### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = RDH12) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "RDH12" "retinol dehydrogenase 12 (all-trans/9-cis/11-cis)" "14" "q24.1" "unknown" "NG_008321.1" "UD_132118436085" "" "http://www.LOVD.nl/RDH12" "" "1" "19977" "145226" "608830" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/RDH12_NM_152443.2_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2015-02-28 12:41:49" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00017595" "RDH12" "retinol dehydrogenase 12 (all-trans/9-cis/11-cis)" "001" "NM_152443.2" "" "NP_689656.2" "" "" "" "-324" "1554" "951" "68168603" "68201168" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25" "03182" "LCA13;RP53" "Leber congenital amaurosis, type 13 (LCA13, retinitis pigmentosa, type 53 (RP53))" "AD;AR" "612712" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" "" "04213" "COD" "dystrophy, cone (COD)" "" "" "" "" "" "00006" "2015-02-27 19:22:18" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "RDH12" "03182" ## Individuals ## Do not remove or alter this header ## ## Count = 605 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001789" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00001790" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00001813" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00016606" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00016613" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00033165" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" "" "00033345" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00033590" "" "" "" "5" "" "00242" "{PMID:Yücelyilmaz 2014:25148430}" "2-generation family, 5 affected (F, 4M), unaffected heterozygous carrier parents" "F;M" "yes" "Turkey" "" "0" "" "" "Turkish" "FamA" "00033603" "" "" "" "1" "" "00130" "{PMID:Neveling 2013:24123792}" "" "" "" "" "" "0" "" "" "" "" "00033687" "" "" "" "1" "" "00243" "" "" "F" "yes" "India" "" "0" "" "" "India, south" "" "00033703" "" "" "" "1" "" "00243" "" "" "F" "no" "India" "" "0" "" "" "India, north" "" "00052407" "" "" "" "1" "" "01338" "" "2-generation family, 2 affecteds, unaffected heterozygous carrier parents" "M" "yes" "India" "" "0" "" "" "" "" "00095956" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61065" "00155529" "" "" "" "8" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155530" "" "" "" "1" "" "01243" "{PMID:Sharon 2019:31456290}" "family" "M" "no" "Israel" "" "0" "" "" "Jewish" "MOL0966" "00155531" "" "" "" "2" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "family" "F" "no" "Israel" "" "0" "" "" "Turkey;Jewish" "MOL0279" "00155532" "" "" "" "3" "" "01243" "{PMID:Sharon 2019:31456290}" "family" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "MOL0851" "00155533" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab Christian" "" "00155534" "" "" "" "4" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "MOL0098" "00155535" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155536" "" "" "" "1" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "family" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "MOL0105" "00207599" "" "" "" "3" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207683" "" "" "" "1" "" "01244" "" "" "M" "" "" "" "0" "" "" "" "" "00207686" "" "" "" "1" "" "01244" "" "" "M" "" "" "" "0" "" "" "" "" "00207688" "" "" "" "2" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207689" "" "" "" "1" "" "01244" "" "" "M" "" "" "" "0" "" "" "" "" "00207700" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00208837" "" "" "" "1" "" "02959" "" "1 generation- 1 affected (F)- parents unknown carriers status because not sequenced" "F" "no" "Costa Rica" "" "0" "" "none" "" "RPCR-XX-1" "00233243" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233244" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233245" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233246" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233247" "" "" "" "215" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233248" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233249" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233776" "" "" "" "15" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00291095" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308409" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC05394" "00308410" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC07241" "00308411" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC07447" "00308539" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308622" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" "" "00309332" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309333" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309334" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309335" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "Morocco;Jewish" "MOL0589" "00309336" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00309337" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309339" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309340" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309341" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309342" "" "" "" "5" "" "00004" "{PMID:Sharon 2019:31456290}" "5 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00324137" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "172672" "00325418" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "872" "00325446" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "2884" "00325463" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "3343" "00325497" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "3647" "00325504" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3777" "00328158" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G006018" "00328263" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G009840" "00328494" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15007408" "00328495" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14003957" "00332264" "" "" "" "1" "" "00000" "{PMID:Porto 2017:29186038}" "proband" "" "" "Brazil" "" "0" "" "" "" "Fam7PatFBP_8" "00332358" "" "" "" "1" "" "00000" "{PMID:Thompson 2017:29178642}" "" "" "" "Australia" "" "0" "" "" "" "Fam1425" "00333956" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "418" "00333957" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "419" "00333958" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "420" "00333959" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "421" "00333960" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "422" "00333961" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "423" "00334429" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "family" "" "" "China" "" "0" "" "" "" "RP-62" "00334448" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "patient" "" "" "China" "" "0" "" "" "" "RP-050" "00334449" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "patient" "" "" "China" "" "0" "" "" "" "RP-060" "00335148" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "838" "00335281" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat95" "00335382" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP004" "00335393" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP071" "00335748" "" "" "" "1" "" "00000" "{PMID:Zolnikova 2017:27939946}" "" "" "" "Russia" "" "0" "" "" "Russia" "P005" "00358791" "" "" "" "1" "" "00000" "{PMID:Zhang 2016:27596865}" "family" "F" "" "United States" "" "0" "" "" "Hispanic" "BLM012" "00358923" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents/relatives" "" "" "China" "" "0" "" "" "Han" "Fam35" "00358937" "" "" "" "2" "" "00006" "{PMID:Sundaramurthy 2016:27383656}" "4-generation family, 4 affected (F, M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "India" "" "0" "" "" "" "Fam01" "00358978" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71868" "00359055" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12012655" "00359089" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13005789" "00359094" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13005791" "00359132" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12013881" "00359334" "" "" "" "1" "" "00000" "{PMID:Khan 2017:27160483}" "see paper" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "32458" "00359382" "" "" "" "1" "" "00000" "{PMID:Bravo-Gil 2016:27032803}" "see paper" "" "" "Spain" "" "0" "" "" "" "277" "00362148" "" "" "" "1" "" "00006" "In press, {PMID:Huang 2016:26992781}" "" "" "" "China" "" "0" "" "" "" "QT1199" "00362173" "" "" "" "1" "" "00000" "{PMID:Perez-Carro 2016:26806561}" "" "" "" "Spain" "" "0" "" "" "" "RP-2114" "00363439" "" "" "" "2" "" "00000" "{PMID:Ge 2015:26667666}" "3-generation family, affected grandfather/granddaughter (F, M)" "F;M" "" "United States" "" "0" "" "" "" "3WP+3.68" "00363446" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "3JY+V.17" "00363447" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "57R+R.78" "00363466" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "34U+F.88" "00363519" "" "" "" "3" "" "00000" "{PMID:Beheshtian 2015:26497376}" "4-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "Iran" "" "0" "" "" "" "9200033/I-39340" "00363612" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG0245" "00363637" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG1939" "00363673" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG2422" "00363692" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG0773" "00363734" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "13DG0835" "00363874" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "Morocco;Jewish" "MOL1042" "00363875" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363876" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363877" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363878" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363879" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363880" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363881" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363882" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "" "" "00363883" "" "" "" "1" "" "00004" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "Arab-Muslim" "MOL1389" "00368357" "" "" "" "1" "" "01695" "{PMID:Xu 2014:24938718}" "Olders sister affected as well" "M" "no" "China" "" "0" "" "" "China" "RP342" "00372076" "" "" "" "1" "" "00000" "{PMID:Srilekha 2015:26147992}" "family" "" "yes" "India" "" "0" "" "" "India-S" "FamLCA-7" "00372407" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "xh18513" "00372482" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1664583" "00372483" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1675310" "00372484" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1546091" "00372485" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "114" "00372486" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "158" "00372670" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP201" "00372671" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP193" "00373744" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "p1 y P2 same family" "" "" "" "" "0" "" "" "" "" "00373745" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "p1 y P2 same family" "" "" "" "" "0" "" "" "" "" "00373746" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "" "" "" "" "" "0" "" "" "" "" "00373747" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "" "" "" "" "" "0" "" "" "" "" "00373809" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat6" "00373815" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat12" "00373904" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-519-1068" "00374973" "" "" "00374972" "1" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "" "RP-0184PatVII1" "00375281" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6106" "00375282" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6413" "00375437" "" "" "" "1" "" "00000" "{PMID:Watson 2014:25133751}" "family" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "MA6" "00375444" "" "" "" "1" "" "00000" "{PMID:Watson 2014:25133751}" "family" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "MA16" "00376293" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376311" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376854" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "yes" "" "" "0" "" "" "Sahrawi" "Fam1" "00376856" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "yes" "Turkey" "" "0" "" "" "" "Fam3" "00376857" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "yes" "Morocco" "" "0" "" "" "" "Fam4" "00376858" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "yes" "Belgium" "" "0" "" "" "" "Fam5" "00377206" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "300" "00377821" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377822" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377823" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377903" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "Both of the twins are affected" "F" "no" "China" "" "0" "" "" "Chinese" "" "00379389" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379390" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "F" "" "Netherlands" "" "0" "" "" "" "" "00379391" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379866" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016060111" "00379867" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016112117" "00379868" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2017010909" "00380312" "" "" "" "2" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380313" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380314" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00381051" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" "" "00381060" "" "" "" "3" "" "00000" "{PMID:Fu-2013:23661369}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381061" "" "" "" "2" "" "00000" "{PMID:Fu-2013:23661369}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381062" "" "" "" "1" "" "00000" "{PMID:Fu-2013:23661369}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381063" "" "" "" "2" "" "00000" "{PMID:Fu-2013:23661369}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381068" "" "" "" "1" "" "00000" "{PMID:Fu-2013:23661369}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381155" "" "" "" "1" "" "00008" "{PMID:Nishiguchi-2013:24043777}" "" "F" "no" "" "" "0" "" "" "Haitian" "" "00381168" "" "" "" "1" "" "00008" "{PMID:Neveling-2013:24123792}" "" "" "" "" "" "0" "" "" "" "" "00381192" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381193" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381194" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381195" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381226" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel missense mutations" "" "no" "" "" "0" "" "" "" "" "00381625" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" "" "00381633" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" "" "00381645" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Congo" "" "0" "" "" "" "" "00381667" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381672" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381703" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" "" "00381704" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" "" "00381720" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" "" "00381878" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "28" "00381879" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "29" "00382132" "" "" "" "1" "" "00000" "{PMID:Patel 2019:30653986}" "" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "7" "00382376" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "205" "00382377" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "206" "00382378" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "207" "00382379" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "208" "00382841" "" "" "" "8" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "East-Jerusalem/Arab-Muslim" "" "00382842" "" "" "" "4" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "East-Jerusalem/Arab-Muslim" "" "00382843" "" "" "" "3" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Arab-Bedouin" "" "00382848" "" "" "" "1" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Arab-Christian" "" "00382849" "" "" "" "1" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Arab-Muslim" "" "00382853" "" "" "" "3" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Arab-Muslim" "" "00382854" "" "" "" "2" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "Morocco" "" "0" "" "" "Morocco;Jewish" "" "00383742" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD0170400709" "00383763" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18070025_A" "00383777" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18073541_A" "00383919" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0379" "00383922" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0447" "00383931" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0613" "00383946" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0837" "00383958" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0995" "00383971" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1175" "00383980" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1317" "00383982" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1339" "00384031" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1777" "00384033" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1789" "00384034" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1791" "00384073" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2114" "00384103" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2308" "00384487" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14859" "00384624" "" "" "" "1" "" "00000" "{PMID:Ehrenberg 2019:31814694}" "" "F" "no" "Israel" "" "0" "" "" "" "Family 2 patient 1" "00384998" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "yes" "China" "" "0" "" "" "" "19040" "00385000" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19072" "00385007" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19250" "00385014" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19269" "00385016" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19280" "00385031" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19478" "00385073" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "67190" "00385095" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "191110" "00385264" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "israeli" "" "00385265" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "israeli" "" "00385266" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "israeli" "" "00385267" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "M" "yes" "Israel" "" "0" "" "" "israeli" "" "00385268" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "M" "yes" "Israel" "" "0" "" "" "israeli" "" "00385269" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "M" "yes" "Israel" "" "0" "" "" "israeli" "" "00385270" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "M" "yes" "Israel" "" "0" "" "" "israeli" "" "00385271" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "israeli" "" "00385272" "" "" "" "1" "" "00000" "{PMID:Benayoun-2009:19140180}" "" "M" "yes" "Israel" "" "0" "" "" "israeli" "" "00385410" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31872526}" "" "F" "" "Taiwan" "" "0" "" "" "" "F21-IV-2" "00386196" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-150, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-313" "00386279" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-71, family member" "F" "" "Spain" "" "0" "" "" "" "RPN-187" "00386280" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-71, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-188" "00386782" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2933_004518" "00386814" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI591_001221" "00387662" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "50" "00387663" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "51" "00388922" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 74, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "206" "00388923" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 74, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "207" "00389121" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 131, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "405" "00389125" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 132, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "409" "00389181" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 149, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "465" "00389413" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 258, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "697" "00389525" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 325, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "809" "00389636" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 393, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "920" "00389799" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 715, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1083" "00389869" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 820, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1153" "00389927" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 941, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1211" "00389930" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 946, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1214" "00390360" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006018" "00390361" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "G009840" "00391349" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "5" "00391672" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "68" "00391673" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "69" "00391674" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "70" "00391675" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "71" "00391676" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "71" "00391677" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "72" "00391678" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "73" "00391731" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "118" "00391732" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "119" "00391733" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "120" "00391734" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "121" "00391735" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "122" "00392622" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "91" "00393587" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393632" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393643" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393673" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393702" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393735" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393756" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393780" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393802" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00394505" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394624" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00395421" "" "" "" "1" "" "00000" "{PMID:Shen 2021:34130719}" "" "M" "yes" "China" "" "0" "" "" "" "F2‑III" "00395579" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1175" "00395590" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1702" "00395810" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F293" "00395842" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F110" "00395843" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F310" "00404113" "" "" "" "3" "" "00006" "{PMID:Aldahmesh 2009:19956407}" "2-generation family affected sister/2 brothers" "F;M" "yes" "Saudi Arabia" "" "0" "" "" "" "DGU-F14" "00407711" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 1, individual X-1" "F" "" "Austria" "" "0" "" "" "" "1_X-1" "00407712" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 1, individual X-2" "F" "" "Austria" "" "0" "" "" "" "1_X-2" "00407713" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 1, individual X-3" "M" "" "Austria" "" "0" "" "" "" "1_X-3" "00407714" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 1, individual X-4" "F" "" "Austria" "" "0" "" "" "" "1_X-4" "00407715" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 1, individual X-5" "M" "" "Austria" "" "0" "" "" "" "1_X-5" "00407716" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 2, individual VI-4" "M" "" "Austria" "" "0" "" "" "" "2_VI-4" "00407717" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 2, individual VI-6" "M" "" "Austria" "" "0" "" "" "" "2_VI-6" "00407718" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 2, individual VI-8" "F" "" "Austria" "" "0" "" "" "" "2_VI-8" "00407719" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 2, individual VI-11" "F" "" "Austria" "" "0" "" "" "" "2_VI-11" "00407720" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 2, individual VIII-2" "M" "" "Austria" "" "0" "" "" "" "2_VIII-2" "00407721" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 3, individual IX-1" "M" "" "Austria" "" "0" "" "" "" "3_IX-1" "00407722" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 3, individual IX-3" "M" "" "Austria" "" "0" "" "" "" "3_IX-3" "00407723" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 3, individual IX-5" "F" "" "Austria" "" "0" "" "" "" "3_IX-5" "00407724" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 3, individual X-2" "F" "" "Austria" "" "0" "" "" "" "3_X-2" "00407725" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "family 3, individual IX-12" "F" "" "Austria" "" "0" "" "" "" "3_IX-12" "00407726" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "German proband" "M" "" "Germany" "" "0" "" "" "" "828" "00407727" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "Turkish proband" "M" "" "Turkey" "" "0" "" "" "" "839" "00407728" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "Turkish proband\'s sister" "F" "" "Turkey" "" "0" "" "" "" "?" "00407729" "" "" "" "1" "" "00000" "{PMID:Janecke 2004:15258582}" "American" "F" "" "United States" "" "0" "" "" "" "33" "00407747" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 1, individual II-3 (proband)" "M" "no" "France" "" "0" "" "" "" "family 1, individual II-3" "00407748" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 2, individual II-2 (proband)" "M" "no" "France" "" "0" "" "" "" "family 2, individual II-2" "00407749" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 2, individual II-3 (proband\'s brother)" "M" "no" "France" "" "0" "" "" "" "family 2, individual II-3" "00407750" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 3, individual II-2 (proband)" "F" "no" "France" "" "0" "" "" "" "family 3, individual II-2" "00407751" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 3, individual II-3 (proband\'s sister)" "F" "no" "France" "" "0" "" "" "" "family 3, individual II-3" "00407752" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 4, individual II-1 (proband)" "F" "no" "France" "" "0" "" "" "" "family 4, individual II-1" "00407753" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 4, individual II-2 (proband\'s sister)" "F" "no" "France" "" "0" "" "" "" "family 4, individual II-2" "00407754" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 5, individual II-1 (proband)" "F" "yes" "France" "" "0" "" "" "" "family 5, individual II-1" "00407755" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 5, individual II-2 (proband\'s brother)" "M" "yes" "France" "" "0" "" "" "" "family 5, individual II-2" "00407756" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 6, individual II-1 (proband)" "F" "no" "France" "" "0" "" "" "" "family 6, individual II-1" "00407757" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 7, individual II-1 (proband)" "M" "no" "France" "" "0" "" "" "" "family 7, individual II-1" "00407758" "" "" "" "1" "" "00000" "{PMID:Perrault 2004:15322982}" "family 8, individual II-1 (proband)" "F" "no" "France" "" "0" "" "" "" "family 8, individual II-1" "00407774" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "2" "00407775" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "16" "00407776" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "19" "00407777" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "74" "00407778" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "84" "00407779" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "93" "00407780" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "131" "00407781" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "203" "00407782" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "217" "00407783" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "237" "00407784" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "261" "00407785" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "379" "00407786" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "434" "00407787" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "447" "00407788" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "496" "00407789" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "603" "00407790" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "679" "00407791" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "915" "00407792" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "1047" "00407793" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "1921" "00407794" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "2975" "00407795" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "3069" "00407796" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "99" "00407797" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "242" "00407798" "" "" "" "1" "" "00000" "{PMID:Thompson 2005:16269441}" "" "?" "" "" "" "0" "" "" "" "613" "00407803" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family I, individual 1" "?" "" "Austria" "" "0" "" "" "" "I_1" "00407804" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family I, individual 2" "?" "" "Austria" "" "0" "" "" "" "I_2" "00407805" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family I, individual 3" "?" "" "Austria" "" "0" "" "" "" "I_3" "00407806" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family II, individual 4" "?" "" "Austria" "" "0" "" "" "" "II_4" "00407807" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family II, individual 5" "?" "" "Austria" "" "0" "" "" "" "II_5" "00407808" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family III, individual 6" "?" "" "Austria" "" "0" "" "" "" "III_6" "00407809" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family III, individual 7" "?" "" "Austria" "" "0" "" "" "" "III_7" "00407810" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family IV, individual 8" "?" "" "Germany" "" "0" "" "" "" "IV_8" "00407811" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family V, individual 9" "?" "" "Turkey" "" "0" "" "" "" "V_9" "00407812" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family VI, individual 10" "?" "" "Turkey" "" "0" "" "" "" "VI_10" "00407813" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family VII, individual 11" "?" "" "Turkey" "" "0" "" "" "" "VII_11" "00407814" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family VIII, individual 12" "?" "" "Saudi Arabia" "" "0" "" "" "" "VIII_12" "00407815" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family IX, individual 13" "?" "" "Germany" "" "0" "" "" "" "IX_13" "00407816" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family X, individual 14" "?" "" "Germany" "" "0" "" "" "" "X_14" "00407817" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family XI, individual 15" "?" "" "Germany" "" "0" "" "" "" "XI_15" "00407818" "" "" "" "1" "" "00000" "{PMID:Schuster 2007:17389517}" "family XII, individual 16" "?" "" "Germany" "" "0" "" "" "" "XII_16" "00407821" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407822" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407823" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407824" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "Italy" "" "0" "" "" "" "Patient 1" "00407825" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407826" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407827" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407828" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407829" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407830" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407831" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407832" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407833" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407834" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407835" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407836" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407837" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407838" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407839" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407840" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407841" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407842" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407843" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407844" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407845" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407846" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407847" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407848" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407849" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407850" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "" "" "" "0" "" "" "" "?" "00407851" "" "" "" "1" "" "00000" "{PMID:Sun 2007:17512964}" "" "" "yes" "India" "" "0" "" "" "" "Patient 2" "00407852" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "IV:1" "00407853" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "IV:3" "00407854" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "IV:6" "00407855" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "IV:8" "00407856" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "IV:11" "00407857" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "IV:14" "00407858" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "IV:17" "00407859" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "IV:21" "00407860" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "V:1" "00407861" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "V:2" "00407862" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "V:3" "00407863" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "V:5" "00407864" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "V:6" "00407865" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "V:8" "00407866" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "V:9" "00407867" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "V:12" "00407868" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "F" "" "United States" "" "0" "" "" "" "V:14" "00407869" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "V:16" "00407870" "" "" "" "1" "" "00000" "{PMID:Fingert 2008:18779497}" "" "M" "" "United States" "" "0" "" "" "" "VI:2" "00407876" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "S203" "00407877" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "M447" "00407878" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "B16" "00407879" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "B237 (04-13)" "00407880" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "M131 (1962)" "00407881" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "B19" "00407882" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "S217" "00407883" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "S261" "00407884" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "M184" "00407885" "" "" "" "1" "" "00000" "{PMID:Valverde 2009:19011012}" "" "" "" "Spain" "" "0" "" "" "" "M379" "00407899" "" "" "" "1" "" "00000" "{PMID:Sodi 2010:20736127}" "" "M" "" "Italy" "" "0" "" "" "white" "Case 1" "00407901" "" "" "" "1" "" "00000" "{PMID:Lee 2011:21232531}" "cell line" "" "" "" "" "0" "" "" "" "?" "00407902" "" "" "" "1" "" "00000" "{PMID:Lee 2011:21232531}" "cell line" "" "" "" "" "0" "" "" "" "?" "00407905" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "1" "00407906" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "" "" "0" "" "" "Gujurati muslim" "2" "00407907" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "3" "00407908" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "4" "00407909" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "5" "00407910" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "6" "00407911" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "7" "00407912" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Bangladesh" "" "0" "" "" "" "8" "00407913" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "" "" "0" "" "" "white" "9" "00407914" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "" "" "0" "" "" "white" "10" "00407915" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "11" "00407916" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Iraq" "" "0" "" "" "Kurdistani Iraqi" "12" "00407917" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "white" "13" "00407918" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "India" "" "0" "" "" "" "14" "00407919" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Afghanistan" "" "0" "" "" "" "15" "00407920" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Pakistan" "" "0" "" "" "" "16" "00407921" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "17" "00407922" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "" "" "0" "" "" "Portuguese, Dominican Republic" "18" "00407923" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Pakistan" "" "0" "" "" "" "19" "00407924" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "" "" "0" "" "" "Gujurati muslim" "20" "00407925" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Pakistan" "" "0" "" "" "" "21" "00407926" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "" "" "0" "" "" "Gujurati muslim" "22" "00407927" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "" "" "" "0" "" "" "Gujurati Hindu" "23" "00407928" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "24" "00407929" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "Iraq" "" "0" "" "" "Kurdistani Iraqi" "25" "00407930" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "" "" "0" "" "" "Gujurati muslim" "26" "00407931" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "" "" "0" "" "" "white" "27" "00407932" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "yes" "" "" "0" "" "" "white" "28" "00407933" "" "" "" "1" "" "00000" "{PMID:Mackay 2011:22065924}" "" "?" "no" "" "" "0" "" "" "white" "29" "00407934" "" "" "" "1" "" "00000" "{PMID:Chacon-Camacho 2013:23900199}" "" "M" "no" "Mexico" "" "0" "" "" "Hispanic" "III:1" "00407935" "" "" "" "1" "" "00000" "{PMID:Chacon-Camacho 2013:23900199}" "" "F" "no" "Mexico" "" "0" "" "" "Hispanic" "III:2" "00407936" "" "" "" "1" "" "00000" "{PMID:Chacon-Camacho 2013:23900199}" "" "F" "no" "Mexico" "" "0" "" "" "Hispanic" "III:3" "00407937" "" "" "" "1" "" "00000" "{PMID:Chacon-Camacho 2013:23900199}" "" "F" "no" "Mexico" "" "0" "" "" "Hispanic" "III:6" "00407938" "" "" "" "1" "" "00000" "{PMID:Chacon-Camacho 2013:23900199}" "" "M" "yes" "Mexico" "" "0" "" "" "Hispanic" "IV-7" "00407939" "" "" "" "1" "" "00000" "{PMID:Kuniyoshi 2014:24752437}" "family kinki-F18, individual kinki-1044" "F" "" "Japan" "" "0" "" "" "" "Patient 1" "00407940" "" "" "" "1" "" "00000" "{PMID:Kuniyoshi 2014:24752437}" "family kinki-F18, individual kinki-1045" "M" "" "Japan" "" "0" "" "" "" "Patient 2" "00407941" "" "" "" "1" "" "00000" "{PMID:Kuniyoshi 2014:24752437}" "family kinki-F33, individual kinki-1076" "F" "" "Japan" "" "0" "" "" "" "Patient 3" "00407942" "" "" "" "1" "" "00000" "{PMID:Gong 2015:26124963}" "family 1, proband" "M" "" "China" "" "0" "" "" "" "III: 1" "00407943" "" "" "" "1" "" "00000" "{PMID:Gong 2015:26124963}" "family 1, proband\'s sister" "F" "" "China" "" "0" "" "" "" "III: 2" "00407944" "" "" "" "1" "" "00000" "{PMID:AlBakri 2015:26691045}" "Family 1, subject 1 (proband)" "M" "" "" "" "0" "" "" "" "Subject 1" "00407945" "" "" "" "1" "" "00000" "{PMID:AlBakri 2015:26691045}" "Family 1, subject 2 (proband\'s sister)" "F" "" "" "" "0" "" "" "" "Subject 2" "00407946" "" "" "" "1" "" "00000" "{PMID:AlBakri 2015:26691045}" "Family 2, subject 3 (proband)" "M" "" "" "" "0" "" "" "" "Subject 3" "00407947" "" "" "" "1" "" "00000" "{PMID:AlBakri 2015:26691045}" "Family 3, subject 4 (proband)" "M" "" "" "" "0" "" "" "" "Subject 4" "00407948" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German, Scottish, Cherokee" "P1" "00407949" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German,Irish, English, Dutch" "P2" "00407950" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "German,Irish, English, Dutch" "P3" "00407951" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "German" "P4" "00407952" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "Greek,Italian" "P5" "00407953" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German, Scottish, Cherokee" "P6" "00407954" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "Iranian, Pakistani,Indian" "P7" "00407955" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "German,Irish, Czech" "P8" "00407956" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "Welsh, Polish" "P9" "00407957" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "Scottish" "P10" "00407958" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German" "P11" "00407959" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "Mexican" "P12" "00407960" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German,Irish, English,Italian" "P13" "00407961" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German,Irish, Czech" "P14" "00407962" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "German,Irish, Scottish" "P15" "00407963" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "Irish, Scottish, Welsh" "P16" "00407964" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German, Scottish, Cherokee" "P17" "00407965" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German,Irish, Polish" "P18" "00407966" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "M" "" "" "" "0" "" "" "Irish, Scottish, Welsh" "P19" "00407967" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "German, Scottish, Cherokee" "P20" "00407968" "" "" "" "1" "" "00000" "{PMID:Aleman 2018:30372751}" "" "F" "" "" "" "0" "" "" "Lebanese" "P21" "00407971" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "1" "00407972" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "2" "00407973" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "3" "00407974" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "4" "00407975" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "5" "00407976" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "6" "00407977" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "7" "00407978" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "8" "00407979" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "9" "00407980" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "10" "00407981" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "11" "00407982" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "12" "00407983" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "13" "00407984" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "14" "00407985" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "15" "00407986" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "16" "00407987" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "17" "00407988" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "18" "00407989" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "19" "00407990" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "20" "00407991" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "21" "00407992" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "22" "00407993" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "23" "00407994" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "24" "00407995" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "25" "00407996" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "26" "00407997" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "27" "00407998" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "28" "00407999" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "29" "00408000" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "30" "00408001" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "31" "00408002" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "32" "00408003" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "33" "00408004" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "34" "00408005" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "35" "00408006" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "36" "00408007" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "37" "00408008" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "38" "00408009" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "39" "00408010" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "40" "00408011" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "41" "00408012" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "42" "00408013" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "43" "00408014" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "44" "00408015" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "45" "00408016" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "46" "00408017" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "47" "00408018" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "48" "00408019" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "49" "00408020" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "50" "00408021" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "51" "00408022" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "52" "00408023" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "53" "00408024" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "54" "00408025" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "55" "00408026" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "F" "" "United States" "" "0" "" "" "" "56" "00408027" "" "" "" "1" "" "00000" "{PMID:Fahim 2019:30979730}" "" "M" "" "United States" "" "0" "" "" "" "57" "00408028" "" "" "" "1" "" "00000" "{PMID:Philip 2019:31424981}" "" "M" "" "United States" "" "0" "" "" "" "1" "00408030" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI519-1068" "00408031" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "M" "" "United States" "" "0" "" "" "" "OGI3079-4672" "00408032" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI2933-4518" "00408033" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "M" "" "United States" "" "0" "" "" "" "OGI3076-4666" "00408034" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI2356-3915" "00408035" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "M" "" "United States" "" "0" "" "" "" "OGI1611-2841" "00408036" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "M" "" "United States" "" "0" "" "" "" "OGI3077-4669" "00408037" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "M" "" "United States" "" "0" "" "" "" "OGI1662-2892" "00408038" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI1613-2843" "00408039" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI1610-2840" "00408040" "" "" "" "1" "" "00000" "{PMID:Scott 2020:32014858}" "" "F" "" "United States" "" "0" "" "" "" "OGI1242-2406" "00408041" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2020:32790509}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" "Case 1" "00408042" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2020:32790509}" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "Case 2" "00408043" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32172635}" "father of proband" "M" "yes" "United States" "" "0" "" "" "" "Patient 1, IV-2" "00408044" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32172635}" "proband" "F" "yes" "United States" "" "0" "" "" "" "Patient 2, V-3" "00408045" "" "" "" "1" "" "00000" "{PMID:Sarkar 2020:32322264}" "family 1, proband" "M" "" "Israel" "" "0" "" "" "Kurdistan, Tunisia" "1_III:11" "00408046" "" "" "" "1" "" "00000" "{PMID:Sarkar 2020:32322264}" "family 1, proband\'s sister" "F" "" "" "" "0" "" "" "" "1_III:10" "00408047" "" "" "" "1" "" "00000" "{PMID:Sarkar 2020:32322264}" "family 1, proband\'s father" "M" "" "" "" "0" "" "" "" "1_II:5" "00408048" "" "" "" "1" "" "00000" "{PMID:Sarkar 2020:32322264}" "family 2, proband\'s mother" "F" "" "" "" "0" "" "" "" "2_II:2" "00408049" "" "" "" "1" "" "00000" "{PMID:Sarkar 2020:32322264}" "family 2, proband" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "2_III:1" "00408051" "" "" "" "1" "" "00000" "{PMID:Xin 2016:26848971}" "family QT1199, individual II1" "M" "" "China" "" "0" "" "" "Asian" "QT1199-II1" "00408056" "" "" "" "1" "" "00000" "{PMID:Chebil 2016:26868535}" "4 patients altogether family D and H" "?" "" "France" "" "0" "" "" "Tunisia" "Family D" "00408058" "" "" "" "1" "" "00000" "{PMID:Chebil 2016:26868535}" "4 patients altogether family D and H" "?" "" "France" "" "0" "" "" "Tunisia" "Family H" "00408064" "" "" "" "1" "" "00000" "{PMID:Garg 2017:28513254}" "Family 1, proband" "M" "" "United States" "" "0" "" "" "" "" "00408065" "" "" "" "1" "" "00000" "{PMID:Garg 2017:28513254}" "Family 1, proband\'s sister" "F" "" "United States" "" "0" "" "" "" "" "00408066" "" "" "" "1" "" "00000" "{PMID:Garg 2017:28513254}" "Family 2, proband" "F" "" "United States" "" "0" "" "" "" "" "00408067" "" "" "" "1" "" "00000" "{PMID:Garg 2017:28513254}" "Family 3, proband" "M" "" "United States" "" "0" "" "" "" "" "00408069" "" "" "" "1" "" "00000" "{PMID:Li 2017:28471114}" "Family 1, proband" "M" "" "China" "" "0" "" "" "" "II:1" "00408070" "" "" "" "1" "" "00000" "{PMID:Li 2017:28471114}" "Family 1, proband" "F" "" "China" "" "0" "" "" "" "II:2" "00408420" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "12" "00408438" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "26" "00419718" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}" "" "M" "" "" "" "0" "" "" "" "067297" "00420458" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F110" "00420580" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F293" "00420591" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F310" "00421512" "" "" "" "1" "" "04364" "" "" "F" "" "India" "08y" "" "" "" "Asian" "" "00422684" "" "" "" "2" "" "04364" "" "" "F" "yes" "India" ">17y" "" "" "" "Asian" "" "00426908" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 10, individual 12" "M" "" "" "" "0" "" "" "" "10_12" "00426930" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 33, individual 39" "F" "" "" "" "0" "" "" "" "33_39" "00429571" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429766" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429770" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429805" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429823" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429870" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429892" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429944" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429953" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429984" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429995" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430003" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430018" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430064" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00446996" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-447" "00447494" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-186" "00447507" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-452" "00447563" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "MDS-400" "00447654" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-414" "00447687" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "OAK-745" "00450834" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "080606" "00450971" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "067109" "00450972" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "067297" "00450973" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "070804" "00450974" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "071006" "00450975" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "071326" "00450976" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "071517" "00450977" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "071782" "00450978" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "071817" "00450979" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "072784" "00450980" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "072973" "00450981" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "075151" "00461076" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "India" "Pat11" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 603 "{{individualid}}" "{{diseaseid}}" "00001789" "00112" "00001790" "00112" "00001813" "00112" "00033165" "04214" "00033345" "04213" "00033590" "04210" "00033603" "00198" "00033687" "04210" "00033703" "04210" "00052407" "04210" "00095956" "00381" "00155529" "04210" "00155530" "04210" "00155531" "04214" "00155532" "04214" "00155533" "04210" "00155534" "04210" "00155535" "04214" "00155536" "04214" "00207599" "04214" "00207683" "04214" "00207686" "04210" "00207688" "04214" "00207689" "04214" "00207700" "04214" "00208837" "04214" "00233243" "04214" "00233244" "04214" "00233245" "04214" "00233246" "04214" "00233247" "04214" "00233248" "04214" "00233249" "04214" "00233776" "04214" "00291095" "00198" "00308409" "04214" "00308410" "04214" "00308411" "04214" "00308539" "04214" "00308622" "04214" "00309332" "04214" "00309333" "04214" "00309334" "04214" "00309335" "04214" "00309336" "04214" "00309337" "04214" "00309339" "04214" "00309340" "04214" "00309341" "04214" "00309342" "04214" "00324137" "03182" "00325418" "04214" "00325446" "04214" "00325463" "04214" "00325497" "04214" "00325504" "04214" "00328158" "04214" "00328263" "04214" "00328494" "04214" "00328495" "04214" "00332264" "04214" "00332358" "04214" "00333956" "04214" "00333957" "04214" "00333958" "04214" "00333959" "04214" "00333960" "04214" "00333961" "04214" "00334429" "04214" "00334448" "04214" "00334449" "04214" "00335148" "00198" "00335281" "04214" "00335382" "04214" "00335393" "04214" "00335748" "04214" "00358791" "04214" "00358923" "04214" "00358937" "04214" "00358978" "04214" "00359055" "04214" "00359089" "04214" "00359094" "04214" "00359132" "04214" "00359334" "04214" "00359382" "04214" "00362148" "04214" "00362173" "04214" "00363439" "04214" "00363446" "04214" "00363447" "04214" "00363466" "04214" "00363519" "04214" "00363612" "04214" "00363637" "04214" "00363673" "04214" "00363692" "04214" "00363734" "04214" "00363874" "04214" "00363875" "04214" "00363876" "04214" "00363877" "04214" "00363878" "04214" "00363879" "04214" "00363880" "04214" "00363881" "04214" "00363882" "04214" "00363883" "04214" "00368357" "04214" "00372076" "04214" "00372407" "04214" "00372482" "04214" "00372483" "04214" "00372484" "04214" "00372485" "04214" "00372486" "04214" "00372670" "04214" "00372671" "04214" "00373744" "04214" "00373745" "04214" "00373746" "04214" "00373747" "04214" "00373809" "04214" "00373815" "04214" "00373904" "04214" "00374973" "04214" "00375281" "04214" "00375282" "04214" "00375437" "04214" "00375444" "04214" "00376293" "04214" "00376311" "04214" "00376854" "04214" "00376856" "04214" "00376857" "04214" "00376858" "04214" "00377206" "04214" "00377821" "04214" "00377822" "04214" "00377823" "04214" "00377903" "04214" "00379389" "04214" "00379390" "04214" "00379391" "04214" "00379866" "04214" "00379867" "04214" "00379868" "04214" "00380312" "04214" "00380313" "04214" "00380314" "04214" "00381051" "04214" "00381060" "04214" "00381061" "04214" "00381062" "04214" "00381063" "04214" "00381068" "04214" "00381155" "04214" "00381168" "04214" "00381192" "04214" "00381193" "04214" "00381194" "04214" "00381195" "04214" "00381226" "04214" "00381625" "04214" "00381633" "04214" "00381645" "04214" "00381667" "04214" "00381672" "04214" "00381703" "04214" "00381704" "04214" "00381720" "04214" "00381878" "04214" "00381879" "04214" "00382132" "03182" "00382376" "04214" "00382377" "04214" "00382378" "04214" "00382379" "04214" "00382841" "04214" "00382842" "04214" "00382843" "04214" "00382848" "04214" "00382849" "04214" "00382853" "04214" "00382854" "04214" "00383742" "04214" "00383763" "04214" "00383777" "04214" "00383919" "04214" "00383922" "04214" "00383931" "04214" "00383946" "04214" "00383958" "04214" "00383971" "04214" "00383980" "04214" "00383982" "04214" "00384031" "04214" "00384033" "04214" "00384034" "04214" "00384073" "04214" "00384103" "04214" "00384487" "04214" "00384624" "00198" "00384998" "04214" "00385000" "04214" "00385007" "04214" "00385014" "04214" "00385016" "04214" "00385031" "04214" "00385073" "04214" "00385095" "04214" "00385264" "04214" "00385265" "04214" "00385266" "04214" "00385267" "04214" "00385268" "04214" "00385269" "04214" "00385270" "04214" "00385271" "04214" "00385272" "04214" "00385410" "04214" "00386196" "04214" "00386279" "04214" "00386280" "04214" "00386782" "04214" "00386814" "04214" "00387662" "04214" "00387663" "04214" "00388922" "04214" "00388923" "04214" "00389121" "04214" "00389125" "04214" "00389181" "04214" "00389413" "04214" "00389525" "04214" "00389636" "04214" "00389799" "04214" "00389869" "04214" "00389927" "04214" "00389930" "04214" "00390360" "04214" "00390361" "04214" "00391349" "04214" "00391672" "04214" "00391673" "04214" "00391674" "04214" "00391675" "04214" "00391676" "04214" "00391677" "04214" "00391678" "04214" "00391731" "04214" "00391732" "04214" "00391733" "04214" "00391734" "04214" "00391735" "04214" "00392622" "04214" "00393587" "04214" "00393632" "04214" "00393643" "04214" "00393673" "04214" "00393702" "04214" "00393735" "04214" "00393756" "04214" "00393780" "04214" "00393802" "04214" "00394505" "04214" "00394624" "04214" "00395421" "04214" "00395579" "04214" "00395590" "04214" "00395810" "04214" "00395842" "04214" "00395843" "04214" "00404113" "04214" "00407711" "04214" "00407712" "04214" "00407713" "04214" "00407714" "04214" "00407715" "04214" "00407716" "04214" "00407717" "04214" "00407718" "04214" "00407719" "04214" "00407720" "04214" "00407721" "04214" "00407722" "04214" "00407723" "04214" "00407724" "04214" "00407725" "04214" "00407726" "04214" "00407727" "04214" "00407728" "04214" "00407729" "04214" "00407747" "04214" "00407748" "04214" "00407749" "04214" "00407750" "04214" "00407751" "04214" "00407752" "04214" "00407753" "04214" "00407754" "04214" "00407755" "04214" "00407756" "04214" "00407757" "04214" "00407758" "04214" "00407774" "04214" "00407775" "04214" "00407776" "04214" "00407777" "04214" "00407778" "04214" "00407779" "04214" "00407780" "04214" "00407781" "04214" "00407782" "04214" "00407783" "04214" "00407784" "04214" "00407785" "04214" "00407786" "04214" "00407787" "04214" "00407788" "04214" "00407789" "04214" "00407790" "04214" "00407791" "04214" "00407792" "04214" "00407793" "04214" "00407794" "04214" "00407795" "04214" "00407796" "04214" "00407797" "04214" "00407798" "04214" "00407803" "04214" "00407804" "04214" "00407805" "04214" "00407806" "04214" "00407807" "04214" "00407808" "04214" "00407809" "04214" "00407810" "04214" "00407811" "04214" "00407812" "04214" "00407813" "04214" "00407814" "04214" "00407815" "04214" "00407816" "04214" "00407817" "04214" "00407818" "04214" "00407821" "04214" "00407822" "04214" "00407823" "04214" "00407824" "04214" "00407825" "04214" "00407826" "04214" "00407827" "04214" "00407828" "04214" "00407829" "04214" "00407830" "04214" "00407831" "04214" "00407832" "04214" "00407833" "04214" "00407834" "04214" "00407835" "04214" "00407836" "04214" "00407837" "04214" "00407838" "04214" "00407839" "04214" "00407840" "04214" "00407841" "04214" "00407842" "04214" "00407843" "04214" "00407844" "04214" "00407845" "04214" "00407846" "04214" "00407847" "04214" "00407848" "04214" "00407849" "04214" "00407850" "04214" "00407851" "04214" "00407852" "04214" "00407853" "04214" "00407854" "04214" "00407855" "04214" "00407856" "04214" "00407857" "04214" "00407858" "04214" "00407859" "04214" "00407860" "04214" "00407861" "04214" "00407862" "04214" "00407863" "04214" "00407864" "04214" "00407865" "04214" "00407866" "04214" "00407867" "04214" "00407868" "04214" "00407869" "04214" "00407870" "04214" "00407876" "04214" "00407877" "04214" "00407878" "04214" "00407879" "04214" "00407880" "04214" "00407881" "04214" "00407882" "04214" "00407883" "04214" "00407884" "04214" "00407885" "04214" "00407899" "04214" "00407901" "04214" "00407902" "04214" "00407905" "04214" "00407906" "04214" "00407907" "04214" "00407908" "04214" "00407909" "04214" "00407910" "04214" "00407911" "04214" "00407912" "04214" "00407913" "04214" "00407914" "04214" "00407915" "04214" "00407916" "04214" "00407917" "04214" "00407918" "04214" "00407919" "04214" "00407920" "04214" "00407921" "04214" "00407922" "04214" "00407923" "04214" "00407924" "04214" "00407925" "04214" "00407926" "04214" "00407927" "04214" "00407928" "04214" "00407929" "04214" "00407930" "04214" "00407931" "04214" "00407932" "04214" "00407933" "04214" "00407934" "04214" "00407935" "04214" "00407936" "04214" "00407937" "04214" "00407938" "04214" "00407939" "04214" "00407940" "04214" "00407941" "04214" "00407942" "04214" "00407943" "04214" "00407944" "04214" "00407945" "04214" "00407946" "04214" "00407947" "04214" "00407948" "04214" "00407949" "04214" "00407950" "04214" "00407951" "04214" "00407952" "04214" "00407953" "04214" "00407954" "04214" "00407955" "04214" "00407956" "04214" "00407957" "04214" "00407958" "04214" "00407959" "04214" "00407960" "04214" "00407961" "04214" "00407962" "04214" "00407963" "04214" "00407964" "04214" "00407965" "04214" "00407966" "04214" "00407967" "04214" "00407968" "04214" "00407971" "04214" "00407972" "04214" "00407973" "04214" "00407974" "04214" "00407975" "04214" "00407976" "04214" "00407977" "04214" "00407978" "04214" "00407979" "04214" "00407980" "04214" "00407981" "04214" "00407982" "04214" "00407983" "04214" "00407984" "04214" "00407985" "04214" "00407986" "04214" "00407987" "04214" "00407988" "04214" "00407989" "04214" "00407990" "04214" "00407991" "04214" "00407992" "04214" "00407993" "04214" "00407994" "04214" "00407995" "04214" "00407996" "04214" "00407997" "04214" "00407998" "04214" "00407999" "04214" "00408000" "04214" "00408001" "04214" "00408002" "04214" "00408003" "04214" "00408004" "04214" "00408005" "04214" "00408006" "04214" "00408007" "04214" "00408008" "04214" "00408009" "04214" "00408010" "04214" "00408011" "04214" "00408012" "04214" "00408013" "04214" "00408014" "04214" "00408015" "04214" "00408016" "04214" "00408017" "04214" "00408018" "04214" "00408019" "04214" "00408020" "04214" "00408021" "04214" "00408022" "04214" "00408023" "04214" "00408024" "04214" "00408025" "04214" "00408026" "04214" "00408027" "04214" "00408028" "04214" "00408030" "04214" "00408031" "04214" "00408032" "04214" "00408033" "04214" "00408034" "04214" "00408035" "04214" "00408036" "04214" "00408037" "04214" "00408038" "04214" "00408039" "04214" "00408040" "04214" "00408041" "04214" "00408042" "04214" "00408043" "04214" "00408044" "04214" "00408045" "04214" "00408046" "04214" "00408047" "04214" "00408048" "04214" "00408049" "04214" "00408051" "04214" "00408056" "04214" "00408058" "04214" "00408064" "04214" "00408065" "04214" "00408066" "04214" "00408067" "04214" "00408069" "04214" "00408070" "04214" "00408420" "04214" "00408438" "04214" "00419718" "04214" "00420458" "04214" "00420580" "04214" "00420591" "04214" "00421512" "00058" "00422684" "00058" "00426908" "04214" "00426930" "04214" "00429571" "00112" "00429766" "00112" "00429770" "00112" "00429805" "00112" "00429823" "04210" "00429870" "04214" "00429892" "04210" "00429944" "00112" "00429953" "04210" "00429984" "00112" "00429995" "00112" "00430003" "00112" "00430018" "00112" "00430064" "00112" "00446996" "00198" "00447494" "00198" "00447507" "00198" "00447563" "00198" "00447654" "00198" "00447687" "00198" "00450834" "04249" "00450971" "04249" "00450972" "04249" "00450973" "04249" "00450974" "04249" "00450975" "04249" "00450976" "04249" "00450977" "04249" "00450978" "04249" "00450979" "04249" "00450980" "04249" "00450981" "04249" "00461076" "04214" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00058, 00112, 00198, 00381, 03182, 04210, 04213, 04214, 04249 ## Count = 591 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000026594" "04214" "00033165" "00229" "Unknown" "26y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026774" "04213" "00033345" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000027019" "04210" "00033590" "00242" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000027032" "00198" "00033603" "00130" "Isolated (sporadic)" "" "retina dystrophy with comorbidithy" "" "" "" "" "" "" "" "" "" "" "" "0000027116" "04210" "00033687" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" "" "0000027132" "04210" "00033703" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" "" "0000038981" "04210" "00052407" "01338" "Familial, autosomal recessive" "" "congenital, Age/Diagnosis 1y" "0d" "" "congenital" "" "" "" "" "" "" "" "" "0000074234" "00381" "00095956" "01769" "Familial, autosomal recessive" "" "Progressive RD" "" "" "" "" "" "" "" "" "" "" "" "0000128029" "04210" "00155529" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000128030" "04210" "00155530" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000128031" "04214" "00155531" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000128032" "04214" "00155532" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000128033" "04210" "00155533" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000128034" "04210" "00155534" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000128035" "04214" "00155535" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000128036" "04214" "00155536" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155410" "04214" "00207599" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155473" "04214" "00207683" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155476" "04210" "00207686" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000155478" "04214" "00207688" "01244" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155479" "04214" "00207689" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155491" "04214" "00207700" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000157446" "04214" "00208837" "02959" "Familial, autosomal recessive" "15y" "20/60 OD, 20/70 OS, nyctalopia, no nystagmus, bony spicules, flat ERG" "00y18m" "" "" "WBaileyGlen" "" "" "" "" "" "Early onset retinal dystrophy" "" "0000233836" "04214" "00308409" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233837" "04214" "00308410" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233838" "04214" "00308411" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233967" "04214" "00308539" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234050" "04214" "00308622" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234652" "04214" "00309332" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" "" "0000234653" "04214" "00309333" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234654" "04214" "00309334" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234655" "04214" "00309335" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234656" "04214" "00309336" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234657" "04214" "00309337" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" "" "0000234659" "04214" "00309339" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234660" "04214" "00309340" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234661" "04214" "00309341" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234662" "04214" "00309342" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000242720" "03182" "00324137" "01164" "Unknown" "18y" "Rod-cone dystrophy, Retinal dystrophy" "" "" "" "" "" "" "" "" "" "" "" "0000243905" "04214" "00325418" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243933" "04214" "00325446" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243950" "04214" "00325463" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243984" "04214" "00325497" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243991" "04214" "00325504" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000246385" "04214" "00328158" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "multiple phenotypes" "" "0000246490" "04214" "00328263" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246720" "04214" "00328494" "00000" "Familial, autosomal recessive" "8y" "retinal dystrophy (HP:0000556)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246721" "04214" "00328495" "00000" "Familial, autosomal recessive" "5y" "retinal dystrophy (HP:0000556)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000250451" "04214" "00332264" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis, early-onset retinal dystrophy" "" "0000250544" "04214" "00332358" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000252141" "04214" "00333956" "00000" "Familial, autosomal recessive" "5y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252142" "04214" "00333957" "00000" "Familial, autosomal recessive" "4y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252143" "04214" "00333958" "00000" "Familial, autosomal recessive" "39y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy with macular hypoplasia" "" "0000252144" "04214" "00333959" "00000" "Familial, autosomal recessive" "3y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252145" "04214" "00333960" "00000" "Familial, autosomal recessive" "50y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252146" "04214" "00333961" "00000" "Familial, autosomal recessive" "10y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252518" "04214" "00334429" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252537" "04214" "00334448" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252538" "04214" "00334449" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252863" "00198" "00335148" "00000" "Unknown" "" "2y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252996" "04214" "00335281" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253328" "04214" "00335382" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253339" "04214" "00335393" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253666" "04214" "00335748" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinopathy" "" "0000254006" "04214" "00358791" "00000" "Familial, autosomal recessive" "21y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254183" "04214" "00358923" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000254235" "04214" "00358937" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000254276" "04214" "00358978" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, DD: retinal dystrophy" "" "0000254352" "04214" "00359055" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254386" "04214" "00359089" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254391" "04214" "00359094" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254429" "04214" "00359132" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254630" "04214" "00359334" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000254653" "04214" "00359382" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000257562" "04214" "00362148" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000257587" "04214" "00362173" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258800" "04214" "00363439" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258807" "04214" "00363446" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258808" "04214" "00363447" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258827" "04214" "00363466" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258868" "04214" "00363519" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258962" "04214" "00363612" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000258987" "04214" "00363637" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259023" "04214" "00363673" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinal dystrophy, unspecfied" "" "0000259042" "04214" "00363692" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259084" "04214" "00363734" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259213" "04214" "00363874" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259214" "04214" "00363875" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259215" "04214" "00363876" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259216" "04214" "00363877" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259217" "04214" "00363878" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259218" "04214" "00363879" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259219" "04214" "00363880" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259220" "04214" "00363881" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259221" "04214" "00363882" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000259222" "04214" "00363883" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000263695" "04214" "00368357" "01695" "Unknown" "" "At the age of 19, the visual acuity was 0.1/0.1 (OD/OS). The fundus showed: attenuated retinal arteries; no foveal reflex;. ERG response of the rods was: not available and of the cones was not available." "13y" "" "poor vision" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267405" "04214" "00372076" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267722" "04214" "00372407" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267797" "04214" "00372482" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267798" "04214" "00372483" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267799" "04214" "00372484" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267800" "04214" "00372485" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267801" "04214" "00372486" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267949" "04214" "00372670" "00000" "Familial, autosomal recessive" "29y" "see paper; ..." "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267950" "04214" "00372671" "00000" "Familial, autosomal recessive" "25y" "see paper; ..." "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268967" "04214" "00373744" "00008" "Familial, autosomal recessive" "8y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268968" "04214" "00373745" "00008" "Familial, autosomal recessive" "11y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268969" "04214" "00373746" "00008" "Familial, autosomal recessive" "13y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268970" "04214" "00373747" "00008" "Familial, autosomal recessive" "21y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000269018" "04214" "00373809" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269024" "04214" "00373815" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269113" "04214" "00373904" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000270183" "04214" "00374973" "00000" "Familial, autosomal recessive" "15y" "3y-night blindenss, diminished visual acuity (3y), diminished visual field (3y); best corrected visual acuity 0.7/0.2; ERG-diminished; pale optic disc, retina vessels attenuation and bone spicule pigmentationmacular alteration; normal hearing acuity (15y)" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270495" "04214" "00375281" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270496" "04214" "00375282" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270651" "04214" "00375437" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270658" "04214" "00375444" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271501" "04214" "00376293" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa ( RP)" "" "0000271519" "04214" "00376311" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Albinism, oculocutaneous LCA/RP" "" "0000272065" "04214" "00376854" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000272067" "04214" "00376856" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272068" "04214" "00376857" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272069" "04214" "00376858" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272364" "04214" "00377206" "00000" "Familial, autosomal recessive" "6y" "see paper" "3y" "4y" "" "" "" "" "" "" "" "retinal disease" "" "0000272967" "04214" "00377821" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" "" "0000272968" "04214" "00377822" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" "" "0000272969" "04214" "00377823" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" "" "0000273049" "04214" "00377903" "00000" "Unknown" "10y" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273262" "04214" "00379389" "00000" "Unknown" "5y" "" "5y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)/retinitis pigmentosa (RP)" "" "0000273263" "04214" "00379390" "00000" "Unknown" "25y" "" "24y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273264" "04214" "00379391" "00000" "Unknown" "29y" "" "26y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273720" "04214" "00379866" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273721" "04214" "00379867" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000273722" "04214" "00379868" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy" "" "0000274163" "04214" "00380312" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "leber congenital amaurosis (LCA)" "" "0000274164" "04214" "00380313" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "leber congenital amaurosis (LCA)" "" "0000274165" "04214" "00380314" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274902" "04214" "00381051" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000274911" "04214" "00381060" "00000" "Familial, autosomal recessive" "31y" "Nystagmus" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" "" "0000274912" "04214" "00381061" "00000" "Familial, autosomal recessive" "39y" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" "" "0000274913" "04214" "00381062" "00000" "Familial, autosomal recessive" "28y" "OD is more severe than OS" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" "" "0000274914" "04214" "00381063" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" "" "0000274919" "04214" "00381068" "00000" "Familial, autosomal recessive" "42y" "Dense confluent retinal pigments" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (RP)" "" "0000275006" "04214" "00381155" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (ARRP)" "" "0000275019" "04214" "00381168" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retina dystrophy with comorbidithy" "" "0000275043" "04214" "00381192" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275044" "04214" "00381193" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275045" "04214" "00381194" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "juvenile retinitis pigmentosa" "" "0000275046" "04214" "00381195" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275077" "04214" "00381226" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275467" "04214" "00381625" "00000" "Familial, autosomal recessive" "" "" "12y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275475" "04214" "00381633" "00000" "Familial, autosomal recessive" "" "" "5y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275487" "04214" "00381645" "00000" "Isolated (sporadic)" "" "" "34y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275509" "04214" "00381667" "00000" "Familial, autosomal recessive" "" "" "7y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275514" "04214" "00381672" "00000" "Familial, autosomal recessive" "" "" "5y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275545" "04214" "00381703" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000275546" "04214" "00381704" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000275562" "04214" "00381720" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000275720" "04214" "00381878" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275721" "04214" "00381879" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275974" "03182" "00382132" "00000" "Familial, autosomal recessive" "" "retinal dystrophy; MIM, 612712" "" "" "" "" "" "" "" "" "" "MIM, 612712" "" "0000276225" "04214" "00382376" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276226" "04214" "00382377" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276227" "04214" "00382378" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276228" "04214" "00382379" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276697" "04214" "00382841" "00000" "Familial, autosomal recessive" "13y" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy (CRD)" "" "0000276698" "04214" "00382842" "00000" "Familial, autosomal recessive" "9y" "" "" "" "" "" "" "" "" "" "" "early-onset retinitis pigmentosa (EORD)" "" "0000276699" "04214" "00382843" "00000" "Familial, autosomal recessive" "6y" "" "" "" "" "" "" "" "" "" "" "early-onset retinitis pigmentosa (EORD)" "" "0000276704" "04214" "00382848" "00000" "Familial, autosomal recessive" "15y" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy (CRD)" "" "0000276705" "04214" "00382849" "00000" "Familial, autosomal recessive" "17y" "" "" "" "" "" "" "" "" "" "" "early-onset retinitis pigmentosa (EORD)" "" "0000276709" "04214" "00382853" "00000" "Familial, autosomal recessive" "20y" "" "" "" "" "" "" "" "" "" "" "early-onset retinitis pigmentosa (EORD)" "" "0000276710" "04214" "00382854" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early-onset retinitis pigmentosa (EORD)" "" "0000277527" "04214" "00383742" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277548" "04214" "00383763" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277562" "04214" "00383777" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277704" "04214" "00383919" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277707" "04214" "00383922" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277716" "04214" "00383931" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277731" "04214" "00383946" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277743" "04214" "00383958" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277756" "04214" "00383971" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277765" "04214" "00383980" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277767" "04214" "00383982" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277816" "04214" "00384031" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277818" "04214" "00384033" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277819" "04214" "00384034" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277858" "04214" "00384073" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277888" "04214" "00384103" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278272" "04214" "00384487" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000278414" "00198" "00384624" "00000" "Unknown" "" "Retinitis pigmentosa (AR) and hemifacial microsomia (AD)" "" "" "" "" "" "" "" "" "Mixed" "Syndromic retinitis pigmentosa" "" "0000278782" "04214" "00384998" "00000" "Familial, autosomal recessive" "4y" "nyctalopia, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: NA" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278784" "04214" "00385000" "00000" "Isolated (sporadic)" "8y" "nyctalopia, no nystagmus, no oculodigital sign, best corrected visual acuity right/left eye: 0.1/0.1" "4y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278791" "04214" "00385007" "00000" "Isolated (sporadic)" "7y" "nyctalopia, no nystagmus, best corrected visual acuity right/left eye: 0.2/0.2" "4y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278798" "04214" "00385014" "00000" "Isolated (sporadic)" "14y" "nyctalopia, no nystagmus, best corrected visual acuity right/left eye: 0.1/0.3" "5y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278800" "04214" "00385016" "00000" "Isolated (sporadic)" "7y" "nyctalopia, no nystagmus, best corrected visual acuity right/left eye: 0.08/0.2" "2y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278815" "04214" "00385031" "00000" "Isolated (sporadic)" "24y" "nyctalopia/photophobia, nystagmus, best corrected visual acuity right/left eye: 0.1/0.1" "5y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278857" "04214" "00385073" "00000" "Isolated (sporadic)" "3y" "no nyctalopia/photophobia, nystagmus, oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.3/0.3" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278879" "04214" "00385095" "00000" "Isolated (sporadic)" "30y" "nyctalopia, nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.03/0.05" "1m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000279060" "04214" "00385264" "00000" "Familial, autosomal recessive" "35y" "Typical bone-spicule pigmentation, vessels attenuation, pale and atrophic optic disk (43 y). Bilateral cataract, nystagmus" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279061" "04214" "00385265" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279062" "04214" "00385266" "00000" "Familial, autosomal recessive" "10y" "Typical bone-spicule pigmentation, vessels attenuation, pale and atrophic optic disk (33 y). Bilateral cataract" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279063" "04214" "00385267" "00000" "Familial, autosomal recessive" "14y" "Typical bone-spicule pigmentation in midperiphery and perivascular, vessels attenuation, pale and atrophic optic disk (36 y). Bilateral cataract" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279064" "04214" "00385268" "00000" "Familial, autosomal recessive" "9y" "Typical and mild bone-spicule pigmentation around the macula (33 y). Nystagmus" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279065" "04214" "00385269" "00000" "Familial, autosomal recessive" "7y" "Typical bone-spicule pigmentation in midperiphery, vessels attenuation, pale and atrophic optic disk (36 y). Exotrophia, nystagmus" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279066" "04214" "00385270" "00000" "Familial, autosomal recessive" "1y6m" "Typical bone-spicule pigmentation in midperiphery, normal vessels, slightly pale optic disk (5 y). Exotrophia" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279067" "04214" "00385271" "00000" "Familial, autosomal recessive" "3y" "Typical bone-spicule pigmentation in midperiphery and perivascular, normal vessels and optic disk (11 y). Exotrophia" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279068" "04214" "00385272" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Early onset retinal degeneration (EORD)" "" "0000279206" "04214" "00385410" "00000" "Familial, autosomal recessive" "37y" "37" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000279999" "04214" "00386196" "00000" "Familial, autosomal recessive" "13y" "" "" "2y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000280082" "04214" "00386279" "00000" "Familial, autosomal recessive" "45y" "" "" "3y" "" "" "" "" "" "" "early onset retinitis pigmentosa" "" "" "0000280083" "04214" "00386280" "00000" "Familial, autosomal recessive" "48y" "" "" "5y" "" "" "" "" "" "" "early onset retinitis pigmentosa" "" "" "0000280582" "04214" "00386782" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280614" "04214" "00386814" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000281225" "04214" "00387662" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281226" "04214" "00387663" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000282463" "04214" "00388922" "00000" "Familial, autosomal recessive" "54y" "age at genetic diagnosis mentioned" "" "47y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282464" "04214" "00388923" "00000" "Familial, autosomal recessive" "56y" "age at genetic diagnosis mentioned" "" "49y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282662" "04214" "00389121" "00000" "Familial, autosomal recessive" "29y" "age at genetic diagnosis mentioned" "" "26y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282666" "04214" "00389125" "00000" "Familial, autosomal recessive" "8y" "age at genetic diagnosis mentioned" "" "6y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282722" "04214" "00389181" "00000" "Familial, autosomal recessive" "11y" "age at genetic diagnosis mentioned" "" "11y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282954" "04214" "00389413" "00000" "Familial, autosomal recessive" "57y" "age at genetic diagnosis mentioned" "" "52y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283066" "04214" "00389525" "00000" "Familial, autosomal recessive" "19y" "age at genetic diagnosis mentioned" "" "16y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283177" "04214" "00389636" "00000" "Familial, autosomal recessive" "50y" "age at genetic diagnosis mentioned" "" "50y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283340" "04214" "00389799" "00000" "Isolated (sporadic)" "15y" "age at genetic diagnosis mentioned" "" "7y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283410" "04214" "00389869" "00000" "Isolated (sporadic)" "16y" "age at genetic diagnosis mentioned" "" "11y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283468" "04214" "00389927" "00000" "Isolated (sporadic)" "52y" "age at genetic diagnosis mentioned" "" "49y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283471" "04214" "00389930" "00000" "Isolated (sporadic)" "39y" "age at genetic diagnosis mentioned" "" "36y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283898" "04214" "00390360" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283899" "04214" "00390361" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284789" "04214" "00391349" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis 13 (612712)" "Leber congenital amaurosis 13 (612712)" "" "0000284997" "04214" "00391672" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800:20/800" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284998" "04214" "00391673" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400:20/100" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284999" "04214" "00391674" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400:20/400" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285000" "04214" "00391675" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/200;20/200" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285001" "04214" "00391676" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/200;20/200" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285002" "04214" "00391677" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20500:20125" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285003" "04214" "00391678" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285056" "04214" "00391731" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "4y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285057" "04214" "00391732" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/60;20/60" "2y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285058" "04214" "00391733" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "2y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285059" "04214" "00391734" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/320;20/400" "3y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285060" "04214" "00391735" "00000" "Unknown" "" "" "<7y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285869" "04214" "00392622" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000286793" "04214" "00393587" "00000" "Isolated (sporadic)" "5y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286838" "04214" "00393632" "00000" "Isolated (sporadic)" "27y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000286849" "04214" "00393643" "00000" "Isolated (sporadic)" "14y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286879" "04214" "00393673" "00000" "Isolated (sporadic)" "5y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286908" "04214" "00393702" "00000" "Isolated (sporadic)" "12y" "" "" "" "" "" "" "" "" "" "" "Stargardt Disease (STGD)" "" "0000286941" "04214" "00393735" "00000" "Isolated (sporadic)" "9y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286962" "04214" "00393756" "00000" "Isolated (sporadic)" "17y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286986" "04214" "00393780" "00000" "Isolated (sporadic)" "35y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000287008" "04214" "00393802" "00000" "Isolated (sporadic)" "12y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287708" "04214" "00394505" "00000" "Familial, autosomal dominant" "26y" "" "10y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287827" "04214" "00394624" "00000" "Familial, autosomal recessive" "60y" "" "11y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000288620" "04214" "00395421" "00000" "Familial, autosomal recessive" "27y" "Night blindness, central vision impairment, best corrected visual acuity 0.1/0.1" "<1y" "" "" "" "" "" "" "" "retinitis pigmentosa with macular coloboma" "" "" "0000288777" "04214" "00395579" "00000" "Familial, autosomal recessive" "" "early onset rod-cone dystrophy, exotropia, dyschromatopsia, nystagmus, obesity (phenotypic finding probably explained by a non-genetic cause)" "" "" "" "" "" "" "" "" "Early onset retinitis pigmentosa, cataract, obesity" "" "" "0000288788" "04214" "00395590" "00000" "Familial, autosomal recessive" "" "astigmatism, congenital blindness, macular atrophy, obesity, preaxial foot polydactyly" "" "" "" "" "" "" "" "" "Leber congenital amaurosis, obesity, preaxial polydactyly" "" "" "0000288972" "04214" "00395810" "00000" "Unknown" "15y10m" "" "3y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000289004" "04214" "00395842" "00000" "Unknown" "35y2m" "" "30y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000289005" "04214" "00395843" "00000" "Unknown" "41y5m" "" "9y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000296702" "04214" "00404113" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000299858" "04214" "00407711" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299859" "04214" "00407712" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299860" "04214" "00407713" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299861" "04214" "00407714" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299862" "04214" "00407715" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299863" "04214" "00407716" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299864" "04214" "00407717" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299865" "04214" "00407718" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299866" "04214" "00407719" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299867" "04214" "00407720" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299868" "04214" "00407721" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299869" "04214" "00407722" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299870" "04214" "00407723" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299871" "04214" "00407724" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299872" "04214" "00407725" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299873" "04214" "00407726" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "4y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299874" "04214" "00407727" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299875" "04214" "00407728" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: pronounced attenuation of retinal arterioles and intraretinal bone spicule pigmentation; electroretinogram: extinguished at the time of the first investigation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299876" "04214" "00407729" "00000" "Familial, autosomal recessive" "" "retinal dystrophy affecting both rods and cones with onset of symptoms in early childhood (2-4 y) and progression to legal blindness in early adulthood (18-25 y); fundus: widespread atrophy of the retinal pigment epithelium, pronounced pigment deposits in the periphery, rarely seen in young individuals with retinal dystrophy with mutations in genes encoding other visual cycle components" "" "5y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299880" "04214" "00407747" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299881" "04214" "00407748" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299882" "04214" "00407749" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299883" "04214" "00407750" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299884" "04214" "00407751" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299885" "04214" "00407752" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299886" "04214" "00407753" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299887" "04214" "00407754" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299888" "04214" "00407755" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299889" "04214" "00407756" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299890" "04214" "00407757" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299891" "04214" "00407758" "00000" "Familial, autosomal recessive" "" "congenital severe and progressive rod-cone dystrophy form of the disease" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299904" "04214" "00407774" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299905" "04214" "00407775" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299906" "04214" "00407776" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299907" "04214" "00407777" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299908" "04214" "00407778" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299909" "04214" "00407779" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299910" "04214" "00407780" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299911" "04214" "00407781" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299912" "04214" "00407782" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299913" "04214" "00407783" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299914" "04214" "00407784" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299915" "04214" "00407785" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299916" "04214" "00407786" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299917" "04214" "00407787" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299918" "04214" "00407788" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299919" "04214" "00407789" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299920" "04214" "00407790" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299921" "04214" "00407791" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299922" "04214" "00407792" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299923" "04214" "00407793" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299924" "04214" "00407794" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299925" "04214" "00407795" "00000" "Familial, autosomal recessive" "" "" "" "" "" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299926" "04214" "00407796" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299927" "04214" "00407797" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299928" "04214" "00407798" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299933" "04214" "00407803" "00000" "Familial, autosomal recessive" "31y" "night blindness, field constriction (early childhood), visual acuity 30/100 (8 y), progressive loss of visual acuity; best corrected visual acuity right, left eye: 1/50, 1/50, refractive error: emmetropic, visual field right // left eye: residual temporal field at 50–60deg, no central field (III/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: subcapsular cataract (bilateral), optic nerve atrophy, central areolar retinal pigment epithelium and choroidal atrophy; circular bone-spicule hyperpigmentation in the midperiphe" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299934" "04214" "00407804" "00000" "Familial, autosomal recessive" "32y" "night blindness, loss of visual acuity (3 y), color vision deficiency and loss of contrast sensitivity (27 y); best corrected visual acuity right, left eye: light perception, hand movements, refractive error right, left eye: 0, +0.75, visual field right // left eye: concentric constriction to 5deg (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: right eye: pseudophakic; left eye subcapsular cataract, optic nerve atrophy, central; circular bone spicule hyperpigmentation in the midperiphery" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299935" "04214" "00407805" "00000" "Familial, autosomal recessive" "27y" "night blindness, field constriction (early childhood), visual acuity 40/100 (12 y), progressive loss of visual acuity and color vision deficiency; best corrected visual acuity right, left eye: light perception, hand movements, refractive error: emmetropic, visual field right // left eye: concentric constriction to 5deg (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: subcapsular cataract (bilateral), optic nerve atrophy, central areolar retinal pigment epithelium and choroidal atrophy; circular dense bone spicule hyperpigmentation in the midperiphery" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299936" "04214" "00407806" "00000" "Familial, autosomal recessive" "49y" "field constriction, loss of visual acuity (early childhood); night blindness (18 y); photophobia (35 y); best corrected visual acuity right, left eye: hand movements, hand movements, refractive error: emmetropic, visual field right // left eye: single spots (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: subcapsular cataract (bilateral), optic nerve atrophy, vessel attenuation, macular retinal pigment epithelium atrophy, peripheral retinal pigment epithelium atrophy, and hyperpigmentation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299937" "04214" "00407807" "00000" "Familial, autosomal recessive" "44y" "night blindness (20 y), field constriction (25 y), photophobia (30 y); best corrected visual acuity right, left eye: 10/200, 10/200, refractive error right, left eye: +1.0, +0.5, visual field right // left eye: concentric constriction to 3deg (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: pseudophakic (bilateral), optic nerve atrophy, vessel attenuation, macular retinal pigment epithelium atrophy, peripheral retinal pigment epithelium atrophy, and hyperpigmentation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299938" "04214" "00407808" "00000" "Familial, autosomal recessive" "69y" "progressive field constriction, night blindness, impairment of visual acuity (early childhood); visual acuity still “sufficient” at age 20 y; best corrected visual acuity right, left eye: hand movements, light perception, refractive error right, left eye: -3.0, -2.25, visual field right // left eye: right eye concentric constriction to 1deg (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: posterior subcapsular cataract (bilateral), optic nerve atrophy, vessel attenuation, macular retinal pigment epithelium atrophy, peripheral retinal pigment epithelium atrophy, and hyperpigmenta" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299939" "04214" "00407809" "00000" "Familial, autosomal recessive" "7y" "field constriction, night vision problems; loss of visual acuity (4 y); no nystagmus; best corrected visual acuity right, left eye: 20/100, 10/100, refractive error right, left eye: +0.5, +0.75, visual field right // left eye: concentric constriction to 20–30deg // 40deg (V/4e), electroretinogram: residual scotopic and Pho 30Hz flicker responses (reduced amp, increased IT), pathological OPs, mfERG: foveal response more affected than peripheral, (reduced amp, increased IT), anterior segment and fundus: slight subcapsular cataract (bilateral), partial optic nerve atrophy, vessel attenuation, increased macular retinal pigment epithelium granularity, peripheral retinal pigment epithelium atrophy, and mild hyperpigmentati" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299940" "04214" "00407810" "00000" "Familial, autosomal recessive" "20y" "night blindness; visual-field constriction; impairment of visual acuity (starting age 4 y): 20/100 // 10/100 (6 y) 10/200 // 10/200 (10 y); best corrected visual acuity right, left eye: light perception, 10/200, refractive error right, left eye: +5.0, +6.0, visual field right // left eye: constriction to 5deg small temporal rest (V/4e), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: posterior subcapsular cataract (bilateral), right eye: coats-like vasoproliferation, midperipheral bone spicule hyperpigmentation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299941" "04214" "00407811" "00000" "Familial, autosomal recessive" "33y" "loss of visual acuity (early childhood), diagnosis LCA (2 y), night blindness; visual acuity: 10/200 // 10/200 (23 y); best corrected visual acuity right, left eye: light perception, hand movements, refractive error right, left eye: +3.0, +3.0, visual field right // left eye: not possible , electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: slight posterior subcapsular cataract (bilateral), pale optic nerve, severely narrowed retinal vessels, choroidal atrophy with diffuse retinal pigment epithelium defects, and peripheral bone spicule hyperpigmentation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299942" "04214" "00407812" "00000" "Familial, autosomal recessive" "20y" "night blindness (early childhood); slowly progressive impairment of visual acuity and field constriction (17 y); best corrected visual acuity right, left eye: 10/200, 10/100, refractive error right, left eye: -1.25, +0.5, visual field right // left eye: concentric constriction to 5deg (III/4e), temporal field of 20deg, electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: slight subcapsular cataract (bilateral), slight narrowing of vessels, macular scars with retinal pigment epithelium and choroidal atrophy, and peripheral retinal pigment epithelium atrophy with bone spicule hyperpigmentation" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299943" "04214" "00407813" "00000" "Familial, autosomal recessive" "33y" "night blindness (early childhood); slowly progressive visual acuity loss, progressive visual field constriction: visual acuity: 10/100 // 10/100 (22 y); best corrected visual acuity right, left eye: light perception, light perception, refractive error right, left eye: , visual field right // left eye: temporal field remnants (10–20deg diameter), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: slight subcapsular cataract (bilateral), right eye // left eye: optic nerve atrophy, peripheral retinal pigment epithelium atrophy with bone spicule hyperpigmentati" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299944" "04214" "00407814" "00000" "Familial, autosomal recessive" "33y" "night blindness, visual field constriction (14 y), reduced visual acuity, blurred vision (21 y); best corrected visual acuity right, left eye: hand movements, hand movements, refractive error right, left eye: , visual field right // left eye: V/4e: only minimal temporal field (5deg diameter), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: posterior subcapsular cataract (bilateral), optic disc pallor, severely narrowed retinal vessels, macula with choroidal and retinal pigment epithelium atrophy, peripheral retinal pigment epithelium atrophy with bone spicules" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299945" "04214" "00407815" "00000" "Familial, autosomal recessive" "4y" "night blindness, blurred vision; best corrected visual acuity right, left eye: 50/100, 50/100, refractive error right, left eye: +3.75, +4.75, visual field right // left eye: no data, electroretinogram: scotopic residual responses, photopic amp reduction to 70% of normal range, anterior segment and fundus: anterior segment: normal, normal optic disc, physiological macular reflexes, midperipheral retinal pigment epithelium atrophy with bone spicules" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299946" "04214" "00407816" "00000" "Familial, autosomal recessive" "14y" "night blindness, blurred vision, peripheral visual field defects (1 y), visual acuity: 10/100 // 10/100 (9 y); best corrected visual acuity right, left eye: 10/100, 10/100, refractive error right, left eye: +5.25, +6.75, visual field right // left eye: constriction to 5deg (V/4e), electroretinogram: scotopic / photopic: residual responses, anterior segment and fundus: anterior segment: normal, normal optic disc, physiological macular reflexes, midperipheral retinal pigment epithelium atrophy with bone spicules anterior segment: normal, normal optic disc, narrowing of retinal vessels; macular pigment mottling; midperipheral retinal pigment epithelium atrophy; bone spicules" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299947" "04214" "00407817" "00000" "Familial, autosomal recessive" "23y" "night blindness (6 y); nystagmus from birth; loss of visual acuity to 40/100 (6 y), peripheral field constriction(12 y); best corrected visual acuity right, left eye: 10/100, 10/100, refractive error right, left eye: +2.5, +1.5, visual field right // left eye: concentric constriction to 5–8deg (III/4e), anterior segment and fundus: no da" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299948" "04214" "00407818" "00000" "Familial, autosomal recessive" "30y" "diagnosis of RP (4 y), documented night blindness (4 y), progressive loss of visual acuity: 10/30 // 50/100 (5 y), 10/30 // 40/100 (16 y) ; best corrected visual acuity right, left eye: hand movements, 10/100, refractive error right, left eye: +2.75, +1.25, visual field right // left eye: concentric constriction to 5deg, (isopter not indicated), electroretinogram: scotopic and photopic: noise level, anterior segment and fundus: pseudophakic (bilateral), right eye // left eye salt-pepper fundus, optic disc pallor, narrowing of retinal vessels; macular retinal pigment epithelium atrophy, peripheral general retinal pigment epithelium atrophy, bone spicules" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299951" "04214" "00407821" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299952" "04214" "00407822" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299953" "04214" "00407823" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299954" "04214" "00407824" "00000" "Familial, autosomal recessive" "" "6y: best corrected visual acuity right/left eye: (VA) 1.0 / 1.3, refractive error: of +1.25 / +1.0; fundus: diffuse retinopathy with pigment clumping and bone spiculae pigmentation, cystoid macular edema and attenuated blood vessels with mild optic atrophy in both eyes; 15y: vision stable; visual field: constricted to about 5deg in diameter in both eyes with a thin peripheral almost circumferential island in his right eye; electroretinogram: not recordable above noise for all tested stimuli at 15y; VA improved slightly to 0.7logMAR using both eyes, under oral treatment with carbonic anhydrase inhibitor for the management of his macular edema, lost the remaining peripheral field; 19y: horizontal and vertical nystagmus; 21y: stable, fundus: atrophic macular changes, optic atrophy and bone spiculae pigmentation in both eyes" "" "2y" "abnormal night vision and restricted side vision" "" "" "" "" "" "Leber congenital amaurosis/early-onset severe retinal dystrophy" "" "" "0000299955" "04214" "00407825" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299956" "04214" "00407826" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299957" "04214" "00407827" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299958" "04214" "00407828" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299959" "04214" "00407829" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299960" "04214" "00407830" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000299961" "04214" "00407831" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299962" "04214" "00407832" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299963" "04214" "00407833" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299964" "04214" "00407834" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299965" "04214" "00407835" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299966" "04214" "00407836" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299967" "04214" "00407837" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299968" "04214" "00407838" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299969" "04214" "00407839" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299970" "04214" "00407840" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299971" "04214" "00407841" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299972" "04214" "00407842" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299973" "04214" "00407843" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299974" "04214" "00407844" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299975" "04214" "00407845" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299976" "04214" "00407846" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299977" "04214" "00407847" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299978" "04214" "00407848" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299979" "04214" "00407849" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299980" "04214" "00407850" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299981" "04214" "00407851" "00000" "Familial, autosomal recessive" "" "nyctalopia and restricted visual field since childhood; was able to read printed text at a younger age. Visual acuity and color perception had significantly deteriorated from 25y; 30y: cataract surgery both eyes, VA: hand motion in both eyes; fundus: macular pseudo-coloboma with dense pigmentation, optic atrophy, arteriole and venous attenuation and peripheral granular pigmentation in the both eyes; horizontal spectral domain optical coherence tomography through the fovea: thinned retina with re-organization of the retinal lamination; structures of photoreceptors not identifiable; epiretinal membrane with moderate traction is visible in the scan through the left foveal region" "" "5y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000299982" "04214" "00407852" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299983" "04214" "00407853" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299984" "04214" "00407854" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299985" "04214" "00407855" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299986" "04214" "00407856" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299987" "04214" "00407857" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299988" "04214" "00407858" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299989" "04214" "00407859" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299990" "04214" "00407860" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299991" "04214" "00407861" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299992" "04214" "00407862" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299993" "04214" "00407863" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299994" "04214" "00407864" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299995" "04214" "00407865" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299996" "04214" "00407866" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299997" "04214" "00407867" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299998" "04214" "00407868" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000299999" "04214" "00407869" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300000" "04214" "00407870" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300006" "04214" "00407876" "00000" "Familial, autosomal dominant" "20y" "visual field: <10deg central, best corrected visual acuity right/left eye: 0.08 / 0.2, fundus: pigment mobilization, macular affectation, atrophy of the optic nerve and blood vessels, electroretinogram: abolished, other symptoms: nystagmus (5y)" "1y6m" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300007" "04214" "00407877" "00000" "Familial, autosomal dominant" "12y" "visual field: <10deg central, best corrected visual acuity right/left eye: both eyes <0.1, fundus: pale discs, arteriolar constriction, retinal pigment epithelium abnormalities, alternating areas of atrophy with bone spicule hyperpigmentation in equatorial area; salt and pepper fundus, electroretinogram: extinguished in both eyes, other symptoms: hypoacusia" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300008" "04214" "00407878" "00000" "Familial, autosomal dominant" "30y" "visual field: absolute scotomas in both eyes, best corrected visual acuity right/left eye: both eyes <0.1, refraction: both eyes +2 at 120deg, fundus: pale papilla, bone spicule pigmentation in middle periphery, narrow vessels, severe macular atrophy, electroretinogram: extinguished in both eyes, other symptoms: cataracts" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300009" "04214" "00407879" "00000" "Familial, autosomal dominant" "5y" "best corrected visual acuity right/left eye: counting fingers, fundus: hyperpigmentation of the retina, electroretinogram: extinguished in both eyes, other symptoms: nystagmus" "0m" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300010" "04214" "00407880" "00000" "Familial, autosomal dominant" "54y" "visual field: 10deg central scotomas, best corrected visual acuity right/left eye: light perception both eyes, fundus: pale discs, arteriolar constriction, dense bone spicule hyperpigmentation in all the retina, electroretinogram: extinguished in both eyes" "7y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300011" "04214" "00407881" "00000" "Familial, autosomal dominant" "39y" "visual field: scotomas absolute both eyes, best corrected visual acuity right/left eye: light perception / hand movements, fundus: pale papilla, bone spicule pigmentation, macular atrophy, electroretinogram: extinguished, other symptoms: cataracts" "6y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300012" "04214" "00407882" "00000" "Familial, autosomal dominant" "52y" "visual field: scotomas absolute both eyes, best corrected visual acuity right/left eye: hand movements, fundus: typical retinitis pigmentosa, electroretinogram: extinguished" "2y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300013" "04214" "00407883" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity right/left eye: 0.1 / 0.8, fundus: pigment mobilization, pale optic disc, filiform vessels, tapetal reflection, electroretinogram: extinguished, other symptoms: photophobia" "11y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300014" "04214" "00407884" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity right/left eye: 0.15 / 0.10, fundus: typical retinitis pigmentosa, electroretinogram: abolished (4 y)" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300015" "04214" "00407885" "00000" "Familial, autosomal dominant" "21y" "best corrected visual acuity right/left eye: both eyes 0.3, fundus: pale papilla, mild vessel constriction, pigmentation in periphery and posterior pole, electroretinogram: not performed" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300029" "04214" "00407899" "00000" "Familial, autosomal recessive" "7y" "best corrected visual acuity right, left eye: 20/125, 20/ 160; refraction: 11.00 D both eyes; fine horizontal pendular nystagmus; intraocular pressure: 15 mm Hg both eyes; fundoscopy: diffuse retinal pigment epithelium dystrophy with bone spicule pigmentation, macular atrophy, attenuated retinal vessels, and a pale optic disk in both eyes; photopic and scotopic electroretinogram responses: nondetectable in both eyes; visual field: severely constricted in both eyes" "<1y" "" "early visual impairment" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300031" "04214" "00407901" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300032" "04214" "00407902" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300035" "04214" "00407905" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300036" "04214" "00407906" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300037" "04214" "00407907" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300038" "04214" "00407908" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300039" "04214" "00407909" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300040" "04214" "00407910" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300041" "04214" "00407911" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300042" "04214" "00407912" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300043" "04214" "00407913" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300044" "04214" "00407914" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300045" "04214" "00407915" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300046" "04214" "00407916" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300047" "04214" "00407917" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300048" "04214" "00407918" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300049" "04214" "00407919" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300050" "04214" "00407920" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300051" "04214" "00407921" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300052" "04214" "00407922" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300053" "04214" "00407923" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300054" "04214" "00407924" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300055" "04214" "00407925" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300056" "04214" "00407926" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300057" "04214" "00407927" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300058" "04214" "00407928" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300059" "04214" "00407929" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300060" "04214" "00407930" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300061" "04214" "00407931" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300062" "04214" "00407932" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300063" "04214" "00407933" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "" "0000300064" "04214" "00407934" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300065" "04214" "00407935" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300066" "04214" "00407936" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300067" "04214" "00407937" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300068" "04214" "00407938" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300069" "04214" "00407939" "00000" "Familial, autosomal recessive" "31y" "at the initial visit best corrected visual acuity: 0.6 with +1.25 diopter sphere (DS) and -0.75 D cylinder (DC) ax 160deg in the right eye and 0.6 with +0.5 DS and -0.25 DC ax 20deg in the left eye; visual field: severely constricted; ophthalmoscopy: diffuse retinal degeneration with macular degeneration; fundus: reticulated before the age 10 years; 9y: single-bright flash full-field electroretinograms: non-recordable, flicker ERGs: barely recordable; vision markedly decreased in middle teens resulting in hand motion vision at age 17 years; macular degeneration -atrophic and a posterior staphyloma present in both eyes; 23y: posterior subcapsular cataract 23-year old. She is now 31-year old, and her vision is light perception in both eyes (Fig. 2).; 30-31y: optical coherence tomography and ultrasonography: deep excavation and a thinning of the retina at the posterior pole of both eyes; axial length right/left eye: 22.72 +/- 0.05 / 21.20 +/- 0.09" "3y" "4y" "difficulty in the dark" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300070" "04214" "00407940" "00000" "Familial, autosomal recessive" "22y" "6y: best corrected visual acuity right/left eye: 0.07 / 0.4, refraction uncorrectable / 0 DS and -1.5 DC ax 160 deg; ophthalmoscopy: diffuse retinal degeneration especially severe in the macula; fundi reticulated before the age 10 years; macular degeneration gradually spread, a posterior staphyloma developed and progressed in both eyes; central vision decreased to hand motion in late teens 22y: peripheral vision but no cataracts in both eyes; full-field electroretinograms, optical coherence tomography: non-recordable single-bright flash electroretinograms, barely recordable flicker electroretinograms, and deep excavation and thin retina at the posterior pole of both eyes; axial length right/left eye: 23.82 +/- 0.05 mm / 24.06 +/- 0.02 mm" "5y" "6y" "visual difficulties" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300071" "04214" "00407941" "00000" "Familial, autosomal recessive" "13y" "3y best corrected visual acuity and refraction right/left eye: 0.07 with +6.0 DS and -1.0 DC ax 115deg / 0.07 with +5.5 DS and -1.5 DC ax 175 deg; ophthalmoscopy: diffuse retinal degeneration with pigmentation in the macular area; fundi reticulated before the age 10 years; 13y: vision gradually decreased to light perception in both eyes; 11y: single-bright flash full-field electroretinograms: nonrecordable, flicker electroretinograms: barely recordable; optical coherence tomography and ultrasonography (11y, 13y): excavation of the posterior pole of both eyes; 13y axial length right/left eye: 20.92 +/- 0.37 mm / 21.22 +/- 0.93 mm" "" "3y" "esotropia and nystagmus" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300072" "04214" "00407942" "00000" "Familial, autosomal recessive" "" "fundus: peripheral pigmentation and retinal vascular attenuation; electroretinogram: no recordable response under either scotopic or photopic condition, indicating significant loss of the function of both rods and cones; best corrected visual acuity right, left eye: 20/400,20/400" "" "" "early-onset and markedly decreased visual acuity" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300073" "04214" "00407943" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 20/400,20/400" "" "" "early-onset and markedly decreased visual acuity" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300074" "04214" "00407944" "00000" "Familial, autosomal recessive" "5y" "best corrected visual acuity: light perception both eyes, globes sunken, with approximately 30delta exotropia and approximately 20 delta bilateral hypotropia by Krimsky testing; child could not elevate his eyes voluntarily; no true ptosis; horizontal ductions and infraduction: full; cycloplegic refraction right/left eye: +3.50 -1.00 x 045 / +3.50 -2.00 x150; fundus: attenuated arterioles, diffuse retinal pigment epithelium atrophy with fine stippling and a reticulated appearance, relative peripapillary sparing, peripheral intraretinal pigment migration, and central macular atrophy; electroretinogram: nonrecordable." "5m" "5y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300075" "04214" "00407945" "00000" "Familial, autosomal recessive" "7y" "2y: electroretinogram: nonrecordable, cycloplegic refraction: +3.25 in both eyes, dystrophic retina; 7y: best corrected visual acuity: 20/100; cycloplegic refraction: +6.50 -1.00 x 180, +7.00), exotropia of approximately 20delta; no voluntary eyelid elevation could be elicited, forced incomplete elevation (Bell phenomenon) in both eyes; other ductions full, no ptosis; fundus: dystrophic changes" "0m" "" "poor vision since soon after birth" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300076" "04214" "00407946" "00000" "Familial, autosomal recessive" "3y" "vision central, steady, unmaintained in both eyes, pendular nystagmus; exotropia of approximately 40 delta, bilateral mild-to-moderate ptosis with approximately 20 delta of hypotropia, inability to elevate both eyes; Bell phenomenon not present in either eye; horizontal ductions and infraduction: full; fundus: retinal dystrophic changes; cycloplegic refraction right/left eye: +5.25 -1.00 x 180 / +5.75 1.00 x 180" "0m" "" "poor vision since soon after birth" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300077" "04214" "00407947" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity: hand motion with poor fixation; exotropia of approximately 20 delta, slight bilateral hypotropia, and inability to elevate either eye, including no Bell phenomenon; ductions otherwise full, no ptosis; fundus: retinal dystrophic changes; cycloplegic refraction both eyes: +0.75" "" "" "poor vision since soon after birth" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300078" "04214" "00407948" "00000" "Familial, autosomal recessive" "2y" "best corrected visual acuity right, left eye: F/F, F/F, refraction right/left eye: +4.63 / +4, maculae: normal, electroretinography: not performed, foveal thickness (um) right/left eye: 96 / 85" "" "2y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300079" "04214" "00407949" "00000" "Familial, autosomal recessive" "4y" "best corrected visual acuity right, left eye: 20/125, 20/125, refraction right/left eye: +1.5 / +1.5, maculae: well-delimited chorioretinal atrophy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 10 / 10, foveal thickness (um) right/left eye: 100 / 154" "" "3y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300080" "04214" "00407950" "00000" "Familial, autosomal recessive" "6y" "best corrected visual acuity right, left eye: 20/200, 20/200, refraction right/left eye: +1.38 / +1.38, maculae: maculopathy, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 4 / 5, foveal thickness (um) right/left eye: 114 / 96" "" "0m" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300081" "04214" "00407951" "00000" "Familial, autosomal recessive" "6y" "best corrected visual acuity right, left eye: 20/200, 20/125, refraction right/left eye: +3.75 / +2.5, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 5 / 7, foveal thickness (um) right/left eye: 85 / 77" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300082" "04214" "00407952" "00000" "Familial, autosomal recessive" "7y" "best corrected visual acuity right, left eye: 20/250, 20/50, refraction right/left eye: +4.5 / +4, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target); +T denotes small temporal island of vision separated from the central residual island) right/left eye: 10+T / 5+T, foveal thickness (um) right/left eye: 85 / 100" "" "3y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300083" "04214" "00407953" "00000" "Familial, autosomal recessive" "7y" "best corrected visual acuity right, left eye: 20/125, 20/70, refraction right/left eye: +0.5 / +1.25, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 8 / 8, foveal thickness (um) right/left eye: 104 / 131" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300084" "04214" "00407954" "00000" "Familial, autosomal recessive" "8y" "best corrected visual acuity right, left eye: 20/200, 20/400, refraction right/left eye: +4.63 / +5.25, maculae: maculopathy, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 8 / 5, foveal thickness (um) right/left eye: 94 / 94" "" "2m" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300085" "04214" "00407955" "00000" "Familial, autosomal recessive" "8y" "best corrected visual acuity right, left eye: 20/80, 20/50, refraction right/left eye: +1.5 / +1.5, maculae: maculopathy, electroretinography: severely reduced amplitudes, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 8 / 8, foveal thickness (um) right/left eye: 84 / 97" "" "4y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300086" "04214" "00407956" "00000" "Familial, autosomal recessive" "9y" "best corrected visual acuity right, left eye: 20/400, 20/400, refraction right/left eye: +1.87 / +2, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 9 / 5, foveal thickness (um) right/left eye: 129 / 157" "" "6y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300087" "04214" "00407957" "00000" "Familial, autosomal recessive" "9y" "best corrected visual acuity right, left eye: 20/300, 20/400, refraction right/left eye: +4.5 / +5.25, maculae: bilateral pseudocoloboma, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target); +T denotes small temporal island of vision separated from the central residual island) right/left eye: 3+T / 5+T, foveal thickness (um) right/left eye: 96 / 83" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300088" "04214" "00407958" "00000" "Familial, autosomal recessive" "10y" "best corrected visual acuity right, left eye: 20/70, 20/60, refraction right/left eye: +2.5 / +3.25, maculae: maculopathy, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 10 / 3, foveal thickness (um) right/left eye: 90 / 96" "" "2y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300089" "04214" "00407959" "00000" "Familial, autosomal recessive" "10y" "best corrected visual acuity right, left eye: 20/100, 20/60, refraction right/left eye: +2.25 / +3.25, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 10 / 10, foveal thickness (um) right/left eye: 108 / 112" "" "2y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300090" "04214" "00407960" "00000" "Familial, autosomal recessive" "11y" "best corrected visual acuity right, left eye: 20/60, 20/125, refraction right/left eye: +2.25 / +3.25, maculae: bilateral pseudocoloboma, electroretinography: severely reduced amplitudes, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 2 / 2, foveal thickness (um) right/left eye: 76 / 34" "" "0m" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300091" "04214" "00407961" "00000" "Familial, autosomal recessive" "11y" "best corrected visual acuity right, left eye: 20/60, 20/40, refraction right/left eye: +2.5 / +1.5, maculae: maculopathy, electroretinography: severely reduced amplitudes, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 6 / 7, foveal thickness (um) right/left eye: 77 / 111" "" "3y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300092" "04214" "00407962" "00000" "Familial, autosomal recessive" "11y" "best corrected visual acuity right, left eye: 20/70, 20/100, refraction right/left eye: +3.37 / +3.25, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target); +T denotes small temporal island of vision separated from the central residual island) right/left eye: 7+T / 3+T, foveal thickness (um) right/left eye: 80 / 78" "" "0m" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300093" "04214" "00407963" "00000" "Familial, autosomal recessive" "11y" "best corrected visual acuity right, left eye: 20/125, 20/125, refraction right/left eye: +3 / +3.5, maculae: maculopathy, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 8 / 9, foveal thickness (um) right/left eye: 130 / 133" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300094" "04214" "00407964" "00000" "Familial, autosomal recessive" "11y" "best corrected visual acuity right, left eye: 20/250, 20/125, refraction right/left eye: +1.87 / +1.25, maculae: maculopathy, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 4 / 3, foveal thickness (um) right/left eye: 87 / 57" "" "2y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300095" "04214" "00407965" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity right, left eye: 20/400, 20/400, refraction right/left eye: +3.37 / +4.75, maculae: maculopathy, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 5 / 9, foveal thickness (um) right/left eye: 83 / 84" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300096" "04214" "00407966" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity right, left eye: 20/60, 20/300, refraction right/left eye: +2.37 / +2.87, maculae: bilateral pseudocoloboma, electroretinography: nondetectable, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target); +T denotes small temporal island of vision separated from the central residual island) right/left eye: 9+T / 2+T, foveal thickness (um) right/left eye: 125 / 91" "" "1y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300097" "04214" "00407967" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity right, left eye: 20/100, 20/300, refraction right/left eye: +4.87 / +3.75, maculae: maculopathy, electroretinography: not available, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 10 / 10, foveal thickness (um) right/left eye: 112 / 85" "" "3y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300098" "04214" "00407968" "00000" "Familial, autosomal recessive" "17y" "best corrected visual acuity right, left eye: LP, 20/800, refraction right/left eye: -5.12 / -2.62, maculae: bilateral pseudocoloboma, electroretinography: not performed, kinetic perimetry (extent in eccentricity to the largest extent of the central isopter (Goldmann V-4e target) right/left eye: 2 / 2, foveal thickness (um) right/left eye: 12 / 37" "" "3y" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300101" "04214" "00407971" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; 20/1000 (16y), visual field: V4e SN island 10x20deg right eye; central 15deg island and larger IT island with V4e left eye (16y), electroretinography: nonrecordable (3y)" "7m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300102" "04214" "00407972" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: counting fingers; hand movements (13y), visual field: 2�� IV4e both eyes (13y), electroretinography: Cones <10%, rods <20% both eyes" "4y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300103" "04214" "00407973" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/125; 20/70 (15y), visual field: Severe constriction, V4e 20deg, III4e 8deg, I4e 5deg right eye; V4e 20deg, III4e 7deg, I4e 4deg left eye (9y), electroretinography: Severely reduced rods and cones (5y)" "5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300104" "04214" "00407974" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; hand movements (30y), visual field: 1deg IV4e center right eye, small peripheral island both eyes (30y), electroretinography: Cones nonrecordable, rods 25% both eyes (7y)" "<5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300105" "04214" "00407975" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; counting fingers (27y), visual field: not done, electroretinography: not done" "1y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300106" "04214" "00407976" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (43y), visual field: not done, electroretinography: Severe rod and cone dysfunction (13y)" "4y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300107" "04214" "00407977" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (24y), visual field: not done, electroretinography: not done" "10y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300108" "04214" "00407978" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/400; light perception (19y), visual field: Nasal and temporal islands with V4e and III4e right eye and temporal only left eye (16y), electroretinography: not done" "<5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300109" "04214" "00407979" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/160; 20/160 (5y), visual field: not done, electroretinography: nonrecordable (4y)" "0m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300110" "04214" "00407980" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/80; 20/80 (3y), visual field: not done, electroretinography: not done" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300111" "04214" "00407981" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; 20/125 (9y), visual field: V4e small paracentral islands and IT island right eye; III4e 10deg central and IT island left eye (9y), electroretinography: nonrecordable (3y)" "6m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300112" "04214" "00407982" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/400; 20/400 (4y), visual field: not done, electroretinography: not done" "1y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300113" "04214" "00407983" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/250; 20/350 (12y), visual field: 10deg both eyes (7y), electroretinography: not done" "1y6m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300114" "04214" "00407984" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/70; 20/50 (9y), visual field: not done, electroretinography: not done" "2y6m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300115" "04214" "00407985" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/50; 20/50 (10y), visual field: V4e 130deg, I4e 57deg right eye; V4e 130deg, I4e 62deg left eye (10y), electroretinography: Rods at 36- 37% and cones at 13- 15% of normal both eyes (8y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300116" "04214" "00407986" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/70; 20/60 (7y), visual field: V4e 138deg, I4e 92deg right eye; V4e 130deg, I4e 55deg left eye (7y), electroretinography: Rods at 26- 28% and cones at 13- 16% of normal both eyes (6y)" "4y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300117" "04214" "00407987" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/60; 20/100 (6y), visual field: not done, electroretinography: nonrecordable (3y)" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300118" "04214" "00407988" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/250; 20/400 (7y), visual field: V4e 120deg, I4e 6deg right eye; V4e 98deg, I4e 6deg left eye (7y), electroretinography: Rods not done; cones <10% of normal (7y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300119" "04214" "00407989" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: not done, visual field: not done, electroretinography: Rods not done; cones barely detectable(3y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300120" "04214" "00407990" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/40; 20/40 (8y), visual field: not done, electroretinography: Rods moderately reduced, cones barely detectable both eyes(6y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300121" "04214" "00407991" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/60; 20/200 (2y), visual field: not done, electroretinography: Generalized rod and cone dysfunction (2y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300122" "04214" "00407992" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/50; 20/60 (23y), visual field: Large ring scotoma with V4e both eyes, with central 8deg right eye and 26deg left eye spared (26y), electroretinography: not done" "1y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300123" "04214" "00407993" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/200; 20/125 (8y), visual field: not done, electroretinography: Severe rod and cone dysfunction both eyes (6y)" "6y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300124" "04214" "00407994" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/125; 20/125 (70y), visual field: III4e 132deg, I4e 57deg right eye; III4e 130deg, I4e 70deg left eye, electroretinography: Moderate rod and cone dysfunction both eyes (61y)" "11y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300125" "04214" "00407995" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/50; 20/60 (8y), visual field: <5 degrees both eyes, electroretinography: not done" "1y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300126" "04214" "00407996" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (14y), visual field: Constricted both eyes, electroretinography: nonrecordable (12y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300127" "04214" "00407997" "00000" "Familial, autosomal recessive" "" "electroretinography: severe rod and cone dysfunction both eyes (3y)" "" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300128" "04214" "00407998" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (35y), visual field: not done, electroretinography: nonrecordable (25y)" "7y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300129" "04214" "00407999" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (51y), visual field: not done, electroretinography: not done" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300130" "04214" "00408000" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (58y), visual field: not done, electroretinography: not done" "<5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300131" "04214" "00408001" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (29y), visual field: not done, electroretinography: not done" "1y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300132" "04214" "00408002" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: counting fingers; counting fingers (46y), visual field: not done, electroretinography: not done" "5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300133" "04214" "00408003" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/120; 20/120 (21y), visual field: not done, electroretinography: Severe rod and cone dysfunction (7y)" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300134" "04214" "00408004" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (49y), visual field: III4e 5deg both eyes, electroretinography: not done" "" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300135" "04214" "00408005" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (46y), visual field: not done, electroretinography: not done" "11y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300136" "04214" "00408006" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/200; 20/80 (45y), visual field: Ring scotoma right eye; left eye not done, electroretinography: not done" "11y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300137" "04214" "00408007" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: counting fingers; counting fingers (48y), visual field: Central scotoma and severe constriction both eyes (34y), electroretinography: nonrecordable (22y)" "10y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300138" "04214" "00408008" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (43y), visual field: not done, electroretinography: not done" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300139" "04214" "00408009" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: no light perception; light perception (29y), visual field: not done, electroretinography: not done" "5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300140" "04214" "00408010" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/250; hand movements (34y), visual field: not done, electroretinography: not done" "5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300141" "04214" "00408011" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/250; 20/400 (12y), visual field: not done, electroretinography: not done" "3m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300142" "04214" "00408012" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (25y), visual field: Severely constricted both eyes (30y), electroretinography: not done" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300143" "04214" "00408013" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/80; 20/60 (15y), visual field: 10-15deg both eyes (14y), electroretinography: not done" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300144" "04214" "00408014" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; hand movements (33y), visual field: Very constricted both eyes (19y), electroretinography: not done" "<18y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300145" "04214" "00408015" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/200; 20/200 (41y), visual field: <10deg both eyes (41y), electroretinography: nonrecordable (21y)" "<5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300146" "04214" "00408016" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/600; 20/200 (41y), visual field: Central and peripheral scotomas (24y), electroretinography: not done" "6y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300147" "04214" "00408017" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/40; 20/40 (5y), visual field: not done, electroretinography: nonrecordable (5y)" "2y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300148" "04214" "00408018" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/70; 20/70 (14y), visual field: not done, electroretinography: Rods not done; cones nonrecordable (5y)" "0m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300149" "04214" "00408019" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/120; 20/200 (27y), visual field: Constricted (19y), electroretinography: not done" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300150" "04214" "00408020" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (36y), visual field: Significant peripheral and central field defects (36y), electroretinography: not done" "4y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300151" "04214" "00408021" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/40; 20/60 (10y), visual field: Moderate central defects and severe peripheral defects, electroretinography: Isolated rods not done but bright flash nonrecordable, barely recordable cones (10y)" "4y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300152" "04214" "00408022" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (43y), visual field: not done, electroretinography: not done" "3y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300153" "04214" "00408023" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; hand movements (27y), visual field: Remaining inferotemporal islands with V4e (24y), electroretinography: not done" "<5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300154" "04214" "00408024" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: light perception; light perception (32y), visual field: not done, electroretinography: not done" "6m" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300155" "04214" "00408025" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/100; 20/100 (23y), visual field: both eyes: V4e large ring scotoma, total 70- 75deg, I4e and III4e with central 10deg and temporal ring islands (23y), electroretinography: Severely reduced rods and cones (cones slightly morey) both eyes (22y)" "8y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300156" "04214" "00408026" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: 20/50; 20/100 (34y), visual field: Dense central and nasal paracentral scotoma to I4e, III4e, and V4e with intact periphery both eyes (31y), electroretinography: Mildly reduced rods and cones both eyes (29y)" "22y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300157" "04214" "00408027" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right; left eye: hand movements; light perception (40y), visual field: not done, electroretinography: not done" "5y" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300158" "04214" "00408028" "00000" "Familial, autosomal recessive" "17y" "refraction at baseline right/left eye: +1.50 x -0.50 x 100 / + 3.00 x -1.50 x 55, best corrected visual acuity: 20/200; 17y: acute change in vision from baseline, described as seeing a black cloud with loss of central vision in the right eye; best corrected visual acuity: 20/400. spectral domain optical coherence tomography and fluorescein angiography: diagnosis of type 2-choroidal neovascularization; treatment with one intravitreal ranibizumab injection; two months later improved vision with visual acuity eturning to baseline at 20/200" "" "" "" "" "" "" "" "" "early onset retinal degeneration" "" "" "0000300160" "04214" "00408030" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 8y: right eye: 20/60; left eye: 20/ 60; 14y: right eye: 20/ 125; left eye: 20/100, Goldmann perimetry: 8y: 5deg central scotoma (I4e); 14y: 15deg central scotoma (I4e), fundus: 8 yr and 14 yr: ring of parafoveal atrophy, periphery normal14 yr: parafoveal ring of hypoautofluorescence with hyperautofluorescent rim; similar to age 10, optical coherence tomography: 14 yr: diffuse photoreceptor loss, parafoveal retinal pigment epithelium atrophy; similar to age 10, electroretinography: 8 yr: normal rod and cone responses" "6y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300161" "04214" "00408031" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 33 yr: right eye: 20/80; left eye: 20/ 80, Goldmann perimetry: central scotomas (5deg V4e; 15deg I2e and I4e), fundus: central macular atrophy; few patches of paravenous atrophycentral macular hypoautofluorescence with hyperautofluorescentrim; few small paravenous hyperautofluorescence rings, optical coherence tomography: bare foveal outer retinal structures with diffuse central photoreceptor and retinal pigment epithelium loss elsewhere in central macula, electroretinography: normal rod and cone responses" "17y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300162" "04214" "00408032" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 29 yr: both eyes: 20/160; 34y: right eye: 20/ 100; left eye: 20/150, Goldmann perimetry: not available, fundus: 29 yr: extensive macular atrophy with peripapillary sparing, peripheral atrophy including perivascular patchesnot available, optical coherence tomography: not available, electroretinography: not available" "<18y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300163" "04214" "00408033" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 13 yr: right eye: 20/ 100; left eye: 20/ 70, Goldmann perimetry: not available, fundus: atrophy in macula and posterior pole atrophy with peripapillary sparing, nummular peripheral atrophy, attenuated vesselsmacular hypoautofluorescence with peripapillary sparing; diffuse peripheral zones of scalloped hypoautofluorescence with hyperautofluorescent outline, optical coherence tomography: diffuse outer retinal loss with focal subfoveal ellipsoid zone and intact peripapillary outer retina, electroretinography: multifocal electroretinogram, right eye: diffuse flattening with small peak centrally" "8y" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000300164" "04214" "00408034" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 7 yr (sc): right eye 20/ 50; left eye 20/100; 11 yr: right eye: 20/ 60; left eye: 20/100, Goldmann perimetry: 10 yr: paracentral and mid- peripheral scotomas, fundus: 10 yr: atrophy in macula and posterior pole, peripapillary sparing, nummular peripheral atrophy, attenuated vessels10 yr: macular hypoautofluorescence with peripapillary sparing; peripheral hypoautofluorescence with hyperautofluorescent rim, perivascular hyperautofluorescence, optical coherence tomography: 10 yr: diffuse outer retinal loss centrally with intact peripapillary outer retina, electroretinography: 7 yr, right eye only: rod amplitude 35% of normal; 30 hz cone flicker 5" "3y" "" "" "" "" "" "" "" "early-onset severe retinal dystrophy" "" "" "0000300165" "04214" "00408035" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 26 yr: right eye: 20/100; left eye: 20/ 80; 48 yr : right eye: lp; left eye: lp, Goldmann perimetry: 26 yr: Generalized constriction (III4e 40deg, V4e 80deg), fundus: 26 yr: macular atrophy and hyperpigmentation, peripheral bone spicules, attenuated vessels48 yr: confluent hypoautofluorescence throughout macula and posterior pole; patchy hypoautofluorescence in periphery, optical coherence tomography: 48 yr: diffuse loss of photoreceptor and retinal pigment epithelium, electroretinography: 26 yr: rod response nd; 30 hz cone flicker 1" "6y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300166" "04214" "00408036" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 6 yr: right eye: 20/ 50; left eye: 20/ 50; 29 yr: right eye: 20/ 100; left eye: 20/ 200, Goldmann perimetry: 6 yr: midperipheral scotomas; 29 yr: severe constriction (V4e < 10deg; peripheral island), fundus: 6 yr: macular granularity, peripheral bone spicules; attenuated vessels; 29 yr: atrophy throughout posterior pole with pigment clumps; peripheral bone spicules; attenuated vessels29 yr: confluent macular hypoautofluorescence extending into midperiphery, optical coherence tomography: 29 yr: diffuse loss of photoreceptors and retinal pigment epithelium; multiple focal pseudo- colobomas; choroidal atrophy, electroretinography: 7 yr: rod response nd; 30 hz cone flicker 1.0 m" "2y" "" "" "" "" "" "" "" "early-onset severe retinal dystrophy" "" "" "0000300167" "04214" "00408037" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 6 yr: right eye: 20/80; left eye: 20/ 80, Goldmann perimetry: mild constriction (I4e 20deg, V4e full), fundus: macular atrophy, peripheral bone spicules, attenuated vesselsnot available, optical coherence tomography: not available, electroretinography: rod response nd; 30 hz cone flicker < 5 mcv" "3y" "" "" "" "" "" "" "" "early-onset severe retinal dystrophy" "" "" "0000300168" "04214" "00408038" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 33 yr : right eye 20/60; left eye 20/ 80; 55 yr: right eye: hand motion; left eye: hand motion, Goldmann perimetry: 44 yr: severe constriction (V4e < 5deg), fundus: macular atrophy with peripapillary sparing; peripheral bone spicules and attenuated vesselsnot available, optical coherence tomography: not available, electroretinography: 44 yr: rod response nd; 30 hz cone flicker < 1 mcv" "26y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300169" "04214" "00408039" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 65 yr: right eye: counting fingers, left eye: counting fingers, Goldmann perimetry: limited peripheral III4e sensitivity; near-full V4e, fundus: macular atrophy, peripheral bone spicules, attenuated vessels, optical coherence tomography: not available, electroretinography: rod response nd; 30 hz cone flicker < 5.0 mcv" "9y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300170" "04214" "00408040" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity: 31 yr: left eye: 20/125, right eye: 20/ 125, Goldmann perimetry: central and midperipheral scotomas, fundus: excavated macular atrophy; peripheral atrophy and bone spicules; attenuated vesselsconfluent hypoautofluorescence throughout macula and posterior pole; peripapillary sparing; patchy peripheral hypoautofluorescence, optical coherence tomography: central staphyloma with absent photoreceptor and retinal pigment epithelium, electroretinography: rod response 20% of normal; 30 hz cone flicker <5.0 m" "<18y" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000300171" "04214" "00408041" "00000" "Familial, autosomal recessive" "29y" "visual acuity (VA) at presentation: 6/60 bilaterally; ocular media: clear, fundi: bilateral outer retinal changes with intraretinal pigment migration in the posterior pole and peripapillary sparing, fine refractile crystal-like deposits were noted at the border of the atrophic changes, no retinal vascular attenuation in either eye; fundus autofluorescence: bilateral patches of hypoautofluorescence in the macula, extending over areas superior and nasal to the optic disc with a rugged hyperautofluorescent border giving a leaf-like appearance; macular optical coherence tomography: outer nuclear and ellipsoid zone layers markedly disrupted; full-field electroretinography: moderate bilateral reduction of the rod and cone-mediated ERG responses, without peak time delay; pattern electroretinography bilaterally undetectable, severe macular dysfunction" "14y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300172" "04214" "00408042" "00000" "Familial, autosomal recessive" "10y" "8y: asymptomatic; best corrected visual acuity: 6/9 bilaterally; 10y: 6/36 without a significant refractive error; patient was able to identify only 2 of the 17 Ishihara color vision plates with the right eye, and 4 of 17 with the left; clear ocular media, both fundi had outer retinal changes in the perifoveal region, but the foveal reflex appeared intact; optic discs and retinal vasculature had a normal appearance; fundus autofluorescence: unusual cloverleaf-shaped hypoautofluorescent areas with a border of increased autofluorescence, and relative preservation of the fovea; optical coherence tomography: attenuation of the ellipsoid zone nasal to the fovea, with a sharp decline of the outer nuclear layer thickness, and preservation of the foveal ellipsoid zone with a prominent band representing the external limiting membrane; outer retinal bands temporal to the fovea: severely attenuated, with preservation of inner retinal lamination; no electroretinography evidence of generalized (peripheral) retinal dysfunction but pattern electroretinography P50 reduction indicated macular dysfunction bilaterally; normal electrooculogram excluded generalized retinal pigment epithelium dysfunction" "" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300173" "04214" "00408043" "00000" "Familial, autosomal recessive" "34y" "best corrected visual acuity right, left eye: hand motion , 20/400 on the left eye; mild nystagmus; fundus: revealed widespread retinal degeneration with dense intraretinal pigment migration; pallor of the optic disk and attenuation of retinal vessels, macula particularly atrophic, with yellowing and pigmentation; short-wavelength fundus autofluorescence: generalized loss of autofluorescence at the posterior pole" "3y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300174" "04214" "00408044" "00000" "Familial, autosomal recessive" "3y" "1y: strabismus surgery for correction of esotropia; pupils: paradoxical reaction to dark; funduscopy: widespread retinal degeneration with retinal pigment epithelium mottling on the periphery was appreciated; macula severely atrophic as compared to the rest of the posterior pole while the peripapillary retina was spared; short-wavelength fundus autofluorescence: peripapillary indicated by the higher levels of autofluorescence as compared to the otherwise widespread loss of autofluorescence throughout the rest of the posterior pole" "" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000300175" "04214" "00408045" "00000" "Familial, autosomal dominant" "32y" "best corrected visual acuity (LogMAR): 0.04 both eyes, fundus: mild waxy disc pallor with retinal vessel attenuation and mid-peripheral bone-spicules; dense spectral domain optical coherence tomography: maximum intensity slab showed an area of hyper-reflectivity surrounded by a ring of lower reflectance due to the increased reflectivity from the intact ellipsoid zone band of the structural OCT and identifies the area of intact photoreceptors; this circular pattern is more reminiscent of RP than classic recessive RDH12 retinopathy; short-wavelength fundus autofluorescence: salient hypo- and hyper-autofluorescence rings and residual foveal island on spectral domain optical coherence tomography; parafoveal macular edema was present in both eyes; adaptive optics scanning laser ophthalmoscopy: foveal cone morphology and density relatively normal, cone density remained relatively preserved across the residual OCT ellipsoid zone island, confirmed by cellular structures present in the split detection images; confocal imaging: drastic reduction in normal appearing foveal cones (bright Gaussian profile spots), even in areas without visible macular edema; split detection imaging: some cellular structures outside the ellipsoid zone island; intact structures can be inferred from the round, dimple-like structures present in the split detection view" "" "" "nyctalopia and visual field loss" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300176" "04214" "00408046" "00000" "Familial, autosomal dominant" "" "" "" "" "nyctalopia and visual field loss" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300177" "04214" "00408047" "00000" "Familial, autosomal dominant" "" "" "" "" "nyctalopia and visual field loss" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300178" "04214" "00408048" "00000" "Familial, autosomal dominant" "" "keratoconus from adolescence, 24y: episode of left hydrops which required a penetrating keratoplasty; after this nyctalopia and progressive visual field loss; good central and color vision; best corrected visual acuity: 0.18 LogMAR both eyes and 17/17 color vision using Ishihara; fundus: mild waxy disc pallor with retinal vessel attenuation and mid-peripheral bone-spicules; ultra-widefield retinal autofluorescence: characteristic hypo- and hyper-autofluorescence rings around the residual foveal island" "" "" "nyctalopia and visual field loss" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300179" "04214" "00408049" "00000" "Familial, autosomal dominant" "" "" "" "" "nyctalopia and visual field loss" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300181" "04214" "00408051" "00000" "Familial, autosomal dominant" "14y" "best corrected visual acuity right/left eye: 0.6/0.6, 14y: 0.2/0.2; refraction error (diopters) right/left eye: -4.00/-1.00 x 176 -3.75/-1.00 x 178; 14y: -5.25/-1.75 x 175 -5.50/-1.50 x 175, fundus 12 and 14y: macular atrophy, optical coherence tomography 12 and 14y: macular thinning/macular thinning; visual field right/left eye 12y: paracentral scotoma/central scotoma; 14y, central scotoma/ central scotoma; electroretinography 14y: mildly reduced cone response" "" "" "" "" "" "" "" "" "late-onset cone-rod dystrophy" "" "" "0000300185" "04214" "00408056" "00000" "Familial, autosomal recessive" "" "onset: 1st decade : no photophobia: no nystagmus: decline in visual acuity: 1st decade; no keratoconus; no cataract; papillary pallor: severe; peripapillary atrophy: yes; white flecks: yes; pigment mottling: no; vessel attenuation: no; bone spicules: diffuse; chorioretinal atrophy: diffuse; optical coherence tomography: irregularity of the retinal pigment epithelium; diffuse macular thickening in 2 patients; visual field: tubular" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300187" "04214" "00408058" "00000" "Familial, autosomal recessive" "" "onset: 1st decade : no photophobia: no nystagmus: decline in visual acuity: 1st decade; no keratoconus; no cataract; papillary pallor: severe; peripapillary atrophy: yes; white flecks: yes; pigment mottling: no; vessel attenuation: no; bone spicules: diffuse; chorioretinal atrophy: diffuse; optical coherence tomography: irregularity of the retinal pigment epithelium; diffuse macular thickening in 2 patients; visual field: tubular" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300192" "04214" "00408064" "00000" "Familial, autosomal recessive" "16y" "best corrected visual acuity right, left eye: 20/50, 20/100, equally reactive pupils, no relative afferent pupillary defect, intraocular pressure: 14 mmHg both eyes; ophthalmoscopy: extensive macular atrophy, peripheral pigment migration, peripapillary and para-arterial sparing; spectral domain optical coherence tomography: marked retinal thinning and excavation at the macula, with sparing of retinal pigment epithelium, atrophy in the peripapillary region of each eye; short wave autofluorescence: pattern of hypoautofluorescence consistent with loss of retinal pigment epithelium throughout the macula with the exception of the peripapillary region of each eye; full field electroretinography: extinguished photopic and scotopic responses consistent with a generalized loss of cone and rod function,; microperimetry: marked decreases in visual sensitivities over the fovea and a complete loss of visual function in the parafoveal region; fixation was foveal in an area of low-decibel cone sensitivity; the peripapillary region was not sampled" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300193" "04214" "00408065" "00000" "Familial, autosomal recessive" "21y" "identical macular phenotype to the brother (proband), with the additional finding of horizontal nystagmus; microperimetry: foveal fixation with the complete loss of visual function in the sampled area, which did not include the parapapillary area" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300194" "04214" "00408066" "00000" "Familial, autosomal recessive" "8y" "best corrected visual acuity right, left eye: 20/60, 20/80, eccentric fixation, equally reactive pupils, no relative afferent pupillary defect, normal intraocular pressures in both eyes; ophthalmoscopy: dense intraretinal pigmentation in the macular and peripherally with peripapillar sparing; spectral domain optical coherence tomography, fundus autofluorescence, and fundus findings similar to family 1; full field electroretinography: extinguished photopic and scotopic responses indicating generalized retinal dysfunction affecting both rods and cones" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300195" "04214" "00408067" "00000" "Familial, autosomal recessive" "10y" "night blindness, no history of nystagmus; best corrected visual acuity right, left eye: 20/30 , 20/60; fundus: depigmentation atrophy of both maculae with bilateral peripapillary sparing; extensive mottling but very little pigment migration; far peripheral retina had a salt-and-pepper appearance; spectral domain optical coherence tomography: marked atrophy of the retinal pigment epithelium with intact retinal cell layers in the peripapillary regions; full field electroretinography: extinguished rod responses and diminished 30 Hz-flicker responses of approximately 10 uV in both eyes confirming a rod-cone dystrophy" "" "3y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300197" "04214" "00408069" "00000" "Familial, autosomal recessive" "24y" "best corrected visual acuity right/left eye: 0.30/0.06; nystagmus, nyctalopia, fundus: peripheral hyperpigmentation, pronounced maculopathy, retinal vascular attenuation; electroretinogram: extinguished" "2y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300198" "04214" "00408070" "00000" "Familial, autosomal recessive" "25y" "best corrected visual acuity right/left eye: 0.04/0.12; nystagmus, nyctalopia, fundus: peripheral hyperpigmentation, pronounced maculopathy, retinal vascular attenuation; electroretinogram: extinguished" "2y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300536" "04214" "00408420" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300554" "04214" "00408438" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis/retinitis pigmentosa" "" "" "0000310998" "04214" "00419718" "04405" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000311706" "04214" "00420458" "00000" "Familial, autosomal recessive" "35y2m" "" "30y" "" "" "" "" "" "" "" "macular dystrophy" "" "" "0000311828" "04214" "00420580" "00000" "Familial, autosomal recessive" "15y10m" "" "3y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000311839" "04214" "00420591" "00000" "Familial, autosomal recessive" "41y5m" "" "9y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000312748" "00058" "00421512" "04364" "Familial, autosomal recessive" "05y" "" "03y" "05y" "" "" "" "" "" "" "Cone Rod Dystrophy" "" "" "0000313888" "00058" "00422684" "04364" "Familial, autosomal recessive" "10y" "" "02y" "10y" "" "" "" "" "" "" "Cone Rod Dystrophy" "Cone Rod Dystrophy" "" "0000318046" "04214" "00426908" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "achromatopsia" "cone dystrophy" "" "0000318068" "04214" "00426930" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000320443" "00112" "00429571" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320638" "00112" "00429766" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320642" "00112" "00429770" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320677" "00112" "00429805" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320695" "04210" "00429823" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320742" "04214" "00429870" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320764" "04210" "00429892" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320816" "00112" "00429944" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320825" "04210" "00429953" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320856" "00112" "00429984" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320867" "00112" "00429995" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320875" "00112" "00430003" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320890" "00112" "00430018" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320936" "00112" "00430064" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000336195" "00198" "00446996" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336693" "00198" "00447494" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336706" "00198" "00447507" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336762" "00198" "00447563" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000336853" "00198" "00447654" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336886" "00198" "00447687" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "optic atrophy" "" "0000339889" "04249" "00450834" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" "" "0000340026" "04249" "00450971" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340027" "04249" "00450972" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340028" "04249" "00450973" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340029" "04249" "00450974" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340030" "04249" "00450975" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340031" "04249" "00450976" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000340032" "04249" "00450977" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000340033" "04249" "00450978" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000340034" "04249" "00450979" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340035" "04249" "00450980" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340036" "04249" "00450981" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000348576" "04214" "00461076" "00006" "Familial, autosomal recessive" "" "" "3y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ## Screenings ## Do not remove or alter this header ## ## Count = 605 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000001592" "00001789" "1" "00102" "00102" "2013-08-08 18:36:29" "" "" "SEQ-NG-I" "DNA" "" "" "0000001593" "00001790" "1" "00102" "00102" "2013-08-08 18:52:31" "" "" "SEQ-NG-I" "DNA" "" "" "0000001616" "00001813" "1" "00102" "00102" "2013-08-08 22:47:57" "" "" "SEQ-NG-I" "DNA" "" "" "0000016559" "00016606" "1" "00552" "00552" "2014-05-23 13:26:55" "" "" "SEQ-NG-I" "DNA" "" "" "0000016566" "00016613" "1" "00552" "00552" "2014-05-23 13:45:26" "" "" "SEQ-NG-I" "DNA" "" "" "0000033233" "00033165" "1" "00229" "00229" "2012-02-04 15:53:12" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033413" "00033345" "1" "00039" "00039" "2012-09-18 13:29:26" "" "" "SEQ" "DNA" "" "" "0000033658" "00033590" "1" "00242" "00242" "2013-04-26 13:56:58" "" "" "SEQ" "DNA" "" "" "0000033671" "00033603" "1" "00130" "00130" "2013-10-01 11:38:26" "" "" "SEQ" "DNA" "" "" "0000033755" "00033687" "1" "00243" "00243" "2015-01-23 06:00:10" "" "" "SEQ" "DNA" "" "" "0000033771" "00033703" "1" "00243" "00243" "2015-02-19 12:43:35" "" "" "SEQ-NG-I" "DNA" "" "" "0000052355" "00052407" "1" "01338" "01338" "2015-10-24 12:14:43" "" "" "SEQ-NG-I" "DNA" "" "" "0000096359" "00095956" "1" "01769" "01769" "2017-01-26 22:42:16" "" "" "SEQ" "DNA" "WBC" "" "0000156394" "00155529" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156395" "00155530" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156396" "00155531" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156397" "00155532" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156398" "00155533" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156399" "00155534" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156400" "00155535" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156401" "00155536" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000208637" "00207599" "1" "01244" "01244" "2018-11-26 15:04:00" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208724" "00207683" "1" "01244" "01244" "2018-11-27 16:52:07" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208727" "00207686" "1" "01244" "01244" "2018-11-28 10:08:46" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208729" "00207688" "1" "01244" "01244" "2018-11-28 10:27:34" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208730" "00207689" "1" "01244" "01244" "2018-11-28 10:35:42" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208741" "00207700" "1" "01244" "01244" "2018-11-28 17:01:50" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000209942" "00208837" "1" "02959" "02959" "2018-12-19 18:31:10" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000234342" "00233243" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234343" "00233244" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234344" "00233245" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234345" "00233246" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234346" "00233247" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234347" "00233248" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234348" "00233249" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234875" "00233776" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000292263" "00291095" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309553" "00308409" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309554" "00308410" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309555" "00308411" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309684" "00308539" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309767" "00308622" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000310477" "00309332" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310478" "00309333" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310479" "00309334" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310480" "00309335" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310481" "00309336" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310482" "00309337" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310484" "00309339" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310485" "00309340" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310486" "00309341" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310487" "00309342" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000325327" "00324137" "1" "01164" "01164" "2020-12-02 15:39:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000326629" "00325418" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326657" "00325446" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326674" "00325463" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326708" "00325497" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326715" "00325504" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000329373" "00328158" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329478" "00328263" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329709" "00328494" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000329710" "00328495" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333484" "00332264" "1" "00000" "00006" "2021-02-16 17:14:33" "" "" "SEQ-NG" "DNA" "" "300-gene panel" "0000333581" "00332358" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" "" "0000335182" "00333956" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335183" "00333957" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335184" "00333958" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335185" "00333959" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335186" "00333960" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335187" "00333961" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335658" "00334429" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000335677" "00334448" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000335678" "00334449" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000336377" "00335148" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000336510" "00335281" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336611" "00335382" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336622" "00335393" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336977" "00335748" "1" "00000" "00006" "2021-03-08 20:49:15" "" "" "SEQ-NG" "DNA" "" "325-gene panel" "0000360021" "00358791" "1" "00000" "00006" "2021-03-12 09:26:03" "" "" "SEQ-NG" "DNA" "" "226-gene panel" "0000360156" "00358923" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360169" "00358937" "1" "00006" "00006" "2021-03-17 16:36:11" "" "" "SEQ" "DNA" "" "" "0000360215" "00358978" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360293" "00359055" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360327" "00359089" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360332" "00359094" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360370" "00359132" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360575" "00359334" "1" "00000" "00006" "2021-03-19 13:20:32" "" "" "SEQ-NG" "DNA" "" "105-gene panel" "0000360624" "00359382" "1" "00000" "00006" "2021-03-19 18:50:51" "" "" "SEQ-NG" "DNA" "" "64-gene panel" "0000363377" "00362148" "1" "00006" "00006" "2021-04-15 14:35:20" "" "" "SEQ-NG" "DNA" "" "WES" "0000363402" "00362173" "1" "00000" "00006" "2021-04-15 17:02:42" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364667" "00363439" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364674" "00363446" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364675" "00363447" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364694" "00363466" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364747" "00363519" "1" "00000" "00006" "2021-04-29 12:09:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000364840" "00363612" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364865" "00363637" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364901" "00363673" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364920" "00363692" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364962" "00363734" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000365102" "00363874" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365103" "00363875" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365104" "00363876" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365105" "00363877" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365106" "00363878" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365107" "00363879" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365108" "00363880" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365109" "00363881" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365110" "00363882" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000365111" "00363883" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000369585" "00368357" "1" "01695" "01695" "2021-05-03 14:25:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000373304" "00372076" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "arraySNP;SEQ" "DNA" "" "" "0000373640" "00372407" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373715" "00372482" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373716" "00372483" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373717" "00372484" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373718" "00372485" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373719" "00372486" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373902" "00372670" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373903" "00372671" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374977" "00373744" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374978" "00373745" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374979" "00373746" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374980" "00373747" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000375041" "00373809" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "arraySEQ" "DNA" "" "Reseq" "0000375047" "00373815" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "arraySEQ" "DNA" "" "Reseq" "0000375136" "00373904" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000376167" "00374973" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" "" "0000376478" "00375281" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376479" "00375282" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376634" "00375437" "1" "00000" "00006" "2021-06-04 11:16:10" "" "" "SEQ-NG" "DNA" "" "162-gene panel" "0000376641" "00375444" "1" "00000" "00006" "2021-06-04 11:16:10" "" "" "SEQ-NG" "DNA" "" "162-gene panel" "0000377489" "00376293" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377507" "00376311" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000378059" "00376854" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000378061" "00376856" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000378062" "00376857" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000378063" "00376858" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000378411" "00377206" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000379025" "00377821" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379026" "00377822" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379027" "00377823" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379107" "00377903" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000380589" "00379389" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380590" "00379390" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380591" "00379391" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000381068" "00379866" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381069" "00379867" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381070" "00379868" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381526" "00380312" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "autozygome-guided sequencing" "0000381527" "00380313" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "autozygome-guided sequencing" "0000381528" "00380314" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "autozygome-guided sequencing" "0000382265" "00381051" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382274" "00381060" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" "" "0000382275" "00381061" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" "" "0000382276" "00381062" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" "" "0000382277" "00381063" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" "" "0000382282" "00381068" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG" "DNA" "blood" "" "0000382370" "00381155" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382383" "00381168" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "Exome Sequencing" "0000382407" "00381192" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382408" "00381193" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382409" "00381194" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382410" "00381195" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382441" "00381226" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382841" "00381625" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382849" "00381633" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382861" "00381645" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382883" "00381667" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382888" "00381672" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382919" "00381703" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000382920" "00381704" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000382936" "00381720" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000383094" "00381878" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383095" "00381879" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383348" "00382132" "1" "00000" "03840" "2021-09-07 10:12:12" "" "" "SEQ-NG" "DNA" "blood" "" "0000383590" "00382376" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383591" "00382377" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383592" "00382378" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383593" "00382379" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000384057" "00382841" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384058" "00382842" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384059" "00382843" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384064" "00382848" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384065" "00382849" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384069" "00382853" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384070" "00382854" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384967" "00383742" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384988" "00383763" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385002" "00383777" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385144" "00383919" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385147" "00383922" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385156" "00383931" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385171" "00383946" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385183" "00383958" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385196" "00383971" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385205" "00383980" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385207" "00383982" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385256" "00384031" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385258" "00384033" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385259" "00384034" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385298" "00384073" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385328" "00384103" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385712" "00384487" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385852" "00384624" "1" "00000" "03840" "2021-10-04 12:47:36" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000386227" "00384998" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ" "DNA" "" "Sanger sequencing" "0000386229" "00385000" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386236" "00385007" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386243" "00385014" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386245" "00385016" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386260" "00385031" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386302" "00385073" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386324" "00385095" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ" "DNA" "" "Sanger sequencing" "0000386493" "00385264" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386494" "00385265" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386495" "00385266" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386496" "00385267" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386497" "00385268" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386498" "00385269" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386499" "00385270" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386500" "00385271" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386501" "00385272" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "" "0000386639" "00385410" "1" "00000" "03840" "2021-10-10 19:46:50" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387425" "00386196" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387508" "00386279" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387509" "00386280" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000388010" "00386782" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388042" "00386814" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388888" "00387662" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388889" "00387663" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000390165" "00388922" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390166" "00388923" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390364" "00389121" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390368" "00389125" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390424" "00389181" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390656" "00389413" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390768" "00389525" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390879" "00389636" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391042" "00389799" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000391112" "00389869" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper" "0000391170" "00389927" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391173" "00389930" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391601" "00390360" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391602" "00390361" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000392591" "00391349" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing" "0000392913" "00391672" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392914" "00391673" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392915" "00391674" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392916" "00391675" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392917" "00391676" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392918" "00391677" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392919" "00391678" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392972" "00391731" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392973" "00391732" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392974" "00391733" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392975" "00391734" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392976" "00391735" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000393869" "00392622" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000394835" "00393587" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394880" "00393632" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394891" "00393643" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394921" "00393673" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394950" "00393702" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394983" "00393735" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395004" "00393756" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395028" "00393780" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395050" "00393802" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395752" "00394505" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395871" "00394624" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000396659" "00395421" "1" "00000" "03840" "2021-12-06 14:47:57" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000396817" "00395579" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing" "0000396828" "00395590" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing" "0000397049" "00395810" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397081" "00395842" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397082" "00395843" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000405351" "00404113" "1" "00006" "00006" "2022-02-27 19:00:28" "" "" "SEQ" "DNA" "" "" "0000408963" "00407711" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408964" "00407712" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408965" "00407713" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408966" "00407714" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408967" "00407715" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408968" "00407716" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408969" "00407717" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408970" "00407718" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408971" "00407719" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408972" "00407720" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408973" "00407721" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408974" "00407722" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408975" "00407723" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408976" "00407724" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408977" "00407725" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408978" "00407726" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408979" "00407727" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408980" "00407728" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408981" "00407729" "1" "00000" "03840" "2022-04-07 22:52:37" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000408999" "00407747" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409000" "00407748" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409001" "00407749" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409002" "00407750" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409003" "00407751" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409004" "00407752" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409005" "00407753" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409006" "00407754" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409007" "00407755" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409008" "00407756" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409009" "00407757" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409010" "00407758" "1" "00000" "03840" "2022-04-08 10:07:02" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409026" "00407774" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409027" "00407775" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409028" "00407776" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409029" "00407777" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409030" "00407778" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409031" "00407779" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409032" "00407780" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409033" "00407781" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409034" "00407782" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409035" "00407783" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409036" "00407784" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409037" "00407785" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409038" "00407786" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409039" "00407787" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409040" "00407788" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409041" "00407789" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409042" "00407790" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409043" "00407791" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409044" "00407792" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409045" "00407793" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409046" "00407794" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409047" "00407795" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409048" "00407796" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409049" "00407797" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409050" "00407798" "1" "00000" "03840" "2022-04-08 15:01:03" "" "" "DHPLC;SEQ" "DNA" "blood" "" "0000409055" "00407803" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409056" "00407804" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409057" "00407805" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409058" "00407806" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409059" "00407807" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409060" "00407808" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409061" "00407809" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409062" "00407810" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409063" "00407811" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409064" "00407812" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409065" "00407813" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409066" "00407814" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409067" "00407815" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409068" "00407816" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409069" "00407817" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409070" "00407818" "1" "00000" "03840" "2022-04-08 20:30:05" "" "" "SEQ" "DNA" "blood" "" "0000409073" "00407821" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409074" "00407822" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409075" "00407823" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409076" "00407824" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409077" "00407825" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409078" "00407826" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409079" "00407827" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409080" "00407828" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409081" "00407829" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409082" "00407830" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409083" "00407831" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409084" "00407832" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409085" "00407833" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409086" "00407834" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409087" "00407835" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409088" "00407836" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409089" "00407837" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409090" "00407838" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409091" "00407839" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409092" "00407840" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409093" "00407841" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409094" "00407842" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409095" "00407843" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409096" "00407844" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409097" "00407845" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409098" "00407846" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409099" "00407847" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409100" "00407848" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409101" "00407849" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409102" "00407850" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409103" "00407851" "1" "00000" "03840" "2022-04-09 17:22:07" "" "" "SEQ" "DNA" "blood" "" "0000409104" "00407852" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409105" "00407853" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409106" "00407854" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409107" "00407855" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409108" "00407856" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409109" "00407857" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409110" "00407858" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409111" "00407859" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409112" "00407860" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409113" "00407861" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409114" "00407862" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409115" "00407863" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409116" "00407864" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409117" "00407865" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409118" "00407866" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409119" "00407867" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409120" "00407868" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409121" "00407869" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409122" "00407870" "1" "00000" "03840" "2022-04-09 19:14:57" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409128" "00407876" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409129" "00407877" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409130" "00407878" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409131" "00407879" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409132" "00407880" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409133" "00407881" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409134" "00407882" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409135" "00407883" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409136" "00407884" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409137" "00407885" "1" "00000" "03840" "2022-04-09 22:56:34" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000409151" "00407899" "1" "00000" "03840" "2022-04-10 18:43:34" "" "" "SEQ" "DNA" "blood" "" "0000409153" "00407901" "1" "00000" "03840" "2022-04-10 18:59:16" "" "" "SEQ" "DNA" "blood" "" "0000409154" "00407902" "1" "00000" "03840" "2022-04-10 18:59:16" "" "" "SEQ" "DNA" "blood" "" "0000409157" "00407905" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409158" "00407906" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409159" "00407907" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409160" "00407908" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409161" "00407909" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409162" "00407910" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409163" "00407911" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409164" "00407912" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409165" "00407913" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409166" "00407914" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409167" "00407915" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Asper chip" "0000409168" "00407916" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Affymetrix" "0000409169" "00407917" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Affymetrix" "0000409170" "00407918" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "arraySNP;SEQ" "DNA" "blood" "method of identification: Affymetrix/phenotype" "0000409171" "00407919" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Direct Seq" "0000409172" "00407920" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Direct Seq" "0000409173" "00407921" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Direct Seq" "0000409174" "00407922" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Direct Seq" "0000409175" "00407923" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409176" "00407924" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409177" "00407925" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409178" "00407926" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409179" "00407927" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409180" "00407928" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409181" "00407929" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409182" "00407930" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409183" "00407931" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409184" "00407932" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409185" "00407933" "1" "00000" "03840" "2022-04-10 20:20:49" "" "" "SEQ" "DNA" "blood" "method of identification: Phenotype" "0000409186" "00407934" "1" "00000" "03840" "2022-04-10 20:34:59" "" "" "SEQ" "DNA" "blood" "" "0000409187" "00407935" "1" "00000" "03840" "2022-04-10 20:34:59" "" "" "SEQ" "DNA" "blood" "" "0000409188" "00407936" "1" "00000" "03840" "2022-04-10 20:34:59" "" "" "SEQ" "DNA" "blood" "" "0000409189" "00407937" "1" "00000" "03840" "2022-04-10 20:34:59" "" "" "SEQ" "DNA" "blood" "" "0000409190" "00407938" "1" "00000" "03840" "2022-04-10 20:34:59" "" "" "SEQ" "DNA" "blood" "" "0000409191" "00407939" "1" "00000" "03840" "2022-04-11 09:44:38" "" "" "SEQ" "DNA" "blood" "" "0000409192" "00407940" "1" "00000" "03840" "2022-04-11 09:44:38" "" "" "SEQ" "DNA" "blood" "" "0000409193" "00407941" "1" "00000" "03840" "2022-04-11 09:44:38" "" "" "SEQ" "DNA" "blood" "" "0000409194" "00407942" "1" "00000" "03840" "2022-04-11 10:59:09" "" "" "SEQ-NG;SEQ" "DNA" "blood" "exome sequencing" "0000409195" "00407943" "1" "00000" "03840" "2022-04-11 10:59:09" "" "" "SEQ" "DNA" "blood" "" "0000409196" "00407944" "1" "00000" "03840" "2022-04-11 13:19:42" "" "" "SEQ" "DNA" "blood" "" "0000409197" "00407945" "1" "00000" "03840" "2022-04-11 13:19:42" "" "" "SEQ" "DNA" "blood" "" "0000409198" "00407946" "1" "00000" "03840" "2022-04-11 13:19:42" "" "" "SEQ" "DNA" "blood" "" "0000409199" "00407947" "1" "00000" "03840" "2022-04-11 13:19:42" "" "" "SEQ" "DNA" "blood" "" "0000409200" "00407948" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409201" "00407949" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409202" "00407950" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409203" "00407951" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409204" "00407952" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409205" "00407953" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409206" "00407954" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409207" "00407955" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409208" "00407956" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409209" "00407957" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409210" "00407958" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409211" "00407959" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409212" "00407960" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409213" "00407961" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409214" "00407962" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409215" "00407963" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409216" "00407964" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409217" "00407965" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409218" "00407966" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409219" "00407967" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409220" "00407968" "1" "00000" "03840" "2022-04-11 15:08:36" "" "" "?" "DNA" "saliva" "" "0000409223" "00407971" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409224" "00407972" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409225" "00407973" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409226" "00407974" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409227" "00407975" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409228" "00407976" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409229" "00407977" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409230" "00407978" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409231" "00407979" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409232" "00407980" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409233" "00407981" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409234" "00407982" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409235" "00407983" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409236" "00407984" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409237" "00407985" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409238" "00407986" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409239" "00407987" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409240" "00407988" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409241" "00407989" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409242" "00407990" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409243" "00407991" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409244" "00407992" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409245" "00407993" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409246" "00407994" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409247" "00407995" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409248" "00407996" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409249" "00407997" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409250" "00407998" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409251" "00407999" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409252" "00408000" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409253" "00408001" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409254" "00408002" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409255" "00408003" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409256" "00408004" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409257" "00408005" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409258" "00408006" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409259" "00408007" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409260" "00408008" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409261" "00408009" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409262" "00408010" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409263" "00408011" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409264" "00408012" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409265" "00408013" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409266" "00408014" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409267" "00408015" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409268" "00408016" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409269" "00408017" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409270" "00408018" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409271" "00408019" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409272" "00408020" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409273" "00408021" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409274" "00408022" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409275" "00408023" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409276" "00408024" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409277" "00408025" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409278" "00408026" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409279" "00408027" "1" "00000" "03840" "2022-04-11 18:59:20" "" "" "RT-PCR;SEQ" "RNA" "blood" "" "0000409280" "00408028" "1" "00000" "03840" "2022-04-11 19:32:55" "" "" "?" "DNA" "" "" "0000409284" "00408030" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409285" "00408031" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409286" "00408032" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409287" "00408033" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409288" "00408034" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409289" "00408035" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409290" "00408036" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409291" "00408037" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409292" "00408038" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409293" "00408039" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409294" "00408040" "1" "00000" "03840" "2022-04-12 13:04:16" "" "" "?" "DNA" "" "" "0000409295" "00408041" "1" "00000" "03840" "2022-04-12 13:39:26" "" "" "?" "DNA" "" "" "0000409296" "00408042" "1" "00000" "03840" "2022-04-12 13:39:26" "" "" "?" "DNA" "" "" "0000409298" "00408043" "1" "00000" "03840" "2022-04-12 14:05:43" "" "" "?" "DNA" "" "" "0000409299" "00408044" "1" "00000" "03840" "2022-04-12 14:05:43" "" "" "?" "DNA" "" "" "0000409300" "00408045" "1" "00000" "03840" "2022-04-12 14:33:18" "" "" "?" "DNA" "" "" "0000409301" "00408046" "1" "00000" "03840" "2022-04-12 14:33:18" "" "" "?" "DNA" "" "" "0000409302" "00408047" "1" "00000" "03840" "2022-04-12 14:33:18" "" "" "?" "DNA" "" "" "0000409303" "00408048" "1" "00000" "03840" "2022-04-12 14:33:18" "" "" "?" "DNA" "" "" "0000409304" "00408049" "1" "00000" "03840" "2022-04-12 14:33:18" "" "" "?" "DNA" "" "" "0000409306" "00408051" "1" "00000" "03840" "2022-04-12 17:27:21" "" "" "SEQ-NG" "DNA" "" "whole exome sequencing" "0000409311" "00408056" "1" "00000" "03840" "2022-04-13 12:09:21" "" "" "arraySNP;SEQ" "DNA" "" "" "0000409313" "00408058" "1" "00000" "03840" "2022-04-13 12:09:21" "" "" "arraySNP;SEQ" "DNA" "" "" "0000409319" "00408064" "1" "00000" "03840" "2022-04-13 13:03:39" "" "" "SEQ" "DNA" "" "" "0000409320" "00408065" "1" "00000" "03840" "2022-04-13 13:03:39" "" "" "SEQ" "DNA" "" "" "0000409321" "00408066" "1" "00000" "03840" "2022-04-13 13:03:39" "" "" "SEQ-NG" "DNA" "" "Whole exome sequencing" "0000409322" "00408067" "1" "00000" "03840" "2022-04-13 13:03:39" "" "" "SEQ" "DNA" "" "" "0000409324" "00408069" "1" "00000" "03840" "2022-04-13 13:55:24" "" "" "SEQ" "DNA" "" "" "0000409325" "00408070" "1" "00000" "03840" "2022-04-13 13:55:24" "" "" "SEQ" "DNA" "" "" "0000409677" "00408420" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000409695" "00408438" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000421023" "00419718" "1" "04405" "00006" "2022-10-21 12:50:15" "" "" "MIPsm" "DNA" "" "smMIPs 105 iMD/AMD genes" "0000421767" "00420458" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421889" "00420580" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421900" "00420591" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000422823" "00421512" "1" "04364" "04364" "2022-11-07 07:38:37" "" "" "SEQ-NG" "DNA" "" "" "0000423994" "00422684" "1" "04364" "04364" "2022-11-11 10:41:45" "" "" "SEQ-NG" "DNA" "" "" "0000428228" "00426908" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing" "0000428250" "00426930" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing" "0000430984" "00429571" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431179" "00429766" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431183" "00429770" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431218" "00429805" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431236" "00429823" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431283" "00429870" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431305" "00429892" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431357" "00429944" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431366" "00429953" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431397" "00429984" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431408" "00429995" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431416" "00430003" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431431" "00430018" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431477" "00430064" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000448573" "00446996" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449071" "00447494" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449084" "00447507" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449140" "00447563" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449231" "00447654" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449264" "00447687" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000452432" "00450834" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452569" "00450971" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452570" "00450972" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452571" "00450973" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452572" "00450974" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452573" "00450975" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452574" "00450976" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452575" "00450977" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452576" "00450978" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452577" "00450979" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452578" "00450980" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452579" "00450981" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000462708" "00461076" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 526 "{{screeningid}}" "{{geneid}}" "0000033233" "RDH12" "0000033413" "RDH12" "0000033658" "RDH12" "0000033671" "RDH12" "0000033755" "RDH12" "0000033771" "RDH12" "0000052355" "RDH12" "0000096359" "RDH12" "0000156394" "RDH12" "0000156395" "RDH12" "0000156396" "RDH12" "0000156397" "RDH12" "0000156398" "RDH12" "0000156399" "RDH12" "0000156400" "RDH12" "0000156401" "RDH12" "0000234342" "RDH12" "0000234343" "RDH12" "0000234344" "RDH12" "0000234345" "RDH12" "0000234346" "RDH12" "0000234347" "RDH12" "0000234348" "RDH12" "0000234875" "RDH12" "0000309553" "RDH12" "0000309554" "RDH12" "0000309555" "RDH12" "0000309684" "RDH12" "0000309767" "RDH12" "0000310477" "RDH12" "0000310478" "RDH12" "0000310479" "RDH12" "0000310480" "RDH12" "0000310481" "RDH12" "0000310482" "RDH12" "0000310484" "RDH12" "0000310485" "RDH12" "0000310486" "RDH12" "0000310487" "RDH12" "0000325327" "RDH12" "0000326629" "RDH12" "0000326657" "RDH12" "0000326674" "RDH12" "0000326708" "RDH12" "0000326715" "RDH12" "0000329373" "RDH12" "0000329478" "RDH12" "0000329709" "RDH12" "0000329710" "RDH12" "0000333484" "RDH12" "0000333581" "RDH12" "0000335182" "RDH12" "0000335183" "RDH12" "0000335184" "RDH12" "0000335185" "RDH12" "0000335186" "RDH12" "0000335187" "RDH12" "0000335658" "RDH12" "0000335658" "SNRNP200" "0000335677" "RDH12" "0000335678" "RDH12" "0000336377" "RDH12" "0000336510" "RDH12" "0000336611" "RDH12" "0000336622" "RDH12" "0000336977" "ABCA4" "0000360021" "RDH12" "0000360156" "RDH12" "0000360575" "RDH12" "0000363377" "RDH12" "0000363402" "RDH12" "0000364667" "RDH12" "0000364674" "RDH12" "0000364675" "RDH12" "0000364694" "RDH12" "0000364747" "RDH12" "0000364840" "RDH12" "0000364865" "RDH12" "0000364901" "RDH12" "0000364920" "RDH12" "0000364962" "RDH12" "0000365102" "RDH12" "0000365103" "RDH12" "0000365104" "RDH12" "0000365105" "RDH12" "0000365106" "RDH12" "0000365107" "RDH12" "0000365108" "RDH12" "0000365109" "RDH12" "0000365110" "RDH12" "0000365111" "RDH12" "0000369585" "ABCA4" "0000373304" "RDH12" "0000373640" "RDH12" "0000373715" "RDH12" "0000373716" "RDH12" "0000373717" "RDH12" "0000373718" "RDH12" "0000373719" "RDH12" "0000374977" "CRB1" "0000374977" "RDH12" "0000374977" "RPE65" "0000374978" "CRB1" "0000374978" "RDH12" "0000374978" "RPE65" "0000374979" "CRB1" "0000374979" "RDH12" "0000374979" "RPE65" "0000374980" "CRB1" "0000374980" "RDH12" "0000374980" "RPE65" "0000375041" "RDH12" "0000375047" "NR2E3" "0000375136" "RDH12" "0000376167" "RDH12" "0000376478" "RDH12" "0000376479" "RDH12" "0000376634" "RDH12" "0000376641" "RDH12" "0000377489" "RDH12" "0000377507" "RDH12" "0000378411" "RDH12" "0000379025" "RDH12" "0000379026" "RDH12" "0000379027" "RDH12" "0000379107" "CRB1" "0000380589" "RDH12" "0000380590" "RDH12" "0000380591" "RDH12" "0000381068" "RDH12" "0000381069" "RDH12" "0000381070" "RDH12" "0000381526" "RDH12" "0000381527" "RDH12" "0000381528" "RDH12" "0000382265" "RDH12" "0000382274" "RDH12" "0000382275" "RDH12" "0000382276" "RDH12" "0000382277" "RDH12" "0000382282" "RDH12" "0000382370" "RDH12" "0000382383" "RDH12" "0000382407" "RDH12" "0000382408" "RDH12" "0000382409" "RDH12" "0000382410" "RDH12" "0000382441" "RDH12" "0000382841" "RDH12" "0000382849" "GUCY2D" "0000382861" "RDH12" "0000382883" "RDH12" "0000382888" "GUCY2D" "0000382919" "RDH12" "0000382920" "RDH12" "0000382936" "RDH12" "0000383094" "RDH12" "0000383095" "RDH12" "0000383348" "RDH12" "0000383590" "RDH12" "0000383591" "RDH12" "0000383592" "RDH12" "0000383593" "RDH12" "0000384057" "RDH12" "0000384058" "RDH12" "0000384059" "RDH12" "0000384064" "RDH12" "0000384065" "RDH12" "0000384069" "RDH12" "0000384070" "RDH12" "0000384967" "RDH12" "0000384988" "RDH12" "0000385002" "SLC7A14" "0000385144" "RDH12" "0000385147" "RDH12" "0000385156" "RDH12" "0000385171" "RDH12" "0000385183" "RDH12" "0000385196" "RDH12" "0000385205" "RDH12" "0000385207" "RDH12" "0000385256" "RDH12" "0000385258" "RDH12" "0000385259" "RDH12" "0000385298" "RDH12" "0000385328" "RDH12" "0000385712" "RDH12" "0000385852" "RDH12" "0000386227" "RDH12" "0000386229" "RDH12" "0000386236" "RDH12" "0000386243" "RDH12" "0000386245" "RDH12" "0000386260" "RDH12" "0000386302" "RDH12" "0000386324" "RDH12" "0000386493" "RDH12" "0000386494" "RDH12" "0000386495" "RDH12" "0000386496" "RDH12" "0000386497" "RDH12" "0000386498" "RDH12" "0000386499" "RDH12" "0000386500" "RDH12" "0000386501" "RDH12" "0000386639" "RDH12" "0000387425" "RDH12" "0000387508" "RDH12" "0000387509" "RDH12" "0000388010" "RDH12" "0000388042" "RDH12" "0000388888" "RDH12" "0000388889" "RDH12" "0000390165" "RDH12" "0000390166" "RDH12" "0000390364" "RDH12" "0000390368" "RDH12" "0000390424" "RDH12" "0000390656" "RDH12" "0000390768" "RDH12" "0000390879" "RDH12" "0000391042" "RDH12" "0000391112" "RDH12" "0000391170" "RDH12" "0000391173" "RDH12" "0000391601" "RDH12" "0000391602" "RDH12" "0000392591" "RDH12" "0000392913" "RDH12" "0000392914" "RDH12" "0000392915" "RDH12" "0000392916" "RDH12" "0000392917" "RDH12" "0000392918" "RDH12" "0000392919" "RDH12" "0000392972" "RDH12" "0000392973" "RDH12" "0000392974" "RDH12" "0000392975" "RDH12" "0000392976" "RDH12" "0000393869" "RDH12" "0000394835" "RDH12" "0000394880" "RDH12" "0000394891" "RDH12" "0000394921" "RDH12" "0000394950" "RDH12" "0000394983" "RDH12" "0000395004" "RDH12" "0000395028" "RDH12" "0000395050" "RDH12" "0000395752" "RDH12" "0000395871" "RDH12" "0000396659" "RDH12" "0000396817" "RDH12" "0000396828" "RDH12" "0000397049" "RDH12" "0000397081" "RDH12" "0000397082" "RDH12" "0000405351" "RDH12" "0000408963" "RDH12" "0000408964" "RDH12" "0000408965" "RDH12" "0000408966" "RDH12" "0000408967" "RDH12" "0000408968" "RDH12" "0000408969" "RDH12" "0000408970" "RDH12" "0000408971" "RDH12" "0000408972" "RDH12" "0000408973" "RDH12" "0000408974" "RDH12" "0000408975" "RDH12" "0000408976" "RDH12" "0000408977" "RDH12" "0000408978" "RDH12" "0000408979" "RDH12" "0000408980" "RDH12" "0000408981" "RDH12" "0000408999" "RDH12" "0000409000" "RDH12" "0000409001" "RDH12" "0000409002" "RDH12" "0000409003" "RDH12" "0000409004" "RDH12" "0000409005" "RDH12" "0000409006" "RDH12" "0000409007" "RDH12" "0000409008" "RDH12" "0000409009" "RDH12" "0000409010" "RDH12" "0000409026" "RDH12" "0000409027" "RDH12" "0000409028" "RDH12" "0000409029" "RDH12" "0000409030" "RDH12" "0000409031" "RDH12" "0000409032" "RDH12" "0000409033" "RDH12" "0000409034" "RDH12" "0000409035" "RDH12" "0000409036" "RDH12" "0000409037" "RDH12" "0000409038" "RDH12" "0000409039" "RDH12" "0000409040" "RDH12" "0000409041" "RDH12" "0000409042" "RDH12" "0000409043" "RDH12" "0000409044" "RDH12" "0000409045" "RDH12" "0000409046" "RDH12" "0000409047" "RDH12" "0000409048" "RDH12" "0000409049" "RDH12" "0000409050" "RDH12" "0000409055" "RDH12" "0000409056" "RDH12" "0000409057" "RDH12" "0000409058" "RDH12" "0000409059" "RDH12" "0000409060" "RDH12" "0000409061" "RDH12" "0000409062" "RDH12" "0000409063" "RDH12" "0000409064" "RDH12" "0000409065" "RDH12" "0000409066" "RDH12" "0000409067" "RDH12" "0000409068" "RDH12" "0000409069" "RDH12" "0000409070" "RDH12" "0000409073" "RDH12" "0000409074" "RDH12" "0000409075" "RDH12" "0000409076" "RDH12" "0000409077" "RDH12" "0000409078" "RDH12" "0000409079" "RDH12" "0000409080" "RDH12" "0000409081" "RDH12" "0000409082" "RDH12" "0000409083" "RDH12" "0000409084" "RDH12" "0000409085" "RDH12" "0000409086" "RDH12" "0000409087" "RDH12" "0000409088" "RDH12" "0000409089" "RDH12" "0000409090" "RDH12" "0000409091" "RDH12" "0000409092" "RDH12" "0000409093" "RDH12" "0000409094" "RDH12" "0000409095" "RDH12" "0000409096" "RDH12" "0000409097" "RDH12" "0000409098" "RDH12" "0000409099" "RDH12" "0000409100" "RDH12" "0000409101" "RDH12" "0000409102" "RDH12" "0000409103" "RDH12" "0000409104" "RDH12" "0000409105" "RDH12" "0000409106" "RDH12" "0000409107" "RDH12" "0000409108" "RDH12" "0000409109" "RDH12" "0000409110" "RDH12" "0000409111" "RDH12" "0000409112" "RDH12" "0000409113" "RDH12" "0000409114" "RDH12" "0000409115" "RDH12" "0000409116" "RDH12" "0000409117" "RDH12" "0000409118" "RDH12" "0000409119" "RDH12" "0000409120" "RDH12" "0000409121" "RDH12" "0000409122" "RDH12" "0000409128" "RDH12" "0000409129" "RDH12" "0000409130" "RDH12" "0000409131" "RDH12" "0000409132" "RDH12" "0000409133" "RDH12" "0000409134" "RDH12" "0000409135" "RDH12" "0000409136" "RDH12" "0000409137" "RDH12" "0000409151" "RDH12" "0000409153" "RDH12" "0000409154" "RDH12" "0000409194" "RDH12" "0000409200" "RDH12" "0000409201" "RDH12" "0000409202" "RDH12" "0000409203" "RDH12" "0000409204" "RDH12" "0000409205" "RDH12" "0000409206" "RDH12" "0000409207" "RDH12" "0000409208" "RDH12" "0000409209" "RDH12" "0000409210" "RDH12" "0000409211" "RDH12" "0000409212" "RDH12" "0000409213" "RDH12" "0000409214" "RDH12" "0000409215" "RDH12" "0000409216" "RDH12" "0000409217" "RDH12" "0000409218" "RDH12" "0000409219" "RDH12" "0000409220" "RDH12" "0000409223" "RDH12" "0000409224" "RDH12" "0000409225" "RDH12" "0000409226" "RDH12" "0000409227" "RDH12" "0000409228" "RDH12" "0000409229" "RDH12" "0000409230" "RDH12" "0000409231" "RDH12" "0000409232" "RDH12" "0000409233" "RDH12" "0000409234" "RDH12" "0000409235" "RDH12" "0000409236" "RDH12" "0000409237" "RDH12" "0000409238" "RDH12" "0000409239" "RDH12" "0000409240" "RDH12" "0000409241" "RDH12" "0000409242" "RDH12" "0000409243" "RDH12" "0000409244" "RDH12" "0000409245" "RDH12" "0000409246" "RDH12" "0000409247" "RDH12" "0000409248" "RDH12" "0000409249" "RDH12" "0000409250" "RDH12" "0000409251" "RDH12" "0000409252" "RDH12" "0000409253" "RDH12" "0000409254" "RDH12" "0000409255" "RDH12" "0000409256" "RDH12" "0000409257" "RDH12" "0000409258" "RDH12" "0000409259" "RDH12" "0000409260" "RDH12" "0000409261" "RDH12" "0000409262" "RDH12" "0000409263" "RDH12" "0000409264" "RDH12" "0000409265" "RDH12" "0000409266" "RDH12" "0000409267" "RDH12" "0000409268" "RDH12" "0000409269" "RDH12" "0000409270" "RDH12" "0000409271" "RDH12" "0000409272" "RDH12" "0000409273" "RDH12" "0000409274" "RDH12" "0000409275" "RDH12" "0000409276" "RDH12" "0000409277" "RDH12" "0000409278" "RDH12" "0000409279" "RDH12" "0000409280" "RDH12" "0000409284" "RDH12" "0000409285" "RDH12" "0000409286" "RDH12" "0000409287" "RDH12" "0000409288" "RDH12" "0000409289" "RDH12" "0000409290" "RDH12" "0000409291" "RDH12" "0000409292" "RDH12" "0000409293" "RDH12" "0000409294" "RDH12" "0000409295" "RDH12" "0000409296" "RDH12" "0000409298" "RDH12" "0000409299" "RDH12" "0000409300" "RDH12" "0000409301" "RDH12" "0000409302" "RDH12" "0000409303" "RDH12" "0000409304" "RDH12" "0000409306" "RDH12" "0000409311" "RDH12" "0000409313" "RDH12" "0000409319" "RDH12" "0000409320" "RDH12" "0000409321" "RDH12" "0000409322" "RDH12" "0000409324" "RDH12" "0000409325" "RDH12" "0000409677" "RDH12" "0000409695" "RDH12" "0000421767" "RDH12" "0000421889" "RDH12" "0000421900" "RDH12" "0000422823" "RDH12" "0000423994" "RDH12" "0000428228" "CNGA3" "0000428250" "RDH12" "0000430984" "RDH12" "0000431179" "RDH12" "0000431183" "RDH12" "0000431218" "RDH12" "0000431236" "RDH12" "0000431283" "RDH12" "0000431305" "RDH12" "0000431357" "RDH12" "0000431366" "RDH12" "0000431397" "RDH12" "0000431408" "RDH12" "0000431416" "RDH12" "0000431431" "RDH12" "0000431477" "RDH12" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 868 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000019487" "0" "90" "14" "68196055" "68196059" "del" "0" "00102" "RDH12_000008" "g.68196055_68196059del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000019488" "0" "90" "14" "68193744" "68193748" "del" "0" "00102" "RDH12_000007" "g.68193744_68193748del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67727027_67727031del" "" "pathogenic" "" "0000019489" "0" "90" "14" "68196055" "68196059" "del" "0" "00102" "RDH12_000008" "g.68196055_68196059del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000019490" "0" "90" "14" "68189422" "68189425" "del" "0" "00102" "RDH12_000011" "g.68189422_68189425del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67722705_67722708del" "" "pathogenic" "" "0000019525" "0" "90" "14" "68196055" "68196059" "del" "0" "00102" "RDH12_000008" "g.68196055_68196059del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000019526" "0" "70" "14" "68191288" "68191288" "subst" "0" "00102" "RDH12_000012" "g.68191288C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.67724571C>A" "" "likely pathogenic" "" "0000036427" "3" "50" "14" "68193850" "68193850" "subst" "0" "00552" "RDH12_000013" "g.68193850T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67727133T>C" "" "VUS" "" "0000036434" "3" "55" "14" "68193755" "68193755" "subst" "1.21828E-5" "00552" "RDH12_000006" "g.68193755G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67727038G>A" "" "VUS" "" "0000060172" "1" "90" "14" "68194498" "68201168" "delins" "0" "00229" "RDH12_000001" "g.68194498_68201168delinsCT" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67727781_67734451delinsCT" "" "pathogenic" "" "0000060173" "2" "90" "14" "68194498" "68201168" "delins" "0" "00229" "RDH12_000001" "g.68194498_68201168delinsCT" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67727781_67734451delinsCT" "" "pathogenic" "" "0000060174" "11" "90" "14" "68191299" "68191299" "subst" "0" "00039" "RDH12_000002" "g.68191299G>C" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.67724582G>C" "" "pathogenic" "" "0000060175" "2" "90" "14" "68191299" "68191299" "subst" "0" "00039" "RDH12_000002" "g.68191299G>C" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.67724582G>C" "" "pathogenic" "" "0000060176" "3" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00242" "RDH12_000003" "g.68191267C>T" "" "{PMID:Yücelyilmaz 2014:25148430}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67724550C>T" "" "pathogenic (recessive)" "" "0000060177" "1" "70" "14" "68200486" "68200486" "subst" "0" "00130" "RDH12_000004" "g.68200486C>T" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.67733769C>T" "" "likely pathogenic" "" "0000060178" "2" "70" "14" "68193773" "68193773" "subst" "2.03051E-5" "00130" "RDH12_000005" "g.68193773C>T" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.67727056C>T" "" "likely pathogenic" "" "0000060179" "3" "70" "14" "68192760" "68192760" "subst" "4.06108E-5" "00243" "RDH12_000009" "g.68192760C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67726043C>T" "" "likely pathogenic" "" "0000060182" "3" "70" "14" "68195995" "68195995" "subst" "0" "00243" "RDH12_000010" "g.68195995G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67729278G>T" "" "likely pathogenic" "" "0000081799" "1" "90" "14" "68196081" "68196081" "subst" "0" "01338" "RDH12_000014" "g.68196081A>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.67729364A>C" "" "pathogenic" "" "0000158352" "3" "90" "14" "68193858" "68193858" "subst" "2.84518E-5" "01769" "RDH12_000015" "g.68193858C>A" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67727141C>A" "" "pathogenic" "" "0000294775" "0" "50" "14" "68191969" "68191969" "subst" "0" "02330" "RDH12_000018" "g.68191969C>A" "" "" "" "RDH12(NM_152443.3):c.341C>A (p.A114E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67725252C>A" "" "VUS" "" "0000294776" "0" "10" "14" "68193740" "68193740" "subst" "1.21841E-5" "02330" "RDH12_000019" "g.68193740T>C" "" "" "" "RDH12(NM_152443.3):c.491T>C (p.V164A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67727023T>C" "" "benign" "" "0000294777" "0" "90" "14" "68193773" "68193773" "subst" "2.03051E-5" "02330" "RDH12_000005" "g.68193773C>T" "" "" "" "RDH12(NM_152443.2):c.524C>T (p.S175L), RDH12(NM_152443.3):c.524C>T (p.S175L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67727056C>T" "" "pathogenic" "" "0000294778" "0" "30" "14" "68193779" "68193779" "subst" "8.93387E-5" "02330" "RDH12_000020" "g.68193779C>T" "" "" "" "RDH12(NM_152443.2):c.530C>T (p.A177V), RDH12(NM_152443.3):c.530C>T (p.A177V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67727062C>T" "" "likely benign" "" "0000294779" "0" "10" "14" "68195895" "68195895" "subst" "4.10721E-6" "02330" "RDH12_000022" "g.68195895C>A" "" "" "" "RDH12(NM_152443.3):c.659-13C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67729178C>A" "" "benign" "" "0000294780" "0" "10" "14" "68191171" "68191172" "del" "8.12203E-6" "02330" "RDH12_000016" "g.68191171_68191172del" "" "" "" "RDH12(NM_152443.3):c.69-19_69-18delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67724454_67724455del" "" "benign" "" "0000294781" "0" "10" "14" "68200545" "68200545" "subst" "0.000337113" "02330" "RDH12_000025" "g.68200545C>T" "" "" "" "RDH12(NM_152443.3):c.931C>T (p.L311=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67733828C>T" "" "benign" "" "0000306892" "0" "50" "14" "68191306" "68191306" "subst" "8.12367E-6" "01943" "RDH12_000017" "g.68191306G>A" "" "" "" "RDH12(NM_152443.2):c.185G>A (p.R62Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67724589G>A" "" "VUS" "" "0000306893" "0" "50" "14" "68193808" "68193808" "subst" "8.12255E-6" "01943" "RDH12_000021" "g.68193808G>A" "" "" "" "RDH12(NM_152443.2):c.559G>A (p.D187N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67727091G>A" "" "VUS" "" "0000306894" "0" "50" "14" "68196006" "68196006" "subst" "0" "01943" "RDH12_000023" "g.68196006C>A" "" "" "" "RDH12(NM_152443.2):c.757C>A (p.P253T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67729289C>A" "" "VUS" "" "0000306896" "0" "90" "14" "68196055" "68196059" "del" "0" "01943" "RDH12_000008" "g.68196055_68196059del" "" "" "" "RDH12(NM_152443.2):c.806_810delCCCTG (p.A269Gfs*2), RDH12(NM_152443.3):c.806_810delCCCTG (p.A269Gfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000343178" "0" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "02327" "RDH12_000028" "g.68191305C>T" "" "" "" "RDH12(NM_152443.2):c.184C>T (p.R62*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67724588C>T" "" "pathogenic" "" "0000346264" "0" "70" "14" "68191854" "68191854" "subst" "0" "02327" "RDH12_000029" "g.68191854G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67725137G>C" "" "likely pathogenic" "" "0000346550" "0" "70" "14" "68191943" "68191943" "subst" "0" "02327" "RDH12_000031" "g.68191943C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67725226C>G" "" "likely pathogenic" "" "0000346755" "0" "70" "14" "68191273" "68191273" "subst" "0" "02327" "RDH12_000027" "g.68191273T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67724556T>C" "" "likely pathogenic" "" "0000347353" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "02327" "RDH12_000030" "g.68191923C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000348277" "0" "50" "14" "68189418" "68189418" "subst" "0" "02327" "RDH12_000026" "g.68189418C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67722701C>T" "" "VUS" "" "0000348782" "0" "90" "14" "68193773" "68193773" "subst" "2.03051E-5" "02327" "RDH12_000005" "g.68193773C>T" "" "" "" "RDH12(NM_152443.2):c.524C>T (p.S175L), RDH12(NM_152443.3):c.524C>T (p.S175L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67727056C>T" "" "pathogenic" "" "0000349298" "0" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "02327" "RDH12_000032" "g.68193713C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.67726996C>T" "" "pathogenic" "" "0000358316" "3" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "01243" "RDH12_000003" "g.68191267C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000358317" "0" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "01243" "RDH12_000033" "g.68191285C>T" "" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic (recessive)" "" "0000358318" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "01243" "RDH12_000030" "g.68191923C>A" "" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (recessive)" "" "0000358319" "3" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "01243" "RDH12_000034" "g.68192801C>T" "" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000358320" "3" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "01243" "RDH12_000035" "g.68193730C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic" "" "0000358321" "3" "90" "14" "68193908" "68193908" "subst" "0" "01243" "RDH12_000036" "g.68193908G>A" "" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "658G>A IVS5+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000358322" "3" "70" "14" "68195964" "68195964" "subst" "4.11529E-6" "01243" "RDH12_000037" "g.68195964C>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.67729247C>A" "" "likely pathogenic" "" "0000358323" "3" "70" "14" "68195989" "68195989" "subst" "0" "01243" "RDH12_000038" "g.68195989T>C" "" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.67729272T>C" "" "pathogenic (recessive)" "" "0000358450" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "01243" "RDH12_000030" "g.68191923C>A" "" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (recessive)" "" "0000438558" "1" "90" "14" "68191299" "68191299" "subst" "1.6247E-5" "01244" "RDH12_000040" "g.68191299G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67724582G>A" "" "pathogenic" "" "0000438559" "2" "90" "14" "68191906" "68191906" "subst" "1.62427E-5" "01244" "RDH12_000041" "g.68191906T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67725189T>C" "" "pathogenic" "" "0000438667" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "01244" "RDH12_000030" "g.68191923C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000438671" "3" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "01244" "RDH12_000032" "g.68193713C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>T" "" "pathogenic" "" "0000438674" "1" "90" "14" "68191906" "68191906" "subst" "1.62427E-5" "01244" "RDH12_000041" "g.68191906T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67725189T>C" "" "pathogenic" "" "0000438675" "2" "90" "14" "68195965" "68195965" "subst" "4.11479E-6" "01244" "RDH12_000042" "g.68195965G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67729248G>T" "" "pathogenic" "" "0000438676" "1" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "01244" "RDH12_000003" "g.68191267C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67724550C>T" "" "pathogenic" "" "0000438677" "2" "90" "14" "68191269" "68191269" "subst" "0" "01244" "RDH12_000039" "g.68191269G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67724552G>A" "" "pathogenic" "" "0000438691" "1" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "01244" "RDH12_000032" "g.68193713C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>T" "" "pathogenic" "" "0000438692" "2" "90" "14" "68195980" "68195980" "subst" "0" "01244" "RDH12_000043" "g.68195980T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.67729263T>C" "" "pathogenic" "" "0000441072" "3" "50" "14" "68193773" "68193773" "subst" "2.03051E-5" "02959" "RDH12_000005" "g.68193773C>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "g.67727056C>T" "{CV:000803392}" "VUS" "" "0000477050" "0" "50" "14" "68191911" "68191911" "subst" "4.06072E-5" "02591" "RDH12_000044" "g.68191911C>T" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs552516182" "0" "" "" "g.67725194C>T" "" "VUS" "" "0000477051" "0" "50" "14" "68191941" "68191941" "subst" "7.30935E-5" "02591" "RDH12_000045" "g.68191941A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs371493398" "0" "" "" "g.67725224A>G" "" "VUS" "" "0000477052" "0" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "02591" "RDH12_000034" "g.68192801C>T" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs202126574" "0" "" "" "g.67726084C>T" "" "pathogenic" "" "0000477053" "0" "90" "14" "68193730" "68193730" "subst" "2.43704E-5" "02591" "RDH12_000035" "g.68193730C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs759408031" "0" "" "" "g.67727013C>T" "" "pathogenic" "" "0000477054" "0" "50" "14" "68193731" "68193731" "subst" "0.131162" "02591" "RDH12_000046" "g.68193731G>A" "215/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17852293" "0" "" "" "g.67727014G>A" "" "VUS" "" "0000477055" "0" "90" "14" "68196003" "68196003" "del" "0" "02591" "RDH12_000047" "g.68196003del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.67729286del" "" "pathogenic" "" "0000477056" "0" "90" "14" "68196010" "68196011" "ins" "0" "02591" "RDH12_000048" "g.68196010_68196011insA" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.67729293_67729294insA" "" "pathogenic" "" "0000477583" "3" "50" "14" "68193731" "68193731" "subst" "0.131162" "02591" "RDH12_000046" "g.68193731G>A" "15/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17852293" "0" "" "" "g.67727014G>A" "" "VUS" "" "0000552870" "0" "50" "14" "68191206" "68191206" "subst" "7.71517E-5" "02330" "RDH12_000049" "g.68191206G>A" "" "" "" "RDH12(NM_152443.3):c.85G>A (p.G29R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67724489G>A" "" "VUS" "" "0000552871" "0" "50" "14" "68191212" "68191212" "subst" "8.12137E-6" "01943" "RDH12_000050" "g.68191212T>C" "" "" "" "RDH12(NM_152443.2):c.91T>C (p.C31R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67724495T>C" "" "VUS" "" "0000552872" "0" "50" "14" "68191843" "68191843" "subst" "0" "01943" "RDH12_000051" "g.68191843A>G" "" "" "" "RDH12(NM_152443.2):c.215A>G (p.D72G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67725126A>G" "" "VUS" "" "0000552873" "0" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "02330" "RDH12_000041" "g.68191906T>C" "" "" "" "RDH12(NM_152443.3):c.278T>C (p.L93P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000552874" "0" "90" "14" "68192873" "68192873" "subst" "0" "02330" "RDH12_000052" "g.68192873G>A" "" "" "" "RDH12(NM_152443.3):c.448+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67726156G>A" "" "pathogenic" "" "0000552875" "0" "30" "14" "68193779" "68193779" "subst" "8.93387E-5" "01943" "RDH12_000020" "g.68193779C>T" "" "" "" "RDH12(NM_152443.2):c.530C>T (p.A177V), RDH12(NM_152443.3):c.530C>T (p.A177V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67727062C>T" "" "likely benign" "" "0000552876" "0" "50" "14" "68193819" "68193819" "subst" "0.00124686" "02330" "RDH12_000053" "g.68193819C>T" "" "" "" "RDH12(NM_152443.3):c.570C>T (p.S190=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67727102C>T" "" "VUS" "" "0000552877" "0" "30" "14" "68193828" "68193828" "subst" "0.000284333" "01943" "RDH12_000054" "g.68193828C>T" "" "" "" "RDH12(NM_152443.2):c.579C>T (p.R193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67727111C>T" "" "likely benign" "" "0000552878" "0" "50" "14" "68195998" "68195998" "subst" "0" "01943" "RDH12_000055" "g.68195998T>C" "" "" "" "RDH12(NM_152443.2):c.749T>C (p.L250P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67729281T>C" "" "VUS" "" "0000615049" "0" "70" "14" "68195926" "68195926" "subst" "0" "02327" "RDH12_000056" "g.68195926A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000623155" "0" "50" "14" "68196010" "68196010" "subst" "0" "01943" "RDH12_000057" "g.68196010T>A" "" "" "" "RDH12(NM_152443.2):c.761T>A (p.F254Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67729293T>A" "" "VUS" "" "0000623156" "0" "90" "14" "68196055" "68196059" "del" "0" "02330" "RDH12_000008" "g.68196055_68196059del" "" "" "" "RDH12(NM_152443.2):c.806_810delCCCTG (p.A269Gfs*2), RDH12(NM_152443.3):c.806_810delCCCTG (p.A269Gfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000648952" "1" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "03575" "RDH12_000003" "g.68191267C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs28940314}" "Germline" "" "rs28940314" "0" "" "" "g.67724550C>T" "" "pathogenic" "" "0000657467" "0" "90" "14" "68193773" "68193773" "subst" "2.03051E-5" "01943" "RDH12_000005" "g.68193773C>T" "" "" "" "RDH12(NM_152443.2):c.524C>T (p.S175L), RDH12(NM_152443.3):c.524C>T (p.S175L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.67727056C>T" "" "pathogenic" "" "0000680016" "0" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "01943" "RDH12_000028" "g.68191305C>T" "" "" "" "RDH12(NM_152443.2):c.184C>T (p.R62*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000684418" "3" "70" "14" "68196055" "68196059" "del" "0" "00004" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "rs386834261" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic (recessive)" "" "0000684419" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00004" "RDH12_000032" "g.68193713C>T" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "rs121434337" "0" "" "" "g.67726996C>T" "" "likely pathogenic (recessive)" "" "0000684420" "1" "70" "14" "68196055" "68196059" "del" "0" "00004" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "rs386834261" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic (recessive)" "" "0000684437" "2" "70" "14" "68192827" "68192827" "subst" "0" "00004" "RDH12_000058" "g.68192827A>G" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "" "0" "" "" "g.67726110A>G" "" "likely pathogenic (recessive)" "" "0000684557" "1" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00004" "RDH12_000028" "g.68191305C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000684640" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00004" "RDH12_000015" "g.68193858C>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic (recessive)" "" "0000685388" "0" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00004" "RDH12_000003" "g.68191267C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685389" "0" "90" "14" "68191285" "68191285" "subst" "2.43647E-5" "00004" "RDH12_000033" "g.68191285C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685390" "0" "90" "14" "68191285" "68191285" "subst" "2.43647E-5" "00004" "RDH12_000033" "g.68191285C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685391" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000685392" "0" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00004" "RDH12_000034" "g.68192801C>T" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685393" "0" "90" "14" "68193730" "68193730" "subst" "2.43704E-5" "00004" "RDH12_000035" "g.68193730C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685395" "0" "70" "14" "68195965" "68195965" "subst" "4.11479E-6" "00004" "RDH12_000042" "g.68195965G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685396" "0" "90" "14" "68196008" "68196008" "del" "0" "00004" "RDH12_000059" "g.68196008del" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685397" "0" "90" "14" "68196070" "68196070" "subst" "0" "00004" "RDH12_000060" "g.68196070T>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685398" "0" "90" "14" "68196070" "68196070" "subst" "0" "00004" "RDH12_000060" "g.68196070T>C" "5/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000691695" "0" "50" "14" "68200519" "68200519" "subst" "0" "02330" "RDH12_000061" "g.68200519G>A" "" "" "" "RDH12(NM_152443.3):c.905G>A (p.R302H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000708307" "3" "70" "14" "68191272" "68191272" "subst" "0" "01164" "RDH12_000062" "g.68191272A>T" "" "" "" "" "ACMG: PM2, PM5, PP3 class 3" "Germline" "?" "" "" "" "" "" "" "VUS (!)" "ACMG" "0000710221" "1" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00006" "RDH12_000030" "g.68191923C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000710249" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00006" "RDH12_000030" "g.68191923C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000710266" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00006" "RDH12_000030" "g.68191923C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000710300" "1" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00006" "RDH12_000030" "g.68191923C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000710307" "3" "90" "14" "68192870" "68192870" "subst" "8.12222E-6" "00006" "RDH12_000063" "g.68192870T>C" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67726153T>C" "" "pathogenic" "" "0000710333" "2" "90" "14" "68192870" "68192870" "subst" "8.12222E-6" "00006" "RDH12_000063" "g.68192870T>C" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67726153T>C" "" "pathogenic" "" "0000710358" "2" "90" "14" "68195946" "68195946" "subst" "4.10334E-6" "00006" "RDH12_000064" "g.68195946G>C" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.67729229G>C" "" "pathogenic" "" "0000713496" "3" "90" "14" "68196054" "68196058" "del" "0.000183192" "00000" "RDH12_000066" "g.68196054_68196058del" "" "{PMID:Carss 2017:28041643}" "" "14:68196053CGCCCT>C ENST00000551171.1:c.806_810delCCCTG (Ala269GlyfsTer2)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713601" "3" "90" "14" "68196054" "68196058" "del" "0.000183192" "00000" "RDH12_000066" "g.68196054_68196058del" "" "{PMID:Carss 2017:28041643}" "" "14:68196053CGCCCT>C ENST00000551171.1:c.806_810delCCCTG (Ala269GlyfsTer2)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000714066" "3" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic (recessive)" "" "0000714067" "2" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic (recessive)" "" "0000714102" "1" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic (recessive)" "" "0000724844" "0" "50" "14" "68191313" "68191313" "subst" "0" "01943" "RDH12_000068" "g.68191313G>C" "" "" "" "RDH12(NM_152443.2):c.187+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724845" "0" "30" "14" "68195950" "68195950" "subst" "9.854E-5" "01943" "RDH12_000069" "g.68195950G>A" "" "" "" "RDH12(NM_152443.2):c.701G>A (p.R234H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000731138" "1" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731165" "2" "90" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731257" "2" "70" "14" "68191944" "68191944" "subst" "1.62433E-5" "00000" "RDH12_000070" "g.68191944C>T" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.67725227C>T" "" "likely pathogenic (recessive)" "" "0000731280" "1" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic (recessive)" "" "0000733191" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Stone 2017:28559085}" "" "805_809delGCCCT" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000733192" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Stone 2017:28559085}" "" "805_809delGCCCT" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000733193" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Stone 2017:28559085}" "" "805_809delGCCCT" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000733194" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Stone 2017:28559085}" "" "805_809delGCCCT" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000733195" "1" "70" "14" "68191254" "68191254" "dup" "0" "00000" "RDH12_000073" "g.68191254dup" "" "{PMID:Stone 2017:28559085}" "" "133_134insA" "" "Germline" "" "" "0" "" "" "g.67724537dup" "" "likely pathogenic" "" "0000733196" "3" "70" "14" "68195964" "68195964" "dup" "0" "00000" "RDH12_000076" "g.68195964dup" "" "{PMID:Stone 2017:28559085}" "" "713_714insC" "" "Germline" "" "" "0" "" "" "g.67729247dup" "" "likely pathogenic" "" "0000733625" "2" "70" "14" "68192801" "68192801" "subst" "0" "00000" "RDH12_000074" "g.68192801C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>A" "" "likely pathogenic" "" "0000733626" "2" "70" "14" "68191288" "68191288" "subst" "0" "00000" "RDH12_000012" "g.68191288C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.67724571C>A" "" "likely pathogenic" "" "0000733627" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000733628" "2" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000734352" "0" "70" "14" "68191242" "68191242" "subst" "0" "00000" "RDH12_000072" "g.68191242G>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Unknown" "" "" "0" "" "" "g.67724525G>T" "" "likely pathogenic" "" "0000734372" "0" "50" "14" "68200554" "68200554" "subst" "1.62492E-5" "00000" "RDH12_000077" "g.68200554C>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.67733837C>T" "" "VUS" "" "0000734373" "0" "50" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "VUS" "" "0000735652" "0" "90" "14" "68191273" "68191273" "subst" "0" "00000" "RDH12_000027" "g.68191273T>C" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.67724556T>C" "" "pathogenic" "" "0000735761" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000735906" "1" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "02485" "RDH12_000041" "g.68191906T>C" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000735962" "2" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "02485" "RDH12_000032" "g.68193713C>T" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000736056" "3" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "" "0000736067" "1" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "" "0000736120" "2" "90" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.67727038G>A" "" "pathogenic" "" "0000736556" "0" "90" "14" "68191254" "68191254" "subst" "0" "00000" "RDH12_000078" "g.68191254A>G" "" "{PMID:Zolnikova 2017:27939946}" "" "" "" "Germline" "" "" "0" "" "" "g.67724537A>G" "" "pathogenic" "" "0000736557" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Zolnikova 2017:27939946}" "" "" "" "Germline" "" "rs17852293" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000759663" "21" "90" "14" "68191267" "68191267" "subst" "8.12156E-6" "00000" "RDH12_000079" "g.68191267C>A" "" "{PMID:Zhang 2016:27596865}" "" "c.C146A" "" "Germline" "" "" "0" "" "" "g.67724550C>A" "" "pathogenic (recessive)" "ACMG" "0000759678" "11" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Zhang 2016:27596865}" "" "c.C295A" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic (recessive)" "ACMG" "0000759854" "1" "70" "14" "68189428" "68189428" "subst" "0" "00000" "RDH12_000080" "g.68189428G>A" "" "{PMID:Wang 2016:27422788}" "" "c.68 + 1G > A NA" "" "Germline" "" "" "0" "" "" "g.67722711G>A" "" "likely pathogenic" "" "0000759882" "2" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2016:27422788}" "" "c.T437A p.V146D" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "likely pathogenic" "" "0000759897" "3" "70" "14" "68196081" "68196081" "subst" "0" "00006" "RDH12_000014" "g.68196081A>C" "" "{PMID:Sundaramurthy 2016:27383656}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000759942" "1" "90" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.67725104C>T" "" "pathogenic (recessive)" "" "0000759963" "2" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic (recessive)" "" "0000760185" "0" "50" "14" "68192807" "68192807" "subst" "0" "00000" "RDH12_000082" "g.68192807T>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67726090T>G" "" "VUS" "" "0000760219" "0" "70" "14" "68193831" "68193831" "subst" "8.12354E-6" "00000" "RDH12_000083" "g.68193831C>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67727114C>G" "" "likely pathogenic" "" "0000760224" "0" "70" "14" "68193773" "68193773" "subst" "2.03051E-5" "00000" "RDH12_000005" "g.68193773C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67727056C>T" "" "likely pathogenic" "" "0000760262" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000760437" "0" "50" "14" "68200524" "68200524" "subst" "4.06118E-6" "00000" "RDH12_000087" "g.68200524T>C" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67733807T>C" "" "VUS" "" "0000760452" "0" "50" "14" "68196099" "68196099" "subst" "0" "00000" "RDH12_000086" "g.68196099T>C" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.67729382T>C" "" "VUS" "" "0000760455" "0" "50" "14" "68193897" "68193927" "del" "0" "00000" "RDH12_000084" "g.68193897_68193927del" "" "{PMID:Ellingford 2016:27208204}" "" "648_658+20delGAGGCTCCAAGGTAAGTCTGG" "" "Germline" "" "" "0" "" "" "g.67727180_67727210del" "" "VUS" "" "0000760607" "1" "50" "14" "68196012" "68196012" "del" "0" "00000" "RDH12_000085" "g.68196012del" "" "{PMID:Khan 2017:27160483}" "" "c.763delG" "variant does not fully segregate with disease" "Germline" "" "" "0" "" "" "g.67729295del" "" "VUS" "" "0000760666" "1" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000760683" "2" "90" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.67727013C>T" "" "pathogenic" "" "0000763954" "1" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00006" "RDH12_000033" "g.68191285C>T" "" "In press, {PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic (recessive)" "" "0000764019" "2" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00006" "RDH12_000089" "g.68196055C>G" "" "In press, {PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic (recessive)" "" "0000764040" "1" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Perez-Carro 2016:26806561}" "" "" "" "Germline" "" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000764066" "2" "70" "14" "68191838" "68191838" "dup" "0" "00000" "RDH12_000088" "g.68191838dup" "" "{PMID:Perez-Carro 2016:26806561}" "" "210_211insC" "" "Germline" "" "" "0" "" "" "g.67725121dup" "" "likely pathogenic" "" "0000765542" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000765549" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "" "0000765550" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>T" "" "pathogenic" "" "0000765569" "3" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Ge 2015:26667666}" "" "805_809del" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000765654" "3" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Beheshtian 2015:26497376}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67724588C>T" "" "pathogenic (recessive)" "" "0000765782" "0" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000765807" "1" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000765843" "0" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000765862" "0" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000765904" "0" "70" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67725137G>C" "" "likely pathogenic" "" "0000765931" "2" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000766057" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000766058" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766059" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766060" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766061" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766062" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766063" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766064" "0" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00004" "RDH12_000030" "g.68191923C>A" "11/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000766065" "0" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00004" "RDH12_000034" "g.68192801C>T" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000766066" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00004" "RDH12_000034" "g.68192801C>T" "4/2420 IRD families" "{PMID:Sharon 2015:26261414}, {PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000783276" "3" "70" "14" "68192760" "68192760" "subst" "4.06108E-5" "00000" "RDH12_000009" "g.68192760C>T" "" "{PMID:Srilekha 2015:26147992}" "" "" "" "Germline" "" "" "0" "" "" "g.67726043C>T" "" "likely pathogenic (recessive)" "" "0000783788" "3" "90" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67725137G>A" "" "pathogenic" "" "0000783863" "1" "50" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "VUS" "" "0000783864" "1" "50" "14" "68193872" "68193872" "subst" "0" "00000" "RDH12_000094" "g.68193872T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67727155T>A" "" "VUS" "" "0000783865" "1" "50" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "VUS" "" "0000783866" "1" "50" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67725104C>T" "" "VUS" "" "0000783867" "1" "50" "14" "68193754" "68193754" "subst" "1.62434E-5" "00000" "RDH12_000092" "g.68193754C>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67727037C>G" "" "VUS" "" "0000783956" "2" "50" "14" "68193850" "68193850" "del" "0" "00000" "RDH12_000093" "g.68193850del" "" "{PMID:Wang 2015:26047050}" "" "601delT" "" "Germline" "" "" "0" "" "" "g.67727133del" "" "VUS" "" "0000783957" "2" "50" "14" "68193773" "68193773" "subst" "2.03051E-5" "00000" "RDH12_000005" "g.68193773C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67727056C>T" "" "VUS" "" "0000783958" "2" "50" "14" "68195973" "68195975" "del" "0" "00000" "RDH12_000095" "g.68195973_68195975del" "" "{PMID:Wang 2015:26047050}" "" "721_723delTCC" "" "Germline" "" "" "0" "" "" "g.67729256_67729258del" "" "VUS" "" "0000783959" "2" "50" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67726144T>A" "" "VUS" "" "0000783960" "2" "50" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.67733780C>T" "" "VUS" "" "0000784159" "0" "50" "14" "68193826" "68193826" "subst" "0.000150278" "00000" "RDH12_000096" "g.68193826C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs148629905" "0" "" "" "g.67727109C>T" "" "VUS" "" "0000784215" "1" "90" "14" "68193847" "68193847" "subst" "0" "00000" "RDH12_000097" "g.68193847T>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.67727130T>C" "" "pathogenic (recessive)" "" "0000784216" "1" "90" "14" "68193848" "68193848" "subst" "0" "00000" "RDH12_000098" "g.68193848A>G" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.67727131A>G" "" "pathogenic (recessive)" "" "0000784582" "2" "90" "14" "68193847" "68193847" "subst" "0" "00000" "RDH12_000097" "g.68193847T>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.67727130T>C" "" "pathogenic (recessive)" "" "0000784583" "2" "90" "14" "68193848" "68193848" "subst" "0" "00000" "RDH12_000098" "g.68193848A>G" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.67727131A>G" "" "pathogenic (recessive)" "" "0000785954" "0" "77" "14" "68193866" "68193866" "subst" "0" "00008" "RDH12_000099" "g.68193866C>A" "" "{PMID:Jacobson 2007:17197551}" "" "A206D" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785955" "0" "77" "14" "0" "0" "" "0" "00008" "SERPINA1_000009" "g.?" "" "{PMID:Jacobson 2007:17197551}" "" "Y194X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785956" "0" "77" "14" "68193866" "68193866" "subst" "0" "00008" "RDH12_000099" "g.68193866C>A" "" "{PMID:Jacobson 2007:17197551}" "" "A206D" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785957" "0" "77" "14" "0" "0" "" "0" "00008" "SERPINA1_000009" "g.?" "" "{PMID:Jacobson 2007:17197551}" "" "Y194X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785958" "0" "77" "14" "68191923" "68191923" "subst" "6.49715E-5" "00008" "RDH12_000030" "g.68191923C>A" "" "{PMID:Jacobson 2007:17197551}" "" "L99I" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785959" "0" "77" "14" "68191260" "68191260" "subst" "8.12163E-6" "00008" "RDH12_000065" "g.68191260G>A" "" "{PMID:Jacobson 2007:17197551}" "" "A47T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785960" "0" "77" "14" "0" "0" "" "0" "00008" "SERPINA1_000009" "g.?" "" "{PMID:Jacobson 2007:17197551}" "" "R295X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785961" "0" "77" "14" "68191285" "68191285" "subst" "2.43647E-5" "00008" "RDH12_000033" "g.68191285C>T" "" "{PMID:Jacobson 2007:17197551}" "" "T55M" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000786302" "3" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "806_810del5" "" "Germline" "" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000786319" "0" "90" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.67729233G>A" "" "pathogenic" "" "0000786431" "1" "90" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "pathogenic (recessive)" "" "0000786487" "2" "90" "14" "68196093" "68196093" "subst" "4.30141E-6" "00000" "RDH12_000100" "g.68196093T>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.67729376T>G" "" "pathogenic (recessive)" "" "0000787735" "3" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "T49M" "" "Germline" "" "" "0" "" "" "g.67724550C>T" "" "pathogenic" "" "0000788086" "1" "90" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Oishi 2014:25324289}" "" "776delG" "" "Germline" "" "" "0" "" "" "g.67729310del" "" "pathogenic" "" "0000788087" "1" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>T" "" "pathogenic" "" "0000788527" "3" "90" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Watson 2014:25133751}" "" "" "" "Germline" "" "" "0" "" "" "g.67727133T>C" "" "pathogenic" "" "0000788534" "3" "90" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Watson 2014:25133751}" "" "" "" "Germline" "" "" "0" "" "" "g.67727038G>A" "" "pathogenic" "" "0000789847" "3" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Avela 2019:31087526}" "" "c.883C>T" "Check also: Thompson 2005" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789869" "3" "50" "14" "68195980" "68195980" "subst" "4.13042E-6" "00000" "RDH12_000102" "g.68195980T>A" "" "{PMID:Avela 2019:31087526}" "" "c.731T>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790728" "3" "70" "14" "68200526" "68200526" "subst" "0" "00000" "RDH12_000104" "g.68200526G>A" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.67733809G>A" "" "likely pathogenic" "" "0000790730" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000790731" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000790732" "3" "70" "14" "68196052" "68196052" "subst" "0" "00000" "RDH12_000103" "g.68196052G>T" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.67729335G>T" "" "likely pathogenic" "" "0000791166" "3" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000792054" "3" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.464C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792055" "3" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.464C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792056" "3" "90" "14" "68192799" "68192799" "subst" "0" "00000" "RDH12_000106" "g.68192799T>A" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.375T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792057" "3" "90" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.701G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792058" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.295C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792059" "3" "90" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.278T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792179" "0" "10" "14" "68191864" "68191864" "subst" "8.12137E-6" "00000" "RDH12_000105" "g.68191864C>T" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "236C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000793734" "3" "90" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Collin-2011:21217109}" "" "c.164C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793735" "3" "70" "14" "68191943" "68191943" "subst" "0" "00000" "RDH12_000031" "g.68191943C>G" "0/360 controls" "{PMID:Collin-2011:21217109}" "" "c.315C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793736" "3" "50" "14" "68194498" "68201837" "delins" "0" "00000" "RDH12_000107" "g.68194498_68201837delinsCT" "" "{PMID:Collin-2011:21217109}" "" "c.658+591_*603+669delinsCT" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000794363" "0" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_152443.2:c.146C>T, NP_689656.2:p.(Thr49Met), NC_000014.8:g.68191267C>T" "" "Germline" "?" "" "0" "" "" "g.67724550C>T" "" "pathogenic" "ACMG" "0000794364" "0" "90" "14" "68193754" "68193754" "subst" "8.1217E-6" "00000" "RDH12_000108" "g.68193754C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_152443.2:c.505C>T, NP_689656.2:p.(Arg169Trp), NC_000014.8:g.68193754C>T" "" "Germline" "?" "" "0" "" "" "g.67727037C>T" "" "pathogenic" "ACMG" "0000794365" "3" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2018:30029497}" "" "NM_152443.2:c.437T>A, NP_689656.2:p.(Val146Asp), NC_000014.8:g.68192861T>A" "" "Germline" "?" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "ACMG" "0000794366" "3" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2018:30029497}" "" "NM_152443.2:c.437T>A, NP_689656.2:p.(Val146Asp), NC_000014.8:g.68192861T>A" "" "Germline" "?" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "ACMG" "0000794987" "3" "50" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.226G>C" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000794988" "3" "50" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.139G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000794989" "3" "50" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.139G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000796007" "0" "30" "14" "68195974" "68195974" "subst" "0" "00000" "RDH12_000112" "g.68195974C>G" "" "{PMID:Chen-2013:23661368}" "" "c.725C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000796018" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Fu-2013:23661369}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796019" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Fu-2013:23661369}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796020" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Fu-2013:23661369}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796021" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Fu-2013:23661369}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796027" "0" "90" "14" "68193754" "68193754" "subst" "8.1217E-6" "00000" "RDH12_000108" "g.68193754C>T" "" "{PMID:Fu-2013:23661369}" "" "c.505C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796028" "0" "90" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Fu-2013:23661369}" "" "c.226G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796149" "0" "90" "14" "68191878" "68191878" "subst" "4.06065E-6" "00000" "RDH12_000110" "g.68191878C>T" "" "{PMID:Nishiguchi-2013:24043777}" "" "c.250C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796150" "0" "90" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000109" "g.68191854G>T" "" "{PMID:Nishiguchi-2013:24043777}" "" "c.226G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796171" "0" "70" "14" "68193773" "68193773" "subst" "2.03051E-5" "00000" "RDH12_000005" "g.68193773C>T" "" "{PMID:Neveling-2013:24123792}" "" "c.524C>T" "-" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000796172" "0" "70" "14" "68200486" "68200486" "subst" "0" "00000" "RDH12_000004" "g.68200486C>T" "" "{PMID:Neveling-2013:24123792}" "" "c.872C>T" "-" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000796206" "0" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Wang-2013:23847139}" "" "c.146C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796207" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2013:23847139}" "" "c.805_809del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796208" "0" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Wang-2013:23847139}" "" "c.146C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796209" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2013:23847139}" "" "c.805_809del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796210" "0" "90" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Wang-2013:23847139}" "" "c.164C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796211" "0" "90" "14" "68193831" "68193831" "subst" "8.12354E-6" "00000" "RDH12_000083" "g.68193831C>G" "" "{PMID:Wang-2013:23847139}" "" "c.582C>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796212" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2013:23847139}" "" "c.805_809del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796261" "0" "90" "14" "68195941" "68195941" "subst" "0" "00000" "RDH12_000111" "g.68195941G>A" "" "{PMID:Wang-2013:23847139}" "" "c.692G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796262" "0" "90" "14" "68196072" "68196072" "subst" "4.28222E-6" "00000" "RDH12_000113" "g.68196072G>T" "" "{PMID:Wang-2013:23847139}" "" "c.823G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796728" "3" "90" "14" "68191254" "68191254" "subst" "0" "00000" "RDH12_000078" "g.68191254A>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.133A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796747" "0" "70" "14" "68200531" "68200531" "subst" "4.06124E-6" "00000" "RDH12_000116" "g.68200531T>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.917T>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796773" "0" "90" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.226G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796775" "0" "90" "14" "68200483" "68200483" "subst" "6.49799E-5" "00000" "RDH12_000115" "g.68200483T>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.869T>G" "" "Germline" "" "rs61740289" "0" "" "" "" "" "pathogenic" "" "0000796828" "3" "90" "14" "68191816" "68191816" "subst" "0" "00000" "RDH12_000114" "g.68191816G>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.188G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796837" "0" "70" "14" "68200531" "68200531" "subst" "4.06124E-6" "00000" "RDH12_000116" "g.68200531T>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.917T>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796879" "0" "90" "14" "68193744" "68193748" "del" "0" "00000" "RDH12_000007" "g.68193744_68193748del" "" "{PMID:Wang-2014:24154662}" "" "c.495_499del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796880" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2014:24154662}" "" "c.806_810del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796881" "0" "90" "14" "68189422" "68189425" "del" "0" "00000" "RDH12_000011" "g.68189422_68189425del" "" "{PMID:Wang-2014:24154662}" "" "c.63_66del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796882" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2014:24154662}" "" "c.806_810del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796906" "0" "90" "14" "68191288" "68191288" "subst" "0" "00000" "RDH12_000012" "g.68191288C>A" "" "{PMID:Wang-2014:24154662}" "" "c.167C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796907" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Wang-2014:24154662}" "" "c.806_810del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000797086" "0" "90" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:Birtel 2018:30543658}" "" "c.226G>C, p.Gly76Arg" "Heterozygous" "Germline" "?" "rs368489658" "0" "" "" "g.67725137G>C" "" "pathogenic" "ACMG" "0000797087" "0" "90" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.701G>A, p.R234H" "Heterozygous" "Germline" "?" "rs750636662" "0" "" "" "g.67729233G>A" "" "pathogenic" "ACMG" "0000797158" "0" "90" "14" "68200483" "68200483" "subst" "6.49799E-5" "00000" "RDH12_000115" "g.68200483T>G" "" "{PMID:Birtel 2018:30543658}" "" "c.869T>G, p.Val290Gly" "Heterozygous" "Germline" "?" "rs61740289" "0" "" "" "g.67733766T>G" "" "pathogenic" "ACMG" "0000797159" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Birtel 2018:30543658}" "" "c.806_810delCCCTG, p.A269Gfs*2" "Heterozygous" "Germline" "" "rs386834261" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000797409" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Patel 2019:30653986}" "" "c.806_810del5; p.Ala269GlyfsTer2" "confirmed with Sanger sequencing; homozygous" "Germline" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000797770" "0" "50" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000119" "g.68195946G>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RDH12 c.451C>G, p.(His151Asp), c.697G>T, p.(Val233Phe)" "" "Germline" "?" "" "0" "" "" "g.67729229G>T" "" "VUS" "ACMG" "0000797771" "0" "90" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "RDH12 c.451C>G, p.(His151Asp), c.697G>T, p.(Val233Phe)" "" "Germline" "?" "" "0" "" "" "g.67726983C>G" "" "pathogenic" "ACMG" "0000797772" "3" "70" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000109" "g.68191854G>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RDH12 c.226G>T, p.(Gly76Trp), c.226G>T, p.(Gly76Trp)" "homozygous" "Germline" "?" "" "0" "" "" "g.67725137G>T" "" "likely pathogenic" "ACMG" "0000797773" "3" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RDH12 c.379G>T, p.(Gly127*), c.379G>T, p.(Gly127*)" "homozygous" "Germline" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "ACMG" "0000797774" "3" "70" "14" "68193859" "68193859" "subst" "0" "00000" "RDH12_000118" "g.68193859A>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "RDH12 c.610A>C, p.(Lys204Gln), c.610A>C, p.(Lys204Gln)" "homozygous" "Germline" "?" "" "0" "" "" "g.67727142A>C" "" "likely pathogenic" "ACMG" "0000798487" "3" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Beryozkin-2014:24474277}" "" "c.146C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798488" "3" "90" "14" "68193908" "68193908" "subst" "0" "00000" "RDH12_000036" "g.68193908G>A" "" "{PMID:Beryozkin-2014:24474277}" "" "c.IVS5+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798489" "3" "90" "14" "68195989" "68195989" "subst" "0" "00000" "RDH12_000038" "g.68195989T>C" "" "{PMID:Beryozkin-2014:24474277}" "" "c.740T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798494" "3" "90" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Beryozkin-2014:24474277}" "" "c.481C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798495" "3" "90" "14" "68195965" "68195965" "subst" "8.22957E-6" "00000" "RDH12_000120" "g.68195965G>A" "" "{PMID:Beryozkin-2014:24474277}" "" "c.716G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798499" "3" "90" "14" "68195989" "68195989" "subst" "0" "00000" "RDH12_000038" "g.68195989T>C" "" "{PMID:Beryozkin-2014:24474277}" "" "c.740T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798500" "3" "90" "14" "68191924" "68191924" "subst" "0" "00000" "SERPINA1_000009" "g.68191924C>A" "" "{PMID:Beryozkin-2014:24474277}" "" "c.296C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000806468" "0" "90" "14" "68191285" "68191285" "subst" "2.43647E-5" "01943" "RDH12_000033" "g.68191285C>T" "" "" "" "RDH12(NM_152443.2):c.164C>T (p.T55M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000806469" "0" "50" "14" "68193830" "68193830" "subst" "0" "01943" "RDH12_000121" "g.68193830A>G" "" "" "" "RDH12(NM_152443.2):c.581A>G (p.Y194C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000811808" "0" "70" "1" "68192861" "68192861" "subst" "0" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Gao 2019:31054281}" "" "c.437T>A, p.Val146Asp" "heterozygous" "Germline" "?" "" "0" "" "" "g.67726144T>A" "" "likely pathogenic" "" "0000811829" "0" "70" "1" "68192801" "68192801" "subst" "0" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Gao 2019:31054281}" "" "c.377C>T, p.Ala126Val" "heterozygous" "Germline" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000811886" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Gao 2019:31054281}" "" "c.437T>A, p.Val146Asp" "heterozygous" "Germline" "?" "" "0" "" "" "g.67726144T>A" "" "likely pathogenic" "" "0000811887" "0" "70" "3" "68191815" "68191815" "subst" "0" "00000" "RDH12_000001" "g.68191815G>A" "" "{PMID:Gao 2019:31054281}" "" "c.188-1G>A Het" "heterozygous" "Germline" "?" "" "0" "" "" "g.67725098G>A" "" "likely pathogenic" "" "0000812027" "0" "70" "14" "68192799" "68192799" "subst" "0" "00000" "RDH12_000106" "g.68192799T>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.6 c.375T>A p.(Asn125Lys), Ex.8 c.701G>A p.(Arg234His)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67726082T>A" "" "likely pathogenic" "" "0000812028" "0" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.6 c.375T>A p.(Asn125Lys), Ex.8 c.701G>A p.(Arg234His)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000812032" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.5 c.295C>A p.(Leu99Ile)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812046" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.7 c.617C>T p.(Ala206Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812047" "0" "70" "14" "68193866" "68193866" "subst" "4.06683E-6" "00000" "RDH12_000122" "g.68193866C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.7 c.617C>T p.(Ala206Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67727149C>T" "" "likely pathogenic" "" "0000812069" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.8 c.806_810del p.(Ala269Glyfs*2), Ex.8 c.806_810del p.(Ala269Glyfs*2)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000812086" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.5 c.295C>A p.(Leu99Ile), AIPL1 : Ex.2 c.112del p.(Arg38Alafs*3)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812110" "3" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.5 c.278T>C p.(Leu93Pro)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000812124" "3" "70" "14" "68193866" "68193866" "subst" "4.06683E-6" "00000" "RDH12_000122" "g.68193866C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.7 c.617C>T p.(Ala206Val), Ex.7 c.617C>T p.(Ala206Val)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727149C>T" "" "likely pathogenic" "" "0000812127" "0" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.5 c.295C>A p.(Leu99Ile)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000812128" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.5 c.295C>A p.(Leu99Ile)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812207" "0" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.6 c.375T>A p.(Asn125Lys), CDH3: Ex.10 c.1291_1294del p.(Val431Argfs*3) //EYS : Ex.43 c.9405T>A p.(Tyr3135*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000812208" "0" "70" "14" "68192799" "68192799" "subst" "0" "00000" "RDH12_000106" "g.68192799T>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.6 c.375T>A p.(Asn125Lys), CDH3: Ex.10 c.1291_1294del p.(Val431Argfs*3) //EYS : Ex.43 c.9405T>A p.(Tyr3135*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67726082T>A" "" "likely pathogenic" "" "0000812212" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.5 c.295C>A p.(Leu99Ile)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812213" "0" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.8 c.806_810del p.(Ala269Glyfs*2), Ex.8 c.701G>A p.(Arg234His)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000812214" "0" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.8 c.806_810del p.(Ala269Glyfs*2), Ex.8 c.701G>A p.(Arg234His)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000812274" "0" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.5 c.210dup p.(Arg71Glnfs*12)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725189T>C" "" "likely pathogenic" "" "0000812275" "0" "70" "14" "68191838" "68191838" "dup" "0" "00000" "RDH12_000088" "g.68191838dup" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.278T>C p.(Leu93Pro), Ex.5 c.210dup p.(Arg71Glnfs*12)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725121dup" "" "likely pathogenic" "" "0000812328" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.8 c.689C>G p.(Pro230Arg)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000812329" "0" "70" "14" "68195938" "68195938" "subst" "0" "00000" "RDH12_000123" "g.68195938C>G" "" "{PMID:Martin Merida 2019:30902645}" "" "RDH12 Ex.5 c.295C>A p.(Leu99Ile), Ex.8 c.689C>G p.(Pro230Arg)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729221C>G" "" "likely pathogenic" "" "0000812823" "0" "70" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Wang 2019:31106028}" "" "c.226G>A, p.(Gly76Arg)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.67725137G>A" "" "likely pathogenic" "" "0000812824" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Wang 2019:31106028}" "" "c.437T>A, p.(Val146Asp)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.67726144T>A" "" "likely pathogenic" "" "0000813009" "0" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Ehrenberg 2019:31814694}" "" "RDH12 (NM_152443; OMIM: 608830): c.164C>T; p.Thr55Met (het) c.295C>A; p.Leu99Ile (het) (RP), OTX2 (NM_021728.3; OMIM: 600037): duplica tion Arr[hg19]14q22.3 (57269186_57925544)dup (het) (hemifacial microsomia)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic" "" "0000813024" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Ehrenberg 2019:31814694}" "" "RDH12 (NM_152443; OMIM: 608830): c.164C>T; p.Thr55Met (het) c.295C>A; p.Leu99Ile (het) (RP), OTX2 (NM_021728.3; OMIM: 600037): duplica tion Arr[hg19]14q22.3 (57269186_57925544)dup (het) (hemifacial microsomia)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000813634" "3" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.24259T>A, c.437T>A, p.V146D" "" "Germline" "yes" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "ACMG" "0000813636" "0" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.24259T>A, c.437T>A, p.V146D" "single heterozygous" "Unknown" "?" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "ACMG" "0000813643" "1" "90" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.23219C>T, c.193C>T, p.R65X" "" "Germline" "yes" "" "0" "" "" "g.67725104C>T" "" "pathogenic" "ACMG" "0000813650" "1" "70" "14" "68193757" "68193757" "subst" "0" "00000" "RDH12_000125" "g.68193757G>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.25155G>A, c.508G>A, p.V170M" "" "Germline" "yes" "" "0" "" "" "g.67727040G>A" "" "likely pathogenic" "ACMG" "0000813652" "1" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.24199C>T, c.377C>T, p.A126V" "" "Germline" "yes" "" "0" "" "" "g.67726084C>T" "" "pathogenic" "ACMG" "0000813667" "3" "70" "14" "68195934" "68195934" "subst" "0" "00000" "RDH12_000126" "g.68195934C>T" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.27332C>T, c.685C>T, p.H229Y" "" "Germline" "yes" "" "0" "" "" "g.67729217C>T" "" "likely pathogenic" "ACMG" "0000813709" "1" "90" "14" "68189428" "68189428" "subst" "0" "00000" "RDH12_000080" "g.68189428G>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.20826G>A, c.68+1G>A" "" "Germline" "yes" "" "0" "" "" "g.67722711G>A" "" "pathogenic" "ACMG" "0000813731" "1" "90" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.23252G>A, c.226G>A, p.G76R" "" "Germline" "yes" "" "0" "" "" "g.67725137G>A" "" "pathogenic" "ACMG" "0000813741" "2" "90" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.23252G>A, c.226G>A, p.G76R" "" "Germline" "yes" "" "0" "" "" "g.67725137G>A" "" "pathogenic" "ACMG" "0000813745" "2" "90" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.22658G>A, c.139G>A, p.A47T" "" "Germline" "yes" "" "0" "" "" "g.67724543G>A" "" "pathogenic" "ACMG" "0000813747" "2" "90" "14" "68195972" "68195972" "del" "0" "00000" "RDH12_000127" "g.68195972del" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.27369_27369delC, c.722delC, p.S242Pfs36" "" "Germline" "yes" "" "0" "" "" "g.67729255del" "" "pathogenic" "ACMG" "0000813778" "2" "90" "14" "68191285" "68191285" "subst" "0" "00000" "RDH12_000124" "g.68191285C>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.22683C>A, c.164C>A, p.T55K" "" "Germline" "yes" "" "0" "" "" "g.67724568C>A" "" "pathogenic" "ACMG" "0000813791" "2" "90" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Xu 2020:31630094}" "" "RDH12 NM_152443: g.24259T>A, c.437T>A, p.V146D" "" "Germline" "yes" "" "0" "" "" "g.67726144T>A" "" "pathogenic" "ACMG" "0000814040" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814041" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814042" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814043" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814044" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814045" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814046" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814047" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/A126V" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814048" "0" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Benayoun-2009:19140180}" "" "A126V/wt" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000814277" "3" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Chen 2020:31872526}" "" "RDH12:NM_152443:exon4:c.139G>A:p.A47T" "homozygous" "Germline" "?" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000815309" "0" "90" "14" "68196044" "68196044" "subst" "0" "00000" "RDH12_000128" "g.68196044C>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RDH12:NM_152443 c.C795A, p.S265R" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67729327C>A" "" "pathogenic" "ACMG" "0000815392" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "c.806_810del; p.(Ala269Glyfs*2)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000815393" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RDH12:NM_152443 c.806_810del, p.(Ala269Glyfs*2)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000815464" "0" "90" "14" "68195938" "68195938" "subst" "0" "00000" "RDH12_000123" "g.68195938C>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RDH12:NM_152443 c.C689G, p.P230R" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67729221C>G" "" "pathogenic" "ACMG" "0000815543" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "c.295C>A; p.(Leu99Ile)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "ACMG" "0000815546" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RDH12:NM_152443 c.C295A, p.L99I" "homozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "ACMG" "0000816168" "0" "70" "14" "68192864" "68192864" "subst" "0" "00000" "RDH12_000130" "g.68192864A>C" "" "{PMID:Zampaglione 2020:32037395}" "" "RDH12 c.440A>C, p.Asn147Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726147A>C" "" "likely pathogenic" "" "0000816200" "3" "50" "14" "68192831" "68192831" "subst" "0" "00000" "RDH12_000129" "g.68192831C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "RDH12 c.407C>T, p.Thr136Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726114C>T" "" "VUS" "" "0000816472" "0" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.701G>A, p.Arg234His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000816500" "0" "50" "14" "68192831" "68192831" "subst" "0" "00000" "RDH12_000129" "g.68192831C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.407C>T, p.Thr136Ile" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726114C>T" "" "VUS" "" "0000817681" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Zanolli 2020:32141364}" "" "RDH12 c.295C>A; c.295C>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000817682" "1" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Zanolli 2020:32141364}" "" "RDH12 c.295C>A; c.716G>T" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000817683" "2" "70" "14" "68195965" "68195965" "subst" "4.11479E-6" "00000" "RDH12_000042" "g.68195965G>T" "" "{PMID:Zanolli 2020:32141364}" "" "RDH12 c.295C>A; c.716G>T" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67729248G>T" "" "likely pathogenic" "" "0000819510" "1" "70" "14" "68196070" "68196070" "subst" "0" "00000" "RDH12_000060" "g.68196070T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.821T>C/p.L274P, variant 2: c.821T>C/p.L274P" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67729353T>C" "" "likely pathogenic" "" "0000819511" "1" "70" "14" "68196070" "68196070" "subst" "0" "00000" "RDH12_000060" "g.68196070T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.821T>C/p.L274P, variant 2: c.821T>C/p.L274P" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67729353T>C" "" "likely pathogenic" "" "0000819709" "1" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.379G>T/p.G127*, variant 2: c.379G>T/p.G127*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000819713" "1" "70" "14" "68191944" "68191944" "subst" "1.62433E-5" "00000" "RDH12_000070" "g.68191944C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.316C>T/p.R106*, variant 2: c.316C>T/p.R106*" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.67725227C>T" "" "likely pathogenic" "" "0000819769" "1" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.379G>T/p.G127*, variant 2: c.379G>T/p.G127*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000820001" "1" "70" "14" "68193848" "68193848" "subst" "0" "00000" "RDH12_000131" "g.68193848A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.599A>C/p.Y200S, variant 2: c.599A>C/p.Y200S" "possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67727131A>C" "" "likely pathogenic" "" "0000820113" "1" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.379G>T/p.G127*, variant 2: c.379G>T/p.G127*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000820224" "1" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.146C>T/p.T49M, variant 2: c.146C>T/p.T49M" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000820387" "1" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.146C>T/p.T49M, variant 2: c.451C>G/p.H151D" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000820457" "1" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.464C>T/p.T155I, variant 2: c.464C>T/p.T155I" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000820515" "1" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.164C>T/p.T55M, variant 2: c.164C>T/p.T55M" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic" "" "0000820518" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.806_810del/p.A269Gfs*2, variant 2: c.677A>G/p.Y226C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000820891" "1" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.146C>T/p.T49M, variant 2: c.451C>G/p.H151D" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000820954" "1" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RDH12, variant 1: c.806_810del/p.A269Gfs*2, variant 2: c.677A>G/p.Y226C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000821350" "3" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Turro 2020:32581362}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsTer2" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000821351" "3" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Turro 2020:32581362}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsTer2" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "" "0000821597" "0" "70" "14" "68176483" "68197327" "del" "0" "00000" "SERPINA1_000009" "g.68176483_68197327del" "" "{PMID:Turro 2020:32581362}" "" "chr14:g.68176483_68197327del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" "" "0000822934" "3" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Méjécase 2020:32783370}" "" "RDH12 c.139G>A p.(Ala47Thr)" "homozygous" "Unknown" "?" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000823382" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.806_810deICCCTG; p.AIa269GIyfsTer2" "homozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000823383" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823384" "0" "70" "14" "68193847" "68193847" "subst" "0" "00000" "RDH12_000097" "g.68193847T>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.598T>C; p.Tyr200His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727130T>C" "" "likely pathogenic" "ACMG" "0000823385" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823386" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823387" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.806_810deICCCTG; p.AIa269GIyfsTer2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000823388" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "homozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823442" "0" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.184C>T; p.Arg62Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "pathogenic" "ACMG" "0000823443" "0" "50" "14" "68195947" "68195948" "delins" "0" "00000" "RDH12_000134" "g.68195947_68195948delinsAA" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698 699delTCinsAA; p.VaI233GIu" "homozygous" "Unknown" "?" "" "0" "" "" "g.67729230_67729231delinsAA" "" "VUS" "ACMG" "0000823444" "0" "50" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.677A>G; p.Tyr226Cys" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729209A>G" "" "VUS" "ACMG" "0000823445" "0" "90" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.806_810deICCCTG; p.AIa269GIyfsTer2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "pathogenic" "ACMG" "0000823446" "0" "50" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.295C>A; p.Leu99IIe" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "VUS" "ACMG" "0000823510" "0" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.184C>T; p.Arg62Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "pathogenic" "ACMG" "0000823511" "0" "50" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.146C>T; p.Thr49Met" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "VUS" "ACMG" "0000823512" "0" "50" "14" "68191246" "68191246" "subst" "0" "00000" "RDH12_000132" "g.68191246T>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.125T>C; p.VaI42AIa" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724529T>C" "" "VUS" "ACMG" "0000823513" "0" "50" "14" "68191246" "68191246" "subst" "0" "00000" "RDH12_000132" "g.68191246T>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.12ST>C; p.VaI42AIa" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724529T>C" "" "VUS" "ACMG" "0000823514" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823544" "0" "50" "14" "68191299" "68191299" "subst" "0" "00000" "RDH12_000002" "g.68191299G>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.178G>C; p.AIa60Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724582G>C" "" "VUS" "ACMG" "0000823545" "0" "50" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.698T>A; p.VaI233Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "VUS" "ACMG" "0000823546" "0" "50" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.278T>C; p.Leu93Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725189T>C" "" "VUS" "ACMG" "0000823559" "0" "50" "14" "68191953" "68191953" "subst" "0" "00000" "RDH12_000133" "g.68191953G>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.325G>C; p.AIa109Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725236G>C" "" "VUS" "ACMG" "0000823560" "0" "50" "14" "68191953" "68191953" "subst" "0" "00000" "RDH12_000133" "g.68191953G>C" "" "{PMID:Sallum 2020:32865313}" "" "RDH12 c.325G>C; p.AIa109Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725236G>C" "" "VUS" "ACMG" "0000824691" "0" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Ma 2021:33691693}" "" "RDH12 c.C377T, p.A126V" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "ACMG" "0000824780" "0" "70" "14" "68195964" "68195964" "subst" "0" "00000" "RDH12_000135" "g.68195964C>G" "" "{PMID:Ma 2021:33691693}" "" "RDH12 c.C715G, p.R239G" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.67729247C>G" "" "likely pathogenic" "ACMG" "0000825887" "3" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Liu-2020:33090715}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825953" "3" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Liu-2020:33090715}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825970" "3" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Liu-2020:33090715}" "" "c.193C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826014" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Liu-2020:33090715}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826015" "0" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Liu-2020:33090715}" "" "c.146C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826061" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Liu-2020:33090715}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826062" "0" "70" "14" "68195920" "68195920" "subst" "8.1984E-6" "00000" "RDH12_000137" "g.68195920C>T" "" "{PMID:Liu-2020:33090715}" "" "c.671C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826118" "0" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Liu-2020:33090715}" "" "c.139G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826119" "0" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Liu-2020:33090715}" "" "c.437T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826150" "0" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Liu-2020:33090715}" "" "c.377C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826151" "0" "70" "14" "68193754" "68193754" "subst" "8.1217E-6" "00000" "RDH12_000108" "g.68193754C>T" "" "{PMID:Liu-2020:33090715}" "" "c.505C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826187" "3" "70" "14" "68195916" "68195916" "subst" "0" "00000" "RDH12_000136" "g.68195916G>T" "" "{PMID:Liu-2020:33090715}" "" "c.667G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826217" "3" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Liu-2020:33090715}" "" "c.146C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827154" "0" "90" "14" "68195929" "68195933" "delins" "0" "00000" "RDH12_000138" "g.68195929_68195933delinsT" "" "{PMID:Colombo-2020:33576794}" "" "c.680_684delinsT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827318" "3" "70" "14" "68195916" "68195916" "subst" "0" "00000" "RDH12_000136" "g.68195916G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.667G>T" "" "Germline" "" "rs370015375" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000828310" "3" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Shen 2021:34130719}" "" "RDH12 c.437 T > A, p.V146D" "homozygous, no ACMG classification" "Germline" "yes" "" "0" "" "" "g.67726144T>A" "" "likely pathogenic" "" "0000828502" "3" "90" "14" "68191906" "68191906" "subst" "1.62427E-5" "00000" "RDH12_000041" "g.68191906T>C" "" "{PMID:Perea-Romero 2021:34448047}" "" "RDH12, gene that can display both dominant and recessive patterns of inheritance, c.278T>C, p.Leu93Pro, homozygous" "" "Unknown" "?" "" "0" "" "" "g.67725189T>C" "" "pathogenic" "ACMG" "0000828518" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Perea-Romero 2021:34448047}" "" "RDH12, gene that can display both dominant and recessive patterns of inheritance, c.295C>A, p.Leu99Ile, homozygous" "" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "ACMG" "0000828795" "0" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.377C>T(;)505C>G, V1: c.377C>T, (p.Ala126Val)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "ACMG" "0000828827" "0" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.146C>T(;)806C>G, V1: c.146C>T, (p.Thr49Met)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "ACMG" "0000828828" "0" "70" "14" "68193754" "68193754" "subst" "1.62434E-5" "00000" "RDH12_000092" "g.68193754C>G" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.505C>G(;)806C>G, V1: c.505C>G, (p.Arg169Gly)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67727037C>G" "" "likely pathogenic" "ACMG" "0000829000" "0" "70" "14" "68193754" "68193754" "subst" "1.62434E-5" "00000" "RDH12_000092" "g.68193754C>G" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.377C>T(;)505C>G, V2: c.505C>G, (p.Arg169Gly)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67727037C>G" "" "likely pathogenic" "ACMG" "0000829032" "0" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00000" "RDH12_000089" "g.68196055C>G" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.146C>T(;)806C>G, V2: c.806C>G, (p.Ala269Gly)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic" "ACMG" "0000829033" "0" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00000" "RDH12_000089" "g.68196055C>G" "" "{PMID:Chen 2021:43360855}" "" "RDH12 c.505C>G(;)806C>G, V2: c.806C>G, (p.Ala269Gly)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic" "ACMG" "0000841439" "3" "90" "14" "68191854" "68191854" "subst" "0" "00006" "RDH12_000029" "g.68191854G>C" "" "{PMID:Aldahmesh 2009:19956407}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000845991" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845992" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845993" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845994" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845995" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845996" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845997" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845998" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000845999" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846000" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846001" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846002" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846003" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846004" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846005" "3" "70" "17" "68195926" "68195926" "subst" "0" "00000" "RDH12_000004" "g.68195926A>G" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 677A->G, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846006" "3" "70" "17" "68196055" "68196059" "del" "0" "00000" "RDH12_000005" "g.68196055_68196059del" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 806delCCCTG, Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846007" "3" "70" "17" "68193814" "68193814" "subst" "0" "00000" "RDH12_000003" "g.68193814C>T" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 565C->T, Q189X" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727097C>T" "" "likely pathogenic" "" "0000846008" "3" "70" "17" "68193814" "68193814" "subst" "0" "00000" "RDH12_000003" "g.68193814C>T" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 565C->T, Q189X" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727097C>T" "" "likely pathogenic" "" "0000846009" "1" "70" "17" "68191267" "68191267" "subst" "0" "00000" "RDH12_000001" "g.68191267C>T" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 146C->T, T49M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846010" "2" "70" "17" "68191305" "68191305" "subst" "0" "00000" "RDH12_000002" "g.68191305C>T" "" "{PMID:Janecke 2004:15258582}" "" "RDH12 184C->T, R62X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846030" "21" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.184C>T, p.Arg62X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846031" "11" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.379G>T, p.Gly127X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846032" "11" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.379G>T, p.Gly127X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846033" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846034" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846035" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846036" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846037" "3" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.451C>G, p.His151Asp" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846038" "3" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.451C>G, p.His151Asp" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846039" "21" "70" "14" "68193772" "68193772" "subst" "0" "00000" "RDH12_000149" "g.68193772T>C" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.523T>C, p.Ser175Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727055T>C" "" "likely pathogenic" "" "0000846040" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846041" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.806_810delCCCTG, p.Ala269fsX270" "error in annotation, stop codon occurs after 2 amino acids and not 270 (p.Ala269Glyfs*2); homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846042" "11" "70" "14" "68191273" "68191273" "subst" "0" "00000" "RDH12_000142" "g.68191273T>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.152T>A, p.Ile51Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724556T>A" "" "likely pathogenic" "" "0000846043" "21" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.295C>A, p.Leu99Ile" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846044" "21" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.295C>A, p.Leu99Ile" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846045" "11" "70" "14" "68195937" "68195937" "subst" "0" "00000" "RDH12_000153" "g.68195937C>G" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.687C>G, p.Pro230Ala" "error in annotation, c.688C>G causes p.Pro230Ala, and not c.687C>G; heterozygous" "Germline" "yes" "" "0" "" "" "g.67729220C>G" "" "likely pathogenic" "" "0000846046" "11" "70" "14" "68195937" "68195937" "subst" "0" "00000" "RDH12_000153" "g.68195937C>G" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.687C>G, p.Pro230Ala" "error in annotation, c.688C>G causes p.Pro230Ala, and not c.687C>G; heterozygous" "Germline" "yes" "" "0" "" "" "g.67729220C>G" "" "likely pathogenic" "" "0000846047" "11" "70" "14" "68193700" "68193700" "subst" "0" "00000" "RDH12_000147" "g.68193700C>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.451C>A, p.His151Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>A" "" "likely pathogenic" "" "0000846048" "11" "70" "14" "68193700" "68193700" "subst" "0" "00000" "RDH12_000147" "g.68193700C>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.451C>A, p.His151Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>A" "" "likely pathogenic" "" "0000846049" "11" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.677A>G, p.Tyr226Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846050" "10" "70" "14" "68193908" "68193908" "subst" "0" "00000" "RDH12_000036" "g.68193908G>A" "" "{PMID:Perrault 2004:15322982}" "" "RDH12 c.658+1G>A, Aberrant splicing" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727191G>A" "" "likely pathogenic" "" "0000846069" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846070" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846071" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.464C>T, p.T155I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , homozygous" "Germline" "yes" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000846072" "3" "70" "14" "68196070" "68196070" "subst" "0" "00000" "RDH12_000060" "g.68196070T>C" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.821T>C, p.L274P" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729353T>C" "" "likely pathogenic" "" "0000846073" "3" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.379G>T, p.G127X" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846074" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsX1" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846075" "21" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846076" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846077" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.464C>T, p.T155I" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000846078" "21" "70" "14" "68191220" "68191223" "dup" "0" "00000" "RDH12_000140" "g.68191220_68191223dup" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.99_102dupAAAT, p.Val35LysfsX27" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67724503_67724506dup" "" "likely pathogenic" "" "0000846079" "21" "70" "14" "68189361" "68189361" "subst" "0" "00000" "RDH12_000139" "g.68189361T>C" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.2T>C, p.M1?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67722644T>C" "" "likely pathogenic" "" "0000846080" "11" "70" "14" "68192799" "68192799" "subst" "0" "00000" "RDH12_000106" "g.68192799T>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.375T>A, p.N125K" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67726082T>A" "" "likely pathogenic" "" "0000846081" "11" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.451C>G, p.H151D" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846082" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846083" "3" "70" "14" "68200468" "68200468" "subst" "0" "00000" "RDH12_000157" "g.68200468G>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.854G>A, p.C285Y" "homozygous" "Germline" "yes" "" "0" "" "" "g.67733751G>A" "" "likely pathogenic" "" "0000846084" "11" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.451C>G, p.H151D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846085" "3" "70" "14" "68192853" "68192856" "delins" "0" "00000" "RDH12_000145" "g.68192853_68192856delinsGGT" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.429_432del4insGGT, p.His143GlnfsX19" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726136_67726139delinsGGT" "" "likely pathogenic" "" "0000846086" "11" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.193C>T, p.R65X" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846087" "11" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.164C>T, p.T55M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic" "" "0000846088" "0" "70" "14" "68195964" "68195964" "subst" "0" "00000" "RDH12_000135" "g.68195964C>G" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.715C>G, p.R239W" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67729247C>G" "" "likely pathogenic" "" "0000846089" "11" "70" "14" "68193831" "68193831" "subst" "0" "00000" "RDH12_000151" "g.68193831C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.582C>A, p.Y194X" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67727114C>A" "" "likely pathogenic" "" "0000846090" "11" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.139G>A, p.A47T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000846091" "11" "50" "14" "68193826" "68193826" "subst" "0.000150278" "00000" "RDH12_000096" "g.68193826C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.577C>T, p.R193C" "single heterozygous variant in a recessive disease - no second allele found" "Germline" "yes" "" "0" "" "" "g.67727109C>T" "" "VUS" "" "0000846092" "11" "70" "14" "68195938" "68195938" "subst" "0" "00000" "RDH12_000154" "g.68195938C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.689C>T, p.P230L" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , single heterozygous variant in a recessive disease - no second allele found" "Germline" "yes" "" "0" "" "" "g.67729221C>T" "" "likely pathogenic" "" "0000846093" "11" "50" "14" "68193866" "68193866" "subst" "4.06683E-6" "00000" "RDH12_000122" "g.68193866C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.617C>T, p.A206V" "single heterozygous variant in a recessive disease - no second allele found" "Germline" "yes" "" "0" "" "" "g.67727149C>T" "" "VUS" "" "0000846094" "11" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsX1" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846095" "11" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846096" "11" "70" "14" "68192858" "68192858" "subst" "0" "00000" "RDH12_000146" "g.68192858G>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.434G>A, p.G145E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726141G>A" "" "likely pathogenic" "" "0000846097" "21" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.701G>A, p.R234H" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000846098" "21" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.464C>T, p.T155I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000846099" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsX1" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846100" "21" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsX1" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846101" "21" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.883C>T, p.R295X" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846102" "0" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.806_810delCCCTG, p.Ala269GlyfsX1" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846103" "21" "70" "14" "68193866" "68193866" "subst" "0" "00000" "RDH12_000099" "g.68193866C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.617C>A, p.A206D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727149C>A" "" "likely pathogenic" "" "0000846104" "21" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Thompson 2005:16269441}" "" "RDH12 c.295C>A, p.L99I" "reduced ability to convert all-trans retinal to all-trans retinol in the presence of NADPH , heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846112" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846113" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846114" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846115" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846116" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846117" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846118" "3" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Y226C" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846119" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.A269GfsXI" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846120" "3" "70" "14" "68193814" "68193814" "subst" "0" "00000" "RDH12_000150" "g.68193814C>T" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.Q189X" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727097C>T" "" "likely pathogenic" "" "0000846121" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.A269GfsX1" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846122" "2" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.H151D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846123" "3" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.G127X" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846124" "3" "70" "14" "68196070" "68196070" "subst" "0" "00000" "RDH12_000060" "g.68196070T>C" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.L274P" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729353T>C" "" "likely pathogenic" "" "0000846125" "1" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.H151D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846126" "2" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.T155I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000846127" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.A269GfsXI" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846128" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.A269GfsXI" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846129" "1" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.R65X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846130" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Schuster 2007:17389517}" "" "RDH12 p.A269GfsXI" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846136" "0" "70" "14" "68191259" "68191259" "subst" "0.000207103" "00000" "RDH12_000141" "g.68191259C>T" "" "{PMID:Sun 2007:17512964}" "" "RDH12 G46G" "single heterozygous variant in a recessive disease; no second allele" "Unknown" "?" "" "0" "" "" "g.67724542C>T" "" "likely pathogenic" "" "0000846137" "0" "70" "14" "68193779" "68193779" "subst" "8.93387E-5" "00000" "RDH12_000020" "g.68193779C>T" "" "{PMID:Sun 2007:17512964}" "" "RDH12 A177V" "similar all-trans-RDH activity to wild-type RDH12; single heterozygous variant in a recessive disease; no second allele" "Unknown" "?" "" "0" "" "" "g.67727062C>T" "" "likely pathogenic" "" "0000846138" "0" "70" "14" "68193779" "68193779" "subst" "8.93387E-5" "00000" "RDH12_000020" "g.68193779C>T" "" "{PMID:Sun 2007:17512964}" "" "RDH12 A177V" "similar all-trans-RDH activity to wild-type RDH12; single heterozygous variant in a recessive disease; no second allele" "Unknown" "?" "" "0" "" "" "g.67727062C>T" "" "likely pathogenic" "" "0000846139" "1" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Sun 2007:17512964}" "" "RDH12 T49M" "dramatic reduction in the ability to produce all-trans-retinol from all-trans-retinal (~95% less); heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846140" "0" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Sun 2007:17512964}" "" "RDH12 A269fsX270" "non-detectable protein levels; no enzymatic activity; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846141" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846142" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846143" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846144" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846145" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846146" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846147" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846148" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846149" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846150" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846151" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846152" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846153" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846154" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846155" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846156" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846157" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846158" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846159" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846160" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846161" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846162" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846163" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846164" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846165" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846166" "0" "70" "14" "68193731" "68193731" "subst" "0.131162" "00000" "RDH12_000046" "g.68193731G>A" "" "{PMID:Sun 2007:17512964}" "" "RDH12 R161Q" "similar all-trans-RDH activity to wild-type RDH12; zygosity unknown (homo- or heterozygous in paper)" "Unknown" "?" "" "0" "" "" "g.67727014G>A" "" "likely pathogenic" "" "0000846167" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Sun 2007:17512964}" "" "RDH12 C201R" "non-detectable protein levels; no enzymatic activity; homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846168" "10" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846169" "10" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846170" "10" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846171" "10" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846172" "20" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846173" "20" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846174" "20" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846175" "20" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846176" "11" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846177" "11" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846178" "21" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846179" "21" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846180" "21" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846181" "21" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846182" "10" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846183" "11" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846184" "21" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846185" "20" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846186" "11" "70" "14" "68196027" "68196027" "del" "0" "00000" "RDH12_000101" "g.68196027del" "" "{PMID:Fingert 2008:18779497}" "" "RDH12 776delG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729310del" "" "likely pathogenic (dominant)" "" "0000846199" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 L99I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (dominant)" "" "0000846200" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 L99I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (dominant)" "" "0000846201" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 L99I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (dominant)" "" "0000846202" "1" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 L99I" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (dominant)" "" "0000846203" "1" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 L99I" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic (dominant)" "" "0000846204" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 T155I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic (dominant)" "" "0000846205" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 T155I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic (dominant)" "" "0000846206" "1" "70" "14" "68192858" "68192858" "subst" "0" "00000" "RDH12_000146" "g.68192858G>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 G145E" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726141G>A" "" "likely pathogenic (dominant)" "" "0000846207" "3" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 T49M" "homozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic (dominant)" "" "0000846208" "1" "70" "14" "68192799" "68192799" "subst" "0" "00000" "RDH12_000106" "g.68192799T>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 N125K" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726082T>A" "" "likely pathogenic (dominant)" "" "0000846209" "2" "70" "14" "68191220" "68191223" "dup" "0" "00000" "RDH12_000140" "g.68191220_68191223dup" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 c.99_102dupAAAT" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724503_67724506dup" "" "likely pathogenic (dominant)" "" "0000846210" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 c.806_810delCCCTG" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic (dominant)" "" "0000846211" "2" "70" "14" "68189361" "68189361" "subst" "0" "00000" "RDH12_000139" "g.68189361T>C" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 M1?" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67722644T>C" "" "likely pathogenic (dominant)" "" "0000846212" "2" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Valverde 2009:19011012}" "" "RDH12 R234H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic (dominant)" "" "0000846230" "3" "70" "14" "68200526" "68200526" "subst" "0" "00000" "RDH12_000104" "g.68200526G>A" "" "{PMID:Sodi 2010:20736127}" "" "RDH12 p.Trp304Stop (c.912G>A)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67733809G>A" "" "likely pathogenic" "" "0000846231" "3" "70" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Sodi 2010:20736127}" "" "RDH12 p.Val233Glu (c.698T>A)" "error in annotation: c.698T>A causes p.Val233Asp and not p.Val233Glu; homozygous" "Germline" "yes" "" "0" "" "" "g.67729230T>A" "" "likely pathogenic" "" "0000846232" "0" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Lee 2011:21232531}" "" "RDH12 T49M" "mutation significantly raises the apparent Km values of RDH12 for nucleotide cofactors; statistically significant improvement in the conversion of retinaldehyde to retinol after treatment with MG132 was observed in the cells containing T49M (but not I51N)" "In vitro (cloned)" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846233" "3" "70" "14" "68191273" "68191273" "subst" "0" "00000" "RDH12_000142" "g.68191273T>A" "" "{PMID:Lee 2011:21232531}" "" "RDH12 I51N" "mutation significantly raises the apparent Km values of RDH12 for nucleotide cofactors" "In vitro (cloned)" "?" "" "0" "" "" "g.67724556T>A" "" "likely pathogenic" "" "0000846236" "1" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846237" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.601T>C, p.C201R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846238" "1" "70" "14" "68195964" "68195964" "subst" "0" "00000" "RDH12_000156" "g.68195964C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.715C>T, p.R239W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729247C>T" "" "likely pathogenic" "" "0000846239" "1" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.700G>C, p.V233L" "error in annotation: p.V233L is caused by c.697G>C and not c.700G>C; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846240" "1" "70" "14" "68191944" "68191944" "subst" "1.62433E-5" "00000" "RDH12_000070" "g.68191944C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.316C>T, p.R106X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725227C>T" "" "likely pathogenic" "" "0000846241" "1" "70" "14" "68193700" "68193700" "subst" "8.13107E-6" "00000" "RDH12_000117" "g.68193700C>G" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.451C>G, p.H151D" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726983C>G" "" "likely pathogenic" "" "0000846242" "3" "70" "14" "68191267" "68191267" "subst" "8.12156E-6" "00000" "RDH12_000079" "g.68191267C>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.146C>A, p.T49K" "homozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>A" "" "likely pathogenic" "" "0000846243" "3" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.193C>T, p.R65X" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846244" "1" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.506G>A, p.R169Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846245" "1" "70" "14" "68191837" "68191837" "subst" "0" "00000" "RDH12_000143" "g.68191837G>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.209G>A, p.C70Y" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725120G>A" "" "likely pathogenic" "" "0000846246" "1" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.144C>T, p.R62X" "error in annotation: p.R62X is caused by c.184C>T and not c.144C>T heterozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846247" "3" "70" "14" "68193848" "68193848" "subst" "0" "00000" "RDH12_000098" "g.68193848A>G" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.599A>G, p.Y200C" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727131A>G" "" "likely pathogenic" "" "0000846248" "3" "70" "14" "68193703" "68193703" "subst" "0" "00000" "RDH12_000148" "g.68193703T>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.454T>A, p.F152I" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726986T>A" "" "likely pathogenic" "" "0000846249" "1" "70" "14" "68191878" "68191878" "subst" "4.06065E-6" "00000" "RDH12_000110" "g.68191878C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.250C>T, p.R84X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725161C>T" "" "likely pathogenic" "" "0000846250" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.609C>A, p.S203R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846251" "3" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.506G>A, p.R169Q" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846252" "1" "70" "14" "68193754" "68193754" "subst" "8.1217E-6" "00000" "RDH12_000108" "g.68193754C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.505C>T, p.R169W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727037C>T" "" "likely pathogenic" "" "0000846253" "1" "70" "14" "68192873" "68192873" "subst" "0" "00000" "RDH12_000052" "g.68192873G>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.448+1g>a, c.698insGT" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726156G>A" "" "likely pathogenic" "" "0000846254" "3" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.619A>G, p.N207D" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "" "0000846255" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.601T>C, p.C201R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846256" "3" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.506G>A, p.R169Q" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846257" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.601T>C, p.C201R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846258" "3" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.146C>T, p.T49M" "homozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846259" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.609C>A, p.S203R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846260" "3" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.379G>T, p.G127X" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846261" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.601T>C, p.C201R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846262" "1" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.481C>T, p.R161W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic" "" "0000846263" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.609C>A, p.S203R" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846264" "1" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.481C>T, p.R161W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic" "" "0000846265" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.883C>T, p.R295X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846266" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846267" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846268" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846269" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846270" "2" "70" "14" "68189422" "68189425" "del" "0" "00000" "RDH12_000011" "g.68189422_68189425del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.57_60del, p.P20del" "error in annotation, 3\' nucleotide and first affected amino acid rule shift it to c.63_66del, p.I22GfsX19; heterozygous" "Unknown" "?" "" "0" "" "" "g.67722705_67722708del" "" "likely pathogenic" "" "0000846271" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation, first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846272" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation, first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846273" "2" "70" "14" "68192805" "68192805" "del" "0" "00000" "RDH12_000144" "g.68192805del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.381_delA, p.G127GfsX1" "error in annotation, first ffected amino acid rule shifts it to p.V128X; heterozygous" "Unknown" "?" "" "0" "" "" "g.67726088del" "" "likely pathogenic" "" "0000846274" "2" "70" "14" "68193773" "68193773" "subst" "2.03051E-5" "00000" "RDH12_000005" "g.68193773C>T" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.525C>T, p.S175L" "error in annotation: p.S175L is caused by c.524C>T and not c.525C>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.67727056C>T" "" "likely pathogenic" "" "0000846275" "2" "70" "14" "68195946" "68195947" "dup" "0" "00000" "RDH12_000155" "g.68195946_68195947dup" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 p.V233VfsX45," "error in annotation, first ffected amino acid rule shifts it to p.R234SfsX45; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229_67729230dup" "" "likely pathogenic" "" "0000846276" "2" "70" "14" "68195964" "68195964" "dup" "0" "00000" "RDH12_000076" "g.68195964dup" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.714insC, p.V238VfsX34" "error in annotation, first ffected amino acid rule shifts it to p.R239PfsX34; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729247dup" "" "likely pathogenic" "" "0000846277" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Mackay 2011:22065924}" "" "RDH12 c.806_810del5bp, p.A269AfsX1" "error in annotation, first ffected amino acid rule shifts it to p.A0269GfsX2; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846278" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846279" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846280" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846281" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846282" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.295C>A, p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846283" "0" "70" "14" "68192870" "68192870" "subst" "8.12222E-6" "00000" "RDH12_000063" "g.68192870T>C" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.446T>C , p.L149P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726153T>C" "" "likely pathogenic" "" "0000846284" "0" "70" "14" "68192870" "68192870" "subst" "8.12222E-6" "00000" "RDH12_000063" "g.68192870T>C" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.446T>C , p.L149P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726153T>C" "" "likely pathogenic" "" "0000846285" "0" "70" "14" "68192870" "68192870" "subst" "8.12222E-6" "00000" "RDH12_000063" "g.68192870T>C" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.446T>C , p.L149P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726153T>C" "" "likely pathogenic" "" "0000846286" "0" "70" "14" "68192870" "68192870" "subst" "8.12222E-6" "00000" "RDH12_000063" "g.68192870T>C" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.446T>C , p.L149P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726153T>C" "" "likely pathogenic" "" "0000846287" "0" "70" "14" "68192870" "68192870" "subst" "8.12222E-6" "00000" "RDH12_000063" "g.68192870T>C" "" "{PMID:Chacon-Camacho 2013:23900199}" "" "RDH12 c.446T>C , p.L149P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726153T>C" "" "likely pathogenic" "" "0000846288" "3" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Kuniyoshi 2014:24752437}" "" "RDH12 c.377C>T, (A126V)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846289" "3" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Kuniyoshi 2014:24752437}" "" "RDH12 c.377C>T, (A126V)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846290" "3" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Kuniyoshi 2014:24752437}" "" "RDH12 c.377C>T, (A126V)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846291" "3" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Gong 2015:26124963}" "" "RDH12 c.437TA" "" "likely pathogenic" "" "0000846292" "3" "70" "14" "68192861" "68192861" "subst" "1.21825E-5" "00000" "RDH12_000075" "g.68192861T>A" "" "{PMID:Gong 2015:26124963}" "" "RDH12 c.437T A" "" "likely pathogenic" "" "0000846293" "3" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:AlBakri 2015:26691045}" "" "RDH12 c.139G>A; p.Ala47Thr" "homozygous" "Germline" "yes" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000846294" "3" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:AlBakri 2015:26691045}" "" "RDH12 c.139G>A; p.Ala47Thr" "homozygous" "Germline" "yes" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000846295" "3" "70" "14" "68196179" "68196179" "subst" "0" "00000" "RDH12_000168" "g.68196179C>G" "" "{PMID:AlBakri 2015:26691045}" "" "RDH12 c.848+82C>G" "homozygous" "Germline" "yes" "" "0" "" "" "g.67729462C>G" "" "likely pathogenic" "" "0000846296" "3" "70" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:AlBakri 2015:26691045}" "" "RDH12 c.266G>C; p.Gly76Arg" "typing error in annotation, p.Gly76Arg is caused by c.226G>C and not c.266G>C; homozygous" "Germline" "yes" "" "0" "" "" "g.67725137G>C" "" "likely pathogenic" "" "0000846297" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846298" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846299" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846300" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846301" "1" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg62Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846302" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846303" "1" "70" "14" "68191854" "68191854" "subst" "0" "00000" "RDH12_000029" "g.68191854G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Gly76Arg" "no nucleotide written, extrapolated from protein and databases; also c.226G>A possible; heterozygous" "Unknown" "?" "" "0" "" "" "g.67725137G>C" "" "likely pathogenic" "" "0000846304" "1" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846305" "1" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val233Leu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846306" "1" "70" "14" "68189422" "68189425" "del" "0" "00000" "RDH12_000011" "g.68189422_68189425del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 lIe22Gly" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in databases lIe22Gly is described as \"\"this sequence change creates a premature translational stop signal (p.Ile22Glyfs*19)\"\", and points to c.63_66del; heterozygous" "Unknown" "?" "" "0" "" "" "g.67722705_67722708del" "" "likely pathogenic" "" "0000846307" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); homozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846308" "3" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846309" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846310" "1" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846311" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846312" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846313" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846314" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846315" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846316" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala269del" "no nucleotide written, extrapolated from protein, databases and publications; error in annotation, in paper Ala 269del is described as \"\"a frameshift mutation leads to a premature stop codon in exon 6\"\", references point to c.806_810delCCCTG, p.(Ala269Glyfs*2); heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846317" "3" "70" "14" "68195964" "68195964" "dup" "0" "00000" "RDH12_000076" "g.68195964dup" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val238ins" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729247dup" "" "likely pathogenic" "" "0000846318" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala126Glu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846319" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala126Glu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846320" "2" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val233Leu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846321" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846322" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846323" "2" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Leu99Ile" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846324" "2" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val233Leu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846325" "2" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ala126Val" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846326" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Asp101Gly" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846327" "2" "70" "14" "68192824" "68192824" "subst" "0" "00000" "RDH12_000164" "g.68192824T>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Ser134Pro" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67726107T>C" "" "likely pathogenic" "" "0000846328" "2" "70" "14" "68193890" "68193890" "subst" "0" "00000" "RDH12_000166" "g.68193890T>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Leu214Pro" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67727173T>C" "" "likely pathogenic" "" "0000846329" "2" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Thr49Met" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846330" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Asp101Gly" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846331" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846332" "2" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val233Leu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846333" "2" "70" "14" "68191254" "68191254" "subst" "0" "00000" "RDH12_000078" "g.68191254A>G" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Thr45Ala" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67724537A>G" "" "likely pathogenic" "" "0000846334" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Arg295Stop" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846335" "2" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Aleman 2018:30372751}" "" "RDH12 Val233Leu" "no nucleotide written, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846338" "3" "70" "14" "68195964" "68195964" "dup" "0" "00000" "RDH12_000076" "g.68195964dup" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.714_715insC, Arg239Argfs" "error in annotation, should be c.715dup, Arg239Profs*34; homozygous" "Unknown" "?" "" "0" "" "" "g.67729247dup" "" "likely pathogenic" "" "0000846339" "1" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.377 C>T, Ala126Val" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846340" "2" "70" "14" "68195920" "68195920" "subst" "8.1984E-6" "00000" "RDH12_000137" "g.68195920C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.671C>T, Thr224Ile" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729203C>T" "" "likely pathogenic" "" "0000846341" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.295 C>A, Leu99Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846342" "1" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.146 C>T, Thr49Met" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846343" "2" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.184C>T, Arg62X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846344" "1" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.506 G>A, Arg169Gln" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846345" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.609 C>A, Ser203Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846346" "1" "70" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.698 T>A, Val233Asp" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "likely pathogenic" "" "0000846347" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.295C>A, Leu99Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846348" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846349" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846350" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846351" "2" "70" "14" "68192801" "68192801" "subst" "0" "00000" "RDH12_000074" "g.68192801C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.377C>A, Ala126Glu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>A" "" "likely pathogenic" "" "0000846352" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846353" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846354" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846355" "1" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.883C>T, Arg295X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846356" "2" "70" "14" "68191930" "68191930" "subst" "8.12137E-6" "00000" "RDH12_000162" "g.68191930A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.302A>G, Asp101Gly" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725213A>G" "" "likely pathogenic" "" "0000846357" "1" "70" "14" "68191930" "68191930" "subst" "8.12137E-6" "00000" "RDH12_000162" "g.68191930A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.302A>G, Asp101Gly" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725213A>G" "" "likely pathogenic" "" "0000846358" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.883C>T, Arg295X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846359" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846360" "1" "70" "14" "68191854" "68191854" "subst" "4.06058E-6" "00000" "RDH12_000091" "g.68191854G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.226G>A, Gly76Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725137G>A" "" "likely pathogenic" "" "0000846361" "2" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.377 C>T, Ala126Val" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000846362" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "homozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846363" "3" "70" "14" "68189397" "68189397" "subst" "0" "00000" "RDH12_000159" "g.68189397C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.38C>A, Ser13X" "homozygous" "Unknown" "?" "" "0" "" "" "g.67722680C>A" "" "likely pathogenic" "" "0000846364" "1" "70" "14" "68191953" "68191953" "subst" "0" "00000" "RDH12_000133" "g.68191953G>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.325G>C, Ala109Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725236G>C" "" "likely pathogenic" "" "0000846365" "2" "70" "14" "68195926" "68195926" "subst" "0" "00000" "RDH12_000056" "g.68195926A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.677A>G, Tyr226Cys" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729209A>G" "" "likely pathogenic" "" "0000846366" "3" "70" "14" "68193713" "68193713" "subst" "2.03135E-5" "00000" "RDH12_000032" "g.68193713C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.464C>T, Thr155Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.67726996C>T" "" "likely pathogenic" "" "0000846367" "1" "70" "14" "68192824" "68192824" "subst" "0" "00000" "RDH12_000164" "g.68192824T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.400T>C, Ser134Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67726107T>C" "" "likely pathogenic" "" "0000846368" "2" "70" "14" "68195946" "68195946" "subst" "4.10334E-6" "00000" "RDH12_000064" "g.68195946G>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.697G>C, Val233Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729229G>C" "" "likely pathogenic" "" "0000846369" "1" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.701G>A, Arg234His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000846370" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846371" "1" "70" "14" "68189422" "68189425" "del" "0" "00000" "RDH12_000011" "g.68189422_68189425del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.57_60delTCCA, Ala19fs" "error in annotation, most 3\' rule shifts it to c.63_66del, Ile22Glyfs*19; single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67722705_67722708del" "" "likely pathogenic" "" "0000846372" "1" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.184C>T, Arg62X" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846373" "1" "70" "14" "68191260" "68191260" "subst" "8.12163E-6" "00000" "RDH12_000065" "g.68191260G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.139G>A, Ala47Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724543G>A" "" "likely pathogenic" "" "0000846374" "2" "70" "14" "68191299" "68191299" "subst" "1.6247E-5" "00000" "RDH12_000040" "g.68191299G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.178G>A, Ala60Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724582G>A" "" "likely pathogenic" "" "0000846375" "1" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.193C>T, Arg65X" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846376" "1" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.295C>A, Leu99Ile" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846377" "1" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.146 C>T, Thr49Met" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000846378" "1" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.609C>A, Ser203Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846379" "1" "70" "14" "68193703" "68193703" "subst" "0" "00000" "RDH12_000148" "g.68193703T>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.454T>A, Phe152Ile" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67726986T>A" "" "likely pathogenic" "" "0000846380" "3" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.601T>C, Cys201Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846381" "1" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.619A>G, Asn207Asp" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "" "0000846382" "1" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.601T>C, Cys201Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846383" "1" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.601T>C, Cys201Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846384" "1" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.481C>T, Arg161Trp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic" "" "0000846385" "2" "70" "14" "68195964" "68195964" "dup" "0" "00000" "RDH12_000076" "g.68195964dup" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.714_715insC, Arg239Argfs" "error in annotation, should be c.715dup, Arg239Profs*34; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729247dup" "" "likely pathogenic" "" "0000846386" "1" "70" "14" "68191944" "68191944" "subst" "1.62433E-5" "00000" "RDH12_000070" "g.68191944C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.316C>T, Arg106X" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67725227C>T" "" "likely pathogenic" "" "0000846387" "1" "70" "14" "68192803" "68192803" "subst" "0" "00000" "RDH12_000090" "g.68192803G>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.379G>T, Gly127X" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67726086G>T" "" "likely pathogenic" "" "0000846388" "1" "70" "14" "68195964" "68195964" "subst" "0" "00000" "RDH12_000156" "g.68195964C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.715C>T, Arg239Trp" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729247C>T" "" "likely pathogenic" "" "0000846389" "1" "70" "14" "68192873" "68192873" "subst" "0" "00000" "RDH12_000052" "g.68192873G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.448+1G>A, c.448+1G>A" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67726156G>A" "" "likely pathogenic" "" "0000846390" "1" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.601T>C, Cys201Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846391" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846392" "1" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.609C>A, Ser203Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846393" "1" "70" "14" "68193850" "68193850" "subst" "0" "00000" "RDH12_000013" "g.68193850T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.601T>C, Cys201Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727133T>C" "" "likely pathogenic" "" "0000846394" "1" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "00000" "RDH12_000035" "g.68193730C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.481C>T, Arg161Trp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic" "" "0000846395" "2" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846396" "1" "70" "14" "68192807" "68192807" "subst" "0" "00000" "RDH12_000082" "g.68192807T>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.383T>G, Val128Gly" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67726090T>G" "" "likely pathogenic" "" "0000846397" "1" "70" "14" "68200524" "68200524" "subst" "4.06118E-6" "00000" "RDH12_000087" "g.68200524T>C" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.910T>C, Trp304Arg" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67733807T>C" "" "likely pathogenic" "" "0000846398" "1" "70" "14" "68191837" "68191837" "subst" "0" "00000" "RDH12_000143" "g.68191837G>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.209G>A, Cys70Tyr" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67725120G>A" "" "likely pathogenic" "" "0000846399" "1" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.619A>G, Asn207Asp" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "" "0000846400" "3" "70" "14" "68193858" "68193858" "subst" "2.84518E-5" "00000" "RDH12_000015" "g.68193858C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.609C>A, Ser203Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.67727141C>A" "" "likely pathogenic" "" "0000846401" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846402" "2" "70" "14" "68195929" "68195933" "delins" "0" "00000" "RDH12_000138" "g.68195929_68195933delinsT" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.680_684delinsT, Ala227Valfs*50" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729212_67729216delinsT" "" "likely pathogenic" "" "0000846403" "1" "70" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.184C>T, Arg62X" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67724588C>T" "" "likely pathogenic" "" "0000846404" "3" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "homozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846405" "1" "70" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.698 T>A, Val233Asp" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "likely pathogenic" "" "0000846406" "3" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.295C>A, Leu99Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846407" "1" "70" "14" "68191306" "68191306" "subst" "0.000174659" "00000" "RDH12_000160" "g.68191306G>T" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.185G>T, Arg62Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67724589G>T" "" "likely pathogenic" "" "0000846408" "2" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.619A>G, Asn207Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "" "0000846409" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Fahim 2019:30979730}" "" "RDH12 c.806_810delCCCTG, Ala269Glyfs*2" "single heterozygous variant" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846410" "1" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Philip 2019:31424981}" "" "RDH12 c.806_810del, p.(Ala269Glyfs*2)" "error in annotation should be c.806_810delCCCTG and not c.806_820delCCCTG, no protein annotation; heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846411" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Philip 2019:31424981}" "" "RDH12 p.Arg295Stop" "no nucleotide written, extrapolated from protein; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846415" "1" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.701G>A, p.Arg234His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "ACMG" "0000846416" "1" "70" "14" "68191306" "68191306" "subst" "0.000174659" "00000" "RDH12_000160" "g.68191306G>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.185G>T, p.Arg62Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724589G>T" "" "likely pathogenic" "ACMG" "0000846417" "1" "90" "14" "68192864" "68192864" "subst" "0" "00000" "RDH12_000130" "g.68192864A>C" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.440A>C, p.Asn147Thr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726147A>C" "" "pathogenic" "ACMG" "0000846418" "11" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.619A>G, p.Asn207Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "ACMG" "0000846419" "0" "50" "14" "68191822" "68191822" "subst" "1.62431E-5" "00000" "RDH12_000161" "g.68191822G>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.194G>A, p.Arg65Gln" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67725105G>A" "" "VUS" "ACMG" "0000846420" "3" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.146C>T, p.Thr49Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.67724550C>T" "" "pathogenic" "ACMG" "0000846421" "3" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.146C>T, p.Thr49Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.67724550C>T" "" "pathogenic" "ACMG" "0000846422" "1" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.164C>T, p.Thr55Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic" "ACMG" "0000846423" "1" "70" "14" "68191843" "68191843" "subst" "0" "00000" "RDH12_000051" "g.68191843A>G" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.215A>G, p.Asp72Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725126A>G" "" "likely pathogenic" "ACMG" "0000846424" "1" "70" "14" "68192786" "68192786" "subst" "0" "00000" "RDH12_000163" "g.68192786T>C" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.362T>C, p.Ile121Thr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726069T>C" "" "likely pathogenic" "ACMG" "0000846425" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.295C>A, p.Leu99Ile" "homozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "ACMG" "0000846426" "2" "70" "14" "68196093" "68196093" "subst" "4.30141E-6" "00000" "RDH12_000100" "g.68196093T>G" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.844T>G, p.Phe282Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729376T>G" "" "likely pathogenic" "ACMG" "0000846427" "2" "70" "14" "68193868" "68193868" "subst" "8.13226E-6" "00000" "RDH12_000152" "g.68193868A>G" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.619A>G, p.Asn207Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727151A>G" "" "likely pathogenic" "ACMG" "0000846428" "2" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.701G>A, p.Arg234His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "ACMG" "0000846429" "21" "90" "14" "68195946" "68195946" "subst" "0" "00000" "RDH12_000167" "g.68195946G>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.697G>A, p.Val233Ile" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729229G>A" "" "pathogenic" "ACMG" "0000846430" "0" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.506G>A, p.Arg169Gln" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "ACMG" "0000846431" "2" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "00000" "RDH12_000028" "g.68191305C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.184C>T, p.Arg62*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724588C>T" "" "pathogenic" "ACMG" "0000846432" "2" "70" "14" "68193773" "68193773" "subst" "2.03051E-5" "00000" "RDH12_000005" "g.68193773C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.524C>T, p.Ser175Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727056C>T" "" "likely pathogenic" "ACMG" "0000846433" "2" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Scott 2020:32014858}" "" "RDH12 c.883C>T, p.Arg295*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "ACMG" "0000846434" "1" "70" "14" "68192873" "68192873" "subst" "0" "00000" "RDH12_000052" "g.68192873G>A" "" "{PMID:Ba-Abbad 2020:32790509}" "" "RDH12 c.448+1G>A, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67726156G>A" "" "likely pathogenic" "" "0000846435" "1" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Ba-Abbad 2020:32790509}" "" "RDH12 c.701G>A, p.(Arg234His)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000846436" "2" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "00000" "RDH12_000069" "g.68195950G>A" "" "{PMID:Ba-Abbad 2020:32790509}" "" "RDH12 c.701G>A, p.(Arg234His)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "" "0000846437" "2" "70" "14" "68195984" "68195992" "del" "0" "00000" "RDH12_000158" "g.68195984_68195992del" "" "{PMID:Ba-Abbad 2020:32790509}" "" "RDH12 c.735_743del, p.(Cys245_Leu247deI)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729267_67729275del" "" "likely pathogenic" "" "0000846438" "3" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Jauregui 2020:32172635}" "" "RDH12 c.506G>A, p.(Arg169Gln)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846439" "3" "70" "14" "68193755" "68193755" "subst" "1.21828E-5" "00000" "RDH12_000006" "g.68193755G>A" "" "{PMID:Jauregui 2020:32172635}" "" "RDH12 c.506G>A, p.(Arg169Gln)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67727038G>A" "" "likely pathogenic" "" "0000846440" "11" "70" "14" "68196008" "68196008" "del" "0" "00000" "RDH12_000059" "g.68196008del" "" "{PMID:Sarkar 2020:32322264}" "" "RDH12 c.759del, p.(Phe254Leufs*24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729291del" "" "likely pathogenic (dominant)" "" "0000846441" "11" "70" "14" "68196008" "68196008" "del" "0" "00000" "RDH12_000059" "g.68196008del" "" "{PMID:Sarkar 2020:32322264}" "" "RDH12 c.759del, p.(Phe254Leufs*24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729291del" "" "likely pathogenic (dominant)" "" "0000846442" "10" "70" "14" "68196008" "68196008" "del" "0" "00000" "RDH12_000059" "g.68196008del" "" "{PMID:Sarkar 2020:32322264}" "" "RDH12 c.759del, p.(Phe254Leufs*24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729291del" "" "likely pathogenic (dominant)" "" "0000846443" "10" "70" "14" "68196008" "68196008" "del" "0" "00000" "RDH12_000059" "g.68196008del" "" "{PMID:Sarkar 2020:32322264}" "" "RDH12 c.759del, p.(Phe254Leufs*24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729291del" "" "likely pathogenic (dominant)" "" "0000846444" "21" "70" "14" "68196008" "68196008" "del" "0" "00000" "RDH12_000059" "g.68196008del" "" "{PMID:Sarkar 2020:32322264}" "" "RDH12 c.759del, p.(Phe254Leufs*24)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729291del" "" "likely pathogenic (dominant)" "" "0000846447" "11" "70" "14" "68191285" "68191285" "subst" "2.43647E-5" "00000" "RDH12_000033" "g.68191285C>T" "" "{PMID:Xin 2016:26848971}" "" "RDH12 c.164C>T, p.(Thr55Met)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>T" "" "likely pathogenic" "" "0000846448" "21" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00000" "RDH12_000089" "g.68196055C>G" "" "{PMID:Xin 2016:26848971}" "" "RDH12 c.806C>G, p.(Ala269Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic" "" "0000846455" "0" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Chebil 2016:26868535}" "" "RDH12 c.193C>T, R65X" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846459" "0" "70" "14" "68191821" "68191821" "subst" "1.62427E-5" "00000" "RDH12_000081" "g.68191821C>T" "" "{PMID:Chebil 2016:26868535}" "" "RDH12 c.193C>T, R65X" "homozygous" "Unknown" "?" "" "0" "" "" "g.67725104C>T" "" "likely pathogenic" "" "0000846465" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Garg 2017:28513254}" "" "RDH12 p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846466" "0" "70" "14" "68191923" "68191923" "subst" "6.49715E-5" "00000" "RDH12_000030" "g.68191923C>A" "" "{PMID:Garg 2017:28513254}" "" "RDH12 p.L99I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67725206C>A" "" "likely pathogenic" "" "0000846467" "0" "70" "14" "68195947" "68195947" "subst" "8.20318E-6" "00000" "RDH12_000071" "g.68195947T>A" "" "{PMID:Garg 2017:28513254}" "" "RDH12 p.V233D" "heterozygous" "Unknown" "?" "" "0" "" "" "g.67729230T>A" "" "likely pathogenic" "" "0000846468" "0" "70" "14" "68196055" "68196059" "del" "0" "00000" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Garg 2017:28513254}" "" "RDH12 c.806_820delCCCTG" "error in annotation, should be RDH12 c.806_810delCCCTG heterozygous" "Unknown" "?" "" "0" "" "" "g.67729338_67729342del" "" "likely pathogenic" "" "0000846469" "0" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Garg 2017:28513254}" "" "RDH12 p.Arg295Stop:c.C > T" "error in annotation, should be c.883C>T; heterozygous" "Unknown" "?" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846471" "11" "70" "14" "68193784" "68193784" "subst" "0" "00000" "RDH12_000165" "g.68193784C>G" "" "{PMID:Li 2017:28471114}" "" "RDH12 c.535C>G, p.H179D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727067C>G" "" "likely pathogenic" "" "0000846472" "11" "70" "14" "68193784" "68193784" "subst" "0" "00000" "RDH12_000165" "g.68193784C>G" "" "{PMID:Li 2017:28471114}" "" "RDH12 c.535C>G, p.H179D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67727067C>G" "" "likely pathogenic" "" "0000846473" "21" "70" "14" "68191285" "68191285" "subst" "0" "00000" "RDH12_000124" "g.68191285C>A" "" "{PMID:Li 2017:28471114}" "" "RDH12 c.164C>A, p.T55K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>A" "" "likely pathogenic" "" "0000846474" "21" "70" "14" "68191285" "68191285" "subst" "0" "00000" "RDH12_000124" "g.68191285C>A" "" "{PMID:Li 2017:28471114}" "" "RDH12 c.164C>A, p.T55K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.67724568C>A" "" "likely pathogenic" "" "0000846881" "3" "70" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Avela 2019:31087526}" "" "RDH12 c.883C>T , p.(Arg295Ter)" "homozygous" "Germline" "yes" "" "0" "" "" "g.67733780C>T" "" "likely pathogenic" "" "0000846899" "3" "50" "14" "68195980" "68195980" "subst" "4.13042E-6" "00000" "RDH12_000102" "g.68195980T>A" "Not in gnomAD or HGMD" "{PMID:Avela 2019:31087526}" "" "RDH12 c.731T>A , p.(Leu244His)" "homozygous, in silico predictions not damaging" "Germline" "yes" "" "0" "" "" "g.67729263T>A" "" "VUS" "" "0000881441" "3" "50" "14" "68196034" "68196034" "subst" "0" "04405" "RDH12_000169" "g.68196034C>G" "" "{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}" "" "" "" "Germline" "" "" "0" "" "" "g.67729317C>G" "" "VUS" "ACMG" "0000896553" "0" "70" "14" "68191267" "68191267" "subst" "1.62431E-5" "00000" "RDH12_000003" "g.68191267C>T" "Taiwan Biobank: 0.000330; GnomAD_exome_East: 0.0000544; GnomAD_All: 0.0000159" "{PMID:Chen 2021:33608557}" "" "RDH12 c.146C>T(;)806C>G; p.(Thr49Met)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67724550C>T" "" "likely pathogenic" "" "0000896554" "0" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00000" "RDH12_000089" "g.68196055C>G" "Taiwan Biobank: 0.003984; GnomAD_exome_East: 0.00346; GnomAD_All: 0.000263" "{PMID:Chen 2021:33608557}" "" "RDH12 c.146C>T(;)806C>G; p.(Ala269Gly)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic" "" "0000896723" "0" "70" "14" "68192801" "68192801" "subst" "1.21826E-5" "00000" "RDH12_000034" "g.68192801C>T" "Taiwan Biobank: 0; GnomAD_exome_East: 0.0000544; GnomAD_All: 0.0000119" "{PMID:Chen 2021:33608557}" "" "RDH12 c.377C>T(;)505C>G; p.(Ala126Val)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67726084C>T" "" "likely pathogenic" "" "0000896724" "0" "70" "14" "68193754" "68193754" "subst" "1.62434E-5" "00000" "RDH12_000092" "g.68193754C>G" "Taiwan Biobank: 0.00033; GnomAD_exome_East: 0.000217; GnomAD_All: 0.0000159" "{PMID:Chen 2021:33608557}" "" "RDH12 c.377C>T(;)505C>G; p.(Arg169Gly)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67727037C>G" "" "likely pathogenic" "" "0000896740" "0" "70" "14" "68193754" "68193754" "subst" "1.62434E-5" "00000" "RDH12_000092" "g.68193754C>G" "Taiwan Biobank: 0.00033; GnomAD_exome_East: 0.000217; GnomAD_All: 0.0000159" "{PMID:Chen 2021:33608557}" "" "RDH12 c.505C>G(;)806C>G; p.(Arg169Gly)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67727037C>G" "" "likely pathogenic" "" "0000896741" "0" "70" "14" "68196055" "68196055" "subst" "0.000251365" "00000" "RDH12_000089" "g.68196055C>G" "Taiwan Biobank: 0.003984; GnomAD_exome_East: 0.00346; GnomAD_All: 0.000263" "{PMID:Chen 2021:33608557}" "" "RDH12 c.505C>G(;)806C>G; p.(Ala269Gly)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67729338C>G" "" "likely pathogenic" "" "0000898080" "3" "70" "14" "68191839" "68191839" "subst" "0" "04364" "RDH12_000170" "g.68191839A>G" "1/20 cases" "" "" "" "not in 100 control chromosomes tested" "Germline/De novo (untested)" "yes" "" "0" "" "" "" "" "VUS" "ACMG" "0000900605" "3" "70" "14" "68195942" "68195943" "ins" "0" "04364" "RDH12_000171" "g.68195942_68195943insACTGCGTCCGCTCTGAGCTGGC" "" "" "" "690_691insGGCACTGCGTCCGCTCTGAGCT" "" "De novo" "yes" "" "0" "" "" "g.67729225_67729226insACTGCGTCCGCTCTGAGCTGGC" "" "likely pathogenic" "ACMG" "0000905874" "0" "70" "14" "68193897" "68193927" "del" "0" "00000" "RDH12_000084" "g.68193897_68193927del" "" "{PMID:Zhu 2022:35456422}" "" "RDH12 c.648_658+20del, p.?" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67727180_67727210del" "" "likely pathogenic" "ACMG" "0000905935" "0" "90" "14" "68200497" "68200497" "subst" "8.12269E-6" "00000" "RDH12_000067" "g.68200497C>T" "" "{PMID:Zhu 2022:35456422}" "" "RDH12 c.883C>T, p.(Arg295*)" "compound heterozygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67733780C>T" "" "pathogenic" "ACMG" "0000905936" "0" "70" "14" "68200524" "68200524" "subst" "4.06118E-6" "00000" "RDH12_000087" "g.68200524T>C" "" "{PMID:Zhu 2022:35456422}" "" "RDH12 c.910T>C, p.(Trp304Arg)" "compound heterozygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.67733807T>C" "" "likely pathogenic" "ACMG" "0000914210" "0" "30" "14" "68195896" "68195896" "subst" "0.00024637" "02330" "RDH12_000174" "g.68195896T>C" "" "" "" "RDH12(NM_152443.3):c.659-12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915902" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04436" "RDH12_000030" "g.68191923C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.295C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916186" "3" "70" "14" "68196037" "68196037" "subst" "0" "04436" "RDH12_000176" "g.68196037A>C" "" "{PMID:Panneman 2023:36819107}" "" "c.788A>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916192" "3" "70" "14" "68193909" "68193909" "dup" "0" "04436" "RDH12_000173" "g.68193909dup" "" "{PMID:Panneman 2023:36819107}" "" "c.658+2dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916251" "1" "90" "14" "68191267" "68191267" "subst" "1.62431E-5" "04436" "RDH12_000003" "g.68191267C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.146C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916252" "2" "70" "14" "68193879" "68193879" "dup" "0" "04436" "RDH12_000172" "g.68193879dup" "" "{PMID:Panneman 2023:36819107}" "" "c.630dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916285" "3" "90" "14" "68195947" "68195947" "subst" "8.20318E-6" "04436" "RDH12_000071" "g.68195947T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.698T>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916355" "1" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "04436" "RDH12_000028" "g.68191305C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.184C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916356" "2" "50" "14" "68193808" "68193808" "subst" "8.12255E-6" "04436" "RDH12_000021" "g.68193808G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.559G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916390" "3" "90" "14" "68195947" "68195947" "subst" "8.20318E-6" "04436" "RDH12_000071" "g.68195947T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.698T>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916466" "1" "50" "14" "68196030" "68196030" "subst" "0" "04436" "RDH12_000175" "g.68196030G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.781G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916467" "2" "50" "14" "68200486" "68200486" "subst" "0" "04436" "RDH12_000004" "g.68200486C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.872C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916481" "3" "90" "14" "68195947" "68195947" "subst" "8.20318E-6" "04436" "RDH12_000071" "g.68195947T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.698T>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916526" "3" "90" "14" "68196055" "68196059" "del" "0" "04436" "RDH12_000008" "g.68196055_68196059del" "" "{PMID:Panneman 2023:36819107}" "" "c.806_810del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916544" "1" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "04436" "RDH12_000041" "g.68191906T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.278T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916545" "2" "90" "14" "68193713" "68193713" "subst" "2.03135E-5" "04436" "RDH12_000032" "g.68193713C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.464C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916554" "1" "70" "14" "68191906" "68191906" "subst" "1.62427E-5" "04436" "RDH12_000041" "g.68191906T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.278T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916555" "2" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04436" "RDH12_000030" "g.68191923C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.295C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916581" "3" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04436" "RDH12_000030" "g.68191923C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.295C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916653" "1" "90" "14" "68191305" "68191305" "subst" "4.46769E-5" "04436" "RDH12_000028" "g.68191305C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.184C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916654" "2" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04436" "RDH12_000030" "g.68191923C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.295C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000958059" "3" "90" "14" "68191854" "68191854" "subst" "4.06058E-6" "00006" "RDH12_000091" "g.68191854G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PS1, PP3, PM2, PM5, PP2, PP5" "Germline" "" "" "0" "" "" "g.67725137G>A" "" "pathogenic (recessive)" "ACMG" "0000958838" "0" "70" "14" "68193730" "68193730" "subst" "2.43704E-5" "00006" "RDH12_000035" "g.68193730C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.67727013C>T" "" "likely pathogenic (recessive)" "ACMG" "0000958851" "3" "50" "14" "68193890" "68193890" "subst" "0" "00006" "RDH12_000166" "g.68193890T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1_SUPPORTING, PP2" "Germline" "" "" "0" "" "" "g.67727173T>C" "" "VUS" "ACMG" "0000958907" "0" "90" "14" "68193700" "68193700" "subst" "8.13107E-6" "00006" "RDH12_000117" "g.68193700C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PP2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.67726983C>G" "" "pathogenic (recessive)" "ACMG" "0000958998" "3" "50" "14" "68191912" "68191912" "subst" "0" "00006" "RDH12_000178" "g.68191912G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5_SUPPORTING, PP2; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.67725195G>C" "" "VUS" "ACMG" "0000959266" "0" "50" "14" "68193881" "68193881" "subst" "0" "00006" "RDH12_000180" "g.68193881C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1_SUPPORTING, PP2" "Germline" "" "" "0" "" "" "g.67727164C>T" "" "VUS" "ACMG" "0000959342" "0" "50" "14" "68191816" "68191816" "subst" "0" "00006" "RDH12_000177" "g.68191816G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP2" "Germline" "" "" "0" "" "" "g.67725099G>A" "" "VUS" "ACMG" "0000959460" "0" "50" "14" "68191945" "68191945" "subst" "0.000166492" "00006" "RDH12_000179" "g.68191945G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP2; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.67725228G>A" "" "VUS" "ACMG" "0000986552" "1" "50" "14" "68196034" "68196034" "subst" "0" "04405" "RDH12_000169" "g.68196034C>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729317C>G" "" "VUS" "ACMG" "0000986553" "3" "50" "14" "68196034" "68196034" "subst" "0" "04405" "RDH12_000169" "g.68196034C>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729317C>G" "" "VUS" "ACMG" "0000986554" "1" "90" "14" "68191269" "68191269" "subst" "0" "04405" "RDH12_000039" "g.68191269G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67724552G>A" "" "pathogenic" "ACMG" "0000986555" "1" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04405" "RDH12_000030" "g.68191923C>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "ACMG" "0000986556" "1" "50" "14" "68191912" "68191912" "subst" "4.06075E-5" "04405" "RDH12_000182" "g.68191912G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67725195G>A" "" "VUS" "ACMG" "0000986557" "1" "90" "14" "68191923" "68191923" "subst" "6.49715E-5" "04405" "RDH12_000030" "g.68191923C>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67725206C>A" "" "pathogenic" "ACMG" "0000986558" "1" "70" "14" "68193713" "68193713" "subst" "0" "04405" "RDH12_000183" "g.68193713C>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67726996C>A" "" "likely pathogenic" "ACMG" "0000986559" "3" "90" "14" "68192803" "68192803" "subst" "0" "04405" "RDH12_000090" "g.68192803G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67726086G>T" "" "pathogenic" "ACMG" "0000986560" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "04405" "RDH12_000034" "g.68192801C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>T" "" "pathogenic" "ACMG" "0000986561" "1" "50" "14" "68191822" "68191822" "subst" "1.62431E-5" "04405" "RDH12_000161" "g.68191822G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67725105G>A" "" "VUS" "ACMG" "0000986562" "3" "90" "14" "68192801" "68192801" "subst" "1.21826E-5" "04405" "RDH12_000034" "g.68192801C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67726084C>T" "" "pathogenic" "ACMG" "0000986922" "1" "70" "14" "68191857" "68191857" "subst" "0" "04405" "RDH12_000181" "g.68191857G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "carries likely causative variants in more than one gene" "Germline" "" "" "0" "" "" "g.67725140G>T" "" "likely pathogenic" "ACMG" "0000986947" "2" "50" "14" "68200552" "68200552" "subst" "0" "04405" "RDH12_000185" "g.68200552T>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67733835T>G" "" "VUS" "ACMG" "0000986948" "2" "50" "14" "68195916" "68195916" "subst" "0" "04405" "RDH12_000136" "g.68195916G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729199G>T" "" "VUS" "ACMG" "0000986949" "2" "50" "14" "68196013" "68196013" "subst" "0" "04405" "RDH12_000184" "g.68196013T>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729296T>G" "" "VUS" "ACMG" "0000986950" "2" "90" "14" "68200497" "68200497" "subst" "8.12269E-6" "04405" "RDH12_000067" "g.68200497C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67733780C>T" "" "pathogenic" "ACMG" "0000986951" "2" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "04405" "RDH12_000069" "g.68195950G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "ACMG" "0000986952" "2" "70" "14" "68195950" "68195950" "subst" "9.854E-5" "04405" "RDH12_000069" "g.68195950G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729233G>A" "" "likely pathogenic" "ACMG" "0000986953" "2" "90" "14" "68195926" "68195926" "subst" "0" "04405" "RDH12_000056" "g.68195926A>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.67729209A>G" "" "pathogenic" "ACMG" "0001001109" "0" "50" "14" "68191306" "68191306" "subst" "0.000174659" "02325" "RDH12_000160" "g.68191306G>T" "" "" "" "RDH12(NM_152443.3):c.185G>T (p.R62L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001022259" "3" "90" "14" "68193850" "68193850" "subst" "0" "00006" "RDH12_000013" "g.68193850T>C" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "" "0" "" "" "g.67727133T>C" "" "pathogenic" "" "0001046476" "0" "50" "14" "68191306" "68191306" "subst" "8.12367E-6" "02327" "RDH12_000017" "g.68191306G>A" "" "" "" "RDH12(NM_152443.2):c.185G>A (p.R62Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes RDH12 ## Count = 868 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000019487" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000019488" "00017595" "90" "495" "0" "499" "0" "c.495_499del" "r.(?)" "p.(Ala166Cysfs*5)" "7" "0000019489" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000019490" "00017595" "90" "63" "0" "66" "0" "c.63_66del" "r.(?)" "p.(Ile22Glyfs*19)" "3" "0000019525" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000019526" "00017595" "70" "167" "0" "167" "0" "c.167C>A" "r.(?)" "p.(Ala56Asp)" "4" "0000036427" "00017595" "50" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "7" "0000036434" "00017595" "55" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "7" "0000060172" "00017595" "90" "658" "591" "1554" "0" "c.658+591_*603delinsCT" "r.del" "p.?" "7i_9" "0000060173" "00017595" "90" "658" "591" "1554" "0" "c.658+591_*603delinsCT" "r.del" "p.?" "7i_9" "0000060174" "00017595" "90" "178" "0" "178" "0" "c.178G>C" "r.(?)" "p.(Ala60Pro)" "4" "0000060175" "00017595" "90" "178" "0" "178" "0" "c.178G>C" "r.(?)" "p.(Ala60Pro)" "4" "0000060176" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "2" "0000060177" "00017595" "70" "872" "0" "872" "0" "c.872C>T" "r.(?)" "p.(Ser291Phe)" "9" "0000060178" "00017595" "70" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "7" "0000060179" "00017595" "70" "344" "-8" "344" "-8" "c.344-8C>T" "r.spl?" "p.(=)" "3i" "0000060182" "00017595" "70" "746" "0" "746" "0" "c.746G>T" "r.(?)" "p.(Arg249Leu)" "6" "0000081799" "00017595" "90" "832" "0" "832" "0" "c.832A>C" "r.(?)" "p.(Ser278Arg)" "8" "0000158352" "00017595" "90" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "7" "0000294775" "00017595" "50" "341" "0" "341" "0" "c.341C>A" "r.(?)" "p.(Ala114Glu)" "" "0000294776" "00017595" "10" "491" "0" "491" "0" "c.491T>C" "r.(?)" "p.(Val164Ala)" "" "0000294777" "00017595" "90" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000294778" "00017595" "30" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "" "0000294779" "00017595" "10" "659" "-13" "659" "-13" "c.659-13C>A" "r.(=)" "p.(=)" "" "0000294780" "00017595" "10" "69" "-19" "69" "-18" "c.69-19_69-18del" "r.(=)" "p.(=)" "" "0000294781" "00017595" "10" "931" "0" "931" "0" "c.931C>T" "r.(?)" "p.(Leu311=)" "" "0000306892" "00017595" "50" "185" "0" "185" "0" "c.185G>A" "r.(?)" "p.(Arg62Gln)" "" "0000306893" "00017595" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Asp187Asn)" "" "0000306894" "00017595" "50" "757" "0" "757" "0" "c.757C>A" "r.(?)" "p.(Pro253Thr)" "" "0000306896" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269GlyfsTer2)" "" "0000343178" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62Ter)" "" "0000346264" "00017595" "70" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "" "0000346550" "00017595" "70" "315" "0" "315" "0" "c.315C>G" "r.(?)" "p.(Ile105Met)" "" "0000346755" "00017595" "70" "152" "0" "152" "0" "c.152T>C" "r.(?)" "p.(Ile51Thr)" "" "0000347353" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000348277" "00017595" "50" "59" "0" "59" "0" "c.59C>T" "r.(?)" "p.(Pro20Leu)" "" "0000348782" "00017595" "90" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000349298" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000358316" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "2" "0000358317" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "2" "0000358318" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000358319" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "4" "0000358320" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "5" "0000358321" "00017595" "90" "658" "1" "658" "1" "c.658+1G>A" "r.spl" "p.?" "5i" "0000358322" "00017595" "70" "715" "0" "715" "0" "c.715C>A" "r.(?)" "p.(Arg239Gln)" "6" "0000358323" "00017595" "70" "740" "0" "740" "0" "c.740T>C" "r.(?)" "p.(Leu274Pro)" "6" "0000358450" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000438558" "00017595" "90" "178" "0" "178" "0" "c.178G>A" "r.(?)" "p.(Ala60Thr)" "4" "0000438559" "00017595" "90" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000438667" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000438671" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000438674" "00017595" "90" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000438675" "00017595" "90" "716" "0" "716" "0" "c.716G>T" "r.(?)" "p.(Arg239Leu)" "" "0000438676" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000438677" "00017595" "90" "148" "0" "148" "0" "c.148G>A" "r.(?)" "p.(Gly50Ser)" "" "0000438691" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000438692" "00017595" "90" "731" "0" "731" "0" "c.731T>C" "r.(?)" "p.(Leu244Pro)" "" "0000441072" "00017595" "50" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000477050" "00017595" "50" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Arg95Trp)" "" "0000477051" "00017595" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Ile105Val)" "" "0000477052" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000477053" "00017595" "90" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000477054" "00017595" "50" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "" "0000477055" "00017595" "90" "754" "0" "754" "0" "c.754del" "r.(?)" "p.(Ser252Profs*26)" "" "0000477056" "00017595" "90" "761" "0" "762" "0" "c.761_762insA" "r.(?)" "p.(Phe254Leufs*19)" "" "0000477583" "00017595" "50" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "" "0000552870" "00017595" "50" "85" "0" "85" "0" "c.85G>A" "r.(?)" "p.(Gly29Arg)" "" "0000552871" "00017595" "50" "91" "0" "91" "0" "c.91T>C" "r.(?)" "p.(Cys31Arg)" "" "0000552872" "00017595" "50" "215" "0" "215" "0" "c.215A>G" "r.(?)" "p.(Asp72Gly)" "" "0000552873" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000552874" "00017595" "90" "448" "1" "448" "1" "c.448+1G>A" "r.spl?" "p.?" "" "0000552875" "00017595" "30" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "" "0000552876" "00017595" "50" "570" "0" "570" "0" "c.570C>T" "r.(?)" "p.(Ser190=)" "" "0000552877" "00017595" "30" "579" "0" "579" "0" "c.579C>T" "r.(?)" "p.(Arg193=)" "" "0000552878" "00017595" "50" "749" "0" "749" "0" "c.749T>C" "r.(?)" "p.(Leu250Pro)" "" "0000615049" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000623155" "00017595" "50" "761" "0" "761" "0" "c.761T>A" "r.(?)" "p.(Phe254Tyr)" "" "0000623156" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269GlyfsTer2)" "" "0000648952" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000657467" "00017595" "90" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000680016" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62Ter)" "" "0000684418" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000684419" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "7" "0000684420" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000684437" "00017595" "70" "403" "0" "403" "0" "c.403A>G" "r.(?)" "p.(Lys135Glu)" "8" "0000684557" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000684640" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000685388" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000685389" "00017595" "90" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000685390" "00017595" "90" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000685391" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000685392" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000685393" "00017595" "90" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000685395" "00017595" "70" "716" "0" "716" "0" "c.716G>T" "r.(?)" "p.(Arg239Leu)" "" "0000685396" "00017595" "90" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000685397" "00017595" "90" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "" "0000685398" "00017595" "90" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "" "0000691695" "00017595" "50" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Arg302His)" "" "0000708307" "00017595" "70" "151" "0" "151" "0" "c.151A>T" "r.(?)" "p.(Ile51Phe)" "4" "0000710221" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000710249" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000710266" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000710300" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000710307" "00017595" "90" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "" "0000710333" "00017595" "90" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "" "0000710358" "00017595" "90" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000713496" "00017595" "90" "805" "0" "809" "0" "c.805_809del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000713601" "00017595" "90" "805" "0" "809" "0" "c.805_809del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000714066" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000714067" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000714102" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000724844" "00017595" "50" "187" "5" "187" "5" "c.187+5G>C" "r.spl?" "p.?" "" "0000724845" "00017595" "30" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000731138" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000731165" "00017595" "90" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000731257" "00017595" "70" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0000731280" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000733191" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000733192" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000733193" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000733194" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000733195" "00017595" "70" "133" "0" "133" "0" "c.133dup" "r.(?)" "p.(Thr45Asnfs*17)" "" "0000733196" "00017595" "70" "715" "0" "715" "0" "c.715dup" "r.(?)" "p.(Arg239Profs*34)" "" "0000733625" "00017595" "70" "377" "0" "377" "0" "c.377C>A" "r.(?)" "p.(Ala126Glu)" "" "0000733626" "00017595" "70" "167" "0" "167" "0" "c.167C>A" "r.(?)" "p.(Ala56Asp)" "" "0000733627" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000733628" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000734352" "00017595" "70" "121" "0" "121" "0" "c.121G>T" "r.(?)" "p.(Val41Leu)" "" "0000734372" "00017595" "50" "940" "0" "940" "0" "c.940C>T" "r.(?)" "p.(Arg314Trp)" "" "0000734373" "00017595" "50" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000735652" "00017595" "90" "152" "0" "152" "0" "c.152T>C" "r.(?)" "p.(Ile51Thr)" "" "0000735761" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000735906" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000735962" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000736056" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000736067" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000736120" "00017595" "90" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000736556" "00017595" "90" "133" "0" "133" "0" "c.133A>G" "r.(?)" "p.(Thr45Ala)" "" "0000736557" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "" "0000759663" "00017595" "90" "146" "0" "146" "0" "c.146C>A" "r.(?)" "p.(Thr49Lys)" "" "0000759678" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000759854" "00017595" "70" "68" "1" "68" "1" "c.68+1G>A" "r.spl" "p.?" "" "0000759882" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000759897" "00017595" "70" "832" "0" "832" "0" "c.832A>C" "r.(?)" "p.(Ser278Arg)" "" "0000759942" "00017595" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000759963" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000760185" "00017595" "50" "383" "0" "383" "0" "c.383T>G" "r.(?)" "p.(Val128Gly)" "" "0000760219" "00017595" "70" "582" "0" "582" "0" "c.582C>G" "r.(?)" "p.(Tyr194*)" "" "0000760224" "00017595" "70" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000760262" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000760437" "00017595" "50" "910" "0" "910" "0" "c.910T>C" "r.(?)" "p.(Trp304Arg)" "" "0000760452" "00017595" "50" "848" "2" "848" "2" "c.848+2T>C" "r.spl" "p.?" "" "0000760455" "00017595" "50" "648" "0" "658" "20" "c.648_658+20del" "r.spl" "p.?" "" "0000760607" "00017595" "50" "763" "0" "763" "0" "c.763del" "r.(?)" "p.(Val255SerfsTer23)" "" "0000760666" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000760683" "00017595" "90" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000763954" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000764019" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "" "0000764040" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000764066" "00017595" "70" "210" "0" "210" "0" "c.210dup" "r.(?)" "p.(Arg71GlnfsTer12)" "" "0000765542" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000765549" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000765550" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000765569" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000765654" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62Ter)" "4" "0000765782" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127Ter)" "" "0000765807" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000765843" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000765862" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000765904" "00017595" "70" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "" "0000765931" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127Ter)" "" "0000766057" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766058" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766059" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766060" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766061" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766062" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766063" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766064" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000766065" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000766066" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000783276" "00017595" "70" "344" "-8" "344" "-8" "c.344-8C>T" "r.spl?" "p.?" "3i" "0000783788" "00017595" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000783863" "00017595" "50" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000783864" "00017595" "50" "623" "0" "623" "0" "c.623T>A" "r.(?)" "p.(Val208Glu)" "" "0000783865" "00017595" "50" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000783866" "00017595" "50" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65Ter)" "" "0000783867" "00017595" "50" "505" "0" "505" "0" "c.505C>G" "r.(?)" "p.(Arg169Gly)" "" "0000783956" "00017595" "50" "601" "0" "601" "0" "c.601del" "r.(?)" "p.(Cys201AlafsTer77)" "" "0000783957" "00017595" "50" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000783958" "00017595" "50" "724" "0" "726" "0" "c.724_726del" "r.(?)" "p.(Ser242del)" "" "0000783959" "00017595" "50" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000783960" "00017595" "50" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295Ter)" "" "0000784159" "00017595" "50" "577" "0" "577" "0" "c.577C>T" "r.(?)" "p.(Arg193Cys)" "" "0000784215" "00017595" "90" "598" "0" "598" "0" "c.598T>C" "r.(?)" "p.(Tyr200His)" "" "0000784216" "00017595" "90" "599" "0" "599" "0" "c.599A>G" "r.(?)" "p.(Tyr200Cys)" "" "0000784582" "00017595" "90" "598" "0" "598" "0" "c.598T>C" "r.(?)" "p.(Tyr200His)" "" "0000784583" "00017595" "90" "599" "0" "599" "0" "c.599A>G" "r.(?)" "p.(Tyr200Cys)" "" "0000785954" "00017595" "77" "617" "0" "617" "0" "c.617C>A" "r.(?)" "p.(Ala206Asp)" "7" "0000785955" "00017595" "77" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000785956" "00017595" "77" "617" "0" "617" "0" "c.617C>A" "r.(?)" "p.(Ala206Asp)" "7" "0000785957" "00017595" "77" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000785958" "00017595" "77" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000785959" "00017595" "77" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "4" "0000785960" "00017595" "77" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000785961" "00017595" "77" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "4" "0000786302" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269GlyfsTer2)" "" "0000786319" "00017595" "90" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000786431" "00017595" "90" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000786487" "00017595" "90" "844" "0" "844" "0" "c.844T>G" "r.(?)" "p.(Phe282Val)" "" "0000787735" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000788086" "00017595" "90" "778" "0" "778" "0" "c.778del" "r.(?)" "p.(Glu260ArgfsTer18)" "" "0000788087" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000788527" "00017595" "90" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000788534" "00017595" "90" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000789847" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "9" "0000789869" "00017595" "50" "731" "0" "731" "0" "c.731T>A" "r.(?)" "p.(Leu244His)" "8" "0000790728" "00017595" "70" "912" "0" "912" "0" "c.912G>A" "r.(?)" "p.(Trp304Ter)" "" "0000790730" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000790731" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000790732" "00017595" "70" "803" "0" "803" "0" "c.803G>T" "r.(?)" "p.(Cys268Phe)" "" "0000791166" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000792054" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "7" "0000792055" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "7" "0000792056" "00017595" "90" "375" "0" "375" "0" "c.375T>A" "r.(?)" "p.(Asn125Lys)" "6" "0000792057" "00017595" "90" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "8" "0000792058" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000792059" "00017595" "90" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000792179" "00017595" "10" "236" "0" "236" "0" "c.236C>T" "r.(?)" "p.(Ala79Val)" "5" "0000793734" "00017595" "90" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "4" "0000793735" "00017595" "70" "315" "0" "315" "0" "c.315C>G" "r.(?)" "p.(Ile105Met)" "5" "0000793736" "00017595" "50" "658" "591" "1554" "669" "c.658+591_*603+669delinsCT" "r.(?)" "p.?" "7i_9" "0000794363" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000794364" "00017595" "90" "505" "0" "505" "0" "c.505C>T" "r.(?)" "p.(Arg169Trp)" "7" "0000794365" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000794366" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000794987" "00017595" "50" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "5" "0000794988" "00017595" "50" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "4" "0000794989" "00017595" "50" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "4" "0000796007" "00017595" "30" "725" "0" "725" "0" "c.725C>G" "r.(?)" "p.(Ser242Cys)" "8" "0000796018" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000796019" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000796020" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000796021" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000796027" "00017595" "90" "505" "0" "505" "0" "c.505C>T" "r.(?)" "p.(Arg169Trp)" "7" "0000796028" "00017595" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "5" "0000796149" "00017595" "90" "250" "0" "250" "0" "c.250C>T" "r.(?)" "p.(Arg84*)" "5" "0000796150" "00017595" "90" "226" "0" "226" "0" "c.226G>T" "r.(?)" "p.(Gly76Trp)" "5" "0000796171" "00017595" "70" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "7" "0000796172" "00017595" "70" "872" "0" "872" "0" "c.872C>T" "r.(?)" "p.(Ser291Phe)" "9" "0000796206" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000796207" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000796208" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000796209" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000796210" "00017595" "90" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "4" "0000796211" "00017595" "90" "582" "0" "582" "0" "c.582C>G" "r.(?)" "p.(Tyr194*)" "7" "0000796212" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000796261" "00017595" "90" "692" "0" "692" "0" "c.692G>A" "r.(?)" "p.(Gly231Asp)" "8" "0000796262" "00017595" "90" "823" "0" "823" "0" "c.823G>T" "r.(?)" "p.(Glu275*)" "8" "0000796728" "00017595" "90" "133" "0" "133" "0" "c.133A>G" "r.(?)" "p.(Thr45Ala)" "4" "0000796747" "00017595" "70" "917" "0" "917" "0" "c.917T>G" "r.(?)" "p.(Val306Gly)" "9" "0000796773" "00017595" "90" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "5" "0000796775" "00017595" "90" "869" "0" "869" "0" "c.869T>G" "r.(?)" "p.(Val290Gly)" "9" "0000796828" "00017595" "90" "188" "0" "188" "0" "c.188G>T" "r.(?)" "p.(Gly63Val)" "5" "0000796837" "00017595" "70" "917" "0" "917" "0" "c.917T>G" "r.(?)" "p.(Val306Gly)" "9" "0000796879" "00017595" "90" "495" "0" "499" "0" "c.495_499del" "r.(?)" "p.(Ala166Cysfs*5)" "7" "0000796880" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000796881" "00017595" "90" "63" "0" "66" "0" "c.63_66del" "r.(?)" "p.(Ile22Glyfs*19)" "3" "0000796882" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000796906" "00017595" "90" "167" "0" "167" "0" "c.167C>A" "r.(?)" "p.(Ala56Asp)" "4" "0000796907" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000797086" "00017595" "90" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "5" "0000797087" "00017595" "90" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "7" "0000797158" "00017595" "90" "869" "0" "869" "0" "c.869T>G" "r.(?)" "p.(Val290Gly)" "9" "0000797159" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "7" "0000797409" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000797770" "00017595" "50" "697" "0" "697" "0" "c.697G>T" "r.(?)" "p.(Val233Phe)" "" "0000797771" "00017595" "90" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000797772" "00017595" "70" "226" "0" "226" "0" "c.226G>T" "r.(?)" "p.(Gly76Trp)" "" "0000797773" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000797774" "00017595" "70" "610" "0" "610" "0" "c.610A>C" "r.(?)" "p.(Lys204Gln)" "" "0000798487" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000798488" "00017595" "90" "658" "1" "658" "1" "c.658+1G>A" "r.spl?" "p.?" "7i" "0000798489" "00017595" "90" "740" "0" "740" "0" "c.740T>C" "r.(?)" "p.(Leu247Pro)" "8" "0000798494" "00017595" "90" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "7" "0000798495" "00017595" "90" "716" "0" "716" "0" "c.716G>A" "r.(?)" "p.(Arg239Gln)" "8" "0000798499" "00017595" "90" "740" "0" "740" "0" "c.740T>C" "r.(?)" "p.(Leu247Pro)" "8" "0000798500" "00017595" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "5" "0000806468" "00017595" "90" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000806469" "00017595" "50" "581" "0" "581" "0" "c.581A>G" "r.(?)" "p.(Tyr194Cys)" "" "0000811808" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000811829" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000811886" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000811887" "00017595" "70" "188" "-1" "188" "-1" "c.188-1G>A" "r.spl" "p.(?)" "" "0000812027" "00017595" "70" "375" "0" "375" "0" "c.375T>A" "r.(?)" "p.(Asn125Lys)" "6" "0000812028" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "8" "0000812032" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812046" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812047" "00017595" "70" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "7" "0000812069" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000812086" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812110" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000812124" "00017595" "70" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "7" "0000812127" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000812128" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812207" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000812208" "00017595" "70" "375" "0" "375" "0" "c.375T>A" "r.(?)" "p.(Asn125Lys)" "6" "0000812212" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812213" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000812214" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "8" "0000812274" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000812275" "00017595" "70" "210" "0" "210" "0" "c.210dup" "r.(?)" "p.(Arg71Glnfs*12)" "5" "0000812328" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000812329" "00017595" "70" "689" "0" "689" "0" "c.689C>G" "r.(?)" "p.(Pro230Arg)" "8" "0000812823" "00017595" "70" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000812824" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000813009" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000813024" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000813634" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000813636" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000813643" "00017595" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000813650" "00017595" "70" "508" "0" "508" "0" "c.508G>A" "r.(?)" "p.(Val170Met)" "" "0000813652" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000813667" "00017595" "70" "685" "0" "685" "0" "c.685C>T" "r.(?)" "p.(His229Tyr)" "" "0000813709" "00017595" "90" "68" "1" "68" "1" "c.68+1G>A" "r.spl" "p.(?)" "" "0000813731" "00017595" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000813741" "00017595" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000813745" "00017595" "90" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000813747" "00017595" "90" "722" "0" "722" "0" "c.722delC" "r.(?)" "p.(Ser242Profs*36)" "" "0000813778" "00017595" "90" "164" "0" "164" "0" "c.164C>A" "r.(?)" "p.(Thr55Lys)" "" "0000813791" "00017595" "90" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000814040" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814041" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814042" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814043" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814044" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814045" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814046" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814047" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814048" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000814277" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "4" "0000815309" "00017595" "90" "795" "0" "795" "0" "c.795C>A" "r.(?)" "p.(Ser265Arg)" "" "0000815392" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000815393" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000815464" "00017595" "90" "689" "0" "689" "0" "c.689C>G" "r.(?)" "p.(Pro230Arg)" "" "0000815543" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000815546" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000816168" "00017595" "70" "440" "0" "440" "0" "c.440A>C" "r.(?)" "p.(Asn147Thr)" "" "0000816200" "00017595" "50" "407" "0" "407" "0" "c.407C>T" "r.(?)" "p.(Thr136Ile)" "" "0000816472" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000816500" "00017595" "50" "407" "0" "407" "0" "c.407C>T" "r.(?)" "p.(Thr136Ile)" "" "0000817681" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000817682" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000817683" "00017595" "70" "716" "0" "716" "0" "c.716G>T" "r.(?)" "p.(Arg239Leu)" "" "0000819510" "00017595" "70" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "" "0000819511" "00017595" "70" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "" "0000819709" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000819713" "00017595" "70" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0000819769" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000820001" "00017595" "70" "599" "0" "599" "0" "c.599A>C" "r.(?)" "p.(Tyr200Ser)" "" "0000820113" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000820224" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000820387" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000820457" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000820515" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000820518" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000820891" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000820954" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000821350" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000821351" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000821597" "00017595" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000822934" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000823382" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000823383" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823384" "00017595" "70" "598" "0" "598" "0" "c.598T>C" "r.(?)" "p.(Tyr200His)" "" "0000823385" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823386" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823387" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000823388" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823442" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000823443" "00017595" "50" "698" "0" "699" "0" "c.698_699delinsAA" "r.(?)" "p.(Val233Glu)" "" "0000823444" "00017595" "50" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000823445" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000823446" "00017595" "50" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000823510" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000823511" "00017595" "50" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000823512" "00017595" "50" "125" "0" "125" "0" "c.125T>C" "r.(?)" "p.(Val42Ala)" "" "0000823513" "00017595" "50" "125" "0" "125" "0" "c.125T>C" "r.(?)" "p.(Val42Ala)" "" "0000823514" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823544" "00017595" "50" "178" "0" "178" "0" "c.178G>C" "r.(?)" "p.(Ala60Pro)" "" "0000823545" "00017595" "50" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000823546" "00017595" "50" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000823559" "00017595" "50" "325" "0" "325" "0" "c.325G>C" "r.(?)" "p.(Ala109Pro)" "" "0000823560" "00017595" "50" "325" "0" "325" "0" "c.325G>C" "r.(?)" "p.(Ala109Pro)" "" "0000824691" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000824780" "00017595" "70" "715" "0" "715" "0" "c.715C>G" "r.(?)" "p.(Arg239Gly)" "" "0000825887" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000825953" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000825970" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "5" "0000826014" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000826015" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000826061" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000826062" "00017595" "70" "671" "0" "671" "0" "c.671C>T" "r.(?)" "p.(Thr224Ile)" "8" "0000826118" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "4" "0000826119" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "6" "0000826150" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000826151" "00017595" "70" "505" "0" "505" "0" "c.505C>T" "r.(?)" "p.(Arg169Trp)" "7" "0000826187" "00017595" "70" "667" "0" "667" "0" "c.667G>T" "r.(?)" "p.(Val223Phe)" "8" "0000826217" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000827154" "00017595" "90" "680" "0" "684" "0" "c.680_684delinsT" "r.(?)" "p.(Ala227Valfs*50)" "8" "0000827318" "00017595" "70" "667" "0" "667" "0" "c.667G>T" "r.(?)" "p.(Val223Phe)" "8" "0000828310" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000828502" "00017595" "90" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "" "0000828518" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000828795" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000828827" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000828828" "00017595" "70" "505" "0" "505" "0" "c.505C>G" "r.(?)" "p.(Arg169Gly)" "" "0000829000" "00017595" "70" "505" "0" "505" "0" "c.505C>G" "r.(?)" "p.(Arg169Gly)" "" "0000829032" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "" "0000829033" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "" "0000841439" "00017595" "90" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "" "0000845991" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845992" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845993" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845994" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845995" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845996" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845997" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845998" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000845999" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846000" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846001" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846002" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846003" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846004" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846005" "00017595" "70" "" "0" "" "0" "677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846006" "00017595" "70" "" "0" "" "0" "806delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846007" "00017595" "70" "" "0" "" "0" "565C>T" "r.(?)" "p.(Gln189*)" "" "0000846008" "00017595" "70" "" "0" "" "0" "565C>T" "r.(?)" "p.(Gln189*)" "" "0000846009" "00017595" "70" "" "0" "" "0" "146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846010" "00017595" "70" "" "0" "" "0" "184C>T" "r.(?)" "p.(Arg62*)" "" "0000846030" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "2" "0000846031" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "4" "0000846032" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "4" "0000846033" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846034" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846035" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846036" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846037" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "5" "0000846038" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "5" "0000846039" "00017595" "70" "523" "0" "523" "0" "c.523T>C" "r.(?)" "p.(Ser175Pro)" "5" "0000846040" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846041" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846042" "00017595" "70" "152" "0" "152" "0" "c.152T>A" "r.(?)" "p.(Ile51Asn)" "2" "0000846043" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846044" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846045" "00017595" "70" "688" "0" "688" "0" "c.688C>G" "r.(?)" "p.(His229Gln)" "6" "0000846046" "00017595" "70" "688" "0" "688" "0" "c.688C>G" "r.(?)" "p.(His229Gln)" "6" "0000846047" "00017595" "70" "451" "0" "451" "0" "c.451C>A" "r.(?)" "p.(His151Asn)" "5" "0000846048" "00017595" "70" "451" "0" "451" "0" "c.451C>A" "r.(?)" "p.(His151Asn)" "5" "0000846049" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "6" "0000846050" "00017595" "70" "658" "1" "658" "1" "c.658+1G>A" "r.(?)" "p.(?)" "5" "0000846069" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846070" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846071" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "5" "0000846072" "00017595" "70" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "6" "0000846073" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "4" "0000846074" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846075" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846076" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846077" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "5" "0000846078" "00017595" "70" "99" "0" "102" "0" "c.99_102dupAAAT" "r.(?)" "p.(Val35Lysfs*28)" "2" "0000846079" "00017595" "70" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.(Met1?)" "1" "0000846080" "00017595" "70" "375" "0" "375" "0" "c.375T>A" "r.(?)" "p.(Asn125Lys)" "4" "0000846081" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "5" "0000846082" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846083" "00017595" "70" "854" "0" "854" "0" "c.854G>A" "r.(?)" "p.(Cys285Tyr)" "7" "0000846084" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "5" "0000846085" "00017595" "70" "429" "0" "432" "0" "c.429_432del4insGGT" "r.(?)" "p.(His143Glnfs*20)" "4" "0000846086" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "3" "0000846087" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "2" "0000846088" "00017595" "70" "715" "0" "715" "0" "c.715C>G" "r.(?)" "p.(Arg239Gly)" "6" "0000846089" "00017595" "70" "582" "0" "582" "0" "c.582C>A" "r.(?)" "p.(Tyr194*)" "5" "0000846090" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "2" "0000846091" "00017595" "50" "577" "0" "577" "0" "c.577C>T" "r.(?)" "p.(Arg193Cys)" "5" "0000846092" "00017595" "70" "689" "0" "689" "0" "c.689C>T" "r.(?)" "p.(Pro230Leu)" "6" "0000846093" "00017595" "50" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "5" "0000846094" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846095" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846096" "00017595" "70" "434" "0" "434" "0" "c.434G>A" "r.(?)" "p.(Gly145Glu)" "4" "0000846097" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "6" "0000846098" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "5" "0000846099" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846100" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846101" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "7" "0000846102" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846103" "00017595" "70" "617" "0" "617" "0" "c.617C>A" "r.(?)" "p.(Ala206Asp)" "5" "0000846104" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846112" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846113" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846114" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846115" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846116" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846117" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846118" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846119" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846120" "00017595" "70" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Gln189*)" "" "0000846121" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846122" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000846123" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000846124" "00017595" "70" "821" "0" "821" "0" "c.821T>C" "r.(?)" "p.(Leu274Pro)" "" "0000846125" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000846126" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000846127" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846128" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846129" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000846130" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846136" "00017595" "70" "138" "0" "138" "0" "c.138C>T" "r.spl?" "p.(Gly46=)" "2" "0000846137" "00017595" "70" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "5" "0000846138" "00017595" "70" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "5" "0000846139" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "2" "0000846140" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846141" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846142" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846143" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846144" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846145" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846146" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846147" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846148" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846149" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846150" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846151" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846152" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846153" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846154" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846155" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846156" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846157" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846158" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846159" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846160" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846161" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846162" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846163" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846164" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846165" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846166" "00017595" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Arg161Gln)" "5" "0000846167" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "5" "0000846168" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846169" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846170" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846171" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846172" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846173" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846174" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846175" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846176" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846177" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846178" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846179" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846180" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846181" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846182" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846183" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846184" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846185" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846186" "00017595" "70" "776" "0" "776" "0" "c.776delG" "r.(?)" "p.(Glu260Argfs*18)" "2" "0000846199" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846200" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846201" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846202" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846203" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846204" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000846205" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000846206" "00017595" "70" "434" "0" "434" "0" "c.434G>A" "r.(?)" "p.(Gly145Glu)" "" "0000846207" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846208" "00017595" "70" "375" "0" "375" "0" "c.375T>A" "r.(?)" "p.(Asn125Lys)" "" "0000846209" "00017595" "70" "99" "0" "102" "0" "c.99_102dupAAAT" "r.(?)" "p.(Val35Lysfs*28)" "" "0000846210" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846211" "00017595" "70" "2" "0" "2" "0" "c.2T>C" "r.0?" "p.(Met1?)" "" "0000846212" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000846230" "00017595" "70" "912" "0" "912" "0" "c.912G>A" "r.(?)" "p.(Trp304*)" "" "0000846231" "00017595" "70" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000846232" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846233" "00017595" "70" "152" "0" "152" "0" "c.152T>A" "r.(?)" "p.(Ile51Asn)" "" "0000846236" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846237" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846238" "00017595" "70" "715" "0" "715" "0" "c.715C>T" "r.(?)" "p.(Arg239Trp)" "" "0000846239" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846240" "00017595" "70" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0000846241" "00017595" "70" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000846242" "00017595" "70" "146" "0" "146" "0" "c.146C>A" "r.(?)" "p.(Thr49Lys)" "" "0000846243" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000846244" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846245" "00017595" "70" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Cys70Tyr)" "" "0000846246" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846247" "00017595" "70" "599" "0" "599" "0" "c.599A>G" "r.(?)" "p.(Tyr200Cys)" "" "0000846248" "00017595" "70" "454" "0" "454" "0" "c.454T>A" "r.(?)" "p.(Phe152Ile)" "" "0000846249" "00017595" "70" "250" "0" "250" "0" "c.250C>T" "r.(?)" "p.(Arg84*)" "" "0000846250" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846251" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846252" "00017595" "70" "505" "0" "505" "0" "c.505C>T" "r.(?)" "p.(Arg169Trp)" "" "0000846253" "00017595" "70" "448" "1" "448" "1" "c.448+1g>a" "r.spl" "p.(?)" "" "0000846254" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846255" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846256" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846257" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846258" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846259" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846260" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000846261" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846262" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000846263" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846264" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000846265" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846266" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846267" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846268" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846269" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846270" "00017595" "70" "63" "0" "66" "0" "c.63_66del" "r.(?)" "p.(Ile22Glyfs*19)" "" "0000846271" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846272" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846273" "00017595" "70" "381" "0" "381" "0" "c.381delA" "r.(?)" "p.(Val128*)" "" "0000846274" "00017595" "70" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000846275" "00017595" "70" "698" "0" "699" "0" "c.698_699insGT" "r.(?)" "p.(Arg234Serfs*45)" "" "0000846276" "00017595" "70" "714" "0" "715" "0" "c.714_715insC" "r.(?)" "p.(Arg239Profs*34)" "" "0000846277" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846278" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846279" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846280" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846281" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846282" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846283" "00017595" "70" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "3" "0000846284" "00017595" "70" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "3" "0000846285" "00017595" "70" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "3" "0000846286" "00017595" "70" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "3" "0000846287" "00017595" "70" "446" "0" "446" "0" "c.446T>C" "r.(?)" "p.(Leu149Pro)" "3" "0000846288" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846289" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846290" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846291" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000846292" "00017595" "70" "437" "0" "437" "0" "c.437T>A" "r.(?)" "p.(Val146Asp)" "" "0000846293" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000846294" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000846295" "00017595" "70" "848" "82" "848" "82" "c.848+82C>G" "r.spl?" "p.(?)" "" "0000846296" "00017595" "70" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "" "0000846297" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846298" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846299" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846300" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846301" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846302" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846303" "00017595" "70" "226" "0" "226" "0" "c.226G>C" "r.(?)" "p.(Gly76Arg)" "" "0000846304" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846305" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846306" "00017595" "70" "63" "0" "66" "0" "c.63_66del" "r.(?)" "p.(Ile22Glyfs*19)" "" "0000846307" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846308" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846309" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846310" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846311" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846312" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846313" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846314" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846315" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846316" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846317" "00017595" "70" "715" "0" "715" "0" "c.715dup" "r.(?)" "p.(Arg239Profs*34)" "" "0000846318" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846319" "00017595" "70" "806" "0" "810" "0" "c.806_810delCCCTG" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846320" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846321" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846322" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846323" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846324" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846325" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846326" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846327" "00017595" "70" "400" "0" "400" "0" "c.400T>C" "r.(?)" "p.(Ser134Pro)" "" "0000846328" "00017595" "70" "641" "0" "641" "0" "c.641T>C" "r.(?)" "p.(Leu214Pro)" "" "0000846329" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846330" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846331" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846332" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846333" "00017595" "70" "133" "0" "133" "0" "c.133A>G" "r.(?)" "p.(Thr45Ala)" "" "0000846334" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846335" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846338" "00017595" "70" "715" "0" "715" "0" "c.715dup" "r.(?)" "p.(Arg239Profs*34)" "" "0000846339" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846340" "00017595" "70" "671" "0" "671" "0" "c.671C>T" "r.(?)" "p.(Thr224Ile)" "" "0000846341" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846342" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846343" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846344" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846345" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846346" "00017595" "70" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000846347" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846348" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846349" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846350" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846351" "00017595" "70" "377" "0" "377" "0" "c.377C>A" "r.(?)" "p.(Ala126Glu)" "" "0000846352" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846353" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846354" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846355" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846356" "00017595" "70" "302" "0" "302" "0" "c.302A>G" "r.(?)" "p.(Asp101Gly)" "" "0000846357" "00017595" "70" "302" "0" "302" "0" "c.302A>G" "r.(?)" "p.(Asp101Gly)" "" "0000846358" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846359" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846360" "00017595" "70" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000846361" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000846362" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846363" "00017595" "70" "38" "0" "38" "0" "c.38C>A" "r.(?)" "p.(Ser13*)" "" "0000846364" "00017595" "70" "325" "0" "325" "0" "c.325G>C" "r.(?)" "p.(Ala109Pro)" "" "0000846365" "00017595" "70" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "" "0000846366" "00017595" "70" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "" "0000846367" "00017595" "70" "400" "0" "400" "0" "c.400T>C" "r.(?)" "p.(Ser134Pro)" "" "0000846368" "00017595" "70" "697" "0" "697" "0" "c.697G>C" "r.(?)" "p.(Val233Leu)" "" "0000846369" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000846370" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846371" "00017595" "70" "63" "0" "66" "0" "c.63_66del" "r.(?)" "p.(Ile22Glyfs*19)" "" "0000846372" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846373" "00017595" "70" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000846374" "00017595" "70" "178" "0" "178" "0" "c.178G>A" "r.(?)" "p.(Ala60Thr)" "" "0000846375" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000846376" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846377" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846378" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846379" "00017595" "70" "454" "0" "454" "0" "c.454T>A" "r.(?)" "p.(Phe152Ile)" "" "0000846380" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846381" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846382" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846383" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846384" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000846385" "00017595" "70" "715" "0" "715" "0" "c.715dup" "r.(?)" "p.(Arg239Profs*34)" "" "0000846386" "00017595" "70" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0000846387" "00017595" "70" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127*)" "" "0000846388" "00017595" "70" "715" "0" "715" "0" "c.715C>T" "r.(?)" "p.(Arg239Trp)" "" "0000846389" "00017595" "70" "448" "1" "448" "1" "c.448+1G>A" "r.(?)" "p.?" "" "0000846390" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846391" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846392" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846393" "00017595" "70" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0000846394" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000846395" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846396" "00017595" "70" "383" "0" "383" "0" "c.383T>G" "r.(?)" "p.(Val128Gly)" "" "0000846397" "00017595" "70" "910" "0" "910" "0" "c.910T>C" "r.(?)" "p.(Trp304Arg)" "" "0000846398" "00017595" "70" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Cys70Tyr)" "" "0000846399" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846400" "00017595" "70" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Ser203Arg)" "" "0000846401" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846402" "00017595" "70" "680" "0" "684" "0" "c.680_684delinsT" "r.(?)" "p.(Ala227Valfs*50)" "" "0000846403" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846404" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846405" "00017595" "70" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "" "0000846406" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846407" "00017595" "70" "185" "0" "185" "0" "c.185G>T" "r.(?)" "p.(Arg62Leu)" "" "0000846408" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846409" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846410" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "" "0000846411" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846415" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000846416" "00017595" "70" "185" "0" "185" "0" "c.185G>T" "r.(?)" "p.(Arg62Leu)" "" "0000846417" "00017595" "70" "440" "0" "440" "0" "c.440A>C" "r.(?)" "p.(Asn147Thr)" "" "0000846418" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846419" "00017595" "70" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Arg65Gln)" "" "0000846420" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846421" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000846422" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "" "0000846423" "00017595" "70" "215" "0" "215" "0" "c.215A>G" "r.(?)" "p.(Asp72Gly)" "" "0000846424" "00017595" "70" "362" "0" "362" "0" "c.362T>C" "r.(?)" "p.(Ile121Thr)" "" "0000846425" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "" "0000846426" "00017595" "70" "844" "0" "844" "0" "c.844T>G" "r.(?)" "p.(Phe282Val)" "" "0000846427" "00017595" "70" "619" "0" "619" "0" "c.619A>G" "r.(?)" "p.(Asn207Asp)" "" "0000846428" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "" "0000846429" "00017595" "70" "697" "0" "697" "0" "c.697G>A" "r.(?)" "p.(Val233Ile)" "" "0000846430" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846431" "00017595" "70" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "" "0000846432" "00017595" "70" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Ser175Leu)" "" "0000846433" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846434" "00017595" "70" "448" "1" "448" "1" "c.448+1G>A" "r.(?)" "p.?" "" "0000846435" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "6" "0000846436" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "6" "0000846437" "00017595" "70" "735" "0" "743" "0" "c.735_743del" "r.(?)" "p.(Cys245_Leu247deI)" "" "0000846438" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846439" "00017595" "70" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Arg169Gln)" "" "0000846440" "00017595" "70" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000846441" "00017595" "70" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000846442" "00017595" "70" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000846443" "00017595" "70" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000846444" "00017595" "70" "759" "0" "759" "0" "c.759del" "r.(?)" "p.(Phe254Leufs*24)" "" "0000846447" "00017595" "70" "164" "0" "164" "0" "c.164C>T" "r.(?)" "p.(Thr55Met)" "2" "0000846448" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "2" "0000846455" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000846459" "00017595" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" "" "0000846465" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846466" "00017595" "70" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "3" "0000846467" "00017595" "70" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "6" "0000846468" "00017595" "70" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "6" "0000846469" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "7" "0000846471" "00017595" "70" "535" "0" "535" "0" "c.535C>G" "r.(?)" "p.(His179Asp)" "7" "0000846472" "00017595" "70" "535" "0" "535" "0" "c.535C>G" "r.(?)" "p.(His179Asp)" "7" "0000846473" "00017595" "70" "164" "0" "164" "0" "c.164C>A" "r.(?)" "p.(Thr55Lys)" "4" "0000846474" "00017595" "70" "164" "0" "164" "0" "c.164C>A" "r.(?)" "p.(Thr55Lys)" "4" "0000846881" "00017595" "70" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000846899" "00017595" "50" "731" "0" "731" "0" "c.731T>A" "r.(?)" "p.(Leu244His)" "" "0000881441" "00017595" "50" "785" "0" "785" "0" "c.785C>G" "r.(?)" "p.(Ala262Gly)" "" "0000896553" "00017595" "70" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "" "0000896554" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "" "0000896723" "00017595" "70" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "" "0000896724" "00017595" "70" "505" "0" "505" "0" "c.505C>G" "r.(?)" "p.(Arg169Gly)" "" "0000896740" "00017595" "70" "505" "0" "505" "0" "c.505C>G" "r.(?)" "p.(Arg169Gly)" "" "0000896741" "00017595" "70" "806" "0" "806" "0" "c.806C>G" "r.(?)" "p.(Ala269Gly)" "" "0000898080" "00017595" "70" "211" "0" "211" "0" "c.211A>G" "r.(?)" "p.(Arg71Gly)" "5" "0000900605" "00017595" "70" "693" "0" "694" "0" "c.693_694insACTGCGTCCGCTCTGAGCTGGC" "r.(?)" "p.(Val232Thrfs*12)" "8" "0000905874" "00017595" "70" "648" "0" "658" "20" "c.648_658+20del" "r.spl" "p.?" "" "0000905935" "00017595" "90" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295*)" "" "0000905936" "00017595" "70" "910" "0" "910" "0" "c.910T>C" "r.(?)" "p.(Trp304Arg)" "" "0000914210" "00017595" "30" "659" "-12" "659" "-12" "c.659-12T>C" "r.(=)" "p.(=)" "" "0000915902" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000916186" "00017595" "70" "788" "0" "788" "0" "c.788A>C" "r.(?)" "p.(Gln263Pro)" "8" "0000916192" "00017595" "70" "658" "2" "658" "2" "c.658+2dup" "r.spl?" "p.(?)" "7i" "0000916251" "00017595" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Thr49Met)" "4" "0000916252" "00017595" "70" "630" "0" "630" "0" "c.630dup" "r.(?)" "p.(Thr211Tyrfs*3)" "7" "0000916285" "00017595" "90" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "8" "0000916355" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "4" "0000916356" "00017595" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Asp187Asn)" "7" "0000916390" "00017595" "90" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "8" "0000916466" "00017595" "50" "781" "0" "781" "0" "c.781G>A" "r.(?)" "p.(Gly261Arg)" "8" "0000916467" "00017595" "50" "872" "0" "872" "0" "c.872C>T" "r.(?)" "p.(Ser291Phe)" "9" "0000916481" "00017595" "90" "698" "0" "698" "0" "c.698T>A" "r.(?)" "p.(Val233Asp)" "8" "0000916526" "00017595" "90" "806" "0" "810" "0" "c.806_810del" "r.(?)" "p.(Ala269Glyfs*2)" "8" "0000916544" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000916545" "00017595" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Thr155Ile)" "7" "0000916554" "00017595" "70" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" "5" "0000916555" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000916581" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000916653" "00017595" "90" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Arg62*)" "4" "0000916654" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000958059" "00017595" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Gly76Arg)" "" "0000958838" "00017595" "70" "481" "0" "481" "0" "c.481C>T" "r.(?)" "p.(Arg161Trp)" "" "0000958851" "00017595" "50" "641" "0" "641" "0" "c.641T>C" "r.(?)" "p.(Leu214Pro)" "" "0000958907" "00017595" "90" "451" "0" "451" "0" "c.451C>G" "r.(?)" "p.(His151Asp)" "" "0000958998" "00017595" "50" "284" "0" "284" "0" "c.284G>C" "r.(?)" "p.(Arg95Pro)" "" "0000959266" "00017595" "50" "632" "0" "632" "0" "c.632C>T" "r.(?)" "p.(Thr211Ile)" "" "0000959342" "00017595" "50" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Gly63Glu)" "" "0000959460" "00017595" "50" "317" "0" "317" "0" "c.317G>A" "r.(?)" "p.(Arg106Gln)" "" "0000986552" "00017595" "50" "785" "0" "785" "0" "c.785C>G" "r.(?)" "p.(Ala262Gly)" "8" "0000986553" "00017595" "50" "785" "0" "785" "0" "c.785C>G" "r.(?)" "p.(Ala262Gly)" "8" "0000986554" "00017595" "90" "148" "0" "148" "0" "c.148G>A" "r.(?)" "p.(Gly50Ser)" "4" "0000986555" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000986556" "00017595" "50" "284" "0" "284" "0" "c.284G>A" "r.(?)" "p.(Arg95Gln)" "5" "0000986557" "00017595" "90" "295" "0" "295" "0" "c.295C>A" "r.(?)" "p.(Leu99Ile)" "5" "0000986558" "00017595" "70" "464" "0" "464" "0" "c.464C>A" "r.(?)" "p.(Thr155Asn)" "7" "0000986559" "00017595" "90" "379" "0" "379" "0" "c.379G>T" "r.(?)" "p.(Gly127Ter)" "6" "0000986560" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000986561" "00017595" "50" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Arg65Gln)" "5" "0000986562" "00017595" "90" "377" "0" "377" "0" "c.377C>T" "r.(?)" "p.(Ala126Val)" "6" "0000986922" "00017595" "70" "229" "0" "229" "0" "c.229G>T" "r.(?)" "p.(Glu77Ter)" "5" "0000986947" "00017595" "50" "938" "0" "938" "0" "c.938T>G" "r.(?)" "p.(Ile313Ser)" "9" "0000986948" "00017595" "50" "667" "0" "667" "0" "c.667G>T" "r.(?)" "p.(Val223Phe)" "8" "0000986949" "00017595" "50" "764" "0" "764" "0" "c.764T>G" "r.(?)" "p.(Val255Gly)" "8" "0000986950" "00017595" "90" "883" "0" "883" "0" "c.883C>T" "r.(?)" "p.(Arg295Ter)" "9" "0000986951" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "8" "0000986952" "00017595" "70" "701" "0" "701" "0" "c.701G>A" "r.(?)" "p.(Arg234His)" "8" "0000986953" "00017595" "90" "677" "0" "677" "0" "c.677A>G" "r.(?)" "p.(Tyr226Cys)" "8" "0001001109" "00017595" "50" "185" "0" "185" "0" "c.185G>T" "r.(?)" "p.(Arg62Leu)" "" "0001022259" "00017595" "90" "601" "0" "601" "0" "c.601T>C" "r.(?)" "p.(Cys201Arg)" "" "0001046476" "00017595" "50" "185" "0" "185" "0" "c.185G>A" "r.(?)" "p.(Arg62Gln)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 827 "{{screeningid}}" "{{variantid}}" "0000001592" "0000019487" "0000001592" "0000019488" "0000001593" "0000019489" "0000001593" "0000019490" "0000001616" "0000019525" "0000001616" "0000019526" "0000016559" "0000036427" "0000016566" "0000036434" "0000033233" "0000060172" "0000033233" "0000060173" "0000033413" "0000060174" "0000033413" "0000060175" "0000033658" "0000060176" "0000033671" "0000060177" "0000033671" "0000060178" "0000033755" "0000060179" "0000033771" "0000060182" "0000052355" "0000081799" "0000096359" "0000158352" "0000156394" "0000358316" "0000156395" "0000358317" "0000156395" "0000358450" "0000156396" "0000358318" "0000156397" "0000358319" "0000156398" "0000358320" "0000156399" "0000358321" "0000156400" "0000358322" "0000156401" "0000358323" "0000208637" "0000438558" "0000208637" "0000438559" "0000208724" "0000438667" "0000208727" "0000438671" "0000208729" "0000438674" "0000208729" "0000438675" "0000208730" "0000438676" "0000208730" "0000438677" "0000208741" "0000438691" "0000208741" "0000438692" "0000209942" "0000441072" "0000234342" "0000477050" "0000234343" "0000477051" "0000234344" "0000477052" "0000234345" "0000477053" "0000234346" "0000477054" "0000234347" "0000477055" "0000234348" "0000477056" "0000234875" "0000477583" "0000292263" "0000648952" "0000309553" "0000684418" "0000309554" "0000684419" "0000309555" "0000684420" "0000309555" "0000684437" "0000309684" "0000684557" "0000309767" "0000684640" "0000310477" "0000685388" "0000310478" "0000685389" "0000310479" "0000685390" "0000310480" "0000685391" "0000310481" "0000685392" "0000310482" "0000685393" "0000310484" "0000685395" "0000310485" "0000685396" "0000310486" "0000685397" "0000310487" "0000685398" "0000325327" "0000708307" "0000326629" "0000710221" "0000326629" "0000710333" "0000326657" "0000710249" "0000326674" "0000710266" "0000326708" "0000710300" "0000326708" "0000710358" "0000326715" "0000710307" "0000329373" "0000713496" "0000329478" "0000713601" "0000329709" "0000714066" "0000329710" "0000714067" "0000329710" "0000714102" "0000333484" "0000731138" "0000333484" "0000731165" "0000333581" "0000731257" "0000333581" "0000731280" "0000335182" "0000733191" "0000335182" "0000733625" "0000335183" "0000733192" "0000335184" "0000733193" "0000335184" "0000733626" "0000335185" "0000733194" "0000335185" "0000733627" "0000335186" "0000733195" "0000335186" "0000733628" "0000335187" "0000733196" "0000335658" "0000734352" "0000335677" "0000734372" "0000335678" "0000734373" "0000336377" "0000735652" "0000336377" "0000735761" "0000336510" "0000735906" "0000336510" "0000735962" "0000336611" "0000736056" "0000336622" "0000736067" "0000336622" "0000736120" "0000336977" "0000736556" "0000336977" "0000736557" "0000360021" "0000759663" "0000360021" "0000759678" "0000360156" "0000759854" "0000360156" "0000759882" "0000360169" "0000759897" "0000360215" "0000759942" "0000360215" "0000759963" "0000360293" "0000760185" "0000360293" "0000760437" "0000360327" "0000760219" "0000360327" "0000760452" "0000360332" "0000760224" "0000360332" "0000760455" "0000360370" "0000760262" "0000360575" "0000760607" "0000360624" "0000760666" "0000360624" "0000760683" "0000363377" "0000763954" "0000363377" "0000764019" "0000363402" "0000764040" "0000363402" "0000764066" "0000364667" "0000765542" "0000364674" "0000765549" "0000364675" "0000765550" "0000364694" "0000765569" "0000364747" "0000765654" "0000364840" "0000765782" "0000364865" "0000765807" "0000364865" "0000765931" "0000364901" "0000765843" "0000364920" "0000765862" "0000364962" "0000765904" "0000365102" "0000766057" "0000365103" "0000766058" "0000365104" "0000766059" "0000365105" "0000766060" "0000365106" "0000766061" "0000365107" "0000766062" "0000365108" "0000766063" "0000365109" "0000766064" "0000365110" "0000766065" "0000365111" "0000766066" "0000369585" "0000784159" "0000373304" "0000783276" "0000373640" "0000783788" "0000373715" "0000783863" "0000373715" "0000783956" "0000373716" "0000783864" "0000373716" "0000783957" "0000373717" "0000783865" "0000373717" "0000783958" "0000373718" "0000783866" "0000373718" "0000783959" "0000373719" "0000783867" "0000373719" "0000783960" "0000373902" "0000784215" "0000373902" "0000784582" "0000373903" "0000784216" "0000373903" "0000784583" "0000374977" "0000785954" "0000374977" "0000785955" "0000374978" "0000785956" "0000374978" "0000785957" "0000374979" "0000785958" "0000374979" "0000785959" "0000374980" "0000785960" "0000374980" "0000785961" "0000375041" "0000786302" "0000375047" "0000786319" "0000375136" "0000786431" "0000375136" "0000786487" "0000376167" "0000787735" "0000376478" "0000788086" "0000376479" "0000788087" "0000376634" "0000788527" "0000376641" "0000788534" "0000377489" "0000789847" "0000377507" "0000789869" "0000378059" "0000790728" "0000378061" "0000790730" "0000378062" "0000790731" "0000378063" "0000790732" "0000378411" "0000791166" "0000379025" "0000792054" "0000379025" "0000792055" "0000379026" "0000792056" "0000379026" "0000792057" "0000379027" "0000792058" "0000379027" "0000792059" "0000379107" "0000792179" "0000380589" "0000793734" "0000380590" "0000793735" "0000380591" "0000793736" "0000381068" "0000794363" "0000381068" "0000794364" "0000381069" "0000794365" "0000381070" "0000794366" "0000381526" "0000794987" "0000381527" "0000794988" "0000381528" "0000794989" "0000382265" "0000796007" "0000382274" "0000796018" "0000382275" "0000796019" "0000382276" "0000796020" "0000382277" "0000796021" "0000382282" "0000796027" "0000382282" "0000796028" "0000382370" "0000796149" "0000382370" "0000796150" "0000382383" "0000796171" "0000382383" "0000796172" "0000382407" "0000796206" "0000382407" "0000796207" "0000382408" "0000796208" "0000382408" "0000796209" "0000382409" "0000796210" "0000382410" "0000796211" "0000382410" "0000796212" "0000382441" "0000796261" "0000382441" "0000796262" "0000382841" "0000796728" "0000382849" "0000796747" "0000382861" "0000796773" "0000382861" "0000796775" "0000382883" "0000796828" "0000382888" "0000796837" "0000382919" "0000796879" "0000382919" "0000796880" "0000382920" "0000796881" "0000382920" "0000796882" "0000382936" "0000796906" "0000382936" "0000796907" "0000383094" "0000797086" "0000383094" "0000797158" "0000383095" "0000797087" "0000383095" "0000797159" "0000383348" "0000797409" "0000383590" "0000797770" "0000383590" "0000797771" "0000383591" "0000797772" "0000383592" "0000797773" "0000383593" "0000797774" "0000384057" "0000798487" "0000384058" "0000798488" "0000384059" "0000798489" "0000384064" "0000798494" "0000384065" "0000798495" "0000384069" "0000798499" "0000384070" "0000798500" "0000384967" "0000811808" "0000384988" "0000811829" "0000385002" "0000811886" "0000385002" "0000811887" "0000385144" "0000812027" "0000385144" "0000812028" "0000385147" "0000812032" "0000385156" "0000812046" "0000385156" "0000812047" "0000385171" "0000812069" "0000385183" "0000812086" "0000385196" "0000812110" "0000385205" "0000812124" "0000385207" "0000812127" "0000385207" "0000812128" "0000385256" "0000812207" "0000385256" "0000812208" "0000385258" "0000812212" "0000385259" "0000812213" "0000385259" "0000812214" "0000385298" "0000812274" "0000385298" "0000812275" "0000385328" "0000812328" "0000385328" "0000812329" "0000385712" "0000812823" "0000385712" "0000812824" "0000385852" "0000813009" "0000385852" "0000813024" "0000386227" "0000813634" "0000386229" "0000813636" "0000386236" "0000813643" "0000386236" "0000813741" "0000386243" "0000813650" "0000386243" "0000813745" "0000386245" "0000813652" "0000386245" "0000813747" "0000386260" "0000813667" "0000386302" "0000813709" "0000386302" "0000813778" "0000386324" "0000813731" "0000386324" "0000813791" "0000386493" "0000814040" "0000386494" "0000814041" "0000386495" "0000814042" "0000386496" "0000814043" "0000386497" "0000814044" "0000386498" "0000814045" "0000386499" "0000814046" "0000386500" "0000814047" "0000386501" "0000814048" "0000386639" "0000814277" "0000387425" "0000815309" "0000387425" "0000815464" "0000387508" "0000815392" "0000387508" "0000815543" "0000387509" "0000815393" "0000387509" "0000815546" "0000388010" "0000816168" "0000388010" "0000816472" "0000388042" "0000816200" "0000388042" "0000816500" "0000388888" "0000817681" "0000388889" "0000817682" "0000388889" "0000817683" "0000390165" "0000819510" "0000390166" "0000819511" "0000390364" "0000819709" "0000390368" "0000819713" "0000390424" "0000819769" "0000390656" "0000820001" "0000390768" "0000820113" "0000390879" "0000820224" "0000391042" "0000820387" "0000391042" "0000820891" "0000391112" "0000820457" "0000391170" "0000820515" "0000391173" "0000820518" "0000391173" "0000820954" "0000391601" "0000821350" "0000391602" "0000821351" "0000391602" "0000821597" "0000392591" "0000822934" "0000392913" "0000823382" "0000392914" "0000823383" "0000392914" "0000823510" "0000392915" "0000823384" "0000392915" "0000823511" "0000392916" "0000823385" "0000392916" "0000823512" "0000392916" "0000823559" "0000392917" "0000823386" "0000392917" "0000823513" "0000392917" "0000823560" "0000392918" "0000823387" "0000392918" "0000823514" "0000392919" "0000823388" "0000392972" "0000823442" "0000392973" "0000823443" "0000392974" "0000823444" "0000392974" "0000823544" "0000392975" "0000823445" "0000392975" "0000823545" "0000392976" "0000823446" "0000392976" "0000823546" "0000393869" "0000824691" "0000393869" "0000824780" "0000394835" "0000825887" "0000394880" "0000825953" "0000394891" "0000825970" "0000394921" "0000826014" "0000394921" "0000826015" "0000394950" "0000826061" "0000394950" "0000826062" "0000394983" "0000826118" "0000394983" "0000826119" "0000395004" "0000826150" "0000395004" "0000826151" "0000395028" "0000826187" "0000395050" "0000826217" "0000395752" "0000827154" "0000395871" "0000827318" "0000396659" "0000828310" "0000396817" "0000828502" "0000396828" "0000828518" "0000397049" "0000828795" "0000397049" "0000829000" "0000397081" "0000828827" "0000397081" "0000829032" "0000397082" "0000828828" "0000397082" "0000829033" "0000405351" "0000841439" "0000408963" "0000845991" "0000408964" "0000845992" "0000408965" "0000845993" "0000408966" "0000845994" "0000408967" "0000845995" "0000408968" "0000845996" "0000408969" "0000845997" "0000408970" "0000845998" "0000408971" "0000845999" "0000408972" "0000846000" "0000408973" "0000846001" "0000408974" "0000846002" "0000408975" "0000846003" "0000408976" "0000846004" "0000408977" "0000846005" "0000408978" "0000846006" "0000408979" "0000846007" "0000408980" "0000846008" "0000408981" "0000846009" "0000408981" "0000846010" "0000408999" "0000846030" "0000408999" "0000846042" "0000409000" "0000846031" "0000409000" "0000846043" "0000409001" "0000846032" "0000409001" "0000846044" "0000409002" "0000846033" "0000409002" "0000846045" "0000409003" "0000846034" "0000409003" "0000846046" "0000409004" "0000846035" "0000409004" "0000846047" "0000409005" "0000846036" "0000409005" "0000846048" "0000409006" "0000846037" "0000409007" "0000846038" "0000409008" "0000846039" "0000409008" "0000846049" "0000409009" "0000846040" "0000409009" "0000846050" "0000409010" "0000846041" "0000409026" "0000846069" "0000409027" "0000846070" "0000409028" "0000846071" "0000409029" "0000846072" "0000409030" "0000846073" "0000409031" "0000846074" "0000409032" "0000846075" "0000409032" "0000846094" "0000409033" "0000846076" "0000409034" "0000846077" "0000409035" "0000846078" "0000409035" "0000846095" "0000409036" "0000846079" "0000409036" "0000846096" "0000409037" "0000846080" "0000409037" "0000846097" "0000409038" "0000846081" "0000409038" "0000846098" "0000409039" "0000846082" "0000409040" "0000846083" "0000409041" "0000846084" "0000409041" "0000846099" "0000409042" "0000846085" "0000409043" "0000846086" "0000409043" "0000846100" "0000409044" "0000846087" "0000409044" "0000846101" "0000409045" "0000846088" "0000409045" "0000846102" "0000409046" "0000846089" "0000409046" "0000846103" "0000409047" "0000846090" "0000409047" "0000846104" "0000409048" "0000846091" "0000409049" "0000846092" "0000409050" "0000846093" "0000409055" "0000846112" "0000409056" "0000846113" "0000409057" "0000846114" "0000409058" "0000846115" "0000409059" "0000846116" "0000409060" "0000846117" "0000409061" "0000846118" "0000409062" "0000846119" "0000409063" "0000846120" "0000409064" "0000846121" "0000409064" "0000846122" "0000409065" "0000846123" "0000409066" "0000846124" "0000409067" "0000846125" "0000409067" "0000846126" "0000409068" "0000846127" "0000409069" "0000846128" "0000409070" "0000846129" "0000409070" "0000846130" "0000409073" "0000846136" "0000409074" "0000846137" "0000409075" "0000846138" "0000409076" "0000846139" "0000409076" "0000846140" "0000409077" "0000846141" "0000409078" "0000846142" "0000409079" "0000846143" "0000409080" "0000846144" "0000409081" "0000846145" "0000409082" "0000846146" "0000409083" "0000846147" "0000409084" "0000846148" "0000409085" "0000846149" "0000409086" "0000846150" "0000409087" "0000846151" "0000409088" "0000846152" "0000409089" "0000846153" "0000409090" "0000846154" "0000409091" "0000846155" "0000409092" "0000846156" "0000409093" "0000846157" "0000409094" "0000846158" "0000409095" "0000846159" "0000409096" "0000846160" "0000409097" "0000846161" "0000409098" "0000846162" "0000409099" "0000846163" "0000409100" "0000846164" "0000409101" "0000846165" "0000409102" "0000846166" "0000409103" "0000846167" "0000409104" "0000846168" "0000409105" "0000846169" "0000409106" "0000846170" "0000409107" "0000846171" "0000409108" "0000846172" "0000409109" "0000846173" "0000409110" "0000846174" "0000409111" "0000846175" "0000409112" "0000846176" "0000409113" "0000846177" "0000409114" "0000846178" "0000409115" "0000846179" "0000409116" "0000846180" "0000409117" "0000846181" "0000409118" "0000846182" "0000409119" "0000846183" "0000409120" "0000846184" "0000409121" "0000846185" "0000409122" "0000846186" "0000409128" "0000846199" "0000409129" "0000846200" "0000409130" "0000846201" "0000409131" "0000846202" "0000409131" "0000846209" "0000409132" "0000846203" "0000409132" "0000846210" "0000409133" "0000846204" "0000409134" "0000846205" "0000409135" "0000846206" "0000409135" "0000846211" "0000409136" "0000846207" "0000409137" "0000846208" "0000409137" "0000846212" "0000409151" "0000846230" "0000409151" "0000846231" "0000409153" "0000846232" "0000409154" "0000846233" "0000409157" "0000846236" "0000409157" "0000846265" "0000409158" "0000846237" "0000409159" "0000846238" "0000409159" "0000846266" "0000409160" "0000846239" "0000409160" "0000846267" "0000409161" "0000846240" "0000409161" "0000846268" "0000409162" "0000846241" "0000409162" "0000846269" "0000409163" "0000846242" "0000409164" "0000846243" "0000409165" "0000846244" "0000409165" "0000846270" "0000409166" "0000846245" "0000409166" "0000846271" "0000409167" "0000846246" "0000409167" "0000846272" "0000409168" "0000846247" "0000409169" "0000846248" "0000409170" "0000846249" "0000409170" "0000846273" "0000409171" "0000846250" "0000409172" "0000846251" "0000409173" "0000846252" "0000409173" "0000846274" "0000409174" "0000846253" "0000409174" "0000846275" "0000409175" "0000846254" "0000409176" "0000846255" "0000409177" "0000846256" "0000409178" "0000846257" "0000409179" "0000846258" "0000409180" "0000846259" "0000409181" "0000846260" "0000409182" "0000846261" "0000409183" "0000846262" "0000409183" "0000846276" "0000409184" "0000846263" "0000409185" "0000846264" "0000409185" "0000846277" "0000409186" "0000846278" "0000409186" "0000846283" "0000409187" "0000846279" "0000409187" "0000846284" "0000409188" "0000846280" "0000409188" "0000846285" "0000409189" "0000846281" "0000409189" "0000846286" "0000409190" "0000846282" "0000409190" "0000846287" "0000409191" "0000846288" "0000409192" "0000846289" "0000409193" "0000846290" "0000409194" "0000846291" "0000409195" "0000846292" "0000409196" "0000846293" "0000409197" "0000846294" "0000409198" "0000846295" "0000409199" "0000846296" "0000409200" "0000846297" "0000409200" "0000846320" "0000409201" "0000846298" "0000409201" "0000846321" "0000409202" "0000846299" "0000409202" "0000846322" "0000409203" "0000846300" "0000409203" "0000846318" "0000409204" "0000846301" "0000409204" "0000846323" "0000409205" "0000846302" "0000409205" "0000846324" "0000409206" "0000846303" "0000409206" "0000846325" "0000409207" "0000846304" "0000409207" "0000846326" "0000409208" "0000846305" "0000409208" "0000846327" "0000409209" "0000846306" "0000409209" "0000846328" "0000409210" "0000846307" "0000409211" "0000846308" "0000409212" "0000846309" "0000409212" "0000846329" "0000409213" "0000846310" "0000409213" "0000846330" "0000409214" "0000846311" "0000409214" "0000846319" "0000409215" "0000846312" "0000409215" "0000846331" "0000409216" "0000846313" "0000409216" "0000846332" "0000409217" "0000846314" "0000409217" "0000846333" "0000409218" "0000846315" "0000409218" "0000846334" "0000409219" "0000846316" "0000409219" "0000846335" "0000409220" "0000846317" "0000409223" "0000846338" "0000409224" "0000846339" "0000409224" "0000846340" "0000409225" "0000846341" "0000409226" "0000846342" "0000409226" "0000846343" "0000409227" "0000846344" "0000409228" "0000846345" "0000409229" "0000846346" "0000409230" "0000846347" "0000409231" "0000846348" "0000409232" "0000846349" "0000409233" "0000846350" "0000409233" "0000846351" "0000409234" "0000846352" "0000409235" "0000846353" "0000409236" "0000846354" "0000409237" "0000846355" "0000409237" "0000846356" "0000409238" "0000846357" "0000409238" "0000846358" "0000409239" "0000846359" "0000409240" "0000846360" "0000409240" "0000846361" "0000409241" "0000846362" "0000409242" "0000846363" "0000409243" "0000846364" "0000409243" "0000846365" "0000409244" "0000846366" "0000409245" "0000846367" "0000409245" "0000846368" "0000409246" "0000846369" "0000409246" "0000846370" "0000409247" "0000846371" "0000409248" "0000846372" "0000409249" "0000846373" "0000409249" "0000846374" "0000409250" "0000846375" "0000409251" "0000846376" "0000409252" "0000846377" "0000409253" "0000846378" "0000409254" "0000846379" "0000409255" "0000846380" "0000409256" "0000846381" "0000409257" "0000846382" "0000409258" "0000846383" "0000409259" "0000846384" "0000409259" "0000846385" "0000409260" "0000846386" "0000409261" "0000846387" "0000409262" "0000846388" "0000409263" "0000846389" "0000409264" "0000846390" "0000409265" "0000846391" "0000409266" "0000846392" "0000409267" "0000846393" "0000409268" "0000846394" "0000409268" "0000846395" "0000409269" "0000846396" "0000409269" "0000846397" "0000409270" "0000846398" "0000409271" "0000846399" "0000409272" "0000846400" "0000409273" "0000846401" "0000409273" "0000846402" "0000409274" "0000846403" "0000409275" "0000846404" "0000409276" "0000846405" "0000409277" "0000846406" "0000409278" "0000846407" "0000409278" "0000846408" "0000409279" "0000846409" "0000409280" "0000846410" "0000409280" "0000846411" "0000409284" "0000846415" "0000409284" "0000846426" "0000409285" "0000846416" "0000409285" "0000846427" "0000409286" "0000846417" "0000409286" "0000846428" "0000409287" "0000846418" "0000409287" "0000846429" "0000409288" "0000846419" "0000409288" "0000846430" "0000409289" "0000846420" "0000409290" "0000846421" "0000409291" "0000846422" "0000409291" "0000846431" "0000409292" "0000846423" "0000409292" "0000846432" "0000409293" "0000846424" "0000409293" "0000846433" "0000409294" "0000846425" "0000409295" "0000846434" "0000409295" "0000846435" "0000409296" "0000846436" "0000409296" "0000846437" "0000409298" "0000846438" "0000409299" "0000846439" "0000409300" "0000846440" "0000409301" "0000846441" "0000409302" "0000846442" "0000409303" "0000846443" "0000409304" "0000846444" "0000409306" "0000846447" "0000409306" "0000846448" "0000409311" "0000846455" "0000409313" "0000846459" "0000409319" "0000846465" "0000409320" "0000846466" "0000409321" "0000846467" "0000409322" "0000846468" "0000409322" "0000846469" "0000409324" "0000846471" "0000409324" "0000846473" "0000409325" "0000846472" "0000409325" "0000846474" "0000409677" "0000846881" "0000409695" "0000846899" "0000421023" "0000881441" "0000421767" "0000896553" "0000421767" "0000896554" "0000421889" "0000896723" "0000421889" "0000896724" "0000421900" "0000896740" "0000421900" "0000896741" "0000422823" "0000898080" "0000423994" "0000900605" "0000428228" "0000905874" "0000428250" "0000905935" "0000428250" "0000905936" "0000430984" "0000915902" "0000431179" "0000916186" "0000431183" "0000916192" "0000431218" "0000916251" "0000431218" "0000916252" "0000431236" "0000916285" "0000431283" "0000916355" "0000431283" "0000916356" "0000431305" "0000916390" "0000431357" "0000916466" "0000431357" "0000916467" "0000431366" "0000916481" "0000431397" "0000916526" "0000431408" "0000916544" "0000431408" "0000916545" "0000431416" "0000916554" "0000431416" "0000916555" "0000431431" "0000916581" "0000431477" "0000916653" "0000431477" "0000916654" "0000448573" "0000958059" "0000449071" "0000958838" "0000449071" "0000959266" "0000449084" "0000958851" "0000449140" "0000958907" "0000449140" "0000959342" "0000449231" "0000958998" "0000449264" "0000959460" "0000452432" "0000986922" "0000452569" "0000986552" "0000452569" "0000986947" "0000452570" "0000986553" "0000452571" "0000986554" "0000452571" "0000986948" "0000452572" "0000986555" "0000452572" "0000986949" "0000452573" "0000986556" "0000452573" "0000986950" "0000452574" "0000986557" "0000452574" "0000986951" "0000452575" "0000986558" "0000452575" "0000986952" "0000452576" "0000986559" "0000452577" "0000986560" "0000452578" "0000986561" "0000452578" "0000986953" "0000452579" "0000986562" "0000462708" "0001022259"