### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = RGR) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "RGR" "retinal G protein coupled receptor" "10" "q23" "unknown" "NG_009106.1" "UD_132118561440" "" "https://www.LOVD.nl/RGR" "" "1" "9990" "5995" "600342" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/RGR_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-02-13 00:00:00" "00006" "2020-11-26 19:09:28" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00017698" "RGR" "transcript variant 1" "001" "NM_002921.3" "" "NP_002912.2" "" "" "" "-38" "1437" "888" "86004809" "86018944" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "03427" "RP44" "retinitis pigmentosa, type 44 (RP44)" "" "613769" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-09 15:05:56" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "RGR" "03427" ## Individuals ## Do not remove or alter this header ## ## Count = 79 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001802" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00033095" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033127" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" "" "00233178" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233179" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233180" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233181" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233182" "" "" "" "208" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233771" "" "" "" "9" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00308540" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308541" "" "" "" "7" "" "00004" "{PMID:Holtan 2020:31429209}" "7 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308542" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00318042" "" "" "" "2" "" "00006" "{PMID:Riazuddin 2017:27457812}" "family, 2 affected" "" "yes" "Pakistan" "" "0" "" "" "Punjabi" "PKMR396" "00326696" "" "" "" "1" "" "00008" "{PMID:Mandal 2005:16123440}" "" "" "" "" "" "0" "" "" "" "" "00328042" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001408" "00333385" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD2–01" "00358979" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71808" "00363350" "" "" "" "1" "" "00000" "{PMID:Sun 2015:26747767}" "proband" "" "" "China" "" "0" "" "" "" "HM723" "00372717" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP267" "00372748" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP369" "00375435" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#030" "00376514" "" "" "" "1" "" "00000" "{PMID:Singh 2009:19339744}" "" "" "yes" "" "" "0" "" "" "Indian" "" "00376515" "" "" "" "1" "" "00000" "{PMID:Singh 2009:19339744}" "" "" "yes" "" "" "0" "" "" "Indian" "" "00376783" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "49" "00376796" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "63" "00379392" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00380186" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP174, II:1" "?" "no" "Spain" "" "0" "" "" "" "II:1" "00381694" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00382857" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382858" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382859" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382860" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382861" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382862" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382863" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382864" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00382865" "" "" "" "1" "" "00000" "{PMID:Ksantini-2010:21067480}" "" "" "" "France" "" "0" "" "" "" "" "00384776" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00385041" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19664" "00386205" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-325" "00388500" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "13013491" "00389428" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 266, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "712" "00389429" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 266, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "713" "00390362" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001408" "00390756" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" "" "00390776" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" "" "00390822" "" "" "" "1" "" "00000" "{PMID:Arno-2016:27623334}" "" "M" "no" "" "" "0" "" "" "Albanian" "" "00390823" "" "" "" "1" "" "00000" "{PMID:Arno-2016:27623334}" "" "F" "no" "" "" "0" "" "" "Albanian" "" "00390824" "" "" "" "1" "" "00000" "{PMID:Arno-2016:27623334}" "" "M" "no" "" "" "0" "" "" "Albanian" "" "00390827" "" "" "" "1" "" "00000" "{PMID:Arno-2016:27623334}" "" "M" "no" "" "" "0" "" "" "Albanian" "" "00391006" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "M" "" "Switzerland" "" "0" "" "" "" "" "00395621" "" "" "" "1" "" "00000" "{PMID:Mermeklieva 2021:34229535}" "" "F" "" "Bulgaria" "" "0" "" "" "Balkan" "?" "00410325" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family WVU, individual III-6" "F" "" "" "" "0" "" "" "" "WVU: III-6" "00410326" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family WVU, individual III-8" "M" "" "" "" "0" "" "" "" "WVU: III-8" "00410327" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family WVU, individual IV-2" "F" "" "" "" "0" "" "" "" "WVU: IV-2" "00410328" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family WVU, individual IV-5" "M" "" "" "" "0" "" "" "" "WVU: IV-5" "00410329" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family WVU, individual IV-6" "M" "" "" "" "0" "" "" "" "WVU: IV-6" "00410330" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family MEH-GC4177, individual IV-1" "F" "" "" "" "0" "" "" "" "MEH-GC4177:IV-1" "00410331" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family MEH-GC4177, individual V-1" "F" "" "" "" "0" "" "" "" "MEH-GC4177:V-1" "00410332" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family MEH-GC4177, individual V-2" "M" "" "" "" "0" "" "" "" "MEH-GC4177:V-2" "00410333" "" "" "" "1" "" "00000" "{PMID:Ba-Abbad 2018:30347075}" "Family MEH-GC4177, individual VI-1" "F" "" "" "" "0" "" "" "" "MEH-GC4177:VI-1" "00410335" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family B763, individual 060-012" "M" "" "" "" "0" "" "" "" "060-012" "00410336" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family B763, individual II:2" "F" "" "" "" "0" "" "" "" "(II:2)" "00410337" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family B763, individual II:3" "M" "" "" "" "0" "" "" "" "(II:3)" "00410338" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family E174, individual 003-186 II:7" "F" "" "" "" "0" "" "" "" "003-186 (II:7)" "00410339" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family E174, individual 218-360 II:6" "F" "" "" "" "0" "" "" "" "218-360 (II:6)" "00410340" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family E174, individual II:5" "M" "" "" "" "0" "" "" "" "(II:5)" "00410341" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family E174, individual II:3" "F" "" "" "" "0" "" "" "" "(II:3)" "00410342" "" "" "" "1" "" "00000" "{PMID:Morimura 1999:10581022}" "family E174, individual II:2" "F" "" "" "" "0" "" "" "" "(II:2)" "00410343" "" "" "" "1" "" "00000" "{PMID:Li 2016:27748892}" "affected" "F" "" "" "" "0" "" "" "" "HM723I1" "00410344" "" "" "" "1" "" "00000" "{PMID:Li 2016:27748892}" "affected - no mutation" "F" "" "" "" "0" "" "" "" "HM723II4" "00410345" "" "" "" "1" "" "00000" "{PMID:Li 2016:27748892}" "unaffected - mutant" "M" "" "" "" "0" "" "" "" "HM723II4" "00410346" "" "" "" "1" "" "00000" "{PMID:Li 2016:27748892}" "affected" "M" "" "" "" "0" "" "" "" "HM824II2" "00410347" "" "" "" "1" "" "00000" "{PMID:Li 2016:27748892}" "unaffected - mutant" "M" "" "" "" "0" "" "" "" "HM824I1" "00446996" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-447" "00447012" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-478" "00447270" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1128" "00447712" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1219" "00469288" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 79 "{{individualid}}" "{{diseaseid}}" "00001802" "00112" "00033095" "04214" "00033127" "04214" "00233178" "04214" "00233179" "04214" "00233180" "04214" "00233181" "04214" "00233182" "04214" "00233771" "04214" "00308540" "04214" "00308541" "04214" "00308542" "04214" "00318042" "00139" "00326696" "04214" "00328042" "04214" "00333385" "04214" "00358979" "04214" "00363350" "04214" "00372717" "04214" "00372748" "04214" "00375435" "04214" "00376514" "04214" "00376515" "04214" "00376783" "04214" "00376796" "04214" "00379392" "04214" "00380186" "04214" "00381694" "04214" "00382857" "04214" "00382858" "04214" "00382859" "04214" "00382860" "04214" "00382861" "04214" "00382862" "04214" "00382863" "04214" "00382864" "04214" "00382865" "04214" "00384776" "04214" "00385041" "04214" "00386205" "04214" "00388500" "04214" "00389428" "04214" "00389429" "04214" "00390362" "04214" "00390756" "04214" "00390776" "04214" "00390822" "04214" "00390823" "04214" "00390824" "04214" "00390827" "04214" "00391006" "04214" "00395621" "04214" "00410325" "04214" "00410326" "04214" "00410327" "04214" "00410328" "04214" "00410329" "04214" "00410330" "04214" "00410331" "04214" "00410332" "04214" "00410333" "04214" "00410335" "04214" "00410336" "04214" "00410337" "04214" "00410338" "04214" "00410339" "04214" "00410340" "04214" "00410341" "04214" "00410342" "04214" "00410343" "04214" "00410344" "04214" "00410345" "04214" "00410346" "04214" "00410347" "04214" "00446996" "00198" "00447012" "00198" "00447270" "00198" "00447712" "00198" "00469288" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00112, 00139, 00198, 03427, 04214 ## Count = 72 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000026524" "04214" "00033095" "00229" "Unknown" "6y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026556" "04214" "00033127" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000233968" "04214" "00308540" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233969" "04214" "00308541" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233970" "04214" "00308542" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000241826" "00139" "00318042" "00006" "Familial, autosomal recessive" "" "moderate to severe ID, aggressive, speech delay, night blindness, impaired conductance, teeth pointed inward, mild nystagmus. 1 affected: mild ID, epilepsy (from 6 months to 4 years age, not now), aggressive. All affected have night blindness, aggressive. IV:1 and IV:8 mild ID while IV:4 moderate to severe ID. IV:1 has myopia, teeth pointed inward, impaired conductance and mild deaf IV:8 epilepsy (from 6 months to 4 years age, not now), febrile seizures, violent shaking, hyperthermia induced seizures and IV:4 has speech delay, mild nystagmus, myopia, teeth pointed inward, impaired conductance with pain in ears and delayed CMS." "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000245162" "04214" "00326696" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000246269" "04214" "00328042" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000251572" "04214" "00333385" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RD" "" "0000254277" "04214" "00358979" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258715" "04214" "00363350" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early onset high myopia" "" "0000267996" "04214" "00372717" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268027" "04214" "00372748" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270649" "04214" "00375435" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271721" "04214" "00376514" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271722" "04214" "00376515" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271994" "04214" "00376783" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, macular subatrophy, pseudohole" "" "0000272007" "04214" "00376796" "00000" "Unknown" "67y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000273265" "04214" "00379392" "00000" "Unknown" "36y" "" "6y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274041" "04214" "00380186" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000275536" "04214" "00381694" "00000" "Familial, autosomal recessive" "" "" "11y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000276713" "04214" "00382857" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276714" "04214" "00382858" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276715" "04214" "00382859" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276716" "04214" "00382860" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276717" "04214" "00382861" "00000" "Familial, autosomal dominant" "30y" "moderate disease; night blindness 31y; marked atrophy of the peripheral retina" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000276718" "04214" "00382862" "00000" "Isolated (sporadic)" "30y" "severe condition; nystagmus and night blindness (4y); severely constricted peripheral visual field, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and numerous pigment deposits on the retina including in the macular area (30y)" "4y" "" "" "" "" "" "" "" "" "recessive retinitis pigmentosa (RP)" "" "0000276719" "04214" "00382863" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276720" "04214" "00382864" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000276721" "04214" "00382865" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000278559" "04214" "00384776" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278825" "04214" "00385041" "00000" "Familial, autosomal dominant" "6y" "photophobia, nystagmus, best corrected visual acuity right/left eye: NA" "2m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000280008" "04214" "00386205" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Best macular dystrophy" "" "0000282052" "04214" "00388500" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000282969" "04214" "00389428" "00000" "Familial, autosomal recessive" "56y" "age at genetic diagnosis mentioned" "" "51y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282970" "04214" "00389429" "00000" "Familial, autosomal recessive" "58y" "age at genetic diagnosis mentioned" "" "53y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283900" "04214" "00390362" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284244" "04214" "00390756" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000284264" "04214" "00390776" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000284310" "04214" "00390822" "00000" "Familial, autosomal recessive" "" "Macular Artrophy" "25y" "" "" "" "" "" "" "" "" "retinal dystrophy (RD)" "" "0000284311" "04214" "00390823" "00000" "Familial, autosomal recessive" "" "Macular Artrophy" "20y" "" "" "" "" "" "" "" "" "retinal dystrophy (RD)" "" "0000284312" "04214" "00390824" "00000" "Familial, autosomal recessive" "" "Macular Artrophy" "38y" "" "" "" "" "" "" "" "" "retinal dystrophy (RD)" "" "0000284315" "04214" "00390827" "00000" "Familial, autosomal recessive" "" "Macular Artrophy" "" "" "" "" "" "" "" "" "" "retinal dystrophy (RD)" "" "0000284494" "04214" "00391006" "00000" "Unknown" "26y-30y" "" "" "" "" "" "" "" "" "" "" "cone dystrophy (COD)" "" "0000288819" "04214" "00395621" "00000" "Familial, autosomal recessive" "26y" "best corrected visual acuity 0.3, 20/40 Snellen equivalent, both eyes. Slightly paler optic discs, moderately attenuated retinal vessels, few pigment deposits peripherally in both eyes and near the optic disc in the right eye, yellowish colored macula were observed in the fundus. fundus autofluorescence: generalized thinning of RPE with punctate salt and pepper-like appearance peripherally and hyperfluorescence in the center of the macula in both eyes. Optical coherence tomography: abnormal foveolar contour with retinal thinning of macular areas in both eyes, centrally and more peripherally located scotomas found on visual field testing, full-field electroretinography: severely affected photopic response- reduced amplitudes and prolonged latencies, scotopic response also pathological although milder." "24y" "" "gradual loss of vision and photophobia" "" "" "" "" "" "retinitis pigmentosa, optic atrophy, cataracts, hearing impairment" "" "" "0000302429" "04214" "00410325" "00000" "Familial, autosomal dominant" "81y" "presentation: visual field defects; best corrected visual acuity right, left eye: 20/30; 20/25; -1.00+0.75 x 175, -0.50 DS; visual field: enlarged blind spots, both eyes; fundus features: bilateral peripapillary atrophy; fundus autofluorescence: reduced peripapillary autofluorescence, extending not availablesally & temporally, relative foveal sparing, reticular pattern of increased autofluorescence in the posterior pole, speckled autofluorescence inferiorly; optical coherence tomography: relative sparing of the fovea, interlaminar bridge not availablesal to the fovea, peripapillary loss of outer retinal layers, thin choroid; electroretinogram: moderate-to-severe reduction of scotopic and photopic responses" "" "" "visual field defects" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302430" "04214" "00410326" "00000" "Familial, autosomal dominant" "59y" "presentation: reduced visual acuity; best corrected visual acuity right, left eye: 20/25; 20/60; +0.75+1.00 x 145, -0.50+1.75 x 175; visual field: enlarged blind spot & large nasal scotomata, both eyes; fundus features: extensive peripapillary atrophy, relative foveal sparing. at age 77: bilateral chorioretinal atrophy in the posterior pole; fundus autofluorescence: reduced autofluorescence with islands of preserved autofluorescence in the posterior pole; optical coherence tomography: 77y: interlaminar bridge temporal to the fovea; extensive loss of the outer retina, thin choroid; electroretinogram: moderate reduction of scotopic bright flash response; mildly subnormal photopic b-wave amplitude" "" "" "reduced visual acuity" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302431" "04214" "00410327" "00000" "Familial, autosomal dominant" "60y" "presentation: asymptomatic; best corrected visual acuity right, left eye: 20/20; 20/20; visual field: not available; fundus features: bilateral peripapillary atrophy & peripheral reticular pigmentation; fundus autofluorescence: reduced peripapillary autofluorescence, reticular pattern of increased autofluorescence, sparing of the posterior pole; optical coherence tomography: preservation of the foveal structure, peripapillary loss of outer retinal layers; electroretinogram: not available" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302432" "04214" "00410328" "00000" "Familial, autosomal dominant" "50y" "presentation: asymptomatic; peripapillary atrophy; best corrected visual acuity right, left eye: 20/20; 20/20; +0.75+0.75 x 132, LE:+1.00+0.50 x 37; visual field: enlarged blind spots, both eyes; fundus features: bilateral peripapillary atrophy & peripheral reticular pigmentation; fundus autofluorescence: reduced peripapillary autofluorescence, reticular pattern of increased autofluorescence and patches of reduced autofluorescence not availablesally; optical coherence tomography: preservation of the foveal structure, deep peripapillary excavation & loss of outer retinal layers; electroretinogram: normal scotopic & photopic responses" "" "" "asymptomatic; peripapillary atrophy" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302433" "04214" "00410329" "00000" "Familial, autosomal dominant" "48y" "presentation: difficulty driving at night; best corrected visual acuity right, left eye: 20/25; 20/25; visual field: not available; fundus features: bilateral peripapillary atrophy & peripheral reticular pigmentation; fundus autofluorescence: not available; optical coherence tomography: not available; electroretinogram: not available" "" "" "difficulty driving at night" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302434" "04214" "00410330" "00000" "Familial, autosomal dominant" "73y" "presentation: reduced visual acuity, difficulty seeing under dim light, & visual field defects; best corrected visual acuity right, left eye: 20/1000; 20/80; visual field: not available; fundus features: bilateral chorioretinal atrophy, no retinal visual acuityscular attenuation, patches of intraretinal pigmentation in the temporal periphery ; fundus autofluorescence: widespread reduced autofluorescence with islands of preserved autofluorescence in the posterior pole; optical coherence tomography: extensive loss of the outer retina at the posterior pole; outer retinal tubulation; electroretinogram: not available" "" "" "reduced visual acuity, difficulty seeing under dim light, & visual field defects" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302435" "04214" "00410331" "00000" "Familial, autosomal dominant" "52y" "presentation: progressive visual field constriction ; best corrected visual acuity right, left eye: 20/20; 20/30; visual field: not available; fundus features: bilateral peripapillary atrophy & peripheral reticular pigmentation; fundus autofluorescence: reduced peripapillary autofluorescence, reticular autofluorescence pattern, patches of reduced autofluorescence not availablesally, relative sparing of the parafoveal region; optical coherence tomography: mild disruption of the ellipsoid zone & the inter-digitation zone; focal thickening of the rpe band not availablesal to the fovea; electroretinogram: not available" "" "" "progressive visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302436" "04214" "00410332" "00000" "Familial, autosomal dominant" "51y" "presentation: asymptomatic; best corrected visual acuity right, left eye: 20/20; 20/20; visual field: not available; fundus features: bilateral peripapillary atrophy & peripheral reticular pigmentation; fundus autofluorescence: reduced peripapillary autofluorescence, reticular pattern of increased autofluorescence not availablesally; optical coherence tomography: marked attenuation of the outer nuclear layer & ellipsoid zone not availablesal to the fovea; outer retinal tabulation; electroretinogram: normal scotopic & photopic responses" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302437" "04214" "00410333" "00000" "Familial, autosomal dominant" "23y" "presentation: asymptomatic; best corrected visual acuity right, left eye: 20/15 20/20; visual field: normal; fundus features: bilateral peripapillary atrophy & diffuse retinal pigment alteration ; fundus autofluorescence: reduced peripapillary autofluorescence, widespread salt-and-pepper hypo-autofluorescence anterior to the visual acuityscular arcades; optical coherence tomography: preservation of the foveal structure, peripapillary loss outer nuclear layer & ellipsoid zone; outer retinal tubulation; electroretinogram: normal scotopic & photopic responses" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302438" "04214" "00410335" "00000" "Familial, autosomal dominant" "" "retinal degeneration similar to patients with Ser66Arg; 65y: poor visual acuity (right 20/40, left 20/160); severely reduced electroretinograms (?1.5 uV, normal ?50 uV) that were nevertheless larger than those of patients up to 30 years younger with the Ser66Arg mutation; normal levels of serum vitamin A" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302439" "04214" "00410336" "00000" "Familial, autosomal dominant" "" "retinal degeneration similar to patients with Ser66Arg; 65y: poor visual acuity (right 20/40, left 20/160); severely reduced electroretinograms (?1.5 uV, normal ?50 uV) that were nevertheless larger than those of patients up to 30 years younger with the Ser66Arg mutation; normal levels of serum vitamin A" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302440" "04214" "00410337" "00000" "Familial, autosomal dominant" "" "retinal degeneration similar to patients with Ser66Arg; 65y: poor visual acuity (right 20/40, left 20/160); severely reduced electroretinograms (?1.5 uV, normal ?50 uV) that were nevertheless larger than those of patients up to 30 years younger with the Ser66Arg mutation; normal levels of serum vitamin A" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302441" "04214" "00410338" "00000" "Familial, autosomal recessive" "" "visual acuity of 20/200 or worse, severely constricted visual fields, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and intraretinal pigment deposits in the periphery; the depigmented patches involved the central macula in siblings with severely decreased acuity; full-field electroretinograms: reduced, reflecting widespread loss of photoreceptor function; 35y: no rod response to single white flashes and computer-averaged cone electroretinograms to 30-Hz white flicker flashes were 0.21�0.35 uV (normal ?50 uV); normal levels of serum vitamin A" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302442" "04214" "00410339" "00000" "Familial, autosomal recessive" "" "visual acuity of 20/200 or worse, severely constricted visual fields, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and intraretinal pigment deposits in the periphery; the depigmented patches involved the central macula in siblings with severely decreased acuity" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302443" "04214" "00410340" "00000" "Familial, autosomal recessive" "" "visual acuity of 20/200 or worse, severely constricted visual fields, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and intraretinal pigment deposits in the periphery; the depigmented patches involved the central macula in siblings with severely decreased acuity" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302444" "04214" "00410341" "00000" "Familial, autosomal recessive" "" "visual acuity of 20/200 or worse, severely constricted visual fields, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and intraretinal pigment deposits in the periphery; the depigmented patches involved the central macula in siblings with severely decreased acuity; full-field electroretinograms: reduced, reflecting widespread loss of photoreceptor function; near-normal levels of serum vitamin A;" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302445" "04214" "00410342" "00000" "Familial, autosomal recessive" "" "visual acuity of 20/200 or worse, severely constricted visual fields, attenuated retinal vessels, diffuse depigmentation of the retinal pigment epithelium and intraretinal pigment deposits in the periphery; the depigmented patches involved the central macula in siblings with severely decreased acuity" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302447" "04214" "00410343" "00000" "Unknown" "43y" "best corrected visual acuity right, left eye: 0.2,0.2; refraction right, left eye (diopters): -12.00,-13.00; axial length (mm): 27.57,28.18; fundus: myopic" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "" "0000302448" "04214" "00410344" "00000" "Unknown" "22y" "best corrected visual acuity right, left eye: 0.5,0.5; refraction right, left eye (diopters): -7.00,-6.50; axial length (mm): 26.28,26.09; fundus: normal" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "" "0000302449" "04214" "00410345" "00000" "Unknown" "10y" "best corrected visual acuity right, left eye: 1.2,1.0; refraction right, left eye (diopters): -1.00,-0.50; axial length (mm): 23.18,23.24; fundus: normal" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "" "0000302450" "04214" "00410346" "00000" "Unknown" "35y" "best corrected visual acuity right, left eye: 0.7,0.1; refraction right, left eye (diopters): -15.50,-18.00; axial length (mm): 31.52,not available - retinal detachment; fundus: myopic" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "" "0000302451" "04214" "00410347" "00000" "Unknown" "66y" "best corrected visual acuity right, left eye: 1.0,1.0; refraction right, left eye (diopters): -2.50,1.00; axial length (mm): 23.92,23.86; fundus: normal" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "" "0000336195" "00198" "00446996" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336211" "00198" "00447012" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336469" "00198" "00447270" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336911" "00198" "00447712" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000354441" "00198" "00469288" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" ## Screenings ## Do not remove or alter this header ## ## Count = 79 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000001605" "00001802" "1" "00102" "00102" "2013-08-08 19:50:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000033163" "00033095" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033195" "00033127" "1" "00229" "00229" "2012-02-13 08:19:26" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000234277" "00233178" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234278" "00233179" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234279" "00233180" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234280" "00233181" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234281" "00233182" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234870" "00233771" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000309685" "00308540" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309686" "00308541" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309687" "00308542" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000319224" "00318042" "1" "00006" "00006" "2020-11-05 17:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000327909" "00326696" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "arraySEQ" "DNA" "blood" "" "0000329257" "00328042" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000334610" "00333385" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000360216" "00358979" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000364578" "00363350" "1" "00000" "00006" "2021-04-26 18:22:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000373949" "00372717" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373980" "00372748" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000376632" "00375435" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000377719" "00376514" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000377720" "00376515" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000377989" "00376783" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000378002" "00376796" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000380592" "00379392" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000381388" "00380186" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000382910" "00381694" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000384073" "00382857" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384074" "00382858" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384075" "00382859" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384076" "00382860" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384077" "00382861" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384078" "00382862" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384079" "00382863" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384080" "00382864" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000384081" "00382865" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ;DHPLC" "DNA" "" "" "0000386002" "00384776" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386270" "00385041" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000387434" "00386205" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000389741" "00388500" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000390671" "00389428" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390672" "00389429" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper" "0000391603" "00390362" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391997" "00390756" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" "" "0000392017" "00390776" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" "" "0000392063" "00390822" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "blood" "" "0000392064" "00390823" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "blood" "" "0000392065" "00390824" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "blood" "" "0000392068" "00390827" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "PE" "DNA" "blood" "" "0000392247" "00391006" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000396859" "00395621" "1" "00000" "03840" "2021-12-08 14:58:54" "" "" "SEQ-NG-I" "DNA" "" "140 genes associated with inherited retinal diseases" "0000411589" "00410325" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411590" "00410326" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411591" "00410327" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411592" "00410328" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411593" "00410329" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411594" "00410330" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411595" "00410331" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411596" "00410332" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411597" "00410333" "1" "00000" "03840" "2022-05-24 11:34:37" "" "" "SEQ-NG" "DNA" "blood" "" "0000411598" "00410335" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411599" "00410336" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411600" "00410337" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411601" "00410338" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411602" "00410339" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411603" "00410340" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411604" "00410341" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411605" "00410342" "1" "00000" "03840" "2022-05-24 12:53:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000411607" "00410343" "1" "00000" "03840" "2022-05-24 13:39:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000411608" "00410344" "0" "00000" "03840" "2022-05-24 13:39:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000411609" "00410345" "1" "00000" "03840" "2022-05-24 13:39:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000411610" "00410346" "1" "00000" "03840" "2022-05-24 13:39:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000411611" "00410347" "1" "00000" "03840" "2022-05-24 13:39:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000448573" "00446996" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448589" "00447012" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448847" "00447270" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449289" "00447712" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000470956" "00469288" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 90 "{{screeningid}}" "{{geneid}}" "0000033163" "PDE6B" "0000033163" "PRPH2" "0000033163" "RGR" "0000033163" "SNRNP200" "0000033195" "CA4" "0000033195" "GUCA1B" "0000033195" "RGR" "0000234277" "RGR" "0000234278" "RGR" "0000234279" "RGR" "0000234280" "RGR" "0000234281" "RGR" "0000234870" "RGR" "0000309685" "RGR" "0000309686" "RGR" "0000309687" "RGR" "0000319224" "RGR" "0000327909" "RGR" "0000329257" "RGR" "0000334610" "RGR" "0000364578" "RGR" "0000377719" "RGR" "0000377720" "RGR" "0000380592" "RGR" "0000381388" "RGR" "0000382910" "RGR" "0000384073" "RBP1" "0000384073" "RBP3" "0000384073" "RGR" "0000384074" "RBP1" "0000384074" "RBP3" "0000384074" "RGR" "0000384075" "RBP1" "0000384075" "RBP3" "0000384075" "RGR" "0000384076" "RBP1" "0000384076" "RBP3" "0000384076" "RGR" "0000384077" "RBP1" "0000384077" "RBP3" "0000384077" "RGR" "0000384078" "RBP1" "0000384078" "RBP3" "0000384078" "RGR" "0000384079" "RBP1" "0000384079" "RBP3" "0000384079" "RGR" "0000384080" "RBP1" "0000384080" "RBP3" "0000384080" "RGR" "0000384081" "RBP1" "0000384081" "RBP3" "0000384081" "RGR" "0000386002" "RGR" "0000386270" "RGR" "0000387434" "CERKL" "0000389741" "RGR" "0000390671" "RGR" "0000390672" "RGR" "0000391603" "RGR" "0000391997" "RGR" "0000392017" "RGR" "0000392063" "CDHR1" "0000392064" "CDHR1" "0000392065" "CDHR1" "0000392068" "CDHR1" "0000392247" "RGR" "0000396859" "CDHR1" "0000411589" "RGR" "0000411590" "RGR" "0000411591" "RGR" "0000411592" "RGR" "0000411593" "RGR" "0000411594" "RGR" "0000411595" "RGR" "0000411596" "RGR" "0000411597" "RGR" "0000411598" "RGR" "0000411599" "RGR" "0000411600" "RGR" "0000411601" "RGR" "0000411602" "RGR" "0000411603" "RGR" "0000411604" "RGR" "0000411605" "RGR" "0000411607" "RGR" "0000411608" "RGR" "0000411609" "RGR" "0000411610" "RGR" "0000411611" "RGR" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 108 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000019507" "0" "90" "10" "86012613" "86012613" "subst" "0" "00102" "RGR_000002" "g.86012613G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.84252857G>A" "" "pathogenic" "" "0000060183" "1" "10" "10" "86017767" "86017767" "subst" "0.00335347" "00229" "RGR_000001" "g.86017767A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "no" "" "0" "" "" "g.84258011A>G" "" "benign" "" "0000060184" "1" "10" "10" "86017767" "86017767" "subst" "0.00335347" "00229" "RGR_000001" "g.86017767A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other family" "Germline" "" "" "0" "" "" "g.84258011A>G" "" "benign" "" "0000255271" "0" "30" "10" "86017767" "86017767" "subst" "0.00335347" "01943" "RGR_000001" "g.86017767A>G" "" "" "" "RGR(NM_002921.3):c.756+5A>G, RGR(NM_002921.4):c.756+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84258011A>G" "" "likely benign" "" "0000294826" "0" "30" "10" "86007450" "86007450" "subst" "0.00011777" "02330" "RGR_000005" "g.86007450G>A" "" "" "" "RGR(NM_002921.3):c.183G>A (p.A61=), RGR(NM_002921.4):c.183G>A (p.A61=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84247694G>A" "" "likely benign" "" "0000294827" "0" "10" "10" "86008759" "86008759" "subst" "0.000637874" "02330" "RGR_000006" "g.86008759T>C" "" "" "" "RGR(NM_002921.3):c.330T>C (p.S110=), RGR(NM_002921.4):c.330T>C (p.S110=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84249003T>C" "" "benign" "" "0000294828" "0" "30" "10" "86012598" "86012598" "subst" "0" "02330" "RGR_000007" "g.86012598C>A" "" "" "" "RGR(NM_002921.4):c.371-15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84252842C>A" "" "likely benign" "" "0000297662" "0" "10" "10" "86004873" "86004873" "subst" "0.524931" "02325" "RGR_000003" "g.86004873T>C" "" "" "" "RGR(NM_002921.4):c.27T>C (p.T9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84245117T>C" "" "benign" "" "0000297663" "0" "10" "10" "86012713" "86012713" "subst" "0.414952" "02325" "RGR_000008" "g.86012713C>T" "" "" "" "RGR(NM_002921.4):c.471C>T (p.Y157=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84252957C>T" "" "benign" "" "0000307058" "0" "50" "10" "86004880" "86004880" "subst" "4.88747E-5" "01943" "RGR_000004" "g.86004880G>A" "" "" "" "RGR(NM_002921.3):c.34G>A (p.G12R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84245124G>A" "" "VUS" "" "0000307059" "0" "30" "10" "86014101" "86014101" "subst" "2.03028E-5" "01943" "RGR_000009" "g.86014101T>C" "" "" "" "RGR(NM_002921.3):c.544T>C (p.F182L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84254345T>C" "" "likely benign" "" "0000340495" "0" "10" "10" "86004865" "86004865" "subst" "0.0751944" "02327" "RGR_000010" "g.86004865C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84245109C>T" "" "benign" "" "0000340496" "0" "10" "10" "86004873" "86004873" "subst" "0.524931" "02327" "RGR_000003" "g.86004873T>C" "" "" "" "RGR(NM_002921.4):c.27T>C (p.T9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84245117T>C" "" "benign" "" "0000340497" "0" "10" "10" "86012713" "86012713" "subst" "0.414952" "02327" "RGR_000008" "g.86012713C>T" "" "" "" "RGR(NM_002921.4):c.471C>T (p.Y157=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84252957C>T" "" "benign" "" "0000349133" "0" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "02327" "RGR_000011" "g.86007463A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.84247707A>C" "" "VUS" "" "0000476985" "0" "50" "10" "86004851" "86004851" "subst" "0" "02591" "RGR_000012" "g.86004851C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.84245095C>T" "" "VUS" "" "0000476986" "0" "50" "10" "86007377" "86007377" "subst" "5.2791E-5" "02591" "RGR_000013" "g.86007377C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs774849552" "0" "" "" "g.84247621C>T" "" "VUS" "" "0000476987" "0" "50" "10" "86012646" "86012646" "subst" "0" "02591" "RGR_000014" "g.86012646T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.84252890T>C" "" "VUS" "" "0000476988" "0" "50" "10" "86012742" "86012742" "subst" "0" "02591" "RGR_000015" "g.86012742C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.84252986C>T" "" "VUS" "" "0000476989" "0" "10" "10" "86017740" "86017740" "subst" "0.0522196" "02591" "RGR_000016" "g.86017740C>T" "208/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs61730895" "0" "" "" "g.84257984C>T" "" "benign" "" "0000477578" "3" "10" "10" "86017740" "86017740" "subst" "0.0522196" "02591" "RGR_000016" "g.86017740C>T" "9/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs61730895" "0" "" "" "g.84257984C>T" "" "benign" "" "0000541136" "0" "30" "10" "86008691" "86008691" "subst" "0.000945688" "02330" "RGR_000017" "g.86008691G>A" "" "" "" "RGR(NM_002921.3):c.262G>A (p.G88S), RGR(NM_002921.4):c.262G>A (p.G88S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84248935G>A" "" "likely benign" "" "0000541137" "0" "30" "10" "86008759" "86008759" "subst" "0.000637874" "01943" "RGR_000006" "g.86008759T>C" "" "" "" "RGR(NM_002921.3):c.330T>C (p.S110=), RGR(NM_002921.4):c.330T>C (p.S110=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84249003T>C" "" "likely benign" "" "0000541138" "0" "50" "10" "86012747" "86012747" "subst" "0.000707467" "02330" "RGR_000018" "g.86012747G>T" "" "" "" "RGR(NM_002921.3):c.505G>T (p.D169Y), RGR(NM_002921.4):c.505G>T (p.D169Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84252991G>T" "" "VUS" "" "0000541139" "0" "30" "10" "86017703" "86017703" "subst" "2.8428E-5" "01943" "RGR_000019" "g.86017703A>C" "" "" "" "RGR(NM_002921.3):c.697A>C (p.I233L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84257947A>C" "" "likely benign" "" "0000541140" "0" "10" "10" "86017767" "86017767" "subst" "0.00335347" "02330" "RGR_000001" "g.86017767A>G" "" "" "" "RGR(NM_002921.3):c.756+5A>G, RGR(NM_002921.4):c.756+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84258011A>G" "" "benign" "" "0000541141" "0" "50" "10" "86018328" "86018328" "subst" "8.12137E-6" "02330" "RGR_000020" "g.86018328A>G" "" "" "" "RGR(NM_002921.4):c.821A>G (p.E274G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84258572A>G" "" "VUS" "" "0000622439" "0" "50" "10" "86012747" "86012747" "subst" "0.000707467" "01943" "RGR_000018" "g.86012747G>T" "" "" "" "RGR(NM_002921.3):c.505G>T (p.D169Y), RGR(NM_002921.4):c.505G>T (p.D169Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.84252991G>T" "" "VUS" "" "0000684558" "1" "70" "10" "86012708" "86012708" "subst" "0.000739332" "00004" "RGR_000021" "g.86012708C>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001012720.1:c.454C>A" "" "Germline" "" "" "0" "" "" "g.84252952C>A" "" "likely pathogenic" "" "0000684559" "1" "70" "10" "86017740" "86017740" "subst" "0.0522196" "00004" "RGR_000016" "g.86017740C>T" "7/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001012720.1:c.454C>A" "" "Germline" "" "" "0" "" "" "g.84257984C>T" "" "likely pathogenic" "" "0000684560" "1" "70" "10" "86017767" "86017767" "subst" "0.00335347" "00004" "RGR_000001" "g.86017767A>G" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001012720.1:c.454C>A" "" "Germline" "" "" "0" "" "" "g.84258011A>G" "" "likely pathogenic" "" "0000690808" "0" "30" "10" "86007450" "86007450" "subst" "0.00011777" "01943" "RGR_000005" "g.86007450G>A" "" "" "" "RGR(NM_002921.3):c.183G>A (p.A61=), RGR(NM_002921.4):c.183G>A (p.A61=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000701888" "3" "50" "10" "86008779" "86008779" "subst" "8.94338E-5" "00006" "RGR_000022" "g.86008779G>A" "" "{PMID:Riazuddin 2017:27457812}" "" "" "" "Germline" "" "" "0" "" "" "g.84249023G>A" "" "VUS" "" "0000711702" "1" "70" "10" "86017740" "86017740" "subst" "0.0522196" "00008" "RGR_000016" "g.86017740C>T" "" "{PMID:Mandal 2005:16123440}" "" "C734T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713380" "0" "90" "10" "86018340" "86018341" "ins" "0" "00000" "RGR_000023" "g.86018340_86018341insG" "" "{PMID:Carss 2017:28041643}" "" "10:86018339A>AG ENST00000359452.4:c.836dupG (Ile280AsnfsTer78)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000722969" "0" "50" "10" "86008691" "86008691" "subst" "0.000945688" "01943" "RGR_000017" "g.86008691G>A" "" "" "" "RGR(NM_002921.3):c.262G>A (p.G88S), RGR(NM_002921.4):c.262G>A (p.G88S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000732542" "1" "90" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Wang 2017:28838317}" "" "NM_001012720.1:c.824dup (I276N*77)" "" "Germline" "" "" "0" "" "" "g.84258587dup" "" "pathogenic (dominant)" "" "0000760095" "0" "50" "10" "86012747" "86012747" "subst" "0.000707467" "00000" "RGR_000018" "g.86012747G>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.84252991G>T" "" "VUS" "" "0000765443" "1" "90" "10" "86008695" "86008695" "subst" "1.63133E-5" "00000" "RGR_000025" "g.86008695C>A" "1/596 chromosomes" "{PMID:Sun 2015:26747767}" "" "" "not in 624 control chromosomes" "Germline" "" "" "0" "" "" "g.84248939C>A" "" "pathogenic" "" "0000784482" "0" "50" "10" "86014209" "86014209" "subst" "3.24897E-5" "00000" "RGR_000027" "g.86014209C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs192139791" "0" "" "" "g.84254453C>T" "" "VUS" "" "0000784545" "0" "50" "10" "86008698" "86008698" "subst" "4.08287E-6" "00000" "RGR_000026" "g.86008698A>G" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.84248942A>G" "" "VUS" "" "0000788522" "0" "50" "10" "86008715" "86008715" "subst" "2.84738E-5" "00000" "RGR_000028" "g.86008715G>A" "" "{PMID:Katagiri 2014:25268133}" "" "NM_001012720G274A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790144" "0" "50" "10" "86007390" "86007390" "subst" "0" "00000" "RGR_000029" "g.86007390C>T" "" "{PMID:Singh 2009:19339744}" "" "" "Other changes detected in the proband: rs2279227, rs1042454, rs61730895, rs3526, rs12042179, rs3902057" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790145" "3" "10" "10" "86018229" "86018229" "subst" "0" "00000" "RGR_000030" "g.86018229C>T" "" "{PMID:Singh 2009:19339744}" "" "" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000790598" "0" "50" "10" "86008691" "86008691" "subst" "0.000945688" "00000" "RGR_000017" "g.86008691G>A" "" "{PMID:Wang 2014:25097241}" "" "NM_001012720.1:c.250G>A" "" "Germline" "" "rs116754489" "0" "" "" "" "" "VUS" "" "0000790640" "0" "50" "10" "86017767" "86017767" "subst" "0.00335347" "00000" "RGR_000001" "g.86017767A>G" "" "{PMID:Wang 2014:25097241}" "" "NM_001012720.1:c.744+5A>G" "" "Germline" "" "rs143720091" "0" "" "" "" "" "VUS" "" "0000793737" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Collin-2011:21217109}" "" "c.196A>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000794818" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001012720, c.196A>C, p.Ser66Arg" "" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000796869" "0" "70" "10" "86012708" "86012708" "subst" "0.000739332" "00000" "RGR_000021" "g.86012708C>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.466C>A" "" "Germline" "" "rs150808273" "0" "" "" "" "" "likely pathogenic" "" "0000798503" "0" "30" "10" "86004736" "86004736" "subst" "0" "00000" "RGR_000031" "g.86004736A>G" "72.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.-111A>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000798504" "0" "10" "10" "86004865" "86004865" "subst" "0.0751944" "00000" "RGR_000010" "g.86004865C>T" "72.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.19C>T" "" "Germline" "" "rs11200938" "0" "" "" "" "" "benign" "" "0000798505" "0" "10" "10" "86004873" "86004873" "subst" "0.524931" "00000" "RGR_000003" "g.86004873T>C" "72.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.27T>C" "" "Germline" "" "rs2279227" "0" "" "" "" "" "benign" "" "0000798506" "0" "30" "10" "86004984" "86004984" "subst" "0" "00000" "RGR_000032" "g.86004984C>T" "2.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.79+59C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000798507" "0" "10" "10" "86012708" "86012708" "subst" "0.000739332" "00000" "RGR_000021" "g.86012708C>A" "0.5% of 216 patients; 0/100 controls" "{PMID:Ksantini-2010:21067480}" "" "c.466C>A" "" "Germline" "" "" "0" "" "" "" "" "benign (dominant)" "" "0000798508" "0" "10" "10" "86012708" "86012708" "subst" "0.000739332" "00000" "RGR_000021" "g.86012708C>A" "0.5% of 216 patients; 0/100 controls" "{PMID:Ksantini-2010:21067480}" "" "c.466C>A" "" "Germline" "" "" "0" "" "" "" "" "benign (recessive)" "" "0000798509" "0" "30" "10" "86012716" "86012716" "subst" "0" "00000" "RGR_000034" "g.86012716C>T" "46.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.474C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000798510" "0" "30" "10" "86014215" "86014215" "subst" "0" "00000" "RGR_000035" "g.86014215G>A" "7.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.642+16G>A" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000798511" "0" "30" "10" "86018460" "86018460" "subst" "0" "00000" "RGR_000036" "g.86018460A>G" "11.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.*65A>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000798512" "0" "30" "10" "86018495" "86018496" "ins" "0" "00000" "RGR_000033" "g.86018495_86018496insA" "6.0% of 216 patients" "{PMID:Ksantini-2010:21067480}" "" "c.*100_101insA" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000804589" "0" "50" "10" "86007355" "86007355" "subst" "4.87428E-5" "01943" "RGR_000037" "g.86007355G>A" "" "" "" "RGR(NM_002921.3):c.88G>A (p.G30S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804590" "0" "50" "10" "86014113" "86014133" "del" "0" "01943" "RGR_000038" "g.86014113_86014133del" "" "" "" "RGR(NM_002921.3):c.556_576delTTCTTCAACTTCGCCATGCCC (p.F186_P192del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804591" "0" "30" "10" "86018269" "86018269" "subst" "5.27914E-5" "01943" "RGR_000039" "g.86018269C>A" "" "" "" "RGR(NM_002921.3):c.762C>A (p.P254=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000813219" "0" "30" "10" "86017767" "86017767" "subst" "0.00335347" "00000" "RGR_000001" "g.86017767A>G" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.756+5A>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813677" "1" "70" "10" "86012613" "86012613" "subst" "0" "00000" "RGR_000002" "g.86012613G>A" "" "{PMID:Xu 2020:31630094}" "" "RGR NM_001012720: g.3980G>A, c.359G>A, p.R120H" "different transcript: NM_001012722.1(RGR):c.359G>A" "Germline" "yes" "" "0" "" "" "g.84252857G>A" "" "likely pathogenic" "ACMG" "0000815602" "0" "50" "10" "86012639" "86012639" "subst" "0.000235581" "00000" "RGR_000040" "g.86012639G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RGR:NM_002921 c.G397A, p.V133I" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.84252883G>A" "" "VUS" "ACMG" "0000818975" "1" "50" "10" "86008665" "86008800" "del" "0" "00000" "RGR_000041" "g.(86007504_86008665)_(86008800_86012612)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr10:86008662–86008804" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000820016" "1" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RGR, variant 1: c.196A>C/p.S66R, variant 2: c.196A>C/p.S66R" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000820017" "1" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RGR, variant 1: c.196A>C/p.S66R, variant 2: c.196A>C/p.S66R" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000821352" "0" "90" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Turro 2020:32581362}" "" "RGR c.836dupG, p.Ile280AsnfsTer78" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.84258587dup" "" "pathogenic" "" "0000822119" "0" "70" "10" "86012696" "86012696" "subst" "0" "00000" "RGR_000043" "g.86012696C>A" "" "{PMID:Booij-2011:20801516}" "" "c.454C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822120" "0" "70" "10" "86017767" "86017767" "subst" "0.00335347" "00000" "RGR_000001" "g.86017767A>G" "" "{PMID:Booij-2011:20801516}" "" "c.756+5A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822158" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Arno-2016:27623334}" "" "c.196A>C" "Reevaluation of the previously reported causative status of this variant" "Germline" "" "" "0" "" "" "" "" "VUS (!)" "" "0000822160" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Arno-2016:27623334}" "" "c.196A>C" "Reevaluation of the previously reported causative status of this variant" "Germline" "" "" "0" "" "" "" "" "VUS (!)" "" "0000822162" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Arno-2016:27623334}" "" "c.196A>C" "Reevaluation of the previously reported causative status of this variant" "Germline" "" "" "0" "" "" "" "" "VUS (!)" "" "0000822167" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Arno-2016:27623334}" "" "c.196A>C" "Reevaluation of the previously reported causative status of this variant" "Germline" "" "" "0" "" "" "" "" "VUS (!)" "" "0000822489" "0" "70" "10" "86007503" "86007503" "subst" "3.65696E-5" "00000" "RGR_000042" "g.86007503G>A" "" "{PMID:Maggi_2021:33546218}" "" "c.236G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822490" "0" "70" "10" "86007503" "86007503" "subst" "3.65696E-5" "00000" "RGR_000042" "g.86007503G>A" "" "{PMID:Maggi_2021:33546218}" "" "c.236G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000828561" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "" "{PMID:Mermeklieva 2021:34229535}" "" "RGR c.196A>C, (p.Ser66Arg)" "" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000852602" "0" "50" "10" "86007496" "86007496" "subst" "0.000349327" "01943" "RGR_000044" "g.86007496C>T" "" "" "" "RGR(NM_002921.3):c.229C>T (p.L77F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852603" "0" "30" "10" "86012708" "86012708" "subst" "0.000739332" "01943" "RGR_000021" "g.86012708C>A" "" "" "" "RGR(NM_002921.3):c.466C>A (p.H156N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000868762" "0" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868763" "0" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868764" "21" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868765" "11" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868766" "11" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868767" "10" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868768" "21" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868769" "21" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868770" "11" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "" "{PMID:Ba-Abbad 2018:30347075}" "" "RGR c.836dupG; p.Ile280Asn*78" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868779" "10" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR 1-bp insertion in codon Gly275 (GGA?GGGA)" "obsolete annotation, the change is actually c.836dupG; p.Ile280Asn*78 (exatraplolated from sequence and databases); heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868780" "10" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR 1-bp insertion in codon Gly275 (GGA?GGGA)" "obsolete annotation, the change is actually c.836dupG; p.Ile280Asn*78 (exatraplolated from sequence and databases); heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868781" "10" "70" "10" "86018343" "86018343" "dup" "0" "00000" "RGR_000024" "g.86018343dup" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR 1-bp insertion in codon Gly275 (GGA?GGGA)" "obsolete annotation, the change is actually c.836dupG; p.Ile280Asn*78 (exatraplolated from sequence and databases); heterozygous" "Germline" "yes" "" "0" "" "" "g.84258587dup" "" "likely pathogenic (dominant)" "" "0000868782" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR Ser66Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic (recessive)" "" "0000868783" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR Ser66Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000868784" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR Ser66Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000868785" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR Ser66Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000868786" "3" "70" "10" "86007463" "86007463" "subst" "3.65473E-5" "00000" "RGR_000011" "g.86007463A>C" "0/95 unaffected controls" "{PMID:Morimura 1999:10581022}" "" "RGR Ser66Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.84247707A>C" "" "likely pathogenic" "" "0000868789" "0" "70" "10" "86008695" "86008695" "subst" "1.63133E-5" "00000" "RGR_000025" "g.86008695C>A" "" "{PMID:Li 2016:27748892}" "" "RGR c.266C>A (p.S89*)" "heterozygous; not segregating in the family - wild type in an affected family member, mutation in unaffected" "Germline" "no" "" "0" "" "" "g.84248939C>A" "" "VUS (!)" "" "0000868790" "0" "70" "10" "86008695" "86008695" "subst" "1.63133E-5" "00000" "RGR_000025" "g.86008695C>A" "" "{PMID:Li 2016:27748892}" "" "RGR c.[=];[=]" "heterozygous; not segregating in the family - wild type in an affected family member, mutation in unaffected" "Germline" "no" "" "0" "" "" "g.84248939C>A" "" "VUS (!)" "" "0000868791" "0" "70" "10" "86008695" "86008695" "subst" "1.63133E-5" "00000" "RGR_000025" "g.86008695C>A" "" "{PMID:Li 2016:27748892}" "" "RGR c.266C>A (p.S89*)" "affected person without the mutation" "Germline" "no" "" "0" "" "" "g.84248939C>A" "" "VUS (!)" "" "0000868792" "0" "70" "10" "86017740" "86017741" "del" "0" "00000" "RGR_000045" "g.86017740_86017741del" "" "{PMID:Li 2016:27748892}" "" "RGR c.722_723delCC (p.S242Yfs*29)" "heterozygous; not segregating in the family - mutation in unaffected family member, error in annotationm this change according to sequence is c.734_735del, p.(Ser245Tyrfs*29)" "Germline" "no" "" "0" "" "" "g.84257984_84257985del" "" "VUS (!)" "" "0000868793" "0" "70" "10" "86017740" "86017741" "del" "0" "00000" "RGR_000045" "g.86017740_86017741del" "" "{PMID:Li 2016:27748892}" "" "RGR c.722_723delCC (p.S242Yfs*29)" "heterozygous; not segregating in the family - mutation in unaffected family member, error in annotationm this change according to sequence is c.734_735del, p.(Ser245Tyrfs*29)" "Germline" "no" "" "0" "" "" "g.84257984_84257985del" "" "VUS (!)" "" "0000958448" "0" "50" "10" "86008715" "86008715" "subst" "2.84738E-5" "00006" "RGR_000028" "g.86008715G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.84248959G>A" "" "VUS" "ACMG" "0000958462" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00006" "RGR_000011" "g.86007463A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.84247707A>C" "" "VUS" "ACMG" "0000958621" "3" "50" "10" "86007463" "86007463" "subst" "3.65473E-5" "00006" "RGR_000011" "g.86007463A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.84247707A>C" "" "VUS" "ACMG" "0000959056" "0" "50" "10" "86008778" "86008778" "subst" "8.13001E-6" "00006" "RGR_000046" "g.86008778C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2; no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.84249022C>T" "" "VUS" "ACMG" "0001059078" "0" "70" "10" "86012740" "86012740" "subst" "0" "00006" "RGR_000047" "g.86012740C>A" "" "{PMID:Retterer 2016:26633542}" "" "NM_001012722.1:c.486C>A" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.84252984C>A" "" "likely pathogenic" "" "0001065293" "0" "50" "10" "86014125" "86014125" "subst" "4.06075E-6" "02325" "RGR_000048" "g.86014125G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes RGR ## Count = 108 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000019507" "00017698" "90" "371" "0" "371" "0" "c.371G>A" "r.(?)" "p.(Arg124His)" "4" "0000060183" "00017698" "10" "756" "5" "756" "5" "c.756+5A>G" "r.(spl?)" "p.(?)" "6i" "0000060184" "00017698" "10" "756" "5" "756" "5" "c.756+5A>G" "r.(spl?)" "p.(?)" "6i" "0000255271" "00017698" "30" "756" "5" "756" "5" "c.756+5A>G" "r.spl?" "p.?" "" "0000294826" "00017698" "30" "183" "0" "183" "0" "c.183G>A" "r.(?)" "p.(Ala61=)" "" "0000294827" "00017698" "10" "330" "0" "330" "0" "c.330T>C" "r.(?)" "p.(Ser110=)" "" "0000294828" "00017698" "30" "371" "-15" "371" "-15" "c.371-15C>A" "r.(=)" "p.(=)" "" "0000297662" "00017698" "10" "27" "0" "27" "0" "c.27T>C" "r.(?)" "p.(Thr9=)" "" "0000297663" "00017698" "10" "471" "0" "471" "0" "c.471C>T" "r.(?)" "p.(Tyr157=)" "" "0000307058" "00017698" "50" "34" "0" "34" "0" "c.34G>A" "r.(?)" "p.(Gly12Arg)" "" "0000307059" "00017698" "30" "544" "0" "544" "0" "c.544T>C" "r.(?)" "p.(Phe182Leu)" "" "0000340495" "00017698" "10" "19" "0" "19" "0" "c.19C>T" "r.(?)" "p.(Leu7=)" "" "0000340496" "00017698" "10" "27" "0" "27" "0" "c.27T>C" "r.(?)" "p.(Thr9=)" "" "0000340497" "00017698" "10" "471" "0" "471" "0" "c.471C>T" "r.(?)" "p.(Tyr157=)" "" "0000349133" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000476985" "00017698" "50" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "" "0000476986" "00017698" "50" "110" "0" "110" "0" "c.110C>T" "r.(?)" "p.(Thr37Ile)" "" "0000476987" "00017698" "50" "404" "0" "404" "0" "c.404T>C" "r.(?)" "p.(Leu135Pro)" "" "0000476988" "00017698" "50" "500" "0" "500" "0" "c.500C>T" "r.(?)" "p.(Thr167Ile)" "" "0000476989" "00017698" "10" "734" "0" "734" "0" "c.734C>T" "r.(?)" "p.(Ser245Phe)" "" "0000477578" "00017698" "10" "734" "0" "734" "0" "c.734C>T" "r.(?)" "p.(Ser245Phe)" "" "0000541136" "00017698" "30" "262" "0" "262" "0" "c.262G>A" "r.(?)" "p.(Gly88Ser)" "" "0000541137" "00017698" "30" "330" "0" "330" "0" "c.330T>C" "r.(?)" "p.(Ser110=)" "" "0000541138" "00017698" "50" "505" "0" "505" "0" "c.505G>T" "r.(?)" "p.(Asp169Tyr)" "" "0000541139" "00017698" "30" "697" "0" "697" "0" "c.697A>C" "r.(?)" "p.(Ile233Leu)" "" "0000541140" "00017698" "10" "756" "5" "756" "5" "c.756+5A>G" "r.spl?" "p.?" "" "0000541141" "00017698" "50" "821" "0" "821" "0" "c.821A>G" "r.(?)" "p.(Glu274Gly)" "" "0000622439" "00017698" "50" "505" "0" "505" "0" "c.505G>T" "r.(?)" "p.(Asp169Tyr)" "" "0000684558" "00017698" "70" "466" "0" "466" "0" "c.466C>A" "r.(?)" "p.(His156Asn)" "" "0000684559" "00017698" "70" "734" "0" "734" "0" "c.734C>T" "r.(?)" "p.(Ser245Phe)" "" "0000684560" "00017698" "70" "756" "5" "756" "5" "c.756+5A>G" "r.spl" "p.?" "" "0000690808" "00017698" "30" "183" "0" "183" "0" "c.183G>A" "r.(?)" "p.(Ala61=)" "" "0000701888" "00017698" "50" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000711702" "00017698" "70" "734" "0" "734" "0" "c.734C>T" "r.(?)" "p.(Ser245Phe)" "6" "0000713380" "00017698" "90" "833" "0" "834" "0" "c.833_834insG" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000722969" "00017698" "50" "262" "0" "262" "0" "c.262G>A" "r.(?)" "p.(Gly88Ser)" "" "0000732542" "00017698" "90" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000760095" "00017698" "50" "505" "0" "505" "0" "c.505G>T" "r.(?)" "p.(Asp169Tyr)" "" "0000765443" "00017698" "90" "266" "0" "266" "0" "c.266C>A" "r.(?)" "p.(Ser89Ter)" "" "0000784482" "00017698" "50" "642" "10" "642" "10" "c.642+10C>T" "r.(=)" "p.(=)" "" "0000784545" "00017698" "50" "269" "0" "269" "0" "c.269A>G" "r.(?)" "p.(Asp90Gly)" "" "0000788522" "00017698" "50" "286" "0" "286" "0" "c.286G>A" "r.(?)" "p.(Gly96Ser)" "3" "0000790144" "00017698" "50" "123" "0" "123" "0" "c.123C>T" "r.(=)" "p.(=)" "2" "0000790145" "00017698" "10" "760" "-38" "760" "-38" "c.760-38C>T" "r.spl?" "p.?" "6i" "0000790598" "00017698" "50" "262" "0" "262" "0" "c.262G>A" "r.(?)" "p.(?)" "" "0000790640" "00017698" "50" "756" "5" "756" "5" "c.756+5A>G" "r.spl?" "p.(?)" "" "0000793737" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000794818" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000796869" "00017698" "70" "466" "0" "466" "0" "c.466C>A" "r.(?)" "p.(His156Asn)" "4" "0000798503" "00017698" "30" "-111" "0" "-111" "0" "c.-111A>G" "r.(=)" "p.(=)" "1" "0000798504" "00017698" "10" "19" "0" "19" "0" "c.19C>T" "r.(=)" "p.(=)" "1" "0000798505" "00017698" "10" "27" "0" "27" "0" "c.27T>C" "r.(=)" "p.(=)" "1" "0000798506" "00017698" "30" "79" "59" "79" "59" "c.79+59C>T" "r.(=)" "p.(=)" "1i" "0000798507" "00017698" "10" "466" "0" "466" "0" "c.466C>A" "r.(?)" "p.(His156Asn)" "4" "0000798508" "00017698" "10" "466" "0" "466" "0" "c.466C>A" "r.(?)" "p.(His156Asn)" "4" "0000798509" "00017698" "30" "474" "0" "474" "0" "c.474C>T" "r.(=)" "p.(=)" "4" "0000798510" "00017698" "30" "642" "16" "642" "16" "c.642+16G>A" "r.(?)" "p.?" "5i" "0000798511" "00017698" "30" "953" "0" "953" "0" "c.*65A>G" "r.(=)" "p.(=)" "7" "0000798512" "00017698" "30" "988" "0" "989" "0" "c.*100_*101insA" "r.(?)" "p.?" "7_2" "0000804589" "00017698" "50" "88" "0" "88" "0" "c.88G>A" "r.(?)" "p.(Gly30Ser)" "" "0000804590" "00017698" "50" "556" "0" "576" "0" "c.556_576del" "r.(?)" "p.(Phe186_Pro192del)" "" "0000804591" "00017698" "30" "762" "0" "762" "0" "c.762C>A" "r.(?)" "p.(Pro254=)" "" "0000813219" "00017698" "30" "756" "5" "756" "5" "c.756+5A>G" "r.spl?" "p.?" "6i" "0000813677" "00017698" "70" "371" "0" "371" "0" "c.371G>A" "r.(?)" "p.(Arg124His)" "" "0000815602" "00017698" "50" "397" "0" "397" "0" "c.397G>A" "r.(?)" "p.(Val133Ile)" "" "0000818975" "00017698" "50" "237" "-1" "370" "1" "c.(236+1_237-1)_(370+1_371-1)del" "r.?" "p.?" "2i_3i" "0000820016" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000820017" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000821352" "00017698" "90" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000822119" "00017698" "70" "454" "0" "454" "0" "c.454C>A" "r.(?)" "p.(Leu152Met)" "4" "0000822120" "00017698" "70" "756" "5" "756" "5" "c.756+5A>G" "r.spl?" "p.?" "6i" "0000822158" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000822160" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000822162" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000822167" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000822489" "00017698" "70" "236" "0" "236" "0" "c.236G>A" "r.(?)" "p.(Arg79His)" "2" "0000822490" "00017698" "70" "236" "0" "236" "0" "c.236G>A" "r.(?)" "p.(Arg79His)" "2" "0000828561" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "2" "0000852602" "00017698" "50" "229" "0" "229" "0" "c.229C>T" "r.(?)" "p.(Leu77Phe)" "" "0000852603" "00017698" "30" "466" "0" "466" "0" "c.466C>A" "r.(?)" "p.(His156Asn)" "" "0000868762" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868763" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868764" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868765" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868766" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868767" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868768" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868769" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868770" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868779" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868780" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868781" "00017698" "70" "836" "0" "836" "0" "c.836dup" "r.(?)" "p.(Ile280Asnfs*78)" "" "0000868782" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000868783" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000868784" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000868785" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000868786" "00017698" "70" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000868789" "00017698" "70" "266" "0" "266" "0" "c.266C>A" "r.(?)" "p.(Ser89*)" "" "0000868790" "00017698" "70" "266" "0" "266" "0" "c.266C>A" "r.(?)" "p.(Ser89*)" "" "0000868791" "00017698" "70" "266" "0" "266" "0" "c.266C>A" "r.(?)" "p.(Ser89*)" "" "0000868792" "00017698" "70" "734" "0" "735" "0" "c.734_735del" "r.(?)" "p.(Ser245Tyrfs*29)" "" "0000868793" "00017698" "70" "734" "0" "735" "0" "c.734_735del" "r.(?)" "p.(Ser245Tyrfs*29)" "" "0000958448" "00017698" "50" "286" "0" "286" "0" "c.286G>A" "r.(?)" "p.(Gly96Ser)" "" "0000958462" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000958621" "00017698" "50" "196" "0" "196" "0" "c.196A>C" "r.(?)" "p.(Ser66Arg)" "" "0000959056" "00017698" "50" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0001059078" "00017698" "70" "498" "0" "498" "0" "c.498C>A" "r.(?)" "p.(Cys166Ter)" "" "0001065293" "00017698" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Ala190Thr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 81 "{{screeningid}}" "{{variantid}}" "0000001605" "0000019507" "0000033163" "0000060183" "0000033195" "0000060184" "0000234277" "0000476985" "0000234278" "0000476986" "0000234279" "0000476987" "0000234280" "0000476988" "0000234281" "0000476989" "0000234870" "0000477578" "0000309685" "0000684558" "0000309686" "0000684559" "0000309687" "0000684560" "0000319224" "0000701888" "0000327909" "0000711702" "0000329257" "0000713380" "0000334610" "0000732542" "0000360216" "0000760095" "0000364578" "0000765443" "0000373949" "0000784482" "0000373980" "0000784545" "0000376632" "0000788522" "0000377719" "0000790144" "0000377720" "0000790145" "0000377989" "0000790598" "0000378002" "0000790640" "0000380592" "0000793737" "0000381388" "0000794818" "0000382910" "0000796869" "0000384073" "0000798503" "0000384074" "0000798504" "0000384075" "0000798505" "0000384076" "0000798506" "0000384077" "0000798507" "0000384078" "0000798508" "0000384078" "0000798509" "0000384079" "0000798510" "0000384080" "0000798511" "0000384081" "0000798512" "0000386002" "0000813219" "0000386270" "0000813677" "0000387434" "0000815602" "0000389741" "0000818975" "0000390671" "0000820016" "0000390672" "0000820017" "0000391603" "0000821352" "0000391997" "0000822119" "0000392017" "0000822120" "0000392063" "0000822158" "0000392064" "0000822160" "0000392065" "0000822162" "0000392068" "0000822167" "0000392247" "0000822489" "0000392247" "0000822490" "0000396859" "0000828561" "0000411589" "0000868762" "0000411590" "0000868763" "0000411591" "0000868764" "0000411592" "0000868765" "0000411593" "0000868766" "0000411594" "0000868767" "0000411595" "0000868768" "0000411596" "0000868769" "0000411597" "0000868770" "0000411598" "0000868779" "0000411599" "0000868780" "0000411600" "0000868781" "0000411601" "0000868782" "0000411602" "0000868783" "0000411603" "0000868784" "0000411604" "0000868785" "0000411605" "0000868786" "0000411607" "0000868789" "0000411608" "0000868790" "0000411609" "0000868791" "0000411610" "0000868792" "0000411611" "0000868793" "0000448573" "0000958448" "0000448589" "0000958462" "0000448847" "0000958621" "0000449289" "0000959056" "0000470956" "0001059078"