### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = RERE)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"RERE"	"arginine-glutamic acid dipeptide (RE) repeats"	"1"	"p36.23"	"unknown"	"NC_000001.10"	"UD_132319015967"	""	""	""	"1"	"9965"	"473"	"605226"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/RERE_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2022-08-25 14:05:07"	"00000"	"2025-11-01 13:22:20"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00017634"	"RERE"	"transcript variant 2"	"001"	"NM_001042681.1"	""	"NP_001036146.1"	""	""	""	"-625"	"7384"	"4701"	"8877699"	"8412464"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 7
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"04171"	"STRMK"	"Stormorken syndrome (STRMK)"	"AD"	"185070"	""	""	""	"00006"	"2015-01-18 10:53:36"	"00006"	"2021-12-10 21:51:32"
"04282"	"CVI"	"cerebral visual impairment (CVI)"	""	""	""	""	""	"00006"	"2015-06-15 15:37:52"	"00006"	"2015-06-15 15:38:26"
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"
"06008"	"NEDBEH"	"Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart"	"AD"	"616975"	""	""	""	"00006"	"2021-12-10 23:20:41"	""	""
"06961"	"del 1p36"	"chromosome deletion syndrome 1p36, distal"	""	"607872"	""	""	""	"00006"	"2022-08-26 10:20:43"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"RERE"	"05611"
"RERE"	"06008"


## Individuals ## Do not remove or alter this header ##
## Count = 53
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00029011"	""	""	""	"1"	""	"00006"	"{PMID:Nesin 2014:24591628}"	"3-generation family, 1 affected"	"M"	"?"	"United States"	""	"0"	""	""	""	""
"00039409"	""	""	""	"1"	""	"01158"	"{PMID:Bosch 2016:26350515}, {DOI:Bosch 2016:10.1038/ejhg.2015.186}, {PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	"no"	"Netherlands"	""	"0"	""	""	""	"Pat22;Pat5"
"00416214"	""	""	""	"1"	""	"01164"	""	""	"F"	"no"	"Germany"	""	"0"	""	""	""	"204274"
"00416232"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected non carrier parents"	"M"	""	""	""	"0"	""	""	"Europe"	"Pat1"
"00416233"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected non carrier parents"	"M"	""	""	""	"0"	""	""	"Europe"	"Pat2"
"00416234"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected non carrier parents"	"M"	""	""	""	"0"	""	""	"Hispanic"	"Pat3"
"00416235"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected non carrier parents"	"F"	""	""	""	"0"	""	""	"Europe"	"Pat4"
"00416236"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"adopted"	"F"	""	""	""	"0"	""	""	"Europe;Hispanic"	"Pat6"
"00416237"	""	""	"00019959"	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"affected twin brother"	"M"	""	"Netherlands"	""	"0"	""	""	""	"Pat7"
"00416238"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected parents"	"M"	""	""	""	"0"	""	""	"Europe"	"Pat8"
"00416239"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	"2 generation family, 1 affected, unaffected non carrier parents"	"M"	""	"Netherlands"	""	"0"	""	""	""	"Pat9"
"00416240"	""	""	""	"1"	""	"00006"	"{PMID:Krumm 2015:25961944}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	"United States"	""	"0"	""	""	""	"11654.p1;Pat10"
"00416258"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat42"
"00416259"	""	""	""	"1"	""	"00006"	"{PMID:Paciorkowski 2011:21694734}, {PMID:Fregeau 2016:27087320}"	""	""	""	""	""	"0"	""	""	""	"Pat1p105-C"
"00416260"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat44"
"00416261"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"M"	""	""	""	"0"	""	""	""	"Pat45"
"00416262"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat46"
"00416263"	""	""	""	"1"	""	"00006"	"{PMID:Campeau 2008:19006213}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat1"
"00416264"	""	""	""	"1"	""	"00006"	"{PMID:Bursztejn 2009:19842196}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	""
"00416265"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat49"
"00416266"	""	""	""	"1"	""	"00006"	"{PMID:Arndt 2013:23768516}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat6"
"00416267"	""	""	""	"1"	""	"00006"	"{PMID:Nicoulaz 2011:21739569}, {PMID:Fregeau 2016:27087320}"	""	""	""	""	""	"0"	""	""	""	""
"00416268"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat47"
"00416269"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat48"
"00416270"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 2353"
"00416271"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United States"	""	"0"	""	""	""	"1P-11-01"
"00416272"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"ECARUCA 4725"
"00416273"	""	""	""	"1"	""	"00006"	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat3"
"00416274"	""	""	""	"1"	""	"00006"	"{PMID:Arndt 2013:23768516}, {PMID:Fregeau 2016:27087320}"	""	"M"	""	""	""	"0"	""	""	""	"Pat16"
"00416275"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"M"	""	""	""	"0"	""	""	""	"ECARUCA 4874"
"00416276"	""	""	""	"1"	""	"00006"	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat5"
"00416277"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 255695"
"00416278"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 2483"
"00416279"	""	""	""	"1"	""	"00006"	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	"M"	""	""	""	"0"	""	""	""	"Pat2"
"00416280"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 2848"
"00416281"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 250349"
"00416282"	""	""	""	"1"	""	"00006"	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	"F"	""	""	""	"0"	""	""	""	"Pat50"
"00416283"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United States"	""	"0"	""	""	""	"1P-08-01"
"00416284"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 255591"
"00416285"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 248448"
"00416286"	""	""	""	"1"	""	"00006"	"{PMID:Fregeau 2016:27087320}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"DECIPHER 252259"
"00416287"	""	""	""	"1"	""	"00006"	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	"M"	""	""	""	"0"	""	""	""	"Pat4"
"00416288"	""	""	""	"1"	""	"00006"	"{PMID:Zaveri 2014:24454898}"	""	"F"	""	""	""	"0"	""	""	""	"Pat6"
"00416290"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	""	"M"	""	""	""	"0"	""	""	"Hispanic"	"Pat1"
"00416291"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	"Hispanic"	"Pat2"
"00416292"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	"Europe"	"Pat3"
"00416293"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	"Europe"	"Pat4"
"00416294"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	"Japan;Europe"	"Pat5"
"00416295"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"India"	""	"0"	""	""	"Asia"	"Pat6"
"00416296"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	"33d"	"0"	""	""	"Europe"	"Pat7"
"00416297"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	"Europe"	"Pat8"
"00416298"	""	""	""	"1"	""	"00006"	"{PMID:Jordan 2018:29330883}"	"2 generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	"Europe"	"Pat9"
"00434648"	""	""	""	"1"	""	"00006"	"{PMID:Carss 2014:24476948}"	"affected fetus"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"F6"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 54
"{{individualid}}"	"{{diseaseid}}"
"00029011"	"04171"
"00039409"	"00139"
"00039409"	"04282"
"00416214"	"06008"
"00416232"	"05611"
"00416233"	"05611"
"00416234"	"05611"
"00416235"	"05611"
"00416236"	"05611"
"00416237"	"05611"
"00416238"	"05611"
"00416239"	"05611"
"00416240"	"05611"
"00416258"	"06961"
"00416259"	"06961"
"00416260"	"06961"
"00416261"	"06961"
"00416262"	"06961"
"00416263"	"06961"
"00416264"	"06961"
"00416265"	"06961"
"00416266"	"06961"
"00416267"	"06961"
"00416268"	"06961"
"00416269"	"06961"
"00416270"	"06961"
"00416271"	"06961"
"00416272"	"06961"
"00416273"	"06961"
"00416274"	"06961"
"00416275"	"06961"
"00416276"	"06961"
"00416277"	"06961"
"00416278"	"06961"
"00416279"	"06961"
"00416280"	"06961"
"00416281"	"06961"
"00416282"	"06961"
"00416283"	"06961"
"00416284"	"06961"
"00416285"	"06961"
"00416286"	"06961"
"00416287"	"06961"
"00416288"	"06961"
"00416290"	"05611"
"00416291"	"05611"
"00416292"	"05611"
"00416293"	"05611"
"00416294"	"05611"
"00416295"	"05611"
"00416296"	"05611"
"00416297"	"05611"
"00416298"	"05611"
"00434648"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 04171, 04282, 05611, 06008, 06961
## Count = 53
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000025032"	"04171"	"00029011"	"00006"	"Isolated (sporadic)"	""	"see paper; congenital miosis, bleeding diathesis, thrombocytopenia, proximal muscle weakness"	""	""	""	""	""	""	""	""	""	""	""
"0000078844"	"04282"	"00039409"	"00006"	"Isolated (sporadic)"	"12y08m"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; seizures; no hypotonia; no behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; feeding/swallowing problems; thin corpus callosum; diminished white matter volume; abnormal cerebellar vermis; ventriculomegaly; no small pons; no abnormal hippocampus; no small anterior commissure; no delayed myelination; no coloboma; optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; pyloric hypertrophy; vesicoureteral reflux; no cystic kidney; no hypospadias; no cryptorchidism; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; tall stature (≥98th centile); no short stature (≤2nd centile); no macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; deeply set eyes; blepharaophymosis; abnormal ears; no preauricular pits; bulbous nose; no anteverted nares; no flat philtrum; full lips; no small mouth; no furrowed tongue; abnormal teeth; broad alveolar ridges; high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	"NEDBEH"	""	""
"0000307979"	"06008"	"00416214"	"01164"	"Isolated (sporadic)"	"04y"	"Birth in 36th week, developmental slowdown from 2nd year, now profound developmental/perceptual disorder, no malformations (incl. MRI skull), no dysmorphia, dichorial diamniote twin sister healthy."	""	""	""	""	""	""	""	""	""	"2y"	""
"0000307999"	"05611"	"00416232"	"00006"	"Isolated (sporadic)"	"3y"	"see paper; ..., intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; no hypotonia; no behavioral problems; spastic quadriparesis; no ttention deficit hyperactivity disorder; feeding/swallowing problems; thin corpus callosum; diminished white matter volume; abnormal cerebellar vermis; no ventriculomegaly; small pons; no abnormal hippocampus; no small anterior commissure; delayed myelination; coloboma; optic nerve atrophy/hypoplasia; microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; sensorineural hearing loss; no choanal atresia; no cleft lip; ventricular septal defect; patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; hypospadias; no cryptorchidism; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; tall stature (≥98th centile); no short stature (≤2nd centile); no macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; no abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308000"	"05611"	"00416233"	"00006"	"Isolated (sporadic)"	"15m"	"see paper; ..., intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; no hypotonia; no behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; no feeding/swallowing problems; thin corpus callosum; diminished white matter volume; no abnormal cerebellar vermis; ventriculomegaly; no small pons; abnormal hippocampus; no small anterior commissure; no delayed myelination; coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; choanal atresia; no cleft lip; ventricular septal defect; no patent foramen ovale; patent ductus arteriosus; anomalous pulmonary venous return; no gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; cystic kidney; no hypospadias; cryptorchidism; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; no tall stature (≥98th centile); short stature (≤2nd centile); no macrocephaly (≥98th centile); microcephaly (≤2nd centile); no third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; 5th finger clinodactyly; no digital anomalies; nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308001"	"05611"	"00416234"	"00006"	"Isolated (sporadic)"	"2y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; hypotonia; no behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; no feeding/swallowing problems; thin corpus callosum; diminished white matter volume; abnormal cerebellar vermis; ventriculomegaly; no small pons; no abnormal hippocampus; no small anterior commissure; no delayed myelination; no coloboma; no optic nerve atrophy/hypoplasia; microphthalmia; Peter’s anomaly; iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; no gastroesophageal reflux disease; duodenal atresia; annular pancreas; no pyloric hypertrophy; vesicoureteral reflux; no cystic kidney; no hypospadias; no cryptorchidism; syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; no tall stature (≥98th centile); short stature (≤2nd centile); no macrocephaly (≥98th centile); no microcephaly (≤2nd centile); third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; hypotelorism; no hypertelorism; upslanting palpebral fissures; no down-slanting palpebral fissures; small palpebral fissures; epicanthal folds; no deeply set eyes; no blepharaophymosis; abnormal ears; preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; micrognathia; small nipples; no inverted nipples; no small hands; syndactyly; no 5th finger clinodactyly; digital anomalies; no nail hypoplasia; abnormal palmar creases; no widow’s peak; sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308002"	"05611"	"00416235"	"00006"	"Isolated (sporadic)"	"9y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; hypotonia; behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; no feeding/swallowing problems; thin corpus callosum; diminished white matter volume; abnormal cerebellar vermis; no ventriculomegaly; no small pons; no abnormal hippocampus; no small anterior commissure; no delayed myelination; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; vesicoureteral reflux; no cystic kidney; no syndactyly; hip dysplasia; no scoliosis; no lumbar lordosis; no tall stature (≥98th centile); no short stature (≤2nd centile); no macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; epicanthal folds; deeply set eyes; no blepharaophymosis; abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; digital anomalies; no nail hypoplasia; abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308003"	"05611"	"00416236"	"00006"	"Unknown"	"6y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; hypotonia; behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; no feeding/swallowing problems; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; no gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; no syndactyly; no hip dysplasia; no scoliosis; lumbar lordosis; no tall stature (≥98th centile); no short stature (≤2nd centile); macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; no frontal bossing; triangular face; abnormal eyebrows; no hypotelorism; hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; abnormal ears; no preauricular pits; no bulbous nose; anteverted nares; flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; small hands; no syndactyly; no 5th finger clinodactyly; digital anomalies; no nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308004"	"05611"	"00416237"	"00006"	"Isolated (sporadic)"	"11y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; hypotonia; no behavioral problems; no spastic quadriparesis; ttention deficit hyperactivity disorder; feeding/swallowing problems; thin corpus callosum; diminished white matter volume; no abnormal cerebellar vermis; no ventriculomegaly; no small pons; no abnormal hippocampus; small anterior commissure; no delayed myelination; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; no gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; no hypospadias; no cryptorchidism; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; no tall stature (≥98th centile); short stature (≤2nd centile); no macrocephaly (≥98th centile); microcephaly (≤2nd centile); no third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; no abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308005"	"05611"	"00416238"	"00006"	"Unknown"	"10y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; no hypotonia; no behavioral problems; no spastic quadriparesis; ttention deficit hyperactivity disorder; feeding/swallowing problems; no thin corpus callosum; no diminished white matter volume; no abnormal cerebellar vermis; no ventriculomegaly; no small pons; no abnormal hippocampus; no small anterior commissure; no delayed myelination; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; no hypospadias; no cryptorchidism; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; no tall stature (≥98th centile); no short stature (≤2nd centile); no macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; no frontal bossing; no triangular face; abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; no abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; abnormal teeth; no broad alveolar ridges; no high arched palate; micrognathia; no small nipples; inverted nipples; small hands; no syndactyly; 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; no abnormal palmar creases; widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308006"	"05611"	"00416239"	"00006"	"Isolated (sporadic)"	"7y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; no hypotonia; no behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; feeding/swallowing problems; no thin corpus callosum; no diminished white matter volume; no abnormal cerebellar vermis; no ventriculomegaly; no small pons; no abnormal hippocampus; no small anterior commissure; delayed myelination; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; no gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; no hypospadias; no cryptorchidism; no syndactyly; no hip dysplasia; scoliosis; no lumbar lordosis; no tall stature (≥98th centile); no short stature (≤2nd centile); macrocephaly (≥98th centile); no microcephaly (≤2nd centile); no third fontanel; frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; no abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308007"	"05611"	"00416240"	"00006"	"Isolated (sporadic)"	"14y"	"see paper; ..., no intrauterine growth retardation; intellectual disability/developmental delay/autism; no seizures; no hypotonia; no behavioral problems; no spastic quadriparesis; no ttention deficit hyperactivity disorder; no feeding/swallowing problems; no coloboma; no optic nerve atrophy/hypoplasia; no microphthalmia; no Peter’s anomaly; no iris anomalies; no blepharophimosis; no sensorineural hearing loss; no choanal atresia; no cleft lip; no ventricular septal defect; no patent foramen ovale; no patent ductus arteriosus; no anomalous pulmonary venous return; no gastroesophageal reflux disease; no duodenal atresia; no annular pancreas; no pyloric hypertrophy; no vesicoureteral reflux; no cystic kidney; no syndactyly; no hip dysplasia; no scoliosis; no lumbar lordosis; no third fontanel; no frontal bossing; no triangular face; no abnormal eyebrows; no hypotelorism; no hypertelorism; no upslanting palpebral fissures; no down-slanting palpebral fissures; no small palpebral fissures; no epicanthal folds; no deeply set eyes; no blepharaophymosis; no abnormal ears; no preauricular pits; no bulbous nose; no anteverted nares; no flat philtrum; no full lips; no small mouth; no furrowed tongue; no abnormal teeth; no broad alveolar ridges; no high arched palate; no micrognathia; no small nipples; no inverted nipples; no small hands; no syndactyly; no 5th finger clinodactyly; no digital anomalies; no nail hypoplasia; no abnormal palmar creases; no widow’s peak; no sacral hair tuft; no cafe au lait spots"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000308025"	"06961"	"00416258"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability, hypotonia, feeding difficulty; cortical dysplasia, enlarged lateral ventricles, hypoplastic corpus callosum; patent ductus arteriosus, ventricular septal defect; hearing loss; cleft lip and palate; dislocated hip"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308026"	"06961"	"00416259"	"00006"	"Isolated (sporadic)"	""	"trichotillomania, bruxism; infantile spasms"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308027"	"06961"	"00416260"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability, hypotonia, feeding difficulty, temper tantrums; seizures; patent ductus arteriosus; nystagmus; hearing loss; cleft lip and palate; late closing anterior fontanelle, straight eyebrows; dental anomalies, hypothyroidism, constipation, ambiguous genitalia"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308028"	"06961"	"00416261"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability, hypotonia, feeding problems; seizures, infantile spasms; cortical hypoplasia, enlarged lateral ventricles, delayed myelination; ventricular septal defect, aortic stenosis; nystagmus; hearing loss; high palate; microcephaly, deeply set eyes, epicanthal folds, low-set ears, broad nasal root/bridge; ambiguous genetalia, cryptoorchidism, scrotal hypoplasia"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308029"	"06961"	"00416262"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability severe, hypotonia, feeding difficulty, poor social interaction; enlarged lateral ventricels; ventricular septal defect; left ventricular non-compaction; strabismus, ametropia, oculomotor disturbance; high palate; limb deformity"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308030"	"06961"	"00416263"	"00006"	"Isolated (sporadic)"	"2y6m"	"developmental delay, hypotonia, ; single febrile seizure; enlarged lateral and third ventricles,  bilateral colpocephaly, moderate to severe non-obstructive hydrocephalus; atrial septal defect,ventricular septal defect, patent ductus arteriosus, distal aortic arch hypoplastic; sensorineural hearing loss; submucosal cleft palate, velapharyngeal incompetence; prominent occiput, high forehead, large anterior fontanel, flat facial profile, deeply set eyes,  narrow palpebral fissures, abnoramal, low-set, posteriorly-rotated ears, small nose, broad nasal root, micrognathia, left single palmar crease, short femurs; hypothyroidism, severe gastroesophageal reflux, decreased ossification of the skull and cervical spine, left pes cavus, calcaneovalgus deformity"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308031"	"06961"	"00416264"	"00006"	"Isolated (sporadic)"	"8y"	"developmental delay; partial seizures, infantile spasms; cerebral malformations, agenesis of the corpus callosum, ventriculomegaly; atrial septal defect, ventricular septal defect; bilateral pupillary coloboma; deeply set eyes, low-set, posteriorly-rotated ears, brachydactyly, hirsuitism"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308032"	"06961"	"00416265"	"00006"	"Isolated (sporadic)"	""	"severe iintellectual disability, hypotonia, feeding difficulty; seizures; ebstein anomaly; microphthalmia; hearing loss; high palate; microcephaly, brachycephaly, straight eyebrows, deeply set eyes, epicanthal folds, low-set ears, broad nasal root/bridge, long philtrum, pointed chin; atresia of exterenal acoustic foramen"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308033"	"06961"	"00416266"	"00006"	"Isolated (sporadic)"	""	"developmental delay, hypotonia; atrial septal defect; left ventricular non-compaction; deeply set eyes, microcephaly"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308034"	"06961"	"00416267"	"00006"	"Isolated (sporadic)"	"2d"	"; ventriculomegaly, marked pachygyria, absent septum pellucidum, thinned corpus callosum; tetralogy of Fallot; deeply set eyes, small palpebral fissures, low-set ears with thickened helices, camptodactyly, joint contractures, pointed chin; intestinal obstruction with suspected deudenal atresia"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308035"	"06961"	"00416268"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability severe, hypotonia, feeding difficulty; seizures; enlarged lateral venticles, hypoplastic corpus callosum; ventricular septal defect; nystagmus; microcephaly, deeply set eyes, low-set ears, broad nasal root/bridge, pointed chin; scoliosis, nasal cavity stenosis"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308036"	"06961"	"00416269"	"00006"	"Isolated (sporadic)"	""	"hypotonia, feeding difficulties; seizures; enlarged lateral ventricles, delayed mylenation, hypoplastic corpus callosum; atrial septal defect, patent ductus arteriosus, ventricular septal defect, pulmonary stenosis, ebstein anomaly; ametropia; microcephaly, brachycephaly, epicanthal folds, low-set ears, broad nasal root/bridge; scoliosis"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308037"	"06961"	"00416270"	"00006"	"Isolated (sporadic)"	"8y"	"intellectual disability, spasticity, dysphagia; seizures; cardiomyopathy; myopia; sensorineural  hearing loss; abnormality of midface, gingival overgrowth"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308038"	"06961"	"00416271"	"00006"	"Isolated (sporadic)"	"30y"	"intellectual disability, developmental delay, feeding difficultites; intractable seizure disorder; patent ductus arteriosus; stones (medication related?); high compound myopic astigmatism, mild ptosis, occasional nystagmus; ears are low-set; brachycephaly, deeply set eyes, narrow palate, small hands and feet, joint contractures,  low posterior hairline, hirsutism; short stature, central obesity, liver nodules, precoious puberty, premature ovarian failure, scoliosis"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308039"	"06961"	"00416272"	"00006"	"Isolated (sporadic)"	"1m"	"feeding difficulty; patent ductus arteriosus, ventricular septal defect; microcephaly, hypertelorism, prominent ears, depressed/flat nasal bridge, short neck, wide-spaced nipples, sacral dimple/sinus, proximally-set halluces; hiatal hernia"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308040"	"06961"	"00416273"	"00006"	"Isolated (sporadic)"	"2m"	"hypotonia; atrial septal defect, patent ductus arteriosus, ventricular septal defect, cleft mitral valve, redundant tricuspid valve leaflets,  mild pulmonary valve stenosis;  severe biventricular hypertrophy; sensorineural hearing loss; bilateral cleft lip and palate; microcephaly, prominence of forehead and perietal bones, broad face, hypertelorism, epicanthal folds,  bushy, arched eyebrows,  posteriorly rotated ears, wide nose with a split appearance to the tip, digital contractures, hirsutism; bilateral nasolacrimal duct obstruction, gastroesophageal reflux"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308041"	"06961"	"00416274"	"00006"	"Isolated (sporadic)"	""	"intellectual disability, developmental delay; ventricular septal defect; cardiomyopathy, transient heart failure; ptosis; microcephaly, hirsutism"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308042"	"06961"	"00416275"	"00006"	"Isolated (sporadic)"	"15y8m"	"severe intellectual disability, speech delay, ataxia, abnormal gait,; seizures; microcephaly; proportionate short stature, enlarged joints, joint stiffness/arthiritis/gout, hyperkeratosis, hyphydrotic or dry skin, erythema"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308043"	"06961"	"00416276"	"00006"	"Isolated (sporadic)"	"6y"	"intelleculal disability, developmental delay, feeding difficulty, ataxic unsteady gait with frequent falls, hypertonia, severe hyperactivity; tonic clonic seizures; partial anomalous pulmonary venous return with the left pulmonary veins draining into the innominate vein, wolf-parkinson-white; right-sided ptosis; microcephaly,  midface hypoplasia, bushy eyebrows, long eyelashes, downslanting palpebral fissures, borderline low-set ears, depressed nasal bridge, prominent mandible, pointy chin, hirsutism; prenatal short stature,  failure to thrive, hemivertebra at T9"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308044"	"06961"	"00416277"	"00006"	"Isolated (sporadic)"	""	"intelectual disability; facial abnormalities"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308045"	"06961"	"00416278"	"00006"	"Isolated (sporadic)"	"5y"	"intelectual disability, developmental delay, feeding difficulty; secundum atrial septal defect; submucous cleft of the hard palate; microcephaly, mid-face retrusion, hypertelorism, prominent ears, down-turned corners of mouth, thick upper lip vermillion, thin lower lip vermillion; scoliosis"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308046"	"06961"	"00416279"	"00006"	"Isolated (sporadic)"	"14m"	"developmental delay, peripheral hypertonia; generalized tonic clonic seizures; enlarged cerebrospinal fluid spaces; two small right coronary artery fistulae terminating in the left atrium and right ventricle; microcephaly, prominent forehead, hypertelorism, epicanthal folds, high arched eyebrows, synophrys, long eyelashes, posteriorly rotated ears, overfolded helices, upturned nose, short neck, bilateral fifth finger clinodactyly, hirsuitims; gastroesophageal reflux"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308047"	"06961"	"00416280"	"00006"	"Isolated (sporadic)"	""	"intellectual diability"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308048"	"06961"	"00416281"	"00006"	"Isolated (sporadic)"	"12y"	"intelectual disability; microcephaly, abnormality of the face, abnormal hair pattern; cryptorchidism"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308049"	"06961"	"00416282"	"00006"	"Isolated (sporadic)"	""	"severe intellectual disability severe, hypotonia, feeding difficulty; patent ductus arteriosus; strabismus; high palate; microcephaly, brachycephaly, epicanthal folds, low-set ears, broad nasal root/bridge; scoliosis"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308050"	"06961"	"00416283"	"00006"	"Isolated (sporadic)"	"5y"	"developmental delay, ataxia, dyspraxia, wide-based gait; Brown syndrome, amblyopia"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308051"	"06961"	"00416284"	"00006"	"Isolated (sporadic)"	"<1y"	"intelectual disability, speech delay; microcephaly, localized hirsutism;  abnormal stomach"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308052"	"06961"	"00416285"	"00006"	"Isolated (sporadic)"	"19y"	"developmental delay, intellectual diability, feeding difficulty; mild pulmonary valve stenosis; sensorineural hearing loss; brachycephaly, flat occiput, mid-face retrusion, long eyelashes, prominent ear helix, flat nose, wide nasal bridge, hypoplastic philtrum, thin upper lip vermilion, abonormal mouth, broad thumbs,  short phalanges, coarse hair, abnormal hair pattern, low posterior hairline; laryngomalacia, recurrent infections, cryptorchidism, proportionate short stature"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308053"	"06961"	"00416286"	"00006"	"Isolated (sporadic)"	"3y"	"intelectual disability, speech delay; abnormal hair pattern; recurrent infections"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308054"	"06961"	"00416287"	"00006"	"Isolated (sporadic)"	"5y"	"developmental delay, hypotonia; small septum secundum atrial septal defect, perimembranous ventricular septal defect; dilated cardiomyopathy; frontal and parietal bossing, mild bitemporal narrowing, broad arched eyebrows with sparse appearance, short palpebral fissures, protruding ears, broad nasal bridge, mildly anteverted small nares, broad columella, smooth philtrum, bowed upper lip, high arched palate, prominent chin, short sternum, second and fifth digits with mild bilateral clinodactyly, short digits with mild bulbous finger tips, hirsutism; failure to thrive"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308055"	"06961"	"00416288"	"00006"	"Isolated (sporadic)"	""	"ventricular septal defect; microcephaly"	""	""	""	""	""	""	""	""	""	"1p36 deletion syndrome"	""
"0000308057"	"05611"	"00416290"	"00006"	"Isolated (sporadic)"	"4y"	"see paper; ..., developmental delay/intellectual disability/autism; no hypotonia; MRI brain normal; no structural eye anomalies; no sensorineural hearing loss; no choanal atresia; no congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308058"	"05611"	"00416291"	"00006"	"Isolated (sporadic)"	"8m"	"see paper; ..., no developmental delay/intellectual disability/autism; no hypotonia; no structural eye anomalies; no sensorineural hearing loss; no choanal atresia; no congenital heart defects; multiple urinary tract infections first few months of life, radiographic studies no hydronephrosis, no vesicoureteral reflux; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308059"	"05611"	"00416292"	"00006"	"Isolated (sporadic)"	"21y"	"see paper; ..., developmental delay/intellectual disability/autism; hypotonia; MRI brain abnormal; no structural eye anomalies; sensorineural hearing loss; no choanal atresia; congenital heart defects; no renal anomalies; scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308060"	"05611"	"00416293"	"00006"	"Isolated (sporadic)"	"13y"	"see paper; ..., developmental delay/intellectual disability/autism; hypotonia; MRI brain abnormal; no structural eye anomalies; no sensorineural hearing loss; no choanal atresia; no congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308061"	"05611"	"00416294"	"00006"	"Isolated (sporadic)"	"22y"	"see paper; ..., developmental delay/intellectual disability/autism; hypotonia; MRI brain mildly prominent CSF spaces; no structural eye anomalies; no sensorineural hearing loss; no choanal atresia; congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308062"	"05611"	"00416295"	"00006"	"Isolated (sporadic)"	"8y"	"see paper; ..., developmental delay/intellectual disability/autism; no hypotonia; MRI brain normal; no structural eye anomalies; sensorineural hearing loss; no choanal atresia; no congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308063"	"05611"	"00416296"	"00006"	"Isolated (sporadic)"	"33d"	"see paper; ..., 33d-died, hypotonia; MRI brain abnormal; structural eye anomalies; choanal atresia; congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308064"	"05611"	"00416297"	"00006"	"Isolated (sporadic)"	"8y"	"see paper; ..., developmental delay/intellectual disability/autism; no hypotonia; structural eye anomalies; sensorineural hearing loss; choanal atresia; congenital heart defects; no renal anomalies; scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000308065"	"05611"	"00416298"	"00006"	"Isolated (sporadic)"	"4y"	"see paper; ..., developmental delay/intellectual disability/autism; no hypotonia; no structural eye anomalies; no sensorineural hearing loss; no choanal atresia; no congenital heart defects; no renal anomalies; no scoliosis"	""	""	""	""	""	""	""	""	"NEDBEH"	"neurodevelopmental disorder"	""
"0000324898"	"00198"	"00434648"	"00006"	"Unknown"	""	"abdominal situs inversus (HP:0003363); asplenia (HP:0001746); abnormality of the liver (HP:0001392); right atrial isomerism (HP:0011536); abnormality of the left ventricle (HP:0001711); abnormality of the coronary sinus (HP:0011642); ventricular septal defect (HP:0001629); atrioventricular canal defect (HP:0006695); double outlet right ventricle (HP:0001719); abnormality of the pulmonary veins (HP:0011718); right aortic arch (HP:0012020); persistent left superior vena cava (HP:0005301); abnormality of the heart (HP:0001627); small chin (HP:0000331); flat forehead (HP:0004425); flat nose (HP:0000457); micrognathia (HP:0000347); abnormality of the head (HP:0000234); hypoplasia of the thymus (HP:0000778); bilateral trilobed lungs (HP:0011861)"	""	""	""	""	""	""	""	""	""	"structural fetal abnormalities"	""


## Screenings ## Do not remove or alter this header ##
## Count = 53
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000029052"	"00029011"	"1"	"00006"	"00006"	"2015-01-18 11:07:59"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000039651"	"00039409"	"1"	"01158"	"01158"	"2015-06-15 15:41:29"	"00006"	"2015-06-16 21:08:22"	"SEQ-NG"	"DNA"	""	""
"0000417493"	"00416214"	"1"	"01164"	"01164"	"2022-08-24 16:55:33"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000417512"	"00416232"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417513"	"00416233"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417514"	"00416234"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417515"	"00416235"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417516"	"00416236"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417517"	"00416237"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417518"	"00416238"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417519"	"00416239"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417520"	"00416240"	"1"	"00006"	"00006"	"2022-08-25 17:20:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417538"	"00416258"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417539"	"00416259"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417540"	"00416260"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417541"	"00416261"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417542"	"00416262"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417543"	"00416263"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417544"	"00416264"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417545"	"00416265"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417546"	"00416266"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417547"	"00416267"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417548"	"00416268"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417549"	"00416269"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417550"	"00416270"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417551"	"00416271"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417552"	"00416272"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417553"	"00416273"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417554"	"00416274"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417555"	"00416275"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417556"	"00416276"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417557"	"00416277"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417558"	"00416278"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417559"	"00416279"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417560"	"00416280"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417561"	"00416281"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417562"	"00416282"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417563"	"00416283"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417564"	"00416284"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417565"	"00416285"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417566"	"00416286"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417567"	"00416287"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417568"	"00416288"	"1"	"00006"	"00006"	"2022-08-26 10:31:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000417570"	"00416290"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"arrayCGH"	"DNA"	""	""
"0000417571"	"00416291"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417572"	"00416292"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417573"	"00416293"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417574"	"00416294"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417575"	"00416295"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417576"	"00416296"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417577"	"00416297"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000417578"	"00416298"	"1"	"00006"	"00006"	"2022-08-26 11:54:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000436120"	"00434648"	"1"	"00006"	"00006"	"2023-04-06 11:34:15"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 7
"{{screeningid}}"	"{{geneid}}"
"0000029052"	"KRTAP1-1"
"0000029052"	"RERE"
"0000029052"	"STIM1"
"0000039651"	"RERE"
"0000039651"	"SLC1A1"
"0000039651"	"SYNE1"
"0000417493"	"RERE"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 173
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000052403"	"0"	"70"	"1"	"8418549"	"8418549"	"subst"	"2.28075E-5"	"00006"	"RERE_000001"	"g.8418549C>T"	""	"{PMID:Nesin 2014:24591628}"	""	"G4046A"	"relation to a phenotype unknown"	"Unknown"	""	""	"0"	""	""	"g.8358489C>T"	""	"likely pathogenic"	""
"0000067277"	"0"	"70"	"1"	"8418302"	"8418302"	"subst"	"0"	"01158"	"RERE_000002"	"g.8418302G>T"	""	"{PMID:Bosch 2016:26350515}, {DOI:Bosch 2016:10.1038/ejhg.2015.186}, {PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8358242G>T"	""	"likely pathogenic (dominant)"	""
"0000320519"	"0"	"30"	"1"	"8425901"	"8425901"	"subst"	"0"	"01804"	"RERE_000008"	"g.8425901G>A"	""	""	""	"RERE(NM_001042681.2):c.1418C>T (p.(Thr473Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.8365841G>A"	""	"likely benign"	""
"0000508491"	"0"	"50"	"1"	"8418372"	"8418372"	"subst"	"1.22371E-5"	"01804"	"RERE_000010"	"g.8418372G>A"	""	""	""	"RERE(NM_001042681.1):c.4223C>T (p.(Ser1408Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8358312G>A"	""	"VUS"	""
"0000508492"	"0"	"10"	"1"	"8418599"	"8418599"	"subst"	"0.00099855"	"01943"	"RERE_000011"	"g.8418599T>C"	""	""	""	"RERE(NM_012102.3):c.3996A>G (p.P1332=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8358539T>C"	""	"benign"	""
"0000508493"	"0"	"50"	"1"	"8418651"	"8418651"	"subst"	"0"	"02325"	"RERE_000012"	"g.8418651C>G"	""	""	""	"RERE(NM_012102.4):c.3944G>C (p.R1315P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8358591C>G"	""	"VUS"	""
"0000508498"	"0"	"50"	"1"	"8420030"	"8420030"	"subst"	"0"	"02327"	"RERE_000017"	"g.8420030C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8359970C>T"	""	"VUS"	""
"0000508499"	"0"	"30"	"1"	"8420270"	"8420270"	"subst"	"0.00304238"	"01943"	"RERE_000018"	"g.8420270G>A"	""	""	""	"RERE(NM_012102.3):c.3297C>T (p.D1099=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8360210G>A"	""	"likely benign"	""
"0000508500"	"0"	"30"	"1"	"8420340"	"8420340"	"subst"	"3.81345E-5"	"01804"	"RERE_000019"	"g.8420340G>A"	""	""	""	"RERE(NM_001042681.1):c.3227C>T (p.(Ser1076Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8360280G>A"	""	"likely benign"	""
"0000508503"	"0"	"50"	"1"	"8421279"	"8421279"	"subst"	"3.75113E-5"	"02325"	"RERE_000022"	"g.8421279G>A"	""	""	""	"RERE(NM_012102.4):c.2288C>T (p.T763M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8361219G>A"	""	"VUS"	""
"0000508504"	"0"	"30"	"1"	"8421328"	"8421328"	"subst"	"9.05789E-6"	"01804"	"RERE_000023"	"g.8421328C>A"	""	""	""	"RERE(NM_001042681.1):c.2239G>T (p.(Val747Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8361268C>A"	""	"likely benign"	""
"0000508505"	"0"	"30"	"1"	"8421875"	"8421875"	"subst"	"0.000227457"	"01804"	"RERE_000024"	"g.8421875G>A"	""	""	""	"RERE(NM_001042681.1):c.1964C>T (p.(Ala655Val)), RERE(NM_012102.3):c.1964C>T (p.A655V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8361815G>A"	""	"likely benign"	""
"0000508506"	"0"	"30"	"1"	"8424796"	"8424796"	"subst"	"0.0012008"	"01943"	"RERE_000025"	"g.8424796G>A"	""	""	""	"RERE(NM_012102.3):c.1540+10C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8364736G>A"	""	"likely benign"	""
"0000508507"	"0"	"50"	"1"	"8426013"	"8426013"	"subst"	"0"	"01804"	"RERE_000026"	"g.8426013A>C"	""	""	""	"RERE(NM_012102.3):c.1306T>G (p.(Tyr436Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8365953A>C"	""	"VUS"	""
"0000508514"	"0"	"50"	"1"	"8617534"	"8617534"	"subst"	"4.06217E-6"	"01804"	"RERE_000027"	"g.8617534A>G"	""	""	""	"RERE(NM_001042681.1):c.571T>C (p.(Ser191Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8557475A>G"	""	"VUS"	""
"0000508517"	"0"	"30"	"1"	"8684410"	"8684410"	"subst"	"2.4477E-5"	"02325"	"RERE_000028"	"g.8684410T>C"	""	""	""	"RERE(NM_012102.4):c.355A>G (p.N119D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8624351T>C"	""	"likely benign"	""
"0000508519"	"0"	"50"	"1"	"8716175"	"8716175"	"subst"	"0"	"02327"	"RERE_000029"	"g.8716175T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8656116T>A"	""	"VUS"	""
"0000508521"	"0"	"30"	"1"	"8716342"	"8716347"	"del"	"0"	"01804"	"RERE_000031"	"g.8716342_8716347del"	""	""	""	"RERE(NM_001042681.1):c.30_35delCAAAGA (p.(Asp10_Lys11del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8656283_8656288del"	""	"likely benign"	""
"0000605980"	"0"	"30"	"1"	"8418972"	"8418972"	"subst"	"5.79415E-5"	"01804"	"RERE_000032"	"g.8418972G>A"	""	""	""	"RERE(NM_001042681.1):c.3623C>T (p.(Ala1208Val)), RERE(NM_012102.4):c.3623C>T (p.A1208V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8358912G>A"	""	"likely benign"	""
"0000605981"	"0"	"30"	"1"	"8419854"	"8419854"	"subst"	"0"	"01943"	"RERE_000033"	"g.8419854T>C"	""	""	""	"RERE(NM_012102.3):c.3588A>G (p.R1196=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8359794T>C"	""	"likely benign"	""
"0000605982"	"0"	"50"	"1"	"8420695"	"8420695"	"subst"	"0"	"02329"	"RERE_000034"	"g.8420695A>G"	""	""	""	"RERE(NM_012102.4):c.2872T>C (p.S958P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8360635A>G"	""	"VUS"	""
"0000605983"	"0"	"50"	"1"	"8420821"	"8420821"	"subst"	"0"	"01804"	"RERE_000035"	"g.8420821G>A"	""	""	""	"RERE(NM_001042681.1):c.2746C>T (p.(Gln916Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8360761G>A"	""	"VUS"	""
"0000620702"	"0"	"30"	"1"	"8421116"	"8421127"	"dup"	"0"	"02325"	"RERE_000036"	"g.8421116_8421127dup"	""	""	""	"RERE(NM_012102.4):c.2449_2460dupCCGCCGCATCCC (p.P817_P820dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8361056_8361067dup"	""	"likely benign"	""
"0000654119"	"0"	"30"	"1"	"8419867"	"8419872"	"del"	"0"	"02325"	"RERE_000037"	"g.8419867_8419872del"	""	""	""	"RERE(NM_012102.4):c.3582_3587delGGAGCG (p.R1200_E1201del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.8359807_8359812del"	""	"likely benign"	""
"0000675941"	"0"	"30"	"1"	"8418896"	"8418896"	"subst"	"7.09332E-5"	"01943"	"RERE_000014"	"g.8418896C>T"	""	""	""	"RERE(NM_012102.3):c.3699G>A (p.E1233=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000675942"	"0"	"50"	"1"	"8420710"	"8420710"	"subst"	"0"	"02329"	"RERE_000038"	"g.8420710C>A"	""	""	""	"RERE(NM_012102.4):c.2857G>T (p.G953W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000675943"	"0"	"50"	"1"	"8424172"	"8424172"	"dup"	"0"	"01943"	"RERE_000039"	"g.8424172dup"	""	""	""	"RERE(NM_012102.3):c.1684dupG (p.E562Gfs*3)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000675945"	"0"	"30"	"1"	"8716302"	"8716302"	"subst"	"8.12889E-6"	"01804"	"RERE_000040"	"g.8716302G>A"	""	""	""	"RERE(NM_001042681.1):c.55C>T (p.(Arg19Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000688252"	"0"	"30"	"1"	"8421096"	"8421096"	"subst"	"0.000593279"	"01804"	"RERE_000041"	"g.8421096G>A"	""	""	""	"RERE(NM_001042681.1):c.2471C>T (p.(Pro824Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000717709"	"0"	"50"	"1"	"8416214"	"8416214"	"subst"	"0"	"02325"	"RERE_000042"	"g.8416214G>C"	""	""	""	"RERE(NM_012102.4):c.4432C>G (p.P1478A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000717710"	"0"	"30"	"1"	"8418620"	"8418620"	"subst"	"4.71686E-5"	"01943"	"RERE_000043"	"g.8418620C>T"	""	""	""	"RERE(NM_012102.3):c.3975G>A (p.P1325=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000717711"	"0"	"50"	"1"	"8418813"	"8418813"	"subst"	"4.11435E-6"	"02329"	"RERE_000013"	"g.8418813C>T"	""	""	""	"RERE(NM_012102.4):c.3782G>A (p.R1261Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000717712"	"0"	"30"	"1"	"8419885"	"8419890"	"dup"	"0"	"02325"	"RERE_000044"	"g.8419885_8419890dup"	""	""	""	"RERE(NM_001042681.1):c.3562_3567dupAAGGAG (p.(Glu1189_Lys1190insLysGlu)), RERE(NM_012102.4):c.3568_3573dupAAGGAG (p.K1190_E1191dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000717713"	"0"	"50"	"1"	"8419976"	"8419976"	"subst"	"2.44155E-5"	"02329"	"RERE_000045"	"g.8419976C>T"	""	""	""	"RERE(NM_012102.4):c.3466G>A (p.G1156R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000717714"	"0"	"50"	"1"	"8421517"	"8421517"	"subst"	"0"	"02329"	"RERE_000006"	"g.8421517C>T"	""	""	""	"RERE(NM_012102.4):c.2050G>A (p.E684K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000717715"	"0"	"50"	"1"	"8421537"	"8421537"	"subst"	"0"	"02327"	"RERE_000046"	"g.8421537G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000717716"	"0"	"10"	"1"	"8716313"	"8716318"	"dup"	"0"	"01943"	"RERE_000047"	"g.8716313_8716318dup"	""	""	""	"RERE(NM_012102.3):c.45_50dupGGACCG (p.D20_R21dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000799538"	"0"	"50"	"1"	"8421481"	"8421481"	"subst"	"4.10775E-6"	"02325"	"RERE_000048"	"g.8421481C>G"	""	""	""	"RERE(NM_012102.4):c.2086G>C (p.E696Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000857613"	"0"	"70"	"1"	"8418302"	"8418302"	"subst"	"0"	"02329"	"RERE_000002"	"g.8418302G>T"	""	""	""	"RERE(NM_012102.4):c.4293C>A (p.H1431Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000857614"	"0"	"50"	"1"	"8420361"	"8420361"	"subst"	"0"	"01804"	"RERE_000049"	"g.8420361G>A"	""	""	""	"RERE(NM_001042681.1):c.3206C>T (p.(Pro1069Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000857615"	"0"	"30"	"1"	"8421875"	"8421875"	"subst"	"0.000227457"	"01943"	"RERE_000024"	"g.8421875G>A"	""	""	""	"RERE(NM_001042681.1):c.1964C>T (p.(Ala655Val)), RERE(NM_012102.3):c.1964C>T (p.A655V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000857622"	"0"	"30"	"1"	"8716342"	"8716347"	"dup"	"0"	"02325"	"RERE_000050"	"g.8716342_8716347dup"	""	""	""	"RERE(NM_012102.4):c.30_35dupCAAAGA (p.D10_K11dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000877177"	"0"	"70"	"1"	"8684418"	"8684418"	"del"	"0"	"01164"	"RERE_000051"	"g.8684418del"	""	""	""	""	"ACMG: PVS1, PM2_SUP"	"Germline"	"?"	""	"0"	""	""	"g.8624359del"	""	"likely pathogenic (dominant)"	"ACMG"
"0000877201"	"0"	"70"	"1"	"8419976"	"8419976"	"subst"	"2.44155E-5"	"00006"	"RERE_000045"	"g.8419976C>T"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8359916C>T"	""	"likely pathogenic (dominant)"	""
"0000877202"	"0"	"70"	"1"	"8418288"	"8418293"	"dup"	"0"	"00006"	"RERE_000009"	"g.8418288_8418293dup"	""	"{PMID:Fregeau 2016:27087320}"	""	"4313_4318dupTCCACC"	""	"De novo"	""	""	"0"	""	""	"g.8358228_8358233dup"	""	"likely pathogenic (dominant)"	""
"0000877203"	"0"	"70"	"1"	"8418810"	"8418810"	"subst"	"0"	"00006"	"RERE_000061"	"g.8418810G>C"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8358750G>C"	""	"likely pathogenic (dominant)"	""
"0000877204"	"0"	"70"	"1"	"8418302"	"8418302"	"subst"	"0"	"00006"	"RERE_000060"	"g.8418302G>C"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8358242G>C"	""	"likely pathogenic (dominant)"	""
"0000877205"	"0"	"70"	"1"	"8420447"	"8420447"	"del"	"0"	"00006"	"RERE_000064"	"g.8420447del"	""	"{PMID:Fregeau 2016:27087320}"	""	"3122delC"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.8360387del"	""	"likely pathogenic (dominant)"	""
"0000877206"	"0"	"70"	"1"	"8425908"	"8425908"	"subst"	"2.03211E-5"	"00006"	"RERE_000066"	"g.8425908C>T"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8365848C>T"	""	"likely pathogenic (dominant)"	""
"0000877207"	"0"	"70"	"1"	"8555123"	"8555123"	"del"	"0"	"00006"	"RERE_000068"	"g.8555123del"	""	"{PMID:Fregeau 2016:27087320}"	""	"1104delA"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.8495063del"	""	"likely pathogenic (dominant)"	""
"0000877208"	"0"	"70"	"1"	"8421298"	"8421319"	"dup"	"0"	"00006"	"RERE_000065"	"g.8421298_8421319dup"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8361238_8361259dup"	""	"likely pathogenic (dominant)"	""
"0000877209"	"0"	"70"	"1"	"8361229"	"8361229"	"subst"	"0"	"00006"	"RERE_000052"	"g.8361229G>A"	""	"{PMID:Krumm 2015:25961944}, {PMID:Fregeau 2016:27087320}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8421289G>A"	""	"likely pathogenic (dominant)"	""
"0000877253"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000053"	"g.(pter)_(8427633_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877254"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000054"	"g.(pter)_(8687168_?)del"	""	"{PMID:Paciorkowski 2011:21694734}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877255"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(9251936_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877256"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(9953030_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877257"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(10001011_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877258"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(10247416_?)del"	""	"{PMID:Campeau 2008:19006213}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877259"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(11809959_?)del"	""	"{PMID:Bursztejn 2009:19842196}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877260"	"0"	"90"	"1"	"0"	"0"	""	"0"	"00006"	"RERE_000055"	"g.(pter)_(12917483_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877261"	"0"	"90"	"1"	"564205"	"10821909"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_564205)_(10821909_?)del"	""	"{PMID:Arndt 2013:23768516}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877262"	"0"	"90"	"1"	"564424"	"16177338"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_564424)_(16177338_?)del"	""	"{PMID:Nicoulaz 2011:21739569}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877263"	"0"	"90"	"1"	"2080309"	"10869155"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_2080309)_(10869155_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877264"	"0"	"90"	"1"	"2785042"	"12743178"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_2785042)_(12743178_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877265"	"0"	"90"	"1"	"3224674"	"12540397"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_3224674)_(12540397_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877266"	"0"	"90"	"1"	"3302941"	"12452716"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_3302941)_(12452716_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877267"	"0"	"90"	"1"	"3694647"	"15600085"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_3694647)_(15600085_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877268"	"0"	"90"	"1"	"3768946"	"18563553"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_3768946)_(18563553_?)del"	""	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877269"	"0"	"90"	"1"	"4089259"	"12054030"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4089259)_(12054030_?)del"	""	"{PMID:Arndt 2013:23768516}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877270"	"0"	"90"	"1"	"4171067"	"12614542"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4171067)_(12614542_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877271"	"0"	"90"	"1"	"4317448"	"13867316"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4317448)_(13867316_?)del"	""	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877272"	"0"	"90"	"1"	"4737853"	"10402188"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4737853)_(10402188_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877273"	"0"	"90"	"1"	"4795388"	"17364849"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4795388)_(17364849_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877274"	"0"	"50"	"1"	"4843323"	"16397974"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_4843323)_(16397974_?)del"	""	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877275"	"0"	"90"	"1"	"5920313"	"10753137"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_5920313)_(10753137_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877276"	"0"	"90"	"1"	"5943597"	"12540397"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_5943597)_(12540397_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877277"	"0"	"90"	"1"	"6614950"	"16890814"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_6614950)_(16890814_?)del"	""	"{PMID:Shimada 2015:25172301}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877278"	"0"	"90"	"1"	"6731238"	"11945039"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_6731238)_(11945039_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877279"	"0"	"90"	"1"	"6942678"	"15390930"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_6942678)_(15390930_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877280"	"0"	"90"	"1"	"7812397"	"13488491"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_7812397)_(13488491_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877281"	"0"	"90"	"1"	"8037608"	"12540406"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_8037608)_(12540406_?)del"	""	"{PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877282"	"0"	"90"	"1"	"8395179"	"11362893"	"del"	"0"	"00006"	"RERE_000055"	"g.(?_8395179)_(11362893_?)del"	""	"{PMID:Kang 2007:17850629}, {PMID:Fregeau 2016:27087320}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877283"	"0"	"90"	"1"	"8803013"	"11739523"	"del"	"0"	"00006"	"RERE_000070"	"g.(?_8803013)_(11739523_?)del"	""	"{PMID:Zaveri 2014:24454898}"	""	""	""	"De novo"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877286"	"0"	"90"	"1"	"8509888"	"8803072"	"del"	"0"	"00006"	"RERE_000067"	"g.(8497191_8509888)_(8803072_8813784)del"	""	"{PMID:Jordan 2018:29330883}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000877287"	"0"	"90"	"1"	"8716116"	"8716116"	"dup"	"0"	"00006"	"RERE_000069"	"g.8716116dup"	""	"{PMID:Jordan 2018:29330883}"	""	"c.248dupA"	""	"De novo"	""	""	"0"	""	""	"g.8656057dup"	""	"pathogenic (dominant)"	""
"0000877288"	"0"	"90"	"1"	"8420421"	"8420421"	"subst"	"0"	"00006"	"RERE_000063"	"g.8420421G>A"	""	"{PMID:Jordan 2018:29330883}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8360361G>A"	""	"pathogenic (dominant)"	""
"0000877289"	"0"	"90"	"1"	"8418292"	"8418292"	"subst"	"0"	"00006"	"RERE_000059"	"g.8418292G>A"	""	"{PMID:Jordan 2018:29330883}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8358232G>A"	""	"pathogenic (dominant)"	""
"0000877290"	"0"	"90"	"1"	"8418291"	"8418291"	"subst"	"0"	"00006"	"RERE_000057"	"g.8418291T>C"	""	"{PMID:Jordan 2018:29330883}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8358231T>C"	""	"pathogenic (dominant)"	""
"0000877291"	"0"	"90"	"1"	"8420275"	"8420275"	"subst"	"0"	"00006"	"RERE_000062"	"g.8420275G>C"	""	"{PMID:Jordan 2018:29330883}"	""	""	"phase unknown"	"De novo"	""	""	"0"	""	""	"g.8360215G>C"	""	"pathogenic (dominant)"	""
"0000877292"	"0"	"70"	"1"	"8418288"	"8418293"	"dup"	"0"	"00006"	"RERE_000009"	"g.8418288_8418293dup"	""	"{PMID:Jordan 2018:29330883}"	""	"c.4313_4318dupTCCACC"	""	"De novo"	""	""	"0"	""	""	"g.8358228_8358233dup"	""	"likely pathogenic (dominant)"	""
"0000877293"	"0"	"70"	"1"	"8418288"	"8418293"	"dup"	"0"	"00006"	"RERE_000009"	"g.8418288_8418293dup"	""	"{PMID:Jordan 2018:29330883}"	""	"c.4313_4318dupTCCACC"	""	"De novo"	""	""	"0"	""	""	"g.8358228_8358233dup"	""	"likely pathogenic (dominant)"	""
"0000877294"	"0"	"90"	"1"	"8416255"	"8416255"	"subst"	"0"	"00006"	"RERE_000056"	"g.8416255T>C"	""	"{PMID:Jordan 2018:29330883}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.8356195T>C"	""	"pathogenic (dominant)"	""
"0000877295"	"0"	"90"	"1"	"8418291"	"8418291"	"subst"	"0"	"00006"	"RERE_000058"	"g.8418291T>A"	""	"{PMID:Jordan 2018:29330883}"	""	""	"phase unknown"	"De novo"	""	""	"0"	""	""	"g.8358231T>A"	""	"pathogenic (dominant)"	""
"0000883617"	"0"	"50"	"1"	"8420285"	"8420287"	"del"	"0"	"02327"	"RERE_000071"	"g.8420285_8420287del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000883618"	"0"	"30"	"1"	"8420969"	"8420969"	"subst"	"0.00011831"	"02326"	"RERE_000072"	"g.8420969T>A"	""	""	""	"RERE(NM_012102.4):c.2598A>T (p.P866=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000883619"	"0"	"50"	"1"	"8421118"	"8421129"	"del"	"0"	"02325"	"RERE_000073"	"g.8421118_8421129del"	""	""	""	"RERE(NM_012102.4):c.2439_2450delACCGCATCCCCC (p.P817_P820del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000883620"	"0"	"30"	"1"	"8424142"	"8424142"	"subst"	"7.3182E-5"	"02325"	"RERE_000074"	"g.8424142T>C"	""	""	""	"RERE(NM_012102.4):c.1714A>G (p.M572V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000911141"	"0"	"50"	"1"	"8422834"	"8422834"	"subst"	"0"	"02325"	"RERE_000075"	"g.8422834T>C"	""	""	""	"RERE(NM_012102.4):c.1811A>G (p.E604G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000911142"	"0"	"70"	"1"	"8424119"	"8424131"	"dup"	"0"	"02325"	"RERE_000076"	"g.8424119_8424131dup"	""	""	""	"RERE(NM_012102.4):c.1725_1737dupGCGGAGTCGGGGC (p.S580Afs*21)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000911144"	"0"	"30"	"1"	"8555165"	"8555165"	"subst"	"1.6243E-5"	"02326"	"RERE_000077"	"g.8555165G>A"	""	""	""	"RERE(NM_012102.4):c.1062C>T (p.V354=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000922474"	"1"	"70"	"1"	"8418331"	"8418331"	"subst"	"1.62885E-5"	"00006"	"RERE_000078"	"g.8418331C>T"	""	"{PMID:Carss 2014:24476948}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000922475"	"2"	"70"	"1"	"8418909"	"8418909"	"subst"	"2.57838E-5"	"00006"	"RERE_000079"	"g.8418909C>T"	""	"{PMID:Carss 2014:24476948}"	""	""	""	"Germline"	""	"rs138814161"	"0"	""	""	""	""	"VUS"	""
"0000923249"	"0"	"50"	"1"	"8418644"	"8418653"	"del"	"9.82511E-5"	"02325"	"RERE_000080"	"g.8418644_8418653del"	""	""	""	"RERE(NM_012102.4):c.3942_3951delCCGAGAGCGG (p.I1314Mfs*7)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000923250"	"0"	"50"	"1"	"8418655"	"8418659"	"del"	"5.58678E-5"	"02325"	"RERE_000081"	"g.8418655_8418659del"	""	""	""	"RERE(NM_012102.4):c.3936_3940delGGAGA (p.E1313Pfs*80)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000923251"	"0"	"30"	"1"	"8421940"	"8421940"	"subst"	"4.07222E-6"	"02325"	"RERE_000082"	"g.8421940C>T"	""	""	""	"RERE(NM_012102.4):c.1903-4G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000947307"	"0"	"50"	"1"	"8420511"	"8420511"	"del"	"0"	"02329"	"RERE_000083"	"g.8420511del"	""	""	""	"RERE(NM_012102.4):c.3058delC (p.H1020Tfs*61)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000947308"	"0"	"50"	"1"	"8555196"	"8555196"	"subst"	"0"	"02325"	"RERE_000084"	"g.8555196C>A"	""	""	""	"RERE(NM_012102.4):c.1031G>T (p.C344F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000961166"	"0"	"50"	"1"	"8424265"	"8424265"	"subst"	"1.62541E-5"	"02325"	"RERE_000085"	"g.8424265C>T"	""	""	""	"RERE(NM_012102.4):c.1591G>A (p.D531N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974125"	"0"	"30"	"1"	"8415631"	"8415631"	"subst"	"0.000859137"	"01804"	"RERE_000089"	"g.8415631C>A"	""	""	""	"RERE(NM_001042681.2):c.4515G>T (p.(Gly1505=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974126"	"0"	"50"	"1"	"8418582"	"8418582"	"subst"	"0"	"01804"	"RERE_000090"	"g.8418582T>G"	""	""	""	"RERE(NM_001042681.2):c.4013A>C (p.(His1338Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974127"	"0"	"50"	"1"	"8418680"	"8418694"	"del"	"0"	"01804"	"RERE_000091"	"g.8418680_8418694del"	""	""	""	"RERE(NM_001042681.2):c.3910_3924del (p.(Leu1304_Glu1308del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974128"	"0"	"50"	"1"	"8418824"	"8418824"	"subst"	"0"	"01804"	"RERE_000092"	"g.8418824G>C"	""	""	""	"RERE(NM_001042681.2):c.3771C>G (p.(Ser1257Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974129"	"0"	"50"	"1"	"8419911"	"8419911"	"subst"	"0"	"01804"	"RERE_000093"	"g.8419911T>G"	""	""	""	"RERE(NM_001042681.2):c.3531A>C (p.(Lys1177Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974130"	"0"	"50"	"1"	"8420346"	"8420346"	"subst"	"0"	"01804"	"RERE_000094"	"g.8420346G>A"	""	""	""	"RERE(NM_001042681.2):c.3221C>T (p.(Ala1074Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000974131"	"0"	"30"	"1"	"8421092"	"8421100"	"del"	"0"	"01804"	"RERE_000095"	"g.8421092_8421100del"	""	""	""	"RERE(NM_001042681.2):c.2468_2476del (p.(His823_Pro825del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974132"	"0"	"30"	"1"	"8421104"	"8421106"	"del"	"0"	"01804"	"RERE_000096"	"g.8421104_8421106del"	""	""	""	"RERE(NM_001042681.2):c.2461_2463del (p.(Ser821del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974133"	"0"	"30"	"1"	"8425908"	"8425908"	"subst"	"2.03211E-5"	"01804"	"RERE_000066"	"g.8425908C>T"	""	""	""	"RERE(NM_001042681.2):c.1411G>A (p.(Val471Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974140"	"0"	"30"	"1"	"8528871"	"8528871"	"subst"	"0"	"01804"	"RERE_000097"	"g.8528871G>A"	""	""	""	"RERE(NM_001042681.2):c.1105-2788C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974141"	"0"	"30"	"1"	"8561890"	"8561890"	"subst"	"0"	"01804"	"RERE_000098"	"g.8561890G>C"	""	""	""	"RERE(NM_001042681.2):c.880-4301C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000974142"	"0"	"30"	"1"	"8667919"	"8667919"	"subst"	"0"	"01804"	"RERE_000099"	"g.8667919A>G"	""	""	""	"RERE(NM_001042681.2):c.522+6701T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991446"	"0"	"50"	"1"	"8416214"	"8416214"	"subst"	"0"	"01804"	"RERE_000100"	"g.8416214G>A"	""	""	""	"RERE(NM_001042681.1):c.4432C>T (p.(Pro1478Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991447"	"0"	"30"	"1"	"8418260"	"8418260"	"subst"	"4.18284E-5"	"01804"	"RERE_000101"	"g.8418260G>T"	""	""	""	"RERE(NM_001042681.1):c.4335C>A (p.(His1445Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991448"	"0"	"50"	"1"	"8418655"	"8418674"	"del"	"4.29753E-5"	"01804"	"RERE_000102"	"g.8418655_8418674del"	""	""	""	"RERE(NM_001042681.1):c.3921_3940delGGAGATCCGAGAGCGGGAGA (p.(Glu1308fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991449"	"0"	"30"	"1"	"8418972"	"8418972"	"subst"	"5.79415E-5"	"02325"	"RERE_000032"	"g.8418972G>A"	""	""	""	"RERE(NM_001042681.1):c.3623C>T (p.(Ala1208Val)), RERE(NM_012102.4):c.3623C>T (p.A1208V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991450"	"0"	"30"	"1"	"8419885"	"8419890"	"dup"	"0"	"01804"	"RERE_000044"	"g.8419885_8419890dup"	""	""	""	"RERE(NM_001042681.1):c.3562_3567dupAAGGAG (p.(Glu1189_Lys1190insLysGlu)), RERE(NM_012102.4):c.3568_3573dupAAGGAG (p.K1190_E1191dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991451"	"0"	"50"	"1"	"8420238"	"8420238"	"subst"	"0"	"01804"	"RERE_000103"	"g.8420238G>T"	""	""	""	"RERE(NM_001042681.1):c.3329C>A (p.(Pro1110Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991452"	"0"	"50"	"1"	"8420262"	"8420262"	"subst"	"4.90812E-5"	"01804"	"RERE_000104"	"g.8420262T>C"	""	""	""	"RERE(NM_001042681.1):c.3305A>G (p.(Glu1102Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991453"	"0"	"70"	"1"	"8420324"	"8420324"	"dup"	"0"	"02329"	"RERE_000105"	"g.8420324dup"	""	""	""	"RERE(NM_012102.4):c.3249dupG (p.S1084Vfs*19)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000991454"	"0"	"30"	"1"	"8420325"	"8420325"	"subst"	"0.000118661"	"01804"	"RERE_000106"	"g.8420325G>A"	""	""	""	"RERE(NM_001042681.1):c.3242C>T (p.(Ala1081Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991455"	"0"	"50"	"1"	"8420725"	"8420725"	"subst"	"3.97411E-5"	"01804"	"RERE_000107"	"g.8420725G>A"	""	""	""	"RERE(NM_001042681.1):c.2842C>T (p.(Pro948Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991456"	"0"	"30"	"1"	"8420826"	"8420826"	"subst"	"4.16806E-5"	"01804"	"RERE_000108"	"g.8420826C>T"	""	""	""	"RERE(NM_001042681.1):c.2741G>A (p.(Arg914Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991457"	"0"	"30"	"1"	"8421010"	"8421010"	"subst"	"1.79643E-5"	"01804"	"RERE_000109"	"g.8421010C>T"	""	""	""	"RERE(NM_001042681.1):c.2557G>A (p.(Gly853Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991458"	"0"	"30"	"1"	"8422829"	"8422829"	"subst"	"4.07203E-6"	"01804"	"RERE_000110"	"g.8422829T>C"	""	""	""	"RERE(NM_001042681.1):c.1816A>G (p.(Ile606Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991459"	"0"	"50"	"1"	"8422900"	"8422900"	"subst"	"1.6609E-5"	"01804"	"RERE_000111"	"g.8422900G>A"	""	""	""	"RERE(NM_001042681.1):c.1745C>T (p.(Ser582Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991460"	"0"	"50"	"1"	"8424129"	"8424129"	"subst"	"1.22174E-5"	"01804"	"RERE_000112"	"g.8424129C>T"	""	""	""	"RERE(NM_001042681.1):c.1727G>A (p.(Arg576Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991461"	"0"	"50"	"1"	"8424222"	"8424222"	"subst"	"0"	"02325"	"RERE_000113"	"g.8424222A>G"	""	""	""	"RERE(NM_012102.4):c.1634T>C (p.I545T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991466"	"0"	"50"	"1"	"8674654"	"8674654"	"subst"	"0"	"01804"	"RERE_000114"	"g.8674654T>G"	""	""	""	"RERE(NM_001042681.1):c.488A>C (p.(Gln163Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000991468"	"0"	"30"	"1"	"8716104"	"8716104"	"subst"	"2.03034E-5"	"01804"	"RERE_000115"	"g.8716104G>A"	""	""	""	"RERE(NM_001042681.1):c.253C>T (p.(Arg85Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000991469"	"0"	"50"	"1"	"8716125"	"8716125"	"subst"	"4.06062E-6"	"01804"	"RERE_000116"	"g.8716125T>C"	""	""	""	"RERE(NM_001042681.1):c.232A>G (p.(Lys78Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001013348"	"0"	"50"	"1"	"8420197"	"8420197"	"subst"	"0"	"02325"	"RERE_000117"	"g.8420197G>A"	""	""	""	"RERE(NM_001042681.2):c.3370C>T (p.(Pro1124Ser)), RERE(NM_012102.4):c.3370C>T (p.P1124S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001013349"	"0"	"50"	"1"	"8601306"	"8601306"	"subst"	"0"	"02325"	"RERE_000118"	"g.8601306A>G"	""	""	""	"RERE(NM_012102.4):c.797T>C (p.F266S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001013350"	"0"	"30"	"1"	"8616562"	"8616562"	"subst"	"0.000511821"	"02326"	"RERE_000119"	"g.8616562C>T"	""	""	""	"RERE(NM_001042681.2):c.697G>A (p.(Val233Ile)), RERE(NM_012102.4):c.697G>A (p.V233I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001024207"	"0"	"50"	"1"	"8422814"	"8422814"	"subst"	"4.07143E-6"	"02325"	"RERE_000120"	"g.8422814G>C"	""	""	""	"RERE(NM_012102.4):c.1831C>G (p.R611G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032195"	"0"	"30"	"1"	"8415322"	"8415322"	"subst"	"0"	"01804"	"RERE_000121"	"g.8415322C>T"	""	""	""	"RERE(NM_001042681.2):c.4668-142G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032196"	"0"	"30"	"1"	"8418541"	"8418541"	"subst"	"0.000504669"	"02325"	"RERE_000122"	"g.8418541C>T"	""	""	""	"RERE(NM_012102.4):c.4054G>A (p.A1352T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032197"	"0"	"50"	"1"	"8418556"	"8418556"	"subst"	"0"	"01804"	"RERE_000123"	"g.8418556A>C"	""	""	""	"RERE(NM_001042681.2):c.4039T>G (p.(Phe1347Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032198"	"0"	"50"	"1"	"8418823"	"8418823"	"subst"	"0"	"01804"	"RERE_000124"	"g.8418823C>T"	""	""	""	"RERE(NM_001042681.2):c.3772G>A (p.(Glu1258Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032199"	"0"	"50"	"1"	"8418867"	"8418867"	"subst"	"0"	"02327"	"RERE_000125"	"g.8418867G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032200"	"0"	"30"	"1"	"8418909"	"8418909"	"subst"	"2.57838E-5"	"01804"	"RERE_000079"	"g.8418909C>T"	""	""	""	"RERE(NM_001042681.2):c.3686G>A (p.(Arg1229Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032201"	"0"	"30"	"1"	"8419849"	"8419849"	"subst"	"0"	"01804"	"RERE_000126"	"g.8419849C>T"	""	""	""	"RERE(NM_001042681.2):c.3593G>A (p.(Arg1198Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032202"	"0"	"50"	"1"	"8419925"	"8419925"	"subst"	"8.16313E-6"	"01804"	"RERE_000127"	"g.8419925C>T"	""	""	""	"RERE(NM_001042681.2):c.3517G>A (p.(Glu1173Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032203"	"0"	"50"	"1"	"8420197"	"8420197"	"subst"	"0"	"01804"	"RERE_000117"	"g.8420197G>A"	""	""	""	"RERE(NM_001042681.2):c.3370C>T (p.(Pro1124Ser)), RERE(NM_012102.4):c.3370C>T (p.P1124S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032204"	"0"	"30"	"1"	"8420410"	"8420410"	"subst"	"0"	"01804"	"RERE_000128"	"g.8420410G>A"	""	""	""	"RERE(NM_001042681.2):c.3157C>T (p.(Pro1053Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032205"	"0"	"50"	"1"	"8420892"	"8420892"	"subst"	"0.000118771"	"01804"	"RERE_000129"	"g.8420892G>A"	""	""	""	"RERE(NM_001042681.2):c.2675C>T (p.(Ala892Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001032206"	"0"	"30"	"1"	"8421145"	"8421145"	"subst"	"0"	"01804"	"RERE_000130"	"g.8421145G>T"	""	""	""	"RERE(NM_001042681.2):c.2422C>A (p.(Pro808Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032212"	"0"	"30"	"1"	"8555123"	"8555123"	"subst"	"2.84269E-5"	"01804"	"RERE_000131"	"g.8555123T>G"	""	""	""	"RERE(NM_001042681.2):c.1104A>C (p.(Thr368=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032213"	"0"	"30"	"1"	"8575308"	"8575308"	"subst"	"0"	"01804"	"RERE_000132"	"g.8575308C>G"	""	""	""	"RERE(NM_001042681.2):c.831-6574G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032214"	"0"	"30"	"1"	"8576308"	"8576308"	"dup"	"0"	"01804"	"RERE_000133"	"g.8576308dup"	""	""	""	"RERE(NM_001042681.2):c.831-7553dup"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032215"	"0"	"30"	"1"	"8616562"	"8616562"	"subst"	"0.000511821"	"01804"	"RERE_000119"	"g.8616562C>T"	""	""	""	"RERE(NM_001042681.2):c.697G>A (p.(Val233Ile)), RERE(NM_012102.4):c.697G>A (p.V233I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032220"	"0"	"30"	"1"	"8757738"	"8757738"	"subst"	"0"	"01804"	"RERE_000134"	"g.8757738C>T"	""	""	""	"RERE(NM_001042681.2):c.-144-41238G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032221"	"0"	"30"	"1"	"8790551"	"8790551"	"subst"	"0"	"01804"	"RERE_000135"	"g.8790551G>A"	""	""	""	"RERE(NM_001042681.2):c.-144-74051C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001032222"	"0"	"30"	"1"	"8829992"	"8829992"	"subst"	"0"	"01804"	"RERE_000136"	"g.8829992C>T"	""	""	""	"RERE(NM_001042681.2):c.-145+47227G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001045700"	"0"	"30"	"1"	"8419843"	"8419843"	"subst"	"0"	"02325"	"RERE_000137"	"g.8419843C>T"	""	""	""	"RERE(NM_012102.4):c.3599G>A (p.R1200H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001045701"	"0"	"30"	"1"	"8526019"	"8526019"	"subst"	"2.44361E-5"	"02325"	"RERE_000138"	"g.8526019T>C"	""	""	""	"RERE(NM_012102.4):c.1169A>G (p.K390R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001049899"	"0"	"50"	"1"	"8414773"	"8414773"	"subst"	"0"	"01804"	"RERE_000139"	"g.8414773G>A"	""	""	""	"RERE(NM_001042681.2):c.*374C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049900"	"0"	"50"	"1"	"8415555"	"8415555"	"subst"	"1.25889E-5"	"01804"	"RERE_000140"	"g.8415555C>A"	""	""	""	"RERE(NM_001042681.2):c.4591G>T (p.(Ala1531Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049901"	"0"	"50"	"1"	"8416280"	"8416280"	"subst"	"0"	"01804"	"RERE_000141"	"g.8416280C>T"	""	""	""	"RERE(NM_001042681.2):c.4366G>A (p.(Val1456Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049902"	"0"	"30"	"1"	"8420842"	"8420842"	"subst"	"0"	"01804"	"RERE_000142"	"g.8420842A>G"	""	""	""	"RERE(NM_001042681.2):c.2725T>C (p.(Ser909Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001049903"	"0"	"30"	"1"	"8420980"	"8420980"	"subst"	"0"	"01804"	"RERE_000143"	"g.8420980G>C"	""	""	""	"RERE(NM_001042681.2):c.2587C>G (p.(Leu863Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001049904"	"0"	"50"	"1"	"8421093"	"8421093"	"subst"	"1.92256E-5"	"01804"	"RERE_000144"	"g.8421093G>A"	""	""	""	"RERE(NM_001042681.2):c.2474C>T (p.(Pro825Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049905"	"0"	"50"	"1"	"8421103"	"8421103"	"subst"	"0"	"01804"	"RERE_000145"	"g.8421103G>A"	""	""	""	"RERE(NM_001042681.2):c.2464C>T (p.(Pro822Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049906"	"0"	"50"	"1"	"8674624"	"8674624"	"subst"	"0"	"01804"	"RERE_000146"	"g.8674624A>C"	""	""	""	"RERE(NM_001042681.2):c.518T>G (p.(Val173Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001049907"	"0"	"30"	"1"	"8803428"	"8803428"	"subst"	"0"	"01804"	"RERE_000147"	"g.8803428C>G"	""	""	""	"RERE(NM_001042681.2):c.-145+73791G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes RERE
## Count = 173
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000052403"	"00017634"	"70"	"4046"	"0"	"4046"	"0"	"c.4046G>A"	"r.(?)"	"p.(Arg1349Gln)"	""
"0000067277"	"00017634"	"70"	"4293"	"0"	"4293"	"0"	"c.4293C>A"	"r.(?)"	"p.(His1431Gln)"	""
"0000320519"	"00017634"	"30"	"1418"	"0"	"1418"	"0"	"c.1418C>T"	"r.(?)"	"p.(Thr473Ile)"	""
"0000508491"	"00017634"	"50"	"4223"	"0"	"4223"	"0"	"c.4223C>T"	"r.(?)"	"p.(Ser1408Leu)"	""
"0000508492"	"00017634"	"10"	"3996"	"0"	"3996"	"0"	"c.3996A>G"	"r.(?)"	"p.(Pro1332=)"	""
"0000508493"	"00017634"	"50"	"3944"	"0"	"3944"	"0"	"c.3944G>C"	"r.(?)"	"p.(Arg1315Pro)"	""
"0000508498"	"00017634"	"50"	"3412"	"0"	"3412"	"0"	"c.3412G>A"	"r.(?)"	"p.(Asp1138Asn)"	""
"0000508499"	"00017634"	"30"	"3297"	"0"	"3297"	"0"	"c.3297C>T"	"r.(?)"	"p.(Asp1099=)"	""
"0000508500"	"00017634"	"30"	"3227"	"0"	"3227"	"0"	"c.3227C>T"	"r.(?)"	"p.(Ser1076Leu)"	""
"0000508503"	"00017634"	"50"	"2288"	"0"	"2288"	"0"	"c.2288C>T"	"r.(?)"	"p.(Thr763Met)"	""
"0000508504"	"00017634"	"30"	"2239"	"0"	"2239"	"0"	"c.2239G>T"	"r.(?)"	"p.(Val747Phe)"	""
"0000508505"	"00017634"	"30"	"1964"	"0"	"1964"	"0"	"c.1964C>T"	"r.(?)"	"p.(Ala655Val)"	""
"0000508506"	"00017634"	"30"	"1540"	"10"	"1540"	"10"	"c.1540+10C>T"	"r.(=)"	"p.(=)"	""
"0000508507"	"00017634"	"50"	"1306"	"0"	"1306"	"0"	"c.1306T>G"	"r.(?)"	"p.(Tyr436Asp)"	""
"0000508514"	"00017634"	"50"	"571"	"0"	"571"	"0"	"c.571T>C"	"r.(?)"	"p.(Ser191Pro)"	""
"0000508517"	"00017634"	"30"	"355"	"0"	"355"	"0"	"c.355A>G"	"r.(?)"	"p.(Asn119Asp)"	""
"0000508519"	"00017634"	"50"	"182"	"0"	"182"	"0"	"c.182A>T"	"r.(?)"	"p.(Asn61Ile)"	""
"0000508521"	"00017634"	"30"	"30"	"0"	"35"	"0"	"c.30_35del"	"r.(?)"	"p.(Asp10_Lys11del)"	""
"0000605980"	"00017634"	"30"	"3623"	"0"	"3623"	"0"	"c.3623C>T"	"r.(?)"	"p.(Ala1208Val)"	""
"0000605981"	"00017634"	"30"	"3588"	"0"	"3588"	"0"	"c.3588A>G"	"r.(?)"	"p.(Arg1196=)"	""
"0000605982"	"00017634"	"50"	"2872"	"0"	"2872"	"0"	"c.2872T>C"	"r.(?)"	"p.(Ser958Pro)"	""
"0000605983"	"00017634"	"50"	"2746"	"0"	"2746"	"0"	"c.2746C>T"	"r.(?)"	"p.(Gln916Ter)"	""
"0000620702"	"00017634"	"30"	"2449"	"0"	"2460"	"0"	"c.2449_2460dup"	"r.(?)"	"p.(Pro817_Pro820dup)"	""
"0000654119"	"00017634"	"30"	"3582"	"0"	"3587"	"0"	"c.3582_3587del"	"r.(?)"	"p.(Arg1200_Glu1201del)"	""
"0000675941"	"00017634"	"30"	"3699"	"0"	"3699"	"0"	"c.3699G>A"	"r.(?)"	"p.(Glu1233=)"	""
"0000675942"	"00017634"	"50"	"2857"	"0"	"2857"	"0"	"c.2857G>T"	"r.(?)"	"p.(Gly953Trp)"	""
"0000675943"	"00017634"	"50"	"1684"	"0"	"1684"	"0"	"c.1684dup"	"r.(?)"	"p.(Glu562GlyfsTer3)"	""
"0000675945"	"00017634"	"30"	"55"	"0"	"55"	"0"	"c.55C>T"	"r.(?)"	"p.(Arg19Trp)"	""
"0000688252"	"00017634"	"30"	"2471"	"0"	"2471"	"0"	"c.2471C>T"	"r.(?)"	"p.(Pro824Leu)"	""
"0000717709"	"00017634"	"50"	"4432"	"0"	"4432"	"0"	"c.4432C>G"	"r.(?)"	"p.(Pro1478Ala)"	""
"0000717710"	"00017634"	"30"	"3975"	"0"	"3975"	"0"	"c.3975G>A"	"r.(?)"	"p.(Pro1325=)"	""
"0000717711"	"00017634"	"50"	"3782"	"0"	"3782"	"0"	"c.3782G>A"	"r.(?)"	"p.(Arg1261Gln)"	""
"0000717712"	"00017634"	"30"	"3568"	"0"	"3573"	"0"	"c.3568_3573dup"	"r.(?)"	"p.(Lys1190_Glu1191dup)"	""
"0000717713"	"00017634"	"50"	"3466"	"0"	"3466"	"0"	"c.3466G>A"	"r.(?)"	"p.(Gly1156Arg)"	""
"0000717714"	"00017634"	"50"	"2050"	"0"	"2050"	"0"	"c.2050G>A"	"r.(?)"	"p.(Glu684Lys)"	""
"0000717715"	"00017634"	"50"	"2030"	"0"	"2030"	"0"	"c.2030C>A"	"r.(?)"	"p.(Pro677His)"	""
"0000717716"	"00017634"	"10"	"45"	"0"	"50"	"0"	"c.45_50dup"	"r.(?)"	"p.(Asp20_Arg21dup)"	""
"0000799538"	"00017634"	"50"	"2086"	"0"	"2086"	"0"	"c.2086G>C"	"r.(?)"	"p.(Glu696Gln)"	""
"0000857613"	"00017634"	"70"	"4293"	"0"	"4293"	"0"	"c.4293C>A"	"r.(?)"	"p.(His1431Gln)"	""
"0000857614"	"00017634"	"50"	"3206"	"0"	"3206"	"0"	"c.3206C>T"	"r.(?)"	"p.(Pro1069Leu)"	""
"0000857615"	"00017634"	"30"	"1964"	"0"	"1964"	"0"	"c.1964C>T"	"r.(?)"	"p.(Ala655Val)"	""
"0000857622"	"00017634"	"30"	"30"	"0"	"35"	"0"	"c.30_35dup"	"r.(?)"	"p.(Asp10_Lys11dup)"	""
"0000877177"	"00017634"	"70"	"348"	"0"	"348"	"0"	"c.348del"	"r.(?)"	"p.(Arg117Glyfs*57)"	"3"
"0000877201"	"00017634"	"70"	"3466"	"0"	"3466"	"0"	"c.3466G>A"	"r.(?)"	"p.(Gly1156Arg)"	""
"0000877202"	"00017634"	"70"	"4313"	"0"	"4318"	"0"	"c.4313_4318dup"	"r.(?)"	"p.(Leu1438_His1439dup)"	""
"0000877203"	"00017634"	"70"	"3785"	"0"	"3785"	"0"	"c.3785C>G"	"r.(?)"	"p.(Pro1262Arg)"	""
"0000877204"	"00017634"	"70"	"4293"	"0"	"4293"	"0"	"c.4293C>G"	"r.(?)"	"p.(His1431Gln)"	""
"0000877205"	"00017634"	"70"	"3122"	"0"	"3122"	"0"	"c.3122del"	"r.(?)"	"p.(Pro1041LeufsTer40)"	""
"0000877206"	"00017634"	"70"	"1411"	"0"	"1411"	"0"	"c.1411G>A"	"r.(?)"	"p.(Val471Ile)"	""
"0000877207"	"00017634"	"70"	"1104"	"0"	"1104"	"0"	"c.1104del"	"r.spl"	"p.?"	""
"0000877208"	"00017634"	"70"	"2249"	"0"	"2270"	"0"	"c.2249_2270dup"	"r.(?)"	"p.(Thr758SerfsTer36)"	""
"0000877209"	"00017634"	"70"	"2278"	"0"	"2278"	"0"	"c.2278C>T"	"r.(?)"	"p.(Gln760Ter)"	""
"0000877253"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_(1285-1599_?){0}"	"r.?"	"p.?"	"_1_12i_"
"0000877254"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_(326-2729_?){0}"	"r.?"	"p.?"	"_1_2i_"
"0000877255"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877256"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877257"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877258"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877259"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877260"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877261"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877262"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877263"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877264"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877265"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877266"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877267"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877268"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877269"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877270"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877271"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877272"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877273"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877274"	"00017634"	"50"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877275"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877276"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877277"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877278"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877279"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877280"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877281"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877282"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_*2683{0}"	"r.0"	"p.0"	"_1_23_"
"0000877283"	"00017634"	"90"	""	"0"	""	"0"	"c.(?_-145+74206)_*2683{0}"	"r.?"	"p.?"	"_1i_23_"
"0000877286"	"00017634"	"90"	""	"0"	""	"0"	"c.-625_(1203+16097_1204-14324){0}"	"r.0?"	"p.0?"	"_1_11i"
"0000877287"	"00017634"	"90"	"248"	"0"	"248"	"0"	"c.248dup"	"r.(?)"	"p.(Ser84ValfsTer4)"	""
"0000877288"	"00017634"	"90"	"3146"	"0"	"3146"	"0"	"c.3146C>T"	"r.(?)"	"p.(Pro1049Leu)"	""
"0000877289"	"00017634"	"90"	"4303"	"0"	"4303"	"0"	"c.4303C>T"	"r.(?)"	"p.(His1435Tyr)"	""
"0000877290"	"00017634"	"90"	"4304"	"0"	"4304"	"0"	"c.4304A>G"	"r.(?)"	"p.(His1435Arg)"	""
"0000877291"	"00017634"	"90"	"3292"	"0"	"3292"	"0"	"c.3292C>G"	"r.(?)"	"p.(Leu1098Val)"	""
"0000877292"	"00017634"	"70"	"4313"	"0"	"4318"	"0"	"c.4313_4318dup"	"r.(?)"	"p.(Leu1438_His1439dup)"	""
"0000877293"	"00017634"	"70"	"4313"	"0"	"4318"	"0"	"c.4313_4318dup"	"r.(?)"	"p.(Leu1438_His1439dup)"	""
"0000877294"	"00017634"	"90"	"4391"	"0"	"4391"	"0"	"c.4391A>G"	"r.(?)"	"p.(His1464Arg)"	""
"0000877295"	"00017634"	"90"	"4304"	"0"	"4304"	"0"	"c.4304A>T"	"r.(?)"	"p.(His1435Leu)"	""
"0000883617"	"00017634"	"50"	"3280"	"0"	"3282"	"0"	"c.3280_3282del"	"r.(?)"	"p.(Lys1094del)"	""
"0000883618"	"00017634"	"30"	"2598"	"0"	"2598"	"0"	"c.2598A>T"	"r.(?)"	"p.(Pro866=)"	""
"0000883619"	"00017634"	"50"	"2439"	"0"	"2450"	"0"	"c.2439_2450del"	"r.(?)"	"p.(Pro817_Pro820del)"	""
"0000883620"	"00017634"	"30"	"1714"	"0"	"1714"	"0"	"c.1714A>G"	"r.(?)"	"p.(Met572Val)"	""
"0000911141"	"00017634"	"50"	"1811"	"0"	"1811"	"0"	"c.1811A>G"	"r.(?)"	"p.(Glu604Gly)"	""
"0000911142"	"00017634"	"70"	"1725"	"0"	"1737"	"0"	"c.1725_1737dup"	"r.(?)"	"p.(Ser580Alafs*21)"	""
"0000911144"	"00017634"	"30"	"1062"	"0"	"1062"	"0"	"c.1062C>T"	"r.(?)"	"p.(Val354=)"	""
"0000922474"	"00017634"	"70"	"4264"	"0"	"4264"	"0"	"c.4264G>A"	"r.(?)"	"p.(Val1422Met)"	""
"0000922475"	"00017634"	"70"	"3686"	"0"	"3686"	"0"	"c.3686G>A"	"r.(?)"	"p.(Arg1229Gln)"	""
"0000923249"	"00017634"	"50"	"3942"	"0"	"3951"	"0"	"c.3942_3951del"	"r.(?)"	"p.(Ile1314Metfs*7)"	""
"0000923250"	"00017634"	"50"	"3936"	"0"	"3940"	"0"	"c.3936_3940del"	"r.(?)"	"p.(Glu1313Profs*80)"	""
"0000923251"	"00017634"	"30"	"1903"	"-4"	"1903"	"-4"	"c.1903-4G>A"	"r.spl?"	"p.?"	""
"0000947307"	"00017634"	"50"	"3058"	"0"	"3058"	"0"	"c.3058del"	"r.(?)"	"p.(His1020Thrfs*61)"	""
"0000947308"	"00017634"	"50"	"1031"	"0"	"1031"	"0"	"c.1031G>T"	"r.(?)"	"p.(Cys344Phe)"	""
"0000961166"	"00017634"	"50"	"1591"	"0"	"1591"	"0"	"c.1591G>A"	"r.(?)"	"p.(Asp531Asn)"	""
"0000974125"	"00017634"	"30"	"4515"	"0"	"4515"	"0"	"c.4515G>T"	"r.(?)"	"p.(=)"	""
"0000974126"	"00017634"	"50"	"4013"	"0"	"4013"	"0"	"c.4013A>C"	"r.(?)"	"p.(His1338Pro)"	""
"0000974127"	"00017634"	"50"	"3910"	"0"	"3924"	"0"	"c.3910_3924del"	"r.(?)"	"p.(Leu1304_Glu1308del)"	""
"0000974128"	"00017634"	"50"	"3771"	"0"	"3771"	"0"	"c.3771C>G"	"r.(?)"	"p.(Ser1257Arg)"	""
"0000974129"	"00017634"	"50"	"3531"	"0"	"3531"	"0"	"c.3531A>C"	"r.(?)"	"p.(Lys1177Asn)"	""
"0000974130"	"00017634"	"50"	"3221"	"0"	"3221"	"0"	"c.3221C>T"	"r.(?)"	"p.(Ala1074Val)"	""
"0000974131"	"00017634"	"30"	"2468"	"0"	"2476"	"0"	"c.2468_2476del"	"r.(?)"	"p.(His823_Pro825del)"	""
"0000974132"	"00017634"	"30"	"2461"	"0"	"2463"	"0"	"c.2461_2463del"	"r.(?)"	"p.(Ser821del)"	""
"0000974133"	"00017634"	"30"	"1411"	"0"	"1411"	"0"	"c.1411G>A"	"r.(?)"	"p.(Val471Ile)"	""
"0000974140"	"00017634"	"30"	"1105"	"-2788"	"1105"	"-2788"	"c.1105-2788C>T"	"r.(=)"	"p.(=)"	""
"0000974141"	"00017634"	"30"	"880"	"-4301"	"880"	"-4301"	"c.880-4301C>G"	"r.(=)"	"p.(=)"	""
"0000974142"	"00017634"	"30"	"522"	"6701"	"522"	"6701"	"c.522+6701T>C"	"r.(=)"	"p.(=)"	""
"0000991446"	"00017634"	"50"	"4432"	"0"	"4432"	"0"	"c.4432C>T"	"r.(?)"	"p.(Pro1478Ser)"	""
"0000991447"	"00017634"	"30"	"4335"	"0"	"4335"	"0"	"c.4335C>A"	"r.(?)"	"p.(His1445Gln)"	""
"0000991448"	"00017634"	"50"	"3921"	"0"	"3940"	"0"	"c.3921_3940del"	"r.(?)"	"p.(Glu1308Profs*80)"	""
"0000991449"	"00017634"	"30"	"3623"	"0"	"3623"	"0"	"c.3623C>T"	"r.(?)"	"p.(Ala1208Val)"	""
"0000991450"	"00017634"	"30"	"3568"	"0"	"3573"	"0"	"c.3568_3573dup"	"r.(?)"	"p.(Lys1190_Glu1191dup)"	""
"0000991451"	"00017634"	"50"	"3329"	"0"	"3329"	"0"	"c.3329C>A"	"r.(?)"	"p.(Pro1110Gln)"	""
"0000991452"	"00017634"	"50"	"3305"	"0"	"3305"	"0"	"c.3305A>G"	"r.(?)"	"p.(Glu1102Gly)"	""
"0000991453"	"00017634"	"70"	"3249"	"0"	"3249"	"0"	"c.3249dup"	"r.(?)"	"p.(Ser1084Valfs*19)"	""
"0000991454"	"00017634"	"30"	"3242"	"0"	"3242"	"0"	"c.3242C>T"	"r.(?)"	"p.(Ala1081Val)"	""
"0000991455"	"00017634"	"50"	"2842"	"0"	"2842"	"0"	"c.2842C>T"	"r.(?)"	"p.(Pro948Ser)"	""
"0000991456"	"00017634"	"30"	"2741"	"0"	"2741"	"0"	"c.2741G>A"	"r.(?)"	"p.(Arg914Gln)"	""
"0000991457"	"00017634"	"30"	"2557"	"0"	"2557"	"0"	"c.2557G>A"	"r.(?)"	"p.(Gly853Ser)"	""
"0000991458"	"00017634"	"30"	"1816"	"0"	"1816"	"0"	"c.1816A>G"	"r.(?)"	"p.(Ile606Val)"	""
"0000991459"	"00017634"	"50"	"1745"	"0"	"1745"	"0"	"c.1745C>T"	"r.(?)"	"p.(Ser582Leu)"	""
"0000991460"	"00017634"	"50"	"1727"	"0"	"1727"	"0"	"c.1727G>A"	"r.(?)"	"p.(Arg576Gln)"	""
"0000991461"	"00017634"	"50"	"1634"	"0"	"1634"	"0"	"c.1634T>C"	"r.(?)"	"p.(Ile545Thr)"	""
"0000991466"	"00017634"	"50"	"488"	"0"	"488"	"0"	"c.488A>C"	"r.(?)"	"p.(Gln163Pro)"	""
"0000991468"	"00017634"	"30"	"253"	"0"	"253"	"0"	"c.253C>T"	"r.(?)"	"p.(Arg85Cys)"	""
"0000991469"	"00017634"	"50"	"232"	"0"	"232"	"0"	"c.232A>G"	"r.(?)"	"p.(Lys78Glu)"	""
"0001013348"	"00017634"	"50"	"3370"	"0"	"3370"	"0"	"c.3370C>T"	"r.(?)"	"p.(Pro1124Ser)"	""
"0001013349"	"00017634"	"50"	"797"	"0"	"797"	"0"	"c.797T>C"	"r.(?)"	"p.(Phe266Ser)"	""
"0001013350"	"00017634"	"30"	"697"	"0"	"697"	"0"	"c.697G>A"	"r.(?)"	"p.(Val233Ile)"	""
"0001024207"	"00017634"	"50"	"1831"	"0"	"1831"	"0"	"c.1831C>G"	"r.(?)"	"p.(Arg611Gly)"	""
"0001032195"	"00017634"	"30"	"4668"	"-142"	"4668"	"-142"	"c.4668-142G>A"	"r.(=)"	"p.(=)"	""
"0001032196"	"00017634"	"30"	"4054"	"0"	"4054"	"0"	"c.4054G>A"	"r.(?)"	"p.(Ala1352Thr)"	""
"0001032197"	"00017634"	"50"	"4039"	"0"	"4039"	"0"	"c.4039T>G"	"r.(?)"	"p.(Phe1347Val)"	""
"0001032198"	"00017634"	"50"	"3772"	"0"	"3772"	"0"	"c.3772G>A"	"r.(?)"	"p.(Glu1258Lys)"	""
"0001032199"	"00017634"	"50"	"3728"	"0"	"3728"	"0"	"c.3728C>T"	"r.(?)"	"p.(Pro1243Leu)"	""
"0001032200"	"00017634"	"30"	"3686"	"0"	"3686"	"0"	"c.3686G>A"	"r.(?)"	"p.(Arg1229Gln)"	""
"0001032201"	"00017634"	"30"	"3593"	"0"	"3593"	"0"	"c.3593G>A"	"r.(?)"	"p.(Arg1198Gln)"	""
"0001032202"	"00017634"	"50"	"3517"	"0"	"3517"	"0"	"c.3517G>A"	"r.(?)"	"p.(Glu1173Lys)"	""
"0001032203"	"00017634"	"50"	"3370"	"0"	"3370"	"0"	"c.3370C>T"	"r.(?)"	"p.(Pro1124Ser)"	""
"0001032204"	"00017634"	"30"	"3157"	"0"	"3157"	"0"	"c.3157C>T"	"r.(?)"	"p.(Pro1053Ser)"	""
"0001032205"	"00017634"	"50"	"2675"	"0"	"2675"	"0"	"c.2675C>T"	"r.(?)"	"p.(Ala892Val)"	""
"0001032206"	"00017634"	"30"	"2422"	"0"	"2422"	"0"	"c.2422C>A"	"r.(?)"	"p.(Pro808Thr)"	""
"0001032212"	"00017634"	"30"	"1104"	"0"	"1104"	"0"	"c.1104A>C"	"r.(?)"	"p.(=)"	""
"0001032213"	"00017634"	"30"	"831"	"-6574"	"831"	"-6574"	"c.831-6574G>C"	"r.(=)"	"p.(=)"	""
"0001032214"	"00017634"	"30"	"831"	"-7553"	"831"	"-7553"	"c.831-7553dup"	"r.(=)"	"p.(=)"	""
"0001032215"	"00017634"	"30"	"697"	"0"	"697"	"0"	"c.697G>A"	"r.(?)"	"p.(Val233Ile)"	""
"0001032220"	"00017634"	"30"	"-144"	"-41238"	"-144"	"-41238"	"c.-144-41238G>A"	"r.(=)"	"p.(=)"	""
"0001032221"	"00017634"	"30"	"-144"	"-74051"	"-144"	"-74051"	"c.-144-74051C>T"	"r.(=)"	"p.(=)"	""
"0001032222"	"00017634"	"30"	"-145"	"47227"	"-145"	"47227"	"c.-145+47227G>A"	"r.(=)"	"p.(=)"	""
"0001045700"	"00017634"	"30"	"3599"	"0"	"3599"	"0"	"c.3599G>A"	"r.(?)"	"p.(Arg1200His)"	""
"0001045701"	"00017634"	"30"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Lys390Arg)"	""
"0001049899"	"00017634"	"50"	"5075"	"0"	"5075"	"0"	"c.*374C>T"	"r.(=)"	"p.(=)"	""
"0001049900"	"00017634"	"50"	"4591"	"0"	"4591"	"0"	"c.4591G>T"	"r.(?)"	"p.(Ala1531Ser)"	""
"0001049901"	"00017634"	"50"	"4366"	"0"	"4366"	"0"	"c.4366G>A"	"r.(?)"	"p.(Val1456Ile)"	""
"0001049902"	"00017634"	"30"	"2725"	"0"	"2725"	"0"	"c.2725T>C"	"r.(?)"	"p.(Ser909Pro)"	""
"0001049903"	"00017634"	"30"	"2587"	"0"	"2587"	"0"	"c.2587C>G"	"r.(?)"	"p.(Leu863Val)"	""
"0001049904"	"00017634"	"50"	"2474"	"0"	"2474"	"0"	"c.2474C>T"	"r.(?)"	"p.(Pro825Leu)"	""
"0001049905"	"00017634"	"50"	"2464"	"0"	"2464"	"0"	"c.2464C>T"	"r.(?)"	"p.(Pro822Ser)"	""
"0001049906"	"00017634"	"50"	"518"	"0"	"518"	"0"	"c.518T>G"	"r.(?)"	"p.(Val173Gly)"	""
"0001049907"	"00017634"	"30"	"-145"	"73791"	"-145"	"73791"	"c.-145+73791G>C"	"r.(=)"	"p.(=)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 55
"{{screeningid}}"	"{{variantid}}"
"0000029052"	"0000052403"
"0000039651"	"0000067277"
"0000417493"	"0000877177"
"0000417512"	"0000877201"
"0000417513"	"0000877202"
"0000417514"	"0000877203"
"0000417515"	"0000877204"
"0000417516"	"0000877205"
"0000417517"	"0000877206"
"0000417518"	"0000877207"
"0000417519"	"0000877208"
"0000417520"	"0000877209"
"0000417538"	"0000877253"
"0000417539"	"0000877254"
"0000417540"	"0000877255"
"0000417541"	"0000877256"
"0000417542"	"0000877257"
"0000417543"	"0000877258"
"0000417544"	"0000877259"
"0000417545"	"0000877260"
"0000417546"	"0000877261"
"0000417547"	"0000877262"
"0000417548"	"0000877263"
"0000417549"	"0000877264"
"0000417550"	"0000877265"
"0000417551"	"0000877266"
"0000417552"	"0000877267"
"0000417553"	"0000877268"
"0000417554"	"0000877269"
"0000417555"	"0000877270"
"0000417556"	"0000877271"
"0000417557"	"0000877272"
"0000417558"	"0000877273"
"0000417559"	"0000877274"
"0000417560"	"0000877275"
"0000417561"	"0000877276"
"0000417562"	"0000877277"
"0000417563"	"0000877278"
"0000417564"	"0000877279"
"0000417565"	"0000877280"
"0000417566"	"0000877281"
"0000417567"	"0000877282"
"0000417568"	"0000877283"
"0000417570"	"0000877286"
"0000417571"	"0000877287"
"0000417572"	"0000877288"
"0000417573"	"0000877289"
"0000417574"	"0000877290"
"0000417575"	"0000877291"
"0000417575"	"0000877295"
"0000417576"	"0000877292"
"0000417577"	"0000877293"
"0000417578"	"0000877294"
"0000436120"	"0000922474"
"0000436120"	"0000922475"