### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = PRR12) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "PRR12" "proline rich 12" "19" "q13.33" "unknown" "NG_051202.1" "UD_136080060500" "" "https://www.LOVD.nl/PRR12" "" "1" "29217" "57479" "616633" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/PRR12_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-10-30 14:01:05" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00016924" "PRR12" "proline rich 12" "001" "NM_020719.1" "" "NP_065770.1" "" "" "" "1" "6943" "6111" "50094912" "50129696" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00356" "MCOP" "anoophthalmia/microphthalmia" "" "" "" "" "" "00006" "2014-03-14 18:41:31" "00006" "2025-11-23 21:29:13" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06981" "NOC" "neuroocular syndrome" "AD" "619539" "" "" "" "00006" "2022-11-30 16:21:49" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "PRR12" "06981" ## Individuals ## Do not remove or alter this header ## ## Count = 40 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00315936" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "F" "" "United States" "" "0" "" "" "white" "Pat1" "00315937" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "M" "" "United States" "" "0" "" "" "" "Pat2" "00315938" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "M" "" "United States" "" "0" "" "" "" "Pat3" "00315939" "" "" "" "1" "" "00006" "{PMID:Cordova-Fletes 2015:26163108}" "" "F" "" "Mexico" "" "0" "" "" "" "patient" "00315940" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "DECIPHER" "00315941" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "DECIPHER" "00315942" "" "" "" "1" "" "00006" "{PMID:Leduc 2018:29556724}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Hispanic" "DECIPHER251777" "00315943" "" "" "" "1" "" "00006" "{PMID:Cordova-Fletes 2020:32597225}" "" "M" "" "Mexico" "" "0" "" "" "" "Pat1" "00315971" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "United States" "" "0" "" "" "Europe-N" "Pat1" "00315972" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "" "" "0" "" "" "white" "Pat2" "00315973" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "Germany" "" "0" "" "" "" "Pat3" "00315974" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "Japan" "" "0" "" "" "" "Pat4" "00315975" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "Japan" "" "0" "" "" "" "Pat5" "00315976" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "Nepal" "" "0" "" "" "" "Pat6" "00315977" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "United States" "" "0" "" "" "white" "Pat7" "00315978" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "United States" "" "0" "" "" "Europe" "Pat8" "00315979" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "France;Germany;Netherlands" "" "0" "" "" "" "Pat9" "00315980" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "Japan" "" "0" "" "" "" "Pat10" "00315981" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "" "" "0" "" "" "Arab" "Pat11" "00315982" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "United States" "" "0" "" "" "white;Europe" "Pat12" "00315983" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "" "" "0" "" "" "white" "Pat13" "00315984" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "" "" "0" "" "" "white" "Pat14" "00315985" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "Philippines" "" "0" "" "" "" "Pat15" "00315986" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "" "" "0" "" "" "white" "Pat16" "00315987" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "" "" "0" "" "" "white" "Pat17" "00315988" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "F" "" "Netherlands" "" "0" "" "" "" "Pat18" "00315989" "" "" "" "1" "" "00006" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "M" "" "Italy" "" "0" "" "" "" "Pat20" "00315990" "" "" "" "1" "" "00006" "{DECIPHER:260525}" "" "" "" "" "" "0" "" "" "" "DECIPHER260525" "00315991" "" "" "" "1" "" "00006" "{DECIPHER:277812}" "" "" "" "" "" "0" "" "" "" "DECIPHER277812" "00315992" "" "" "" "1" "" "00006" "{DECIPHER:280416}" "" "" "" "" "" "0" "" "" "" "DECIPHER280416" "00315993" "" "" "" "1" "" "00006" "{DECIPHER:417908}" "" "" "" "" "" "0" "" "" "" "DECIPHER417908" "00426469" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "209706" "00426470" "" "" "" "2" "" "00006" "{PMID:Reis 2021:33314030}," "3-generation family, affected mother/daughter" "F" "" "United States" "" "0" "" "" "" "Fam1Pat1A" "00426471" "" "" "00426470" "1" "" "00006" "{PMID:Reis 2021:33314030}" "daughter" "F" "" "United States" "" "0" "" "" "" "FamPatB" "00426472" "" "" "" "1" "" "00006" "{PMID:Reis 2021:33314030}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "Pat2" "00426473" "" "" "" "1" "" "00006" "{PMID:Reis 2021:33314030}" "3-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "Pat3" "00426474" "" "" "" "1" "" "00006" "{PMID:Reis 2021:33314030}" "2-generation family, 1 affected, unaffected parents" "F" "" "United States" "" "0" "" "" "" "Pat4" "00426477" "" "" "" "1" "" "00006" "{PMID:Chowdhury 2021:33824499}" "" "F" "" "" "" "0" "" "" "white" "Pat19" "00427165" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "210060" "00435600" "" "" "" "1" "" "00006" "{PMID:Niggl 2023:37541189}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat6" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 40 "{{individualid}}" "{{diseaseid}}" "00315936" "00139" "00315937" "00139" "00315938" "00139" "00315939" "00139" "00315940" "00198" "00315941" "00198" "00315942" "00198" "00315943" "00198" "00315971" "00198" "00315972" "00198" "00315973" "00198" "00315974" "00198" "00315975" "00198" "00315976" "00198" "00315977" "00198" "00315978" "00198" "00315979" "00198" "00315980" "00198" "00315981" "00198" "00315982" "00198" "00315983" "00198" "00315984" "00198" "00315985" "00198" "00315986" "00198" "00315987" "00198" "00315988" "00198" "00315989" "00198" "00315990" "00198" "00315991" "00198" "00315992" "00198" "00315993" "00198" "00426469" "06981" "00426470" "00356" "00426471" "00356" "00426472" "00356" "00426473" "00356" "00426474" "00356" "00426477" "00198" "00427165" "06981" "00435600" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00356, 05611, 06981 ## Count = 40 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000239681" "00139" "00315936" "00006" "Isolated (sporadic)" "4y11m" "sit-12m, walk-24m; 1st word 24m, combined words 36m; intellectual disability; no seizures; truncal hypotonia; gait narrow base of support, short choppy steps; autism, anxiety; excessive sleep (18h/day), low energy; iris brushfield spots, stellate pattern, brilliant blue; left iris coloboma; long eyelashes, synophyrs, nasolacrimal duct obstruction; myopia, exotropia; microcephaly, low set small ears, ear lobe creases, down pointing mouth, slight retrognathia ; pectus excavatum, 2–3 toe syndactyly; 2 maternal half-sisters attention deficit and hyperactivity" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000239682" "00139" "00315937" "00006" "Isolated (sporadic)" "8y" "walk-18; speech delay, 3y-speech therapy; intellectual disability; no seizures; history of hypotonia which has improved; immature motor skills, significant motor planning difficulties ; autism, attention deficit and hyperactivity; difficulty falling asleep; stellate iris pattern; no coloboma; mild ptosis, distichiasis, lagophthalmos, mildly downslanting palpebral fissures; mild accommodative exotropia ; flattened midface, downslanting palpebral fissures, hooded upper eyelids, low-set ears and mild overbite; mild scapular winging; unilateral hearing loss; no family history" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000239683" "00139" "00315938" "00006" "Isolated (sporadic)" "6y7m" "sit-5–6m, walk-13m; speech delay, poor articulation; intellectual disability; no seizures; 3+ brisk patellars; abnormal gait, reported likely due to tibial torsion; attention deficit and hyperactivity, anxiety; snoring, obstructive sleep apnea; blue irides with stellate pattern; bilateral iris and lentincular coloboma; deep set eyes, ptosis, synophyrs, arched heavy eyebrows, large looking palpebral fissures; myopia with astigmatism, unilateral strabismic amblyopia, resolved exotropia; microcephaly, soft cartilage, cupped ears, submucous cleft palate, torus palatinus, small uvula, wide spaced/irregular/small teeth, supraorbital ridges; sacral dimple, genu recurvatum, tibial torsion, pes planus, fifth finger clinodactyly, hyperextension in small joints of hands: umbilical hernia, ankyloglossia, patent foramen ovale, tapered fingers, small nails, prominent finger pads, deep hand creases; Chiari I malformation in mother and maternal aunt" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000239684" "00139" "00315939" "00006" "Isolated (sporadic)" "11y" "see paper; ..., intellectual disability; 1w-seizures since 1st week of age; no hypotonia, no hypertonia; normal gait; anxiety, poor visual contact, short attention span, lack of social sharing; no iris abnormality, no coloboma; synophrys, myopia, strabismus; long philtrum; bilateral pes varus; hypertrichosis, abundant gray hair, persistence of fingerpads; no family history" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000239685" "00198" "00315940" "00006" "Isolated (sporadic)" "" "abnormalities head or neck, abnormalities nervous system" "" "" "" "" "" "" "" "" "" "" "" "0000239686" "00198" "00315941" "00006" "Isolated (sporadic)" "" "abnormalities head and neck, abnormalities cardiovascular system, abnormalities integument, abnormalities musculature, abnormalities nervous system" "" "" "" "" "" "" "" "" "" "" "" "0000239687" "00198" "00315942" "00006" "Unknown" "" "autism, intellectual disability, congenital diaphragmatic hernia, obesity, synophrys, deeply set eyes, clinodactyly 5th finger" "" "" "" "" "" "" "" "" "" "" "" "0000239688" "00198" "00315943" "00006" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Blau syndrome" "" "0000239716" "00198" "00315971" "00006" "Isolated (sporadic)" "00y23m" "see paper; ..., failure to thrive; bilateral anophthalmia; bilateral ankyloblepharon; motor delay; speech delay; self-stimulating behaviors; no hypotonia; no cardiac defect; no kidney anomaly; Microcephaly" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239717" "00198" "00315972" "00006" "Isolated (sporadic)" "03y08m" "see paper; ..., failure to thrive; no globe defect; no coloboma; visual impairment; Intermittent exotropia; no motor delay; speech delay; aggression, biting, phonosensitivity, pacing; hypotonia; no cardiac defect; no kidney anomaly; left eye diaphragmatic hernia; thin upper lip" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239718" "00198" "00315973" "00006" "Isolated (sporadic)" "23y" "see paper; ..., failure to thrive; no globe defect; no coloboma; no visual impairment; motor delay; no speech delay; mild intellectual disability; autism spectrum disorder, attention deficit-hyperactivity disorder, anxiety, aggression; hypotonia; no cardiac defect; no kidney anomaly; Kyphosis; low-set ears; 5th finger clinodactyly; periorbital puffiness" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239719" "00198" "00315974" "00006" "Isolated (sporadic)" "23y" "see paper; ..., failure to thrive; no globe defect; no coloboma; visual impairment; left eye ptosis; motor delay; speech delay; mild intellectual disability; no behavioral features; hypotonia; cardiac defect; no kidney anomaly; Scoliosis; cleft soft palate; Meckel’s diverticulum; microcephaly; low-set ears; upturned nose; thin lips" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239720" "00198" "00315975" "00006" "Isolated (sporadic)" "23y" "see paper; ..., failure to thrive; no globe defect; no coloboma; visual impairment; motor delay; speech delay; mild intellectual disability; no behavioral features; hypotonia; no cardiac defect; no kidney anomaly; bilateral sensorineural hearing loss; microcephaly; cleft soft palate; low-set ears; upturned nose; thin lips" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239721" "00198" "00315976" "00006" "Isolated (sporadic)" "18y" "see paper; ..., no failure to thrive; no globe defect; no coloboma; visual impairment; Intermittent exotropia; motor delay; speech delay; mild intellectual disability; self-injurious and repetitive behaviors; no hypotonia; no cardiac defect; kidney anomaly; bilateral hearing loss; unilateral cryptorchidism; left eye plagiocephaly" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239722" "00198" "00315977" "00006" "Isolated (sporadic)" "04y07m" "see paper; ..., no failure to thrive; no globe defect; no coloboma; visual impairment; Esotropia; nystagmus; motor delay; speech delay; no behavioral features; no hypotonia; cardiac defect; kidney anomaly; Low-set ears; bilateral epicanthal folds; obstructive sleep apnea" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239723" "00198" "00315978" "00006" "Isolated (sporadic)" "34y" "see paper; ..., failure to thrive; no globe defect; no coloboma; no visual impairment; motor delay; speech delay; mild/moderate intellectual disability; stereotypies, agitation, anxiety; no hypotonia; no cardiac defect; no kidney anomaly; Microcephaly; bilateral cryptorchidism, epicanthal folds; left eye 1-2 toe syndactyly; upturned nose; thin upper lip" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239724" "00198" "00315979" "00006" "Isolated (sporadic)" "13y01m" "see paper; ..., no failure to thrive; no globe defect; bilateral: macula; visual impairment; bilateral retinal dysplasia, nasolacrimal duct stenosis; strabismus; motor delay; speech delay; moderate/severe intellectual disability; repetitive behaviors, anxiety; no hypotonia; no cardiac defect; no kidney anomaly; Low-set ears; bilateral inguinal hernia, cryptorchidism" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239725" "00198" "00315980" "00006" "Isolated (sporadic)" "00y12m" "see paper; ..., failure to thrive; no globe defect; no coloboma; no visual impairment; motor delay; speech delay; no behavioral features; hypotonia; cardiac defect; kidney anomaly; Umbilical hernia; malrotation of small intestine; bilateral cryptorchidism; upturned nose" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239726" "00198" "00315981" "00006" "Isolated (sporadic)" "02y02m" "see paper; ..., failure to thrive; bilateral microphthalmia; left eye iris coloboma, chorioretinal; bilateral pigmentary changes in retina (severe), optic nerve hypoplasia;rigft eye persistent pupillary membrane (Wachendorf membrane); motor delay; speech delay; attention deficit, hyperactivity, repetitive movements, no interest in social interaction; hypotonia; cardiac defect; no kidney anomaly; Microcephaly; thin upper lip; bilateral 2-3 toe syndactyly" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239727" "00198" "00315982" "00006" "Isolated (sporadic)" "05y07m" "see paper; ..., no failure to thrive; no globe defect; no coloboma; visual impairment; Stellate irides; motor delay; speech delay; attention deficit-hyperactivity disorder, sensory processing disorder, self-injurious and repetitive behaviors; hypotonia; cardiac defect; kidney anomaly; Kyphosis; microcephaly; upturned nose" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239728" "00198" "00315983" "00006" "Isolated (sporadic)" "10y" "see paper; ..., failure to thrive; left eye microphthalmia; left eye iris coloboma, optic nerve; right eye iris coloboma; visual impairment; right eye complex Rieger anomaly; no motor delay; speech delay; profound intellectual disability; no behavioral features; cardiac defect; no kidney anomaly; Short trunk; thyroid hypoplasia; 5th finger clinodactyly; upturned nose; thin lips" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239729" "00198" "00315984" "00006" "Isolated (sporadic)" "00y15m" "see paper; ..., no failure to thrive; no globe defect; no coloboma; visual impairment; bilateral oblong optic nerves, ptosis; motor delay; no speech delay; no behavioral features; no hypotonia; cardiac defect; no kidney anomaly; Downslanting palpebral fissures" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239730" "00198" "00315985" "00006" "Isolated (sporadic)" "00y05m" "see paper; ..., no failure to thrive; no globe defect; no coloboma; no visual impairment; Retinopathy of prematurity; motor delay; speech delay; autistic features; hypotonia; no cardiac defect; kidney anomaly; Microcephaly; bilateral epicanthal folds" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239731" "00198" "00315986" "00006" "Isolated (sporadic)" "02y07m" "see paper; ..., failure to thrive; no globe defect; no coloboma; no visual impairment; motor delay; speech delay; no behavioral features; hypotonia; cardiac defect; no kidney anomaly; bilateral choanal stenosis, epicanthal folds, 5th finger clinodactyly; unilateral cryptorchidism, CHARGE ear; hearing loss; thin upper lip" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239732" "00198" "00315987" "00006" "Isolated (sporadic)" "00y15m" "see paper; ..., no failure to thrive; left eye anophthalmia; right eye iris coloboma; visual impairment; left eye optic nerve hypoplasia, ankyloblepharon; no motor delay; speech delay; no behavioral features; no hypotonia; cardiac defect; kidney anomaly" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239733" "00198" "00315988" "00006" "Isolated (sporadic)" "36y" "see paper; ..., failure to thrive; no globe defect; no coloboma; visual impairment; Strabismus; motor delay; speech delay; mild intellectual disability; no behavioral features; hypotonia; no cardiac defect; kidney anomaly; bilateral hearing loss, epicanthal folds; unilateral 2-3 toe syndactyly; upturned nose" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239734" "00198" "00315989" "00006" "Isolated (sporadic)" "15y07m" "see paper; ..., no failure to thrive; no globe defect; no coloboma; visual impairment; left eye congenital hypertrophy of retinal pigment epithelium (stable); motor delay; no speech delay; moderate intellectual disability; no behavioral features; hypotonia; cardiac defect; no kidney anomaly; Brachycephaly; downslanting palpebral fissures" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239735" "00198" "00315990" "00006" "Isolated (sporadic)" "" "broad-based gait, cerebral calcification, developmental regression, global developmental delay, microcephaly, seizure" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239736" "00198" "00315991" "00006" "Isolated (sporadic)" "" "coarctation of aorta, downslanted palpebral fissures, gastrostomy tube feeding in infancy, long fingers, long philtrum, micrognathia, moderate global developmental delay, patent ductus arteriosus after birth at term, tricuspid atresia, obsolete transposition of the great arteries with ventricular septal defect" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239737" "00198" "00315992" "00006" "Isolated (sporadic)" "" "aplasia/hypoplasia of the optic nerve, congenital hip dislocation, conical mandibular incisor, iris coloboma, moderate global developmental delay, postnatal microcephaly, preauricular pit, sacral dimple, unilateral microphthalmos" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000239738" "00198" "00315993" "00006" "Isolated (sporadic)" "" "absent speech, global developmental delay, recurrent hand flapping" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000317624" "06981" "00426469" "01164" "Unknown" "04y" "neurodevelopmental delay, delayed speech and language development" "" "" "" "" "" "" "" "" "NOC" "" "" "0000317625" "00356" "00426470" "00006" "Unknown" "" "left eye microphthalmia; fragile hair" "" "" "" "" "" "" "" "" "31y" "microphthalmia" "" "0000317626" "00356" "00426471" "00006" "Familial, autosomal dominant" "07y" "left eye Peters Anomaly, microphthalmia; right eye hyperopia; bilateral nystagmus; mild developmental delay/learning difficulties" "" "" "" "" "" "" "" "" "" "microphthalmia" "" "0000317627" "00356" "00426472" "00006" "Isolated (sporadic)" "13y" "bilateral iris coloboma, nystagmus and foveal hypoplasia; left eye Peters anomaly, microcornea; right eye persistent fetal vasculature cataract, abnormal blood vessels in iris and cornea" "" "" "" "" "" "" "" "" "" "microphthalmia" "" "0000317628" "00356" "00426473" "00006" "Unknown" "16y" "bilateral Peter\'s anomaly, left eye microphthalmia, right eye glaucoma; severe intellectual disability, moderate periventricular leukomalacia; short stature, dysmorphic facial features, 4q35.1del" "" "" "" "" "" "" "" "" "" "microphthalmia" "" "0000317629" "00356" "00426474" "00006" "Unknown" "" "unilaterla microphthalmia; global delays; short stature" "" "" "" "" "" "" "" "" "" "microphthalmia" "" "0000317631" "00198" "00426477" "00006" "Isolated (sporadic)" "15y07m" "see paper; ..., failure to thrive; no globe defect; no coloboma; visual impairment; lagophthalmos; no motor delay; speech delay; intellectual disability; no behavioral features; no hypotonia; cardiac defect; no kidney anomaly; Malrotation of intestine; downslanting palpebral fissures; cleft palate" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000318182" "06981" "00427165" "01164" "Isolated (sporadic)" "08y" "Neurodevelopmental delay, Hypotonia, Hearing impairment" "" "" "" "" "" "" "" "" "" "" "" "0000325785" "05611" "00435600" "00006" "Isolated (sporadic)" "4y" "see paper; ..., normal pregnancy, birth birth at term; 3y6m-first words; <2y6m-walk; 4y-can speak in sentences (received significant speech therapy); moderate intellectual disability; delayed gross motor skills; delayed fine motor skills; no seizures; hypotonia; no movement disorder; happy demeanor, poor concentration; rare apnea, sleep study, no intervention recommended; round face, cleft palate, small hands and feet, deep-set eyes, thin upper lip, smooth philtrum, slightly downslanting palpebral fissures; normal eyes/vision; middle ear disease, recurrent ear infections; no feeding problems, required G-tube; ear infections; joint laxity" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" ## Screenings ## Do not remove or alter this header ## ## Count = 40 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000317118" "00315936" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317119" "00315937" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317120" "00315938" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317121" "00315939" "1" "00006" "00006" "2020-10-30 15:23:09" "00006" "2020-10-30 15:30:50" "arraySNP;microscope;SEQ" "DNA;RNA" "" "" "0000317122" "00315940" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317123" "00315941" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317124" "00315942" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317125" "00315943" "1" "00006" "00006" "2020-10-30 15:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317153" "00315971" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317154" "00315972" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317155" "00315973" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317156" "00315974" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317157" "00315975" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317158" "00315976" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317159" "00315977" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317160" "00315978" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317161" "00315979" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317162" "00315980" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317163" "00315981" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317164" "00315982" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317165" "00315983" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317166" "00315984" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317167" "00315985" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317168" "00315986" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317169" "00315987" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317170" "00315988" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317171" "00315989" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317172" "00315990" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317173" "00315991" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317174" "00315992" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000317175" "00315993" "1" "00006" "00006" "2020-11-01 10:06:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427789" "00426469" "1" "01164" "01164" "2022-11-30 13:44:52" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000427790" "00426470" "1" "00006" "00006" "2022-11-30 16:35:28" "" "" "SEQ;SEQ-NG" "DNA" "WES" "" "0000427791" "00426471" "1" "00006" "00006" "2022-11-30 16:42:58" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427792" "00426472" "1" "00006" "00006" "2022-11-30 16:48:25" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427793" "00426473" "1" "00006" "00006" "2022-11-30 16:54:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427794" "00426474" "1" "00006" "00006" "2022-11-30 17:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427797" "00426477" "1" "00006" "00006" "2022-11-30 20:30:22" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428486" "00427165" "1" "01164" "01164" "2022-12-06 14:33:00" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000437081" "00435600" "1" "00006" "00006" "2023-08-05 19:25:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 36 "{{screeningid}}" "{{geneid}}" "0000317118" "PRR12" "0000317119" "PRR12" "0000317120" "PRR12" "0000317121" "PRR12" "0000317121" "ZMIZ1" "0000317122" "PRR12" "0000317123" "PRR12" "0000317124" "PRR12" "0000317125" "NOD2" "0000317125" "PRR12" "0000317153" "PRR12" "0000317154" "PRR12" "0000317155" "PRR12" "0000317156" "PRR12" "0000317157" "PRR12" "0000317158" "PRR12" "0000317159" "PRR12" "0000317160" "PRR12" "0000317161" "PRR12" "0000317162" "PRR12" "0000317163" "PRR12" "0000317164" "PRR12" "0000317165" "PRR12" "0000317166" "PRR12" "0000317167" "PRR12" "0000317168" "PRR12" "0000317169" "PRR12" "0000317170" "PRR12" "0000317171" "PRR12" "0000317172" "PRR12" "0000317173" "PRR12" "0000317174" "PRR12" "0000317175" "PRR12" "0000427789" "PRR12" "0000427791" "PRR12" "0000428486" "PRR12" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 119 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000306495" "0" "50" "19" "50124861" "50124861" "del" "0" "01943" "PRR12_000005" "g.50124861del" "" "" "" "PRR12(NM_020719.2):c.5703delG (p.L1902*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49621604del" "" "VUS" "" "0000326717" "0" "50" "19" "50093299" "50093299" "subst" "0.000330073" "01804" "PRRG2_000001" "g.50093299C>T" "" "" "" "PRRG2(NM_000951.2):c.580C>T (p.(Pro194Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49590042C>T" "" "VUS" "" "0000326718" "0" "50" "19" "50093300" "50093300" "subst" "0.00150092" "01804" "PRRG2_000002" "g.50093300C>G" "" "" "" "PRRG2(NM_000951.2):c.581C>G (p.(Pro194Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49590043C>G" "" "VUS" "" "0000326719" "0" "50" "19" "50098254" "50098254" "subst" "0" "01804" "PRR12_000001" "g.50098254C>T" "" "" "" "PRR12(NM_020719.1):c.662C>T (p.(Pro221Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49594997C>T" "" "VUS" "" "0000326720" "0" "50" "19" "50098268" "50098268" "subst" "0.00859754" "01804" "PRR12_000002" "g.50098268C>A" "" "" "" "PRR12(NM_020719.1):c.676C>A (p.(Pro226Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49595011C>A" "" "VUS" "" "0000326723" "0" "50" "19" "50104825" "50104825" "subst" "0.0049224" "01804" "PRR12_000004" "g.50104825C>A" "" "" "" "PRR12(NM_020719.1):c.4423C>A (p.(Pro1475Thr)), PRR12(NM_020719.3):c.4423C>A (p.P1475T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49601568C>A" "" "VUS" "" "0000341759" "0" "50" "19" "50101061" "50101061" "subst" "0" "02327" "PRR12_000007" "g.50101061C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49597804C>G" "" "VUS" "" "0000344986" "0" "90" "19" "50100092" "50100092" "subst" "0" "02327" "PRR12_000006" "g.50100092C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49596835C>T" "" "pathogenic" "" "0000568001" "0" "30" "19" "50091763" "50091763" "subst" "0.00434273" "01804" "PRR12_000008" "g.50091763G>A" "" "" "" "PRRG2(NM_000951.3):c.311G>A (p.(Arg104Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49588506G>A" "" "likely benign" "" "0000568002" "0" "50" "19" "50091849" "50091849" "subst" "2.67953E-5" "01943" "PRR12_000009" "g.50091849C>T" "" "" "" "PRRG2(NM_001316335.1):c.328C>T (p.R110C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49588592C>T" "" "VUS" "" "0000568003" "0" "30" "19" "50093194" "50093194" "subst" "0.000388312" "01804" "PRR12_000010" "g.50093194C>G" "" "" "" "PRRG2(NM_000951.2):c.475C>G (p.(Leu159Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49589937C>G" "" "likely benign" "" "0000568004" "0" "30" "19" "50099539" "50099539" "subst" "0" "01943" "PRR12_000011" "g.50099539G>A" "" "" "" "PRR12(NM_020719.2):c.1947G>A (p.A649=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49596282G>A" "" "likely benign" "" "0000568005" "0" "30" "19" "50100122" "50100122" "subst" "0" "01943" "PRR12_000012" "g.50100122C>T" "" "" "" "PRR12(NM_020719.2):c.2530C>T (p.P844S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49596865C>T" "" "likely benign" "" "0000568006" "0" "30" "19" "50100192" "50100192" "subst" "0.0021678" "01943" "PRR12_000013" "g.50100192G>A" "" "" "" "PRR12(NM_020719.2):c.2600G>A (p.R867H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49596935G>A" "" "likely benign" "" "0000568008" "0" "30" "19" "50104825" "50104825" "subst" "0.0049224" "02325" "PRR12_000004" "g.50104825C>A" "" "" "" "PRR12(NM_020719.1):c.4423C>A (p.(Pro1475Thr)), PRR12(NM_020719.3):c.4423C>A (p.P1475T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49601568C>A" "" "likely benign" "" "0000568009" "0" "90" "19" "50105170" "50105170" "dup" "0" "02325" "PRR12_000015" "g.50105170dup" "" "" "" "PRR12(NM_020719.3):c.4768dupC (p.L1590Pfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49601913dup" "" "pathogenic" "" "0000568010" "0" "50" "19" "50119050" "50119050" "subst" "0" "02325" "PRR12_000016" "g.50119050G>C" "" "" "" "PRR12(NM_020719.3):c.5071G>C (p.A1691P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49615793G>C" "" "VUS" "" "0000568012" "0" "70" "19" "50123698" "50123698" "del" "0" "02327" "PRR12_000018" "g.50123698del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49620441del" "" "likely pathogenic" "" "0000617795" "0" "70" "19" "50098219" "50098219" "del" "0" "02327" "PRR12_000019" "g.50098219del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49594962del" "" "likely pathogenic" "" "0000617796" "0" "50" "19" "50098683" "50098683" "subst" "0" "02325" "PRR12_000020" "g.50098683G>A" "" "" "" "PRR12(NM_020719.3):c.1091G>A (p.G364D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49595426G>A" "" "VUS" "" "0000617797" "0" "70" "19" "50098738" "50098738" "dup" "0" "02329" "PRR12_000021" "g.50098738dup" "" "" "" "PRR12(NM_020719.3):c.1146dupC (p.I383Hfs*176)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49595481dup" "" "likely pathogenic" "" "0000617798" "0" "30" "19" "50101174" "50101174" "subst" "3.29663E-5" "01943" "PRR12_000022" "g.50101174C>G" "" "" "" "PRR12(NM_020719.2):c.3582C>G (p.T1194=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49597917C>G" "" "likely benign" "" "0000617799" "0" "30" "19" "50104890" "50104890" "subst" "0.0045686" "01943" "PRR12_000023" "g.50104890A>T" "" "" "" "PRR12(NM_020719.2):c.4488A>T (p.P1496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49601633A>T" "" "likely benign" "" "0000681478" "0" "50" "19" "50098815" "50098815" "subst" "0" "01943" "PRR12_000024" "g.50098815C>G" "" "" "" "PRR12(NM_020719.2):c.1223C>G (p.P408R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681479" "0" "50" "19" "50100965" "50100965" "subst" "0.00176007" "02325" "PRR12_000025" "g.50100965G>A" "" "" "" "PRR12(NM_020719.3):c.3373G>A (p.V1125I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681480" "0" "30" "19" "50102809" "50102809" "subst" "5.64069E-5" "01943" "PRR12_000026" "g.50102809G>A" "" "" "" "PRR12(NM_020719.2):c.3959G>A (p.R1320Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681481" "0" "30" "19" "50119139" "50119139" "subst" "0.00203481" "01943" "PRR12_000027" "g.50119139G>A" "" "" "" "PRR12(NM_020719.2):c.5160G>A (p.E1720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000699303" "0" "90" "19" "50099510" "50099510" "subst" "0" "00006" "PRR12_000037" "g.50099510G>T" "" "{PMID:Leduc 2018:29556724}" "" "" "" "De novo" "" "" "0" "" "" "g.49596253G>T" "" "pathogenic (dominant)" "" "0000699304" "0" "90" "19" "50104904" "50104907" "del" "0" "00006" "PRR12_000031" "g.50104904_50104907del" "" "{PMID:Leduc 2018:29556724}" "" "4502_4505delTGCC" "" "De novo" "" "" "0" "" "" "g.49601647_49601650del" "" "pathogenic (dominant)" "" "0000699305" "0" "90" "19" "50098495" "50098501" "dup" "0" "00006" "PRR12_000035" "g.50098495_50098501dup" "" "{PMID:Leduc 2018:29556724}" "" "" "" "De novo" "" "" "0" "" "" "g.49595238_49595244dup" "" "pathogenic (dominant)" "" "0000699306" "0" "90" "19" "0" "0" "" "0" "00006" "PRR12_000030" "g.(50124880_50128100)_qterdelins[NC_000010.10:g.(80976032_81036937)_qter" "" "{PMID:Leduc 2018:29556724}" "" "" "" "De novo" "" "" "0" "" "46,XX,t(10;19)(q22.3;q13.33)" "g.(49621623_49624843)_qterdelins[NC_000010.10:g.(79216275_79277180)_qter" "" "pathogenic" "" "0000699307" "0" "90" "19" "50118247" "50118247" "subst" "0" "00006" "PRR12_000053" "g.50118247C>T" "" "{PMID:Leduc 2018:29556724}" "" "" "" "De novo" "" "" "0" "" "" "g.49614990C>T" "" "pathogenic (dominant)" "" "0000699308" "0" "90" "19" "50100721" "50100726" "del" "0" "00006" "PRR12_000045" "g.50100721_50100726del" "" "{PMID:Leduc 2018:29556724}" "" "3129_3134delTCCGCC" "" "De novo" "" "" "0" "" "" "g.49597464_49597469del" "" "pathogenic (dominant)" "" "0000699309" "0" "90" "19" "50094912" "50129696" "del" "0" "00006" "PRR12_000029" "g.(?_50094912)_(50129696_?)del" "" "{PMID:Leduc 2018:29556724}" "" "" "2.04 Mb deletion including PRR12" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000699314" "0" "50" "19" "50100192" "50100192" "subst" "0.0021678" "00006" "PRR12_000013" "g.50100192G>A" "" "{PMID:Cordova-Fletes 2020:32597225}" "" "" "" "Unknown" "" "rs181265966" "0" "" "" "g.49596935G>A" "" "VUS" "" "0000699357" "0" "90" "19" "50097845" "50097845" "dup" "0" "00006" "PRR12_000033" "g.50097845dup" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "334dupC" "" "De novo" "" "" "0" "" "" "g.49594588dup" "" "pathogenic (dominant)" "" "0000699358" "0" "90" "19" "50098382" "50098382" "subst" "0" "00006" "PRR12_000034" "g.50098382C>T" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "Gln264*" "" "De novo" "" "" "0" "" "" "g.49595125C>T" "" "pathogenic (dominant)" "" "0000699359" "0" "90" "19" "50098824" "50098824" "subst" "0" "00006" "PRR12_000036" "g.50098824C>A" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49595567C>A" "" "pathogenic (dominant)" "" "0000699360" "0" "90" "19" "50099113" "50099113" "" "0" "00006" "PRR12_000032" "g.50099113T>G" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "Tyr507*" "" "De novo" "" "" "0" "" "" "g.49595856T>G" "" "pathogenic (dominant)" "" "0000699361" "0" "90" "19" "50099113" "50099113" "" "0" "00006" "PRR12_000032" "g.50099113T>G" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "Tyr507*" "" "De novo" "" "" "0" "" "" "g.49595856T>G" "" "pathogenic (dominant)" "" "0000699362" "0" "90" "19" "50099828" "50099829" "del" "0" "00006" "PRR12_000038" "g.50099828_50099829del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "2236_2237delGT" "" "De novo" "" "" "0" "" "" "g.49596571_49596572del" "" "pathogenic (dominant)" "" "0000699363" "0" "90" "19" "50099990" "50099990" "dup" "0" "00006" "PRR12_000039" "g.50099990dup" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "2398dupC" "" "De novo" "" "" "0" "" "" "g.49596733dup" "" "pathogenic (dominant)" "" "0000699364" "0" "90" "19" "50100324" "50100336" "del" "0" "00006" "PRR12_000041" "g.50100324_50100336del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49597067_49597079del" "" "pathogenic (dominant)" "" "0000699365" "0" "90" "19" "50100347" "50100347" "subst" "0" "00006" "PRR12_000042" "g.50100347C>T" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "Gln919*" "" "De novo" "" "" "0" "" "" "g.49597090C>T" "" "pathogenic (dominant)" "" "0000699366" "0" "90" "19" "50100416" "50100416" "del" "0" "00006" "PRR12_000043" "g.50100416del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "2824delG" "" "De novo" "" "" "0" "" "" "g.49597159del" "" "pathogenic (dominant)" "" "0000699367" "0" "90" "19" "50100601" "50100620" "dup" "0" "00006" "PRR12_000044" "g.50100601_50100620dup" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49597344_49597363dup" "" "pathogenic (dominant)" "" "0000699368" "0" "90" "19" "50100816" "50100816" "del" "0" "00006" "PRR12_000046" "g.50100816del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "3224delC" "" "De novo" "" "" "0" "" "" "g.49597559del" "" "pathogenic (dominant)" "" "0000699369" "0" "90" "19" "50100865" "50100865" "del" "0" "00006" "PRR12_000047" "g.50100865del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "3273delC" "" "De novo" "" "" "0" "" "" "g.49597608del" "" "pathogenic (dominant)" "" "0000699370" "0" "90" "19" "50100865" "50100865" "del" "0" "00006" "PRR12_000047" "g.50100865del" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "3273delC" "" "De novo" "" "" "0" "" "" "g.49597608del" "" "pathogenic (dominant)" "" "0000699371" "0" "70" "19" "50101097" "50101097" "subst" "0" "00006" "PRR12_000048" "g.50101097C>T" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49597840C>T" "" "likely pathogenic (dominant)" "" "0000699372" "0" "90" "19" "50102808" "50102808" "subst" "0" "00006" "PRR12_000049" "g.50102808C>T" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49599551C>T" "" "pathogenic (dominant)" "" "0000699373" "0" "90" "19" "50105076" "50105078" "delins" "0" "00006" "PRR12_000051" "g.50105076_50105078delinsGC" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "4674_4676delTGGinsGC" "US" "De novo" "" "" "0" "" "" "g.49601819_49601821delinsGC" "" "pathogenic (dominant)" "" "0000699374" "0" "90" "19" "50105170" "50105170" "dup" "0" "00006" "PRR12_000015" "g.50105170dup" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "4768dupC" "" "De novo" "" "" "0" "" "" "g.49601913dup" "" "pathogenic (dominant)" "" "0000699375" "0" "70" "19" "50128402" "50128402" "subst" "0" "00006" "PRR12_000055" "g.50128402T>C" "" "Chowdhury ASHG2020, {PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49625145T>C" "" "likely pathogenic (dominant)" "" "0000699376" "0" "70" "19" "50119362" "50119362" "subst" "0" "00006" "PRR12_000054" "g.50119362C>T" "" "{DECIPHER:260525}" "" "" "" "De novo" "" "" "0" "" "" "g.49616105C>T" "" "likely pathogenic (dominant)" "" "0000699377" "0" "90" "19" "50100179" "50100179" "dup" "0" "00006" "PRR12_000040" "g.50100179dup" "" "{DECIPHER:277812}" "" "2585_2586insG" "" "De novo" "" "" "0" "" "" "g.49596922dup" "" "pathogenic (dominant)" "" "0000699378" "0" "90" "19" "50105128" "50105128" "subst" "0" "00006" "PRR12_000052" "g.50105128G>T" "" "{DECIPHER:280416}" "" "" "" "De novo" "" "" "0" "" "" "g.49601871G>T" "" "pathogenic (dominant)" "" "0000699379" "0" "50" "19" "50104789" "50104789" "subst" "0" "00006" "PRR12_000050" "g.50104789C>T" "" "{DECIPHER:417908}" "" "" "" "De novo" "" "" "0" "" "" "g.49601532C>T" "" "VUS" "" "0000808979" "0" "50" "19" "50097746" "50097746" "subst" "0.00150561" "01943" "PRR12_000056" "g.50097746G>A" "" "" "" "PRR12(NM_020719.2):c.235G>A (p.A79T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808980" "0" "30" "19" "50099185" "50099185" "subst" "0" "01943" "PRR12_000057" "g.50099185C>G" "" "" "" "PRR12(NM_020719.2):c.1593C>G (p.L531=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855660" "0" "30" "19" "50098633" "50098633" "subst" "0" "01943" "PRR12_000059" "g.50098633C>T" "" "" "" "PRR12(NM_020719.2):c.1041C>T (p.S347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855661" "0" "50" "19" "50098646" "50098646" "subst" "8.82262E-5" "01943" "PRR12_000060" "g.50098646A>C" "" "" "" "PRR12(NM_020719.2):c.1054A>C (p.S352R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855662" "0" "30" "19" "50098829" "50098829" "subst" "0" "01943" "PRR12_000061" "g.50098829G>A" "" "" "" "PRR12(NM_020719.2):c.1237G>A (p.A413T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855663" "0" "30" "19" "50100190" "50100190" "subst" "9.38845E-5" "01943" "PRR12_000063" "g.50100190C>T" "" "" "" "PRR12(NM_020719.2):c.2598C>T (p.P866=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855664" "0" "50" "19" "50104829" "50104829" "subst" "0" "01943" "PRR12_000064" "g.50104829C>T" "" "" "" "PRR12(NM_020719.2):c.4427C>T (p.P1476L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866227" "0" "50" "19" "50098103" "50098103" "subst" "0" "01804" "PRR12_000058" "g.50098103C>T" "" "" "" "PRR12(NM_020719.1):c.511C>T (p.(Gln171*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866228" "0" "50" "19" "50099565" "50099565" "subst" "0.000243501" "01943" "PRR12_000062" "g.50099565C>T" "" "" "" "PRR12(NM_020719.2):c.1973C>T (p.A658V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895085" "0" "50" "19" "50099292" "50099292" "subst" "0" "02325" "PRR12_000065" "g.50099292C>T" "" "" "" "PRR12(NM_020719.3):c.1700C>T (p.P567L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895086" "0" "30" "19" "50119297" "50119297" "subst" "0.000829844" "02325" "PRR12_000066" "g.50119297C>T" "" "" "" "PRR12(NM_020719.3):c.5318C>T (p.T1773M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000905238" "0" "90" "19" "50100233" "50100233" "subst" "0" "01164" "PRR12_000067" "g.50100233C>T" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP; de novo in trio exome" "De novo" "-" "" "0" "" "" "" "" "pathogenic (dominant)" "ACMG" "0000905241" "0" "90" "19" "50124780" "50124780" "subst" "0" "00006" "PRR12_000068" "g.50124780A>G" "" "{PMID:Reis 2021:33314030}" "" "" "unaffected mother not available" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000905242" "21" "90" "19" "50124780" "50124780" "subst" "0" "00006" "PRR12_000068" "g.50124780A>G" "" "{PMID:Reis 2021:33314030}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000905243" "0" "90" "19" "50099637" "50099637" "del" "0" "00006" "PRR12_000069" "g.50099637del" "" "{PMID:Reis 2021:33314030}" "" "2045delG" "" "De novo" "" "" "0" "" "" ".49596380del" "" "pathogenic (dominant)" "" "0000905244" "0" "90" "19" "50098269" "50098269" "dup" "0" "00006" "PRR12_000070" "g.50098269dup" "" "{PMID:Reis 2021:33314030}" "" "677dupC" "" "De novo" "" "" "0" "" "" "g.49595012dup" "" "pathogenic (dominant)" "" "0000905245" "0" "90" "19" "50099945" "50099952" "del" "0" "00006" "PRR12_000071" "g.50099945_50099952del" "" "{PMID:Reis 2021:33314030}" "" "2353_2360delGCCGGGGG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49596688_49596695del" "" "pathogenic (dominant)" "" "0000905247" "0" "90" "19" "50118131" "50118131" "subst" "0" "00006" "PRR12_000072" "g.50118131A>G" "" "{PMID:Chowdhury 2021:33824499}" "" "" "" "De novo" "" "" "0" "" "" "g.49614874A>G" "" "pathogenic (dominant)" "" "0000906302" "0" "70" "19" "50124808" "50124811" "del" "0" "01164" "PRR12_000073" "g.50124808_50124811del" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP; confirmed de novo in trio-exome" "De novo" "" "" "0" "" "" "g.49621551_49621554del" "" "pathogenic (dominant)" "ACMG" "0000915277" "0" "50" "19" "50098641" "50098641" "subst" "0" "02327" "PRR12_000074" "g.50098641G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931087" "0" "50" "19" "50105044" "50105044" "subst" "0" "02325" "PRR12_000076" "g.50105044C>G" "" "" "" "PRR12(NM_020719.3):c.4642C>G (p.L1548V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931853" "0" "70" "19" "50098793" "50098793" "subst" "0" "00006" "PRR12_000077" "g.50098793G>A" "" "{PMID:Niggl 2023:37541189}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000951329" "0" "50" "19" "50098068" "50098068" "subst" "0" "02325" "PRR12_000078" "g.50098068G>A" "" "" "" "PRR12(NM_020719.3):c.476G>A (p.S159N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951330" "0" "50" "19" "50102639" "50102639" "subst" "0" "02325" "PRR12_000079" "g.50102639C>G" "" "" "" "PRR12(NM_020719.3):c.3789C>G (p.I1263M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951331" "0" "30" "19" "50128236" "50128236" "subst" "5.10769E-5" "02325" "PRR12_000080" "g.50128236G>A" "" "" "" "PRR12(NM_020719.3):c.5857G>A (p.V1953I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983588" "0" "30" "19" "50093627" "50093627" "subst" "0.000637765" "01804" "PRR12_000081" "g.50093627G>A" "" "" "" "PRRG2(NM_000951.3):c.591-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983589" "0" "30" "19" "50104935" "50104935" "subst" "0.0051122" "01804" "PRR12_000082" "g.50104935G>A" "" "" "" "PRR12(NM_020719.3):c.4533G>A (p.(Ser1511=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983590" "0" "30" "19" "50128173" "50128173" "subst" "3.38175E-5" "01804" "PRR12_000083" "g.50128173C>T" "" "" "" "PRR12(NM_020719.3):c.5794C>T (p.(Arg1932Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004990" "0" "50" "19" "50098173" "50098173" "subst" "0" "01804" "PRR12_000084" "g.50098173C>T" "" "" "" "PRR12(NM_020719.1):c.581C>T (p.(Ser194Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004991" "0" "50" "19" "50098659" "50098682" "del" "0" "01804" "PRR12_000085" "g.50098659_50098682del" "" "" "" "PRR12(NM_020719.1):c.1067_1090delCTGGGGCATCTGGCCGGGCCACGG (p.(Ala356_Thr363del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004992" "0" "30" "19" "50098815" "50098815" "subst" "1.00498E-5" "01804" "PRR12_000086" "g.50098815C>A" "" "" "" "PRR12(NM_020719.1):c.1223C>A (p.(Pro408Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004993" "0" "30" "19" "50098868" "50098868" "subst" "0" "01804" "PRR12_000087" "g.50098868G>A" "" "" "" "PRR12(NM_020719.1):c.1276G>A (p.(Ala426Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004994" "0" "50" "19" "50099793" "50099793" "subst" "1.29557E-5" "01804" "PRR12_000088" "g.50099793G>T" "" "" "" "PRR12(NM_020719.1):c.2201G>T (p.(Arg734Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004995" "0" "30" "19" "50099995" "50099997" "dup" "0" "01804" "PRR12_000089" "g.50099995_50099997dup" "" "" "" "PRR12(NM_020719.1):c.2403_2405dupGCT (p.(Leu802dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004996" "0" "30" "19" "50100101" "50100102" "del" "0" "01804" "PRR12_000090" "g.50100101_50100102del" "" "" "" "PRR12(NM_020719.1):c.2509_2510delCC (p.(Pro837fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004997" "0" "50" "19" "50100146" "50100148" "del" "0" "01804" "PRR12_000091" "g.50100146_50100148del" "" "" "" "PRR12(NM_020719.1):c.2554_2556delGCC (p.(Ala852del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004998" "0" "30" "19" "50100287" "50100287" "subst" "0" "01804" "PRR12_000092" "g.50100287G>A" "" "" "" "PRR12(NM_020719.1):c.2695G>A (p.(Val899Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004999" "0" "50" "19" "50100304" "50100315" "del" "0" "01804" "PRR12_000093" "g.50100304_50100315del" "" "" "" "PRR12(NM_020719.1):c.2712_2723delGGAGGGCAAGGA (p.(Glu905_Asp908del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005000" "0" "50" "19" "50100654" "50100654" "subst" "0" "01804" "PRR12_000094" "g.50100654C>T" "" "" "" "PRR12(NM_020719.1):c.3062C>T (p.(Thr1021Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005001" "0" "30" "19" "50100861" "50100861" "subst" "4.25308E-6" "01804" "PRR12_000095" "g.50100861C>G" "" "" "" "PRR12(NM_020719.1):c.3269C>G (p.(Thr1090Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005002" "0" "30" "19" "50101031" "50101031" "subst" "4.54521E-6" "01804" "PRR12_000096" "g.50101031C>T" "" "" "" "PRR12(NM_020719.1):c.3439C>T (p.(Pro1147Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005003" "0" "50" "19" "50104816" "50104816" "subst" "1.41776E-5" "01804" "PRR12_000097" "g.50104816C>T" "" "" "" "PRR12(NM_020719.1):c.4414C>T (p.(Pro1472Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005004" "0" "50" "19" "50105006" "50105006" "subst" "0" "01804" "PRR12_000098" "g.50105006C>A" "" "" "" "PRR12(NM_020719.1):c.4604C>A (p.(Pro1535His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005005" "0" "30" "19" "50119029" "50119029" "subst" "2.89551E-5" "01804" "PRR12_000099" "g.50119029G>A" "" "" "" "PRR12(NM_020719.1):c.5050G>A (p.(Val1684Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005006" "0" "30" "19" "50119266" "50119266" "subst" "1.96969E-5" "01804" "PRR12_000100" "g.50119266C>T" "" "" "" "PRR12(NM_020719.1):c.5287C>T (p.(Arg1763Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005007" "0" "30" "19" "50119308" "50119308" "subst" "0" "01804" "PRR12_000101" "g.50119308G>T" "" "" "" "PRR12(NM_020719.1):c.5329G>T (p.(Ala1777Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005008" "0" "30" "19" "50119312" "50119312" "subst" "0" "01804" "PRR12_000102" "g.50119312C>T" "" "" "" "PRR12(NM_020719.1):c.5333C>T (p.(Thr1778Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005009" "0" "50" "19" "50119328" "50119342" "dup" "0" "02325" "PRR12_000103" "g.50119328_50119342dup" "" "" "" "PRR12(NM_020719.3):c.5349_5363dupAGCCCGGCCTACCAA (p.A1784_K1788dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005010" "0" "30" "19" "50119404" "50119404" "subst" "0" "01804" "PRR12_000104" "g.50119404G>A" "" "" "" "PRR12(NM_020719.1):c.5425G>A (p.(Ala1809Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027242" "0" "50" "19" "50123623" "50123623" "subst" "0" "02325" "PRR12_000105" "g.50123623G>A" "" "" "" "PRR12(NM_020719.3):c.5512G>A (p.G1838R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043097" "0" "30" "19" "50097701" "50097701" "subst" "0" "01804" "PRR12_000106" "g.50097701C>A" "" "" "" "PRR12(NM_020719.3):c.200-10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043098" "0" "50" "19" "50098360" "50098362" "dup" "0" "01804" "PRR12_000107" "g.50098360_50098362dup" "" "" "" "PRR12(NM_020719.3):c.768_770dup (p.(Ala258dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043099" "0" "30" "19" "50098515" "50098515" "subst" "0" "01804" "PRR12_000108" "g.50098515A>T" "" "" "" "PRR12(NM_020719.3):c.923A>T (p.(His308Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043100" "0" "30" "19" "50098961" "50098961" "subst" "0" "02327" "PRR12_000109" "g.50098961T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043101" "0" "30" "19" "50100121" "50100121" "subst" "0" "01804" "PRR12_000110" "g.50100121A>G" "" "" "" "PRR12(NM_020719.3):c.2529A>G (p.(Pro843=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056751" "0" "30" "19" "50099496" "50099496" "subst" "0" "01804" "PRR12_000111" "g.50099496G>A" "" "" "" "PRR12(NM_020719.3):c.1904G>A (p.(Arg635His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001067245" "0" "50" "19" "50099258" "50099258" "subst" "0" "02325" "PRR12_000112" "g.50099258G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067246" "0" "50" "19" "50100257" "50100257" "subst" "0" "01804" "PRR12_000113" "g.50100257C>T" "" "" "" "PRR12(NM_020719.3):c.2665C>T (p.(Pro889Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067247" "0" "50" "19" "50100415" "50100415" "subst" "0" "02325" "PRR12_000114" "g.50100415C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067248" "0" "50" "19" "50102989" "50102991" "del" "0" "02325" "PRR12_000115" "g.50102989_50102991del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067249" "0" "50" "19" "50103051" "50103051" "subst" "0" "02325" "PRR12_000116" "g.50103051G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes PRR12 ## Count = 119 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000306495" "00016924" "50" "5703" "0" "5703" "0" "c.5703del" "r.(?)" "p.(Leu1902Ter)" "" "0000326717" "00016924" "50" "-1613" "0" "-1613" "0" "c.-1613C>T" "r.(?)" "p.(=)" "" "0000326718" "00016924" "50" "-1612" "0" "-1612" "0" "c.-1612C>G" "r.(?)" "p.(=)" "" "0000326719" "00016924" "50" "662" "0" "662" "0" "c.662C>T" "r.(?)" "p.(Pro221Leu)" "" "0000326720" "00016924" "50" "676" "0" "676" "0" "c.676C>A" "r.(?)" "p.(Pro226Thr)" "" "0000326723" "00016924" "50" "4423" "0" "4423" "0" "c.4423C>A" "r.(?)" "p.(Pro1475Thr)" "" "0000341759" "00016924" "50" "3469" "0" "3469" "0" "c.3469C>G" "r.(?)" "p.(Arg1157Gly)" "" "0000344986" "00016924" "90" "2500" "0" "2500" "0" "c.2500C>T" "r.(?)" "p.(Gln834Ter)" "" "0000568001" "00016924" "30" "-3149" "0" "-3149" "0" "c.-3149G>A" "r.(?)" "p.(=)" "" "0000568002" "00016924" "50" "-3063" "0" "-3063" "0" "c.-3063C>T" "r.(?)" "p.(=)" "" "0000568003" "00016924" "30" "-1718" "0" "-1718" "0" "c.-1718C>G" "r.(?)" "p.(=)" "" "0000568004" "00016924" "30" "1947" "0" "1947" "0" "c.1947G>A" "r.(?)" "p.(Ala649=)" "" "0000568005" "00016924" "30" "2530" "0" "2530" "0" "c.2530C>T" "r.(?)" "p.(Pro844Ser)" "" "0000568006" "00016924" "30" "2600" "0" "2600" "0" "c.2600G>A" "r.(?)" "p.(Arg867His)" "" "0000568008" "00016924" "30" "4423" "0" "4423" "0" "c.4423C>A" "r.(?)" "p.(Pro1475Thr)" "" "0000568009" "00016924" "90" "4768" "0" "4768" "0" "c.4768dup" "r.(?)" "p.(Leu1590ProfsTer10)" "" "0000568010" "00016924" "50" "5071" "0" "5071" "0" "c.5071G>C" "r.(?)" "p.(Ala1691Pro)" "" "0000568012" "00016924" "70" "5587" "0" "5587" "0" "c.5587del" "r.(?)" "p.(Asp1863ThrfsTer4)" "" "0000617795" "00016924" "70" "627" "0" "627" "0" "c.627del" "r.(?)" "p.(Gly211AlafsTer104)" "" "0000617796" "00016924" "50" "1091" "0" "1091" "0" "c.1091G>A" "r.(?)" "p.(Gly364Asp)" "" "0000617797" "00016924" "70" "1146" "0" "1146" "0" "c.1146dup" "r.(?)" "p.(Ile383HisfsTer176)" "" "0000617798" "00016924" "30" "3582" "0" "3582" "0" "c.3582C>G" "r.(?)" "p.(Thr1194=)" "" "0000617799" "00016924" "30" "4488" "0" "4488" "0" "c.4488A>T" "r.(?)" "p.(Pro1496=)" "" "0000681478" "00016924" "50" "1223" "0" "1223" "0" "c.1223C>G" "r.(?)" "p.(Pro408Arg)" "" "0000681479" "00016924" "50" "3373" "0" "3373" "0" "c.3373G>A" "r.(?)" "p.(Val1125Ile)" "" "0000681480" "00016924" "30" "3959" "0" "3959" "0" "c.3959G>A" "r.(?)" "p.(Arg1320Gln)" "" "0000681481" "00016924" "30" "5160" "0" "5160" "0" "c.5160G>A" "r.(?)" "p.(Glu1720=)" "" "0000699303" "00016924" "90" "1918" "0" "1918" "0" "c.1918G>T" "r.(?)" "p.(Glu640*)" "" "0000699304" "00016924" "90" "4502" "0" "4505" "0" "c.4502_4505del" "r.(?)" "p.(Leu1501Argfs*146)" "" "0000699305" "00016924" "90" "903" "0" "909" "0" "c.903_909dup" "r.(?)" "p.(Pro304Thrfs*46)" "" "0000699306" "00016924" "90" "5722" "-1" "6943" "0" "c.(5721+1_5722-1)_*832delins[NM_020338.3:c.(280+1_281-1)_*3779]" "r.1_5721::[NM_020338.3:r.280_*3779]" "p.?" "" "0000699307" "00016924" "90" "5005" "0" "5005" "0" "c.5005C>T" "r.(?)" "p.(Arg1669Trp)" "" "0000699308" "00016924" "90" "3129" "0" "3134" "0" "c.3129_3134del" "r.(?)" "p.(Pro1048_Pro1049del)" "" "0000699309" "00016924" "90" "0" "0" "0" "0" "c.1_*832{0}" "r.0" "p.0" "" "0000699314" "00016924" "50" "2600" "0" "2600" "0" "c.2600G>A" "r.(?)" "p.(Arg867His)" "" "0000699357" "00016924" "90" "334" "0" "334" "0" "c.334dup" "r.(?)" "p.(Gln112Profs*69)" "" "0000699358" "00016924" "90" "790" "0" "790" "0" "c.790C>T" "r.(?)" "p.(Gln264*)" "" "0000699359" "00016924" "90" "1232" "0" "1232" "0" "c.1232C>A" "r.(?)" "p.(Ser411*)" "" "0000699360" "00016924" "90" "1521" "0" "1521" "0" "c.1521T>G" "r.(?)" "p.(Tyr507*)" "" "0000699361" "00016924" "90" "1521" "0" "1521" "0" "c.1521T>G" "r.(?)" "p.(Tyr507*)" "" "0000699362" "00016924" "90" "2236" "0" "2237" "0" "c.2236_2237del" "r.(?)" "p.(Val746Cysfs*43)" "" "0000699363" "00016924" "90" "2398" "0" "2398" "0" "c.2398dup" "r.(?)" "p.(Gln800Profs*26)" "" "0000699364" "00016924" "90" "2732" "0" "2744" "0" "c.2732_2744del" "r.(?)" "p.(Gly911Alafs*115)" "" "0000699365" "00016924" "90" "2755" "0" "2755" "0" "c.2755C>T" "r.(?)" "p.(Gln919*)" "" "0000699366" "00016924" "90" "2824" "0" "2824" "0" "c.2824del" "r.(?)" "p.(Glu942Argfs*88)" "" "0000699367" "00016924" "90" "3009" "0" "3028" "0" "c.3009_3028dup" "r.(?)" "p.(Leu1010Profs*27)" "" "0000699368" "00016924" "90" "3224" "0" "3224" "0" "c.3224del" "r.(?)" "p.(Thr1075Asnfs*148)" "" "0000699369" "00016924" "90" "3273" "0" "3273" "0" "c.3273del" "r.(?)" "p.(Lys1092Argfs*131)" "" "0000699370" "00016924" "90" "3273" "0" "3273" "0" "c.3273del" "r.(?)" "p.(Lys1092Argfs*131)" "" "0000699371" "00016924" "70" "3505" "0" "3505" "0" "c.3505C>T" "r.(?)" "p.(Arg1169Trp)" "" "0000699372" "00016924" "90" "3958" "0" "3958" "0" "c.3958C>T" "r.(?)" "p.(Arg1320*)" "" "0000699373" "00016924" "90" "4674" "0" "4676" "0" "c.4674_4676delinsGC" "r.(?)" "p.(Cys1558Trpfs*90)" "" "0000699374" "00016924" "90" "4768" "0" "4768" "0" "c.4768dup" "r.(?)" "p.(Leu1590Profs*10)" "" "0000699375" "00016924" "70" "5909" "0" "5909" "0" "c.5909T>C" "r.(?)" "p.(Leu1970Pro)" "" "0000699376" "00016924" "70" "5383" "0" "5383" "0" "c.5383C>T" "r.(?)" "p.(Pro1795Ser)" "" "0000699377" "00016924" "90" "2587" "0" "2587" "0" "c.2587dup" "r.(?)" "p.(Ala863Glyfs*74)" "" "0000699378" "00016924" "90" "4726" "0" "4726" "0" "c.4726G>T" "r.(?)" "p.(Glu1576*)" "" "0000699379" "00016924" "50" "4387" "0" "4387" "0" "c.4387C>T" "r.(?)" "p.(Pro1463Ser)" "" "0000808979" "00016924" "50" "235" "0" "235" "0" "c.235G>A" "r.(?)" "p.(Ala79Thr)" "" "0000808980" "00016924" "30" "1593" "0" "1593" "0" "c.1593C>G" "r.(?)" "p.(Leu531=)" "" "0000855660" "00016924" "30" "1041" "0" "1041" "0" "c.1041C>T" "r.(?)" "p.(Ser347=)" "" "0000855661" "00016924" "50" "1054" "0" "1054" "0" "c.1054A>C" "r.(?)" "p.(Ser352Arg)" "" "0000855662" "00016924" "30" "1237" "0" "1237" "0" "c.1237G>A" "r.(?)" "p.(Ala413Thr)" "" "0000855663" "00016924" "30" "2598" "0" "2598" "0" "c.2598C>T" "r.(?)" "p.(Pro866=)" "" "0000855664" "00016924" "50" "4427" "0" "4427" "0" "c.4427C>T" "r.(?)" "p.(Pro1476Leu)" "" "0000866227" "00016924" "50" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Gln171*)" "" "0000866228" "00016924" "50" "1973" "0" "1973" "0" "c.1973C>T" "r.(?)" "p.(Ala658Val)" "" "0000895085" "00016924" "50" "1700" "0" "1700" "0" "c.1700C>T" "r.(?)" "p.(Pro567Leu)" "" "0000895086" "00016924" "30" "5318" "0" "5318" "0" "c.5318C>T" "r.(?)" "p.(Thr1773Met)" "" "0000905238" "00016924" "90" "2641" "0" "2641" "0" "c.2641C>T" "r.(?)" "p.(Gln881*)" "4" "0000905241" "00016924" "90" "5624" "-2" "5624" "-2" "c.5624-2A>G" "r.(5624_5721del)" "p.(Asp1875Glyfs*54))" "10i" "0000905242" "00016924" "90" "5624" "-2" "5624" "-2" "c.5624-2A>G" "r.(5624_5721del)" "p.(Asp1875Glyfs*54))" "10i" "0000905243" "00016924" "90" "2045" "0" "2045" "0" "c.2045del" "r.(?)" "p.(Gly682Aspfs*44)" "" "0000905244" "00016924" "90" "677" "0" "677" "0" "c.677dup" "r.(?)" "p.(Tyr227Leufs*41)" "" "0000905245" "00016924" "90" "2353" "0" "2360" "0" "c.2353_2360del" "r.(?)" "p.(Ala785Profs*2)" "" "0000905247" "00016924" "90" "4891" "-2" "4891" "-2" "c.4891-2A>G" "r.spl" "p.?" "" "0000906302" "00016924" "70" "5650" "0" "5653" "0" "c.5650_5653del" "r.(?)" "p.(Lys1884*)" "" "0000915277" "00016924" "50" "1049" "0" "1049" "0" "c.1049G>A" "r.(?)" "p.(Gly350Asp)" "" "0000931087" "00016924" "50" "4642" "0" "4642" "0" "c.4642C>G" "r.(?)" "p.(Leu1548Val)" "" "0000931853" "00016924" "70" "1201" "0" "1201" "0" "c.1201G>A" "r.(?)" "p.(Gly401Arg)" "" "0000951329" "00016924" "50" "476" "0" "476" "0" "c.476G>A" "r.(?)" "p.(Ser159Asn)" "" "0000951330" "00016924" "50" "3789" "0" "3789" "0" "c.3789C>G" "r.(?)" "p.(Ile1263Met)" "" "0000951331" "00016924" "30" "5857" "0" "5857" "0" "c.5857G>A" "r.(?)" "p.(Val1953Ile)" "" "0000983588" "00016924" "30" "-1285" "0" "-1285" "0" "c.-1285G>A" "r.(?)" "p.(=)" "" "0000983589" "00016924" "30" "4533" "0" "4533" "0" "c.4533G>A" "r.(?)" "p.(=)" "" "0000983590" "00016924" "30" "5794" "0" "5794" "0" "c.5794C>T" "r.(?)" "p.(Arg1932Trp)" "" "0001004990" "00016924" "50" "581" "0" "581" "0" "c.581C>T" "r.(?)" "p.(Ser194Leu)" "" "0001004991" "00016924" "50" "1067" "0" "1090" "0" "c.1067_1090del" "r.(?)" "p.(Ala356_Thr363del)" "" "0001004992" "00016924" "30" "1223" "0" "1223" "0" "c.1223C>A" "r.(?)" "p.(Pro408Gln)" "" "0001004993" "00016924" "30" "1276" "0" "1276" "0" "c.1276G>A" "r.(?)" "p.(Ala426Thr)" "" "0001004994" "00016924" "50" "2201" "0" "2201" "0" "c.2201G>T" "r.(?)" "p.(Arg734Leu)" "" "0001004995" "00016924" "30" "2403" "0" "2405" "0" "c.2403_2405dup" "r.(?)" "p.(Leu802dup)" "" "0001004996" "00016924" "30" "2509" "0" "2510" "0" "c.2509_2510del" "r.(?)" "p.(Pro837Thrfs*99)" "" "0001004997" "00016924" "50" "2554" "0" "2556" "0" "c.2554_2556del" "r.(?)" "p.(Ala852del)" "" "0001004998" "00016924" "30" "2695" "0" "2695" "0" "c.2695G>A" "r.(?)" "p.(Val899Ile)" "" "0001004999" "00016924" "50" "2712" "0" "2723" "0" "c.2712_2723del" "r.(?)" "p.(Glu905_Asp908del)" "" "0001005000" "00016924" "50" "3062" "0" "3062" "0" "c.3062C>T" "r.(?)" "p.(Thr1021Met)" "" "0001005001" "00016924" "30" "3269" "0" "3269" "0" "c.3269C>G" "r.(?)" "p.(Thr1090Ser)" "" "0001005002" "00016924" "30" "3439" "0" "3439" "0" "c.3439C>T" "r.(?)" "p.(Pro1147Ser)" "" "0001005003" "00016924" "50" "4414" "0" "4414" "0" "c.4414C>T" "r.(?)" "p.(Pro1472Ser)" "" "0001005004" "00016924" "50" "4604" "0" "4604" "0" "c.4604C>A" "r.(?)" "p.(Pro1535His)" "" "0001005005" "00016924" "30" "5050" "0" "5050" "0" "c.5050G>A" "r.(?)" "p.(Val1684Ile)" "" "0001005006" "00016924" "30" "5287" "0" "5287" "0" "c.5287C>T" "r.(?)" "p.(Arg1763Trp)" "" "0001005007" "00016924" "30" "5329" "0" "5329" "0" "c.5329G>T" "r.(?)" "p.(Ala1777Ser)" "" "0001005008" "00016924" "30" "5333" "0" "5333" "0" "c.5333C>T" "r.(?)" "p.(Thr1778Ile)" "" "0001005009" "00016924" "50" "5349" "0" "5363" "0" "c.5349_5363dup" "r.(?)" "p.(Ala1784_Lys1788dup)" "" "0001005010" "00016924" "30" "5425" "0" "5425" "0" "c.5425G>A" "r.(?)" "p.(Ala1809Thr)" "" "0001027242" "00016924" "50" "5512" "0" "5512" "0" "c.5512G>A" "r.(?)" "p.(Gly1838Arg)" "" "0001043097" "00016924" "30" "200" "-10" "200" "-10" "c.200-10C>A" "r.(=)" "p.(=)" "" "0001043098" "00016924" "50" "768" "0" "770" "0" "c.768_770dup" "r.(?)" "p.(Ala258dup)" "" "0001043099" "00016924" "30" "923" "0" "923" "0" "c.923A>T" "r.(?)" "p.(His308Leu)" "" "0001043100" "00016924" "30" "1369" "0" "1369" "0" "c.1369T>C" "r.(?)" "p.(Tyr457His)" "" "0001043101" "00016924" "30" "2529" "0" "2529" "0" "c.2529A>G" "r.(?)" "p.(=)" "" "0001056751" "00016924" "30" "1904" "0" "1904" "0" "c.1904G>A" "r.(?)" "p.(Arg635His)" "" "0001067245" "00016924" "50" "1666" "0" "1666" "0" "c.1666G>T" "r.(?)" "p.(Gly556Cys)" "" "0001067246" "00016924" "50" "2665" "0" "2665" "0" "c.2665C>T" "r.(?)" "p.(Pro889Ser)" "" "0001067247" "00016924" "50" "2823" "0" "2823" "0" "c.2823C>A" "r.(?)" "p.(Asp941Glu)" "" "0001067248" "00016924" "50" "4139" "0" "4141" "0" "c.4139_4141del" "r.(?)" "p.(Phe1380del)" "" "0001067249" "00016924" "50" "4201" "0" "4201" "0" "c.4201G>A" "r.(?)" "p.(Ala1401Thr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 40 "{{screeningid}}" "{{variantid}}" "0000317118" "0000699303" "0000317119" "0000699304" "0000317120" "0000699305" "0000317121" "0000699306" "0000317122" "0000699307" "0000317123" "0000699308" "0000317124" "0000699309" "0000317125" "0000699314" "0000317153" "0000699357" "0000317154" "0000699358" "0000317155" "0000699359" "0000317156" "0000699360" "0000317157" "0000699361" "0000317158" "0000699362" "0000317159" "0000699363" "0000317160" "0000699364" "0000317161" "0000699365" "0000317162" "0000699366" "0000317163" "0000699367" "0000317164" "0000699368" "0000317165" "0000699369" "0000317166" "0000699370" "0000317167" "0000699371" "0000317168" "0000699372" "0000317169" "0000699373" "0000317170" "0000699374" "0000317171" "0000699375" "0000317172" "0000699376" "0000317173" "0000699377" "0000317174" "0000699378" "0000317175" "0000699379" "0000427789" "0000905238" "0000427790" "0000905241" "0000427791" "0000905242" "0000427792" "0000905243" "0000427793" "0000905244" "0000427794" "0000905245" "0000427797" "0000905247" "0000428486" "0000906302" "0000437081" "0000931853"