.P19Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18936232G>T" "" "benign" "" "0000301233" "0" "30" "22" "18905964" "18905964" "subst" "0.0722605" "02326" "PRODH_000013" "g.18905964C>T" "" "" "" "PRODH(NM_016335.5):c.1292G>A (p.R431H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18918451C>T" "" "likely benign" "" "0000301234" "0" "90" "22" "18908937" "18908937" "subst" "0.00015493" "02326" "PRODH_000018" "g.18908937C>G" "" "" "" "PRODH(NM_016335.5):c.930-1G>C, PRODH(NM_016335.6):c.930-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18921424C>G" "" "pathogenic" "" "0000306441" "0" "50" "22" "18907052" "18907052" "subst" "1.63291E-5" "01943" "PRODH_000015" "g.18907052G>A" "" "" "" "PRODH(NM_016335.4):c.1163C>T (p.P388L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18919539G>A" "" "VUS" "" "0000306442" "0" "10" "22" "18905859" "18905859" "subst" "0.00456016" "01943" "PRODH_000011" "g.18905859G>A" "" "" "" "PRODH(NM_016335.4):c.1397C>T (p.T466M, p.(Thr466Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18918346G>A" "" "benign" "" "0000306443" "0" "30" "22" "18900884" "18900884" "subst" "0" "01943" "PRODH_000005" "g.18900884G>A" "" "" "" "PRODH(NM_016335.4):c.1616-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18913371G>A" "" "likely benign" "" "0000306444" "0" "50" "22" "18912653" "18912653" "subst" "0.000292429" "01943" "PRODH_000021" "g.18912653C>T" "" "" "" "PRODH(NM_016335.4):c.578G>A (p.G193D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18925140C>T" "" "VUS" "" "0000328854" "0" "30" "22" "18897756" "18897756" "subst" "0.0192111" "01804" "DGCR6_000015" "g.18897756C>A" "" "" "" "DGCR6(NM_005675.4):c.343C>A (p.(Leu115Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910243C>A" "" "likely benign" "" "0000328855" "0" "30" "22" "18897756" "18897756" "subst" "0.00410761" "01804" "DGCR6_000016" "g.18897756C>G" "" "" "" "DGCR6(NM_005675.4):c.343C>G (p.(Leu115Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910243C>G" "" "likely benign" "" "0000328856" "0" "30" "22" "18897763" "18897763" "subst" "0.00397094" "01804" "DGCR6_000017" "g.18897763C>T" "" "" "" "DGCR6(NM_005675.4):c.350C>T (p.(Ala117Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910250C>T" "" "likely benign" "" "0000328857" "0" "50" "22" "18897771" "18897771" "subst" "0" "01804" "DGCR6_000018" "g.18897771C>T" "" "" "" "DGCR6(NM_005675.4):c.358C>T (p.(Gln120Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910258C>T" "" "VUS" "" "0000328858" "0" "30" "22" "18898395" "18898395" "subst" "0.00970451" "01804" "DGCR6_000001" "g.18898395C>T" "" "" "" "DGCR6(NM_005675.4):c.373-6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910882C>T" "" "likely benign" "" "0000328860" "0" "50" "22" "18898403" "18898403" "subst" "0.000127358" "01804" "DGCR6_000002" "g.18898403G>A" "" "" "" "DGCR6(NM_005675.4):c.375G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910890G>A" "" "VUS" "" "0000328862" "0" "50" "22" "18898414" "18898414" "subst" "4.09319E-5" "01804" "DGCR6_000004" "g.18898414G>A" "" "" "" "DGCR6(NM_005675.4):c.386G>A (p.(Arg129Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910901G>A" "" "VUS" "" "0000328863" "0" "30" "22" "18898420" "18898420" "subst" "0.00286744" "01804" "DGCR6_000005" "g.18898420G>A" "" "" "" "DGCR6(NM_005675.4):c.392G>A (p.(Arg131His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910907G>A" "" "likely benign" "" "0000328864" "0" "30" "22" "18898468" "18898468" "subst" "0.00246131" "01804" "DGCR6_000006" "g.18898468G>A" "" "" "" "DGCR6(NM_005675.4):c.440G>A (p.(Arg147Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18910955G>A" "" "likely benign" "" "0000328869" "0" "30" "22" "18904466" "18904466" "subst" "0.00269731" "01804" "PRODH_000008" "g.18904466T>C" "" "" "" "PRODH(NM_001195226.1):c.1139A>G (p.(Asn380Ser)), PRODH(NM_016335.4):c.1463A>G (p.N488S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18916953T>C" "" "likely benign" "" "0000328871" "0" "30" "22" "18904484" "18904484" "subst" "0" "01804" "PRODH_000010" "g.18904484A>G" "" "" "" "PRODH(NM_001195226.1):c.1121T>C (p.(Leu374Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18916971A>G" "" "likely benign" "" "0000347173" "0" "70" "22" "18905934" "18905934" "subst" "0.00521212" "02327" "PRODH_000012" "g.18905934A>G" "" "" "" "PRODH(NM_016335.4):c.1322T>C (p.L441P), PRODH(NM_016335.5):c.1322T>C (p.L441P), PRODH(NM_016335.6):c.1322T>C (p.(Leu441Pro), p.L441P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18918421A>G" "" "likely pathogenic" "" "0000405977" "21" "90" "22" "18905899" "18905899" "subst" "0.0106467" "02552" "PRODH_000025" "g.18905899G>A" "" "{PMID:Papuc 2019:30552426}" "" "" "" "Germline" "" "rs3970559" "0" "" "" "g.18918386G>A" "" "pathogenic" "" "0000405978" "0" "90" "22" "18901004" "18901004" "subst" "0.928193" "02552" "PRODH_000024" "g.18901004C>T" "" "{PMID:Papuc 2019:30552426}" "" "1562A>G (Gln521Arg)" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs450046" "0" "" "" "" "" "pathogenic" "" "0000571295" "0" "90" "22" "18905899" "18905899" "subst" "0.0106467" "02325" "PRODH_000025" "g.18905899G>A" "" "" "" "PRODH(NM_016335.5):c.1357C>T (p.R453C), PRODH(NM_016335.6):c.1357C>T (p.R453C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18918386G>A" "" "pathogenic" "" "0000571296" "0" "50" "22" "18905899" "18905899" "subst" "0.0106467" "02326" "PRODH_000025" "g.18905899G>A" "" "" "" "PRODH(NM_016335.5):c.1357C>T (p.R453C), PRODH(NM_016335.6):c.1357C>T (p.R453C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18918386G>A" "" "VUS" "" "0000571297" "0" "50" "22" "18907230" "18907230" "subst" "2.03676E-5" "01943" "PRODH_000026" "g.18907230C>A" "" "" "" "PRODH(NM_016335.4):c.1093G>T (p.V365F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18919717C>A" "" "VUS" "" "0000571298" "0" "50" "22" "18910407" "18910407" "subst" "0" "02325" "PRODH_000027" "g.18910407A>C" "" "" "" "PRODH(NM_016335.6):c.772T>G (p.F258V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18922894A>C" "" "VUS" "" "0000571299" "0" "50" "22" "18910657" "18910657" "subst" "0.000580744" "02329" "PRODH_000028" "g.18910657G>A" "" "" "" "PRODH(NM_016335.6):c.703C>T (p.L235F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18923144G>A" "" "VUS" "" "0000571300" "0" "10" "22" "18910756" "18910756" "subst" "0" "02325" "PRODH_000029" "g.18910756C>G" "" "" "" "PRODH(NM_016335.6):c.668-64G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18923243C>G" "" "benign" "" "0000571301" "0" "50" "22" "18923648" "18923674" "del" "0" "01943" "PRODH_000030" "g.18923648_18923674del" "" "" "" "PRODH(NM_016335.4):c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC (p.T44_A52del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18936135_18936161del" "" "VUS" "" "0000604404" "21" "90" "22" "18905859" "18905859" "subst" "0.00456016" "03512" "PRODH_000011" "g.18905859G>A" "" "{PMID:Minardi 2020:32725632}" "" "" "" "Germline" "" "" "0" "" "" "g.18918346G>A" "" "pathogenic (recessive)" "" "0000604405" "11" "90" "22" "18905934" "18905934" "subst" "0.00521212" "03512" "PRODH_000012" "g.18905934A>G" "" "{PMID:Minardi 2020:32725632}" "" "" "" "Germline" "" "" "0" "" "" "g.18918421A>G" "" "pathogenic (recessive)" "" "0000618450" "0" "50" "22" "18905934" "18905934" "subst" "0.00521212" "02326" "PRODH_000012" "g.18905934A>G" "" "" "" "PRODH(NM_016335.4):c.1322T>C (p.L441P), PRODH(NM_016335.5):c.1322T>C (p.L441P), PRODH(NM_016335.6):c.1322T>C (p.(Leu441Pro), p.L441P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18918421A>G" "" "VUS" "" "0000618451" "0" "50" "22" "18907089" "18907089" "subst" "0.000215644" "01943" "PRODH_000031" "g.18907089G>A" "" "" "" "PRODH(NM_016335.4):c.1126C>T (p.R376W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18919576G>A" "" "VUS" "" "0000650920" "1" "10" "22" "18912677" "18912677" "subst" "0.0389765" "03575" "PRODH_000032" "g.18912677C>T" "100/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "100 heterozygous; {DB:CLININrs11913840}" "Germline" "" "rs11913840" "0" "" "" "g.18925164C>T" "" "benign" "" "0000658871" "0" "30" "22" "18904466" "18904466" "subst" "0.00269731" "01943" "PRODH_000008" "g.18904466T>C" "" "" "" "PRODH(NM_001195226.1):c.1139A>G (p.(Asn380Ser)), PRODH(NM_016335.4):c.1463A>G (p.N488S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18916953T>C" "" "likely benign" "" "0000669704" "3" "10" "22" "18912677" "18912677" "subst" "0.0389765" "03575" "PRODH_000032" "g.18912677C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs11913840}" "Germline" "" "rs11913840" "0" "" "" "g.18925164C>T" "" "benign" "" "0000681775" "0" "30" "22" "18909835" "18909835" "subst" "2.92381E-5" "01943" "PRODH_000033" "g.18909835C>T" "" "" "" "PRODH(NM_016335.4):c.929+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681776" "0" "30" "22" "18909902" "18909902" "subst" "0.00356846" "02325" "PRODH_000019" "g.18909902A>T" "" "" "" "PRODH(NM_016335.4):c.865T>A (p.L289M), PRODH(NM_016335.6):c.865T>A (p.L289M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693100" "0" "50" "22" "18905893" "18905893" "subst" "0.000915773" "01943" "PRODH_000034" "g.18905893C>A" "" "" "" "PRODH(NM_016335.4):c.1363G>T (p.A455S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693101" "0" "90" "22" "18905934" "18905934" "subst" "0.00521212" "02325" "PRODH_000012" "g.18905934A>G" "" "" "" "PRODH(NM_016335.4):c.1322T>C (p.L441P), PRODH(NM_016335.5):c.1322T>C (p.L441P), PRODH(NM_016335.6):c.1322T>C (p.(Leu441Pro), p.L441P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000693102" "0" "50" "22" "18908937" "18908937" "subst" "0.00015493" "02325" "PRODH_000018" "g.18908937C>G" "" "" "" "PRODH(NM_016335.5):c.930-1G>C, PRODH(NM_016335.6):c.930-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693103" "0" "30" "22" "18910376" "18910376" "subst" "6.09295E-5" "01943" "PRODH_000035" "g.18910376G>A" "" "" "" "PRODH(NM_016335.4):c.803C>T (p.A268V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728028" "0" "50" "22" "18910412" "18910412" "subst" "0.000231495" "01943" "PRODH_000036" "g.18910412C>A" "" "" "" "PRODH(NM_016335.4):c.767G>T (p.C256F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728029" "0" "30" "22" "18923785" "18923785" "subst" "0" "01943" "PRODH_000037" "g.18923785C>T" "" "" "" "PRODH(NM_016335.4):c.16G>A (p.A6T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728030" "0" "50" "22" "18923799" "18923799" "subst" "0" "01943" "PRODH_000038" "g.18923799A>T" "" "" "" "PRODH(NM_016335.4):c.2T>A (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809477" "0" "30" "22" "18901014" "18901014" "subst" "0" "01943" "DGCR6_000021" "g.18901014C>T" "" "" "" "PRODH(NM_016335.4):c.1552G>A (p.A518T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809478" "0" "30" "22" "18907007" "18907007" "subst" "0" "01943" "PRODH_000039" "g.18907007A>G" "" "" "" "PRODH(NM_016335.4):c.1208T>C (p.V403A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809479" "0" "30" "22" "18912625" "18912625" "subst" "0.00022748" "01943" "PRODH_000040" "g.18912625G>A" "" "" "" "PRODH(NM_016335.4):c.606C>T (p.Y202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856054" "0" "30" "22" "18901042" "18901042" "subst" "0" "02325" "DGCR6_000022" "g.18901042G>A" "" "" "" "PRODH(NM_016335.6):c.1527-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895580" "0" "50" "22" "18906979" "18906979" "subst" "0" "02327" "PRODH_000041" "g.18906979G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895581" "0" "50" "22" "18918627" "18918627" "subst" "0" "02325" "PRODH_000042" "g.18918627C>A" "" "" "" "PRODH(NM_016335.6):c.358G>T (p.G120W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951534" "0" "50" "22" "18907014" "18907014" "subst" "8.13544E-6" "02325" "PRODH_000043" "g.18907014A>G" "" "" "" "PRODH(NM_016335.6):c.1201T>C (p.F401L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970363" "0" "10" "22" "18900669" "18900669" "subst" "0.933037" "02327" "PRODH_000001" "g.18900669A>G" "" "" "" "PRODH(NM_016335.6):c.*19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970364" "0" "10" "22" "18900750" "18900750" "subst" "0.78378" "02327" "PRODH_000002" "g.18900750G>A" "" "" "" "PRODH(NM_016335.6):c.1741C>T (p.L581=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970365" "0" "10" "22" "18901004" "18901004" "subst" "0.928193" "02327" "PRODH_000006" "g.18901004C>T" "" "" "" "PRODH(NM_016335.6):c.1562G>A (p.R521Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970366" "0" "10" "22" "18904414" "18904414" "subst" "0.910502" "02327" "PRODH_000007" "g.18904414A>G" "" "" "" "PRODH(NM_016335.6):c.1515T>C (p.F505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970367" "0" "50" "22" "18906998" "18906998" "subst" "0.00192137" "02327" "PRODH_000044" "g.18906998G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005878" "0" "30" "22" "18901023" "18901023" "subst" "0" "01804" "DGCR6_000023" "g.18901023G>T" "" "" "" "PRODH(NM_016335.4):c.1543C>A (p.(Leu515Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005879" "0" "50" "22" "18905859" "18905859" "subst" "0.00456016" "01804" "PRODH_000011" "g.18905859G>A" "" "" "" "PRODH(NM_016335.4):c.1397C>T (p.T466M, p.(Thr466Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001007311" "1" "70" "22" "18923745" "18923745" "subst" "0.558796" "00006" "PRODH_000023" "g.18923745G>T" "" "{PMID:Navarrete 2019:30626930}" "" "56A>C (Pro19Gln)" "" "Germline" "" "" "0" "" "" "g.18936232G>T" "" "likely pathogenic" "" "0001007418" "2" "70" "22" "18912678" "18912678" "=" "0" "00006" "PRODH_000045" "g.18912678=" "" "{PMID:Navarrete 2019:30626930}" "" "" "" "Germline" "" "" "0" "" "" "g.18925165=" "" "likely pathogenic" "" "0001027362" "0" "10" "22" "18905964" "18905964" "subst" "0.0722605" "02327" "PRODH_000013" "g.18905964C>T" "" "" "" "PRODH(NM_016335.5):c.1292G>A (p.R431H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027363" "0" "10" "22" "18907124" "18907124" "subst" "0.456164" "02327" "PRODH_000016" "g.18907124G>A" "" "" "" "PRODH(NM_016335.6):c.1105-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027364" "0" "10" "22" "18912678" "18912678" "subst" "0.635548" "02327" "PRODH_000022" "g.18912678A>G" "" "" "" "PRODH(NM_016335.6):c.553T>C (p.W185R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027365" "0" "30" "22" "18923512" "18923512" "subst" "7.69468E-5" "02327" "PRODH_000046" "g.18923512C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043695" "0" "70" "22" "18905934" "18905934" "subst" "0.00521212" "01804" "PRODH_000012" "g.18905934A>G" "" "" "" "PRODH(NM_016335.4):c.1322T>C (p.L441P), PRODH(NM_016335.5):c.1322T>C (p.L441P), PRODH(NM_016335.6):c.1322T>C (p.(Leu441Pro), p.L441P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001043696" "0" "50" "22" "18923533" "18923533" "subst" "0" "01804" "PRODH_000047" "g.18923533C>A" "" "" "" "PRODH(NM_016335.6):c.268G>T (p.(Glu90*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PRODH ## Count = 80 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000079363" "00016878" "00" "-2540257" "0" "13452" "0" "c.-2540257_*11649del" "r.0?" "p.0?" "" "0000079439" "00016878" "00" "-2906700" "0" "63204" "0" "c.-2906700_*61401dup" "r.?" "p.?" "" "0000079538" "00016878" "00" "-2540257" "0" "8928" "0" "c.-2540257_*7125del" "" "" "" "0000248729" "00016878" "10" "1515" "0" "1515" "0" "c.1515T>C" "r.(?)" "p.(Phe505=)" "" "0000248730" "00016878" "10" "991" "0" "991" "0" "c.991T>C" "r.(?)" "p.(Leu331=)" "" "0000248948" "00016878" "10" "553" "0" "553" "0" "c.553=" "r.(=)" "p.(Arg185=)" "" "0000249263" "00016878" "10" "1822" "0" "1822" "0" "c.*19T>C" "r.(=)" "p.(=)" "" "0000249264" "00016878" "10" "733" "-5" "733" "-5" "c.733-5del" "r.spl?" "p.?" "" "0000256244" "00016878" "50" "865" "0" "865" "0" "c.865T>A" "r.(?)" "p.(Leu289Met)" "" "0000256256" "00016878" "50" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0000297371" "00016878" "10" "1105" "-14" "1105" "-14" "c.1105-14C>T" "r.(=)" "p.(=)" "" "0000297372" "00016878" "10" "1278" "0" "1278" "0" "c.1278C>T" "r.(?)" "p.(Asp426=)" "" "0000297373" "00016878" "10" "1562" "0" "1562" "0" "c.1562=" "r.(=)" "p.(Gln521=)" "" "0000297374" "00016878" "10" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(Leu581=)" "" "0000297375" "00016878" "10" "56" "0" "56" "0" "c.56C>A" "r.(?)" "p.(Pro19Gln)" "" "0000301233" "00016878" "30" "1292" "0" "1292" "0" "c.1292G>A" "r.(?)" "p.(Arg431His)" "" "0000301234" "00016878" "90" "930" "-1" "930" "-1" "c.930-1G>C" "r.spl?" "p.?" "" "0000306441" "00016878" "50" "1163" "0" "1163" "0" "c.1163C>T" "r.(?)" "p.(Pro388Leu)" "" "0000306442" "00016878" "10" "1397" "0" "1397" "0" "c.1397C>T" "r.(?)" "p.(Thr466Met)" "" "0000306443" "00016878" "30" "1616" "-9" "1616" "-9" "c.1616-9C>T" "r.(=)" "p.(=)" "" "0000306444" "00016878" "50" "578" "0" "578" "0" "c.578G>A" "r.(?)" "p.(Gly193Asp)" "" "0000328854" "00016878" "30" "4735" "0" "4735" "0" "c.*2932G>T" "r.(=)" "p.(=)" "" "0000328855" "00016878" "30" "4735" "0" "4735" "0" "c.*2932G>C" "r.(=)" "p.(=)" "" "0000328856" "00016878" "30" "4728" "0" "4728" "0" "c.*2925G>A" "r.(=)" "p.(=)" "" "0000328857" "00016878" "50" "4720" "0" "4720" "0" "c.*2917G>A" "r.(=)" "p.(=)" "" "0000328858" "00016878" "30" "4096" "0" "4096" "0" "c.*2293G>A" "r.(=)" "p.(=)" "" "0000328860" "00016878" "50" "4088" "0" "4088" "0" "c.*2285C>T" "r.(=)" "p.(=)" "" "0000328862" "00016878" "50" "4077" "0" "4077" "0" "c.*2274C>T" "r.(=)" "p.(=)" "" "0000328863" "00016878" "30" "4071" "0" "4071" "0" "c.*2268C>T" "r.(=)" "p.(=)" "" "0000328864" "00016878" "30" "4023" "0" "4023" "0" "c.*2220C>T" "r.(=)" "p.(=)" "" "0000328869" "00016878" "30" "1463" "0" "1463" "0" "c.1463A>G" "r.(?)" "p.(Asn488Ser)" "" "0000328871" "00016878" "30" "1445" "0" "1445" "0" "c.1445T>C" "r.(?)" "p.(Leu482Ser)" "" "0000347173" "00016878" "70" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0000405977" "00016878" "90" "1357" "0" "1357" "0" "c.1357C>T" "r.(?)" "p.(Arg453Cys)" "" "0000405978" "00016878" "90" "1562" "0" "1562" "0" "c.1562G>A" "r.(?)" "p.(Arg521Gln)" "14" "0000571295" "00016878" "90" "1357" "0" "1357" "0" "c.1357C>T" "r.(?)" "p.(Arg453Cys)" "" "0000571296" "00016878" "50" "1357" "0" "1357" "0" "c.1357C>T" "r.(?)" "p.(Arg453Cys)" "" "0000571297" "00016878" "50" "1093" "0" "1093" "0" "c.1093G>T" "r.(?)" "p.(Val365Phe)" "" "0000571298" "00016878" "50" "772" "0" "772" "0" "c.772T>G" "r.(?)" "p.(Phe258Val)" "" "0000571299" "00016878" "50" "703" "0" "703" "0" "c.703C>T" "r.(?)" "p.(Leu235Phe)" "" "0000571300" "00016878" "10" "668" "-64" "668" "-64" "c.668-64G>C" "r.(=)" "p.(=)" "" "0000571301" "00016878" "50" "130" "0" "156" "0" "c.130_156del" "r.(?)" "p.(Thr44_Ala52del)" "" "0000604404" "00016878" "90" "1397" "0" "1397" "0" "c.1397C>T" "r.(?)" "p.(Thr466Met)" "" "0000604405" "00016878" "90" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0000618450" "00016878" "50" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0000618451" "00016878" "50" "1126" "0" "1126" "0" "c.1126C>T" "r.(?)" "p.(Arg376Trp)" "" "0000650920" "00016878" "10" "554" "0" "554" "0" "c.554G>A" "r.(?)" "p.(Trp185*)" "" "0000658871" "00016878" "30" "1463" "0" "1463" "0" "c.1463A>G" "r.(?)" "p.(Asn488Ser)" "" "0000669704" "00016878" "10" "554" "0" "554" "0" "c.554G>A" "r.(?)" "p.(Trp185*)" "" "0000681775" "00016878" "30" "929" "3" "929" "3" "c.929+3G>A" "r.spl?" "p.?" "" "0000681776" "00016878" "30" "865" "0" "865" "0" "c.865T>A" "r.(?)" "p.(Leu289Met)" "" "0000693100" "00016878" "50" "1363" "0" "1363" "0" "c.1363G>T" "r.(?)" "p.(Ala455Ser)" "" "0000693101" "00016878" "90" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0000693102" "00016878" "50" "930" "-1" "930" "-1" "c.930-1G>C" "r.spl?" "p.?" "" "0000693103" "00016878" "30" "803" "0" "803" "0" "c.803C>T" "r.(?)" "p.(Ala268Val)" "" "0000728028" "00016878" "50" "767" "0" "767" "0" "c.767G>T" "r.(?)" "p.(Cys256Phe)" "" "0000728029" "00016878" "30" "16" "0" "16" "0" "c.16G>A" "r.(?)" "p.(Ala6Thr)" "" "0000728030" "00016878" "50" "2" "0" "2" "0" "c.2T>A" "r.(?)" "p.(Met1?)" "" "0000809477" "00016878" "30" "1552" "0" "1552" "0" "c.1552G>A" "r.(?)" "p.(Ala518Thr)" "" "0000809478" "00016878" "30" "1208" "0" "1208" "0" "c.1208T>C" "r.(?)" "p.(Val403Ala)" "" "0000809479" "00016878" "30" "606" "0" "606" "0" "c.606C>T" "r.(?)" "p.(Tyr202=)" "" "0000856054" "00016878" "30" "1527" "-3" "1527" "-3" "c.1527-3C>T" "r.spl?" "p.?" "" "0000895580" "00016878" "50" "1236" "0" "1236" "0" "c.1236C>G" "r.(?)" "p.(Tyr412*)" "" "0000895581" "00016878" "50" "358" "0" "358" "0" "c.358G>T" "r.(?)" "p.(Gly120Trp)" "" "0000951534" "00016878" "50" "1201" "0" "1201" "0" "c.1201T>C" "r.(?)" "p.(Phe401Leu)" "" "0000970363" "00016878" "10" "1822" "0" "1822" "0" "c.*19T>C" "r.(=)" "p.(=)" "" "0000970364" "00016878" "10" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(Leu581=)" "" "0000970365" "00016878" "10" "1562" "0" "1562" "0" "c.1562=" "r.(=)" "p.(Gln521=)" "" "0000970366" "00016878" "10" "1515" "0" "1515" "0" "c.1515T>C" "r.(?)" "p.(Phe505=)" "" "0000970367" "00016878" "50" "1217" "0" "1217" "0" "c.1217C>T" "r.(?)" "p.(Pro406Leu)" "" "0001005878" "00016878" "30" "1543" "0" "1543" "0" "c.1543C>A" "r.(?)" "p.(Leu515Met)" "" "0001005879" "00016878" "50" "1397" "0" "1397" "0" "c.1397C>T" "r.(?)" "p.(Thr466Met)" "" "0001007311" "00016878" "70" "56" "0" "56" "0" "c.56C>A" "r.(?)" "p.(Pro19Gln)" "" "0001007418" "00016878" "70" "553" "0" "553" "0" "c.553C>T" "r.(?)" "p.(Arg185Trp)" "" "0001027362" "00016878" "10" "1292" "0" "1292" "0" "c.1292G>A" "r.(?)" "p.(Arg431His)" "" "0001027363" "00016878" "10" "1105" "-14" "1105" "-14" "c.1105-14C>T" "r.(=)" "p.(=)" "" "0001027364" "00016878" "10" "553" "0" "553" "0" "c.553=" "r.(=)" "p.(Arg185=)" "" "0001027365" "00016878" "30" "273" "16" "273" "16" "c.273+16G>C" "r.(=)" "p.(=)" "" "0001043695" "00016878" "70" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Leu441Pro)" "" "0001043696" "00016878" "50" "268" "0" "268" "0" "c.268G>T" "r.(?)" "p.(Glu90*)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 11 "{{screeningid}}" "{{variantid}}" "0000050383" "0000079363" "0000050459" "0000079439" "0000050558" "0000079538" "0000182144" "0000405977" "0000182144" "0000405978" "0000270622" "0000604404" "0000270622" "0000604405" "0000294231" "0000650920" "0000306016" "0000669704" "0000455278" "0001007311" "0000455278" "0001007418"