### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = REST) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "REST" "RE1-silencing transcription factor" "4" "q12" "unknown" "NC_000004.11" "UD_132084562260" "" "https://www.LOVD.nl/REST" "" "1" "9966" "5978" "600571" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/REST_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2012-05-01 00:00:00" "00006" "2023-01-05 16:22:42" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000090" "REST" "RE1-silencing transcription factor, transcript variant 1" "001" "NM_005612.4" "" "NP_005603.3" "" "" "" "-347" "6986" "3294" "57774042" "57802010" "00002" "2012-05-11 13:12:04" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05110" "WT" "Wilms tumor" "" "" "" "" "" "00006" "2016-01-10 03:49:29" "00006" "2016-03-20 12:15:43" "05415" "USH" "Usher syndrome (USH)" "" "" "" "" "" "00006" "2018-04-02 16:40:44" "" "" "06612" "DFNA27" "?Deafness, autosomal dominant 27" "AD" "612431" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06616" "WT6" "{Wilms tumor 6, susceptibility to}" "" "616806" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06629" "GINGF5" "fibromatosis, gingival, type 5" "AD" "617626" "" "" "" "00006" "2021-12-10 23:20:41" "00006" "2023-01-05 14:47:46" "06877" "DFNA" "deafness, nonsyndromic (DFNA, autosomal dominant)" "" "" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06994" "GINGF" "fibromatosis, gingival" "" "" "" "" "" "00006" "2023-01-05 14:47:04" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{geneid}}" "{{diseaseid}}" "REST" "06612" "REST" "06616" "REST" "06629" "REST" "06877" ## Individuals ## Do not remove or alter this header ## ## Count = 33 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000029" "" "" "" "1" "" "00004" "{PMID:Almomani 2011:21102627}" "" "" "" "" "" "0" "" "" "" "" "00056439" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668}, {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2-generation family, 1 affected, unaffected carrier father" "M" "no" "(United Kingdom (Great Britain))" ">03y02m" "0" "" "" "-" "" "00057228" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 Generation family, 1 affected" "F" "no" "(United Kingdom (Great Britain))" ">00y11m" "0" "" "" "" "" "00057233" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2-generation family, 1 affected, unaffected carrier mother" "M" "no" "(United Kingdom (Great Britain))" ">03y04m" "0" "" "" "" "" "00057271" "" "" "" "1" "" "01501" "{PMID:Mahamadallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected" "M" "no" "(United Kingdom (Great Britain))" ">02y10m" "0" "" "" "" "" "00058559" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected" "M" "no" "(United Kingdom (Great Britain))" ">03y11m" "0" "" "" "" "" "00058560" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected" "M" "no" "(United Kingdom (Great Britain))" ">03y07m" "0" "" "" "" "" "00058561" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected, unaffected carrier mother" "F" "no" "(United Kingdom (Great Britain))" ">03y05m" "0" "" "" "" "" "00058562" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected" "M" "no" "(United Kingdom (Great Britain))" ">00y06m" "0" "" "" "" "" "00058563" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2 generation family, 1 affected" "F" "no" "(United Kingdom (Great Britain))" ">04y06m" "0" "" "" "" "" "00058564" "" "" "" "2" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "2-generation family, 2 affected sisters, unaffected carrier mother" "F" "no" "(United Kingdom (Great Britain))" ">03y08m" "0" "" "" "" "" "00058565" "" "" "" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "sister of FAM0482" "F" "no" "(United Kingdom (Great Britain))" ">06y00m" "0" "" "" "" "" "00058566" "" "" "" "3" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "3-generation family, 3 affected first cousins, 2 unaffected carrier females, 1 unaffected carrier male" "F" "no" "(United Kingdom (Great Britain))" ">03y00m" "0" "" "" "" "" "00058567" "" "" "00058566" "1" "" "01501" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "first cousin of FAM0481" "M" "no" "(United Kingdom (Great Britain))" ">00y06m" "" "" "" "" "" "00401174" "" "" "" "1" "" "00000" "{PMID:Fu 2020:32449591}" "" "M" "" "China" "" "0" "" "" "" "II:1" "00416320" "" "" "" "3" "" "03194" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "2-generation family, 3 affected (father/2 daughters)" "F" "no" "Finland" "" "0" "" "" "" "FamPat1" "00420046" "" "" "00416320" "1" "" "03194" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "sister" "F" "no" "Finland" "" "0" "" "" "" "FamPat2" "00420048" "" "" "00416320" "1" "" "03194" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "father" "M" "no" "Finland" "" "0" "" "" "" "FamPat3" "00428310" "" "" "" "2" "" "04147" "{PMID:Manyisa 2021:34828371}" "4-generation family, 2 affected, mother/son, (F, M), 2 unaffected (half sister and maternal grandmother)" "M" "no" "South Africa" ">12y" "0" "" "" "Africa" "FamPatIV3" "00428650" "" "" "" "3" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "2-generation family, 2 affected brothers and mildly affected father" "M" "" "Turkey" "" "0" "" "" "" "BAB4122" "00428651" "" "" "00428650" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "father" "M" "" "Turkey" "" "0" "" "" "" "BAB4124" "00428652" "" "" "00428650" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "brother" "M" "" "Turkey" "" "0" "" "" "" "BAB4125" "00428653" "" "" "" "7" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "3-generation family, 7 affected (2F, 5M)" "M" "" "Turkey" "" "0" "" "" "" "BAB4235" "00428654" "" "" "00428653" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "mother" "F" "" "Turkey" "" "0" "" "" "" "BAB4236" "00428655" "" "" "00428653" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "sister" "F" "" "Turkey" "" "0" "" "" "" "BAB4237" "00428656" "" "" "00428653" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "brother" "M" "" "Turkey" "" "0" "" "" "" "BAB4238" "00428657" "" "" "00428653" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "uncle" "M" "" "Turkey" "" "0" "" "" "" "BAB4239" "00428658" "" "" "" "1" "" "00006" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "2-generation family, 1 affected, unaffected parents" "F" "" "Turkey" "" "0" "" "" "" "Fam3Pat" "00428659" "" "" "" "1" "" "00006" "{PMID:Chen 2021:33719663}, {DOI:Chen 2021:10.1177/0022034521996620}" "3-generation family, 7 affected (3F, 4M)" "M" "no" "Taiwan" "" "0" "" "" "" "PamPatIII3" "00428660" "" "" "" "1" "" "00006" "{PMID:Chen 2021:33719663}, {DOI:Chen 2021:10.1177/0022034521996620}" "2-generation family, 1 affected, unaffected non carrier parents" "F" "no" "Taiwan" "" "0" "" "" "" "Fam2PatII2" "00428661" "" "" "" "4" "" "00006" "{PMID:Machado 2022:35665929}, {DOI:Machado 2022:10.1002/JPER.22-0219}" "3-generation family, 4 affected (2F, 2M)" "F;M" "" "Brazil" "" "0" "" "" "" "FamC" "00428665" "" "" "" "12" "" "00006" "{PMID:Peters 2008:18279434}, {PMID:Nakano 2018:29961578}" "2-generation family, 12 affected (6F, 6M)" "F;M" "no" "United States" "" "0" "" "" "" "FamLMG2" "00443407" "" "" "" "1" "" "00006" "{PMID:Redfield 2024:38459354}, {PMID:Redfield 2023:37873491}, {DOI:Redfield 2023:10.1101/2023.10.08.23296081}" "2-generation family, 1 affected, unaffected heterozygous parents" "M" "yes" "United States" "" "0" "" "" "" "Fam2" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 32 "{{individualid}}" "{{diseaseid}}" "00056439" "05110" "00057228" "05110" "00057233" "05110" "00057271" "05110" "00058559" "05110" "00058560" "05110" "00058561" "05110" "00058562" "05110" "00058563" "05110" "00058564" "05110" "00058565" "05110" "00058566" "05110" "00058567" "05110" "00401174" "05415" "00416320" "06629" "00420046" "06629" "00420048" "06629" "00428310" "06877" "00428650" "06994" "00428651" "06994" "00428652" "06994" "00428653" "06994" "00428654" "06994" "00428655" "06994" "00428656" "06994" "00428657" "06994" "00428658" "06994" "00428659" "06994" "00428660" "06994" "00428661" "06994" "00428665" "06877" "00443407" "05086" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 05086, 05110, 05415, 06612, 06616, 06629, 06877, 06994 ## Count = 31 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000043068" "05110" "00056439" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilms tumor (HP:0002667), acquired von Willebrand disease (HP:0012146); mother marsupialization Bartholin’s cyst (36y); father tubulovillous adenoma rectum, fibroma left foot (35y)" "03y02m" "" "Wilms tumor" "" "" "" "" "" "" "0000043908" "05110" "00057228" "01501" "Unknown" "" "nephroblastoma/Wilms tumor (HP:0002667)" "00y11m" "" "" "" "" "" "" "" "" "0000043914" "05110" "00057233" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilm\'s tumour(HP:0002667), café-au-lait patches, hydrocele, abnormal shape of body of mons, abnormality of the stapes(HP_0008628)" "03y04m" "" "" "" "" "" "" "" "" "0000045155" "05110" "00058559" "01501" "Unknown" "" "nephroblastoma/Wilms tumor (HP:0002667)" "03y11m" "" "" "" "" "" "" "" "" "0000045156" "05110" "00058560" "01501" "-" "" "nephroblastoma/Wilm\'s tumour(HP:0002667)" "03y07m" "" "" "" "" "" "" "" "" "0000045157" "05110" "00058561" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilms tumor (HP:0002667)" "03y05m" "" "" "" "" "" "" "" "" "0000045158" "05110" "00058562" "01501" "Unknown" "" "nephroblastoma/Wilms tumor (HP:0002667), mild global developmental delay (HP:0011342)" "00y06m" "" "" "" "" "" "" "" "" "0000045159" "05110" "00058563" "01501" "Unknown" "" "nephroblastoma/Wilm\'s tumour(HP:0002667), heart murmur(HP:0030148), patent ductus arteriosus(HP:0001643)" "04y06m" "" "" "" "" "" "" "" "" "0000045160" "05110" "00058564" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilm\'s tumour(HP:0002667), pleural effusion(HP:0002202), primary ovarian failure(HP:0001587)" "03y08m" "" "" "" "" "" "" "" "" "0000045161" "05110" "00058565" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilms tumor (HP:0002667)" "06y00m" "" "" "" "" "" "" "" "" "0000045162" "05110" "00058566" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilms tumor (HP:0002667)" "03y00m" "" "" "" "" "" "" "" "" "0000045170" "05110" "00058567" "01501" "Familial, autosomal dominant" "" "nephroblastoma/Wilms tumor (HP:0002667), reduced phenylalanine hydroxylase activity(HP:0005982)" "00y06m" "" "" "" "" "" "" "" "" "0000294217" "05415" "00401174" "00000" "Isolated (sporadic)" "5y" "pure-tone audiometry: binaural moderate to severe deafness with sloping audiograms, increased thresholds across all frequencies (left ear: 68.3 dB; right ear: 66.7 dB); air-bone gap value: > 10 dB which eqals mixed deafness (both sensorineural and conductive defects). The proband reported normal vision and declined ophthalmic examination (may still develop symptoms, so Usher syndrome is plausible)" "" "" "" "" "" "" "" "Usher syndrome type 2A" "" "0000311282" "06629" "00416320" "03194" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "Jones syndrome" "gingival fibromatosis and hearing loss" "0000311283" "06629" "00420046" "03194" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "Jones syndrome" "gingival fibromatosis and hearing loss" "0000311285" "06629" "00420048" "03194" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "Jones syndrome" "gingival fibromatosis and hearing loss" "0000319215" "06877" "00428310" "04147" "Familial, autosomal dominant" "12y" "3y-hearing impairment, progressive" "" "03y" "HP:0011474" "" "" "" "" "DFNA27" "non-syndromic autosomal dominant hearing impairment" "0000319555" "06994" "00428650" "00006" "Familial, autosomal dominant" "17y" "see paper; ..., gingival fibromatosis; gingivectomy; pectus deformity; osteomyelitis, osteoporosis" "07y-08y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319556" "06994" "00428651" "00006" "Familial, autosomal dominant" "48y" "see paper; ..., mild gingival fibromatosis; no pectus deformity" "" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319557" "06994" "00428652" "00006" "Familial, autosomal dominant" "13y" "see paper; ..., gingival fibromatosis; gingivectomy; pectus deformity; osteomyelitis, osteoporosis" "07y-08y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319558" "06994" "00428653" "00006" "Familial, autosomal dominant" "9y" "see paper; ..., gingival fibromatosis; no pectus deformity" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319559" "06994" "00428654" "00006" "Familial, autosomal dominant" "38y" "see paper; ..., gingival fibromatosis; no pectus deformity" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319560" "06994" "00428655" "00006" "Familial, autosomal dominant" "14y" "see paper; ..., gingival fibromatosis; no pectus deformity" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319561" "06994" "00428656" "00006" "Familial, autosomal dominant" "16y" "see paper; ..., gingival fibromatosis; no pectus deformity" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319562" "06994" "00428657" "00006" "Familial, autosomal dominant" "32y" "see paper; ..., gingival fibromatosis; no pectus deformity" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319563" "06994" "00428658" "00006" "Isolated (sporadic)" "9y" "see paper; ..., gingival fibromatosis; gingivectomy/recurrence; pectus deformity; small hiatal hernia, short stature, recurrent upper respiratory infections" "03y-04y" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319564" "06994" "00428659" "00006" "Familial, autosomal dominant" "46y" "gingival overgrowth; no hearing loss" "" "" "" "" "" "" "" "GINGF5" "fibromatosis, gingival" "0000319565" "06994" "00428660" "00006" "Isolated (sporadic)" "15y" "see paper; ..., gingival overgrowth, gingiva thick, covered parts dental crowns, particularly over posterior teeth, surface gingiva smooth, palatal and facial gingivae upper dental arch prominent but with minimal inflammation; mucosae outside of tooth-bearing area, incl. cheek, tongue, lip, floor of mouth appeared normal with no signs of overgrowth; teeth generally spaced apart and misaligned;no dental caries; panoramic radiograph no apparent bony pathology upper/lower jaws; no hearing loss" "" "" "" "" "" "" "" "GINGF5" "fibromatosis, gingival" "0000319566" "06994" "00428661" "00006" "Familial, autosomal dominant" "" "see paper; ..., gingival fibromatosis, no hearing loss" "" "" "" "" "" "" "" "GINGF5" "gingival fibromatosis" "0000319570" "06877" "00428665" "00006" "Familial, autosomal dominant" "" "see paper; ..., progressive, non-syndromic, sensorineural hearing loss" "" "" "" "" "" "" "" "DFNA27" "sensorineural hearing loss" "0000332748" "05086" "00443407" "00006" "Familial, autosomal recessive" "<10y" "see paper; ..., moderate to severe congenital bilateral sensorineural hearing loss" "" "" "" "" "" "" "" "DFNB124" "hearing loss" ## Screenings ## Do not remove or alter this header ## ## Count = 33 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000029" "00000029" "1" "00004" "" "2012-05-11 13:18:42" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000056399" "00056439" "1" "01501" "01501" "2016-01-08 08:22:16" "" "" "SEQ" "DNA" "" "" "0000057190" "00057228" "1" "01501" "01501" "2016-01-19 09:32:00" "" "" "SEQ" "DNA" "" "" "0000057195" "00057233" "1" "01501" "01501" "2016-01-20 10:45:23" "" "" "SEQ" "DNA" "" "" "0000057232" "00057271" "1" "01501" "01501" "2016-01-22 06:03:57" "" "" "SEQ" "DNA" "" "" "0000058524" "00058559" "1" "01501" "01501" "2016-02-01 01:25:42" "" "" "SEQ" "DNA" "" "" "0000058525" "00058560" "1" "01501" "01501" "2016-02-01 01:38:46" "" "" "SEQ" "DNA" "" "" "0000058526" "00058561" "1" "01501" "01501" "2016-02-01 01:54:26" "" "" "SEQ" "DNA" "" "" "0000058527" "00058562" "1" "01501" "01501" "2016-02-01 02:04:58" "" "" "SEQ" "DNA" "" "" "0000058528" "00058563" "1" "01501" "01501" "2016-02-01 02:13:08" "" "" "SEQ" "DNA" "" "" "0000058529" "00058564" "1" "01501" "01501" "2016-02-01 07:38:22" "" "" "SEQ" "DNA" "" "" "0000058530" "00058565" "1" "01501" "01501" "2016-02-01 07:50:45" "" "" "SEQ" "DNA" "" "" "0000058531" "00058566" "1" "01501" "01501" "2016-02-01 09:13:49" "" "" "SEQ" "DNA" "" "" "0000058539" "00058567" "1" "01501" "01501" "2016-02-01 11:14:54" "" "" "SEQ" "DNA" "" "" "0000402418" "00401174" "1" "00000" "03840" "2022-01-28 14:07:59" "" "" "SEQ-NG-I;arraySNP;STR;SEQ" "DNA" "blood" "whole exome sequencing" "0000417600" "00416320" "1" "03194" "03194" "2022-08-27 02:33:17" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000421354" "00420046" "1" "03194" "03194" "2022-10-30 17:09:36" "" "" "SEQ-NG" "DNA" "" "" "0000421356" "00420048" "1" "03194" "03194" "2022-10-30 17:13:51" "" "" "SEQ-NG" "DNA" "" "" "0000429721" "00428310" "1" "04147" "04147" "2022-12-30 15:29:43" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "" "0000430062" "00428650" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430063" "00428651" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430064" "00428652" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430065" "00428653" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430066" "00428654" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430067" "00428655" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430068" "00428656" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430069" "00428657" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430070" "00428658" "1" "00006" "00006" "2023-01-05 15:17:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430071" "00428659" "1" "00006" "00006" "2023-01-05 15:24:56" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430072" "00428660" "1" "00006" "00006" "2023-01-05 15:32:57" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430073" "00428661" "1" "00006" "00006" "2023-01-05 15:39:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000430077" "00428665" "1" "00006" "00006" "2023-01-05 16:11:30" "00006" "2023-01-05 16:34:14" "arraySNP;RT-PCR;SEQ" "DNA;RNA" "" "" "0000444896" "00443407" "1" "00006" "00006" "2023-11-26 09:32:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 47 "{{screeningid}}" "{{geneid}}" "0000000029" "ALG9" "0000000029" "ASPM" "0000000029" "B3GLCT" "0000000029" "BBS1" "0000000029" "CBS" "0000000029" "CC2D1A" "0000000029" "CDK5RAP2" "0000000029" "DLG3" "0000000029" "DNMT3B" "0000000029" "DPM1" "0000000029" "DPP3" "0000000029" "GLI3" "0000000029" "JAG1" "0000000029" "KRAS" "0000000029" "MECP2" "0000000029" "MPDU1" "0000000029" "NLGN4X" "0000000029" "NSD1" "0000000029" "PHF8" "0000000029" "PMM2" "0000000029" "RAI1" "0000000029" "REST" "0000000029" "SATB2" "0000000029" "SCN8A" "0000000029" "SHANK3" "0000000029" "SLC35C1" "0000000029" "TCF4" "0000000029" "TSC1" "0000000029" "UPF3B" "0000000029" "ZEB2" "0000000029" "ZNF41" "0000056399" "REST" "0000057190" "REST" "0000057195" "REST" "0000057232" "REST" "0000058524" "REST" "0000058525" "REST" "0000058526" "REST" "0000058527" "REST" "0000058528" "REST" "0000058529" "REST" "0000058530" "REST" "0000058531" "REST" "0000058539" "REST" "0000402418" "USH2A" "0000429721" "REST" "0000430077" "REST" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 65 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000001010" "1" "50" "4" "57797414" "57797414" "subst" "0.223272" "00002" "REST_000001" "g.57797414C>T" "" "{PMID:Almomani 2011:21102627}" "" "" "" "Germline" "" "rs3796529" "0" "" "" "g.56931248C>T" "" "VUS" "" "0000086641" "11" "90" "4" "57777635" "57777636" "del" "0" "01501" "REST_000002" "g.57777635_57777636del" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668}, {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "831_832delAT" "" "Germline" "" "" "0" "" "" "g.56911469_56911470del" "" "pathogenic" "" "0000087482" "0" "90" "4" "57777283" "57777283" "subst" "0" "01501" "REST_000003" "g.57777283G>C" "" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "DNA from parents unavailable" "Unknown" "" "" "0" "" "" "g.56911117G>C" "" "pathogenic" "" "0000087485" "21" "90" "4" "57777540" "57777540" "subst" "8.1217E-6" "01501" "REST_000004" "g.57777540C>T" "" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Germline" "" "" "0" "" "" "g.56911374C>T" "" "pathogenic" "" "0000087526" "0" "90" "4" "57785951" "57785951" "subst" "0" "01501" "REST_000005" "g.57785951A>G" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Unknown" "" "" "0" "" "" "g.56919785A>G" "" "pathogenic" "" "0000089110" "0" "90" "4" "57777449" "57777449" "del" "0" "01501" "REST_000006" "g.57777449del" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "642delC" "paternal DNA unavailable" "Unknown" "" "" "0" "" "" "g.56911283del" "" "pathogenic" "" "0000089111" "0" "90" "4" "57786031" "57786031" "dup" "0" "01501" "REST_000009" "g.57786031dup" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "De novo" "" "" "0" "" "" "g.56919865dup" "" "pathogenic" "" "0000089112" "21" "90" "4" "57797794" "57797794" "subst" "0" "01501" "REST_000007" "g.57797794C>T" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Germline" "" "" "0" "" "" "g.56931628C>T" "" "pathogenic" "" "0000089113" "0" "90" "4" "57786019" "57786019" "subst" "0" "01501" "REST_000010" "g.57786019A>G" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668}, {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Unknown" "" "" "0" "" "" "g.56919853A>G" "" "pathogenic" "" "0000089114" "0" "90" "4" "57796260" "57796260" "subst" "0" "01501" "REST_000008" "g.57796260T>A" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "paternal DNA unavailable" "Unknown" "" "" "0" "" "" "g.56930094T>A" "" "pathogenic" "" "0000089115" "21" "90" "4" "57777635" "57777636" "del" "0" "01501" "REST_000002" "g.57777635_57777636del" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "831_832delAT" "" "Germline" "" "" "0" "" "" "g.56911469_56911470del" "" "pathogenic" "" "0000089116" "21" "90" "4" "57777635" "57777636" "del" "0" "01501" "REST_000002" "g.57777635_57777636del" "1/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Germline" "" "" "0" "" "" "g.56911469_56911470del" "" "pathogenic" "" "0000089117" "11" "90" "4" "57786019" "57786019" "subst" "0" "01501" "REST_000010" "g.57786019A>G" "3/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015: 10.1038/ng.3440}" "" "" "" "Germline" "" "" "0" "" "" "g.56919853A>G" "" "pathogenic" "" "0000089125" "21" "90" "4" "57786019" "57786019" "subst" "0" "01501" "REST_000010" "g.57786019A>G" "3/519 WT cases" "{PMID:Mahamdallie 2015:26551668} {DOI:Mahamdallie 2015:10.1038/ng.3440}" "" "" "" "Germline" "" "" "" "" "" "g.56919853A>G" "" "pathogenic" "" "0000307031" "0" "30" "4" "57797230" "57797230" "subst" "0.00369683" "01943" "REST_000012" "g.57797230C>T" "" "" "" "REST(NM_005612.4):c.2206C>T (p.P736S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56931064C>T" "" "likely benign" "" "0000307032" "0" "10" "4" "57797253" "57797300" "del" "0" "01943" "REST_000011" "g.57797253_57797300del" "" "" "" "REST(NM_005612.4):c.2229_2276del (p.Q746_V761del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56931087_56931134del" "" "benign" "" "0000522755" "0" "30" "4" "57777078" "57777078" "subst" "0.00218477" "01943" "REST_000014" "g.57777078G>A" "" "" "" "REST(NM_005612.4):c.274G>A (p.G92R), REST(NM_005612.5):c.274G>A (p.G92R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56910912G>A" "" "likely benign" "" "0000522756" "0" "50" "4" "57777171" "57777171" "subst" "0.00179101" "01943" "REST_000015" "g.57777171C>G" "" "" "" "REST(NM_005612.4):c.367C>G (p.P123A), REST(NM_005612.5):c.367C>G (p.P123A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56911005C>G" "" "VUS" "" "0000522757" "0" "50" "4" "57796175" "57796175" "subst" "0" "01943" "REST_000016" "g.57796175T>G" "" "" "" "REST(NM_005612.4):c.1151T>G (p.V384G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56930009T>G" "" "VUS" "" "0000522758" "0" "30" "4" "57796639" "57796639" "subst" "0.00826365" "01804" "REST_000017" "g.57796639T>C" "" "" "" "REST(NM_001193508.1):c.1615T>C (p.(Ser539Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56930473T>C" "" "likely benign" "" "0000522759" "0" "50" "4" "57797017" "57797017" "subst" "0" "01804" "REST_000018" "g.57797017G>A" "" "" "" "REST(NM_001193508.1):c.1993G>A (p.(Glu665Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56930851G>A" "" "VUS" "" "0000522760" "0" "30" "4" "57797037" "57797037" "subst" "0.00198616" "01943" "REST_000019" "g.57797037G>T" "" "" "" "REST(NM_005612.4):c.2013G>T (p.E671D), REST(NM_005612.5):c.2013G>T (p.E671D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56930871G>T" "" "likely benign" "" "0000621405" "0" "50" "4" "57777226" "57777226" "subst" "0.00019499" "01943" "REST_000022" "g.57777226C>G" "" "" "" "REST(NM_001363453.1):c.422C>G (p.P141R), REST(NM_005612.4):c.422C>G (p.P141R), REST(NM_005612.5):c.422C>G (p.P141R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56911060C>G" "" "VUS" "" "0000689317" "0" "50" "4" "57798031" "57798031" "subst" "4.06517E-6" "01943" "REST_000023" "g.57798031C>A" "" "" "" "REST(NM_005612.4):c.3007C>A (p.Q1003K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000719941" "0" "50" "4" "57786022" "57786022" "subst" "0" "02327" "REST_000024" "g.57786022T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000719942" "0" "50" "4" "57797533" "57797533" "subst" "0" "01943" "REST_000025" "g.57797533C>G" "" "" "" "REST(NM_001363453.1):c.2509C>G (p.L837V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000836562" "21" "90" "1" "216595579" "216595580" "ins" "0" "00000" "USH2A_000889" "g.216595579_216595580insA" "" "{PMID:Fu 2020:32449591}" "" "USH2A c.99_100insT (p.Arg34Serfs*41)" "apparent homozygosity - uniparental (maternal) isodisomy" "Germline" "yes" "" "0" "" "" "g.216422237_216422238insA" "" "pathogenic" "" "0000850641" "0" "30" "4" "57796884" "57796884" "subst" "6.92521E-5" "01943" "REST_000027" "g.57796884G>T" "" "" "" "REST(NM_001363453.1):c.1860G>T (p.A620=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000850642" "0" "10" "4" "57797580" "57797580" "subst" "0.00176338" "02329" "REST_000028" "g.57797580G>A" "" "" "" "REST(NM_005612.5):c.2556G>A (p.K852=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000859463" "0" "30" "4" "57777078" "57777078" "subst" "0.00218477" "02329" "REST_000014" "g.57777078G>A" "" "" "" "REST(NM_005612.4):c.274G>A (p.G92R), REST(NM_005612.5):c.274G>A (p.G92R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000859464" "0" "30" "4" "57796119" "57796119" "subst" "0.000377705" "01943" "REST_000026" "g.57796119C>T" "" "" "" "REST(NM_005612.4):c.1095C>T (p.H365=), REST(NM_005612.5):c.1095C>T (p.H365=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000859465" "0" "90" "4" "57797669" "57797669" "subst" "0" "01943" "REST_000029" "g.57797669T>G" "" "" "" "REST(NM_001363453.1):c.2645T>G (p.L882*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000877319" "11" "70" "4" "57797694" "57797697" "del" "0" "03194" "REST_000030" "g.57797694_57797697del" "" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56931528_56931531del" "" "pathogenic (dominant)" "ACMG" "0000882121" "11" "70" "4" "57797694" "57797697" "del" "0" "03194" "REST_000030" "g.57797694_57797697del" "" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56931528_56931531del" "" "pathogenic (dominant)" "ACMG" "0000882124" "0" "90" "4" "57797694" "57797697" "del" "0" "03194" "REST_000030" "g.57797694_57797697del" "" "{PMID:Rahikkala 2022:36509837}, {DOI:Rahikkala 2022:10.1038/s41431-022-01258-9}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.56931528_56931531del" "" "pathogenic (dominant)" "ACMG" "0000886314" "0" "10" "4" "57777038" "57777038" "subst" "0.0132068" "02329" "REST_000031" "g.57777038G>T" "" "" "" "REST(NM_005612.5):c.234G>T (p.P78=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000886315" "0" "30" "4" "57777226" "57777226" "subst" "0.00019499" "02326" "REST_000022" "g.57777226C>G" "" "" "" "REST(NM_001363453.1):c.422C>G (p.P141R), REST(NM_005612.4):c.422C>G (p.P141R), REST(NM_005612.5):c.422C>G (p.P141R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000909332" "21" "90" "4" "57796268" "57796268" "subst" "0" "04147" "REST_000032" "g.57796268G>C" "" "{PMID:Manyisa 2021:34828371}" "" "" "variant not found in 206 control chromosomes" "Germline" "yes" "" "0" "" "" "g.56930102G>C" "" "pathogenic (dominant)" "ACMG" "0000909790" "11" "90" "4" "57797889" "57797890" "del" "0" "00006" "REST_000039" "g.57797889_57797890del" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "2865_2866delAA" "" "Germline" "" "" "0" "" "" "g.56931723_56931724del" "" "pathogenic (dominant)" "" "0000909791" "0" "90" "4" "57797889" "57797890" "del" "0" "00006" "REST_000039" "g.57797889_57797890del" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "2865_2866delAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56931723_56931724del" "" "pathogenic (dominant)" "" "0000909792" "11" "90" "4" "57797889" "57797890" "del" "0" "00006" "REST_000039" "g.57797889_57797890del" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "2865_2866delAA" "" "Germline" "" "" "0" "" "" "g.56931723_56931724del" "" "pathogenic (dominant)" "" "0000909793" "21" "90" "4" "57796334" "57796334" "subst" "0" "00006" "REST_000037" "g.57796334T>A" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.56930168T>A" "" "pathogenic (dominant)" "" "0000909794" "11" "90" "4" "57796334" "57796334" "subst" "0" "00006" "REST_000037" "g.57796334T>A" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.56930168T>A" "" "pathogenic (dominant)" "" "0000909795" "21" "90" "4" "57796334" "57796334" "subst" "0" "00006" "REST_000037" "g.57796334T>A" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.56930168T>A" "" "pathogenic (dominant)" "" "0000909796" "21" "90" "4" "57796334" "57796334" "subst" "0" "00006" "REST_000037" "g.57796334T>A" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.56930168T>A" "" "pathogenic (dominant)" "" "0000909797" "11" "90" "4" "57796334" "57796334" "subst" "0" "00006" "REST_000037" "g.57796334T>A" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "" "" "Germline" "" "" "0" "" "" "g.56930168T>A" "" "pathogenic (dominant)" "" "0000909798" "0" "90" "4" "57797437" "57797437" "del" "0" "00006" "REST_000038" "g.57797437del" "" "{PMID:Bayram 2017:28686854}, {DOI:Bayram 2017:10.1016/j.ajhg.2017.06.006}" "" "2413delC" "" "De novo" "" "" "0" "" "" "g.56931271del" "" "pathogenic (dominant)" "" "0000909799" "11" "90" "4" "57797473" "57797473" "subst" "0" "00006" "REST_000033" "g.57797473C>T" "" "{PMID:Chen 2021:33719663}, {DOI:Chen 2021:10.1177/0022034521996620}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000909800" "0" "90" "4" "57797795" "57797817" "dup" "0" "00006" "REST_000034" "g.57797795_57797817dup" "" "{PMID:Chen 2021:33719663}, {DOI:Chen 2021:10.1177/0022034521996620}" "" "dupAAAACTTGAATACGCCAGAGGGT" "" "De novo" "" "" "0" "" "" "g.56931629_56931651dup" "" "pathogenic (dominant)" "" "0000909801" "1" "90" "4" "57796517" "57796518" "del" "0" "00006" "REST_000035" "g.57796517_57796518del" "" "{PMID:Machado 2022:35665929}, {DOI:Machado 2022:10.1002/JPER.22-0219}" "" "1491_1492delAG" "" "Germline" "yes" "" "0" "" "" "g.56930351_56930352del" "" "pathogenic (dominant)" "" "0000909805" "1" "90" "4" "57793760" "57793760" "subst" "0" "00006" "REST_000036" "g.57793760C>G" "" "{PMID:Nakano 2018:29961578}" "" "" "mapping LOD score 4.67" "Germline" "yes" "" "0" "" "" "g.56927594C>G" "" "pathogenic (dominant)" "" "0000912122" "0" "50" "4" "57777681" "57777681" "subst" "0" "02327" "REST_000040" "g.57777681C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924125" "0" "30" "4" "57796119" "57796119" "subst" "0.000377705" "02326" "REST_000026" "g.57796119C>T" "" "" "" "REST(NM_005612.4):c.1095C>T (p.H365=), REST(NM_005612.5):c.1095C>T (p.H365=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924126" "0" "30" "4" "57798144" "57798144" "subst" "0.0128131" "02329" "REST_000041" "g.57798144A>G" "" "" "" "REST(NM_005612.5):c.3120A>G (p.Q1040=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928918" "0" "10" "4" "57797037" "57797037" "subst" "0.00198616" "02329" "REST_000019" "g.57797037G>T" "" "" "" "REST(NM_005612.4):c.2013G>T (p.E671D), REST(NM_005612.5):c.2013G>T (p.E671D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000928919" "0" "10" "4" "57797467" "57797467" "subst" "0.0141863" "02329" "REST_000042" "g.57797467C>T" "" "" "" "REST(NM_005612.5):c.2443C>T (p.P815S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000946829" "21" "70" "4" "57797374" "57797374" "subst" "0" "00006" "REST_000043" "g.57797374C>T" "" "{PMID:Redfield 2023:37873491}, {DOI:Redfield 2023:10.1101/2023.10.08.23296081}" "" "" "" "Germline" "no" "" "0" "" "" "g.56931208C>T" "" "VUS" "" "0000963199" "0" "30" "4" "57777171" "57777171" "subst" "0.00179101" "02326" "REST_000015" "g.57777171C>G" "" "" "" "REST(NM_005612.4):c.367C>G (p.P123A), REST(NM_005612.5):c.367C>G (p.P123A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963200" "0" "30" "4" "57797350" "57797350" "subst" "0.0112309" "02329" "REST_000044" "g.57797350C>G" "" "" "" "REST(NM_005612.5):c.2326C>G (p.P776A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976326" "0" "50" "4" "57797265" "57797265" "subst" "0" "01804" "REST_000045" "g.57797265A>G" "" "" "" "REST(NM_005612.5):c.2241A>G (p.(Ile747Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013974" "0" "50" "4" "57797834" "57797834" "subst" "0" "02329" "REST_000046" "g.57797834A>G" "" "" "" "REST(NM_005612.5):c.2810A>G (p.K937R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001024932" "0" "30" "4" "57796476" "57796476" "subst" "4.48007E-5" "02329" "REST_000047" "g.57796476A>G" "" "" "" "REST(NM_005612.5):c.1452A>G (p.S484=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001034617" "0" "30" "4" "57776990" "57776992" "del" "0" "01804" "REST_000048" "g.57776990_57776992del" "" "" "" "REST(NM_005612.5):c.186_188del (p.(Cys63del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001034618" "0" "50" "4" "57797614" "57797622" "del" "0" "01804" "REST_000049" "g.57797614_57797622del" "" "" "" "REST(NM_005612.5):c.2590_2598del (p.(Ser864_Pro866del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064193" "0" "50" "4" "57785991" "57785991" "subst" "0" "01804" "REST_000050" "g.57785991A>G" "" "" "" "REST(NM_005612.5):c.937A>G (p.(Ser313Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes REST ## Count = 65 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000001010" "00000090" "50" "2390" "0" "2390" "0" "c.2390C>T" "r.(?)" "p.(Pro797Leu)" "4" "0000086641" "00000090" "90" "831" "0" "832" "0" "c.831_832del" "r.(?)" "p.(Cys278Trpfs*18)" "2" "0000087482" "00000090" "90" "479" "0" "479" "0" "c.479G>C" "r.(?)" "p.(Arg160Pro)" "2" "0000087485" "00000090" "90" "736" "0" "736" "0" "c.736C>T" "r.(?)" "p.(Arg246*)" "2" "0000087526" "00000090" "90" "899" "-2" "899" "-2" "c.899-2A>G" "r.spl" "p.?" "2i" "0000089110" "00000090" "90" "645" "0" "645" "0" "c.645del" "r.(?)" "p.(Ile216Phefs*20)" "2" "0000089111" "00000090" "90" "977" "0" "977" "0" "c.977dup" "r.(?)" "p.(His326Glnfs*4)" "3" "0000089112" "00000090" "90" "2770" "0" "2770" "0" "c.2770C>T" "r.(?)" "p.(Gln924*)" "4" "0000089113" "00000090" "90" "965" "0" "965" "0" "c.965A>G" "r.(?)" "p.(His322Arg)" "3" "0000089114" "00000090" "90" "1236" "0" "1236" "0" "c.1236T>A" "r.(?)" "p.(His412Gln)" "4" "0000089115" "00000090" "90" "831" "0" "832" "0" "c.831_832del" "r.(?)" "p.(Cys278Trpfs*18)" "2" "0000089116" "00000090" "90" "831" "0" "832" "0" "c.831_832del" "r.(?)" "p.(Cys278Trpfs*18)" "2" "0000089117" "00000090" "90" "965" "0" "965" "0" "c.965A>G" "r.(?)" "p.(His322Arg)" "3" "0000089125" "00000090" "90" "965" "0" "965" "0" "c.965A>G" "r.(?)" "p.(His322Arg)" "3" "0000307031" "00000090" "30" "2206" "0" "2206" "0" "c.2206C>T" "r.(?)" "p.(Pro736Ser)" "" "0000307032" "00000090" "10" "2229" "0" "2276" "0" "c.2229_2276del" "r.(?)" "p.(Gln746_Val761del)" "" "0000522755" "00000090" "30" "274" "0" "274" "0" "c.274G>A" "r.(?)" "p.(Gly92Arg)" "" "0000522756" "00000090" "50" "367" "0" "367" "0" "c.367C>G" "r.(?)" "p.(Pro123Ala)" "" "0000522757" "00000090" "50" "1151" "0" "1151" "0" "c.1151T>G" "r.(?)" "p.(Val384Gly)" "" "0000522758" "00000090" "30" "1615" "0" "1615" "0" "c.1615T>C" "r.(?)" "p.(Ser539Pro)" "" "0000522759" "00000090" "50" "1993" "0" "1993" "0" "c.1993G>A" "r.(?)" "p.(Glu665Lys)" "" "0000522760" "00000090" "30" "2013" "0" "2013" "0" "c.2013G>T" "r.(?)" "p.(Glu671Asp)" "" "0000621405" "00000090" "50" "422" "0" "422" "0" "c.422C>G" "r.(?)" "p.(Pro141Arg)" "" "0000689317" "00000090" "50" "3007" "0" "3007" "0" "c.3007C>A" "r.(?)" "p.(Gln1003Lys)" "" "0000719941" "00000090" "50" "968" "0" "968" "0" "c.968T>G" "r.(?)" "p.(Met323Arg)" "" "0000719942" "00000090" "50" "2509" "0" "2509" "0" "c.2509C>G" "r.(?)" "p.(Leu837Val)" "" "0000836562" "00000090" "70" "99" "0" "100" "0" "c.99_100insT" "r.(?)" "p.(Arg34Serfs*41)" "1" "0000850641" "00000090" "30" "1860" "0" "1860" "0" "c.1860G>T" "r.(?)" "p.(Ala620=)" "" "0000850642" "00000090" "10" "2556" "0" "2556" "0" "c.2556G>A" "r.(?)" "p.(Lys852=)" "" "0000859463" "00000090" "30" "274" "0" "274" "0" "c.274G>A" "r.(?)" "p.(Gly92Arg)" "" "0000859464" "00000090" "30" "1095" "0" "1095" "0" "c.1095C>T" "r.(?)" "p.(His365=)" "" "0000859465" "00000090" "90" "2645" "0" "2645" "0" "c.2645T>G" "r.(?)" "p.(Leu882*)" "" "0000877319" "00000090" "70" "2670" "0" "2673" "0" "c.2670_2673del" "r.(?)" "p.(Glu891Profs*6)" "" "0000882121" "00000090" "70" "2670" "0" "2673" "0" "c.2670_2673del" "r.(?)" "p.(Glu891Profs*6)" "" "0000882124" "00000090" "90" "2670" "0" "2673" "0" "c.2670_2673del" "r.(?)" "p.(Glu891Profs*6)" "" "0000886314" "00000090" "10" "234" "0" "234" "0" "c.234G>T" "r.(?)" "p.(Pro78=)" "" "0000886315" "00000090" "30" "422" "0" "422" "0" "c.422C>G" "r.(?)" "p.(Pro141Arg)" "" "0000909332" "00000090" "90" "1244" "0" "1244" "0" "c.1244G>C" "r.(?)" "p.(Cys415Ser)" "" "0000909790" "00000090" "90" "2865" "0" "2866" "0" "c.2865_2866del" "r.(?)" "p.(Asn958SerfsTer9)" "" "0000909791" "00000090" "90" "2865" "0" "2866" "0" "c.2865_2866del" "r.(?)" "p.(Asn958SerfsTer9)" "" "0000909792" "00000090" "90" "2865" "0" "2866" "0" "c.2865_2866del" "r.(?)" "p.(Asn958SerfsTer9)" "" "0000909793" "00000090" "90" "1310" "0" "1310" "0" "c.1310T>A" "r.(?)" "p.(Leu437Ter)" "" "0000909794" "00000090" "90" "1310" "0" "1310" "0" "c.1310T>A" "r.(?)" "p.(Leu437Ter)" "" "0000909795" "00000090" "90" "1310" "0" "1310" "0" "c.1310T>A" "r.(?)" "p.(Leu437Ter)" "" "0000909796" "00000090" "90" "1310" "0" "1310" "0" "c.1310T>A" "r.(?)" "p.(Leu437Ter)" "" "0000909797" "00000090" "90" "1310" "0" "1310" "0" "c.1310T>A" "r.(?)" "p.(Leu437Ter)" "" "0000909798" "00000090" "90" "2413" "0" "2413" "0" "c.2413del" "r.(?)" "p.(Leu805PhefsTer38)" "" "0000909799" "00000090" "90" "2449" "0" "2449" "0" "c.2449C>T" "r.(?)" "p.(Arg817*)" "" "0000909800" "00000090" "90" "2771" "0" "2793" "0" "c.2771_2793dup" "r.(?)" "p.(Glu932Lysfs*3)" "" "0000909801" "00000090" "90" "1493" "0" "1494" "0" "c.1493_1494del" "r.(?)" "p.(Glu498Glyfs*17)" "" "0000909805" "00000090" "90" "983" "-2247" "983" "-2247" "c.983-2247C>G" "r.982_983ins983-2246_983-2177" "p.?" "" "0000912122" "00000090" "50" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Gln293*)" "" "0000924125" "00000090" "30" "1095" "0" "1095" "0" "c.1095C>T" "r.(?)" "p.(His365=)" "" "0000924126" "00000090" "30" "3120" "0" "3120" "0" "c.3120A>G" "r.(?)" "p.(Gln1040=)" "" "0000928918" "00000090" "10" "2013" "0" "2013" "0" "c.2013G>T" "r.(?)" "p.(Glu671Asp)" "" "0000928919" "00000090" "10" "2443" "0" "2443" "0" "c.2443C>T" "r.(?)" "p.(Pro815Ser)" "" "0000946829" "00000090" "70" "2350" "0" "2350" "0" "c.2350C>T" "r.(?)" "p.(Pro784Ser)" "" "0000963199" "00000090" "30" "367" "0" "367" "0" "c.367C>G" "r.(?)" "p.(Pro123Ala)" "" "0000963200" "00000090" "30" "2326" "0" "2326" "0" "c.2326C>G" "r.(?)" "p.(Pro776Ala)" "" "0000976326" "00000090" "50" "2241" "0" "2241" "0" "c.2241A>G" "r.(?)" "p.(Ile747Met)" "" "0001013974" "00000090" "50" "2810" "0" "2810" "0" "c.2810A>G" "r.(?)" "p.(Lys937Arg)" "" "0001024932" "00000090" "30" "1452" "0" "1452" "0" "c.1452A>G" "r.(?)" "p.(=)" "" "0001034617" "00000090" "30" "186" "0" "188" "0" "c.186_188del" "r.(?)" "p.(Cys63del)" "" "0001034618" "00000090" "50" "2590" "0" "2598" "0" "c.2590_2598del" "r.(?)" "p.(Ser864_Pro866del)" "" "0001064193" "00000090" "50" "937" "0" "937" "0" "c.937A>G" "r.(?)" "p.(Ser313Gly)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 33 "{{screeningid}}" "{{variantid}}" "0000000029" "0000001010" "0000056399" "0000086641" "0000057190" "0000087482" "0000057195" "0000087485" "0000057232" "0000087526" "0000058524" "0000089110" "0000058525" "0000089111" "0000058526" "0000089112" "0000058527" "0000089113" "0000058528" "0000089114" "0000058529" "0000089115" "0000058530" "0000089116" "0000058531" "0000089117" "0000058539" "0000089125" "0000402418" "0000836562" "0000417600" "0000877319" "0000421354" "0000882121" "0000421356" "0000882124" "0000429721" "0000909332" "0000430062" "0000909790" "0000430063" "0000909791" "0000430064" "0000909792" "0000430065" "0000909793" "0000430066" "0000909794" "0000430067" "0000909795" "0000430068" "0000909796" "0000430069" "0000909797" "0000430070" "0000909798" "0000430071" "0000909799" "0000430072" "0000909800" "0000430073" "0000909801" "0000430077" "0000909805" "0000444896" "0000946829"