### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = RAD21) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "RAD21" "RAD21 homolog (S. pombe)" "8" "q24.11" "unknown" "NC_000008.10" "UD_132609976435" "" "https://www.LOVD.nl/RAD21" "" "1" "9811" "5885" "606462" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/RAD21_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-06-02 09:55:47" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00017360" "RAD21" "RAD21 homolog (S. pombe)" "001" "NM_006265.2" "" "NP_006256.1" "" "" "" "-288" "3462" "1896" "117887105" "117858173" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00660" "CDLS4" "Cornelia de Lange syndrome, type 4 (CDLS-4)" "AD" "614701" "" "mild cognitive delay; growth retardation; neuropsychiatric behaviors; microcephaly; craniofacial dysmorphia; cleft/arched palate; organ abnormalitie; no cardiac defects; no limb reductions; no hearing loss; no skin pigmentation abnormalities; no elevated cancer incidence; no bone marrow/hematopoietic defects" "" "00006" "2014-09-25 23:29:40" "00006" "2023-08-31 23:34:34" "04281" "CDLS" "Cornelia de Lange syndrome (CDLS)" "" "" "" "" "" "00006" "2015-06-15 14:50:45" "" "" "06780" "MGS" "?Mungan syndrome" "AR" "611376" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "RAD21" "00139" "RAD21" "00660" "RAD21" "06780" ## Individuals ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00183680" "" "" "" "1" "" "00006" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "Spain" "" "0" "" "" "" "27620904-Pat25" "00207752" "" "" "" "1" "" "01227" "" "" "M" "" "Belgium" "" "0" "" "" "" "" "00430270" "" "" "" "1" "" "01164" "" "" "F" "?" "Saudi Arabia" "" "0" "" "" "" "213171" "00436371" "" "" "" "1" "" "00006" "{PMID:Yuan 2019:30158690}" "2-generation family, 1 affected, mildly affected parant" "" "" "" "" "0" "" "" "" "Rad21-Pat1" "00436372" "" "" "" "1" "" "00006" "{PMID:Yuan 2019:30158690}" "2-generation family, 1 affected, mildly affected parant" "" "" "" "" "0" "" "" "" "Rad21-Pat2" "00451624" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00460955" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 7 "{{individualid}}" "{{diseaseid}}" "00183680" "00139" "00207752" "04281" "00430270" "00660" "00436371" "04281" "00436372" "04281" "00451624" "04281" "00460955" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00660, 04281, 06780 ## Count = 5 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Head/Microcephaly}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000144366" "00139" "00183680" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "CDLS" "intellectual disability" "" "0000321080" "00660" "00430270" "01164" "Unknown" "00y06m" "Neurodevelopmental delay, Butterfly vertebrae, Microcephaly, Single transverse palmar crease, Sandal gap, Patent foramen ovale, Patent ductus arteriosus, Abnormal hip joint morphology, Feeding difficulties in infancy, Choanal atresia, Upslanted palpebral fissure, Low-set, posteriorly rotated ears; mild prenatal growth retardation, microcephaly, intellectual disability, abnormal ear" "" "microcephaly" "" "" "" "" "" "" "" "" "" "" "0000326550" "04281" "00436371" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "CDLS4" "xeroderma pigmentosa" "" "0000326551" "04281" "00436372" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "CDLS4" "xeroderma pigmentosa" "" "0000340290" "04281" "00451624" "03544" "Isolated (sporadic)" "" "HP:0000271, HP:0002777, HP:0002021, HP:0001263" "" "" "" "" "" "" "" "" "" "CDLS4" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000184648" "00183680" "1" "00006" "00006" "2018-10-27 10:06:27" "" "" "SEQ;SEQ-NG" "DNA" "" "1256 gene panel" "0000208805" "00207752" "1" "01227" "01227" "2018-11-30 14:23:37" "" "" "SEQ-NG" "DNA" "peripheral blood" "" "0000431685" "00430270" "1" "01164" "01164" "2023-01-16 17:08:42" "" "" "SEQ-NG-I" "DNA" "" "" "0000437853" "00436371" "1" "00006" "00006" "2023-09-04 09:51:16" "" "" "SEQ-NG" "DNA" "" "clinical WES" "0000437854" "00436372" "1" "00006" "00006" "2023-09-04 09:51:16" "" "" "SEQ-NG" "DNA" "" "clinical WES" "0000453226" "00451624" "1" "03544" "03544" "2024-06-17 14:37:05" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000462587" "00460955" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 12 "{{screeningid}}" "{{geneid}}" "0000184648" "RAD21" "0000208805" "ANKRD11" "0000208805" "ESCO2" "0000208805" "HDAC8" "0000208805" "KMT2A" "0000208805" "NIPBL" "0000208805" "RAD21" "0000208805" "RECQL4" "0000208805" "SMC1A" "0000208805" "SMC3" "0000431685" "RAD21" "0000462587" "RAD21" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 66 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000250566" "0" "50" "8" "117870658" "117870658" "subst" "0" "02329" "RAD21_000011" "g.117870658A>C" "" "" "" "RAD21(NM_006265.3):c.414T>G (p.S138R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116858419A>C" "" "VUS" "" "0000250817" "0" "30" "8" "117868554" "117868554" "del" "0" "02326" "RAD21_000005" "g.117868554del" "" "" "" "RAD21(NM_006265.2):c.815-5del (p.?), RAD21(NM_006265.2):c.815-5delT, RAD21(NM_006265.3):c.815-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116856315del" "" "likely benign" "" "0000254036" "0" "30" "8" "117868554" "117868554" "del" "0" "01943" "RAD21_000005" "g.117868554del" "" "" "" "RAD21(NM_006265.2):c.815-5del (p.?), RAD21(NM_006265.2):c.815-5delT, RAD21(NM_006265.3):c.815-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116856315del" "" "likely benign" "" "0000255054" "0" "30" "8" "117869630" "117869630" "subst" "2.44371E-5" "01943" "RAD21_000008" "g.117869630A>C" "" "" "" "RAD21(NM_006265.2):c.564T>G (p.T188=), RAD21(NM_006265.3):c.564T>G (p.(Thr188=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116857391A>C" "" "likely benign" "" "0000301338" "0" "10" "8" "117868553" "117868554" "del" "0" "02326" "RAD21_000006" "g.117868553_117868554del" "" "" "" "RAD21(NM_006265.2):c.815-6_815-5del (p.?), RAD21(NM_006265.2):c.815-6_815-5delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116856314_116856315del" "" "benign" "" "0000306713" "0" "30" "8" "117879001" "117879001" "subst" "0.00123207" "01943" "RAD21_000009" "g.117879001C>T" "" "" "" "RAD21(NM_006265.2):c.-32-1G>A (p.(=)), RAD21(NM_006265.3):c.-32-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116866762C>T" "" "likely benign" "" "0000332289" "0" "50" "8" "117866571" "117866571" "subst" "0" "01804" "RAD21_000004" "g.117866571C>G" "" "" "" "RAD21(NM_006265.2):c.1074G>C (p.(Lys358Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116854332C>G" "" "VUS" "" "0000345608" "0" "70" "8" "117874162" "117874163" "del" "0" "02327" "RAD21_000010" "g.117874162_117874163del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.116861923_116861924del" "" "likely pathogenic" "" "0000408771" "0" "90" "8" "117878901" "117878901" "subst" "0" "00006" "RAD21_000012" "g.117878901C>T" "" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "De novo" "" "" "0" "" "" "g.116866662C>T" "" "pathogenic (dominant)" "" "0000438789" "0" "70" "8" "117866702" "117866705" "del" "0" "01227" "RAD21_000013" "g.117866702_117866705del" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.116854463_116854466del" "" "pathogenic (dominant)" "" "0000533661" "0" "50" "8" "117864200" "117864200" "subst" "8.13795E-6" "01804" "RAD21_000015" "g.117864200T>A" "" "" "" "RAD21(NM_006265.2):c.1457A>T (p.(Glu486Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116851961T>A" "" "VUS" "" "0000533662" "0" "10" "8" "117864217" "117864217" "subst" "0.17801" "01943" "RAD21_000016" "g.117864217A>G" "" "" "" "RAD21(NM_006265.2):c.1440T>C (p.A480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116851978A>G" "" "benign" "" "0000533663" "0" "50" "8" "117864305" "117864305" "subst" "0.000272648" "01943" "RAD21_000017" "g.117864305A>C" "" "" "" "RAD21(NM_006265.2):c.1352T>G (p.L451R), RAD21(NM_006265.3):c.1352T>G (p.(Leu451Arg), p.L451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852066A>C" "" "VUS" "" "0000533664" "0" "30" "8" "117864305" "117864305" "subst" "0.000272648" "02326" "RAD21_000017" "g.117864305A>C" "" "" "" "RAD21(NM_006265.2):c.1352T>G (p.L451R), RAD21(NM_006265.3):c.1352T>G (p.(Leu451Arg), p.L451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852066A>C" "" "likely benign" "" "0000533665" "0" "10" "8" "117864867" "117864867" "subst" "0.0014362" "01943" "RAD21_000018" "g.117864867A>C" "" "" "" "RAD21(NM_006265.2):c.1242T>G (p.D414E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852628A>C" "" "benign" "" "0000533666" "0" "30" "8" "117864966" "117864966" "del" "0" "01804" "RAD21_000019" "g.117864966del" "" "" "" "RAD21(NM_006265.2):c.1162-6del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852727del" "" "likely benign" "" "0000533667" "0" "30" "8" "117864966" "117864966" "dup" "0" "01804" "RAD21_000020" "g.117864966dup" "" "" "" "RAD21(NM_006265.2):c.1162-6dup (p.(=)), RAD21(NM_006265.3):c.1162-6dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852727dup" "" "likely benign" "" "0000533668" "0" "30" "8" "117866718" "117866718" "subst" "0.00370685" "01943" "RAD21_000021" "g.117866718A>G" "" "" "" "RAD21(NM_006265.2):c.938-11T>C, RAD21(NM_006265.3):c.938-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116854479A>G" "" "likely benign" "" "0000533673" "0" "30" "8" "117868553" "117868554" "del" "0" "01804" "RAD21_000006" "g.117868553_117868554del" "" "" "" "RAD21(NM_006265.2):c.815-6_815-5del (p.?), RAD21(NM_006265.2):c.815-6_815-5delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116856314_116856315del" "" "likely benign" "" "0000533674" "0" "30" "8" "117868554" "117868554" "del" "0" "01804" "RAD21_000005" "g.117868554del" "" "" "" "RAD21(NM_006265.2):c.815-5del (p.?), RAD21(NM_006265.2):c.815-5delT, RAD21(NM_006265.3):c.815-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116856315del" "" "likely benign" "" "0000533675" "0" "30" "8" "117868554" "117868554" "dup" "0" "01804" "RAD21_000024" "g.117868554dup" "" "" "" "RAD21(NM_006265.2):c.815-6dup (p.(=)), RAD21(NM_006265.3):c.815-5dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116856315dup" "" "likely benign" "" "0000611418" "0" "50" "8" "117862896" "117862919" "dup" "0" "02325" "RAD21_000002" "g.117862896_117862919dup" "" "" "" "RAD21(NM_006265.3):c.1560_1583dupACTTCTGCCAGAAAAAGAGAAGGA (p.L521_E528dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116850657_116850680dup" "" "VUS" "" "0000611419" "0" "30" "8" "117864257" "117864257" "subst" "0" "01804" "RAD21_000025" "g.117864257G>A" "" "" "" "RAD21(NM_006265.2):c.1400C>T (p.(Ala467Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116852018G>A" "" "likely benign" "" "0000611420" "0" "30" "8" "117868463" "117868463" "subst" "4.15055E-6" "01804" "RAD21_000026" "g.117868463T>G" "" "" "" "RAD21(NM_006265.2):c.879A>C (p.(Gln293His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116856224T>G" "" "likely benign" "" "0000655987" "0" "50" "8" "117868522" "117868522" "subst" "0" "02327" "RAD21_000027" "g.117868522C>T" "" "" "" "RAD21(NM_006265.3):c.820G>A (p.G274R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.116856283C>T" "" "VUS" "" "0000678276" "0" "30" "8" "117859924" "117859924" "subst" "0.000144002" "01804" "RAD21_000028" "g.117859924G>A" "" "" "" "RAD21(NM_006265.2):c.1711C>T (p.(Leu571Phe)), RAD21(NM_006265.3):c.1711C>T (p.L571F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678277" "0" "90" "8" "117875366" "117875366" "subst" "0" "01943" "RAD21_000029" "g.117875366T>C" "" "" "" "RAD21(NM_006265.2):c.274+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000678278" "0" "30" "8" "117879001" "117879001" "subst" "0.00123207" "01804" "RAD21_000009" "g.117879001C>T" "" "" "" "RAD21(NM_006265.2):c.-32-1G>A (p.(=)), RAD21(NM_006265.3):c.-32-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721772" "0" "90" "8" "117861254" "117861254" "del" "0" "02329" "RAD21_000001" "g.117861254del" "" "" "" "RAD21(NM_006265.3):c.1635delA (p.G547Afs*65)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721773" "0" "50" "8" "117864305" "117864305" "subst" "0.000272648" "02325" "RAD21_000017" "g.117864305A>C" "" "" "" "RAD21(NM_006265.2):c.1352T>G (p.L451R), RAD21(NM_006265.3):c.1352T>G (p.(Leu451Arg), p.L451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721774" "0" "30" "8" "117879001" "117879001" "subst" "0.00123207" "02325" "RAD21_000009" "g.117879001C>T" "" "" "" "RAD21(NM_006265.2):c.-32-1G>A (p.(=)), RAD21(NM_006265.3):c.-32-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803426" "0" "50" "8" "117859924" "117859924" "subst" "0.000144002" "02325" "RAD21_000028" "g.117859924G>A" "" "" "" "RAD21(NM_006265.2):c.1711C>T (p.(Leu571Phe)), RAD21(NM_006265.3):c.1711C>T (p.L571F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803427" "0" "10" "8" "117868552" "117868554" "del" "0" "01943" "RAD21_000023" "g.117868552_117868554del" "" "" "" "RAD21(NM_006265.2):c.815-7_815-5delTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000803428" "0" "70" "8" "117878968" "117878968" "subst" "0" "02327" "RAD21_000030" "g.117878968T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000861049" "0" "90" "8" "117868965" "117868966" "ins" "0" "01943" "RAD21_000031" "g.117868965_117868966insA" "" "" "" "RAD21(NM_006265.2):c.733_734insT (p.P245Lfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000861050" "0" "30" "8" "117879010" "117879010" "subst" "3.53286E-5" "01943" "RAD21_000032" "g.117879010G>A" "" "" "" "RAD21(NM_006265.2):c.-32-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888136" "0" "70" "8" "117868513" "117868513" "dup" "0" "01804" "RAD21_000033" "g.117868513dup" "" "" "" "RAD21(NM_006265.2):c.829dup (p.(Ser277Lysfs*3))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000888137" "0" "70" "8" "117875449" "117875449" "subst" "4.06534E-6" "02329" "RAD21_000034" "g.117875449C>T" "" "" "" "RAD21(NM_006265.3):c.194G>A (p.R65Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000888138" "0" "90" "8" "117878832" "117878832" "subst" "0" "02327" "RAD21_000035" "g.117878832G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000916945" "0" "70" "8" "117866524" "117866528" "del" "0" "01164" "RAD21_000036" "g.117866524_117866528del" "" "" "" "" "ACMG: PVS1, PS2_MOD, PM2_SUP; confirmed de novo in trio exome" "De novo" "-" "" "0" "" "" "g.116854285_116854289del" "" "pathogenic (dominant)" "ACMG" "0000924817" "0" "50" "8" "117859773" "117859773" "subst" "0" "02325" "RAD21_000037" "g.117859773A>G" "" "" "" "RAD21(NM_006265.3):c.1862T>C (p.I621T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924818" "0" "70" "8" "117878913" "117878913" "subst" "0" "02327" "RAD21_000038" "g.117878913A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000933271" "11" "90" "8" "117862928" "117862928" "dup" "0" "00006" "RAD21_000039" "g.117862928dup" "" "{PMID:Yuan 2019:30158690}" "" "1550dupC" "" "Germline" "" "" "0" "" "" "g.116850689dup" "" "pathogenic (dominant)" "" "0000933272" "21" "90" "8" "117866483" "117866483" "subst" "0" "00006" "RAD21_000040" "g.117866483C>T" "" "{PMID:Yuan 2019:30158690}" "" "" "" "Germline" "" "" "0" "" "" "g.116854244C>T" "" "pathogenic (dominant)" "" "0000949012" "0" "50" "8" "117862903" "117862903" "subst" "0" "02329" "RAD21_000041" "g.117862903T>G" "" "" "" "RAD21(NM_006265.3):c.1574A>C (p.K525T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964800" "0" "10" "8" "117864966" "117864966" "dup" "0" "02330" "RAD21_000020" "g.117864966dup" "" "" "" "RAD21(NM_006265.2):c.1162-6dup (p.(=)), RAD21(NM_006265.3):c.1162-6dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964801" "0" "30" "8" "117866718" "117866718" "subst" "0.00370685" "02330" "RAD21_000021" "g.117866718A>G" "" "" "" "RAD21(NM_006265.2):c.938-11T>C, RAD21(NM_006265.3):c.938-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964802" "0" "30" "8" "117868544" "117868554" "del" "0" "02330" "RAD21_000042" "g.117868544_117868554del" "" "" "" "RAD21(NM_006265.3):c.815-15_815-5delTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964803" "0" "10" "8" "117868544" "117868554" "del" "0" "02329" "RAD21_000042" "g.117868544_117868554del" "" "" "" "RAD21(NM_006265.3):c.815-15_815-5delTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964807" "0" "10" "8" "117868554" "117868554" "del" "0" "02330" "RAD21_000005" "g.117868554del" "" "" "" "RAD21(NM_006265.2):c.815-5del (p.?), RAD21(NM_006265.2):c.815-5delT, RAD21(NM_006265.3):c.815-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964808" "0" "10" "8" "117868554" "117868554" "dup" "0" "02330" "RAD21_000024" "g.117868554dup" "" "" "" "RAD21(NM_006265.2):c.815-6dup (p.(=)), RAD21(NM_006265.3):c.815-5dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964810" "0" "50" "8" "117874165" "117874165" "subst" "0" "02330" "RAD21_000043" "g.117874165G>A" "" "" "" "RAD21(NM_006265.3):c.289C>T (p.P97S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978012" "0" "50" "8" "117862875" "117862875" "subst" "6.92476E-5" "01804" "RAD21_000044" "g.117862875T>A" "" "" "" "RAD21(NM_006265.3):c.1602A>T (p.(Glu534Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978013" "0" "30" "8" "117864305" "117864305" "subst" "0.000272648" "01804" "RAD21_000017" "g.117864305A>C" "" "" "" "RAD21(NM_006265.2):c.1352T>G (p.L451R), RAD21(NM_006265.3):c.1352T>G (p.(Leu451Arg), p.L451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978014" "0" "50" "8" "117868522" "117868522" "subst" "0" "02325" "RAD21_000027" "g.117868522C>T" "" "" "" "RAD21(NM_006265.3):c.820G>A (p.G274R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978015" "0" "90" "8" "117875450" "117875450" "subst" "0" "01804" "RAD21_000045" "g.117875450G>A" "" "" "" "RAD21(NM_006265.3):c.193C>T (p.(Arg65*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000987763" "0" "70" "8" "117868465" "117868465" "subst" "0" "03544" "RAD21_000046" "g.117868465G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.116856226G>A" "{CV:3374737}" "likely pathogenic" "ACMG" "0000996905" "0" "30" "8" "117868553" "117868554" "dup" "0" "02330" "RAD21_000047" "g.117868553_117868554dup" "" "" "" "RAD21(NM_006265.3):c.815-6_815-5dupTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996906" "0" "30" "8" "117869016" "117869016" "del" "0" "02325" "RAD21_000048" "g.117869016del" "" "" "" "RAD21(NM_006265.3):c.689-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996907" "0" "50" "8" "117878896" "117878896" "subst" "0" "01804" "RAD21_000049" "g.117878896T>C" "" "" "" "RAD21(NM_006265.2):c.73A>G (p.(Lys25Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014401" "0" "30" "8" "117859942" "117859942" "subst" "0.000299235" "02330" "RAD21_000050" "g.117859942C>T" "" "" "" "RAD21(NM_006265.3):c.1705-12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014402" "0" "30" "8" "117863017" "117863017" "subst" "0.000144647" "02330" "RAD21_000051" "g.117863017T>C" "" "" "" "RAD21(NM_006265.3):c.1471-11A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001022114" "0" "70" "8" "117875366" "117875366" "subst" "0" "04796" "RAD21_000029" "g.117875366T>C" "" "" "" "" "effect on RNA exon skipping" "In vitro (cloned)" "" "" "0" "" "" "g.116863127T>C" "" "likely pathogenic" "" "0001025479" "0" "30" "8" "117868542" "117868554" "del" "0" "02325" "RAD21_000052" "g.117868542_117868554del" "" "" "" "RAD21(NM_006265.3):c.815-17_815-5del, RAD21(NM_006265.3):c.815-17_815-5delTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036714" "0" "30" "8" "117868542" "117868554" "del" "0" "01804" "RAD21_000052" "g.117868542_117868554del" "" "" "" "RAD21(NM_006265.3):c.815-17_815-5del, RAD21(NM_006265.3):c.815-17_815-5delTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036715" "0" "30" "8" "117869630" "117869630" "subst" "2.44371E-5" "01804" "RAD21_000008" "g.117869630A>C" "" "" "" "RAD21(NM_006265.2):c.564T>G (p.T188=), RAD21(NM_006265.3):c.564T>G (p.(Thr188=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes RAD21 ## Count = 66 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000250566" "00017360" "50" "414" "0" "414" "0" "c.414T>G" "r.(?)" "p.(Ser138Arg)" "" "0000250817" "00017360" "30" "815" "-5" "815" "-5" "c.815-5del" "r.spl?" "p.?" "" "0000254036" "00017360" "30" "815" "-5" "815" "-5" "c.815-5del" "r.spl?" "p.?" "" "0000255054" "00017360" "30" "564" "0" "564" "0" "c.564T>G" "r.(?)" "p.(Thr188=)" "" "0000301338" "00017360" "10" "815" "-6" "815" "-5" "c.815-6_815-5del" "r.spl?" "p.?" "" "0000306713" "00017360" "30" "-32" "-1" "-32" "-1" "c.-32-1G>A" "r.spl?" "p.?" "" "0000332289" "00017360" "50" "1074" "0" "1074" "0" "c.1074G>C" "r.(?)" "p.(Lys358Asn)" "" "0000345608" "00017360" "70" "291" "0" "292" "0" "c.291_292del" "r.(?)" "p.(Glu98GlyfsTer8)" "" "0000408771" "00017360" "90" "68" "0" "68" "0" "c.68G>A" "r.(?)" "p.(Trp23*)" "2" "0000438789" "00017360" "70" "943" "0" "946" "0" "c.943_946del" "r.(?)" "p.(Glu315Glnfs*9)" "9" "0000533661" "00017360" "50" "1457" "0" "1457" "0" "c.1457A>T" "r.(?)" "p.(Glu486Val)" "" "0000533662" "00017360" "10" "1440" "0" "1440" "0" "c.1440T>C" "r.(?)" "p.(Ala480=)" "" "0000533663" "00017360" "50" "1352" "0" "1352" "0" "c.1352T>G" "r.(?)" "p.(Leu451Arg)" "" "0000533664" "00017360" "30" "1352" "0" "1352" "0" "c.1352T>G" "r.(?)" "p.(Leu451Arg)" "" "0000533665" "00017360" "10" "1242" "0" "1242" "0" "c.1242T>G" "r.(?)" "p.(Asp414Glu)" "" "0000533666" "00017360" "30" "1162" "-6" "1162" "-6" "c.1162-6del" "r.(=)" "p.(=)" "" "0000533667" "00017360" "30" "1162" "-6" "1162" "-6" "c.1162-6dup" "r.(=)" "p.(=)" "" "0000533668" "00017360" "30" "938" "-11" "938" "-11" "c.938-11T>C" "r.(=)" "p.(=)" "" "0000533673" "00017360" "30" "815" "-6" "815" "-5" "c.815-6_815-5del" "r.spl?" "p.?" "" "0000533674" "00017360" "30" "815" "-5" "815" "-5" "c.815-5del" "r.spl?" "p.?" "" "0000533675" "00017360" "30" "815" "-5" "815" "-5" "c.815-5dup" "r.spl?" "p.?" "" "0000611418" "00017360" "50" "1560" "0" "1583" "0" "c.1560_1583dup" "r.(?)" "p.(Leu521_Glu528dup)" "" "0000611419" "00017360" "30" "1400" "0" "1400" "0" "c.1400C>T" "r.(?)" "p.(Ala467Val)" "" "0000611420" "00017360" "30" "879" "0" "879" "0" "c.879A>C" "r.(?)" "p.(Gln293His)" "" "0000655987" "00017360" "50" "820" "0" "820" "0" "c.820G>A" "r.(?)" "p.(Gly274Arg)" "" "0000678276" "00017360" "30" "1711" "0" "1711" "0" "c.1711C>T" "r.(?)" "p.(Leu571Phe)" "" "0000678277" "00017360" "90" "274" "3" "274" "3" "c.274+3A>G" "r.spl?" "p.?" "" "0000678278" "00017360" "30" "-32" "-1" "-32" "-1" "c.-32-1G>A" "r.spl?" "p.?" "" "0000721772" "00017360" "90" "1635" "0" "1635" "0" "c.1635del" "r.(?)" "p.(Gly547AlafsTer65)" "" "0000721773" "00017360" "50" "1352" "0" "1352" "0" "c.1352T>G" "r.(?)" "p.(Leu451Arg)" "" "0000721774" "00017360" "30" "-32" "-1" "-32" "-1" "c.-32-1G>A" "r.spl?" "p.?" "" "0000803426" "00017360" "50" "1711" "0" "1711" "0" "c.1711C>T" "r.(?)" "p.(Leu571Phe)" "" "0000803427" "00017360" "10" "815" "-7" "815" "-5" "c.815-7_815-5del" "r.spl?" "p.?" "" "0000803428" "00017360" "70" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "" "0000861049" "00017360" "90" "733" "0" "734" "0" "c.733_734insT" "r.(?)" "p.(Pro245Leufs*6)" "" "0000861050" "00017360" "30" "-32" "-10" "-32" "-10" "c.-32-10C>T" "r.(=)" "p.(=)" "" "0000888136" "00017360" "70" "829" "0" "829" "0" "c.829dup" "r.(?)" "p.(Ser277Lysfs*3)" "" "0000888137" "00017360" "70" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Arg65Gln)" "" "0000888138" "00017360" "90" "137" "0" "137" "0" "c.137C>G" "r.(?)" "p.(Ser46*)" "" "0000916945" "00017360" "70" "1120" "0" "1124" "0" "c.1120_1124del" "r.(?)" "p.(Ser374Thrfs*8)" "" "0000924817" "00017360" "50" "1862" "0" "1862" "0" "c.1862T>C" "r.(?)" "p.(Ile621Thr)" "" "0000924818" "00017360" "70" "56" "0" "56" "0" "c.56T>C" "r.(?)" "p.(Leu19Pro)" "" "0000933271" "00017360" "90" "1550" "0" "1550" "0" "c.1550dup" "r.(?)" "p.(Glu518Argfs*19)" "12" "0000933272" "00017360" "90" "1161" "1" "1161" "1" "c.1161+1G>A" "r.spl" "p.?" "10i" "0000949012" "00017360" "50" "1574" "0" "1574" "0" "c.1574A>C" "r.(?)" "p.(Lys525Thr)" "" "0000964800" "00017360" "10" "1162" "-6" "1162" "-6" "c.1162-6dup" "r.(=)" "p.(=)" "" "0000964801" "00017360" "30" "938" "-11" "938" "-11" "c.938-11T>C" "r.(=)" "p.(=)" "" "0000964802" "00017360" "30" "815" "-15" "815" "-5" "c.815-15_815-5del" "r.spl?" "p.?" "" "0000964803" "00017360" "10" "815" "-15" "815" "-5" "c.815-15_815-5del" "r.spl?" "p.?" "" "0000964807" "00017360" "10" "815" "-5" "815" "-5" "c.815-5del" "r.spl?" "p.?" "" "0000964808" "00017360" "10" "815" "-5" "815" "-5" "c.815-5dup" "r.spl?" "p.?" "" "0000964810" "00017360" "50" "289" "0" "289" "0" "c.289C>T" "r.(?)" "p.(Pro97Ser)" "" "0000978012" "00017360" "50" "1602" "0" "1602" "0" "c.1602A>T" "r.(?)" "p.(Glu534Asp)" "" "0000978013" "00017360" "30" "1352" "0" "1352" "0" "c.1352T>G" "r.(?)" "p.(Leu451Arg)" "" "0000978014" "00017360" "50" "820" "0" "820" "0" "c.820G>A" "r.(?)" "p.(Gly274Arg)" "" "0000978015" "00017360" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000987763" "00017360" "70" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Gln293*)" "8" "0000996905" "00017360" "30" "815" "-6" "815" "-5" "c.815-6_815-5dup" "r.spl?" "p.?" "" "0000996906" "00017360" "30" "689" "-4" "689" "-4" "c.689-4del" "r.spl?" "p.?" "" "0000996907" "00017360" "50" "73" "0" "73" "0" "c.73A>G" "r.(?)" "p.(Lys25Glu)" "" "0001014401" "00017360" "30" "1705" "-12" "1705" "-12" "c.1705-12G>A" "r.(=)" "p.(=)" "" "0001014402" "00017360" "30" "1471" "-11" "1471" "-11" "c.1471-11A>G" "r.(=)" "p.(=)" "" "0001022114" "00017360" "70" "274" "3" "274" "3" "c.274+3A>G" "r.[145_274del,145_374del,=]" "p.[p.Lys50TrpfsTer32,Val49Ter,=]" "3i" "0001025479" "00017360" "30" "815" "-17" "815" "-5" "c.815-17_815-5del" "r.spl?" "p.?" "" "0001036714" "00017360" "30" "815" "-17" "815" "-5" "c.815-17_815-5del" "r.spl?" "p.?" "" "0001036715" "00017360" "30" "564" "0" "564" "0" "c.564T>G" "r.(?)" "p.(Thr188=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 7 "{{screeningid}}" "{{variantid}}" "0000184648" "0000408771" "0000208805" "0000438789" "0000431685" "0000916945" "0000437853" "0000933271" "0000437854" "0000933272" "0000453226" "0000987763" "0000462587" "0001022114"