### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = RHO) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "RHO" "rhodopsin" "3" "q21-q24" "unknown" "NG_009115.1" "UD_132119099601" "" "https://www.LOVD.nl/RHO" "Mutations of the Rhodopsin Gene " "1" "10012" "6010" "180380" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/RHO_NM_000539.3_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2019-06-28 19:14:31" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001707" "RHO" "rhodopsin" "001" "NM_000539.3" "" "NP_000530.1" "" "" "" "-95" "2673" "1047" "129247482" "129254187" "00000" "2012-09-13 13:46:43" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01339" "-" "fundus albipunctatus (retinitis punctata albescens (RPA))" "AD;AR" "136880" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-12-17 16:27:42" "01680" "BCD" "dystrophy, corneoretinal, crystalline, Bietti (BCD)" "AR" "210370" "eyes" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02943" "CSNBAD1" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "610445" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03409" "RP4" "retinitis pigmentosa, type 4 (RP4)" "AD;AR" "613731" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05130" "CSNB" "blindness, night, stationary, congenital (CSNB)" "" "" "" "" "" "00006" "2016-02-03 23:24:36" "" "" "05415" "USH" "Usher syndrome (USH)" "" "" "" "" "" "00006" "2018-04-02 16:40:44" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "RHO" "01339" "RHO" "02943" "RHO" "03409" ## Individuals ## Do not remove or alter this header ## ## Count = 1946 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000008" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000029" "" "" "" "1" "" "00004" "{PMID:Almomani 2011:21102627}" "" "" "" "" "" "0" "" "" "" "" "00000041" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000101" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00001781" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00033120" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" "" "00033140" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033159" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00207607" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00232421" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232422" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232423" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232424" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232425" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232426" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232427" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232428" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232429" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232430" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232431" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232432" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232433" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232434" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232435" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232436" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232437" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232438" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232439" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232440" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232441" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232442" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232443" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232444" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232445" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232446" "" "" "" "97" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232447" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232448" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232449" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232450" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232451" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232452" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233657" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233658" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00246668" "" "" "" "1" "" "00006" "{PMID:Dryja 1993:8358437}" "" "M" "no" "United States" "" "0" "" "" "" "patient" "00246669" "" "" "" "1" "" "00006" "{PMID:Rao 1994:8107847}" "" "" "" "United States" "" "0" "" "" "" "" "00246670" "" "" "" "8" "" "00006" "{PMID:al-Jandal 1999:9888392}" "4-generation family, 8 affected (2F, 6M)" "F;M" "no" "Ireland" "" "0" "" "" "" "FamTCD/BC" "00269943" "" "" "" "1" "" "01848" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Italy" "" "0" "" "" "" "Fam22P26" "00293212" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293213" "" "" "" "143" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00300246" "" "" "" "3" "" "00006" "{PMID:Wang 2017:28837730}" "3-generation family, 3 affected (3F)" "F" "" "China" "" "0" "" "" "" "Fam" "00304924" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308543" "" "" "" "4" "" "00004" "{PMID:Holtan 2020:31429209}" "4 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308544" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308545" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308546" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308547" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308548" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308549" "" "" "" "4" "" "00004" "{PMID:Holtan 2020:31429209}" "4 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308640" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00308641" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00309358" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309359" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309360" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309361" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309362" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309363" "" "" "" "1" "" "00004" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309364" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309365" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309366" "" "" "" "1" "" "00004" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309367" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309368" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00319822" "" "" "" "1" "" "00008" "{PMID:Scholl 2001:11372548}" "" "M" "" "" "" "0" "" "" "" "" "00319835" "" "" "" "29" "" "00008" "{PMID:Milla 2002:12221539}" "" "" "" "Spain" "" "0" "" "" "" "" "00325450" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3065" "00325494" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3627" "00326679" "" "" "" "4" "" "00008" "{PMID:Ziviello 2005:15994872}" "" "" "" "Italy" "" "0" "" "" "" "" "00326680" "" "" "" "2" "" "00008" "{PMID:Ziviello 2005:15994872}" "" "" "" "Italy" "" "0" "" "" "" "" "00326681" "" "" "" "1" "" "00008" "{PMID:Ziviello 2005:15994872}" "" "" "" "Italy" "" "0" "" "" "" "" "00326692" "" "" "" "1" "" "00008" "{PMID:Mandal 2005:16123440}" "" "" "" "" "" "0" "" "" "" "" "00326702" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326703" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326704" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326705" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326706" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326707" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326708" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326709" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326710" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326711" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326712" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326713" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326714" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326715" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326716" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326717" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326718" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326719" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326720" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326721" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326722" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326723" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326724" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326725" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326726" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326727" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326728" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326729" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326730" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326731" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326732" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326733" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326734" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326735" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326736" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326737" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326738" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326739" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326740" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326741" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326742" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326743" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326744" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326745" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326746" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326747" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326748" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326749" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326750" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326751" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326752" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326753" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326754" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326755" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326756" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326757" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326758" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00326759" "" "" "" "1" "" "00008" "{PMID:Sohocki 2001:11139241}" "" "" "" "" "" "0" "" "" "" "" "00328037" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001401" "00328052" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001428" "00328088" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G005022" "00328090" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G005167" "00328166" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G006301" "00328174" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G007664" "00328299" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000175" "00328401" "" "" "" "1" "" "00000" "{PMID:Zhou 2018:29453956}" "" "" "" "China" "" "0" "" "" "" "711600" "00328435" "" "" "" "1" "" "00000" "{PMID:Zhou 2018:29453956}" "" "" "" "China" "" "0" "" "" "" "691023" "00328479" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15015157" "00331270" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "F" "" "Japan" "" "0" "" "" "" "Pat24" "00331271" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat25" "00332499" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat24" "00332526" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "" "F" "" "United States" "" "0" "" "" "" "Pat4" "00332529" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "F" "" "United States" "" "0" "" "" "" "Pat7" "00332532" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "F" "" "United States" "" "0" "" "" "" "Pat14" "00332538" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "M" "" "United States" "" "0" "" "" "" "Pat23" "00333359" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat10" "00333386" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD11–03" "00333406" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD5–04" "00333407" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD13–02" "00333408" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD12–08" "00333409" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD12–07" "00333512" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "57" "00333513" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "58" "00333514" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "60" "00333515" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "61" "00333516" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "63" "00333517" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "64" "00333518" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "65" "00333570" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "245" "00333571" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "246" "00333572" "" "" "" "4" "" "00000" "{PMID:Stone 2017:28559085}" "family, 4 affected" "M" "" "(United States)" "" "0" "" "" "" "247" "00333573" "" "" "" "10" "" "00000" "{PMID:Stone 2017:28559085}" "family, 10 affected" "M" "" "(United States)" "" "0" "" "" "" "248" "00333574" "" "" "" "13" "" "00000" "{PMID:Stone 2017:28559085}" "family, 13 affected" "F" "" "(United States)" "" "0" "" "" "" "249" "00333575" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "250" "00333576" "" "" "" "5" "" "00000" "{PMID:Stone 2017:28559085}" "family, 5 affected" "F" "" "(United States)" "" "0" "" "" "" "251" "00333595" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "304" "00333596" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "305" "00333597" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "306" "00333598" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "307" "00333599" "" "" "" "5" "" "00000" "{PMID:Stone 2017:28559085}" "family, 5 affected" "M" "" "(United States)" "" "0" "" "" "" "308" "00333600" "" "" "" "4" "" "00000" "{PMID:Stone 2017:28559085}" "family, 4 affected" "F" "" "(United States)" "" "0" "" "" "" "309" "00333601" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "310" "00333602" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "311" "00333603" "" "" "" "5" "" "00000" "{PMID:Stone 2017:28559085}" "family, 5 affected" "M" "" "(United States)" "" "0" "" "" "" "313" "00333604" "" "" "" "5" "" "00000" "{PMID:Stone 2017:28559085}" "family, 5 affected" "M" "" "(United States)" "" "0" "" "" "" "314" "00333605" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "315" "00333606" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "316" "00333607" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "317" "00333608" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "318" "00333853" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "59" "00333854" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "62" "00333918" "" "" "" "3" "" "00000" "{PMID:Stone 2017:28559085}" "family, 3 affected" "M" "" "(United States)" "" "0" "" "" "" "312" "00333978" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "442" "00333979" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "443" "00333980" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "444" "00334430" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "family" "" "" "China" "" "0" "" "" "" "RP-017" "00335149" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "family" "" "no" "Netherlands" "" "0" "" "" "" "5932" "00335219" "" "" "" "2" "" "00000" "{PMID:Riera 2017:28181551}" "family, several affected" "" "" "Spain" "" "0" "" "" "" "Fi15/06" "00335299" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat8" "00335300" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "family" "" "" "Spain" "" "0" "" "" "" "Pat15" "00335301" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat68" "00335385" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP018" "00335386" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP033" "00335403" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP057" "00335439" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP084" "00335492" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD026" "00335543" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_001" "00335544" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_002" "00335545" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_003" "00335546" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_004" "00335547" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_005" "00335548" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_006" "00335549" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_007" "00335550" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_008" "00335551" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_009" "00335552" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_010" "00335553" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_011" "00335554" "" "" "" "1" "" "00000" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Belgium" "" "0" "" "" "" "FAM_012" "00335680" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335681" "" "" "" "20" "" "00008" "{PMID:Sullivan 2006:16799052}" "20 families" "" "" "United States" "" "0" "" "" "" "" "00335682" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335683" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335684" "" "" "" "8" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335685" "" "" "" "2" "" "00008" "{PMID:Sullivan 2006:16799052}" "2 families" "" "" "United States" "" "0" "" "" "" "" "00335686" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335687" "" "" "" "8" "" "00008" "{PMID:Sullivan 2006:16799052}" "4 families" "" "" "United States" "" "0" "" "" "" "" "00335688" "" "" "" "20" "" "00008" "{PMID:Sullivan 2006:16799052}" "3 families" "" "" "United States" "" "0" "" "" "" "" "00335689" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335690" "" "" "" "7" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335691" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335692" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335693" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335694" "" "" "" "3" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335695" "" "" "" "2" "" "00008" "{PMID:Sullivan 2006:16799052}" "2 families" "" "" "United States" "" "0" "" "" "" "" "00335696" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335697" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335698" "" "" "" "7" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335699" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335700" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335701" "" "" "" "11" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335702" "" "" "" "2" "" "00008" "{PMID:Sullivan 2006:16799052}" "2 families" "" "" "United States" "" "0" "" "" "" "" "00335703" "" "" "" "4" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335704" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335705" "" "" "" "2" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335706" "" "" "" "1" "" "00008" "{PMID:Sullivan 2006:16799052}" "1 family" "" "" "United States" "" "0" "" "" "" "" "00335734" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Spain" "" "0" "" "" "" "RP133" "00335735" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Spain" "" "0" "" "" "" "RP105" "00335736" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Spain" "" "0" "" "" "" "RP135" "00335737" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Spain" "" "0" "" "" "" "RP146" "00335949" "" "" "" "1" "" "00000" "{PMID:Roberts 2016:27898983}" "family, see paper" "" "" "South Africa" "" "0" "" "" "Xhosa" "RP1010" "00358734" "" "" "" "1" "" "00000" "{PMID:Carrigan 2016:27624628}" "" "" "" "Ireland" "" "0" "" "" "" "" "00358735" "" "" "" "1" "" "00000" "{PMID:Carrigan 2016:27624628}" "" "" "" "Ireland" "" "0" "" "" "" "" "00358736" "" "" "" "1" "" "00000" "{PMID:Carrigan 2016:27624628}" "" "" "" "Ireland" "" "0" "" "" "" "" "00358794" "" "" "" "1" "" "00000" "{PMID:Zhang 2016:27596865}" "simplex case" "M" "" "United States" "" "0" "" "" "Hispanic" "BLM088" "00358928" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27391102}" "" "" "" "Switzerland" "" "0" "" "" "" "Case27485" "00358950" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71876" "00359001" "" "" "" "5" "" "00006" "{PMID:Abdulridha-Aboud 2016:27212874}" "4-generation family, 5 affected (4F, 1M)" "F" "" "Sweden" "" "0" "" "" "" "FamBPatII1" "00359129" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12007876" "00359141" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13012574" "00359154" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13008977" "00359170" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12015561" "00359192" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13016341" "00359212" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13006601" "00361426" "" "" "" "1" "" "04036" "{PMID:Xu 2014:24938718}" "index case" "M" "no" "China" "" "0" "" "" "Asia" "RP405" "00361444" "" "" "" "1" "" "04036" "{PMID:Jin 2008:18310263}" "index case" "" "" "Japan" "" "0" "" "" "Asia" "S_0101" "00362253" "" "" "" "3" "" "02404" "{PMID:Bahena 2021:34148116}" "" "M" "yes" "Iran" "" "0" "" "" "" "Pat45" "00362890" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ADRP298" "00362891" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ADRP308" "00363392" "" "" "" "1" "" "00000" "{PMID:Sun 2015:26747767}" "proband" "" "" "China" "" "0" "" "" "" "HM244" "00363405" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363406" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363407" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363408" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363409" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363410" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363411" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363412" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363413" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363414" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363421" "" "" "" "1" "" "00000" "{PMID:Coussa 2015:26720483}" "index patient" "" "" "Canada" "" "0" "" "" "French-Canadian" "" "00363440" "" "" "" "4" "" "00000" "{PMID:Ge 2015:26667666}" "3-generation family, 4 affected (2F, 2M)" "F;M" "" "United States" "" "0" "" "" "" "5A2+H.62" "00363467" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "S7+G.76" "00363468" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "5VY+V.14" "00363504" "" "" "" "1" "" "00000" "{PMID:Yang 2015:26496393}" "family" "M" "" "China" "" "0" "" "" "Han" "RP98" "00363505" "" "" "" "1" "" "00000" "{PMID:Yang 2015:26496393}" "family" "M" "" "China" "" "0" "" "" "Han" "RP154" "00363506" "" "" "" "1" "" "00000" "{PMID:Yang 2015:26496393}" "family" "M" "" "China" "" "0" "" "" "Han" "RP152" "00372081" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "family" "" "" "Korea" "" "0" "" "" "" "F09" "00372084" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "family" "" "" "Korea" "" "0" "" "" "" "F13" "00372500" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "688" "00372623" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP314" "00372624" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP209" "00372625" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP221" "00372626" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP295" "00372627" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP253" "00372628" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP373" "00372629" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP042" "00372630" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP100" "00372631" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP343" "00372701" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP391" "00373339" "" "" "" "4" "" "00006" "{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}" "5-generation family, 4 affected (3F, M), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "Pakistan" "" "0" "" "" "" "FamMA62" "00373370" "" "" "" "1" "" "00000" "{PMID:Van Huet 2015:25999674}" "" "" "" "Netherlands" "" "0" "" "" "" "" "00373467" "" "" "" "2" "" "00000" "{PMID:Fernandez-San Jose 2015:25698705}" "family, 2 affected" "" "" "Spain" "" "0" "" "" "" "RP0642" "00373510" "" "" "" "1" "" "00000" "{PMID:Liu 2015:25611614}" "" "" "" "China" "" "0" "" "" "" "RH16" "00373512" "" "" "" "9" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "4-generation family, 9 affected (3F, 6M)" "M" "" "Spain" "" "0" "" "" "" "RP453PatIV1" "00373513" "" "" "00373512" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "" "F" "" "Spain" "" "0" "" "" "" "RP453PatIII2" "00373514" "" "" "00373512" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "" "M" "" "Spain" "" "0" "" "" "" "RP453PatIII3" "00373515" "" "" "00373512" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "" "F" "" "Spain" "" "0" "" "" "" "RP453PatIII6" "00373516" "" "" "00373512" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "" "M" "" "Spain" "" "0" "" "" "" "RP453PatIV4" "00373517" "" "" "00373512" "1" "" "00000" "{PMID:Gonzalez-del Pozo 2014:25544989}" "" "M" "" "Spain" "" "0" "" "" "" "RP453PatIV5" "00373816" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat13" "00373819" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat16" "00373912" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-293-636" "00373915" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-311-746" "00373920" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-390-845" "00373945" "" "" "" "1" "" "00000" "{PMID:Pierrottet 2014:25366773}" "" "" "" "Italy" "" "0" "" "" "" "P2 [F2]" "00373950" "" "" "" "1" "" "00000" "{PMID:Pierrottet 2014:25366773}" "" "" "" "Italy" "" "0" "" "" "" "P22" "00373958" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1927" "00373959" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0706" "00373960" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐2179" "00373961" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0041" "00373962" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0820" "00373963" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1908" "00373964" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "ONCE‐0169" "00373965" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0890" "00373966" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0242" "00373967" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0515" "00373968" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1584" "00373969" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0314" "00373970" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1188" "00373971" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1876" "00373972" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0269" "00373973" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0727" "00373974" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1930" "00373975" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1458" "00373976" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1941" "00373977" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐2021" "00373978" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1125" "00373979" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0568" "00373980" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0913" "00373981" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1672" "00373982" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0640" "00373983" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1375" "00373984" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1952" "00373985" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0115" "00373986" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0352" "00373987" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0188" "00373988" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0328" "00373989" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0566" "00373990" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0206" "00373991" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0220" "00373992" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0542" "00373993" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0685" "00373994" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0900" "00373995" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐0975" "00373996" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1453" "00373997" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1472" "00373998" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐1697" "00373999" "" "" "" "1" "" "00000" "{PMID:Fernandez 2014:25408095}" "" "" "" "Spain" "" "0" "" "" "" "RP‐2181" "00374910" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "F5-1" "00374926" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "S11-1" "00374928" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "W83-1" "00374935" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "W90-1" "00375283" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K1841" "00375284" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6348" "00375285" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6556" "00375286" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6381" "00375304" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6034" "00375305" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6060" "00375306" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6431" "00375410" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#001" "00375453" "" "" "" "1" "" "00000" "{PMID:Pan 2014:24940031}" "2-generation family, 1 affected (M)" "" "" "China" "" "0" "" "" "" "Fam06" "00376168" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376176" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376177" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376183" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376185" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376294" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376482" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376483" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376484" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376485" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376486" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376487" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376488" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376489" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "F" "" "" "" "0" "" "" "Chinese" "" "00376501" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "" "" "" "" "0" "" "" "Chinese" "" "00376502" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "" "" "" "" "0" "" "" "Chinese" "" "00376503" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "" "" "" "" "0" "" "" "Chinese" "" "00376504" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "" "" "" "" "0" "" "" "Chinese" "" "00376505" "" "" "" "1" "" "00000" "{PMID:Lim-2009:19506198}" "" "" "" "" "" "0" "" "" "Chinese" "" "00376525" "" "" "" "1" "" "00000" "{PMID:Zeitz-2009:19578023}" "" "" "" "" "" "0" "" "" "" "" "00376526" "" "" "" "1" "" "00000" "{PMID:Zeitz-2009:19578023}" "" "" "" "" "" "0" "" "" "" "" "00376527" "" "" "" "1" "" "00000" "{PMID:Zeitz-2009:19578023}" "" "" "" "" "" "0" "" "" "" "" "00376528" "" "" "" "7" "" "00000" "{PMID:Zeitz-2009:19578023} {PMID:Zeitz 2008:18487375}" "7 affected het, 4 unaffected wt" "" "" "Switzerland" "" "0" "" "" "" "" "00376746" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "41" "00376769" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "33" "00376776" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "40" "00376783" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "49" "00376993" "" "" "" "1" "" "00000" "{PMID:Matias-Florentino-2009:19958124}" "" "F" "" "Mexico" "" "0" "" "" "Mexican" "" "00376994" "" "" "" "1" "" "00000" "{PMID:Matias-Florentino-2009:19958124}" "" "" "" "Mexico" "" "0" "" "" "Mexican" "" "00376995" "" "" "" "1" "" "00000" "{PMID:Matias-Florentino-2009:19958124}" "" "" "" "Mexico" "" "0" "" "" "Mexican" "" "00376996" "" "" "" "1" "" "00000" "{PMID:Matias-Florentino-2009:19958124}" "" "" "" "Mexico" "" "0" "" "" "Mexican" "" "00376997" "" "" "" "1" "" "00000" "{PMID:Matias-Florentino-2009:19958124}" "" "" "" "Mexico" "" "0" "" "" "Mexican" "" "00377215" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "311" "00377241" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "353" "00377246" "" "" "" "5" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "359" "00377247" "" "" "00377246" "1" "" "00000" "Tracewska 2021, MolVis in press" "brother\'s son" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "590" "00377248" "" "" "00377246" "1" "" "00000" "Tracewska 2021, MolVis in press" "brother" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "586" "00377249" "" "" "00377246" "1" "" "00000" "Tracewska 2021, MolVis in press" "daughter" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "587" "00377250" "" "" "00377246" "1" "" "00000" "Tracewska 2021, MolVis in press" "father" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "585" "00377252" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "362" "00377416" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377417" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377418" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377419" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377420" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377421" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377422" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377423" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377424" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377425" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377426" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377427" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377428" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377429" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377430" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377431" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377432" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377433" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377434" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377435" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377436" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377437" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377438" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377439" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377440" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377441" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377442" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377443" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377444" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377445" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377446" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377447" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377448" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377449" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377450" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377451" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377452" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377453" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377454" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377455" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377456" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377457" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377458" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377459" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377460" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377461" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377462" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377463" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377464" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377465" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377466" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377467" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377468" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "?" "00377512" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "RP-1383" "00377729" "" "" "" "1" "" "00000" "{PMID:Bowne 2011:20861475}" "Positive Control Sample" "" "no" "" "" "0" "" "" "" "" "00377730" "" "" "" "1" "" "00000" "{PMID:Bowne 2011:20861475}" "Positive Control Sample" "" "no" "" "" "0" "" "" "" "" "00379393" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "yes" "Netherlands" "" "0" "" "" "Turkish" "" "00379411" "" "" "" "1" "" "00000" "{PMID:Zhou 2011:29453956}" "" "" "" "China" "" "0" "" "" "" "" "00379450" "" "" "" "1" "" "00000" "{PMID:Zhou 2011:29453956}" "" "" "" "China" "" "0" "" "" "" "" "00379550" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0011" "00379601" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379602" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379603" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379604" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379605" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379606" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379607" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379608" "" "" "" "1" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379609" "" "" "" "4" "" "00000" "{PMID:Blanco-Kelly-2012:22736939}" "" "" "" "Spain" "" "0" "" "" "spanish" "" "00379667" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0053" "00379798" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0158" "00379799" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GJ_0159" "00379869" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016060102" "00379870" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016090901" "00379871" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016092101" "00379872" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016092102" "00379873" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016121203" "00379874" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016121220" "00380229" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380230" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380231" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380232" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "australian" "" "00380233" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380234" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380235" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380236" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380237" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380238" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "australian" "" "00380239" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380240" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380241" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380242" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380243" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380244" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380245" "" "" "" "1" "" "00000" "{PMID:Bunge_1993:08406457}" "" "" "" "" "" "0" "" "" "" "" "00380248" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "Mother of R0119:III-2" "F" "" "China" "" "0" "" "" "" "" "00380249" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "M" "" "China" "" "0" "" "" "" "" "00380250" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "M" "" "China" "" "0" "" "" "" "" "00380259" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "" "" "China" "" "0" "" "" "" "" "00380260" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "" "" "China" "" "0" "" "" "" "" "00380261" "" "" "" "1" "" "00000" "{PMID:Kim-2012:23049240}" "" "" "" "China" "" "0" "" "" "" "" "00380997" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" "" "00380999" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" "" "00381016" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23462753}" "" "" "" "China" "" "0" "" "" "Chinese" "" "00381098" "" "" "" "1" "" "00000" "{PMID:Gandra-2008:18552984}" "" "F" "" "India" "" "0" "" "" "Indian" "" "00381613" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381620" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381637" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Italy" "" "0" "" "" "" "" "00381647" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381668" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "" "" "0" "" "" "white" "" "00381674" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "" "00381680" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" "" "00381695" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" "" "00381734" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381735" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381736" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381737" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381738" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381739" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381740" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381741" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381742" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381743" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381744" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381745" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381746" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381747" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381748" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381749" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381750" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381751" "" "" "" "1" "" "00000" "{PMID:Sullivan-2013:23950152}" "" "" "no" "" "" "0" "" "" "" "" "00381805" "" "" "" "8" "" "00000" "{PMID:Ma-2013:23991373}" "" "" "" "China" "" "0" "" "" "chinese" "" "00381904" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "54" "00381905" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "55" "00381906" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "56" "00381907" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "57" "00382380" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "209" "00382381" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "210" "00382382" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "211" "00382383" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "212" "00382384" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "213" "00382385" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "214" "00382386" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "215" "00382387" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "216" "00382388" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "217" "00382389" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "218" "00382390" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "219" "00382391" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "220" "00382392" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "221" "00382393" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "222" "00382394" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "223" "00382395" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "224" "00382396" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "225" "00382397" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "226" "00382398" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "227" "00382399" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "228" "00382400" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "229" "00382789" "" "" "" "1" "" "00000" "{PMID:Azam-2011:21987686}" "" "" "yes" "Pakistan" "" "0" "" "" "pakistani" "" "00382794" "" "" "" "1" "" "00000" "{PMID:Azam-2011:21987686}" "" "" "yes" "Pakistan" "" "0" "" "" "pakistani" "" "00382831" "" "" "" "1" "" "00000" "{PMID:Mezer-2006:16767206}" "" "" "" "Canada" "" "0" "" "" "Canadian" "" "00382833" "" "" "" "1" "" "00000" "{PMID:Mezer-2006:16767206}" "" "" "" "Canada" "" "0" "" "" "Canadian" "" "00382834" "" "" "" "1" "" "00000" "{PMID:Mezer-2006:16767206}" "" "" "" "Canada" "" "0" "" "" "Canadian" "" "00382836" "" "" "" "1" "" "00000" "{PMID:Mezer-2006:16767206}" "" "" "" "Canada" "" "0" "" "" "Canadian" "" "00382837" "" "" "" "5" "" "00000" "{PMID:Mezer-2006:16767206}" "" "" "" "Canada" "" "0" "" "" "Canadian" "" "00383059" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383061" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383072" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383073" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383080" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383087" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383093" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383095" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383486" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383487" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383710" "" "" "00383709" "1" "" "00000" "{PMID:Stanwyck 2019:31193260}" "Family 1, individual IV-4" "M" "" "" "" "0" "" "" "" "GT-02" "00383806" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18184142_B" "00383837" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" "" "00384076" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2135" "00384274" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13348" "00384331" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13721" "00384746" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384747" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384774" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384775" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00385051" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19869" "00385724" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "127" "00385725" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "128" "00385877" "" "" "" "1" "" "00000" "{PMID:Birtel 2020:32013026}" "father of V:1 and V:2" "M" "" "(Germany)" "" "0" "" "" "white" "IV.3" "00385955" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "" "" "" "" "" "0" "" "" "" "" "00386164" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-108, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-253" "00386165" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-108, family member" "F" "" "Spain" "" "0" "" "" "" "RPN-254" "00386203" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-158, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-323" "00386302" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-SRT, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-443" "00386547" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "001-060" "00386549" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "001-099" "00386554" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "001-124" "00386565" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "001-591" "00386589" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "004-257" "00386619" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-094" "00386646" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-186" "00386675" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-643" "00386686" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "226-1064" "00386715" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2849_004434" "00386720" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2854_004439" "00386840" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI668_001345" "00386996" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "22" "00386997" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "23" "00386998" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "24" "00386999" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "25" "00387000" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "26" "00387001" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "27" "00387002" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "28" "00387003" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "29" "00387004" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "30" "00387005" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "31" "00387006" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "32" "00387007" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "33" "00387008" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "34" "00387009" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "35" "00387010" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "36" "00387011" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "37" "00387012" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "38" "00387013" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "39" "00387014" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "40" "00387015" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "41" "00387016" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "42" "00387384" "" "" "" "1" "" "00000" "{PMID:Sun 2020:32100970}" "" "F" "" "China" "" "0" "" "" "" "4" "00387385" "" "" "" "1" "" "00000" "{PMID:Sun 2020:32100970}" "" "F" "" "China" "" "0" "" "" "" "5" "00387514" "" "" "" "1" "" "00000" "{PMID:Matsui 2015:26393467}" "Previously described in Jacobson et al., 1994" "F" "" "United States" "" "0" "" "" "" "" "00388551" "" "" "" "1" "" "00000" "{PMID:Dineiro 2020:32483926}" "" "?" "" "Spain" "" "0" "" "" "" "OFTALMO.012" "00388724" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 4, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "8" "00388725" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 4, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "9" "00388726" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 4, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "10" "00388807" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 44, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "91" "00388847" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 58, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "131" "00388883" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 66, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "167" "00388884" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 66, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "168" "00388885" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 66, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "169" "00388981" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 89, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "265" "00388982" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 89, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "266" "00388983" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 89, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "267" "00388984" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 89, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "268" "00389107" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 129, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "391" "00389108" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 129, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "392" "00389109" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 129, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "393" "00389213" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 164, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "497" "00389214" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 164, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "498" "00389264" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 194, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "548" "00389265" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 194, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "549" "00389395" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 246, unclassified / mixed, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "679" "00389479" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 296, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "763" "00389480" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 296, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "764" "00389489" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 299, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "773" "00389496" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 302, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "780" "00389497" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 302, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "781" "00389513" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 315, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "797" "00389514" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 315, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "798" "00389532" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 332, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "816" "00389533" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 332, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "817" "00389534" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 332, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "818" "00389538" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 335, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "822" "00389539" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 335, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "823" "00389543" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 338, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "827" "00389582" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 359, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "866" "00389583" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 359, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "867" "00389607" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 373, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "891" "00389623" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 385, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "907" "00389649" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 406, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "933" "00389650" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 406, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "934" "00389674" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 426, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "958" "00389678" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 430, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "962" "00389686" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 436, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "970" "00389688" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 437, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "972" "00389689" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 437, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "973" "00389690" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 437, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "974" "00389691" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 437, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "975" "00389693" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 441, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "977" "00389694" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 441, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "978" "00389696" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 444, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "980" "00389697" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 444, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "981" "00389701" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 450, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "985" "00389702" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 450, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "986" "00389706" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 454, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "990" "00389707" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 454, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "991" "00389714" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 459, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "998" "00389715" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 460, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "999" "00389716" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 460, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1000" "00389717" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 460, autosomal dominant retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1001" "00389813" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 736, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1097" "00389833" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 762, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1117" "00389894" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 866, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1178" "00389940" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 965, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1224" "00389955" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1003, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1239" "00389957" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1008, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1241" "00389991" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1092, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1275" "00390008" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1138, sporadic retinitis pigmentosa , no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1292" "00390036" "" "" "" "1" "" "00000" "{PMID:Liu 2020:32562694}" "" "?" "" "China" "" "0" "" "" "" "G1498" "00390363" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001401" "00390364" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001428" "00390365" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005022" "00390366" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005167" "00390367" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006301" "00390368" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G007664" "00390369" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000175" "00391388" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "56" "00391585" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Middle Eastern" "84" "00392314" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "83" "00392316" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "120" "00392321" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "191073" "00392322" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "191098" "00392325" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "191140" "00392336" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "191369" "00392341" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "191468" "00392347" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "191549" "00392348" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19176" "00392349" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19191" "00392352" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19249" "00392357" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19422" "00392361" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19498" "00392364" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19544" "00392367" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19576" "00392368" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19609" "00392375" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19655" "00392376" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19671" "00392382" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19768" "00392383" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19780" "00392386" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19852" "00392387" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19875" "00392393" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "112" "00392552" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family A, brother of P2" "F" "" "Italy" "" "0" "" "" "" "P1" "00392553" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family A, sister of P1" "M" "" "Italy" "" "0" "" "" "" "P2" "00392554" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "" "M" "" "Italy" "" "0" "" "" "" "P5" "00392555" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "" "M" "" "Italy" "" "0" "" "" "" "P6" "00392556" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "" "F" "" "Italy" "" "0" "" "" "" "P8" "00392557" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family S, father of P10 , P11, brother of P13" "M" "" "Italy" "" "0" "" "" "" "P9" "00392558" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family S, daughter of P9" "F" "" "Italy" "" "0" "" "" "" "P11" "00392559" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family S, daughter of P9" "F" "" "Italy" "" "0" "" "" "" "P12" "00392560" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family S, brother of P9" "M" "" "Italy" "" "0" "" "" "" "P13" "00392561" "" "" "" "1" "" "00000" "{PMID:Verdina 2021:33688152}" "family S, daughter of P13" "F" "" "Italy" "" "0" "" "" "" "P14" "00392581" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "33" "00392609" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "72" "00392658" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "149" "00392778" "" "" "" "1" "" "00000" "{PMID:Donato-2021:33801777}" "" "M" "yes" "Egypt" "" "0" "" "" "" "II:1" "00392779" "" "" "" "1" "" "00000" "{PMID:Donato-2021:33801777}" "" "M" "yes" "Egypt" "" "0" "" "" "" "II:2" "00393440" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393534" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393599" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393606" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393611" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393640" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393733" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393910" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393914" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00394329" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "RP11" "00394506" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394507" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394508" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394509" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394510" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394511" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394512" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394513" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394514" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394515" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394516" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394517" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394518" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394519" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394520" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394521" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394522" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00395559" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-0118" "00395918" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F045" "00395934" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F129" "00395951" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F307" "00395971" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 16765, genetic ID: 23876" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P17" "00395972" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 2482, genetic ID: 1535" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P18" "00395973" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 1379, genetic ID: 4976" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P19" "00395974" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 1379, genetic ID: 22517" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P20" "00395975" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 3509, genetic ID: 21686" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P21" "00395976" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 3509, genetic ID: 9533" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P22" "00395977" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 1895, genetic ID: 9592" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P23" "00395978" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 3492, genetic ID: 10471" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P24" "00395979" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 2554, genetic ID: 9924" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P25" "00395980" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 19172, genetic ID: 29744" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P26" "00396486" "" "" "" "1" "" "00000" "{PMID:Dockery 2017:29099798}" "no patient numbers in the paper, consecutive numbers given" "?" "" "Ireland" "" "0" "" "" "" "19" "00396509" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396513" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00408421" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "13" "00409498" "" "" "" "1" "" "00000" "{PMID:Lockhart 2018:28698241}" "" "F" "" "" "" "0" "" "" "" "?" "00410607" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "proband" "M" "" "United States" "" "0" "" "" "" "A_Patient 1" "00410608" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "A_I:2" "00410609" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "A_II:2" "00410610" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "A_II:4" "00410611" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "A_II:7" "00410612" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "A_II:8" "00410613" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "A_III:2" "00410614" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "A_III:7" "00410615" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "A_IV:2" "00410616" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "proband" "F" "" "United States" "" "0" "" "" "" "B_Patient 2" "00410617" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "B_II:2" "00410618" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "B_III:3" "00410619" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "B_III:4" "00410620" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "B_III:5" "00410621" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "proband" "M" "" "United States" "" "0" "" "" "" "C_Patient 3" "00410622" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "C_II:2" "00410623" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "C_II:6" "00410624" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "C_III:1" "00410625" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "F" "" "United States" "" "0" "" "" "" "C_III:2" "00410626" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2215617}" "" "M" "" "United States" "" "0" "" "" "" "C_III:4" "00410627" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patI:2" "00410628" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patII:4" "00410629" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patII:6" "00410630" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "M" "" "United States" "" "0" "" "" "British" "fam5850patII:8" "00410631" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patII:15" "00410632" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "M" "" "United States" "" "0" "" "" "British" "fam5850patII:16" "00410633" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patIII:1" "00410634" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patIII:3" "00410635" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patIII:5" "00410636" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "F" "" "United States" "" "0" "" "" "British" "fam5850patIII:8" "00410637" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "British" "AD133" "00410638" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410639" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410640" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410641" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410642" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410643" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410644" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410645" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410646" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410647" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410648" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410649" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410650" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410651" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410652" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410653" "" "" "" "1" "" "00000" "{PMID:Dryja 1990:2137202}" "" "?" "" "United States" "" "0" "" "" "" "?" "00410654" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam5926patII:3" "00410655" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patI:5" "00410656" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patII:2" "00410657" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patII:5" "00410658" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patIII:1" "00410659" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5926patIII:4" "00410660" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patIII:7" "00410661" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5926patIII:8" "00410662" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5984patI:1" "00410663" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam5984patII:1" "00410664" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410665" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "F" "" "United States" "" "0" "" "" "" "fam6676patII:3" "00410666" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6676patI:2" "00410667" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6676patI:5" "00410668" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6676patI:7" "00410669" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6676patI:8" "00410670" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6676patII:1" "00410671" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6676patII:6" "00410672" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6676patII:8" "00410673" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6676patII:9" "00410674" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6676patIII:2" "00410675" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410676" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam6207patIII:2" "00410677" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6207patI:2" "00410678" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6207patII:1" "00410679" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5732patI:3" "00410680" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5732patII:1" "00410681" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam5732patII:3" "00410682" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5732patII:6" "00410683" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5732patII:9" "00410684" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5732patII:11" "00410685" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5732patIII:1" "00410686" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5732patIII:3" "00410687" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband: relatives refused to donate blood" "?" "" "United States" "" "0" "" "" "" "?" "00410688" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "F" "" "United States" "" "0" "" "" "" "fam6976patIII:3" "00410689" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6976patII:3" "00410690" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6976patIII:5" "00410691" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6976patIII:6" "00410692" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam6976patIII:7" "00410693" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "F" "" "United States" "" "0" "" "" "" "fam6078patII:1" "00410694" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6078patI:2" "00410695" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6078patII:5" "00410696" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband: relatives refused to donate blood" "?" "" "United States" "" "0" "" "" "" "?" "00410697" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam6995patIII:2" "00410698" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6995patII:2" "00410699" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6995patIII:4" "00410700" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam6995patIV:1" "00410701" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam0331patIII:1" "00410702" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam0331patIII:3" "00410703" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam0331patIII:5" "00410704" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam0331patIII:6" "00410705" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam0331patIV:1" "00410706" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam0331patIV:2" "00410707" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam2470patIII:7" "00410708" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam2470patIII:9" "00410709" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam2470patII:1" "00410710" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam2470patII:3" "00410711" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam2470patI:2" "00410712" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5067patI:1" "00410713" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "M" "" "United States" "" "0" "" "" "" "fam5067patII:4" "00410714" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5067patII:1" "00410715" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5067patII:2" "00410716" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5067patII:6" "00410717" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5067patII:8" "00410718" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "F" "" "United States" "" "0" "" "" "" "fam5067patiII:1" "00410719" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "F" "" "United States" "" "0" "" "" "" "fam5864patII:2" "00410720" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "" "M" "" "United States" "" "0" "" "" "" "fam5864patIIi:2" "00410721" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410722" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410723" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410724" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410725" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410726" "" "" "" "1" "" "00000" "{PMID:Dryja 1991:1833777}" "proband" "?" "" "United States" "" "0" "" "" "" "?" "00410727" "" "" "" "1" "" "00000" "{PMID:Dryja 1992:1358680}" "own laboratory results mentioned within a lecture, no patient or family mentioned" "?" "" "" "" "0" "" "" "" "?" "00410728" "" "" "" "1" "" "00000" "{PMID:Dryja 1992:1358680}" "own laboratory results mentioned within a lecture, no patient or family mentioned" "?" "" "" "" "0" "" "" "" "?" "00410729" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband" "M" "" "United States" "" "0" "" "" "" "VI:1" "00410730" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband\'s brother" "M" "" "United States" "" "0" "" "" "" "VI:2" "00410731" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband\'s 2nd degree cousin 1" "M" "" "United States" "" "0" "" "" "" "VI:5" "00410732" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband\'s 2nd degree cousin 1" "M" "" "United States" "" "0" "" "" "" "VI:7" "00410733" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband\'s father" "M" "" "United States" "" "0" "" "" "" "V:3" "00410734" "" "" "" "1" "" "00000" "{PMID:Gal 1991:1840561}" "proband\'s father\'s 1st degree cousin" "M" "" "United States" "" "0" "" "" "" "V:12" "00410736" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _1" "00410737" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _3" "00410738" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _4" "00410739" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _23" "00410740" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _8" "00410741" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _11" "00410742" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _12" "00410743" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _14" "00410744" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _15" "00410745" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _16" "00410746" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1985460}" "family ADRP14" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "ADRP14 _19" "00410771" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "III:1" "00410772" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "III:3" "00410773" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "III:6" "00410774" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "III:8" "00410775" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "III:9" "00410776" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:2" "00410777" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:4" "00410778" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:6" "00410779" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:7" "00410780" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:8" "00410781" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP10" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "IV:9" "00410782" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP38" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "?" "00410783" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP38" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "?" "00410784" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP38" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "?" "00410785" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "II:1" "00410786" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "III:1" "00410787" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "IV:2" "00410788" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "III:3" "00410789" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "IV:3" "00410790" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "IV:4" "00410791" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "IV:5" "00410792" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "III:5" "00410793" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "III:6" "00410794" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "II:3" "00410795" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "III:7" "00410796" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP25" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "IV:9" "00410797" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP30" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "Sardinian" "?" "00410798" "" "" "" "1" "" "00000" "{PMID:Keen 1991:1765377}" "family ADRP39" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "?" "00410813" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_1" "00410814" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_4" "00410815" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_5" "00410816" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_6" "00410817" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_7" "00410818" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "F" "" "United States" "" "0" "" "" "" "B1_2" "00410819" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "M" "" "United States" "" "0" "" "" "" "B1_4" "00410820" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "M" "" "United States" "" "0" "" "" "" "B1_6" "00410821" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "F" "" "United States" "" "0" "" "" "" "B1_8" "00410822" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "M" "" "United States" "" "0" "" "" "" "B1_10" "00410823" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "F" "" "United States" "" "0" "" "" "" "B1_11" "00410824" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "F" "" "United States" "" "0" "" "" "" "B1_12" "00410825" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "F" "" "United States" "" "0" "" "" "" "B1_14" "00410826" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "M" "" "United States" "" "0" "" "" "" "B1_15" "00410827" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B1" "M" "" "United States" "" "0" "" "" "" "B1_16" "00410828" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "F" "" "United States" "" "0" "" "" "" "B2_1" "00410829" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "M" "" "United States" "" "0" "" "" "" "B2_3" "00410830" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "F" "" "United States" "" "0" "" "" "" "B2_5" "00410831" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "F" "" "United States" "" "0" "" "" "" "B2_7" "00410832" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "F" "" "United States" "" "0" "" "" "" "B2_8" "00410833" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family B2" "F" "" "United States" "" "0" "" "" "" "B2_10" "00410834" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family C" "F" "" "United States" "" "0" "" "" "" "C_1" "00410835" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family C" "F" "" "United States" "" "0" "" "" "" "C_2" "00410836" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family C" "F" "" "United States" "" "0" "" "" "" "C_3" "00410837" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family C" "M" "" "United States" "" "0" "" "" "" "C_5" "00410838" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family C" "F" "" "United States" "" "0" "" "" "" "C_7" "00410839" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "F" "" "United States" "" "0" "" "" "" "D_1" "00410840" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "M" "" "United States" "" "0" "" "" "" "D_2" "00410841" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "M" "" "United States" "" "0" "" "" "" "D_6" "00410842" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "M" "" "United States" "" "0" "" "" "" "D_9" "00410843" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "F" "" "United States" "" "0" "" "" "" "D_10" "00410844" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family D" "F" "" "United States" "" "0" "" "" "" "D_11" "00410845" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family E" "M" "" "United States" "" "0" "" "" "" "E_1" "00410846" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family E" "F" "" "United States" "" "0" "" "" "" "E_2" "00410847" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_2" "00410848" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_3" "00410849" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_4" "00410850" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_6" "00410851" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_7" "00410852" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_9" "00410853" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_10" "00410854" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_11" "00410855" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_13" "00410856" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "M" "" "United States" "" "0" "" "" "" "F1_14" "00410857" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_17" "00410858" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "F" "" "United States" "" "0" "" "" "" "F1_20" "00410859" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "M" "" "United States" "" "0" "" "" "" "F1_22" "00410860" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F1" "M" "" "United States" "" "0" "" "" "" "F1_23" "00410861" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F2" "F" "" "United States" "" "0" "" "" "" "F2_1" "00410862" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family F2" "F" "" "United States" "" "0" "" "" "" "F2_3" "00410863" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family G" "M" "" "United States" "" "0" "" "" "" "G_1" "00410864" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family G" "M" "" "United States" "" "0" "" "" "" "G_3" "00410865" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family G" "F" "" "United States" "" "0" "" "" "" "G_4" "00410866" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "M" "" "United States" "" "0" "" "" "" "H1_1" "00410867" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "F" "" "United States" "" "0" "" "" "" "H1_2" "00410868" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "F" "" "United States" "" "0" "" "" "" "H1_3" "00410869" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "F" "" "United States" "" "0" "" "" "" "H1_5" "00410870" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "M" "" "United States" "" "0" "" "" "" "H1_6" "00410871" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H1" "F" "" "United States" "" "0" "" "" "" "H1_7" "00410872" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_1" "00410873" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_3" "00410874" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_5" "00410875" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_9" "00410876" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_10" "00410877" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_13" "00410878" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_14" "00410879" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_16" "00410880" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_17" "00410881" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_19" "00410882" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_18" "00410883" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_21" "00410884" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_22" "00410885" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_23" "00410886" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_27" "00410887" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "F" "" "United States" "" "0" "" "" "" "H2_28" "00410888" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_29" "00410889" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_31" "00410890" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family H2" "M" "" "United States" "" "0" "" "" "" "H2_32" "00410891" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I1" "M" "" "United States" "" "0" "" "" "" "I1_2" "00410892" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I1" "F" "" "United States" "" "0" "" "" "" "I1_4" "00410893" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I1" "F" "" "United States" "" "0" "" "" "" "I1_6" "00410894" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "F" "" "United States" "" "0" "" "" "" "I2_2" "00410895" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "F" "" "United States" "" "0" "" "" "" "I2_4" "00410896" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "M" "" "United States" "" "0" "" "" "" "I2_5" "00410897" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "F" "" "United States" "" "0" "" "" "" "I2_6" "00410898" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "F" "" "United States" "" "0" "" "" "" "I2_7" "00410899" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "M" "" "United States" "" "0" "" "" "" "I2_8" "00410900" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family I2" "M" "" "United States" "" "0" "" "" "" "I2_10" "00410901" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family J" "M" "" "United States" "" "0" "" "" "" "J_1" "00410902" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family J" "F" "" "United States" "" "0" "" "" "" "J_4" "00410903" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family J" "M" "" "United States" "" "0" "" "" "" "J_7" "00410904" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family K" "M" "" "United States" "" "0" "" "" "" "K_1" "00410905" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family K" "M" "" "United States" "" "0" "" "" "" "K_2" "00410906" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family K" "F" "" "United States" "" "0" "" "" "" "K_5" "00410907" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "M" "" "United States" "" "0" "" "" "" "L_1" "00410908" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "M" "" "United States" "" "0" "" "" "" "L_2" "00410909" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "F" "" "United States" "" "0" "" "" "" "L_3" "00410910" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "F" "" "United States" "" "0" "" "" "" "L_5" "00410911" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "F" "" "United States" "" "0" "" "" "" "L_6" "00410912" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family L" "F" "" "United States" "" "0" "" "" "" "L_7" "00410913" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family M" "F" "" "United States" "" "0" "" "" "" "M_1" "00410914" "" "" "" "1" "" "00000" "{PMID:Sung 1991:1862076}" "Family M" "F" "" "United States" "" "0" "" "" "" "M_2" "00410929" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "F" "" "United States" "" "0" "" "" "" "A_I:1" "00410930" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_I:2" "00410931" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_I:3" "00410932" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "M" "" "United States" "" "0" "" "" "" "A_I:6" "00410933" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "F" "" "United States" "" "0" "" "" "" "A_II:1" "00410934" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family A" "F" "" "United States" "" "0" "" "" "" "A_II:2" "00410935" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family B" "M" "" "United States" "" "0" "" "" "" "B_1" "00410936" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family B" "M" "" "United States" "" "0" "" "" "" "B_2" "00410937" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "Family B" "F" "" "United States" "" "0" "" "" "" "B_3" "00410938" "" "" "" "1" "" "00000" "{PMID:Sheffield 1991:1897520}" "isolated patient" "M" "" "United States" "" "0" "" "" "" "C" "00411072" "" "" "" "1" "" "00000" "{PMID:Heckenlively 1991:1987955}" "Family 1, proband" "M" "" "United States" "" "0" "" "" "English" "1-1(III:6)" "00411073" "" "" "" "1" "" "00000" "{PMID:Heckenlively 1991:1987955}" "Family 1, proband\'s mother" "F" "" "United States" "" "0" "" "" "English" "1-2(II:3)" "00411074" "" "" "" "1" "" "00000" "{PMID:Heckenlively 1991:1987955}" "Family 2, proband" "M" "" "United States" "" "0" "" "" "Scottish, French" "2-1(IV:9)" "00411075" "" "" "" "1" "" "00000" "{PMID:Heckenlively 1991:1987955}" "Family 2, proband\'s father" "M" "" "United States" "" "0" "" "" "Scottish, French" "2-2(III:5)" "00411076" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1301135}" "data for the whole family, no single individuals described" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "ADRP 28" "00411077" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1301135}" "data for the whole family, no single individuals described" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "ADRP 36" "00411078" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1301135}" "data for the whole family, no single individuals described" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "ADRP 48" "00411079" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1301135}" "data for the whole family, no single individuals described" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "ADRP 37" "00411080" "" "" "" "1" "" "00000" "{PMID:Inglehearn 1992:1301135}" "data for the whole family, no single individuals described" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "English" "ADRP 44" "00411081" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "F" "" "" "" "0" "" "" "" "family TCDM1_1" "00411082" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "M" "" "" "" "0" "" "" "" "family TCDM1_2" "00411083" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "M" "" "" "" "0" "" "" "" "family TCDM1_3" "00411084" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "F" "" "" "" "0" "" "" "" "family TCDM1_4" "00411085" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "F" "" "" "" "0" "" "" "" "family TCDM1_5" "00411086" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "M" "" "" "" "0" "" "" "" "family TCDM1_6" "00411087" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "M" "" "" "" "0" "" "" "" "family TCDM1_7" "00411088" "" "" "" "1" "" "00000" "{PMID:Farrar 1992:1302614}" "Family TCDM1; only 8 members mentioned of a reportedly large pedigree; no numbering, consecutive numbers given" "M" "" "" "" "0" "" "" "" "family TCDM1_8" "00411096" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family I, proband" "F" "" "United States" "" "0" "" "" "" "famIpatII-1" "00411097" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family I, proband\'s father" "M" "" "United States" "" "0" "" "" "" "famIpatI-1" "00411098" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family II, proband" "F" "" "United States" "" "0" "" "" "" "famIIpatIII-1" "00411099" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family II, proband\'s mother" "F" "" "United States" "" "0" "" "" "" "famIIpatII-3" "00411100" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family III, proband\'s mother" "F" "" "United States" "" "0" "" "" "" "famIIIpatII-4" "00411101" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family III, proband\'s sister" "F" "" "United States" "" "0" "" "" "" "famIIIpatIII-1" "00411102" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family III, proband" "F" "" "United States" "" "0" "" "" "Irish" "famIIIpatIII-2" "00411103" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1444916}" "Family III, proband\'s sister\'s daughter" "F" "" "United States" "" "0" "" "" "" "famIIIpatIV-2" "00411107" "" "" "" "1" "" "00000" "{PMID:Horn 1992:1487240}" "Family A" "M" "" "Germany" "" "0" "" "" "" "famApatII-8" "00411108" "" "" "" "1" "" "00000" "{PMID:Horn 1992:1487240}" "Family A" "F" "" "United States" "" "0" "" "" "" "famApatIII-2" "00411109" "" "" "" "1" "" "00000" "{PMID:Horn 1992:1487240}" "Family A" "M" "" "United States" "" "0" "" "" "" "famApatIV-1" "00411110" "" "" "" "1" "" "00000" "{PMID:Horn 1992:1487240}" "Family B" "M" "" "United States" "" "0" "" "" "" "famBpatIV-1" "00411111" "" "" "" "1" "" "00000" "{PMID:Horn 1992:1487240}" "Family B" "M" "" "United States" "" "0" "" "" "" "famBpatV-1" "00411118" "" "" "" "1" "" "00000" "{PMID:Rosenfeld 1992:1303237}" "" "F" "yes" "" "" "0" "" "" "French-Canadian" "IV:3" "00411130" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1580841}" "Family I, proband" "M" "" "" "" "0" "" "" "Irish" "famIpatII-4" "00411131" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1580841}" "Family I, proband\'s son 1" "M" "" "" "" "0" "" "" "Irish" "famIpatIII-12" "00411132" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1580841}" "Family I, proband\'s son 2" "M" "" "" "" "0" "" "" "Irish" "famIpatIII-15" "00411133" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1580841}" "Family II, proband" "M" "" "" "" "0" "" "" "European Jewish" "famIIpatIV-1" "00411134" "" "" "" "1" "" "00000" "{PMID:Fishman 1992:1580841}" "Family II, proband\'s father" "M" "" "" "" "0" "" "" "European Jewish" "famIIpatII1-3" "00411137" "" "" "" "1" "" "00000" "{PMID:Fujiki 1992:1391967}" "Family I, proband" "M" "" "Japan" "" "0" "" "" "" "no.5" "00411138" "" "" "" "1" "" "00000" "{PMID:Fujiki 1992:1391967}" "Family I, proband\'s mother" "F" "" "Japan" "" "0" "" "" "" "1" "00411139" "" "" "" "1" "" "00000" "{PMID:Fujiki 1992:1391967}" "Family II, proband" "M" "" "Japan" "" "0" "" "" "" "2" "00411140" "" "" "" "1" "" "00000" "{PMID:Fujiki 1992:1391967}" "Family II, proband\'s daughter 1" "F" "" "Japan" "" "0" "" "" "" "3" "00411141" "" "" "" "1" "" "00000" "{PMID:Fujiki 1992:1391967}" "Family II, proband\'s daughter 2" "F" "" "Japan" "" "0" "" "" "" "4" "00411142" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "2" "00411143" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "5" "00411144" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "10" "00411145" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "18" "00411146" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "19" "00411147" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "4" "00411148" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "8" "00411149" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "12" "00411150" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "17" "00411151" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "14" "00411152" "" "" "" "1" "" "00000" "{PMID:Bell 1992:1404299}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "15" "00411153" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "IV:3" "00411154" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "IV:4" "00411155" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "IV:5" "00411156" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "V:6" "00411157" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "mother of VI:3" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "V:1" "00411158" "" "" "" "1" "" "00000" "{PMID:Andreasson 1992:1484692}" "son of V:6" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "VI:3" "00411170" "" "" "" "1" "" "00000" "{PMID:Sullivan 1993:8240107}" "" "F" "" "Australia" "" "0" "" "" "" "III-3" "00411171" "" "" "" "1" "" "00000" "{PMID:Sullivan 1993:8240107}" "" "F" "" "Australia" "" "0" "" "" "" "IV-2" "00411172" "" "" "" "1" "" "00000" "{PMID:Sullivan 1993:8240107}" "" "M" "" "Australia" "" "0" "" "" "" "IV-4" "00411200" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411201" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411202" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411203" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411204" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411205" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1849" "00411206" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1711-3" "00411207" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1711-5" "00411208" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1711-1" "00411209" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1711-11" "00411210" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1711-12" "00411211" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1711-9" "00411212" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1711-10" "00411213" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS889-1" "00411214" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS889-2" "00411215" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1193-1" "00411216" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1193-2" "00411217" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1193-3" "00411218" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1193-4" "00411219" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1371-1" "00411220" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS1371-6" "00411221" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411222" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411223" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411224" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411225" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411226" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1708-1" "00411227" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1708-2" "00411228" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS194-2" "00411229" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS194-4" "00411230" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS194-1" "00411231" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS343-1" "00411232" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1688-1" "00411233" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS1688-6" "00411234" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411235" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411236" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411237" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "?" "" "United States" "" "0" "" "" "" "?" "00411238" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS461-1" "00411239" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS461-2" "00411240" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "M" "" "United States" "" "0" "" "" "" "HS461-3" "00411241" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS461-4" "00411242" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "II-3" "00411243" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "II-5" "00411244" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "II-7" "00411245" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "II-9" "00411246" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "II-12" "00411247" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "III-3" "00411248" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "III-5" "00411249" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "III-12" "00411250" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "III-13" "00411251" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "VI-3" "00411252" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "VI-6" "00411253" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "F" "" "Australia" "" "0" "" "" "" "VI-8" "00411254" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "VI-9" "00411255" "" "" "" "1" "" "00000" "{PMID:Kranich_1993:8353500}" "" "M" "" "Australia" "" "0" "" "" "" "VI-11" "00411257" "" "" "" "1" "" "00000" "{PMID:Rodriguez_1993:8364589}" "family RFS04, individual I-1 (proband\'s father)" "M" "" "United States" "" "0" "" "" "" "3871" "00411258" "" "" "" "1" "" "00000" "{PMID:Rodriguez_1993:8364589}" "family RFS04, individual II-2 (proband)" "F" "" "United States" "" "0" "" "" "" "3398" "00411259" "" "" "" "1" "" "00000" "{PMID:Rodriguez_1993:8364589}" "family RFS04, individual III-1 (proband\'s son 1)" "M" "" "United States" "" "0" "" "" "" "3399" "00411260" "" "" "" "1" "" "00000" "{PMID:Rodriguez_1993:8364589}" "family RFS04, individual III-1 (proband\'s son 2)" "M" "" "United States" "" "0" "" "" "" "3400" "00411265" "" "" "" "1" "" "00000" "{PMID:Restango 1993:8499910}" "" "F" "" "Italy" "" "0" "" "" "" "I-2" "00411266" "" "" "" "1" "" "00000" "{PMID:Restango 1993:8499910}" "" "M" "" "Italy" "" "0" "" "" "" "II-1" "00411267" "" "" "" "1" "" "00000" "{PMID:Restango 1993:8499910}" "" "M" "" "Italy" "" "0" "" "" "" "II-2" "00411268" "" "" "" "1" "" "00000" "{PMID:Restango 1993:8499910}" "" "F" "" "Italy" "" "0" "" "" "" "III-2" "00411269" "" "" "" "1" "" "00000" "{PMID:Restango 1993:8499910}" "" "F" "" "Italy" "" "0" "" "" "" "III-4" "00411278" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "M" "" "Italy" "" "0" "" "" "" "III-l" "00411279" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "M" "" "Italy" "" "0" "" "" "" "III-4" "00411280" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "F" "" "Italy" "" "0" "" "" "" "IV-4" "00411281" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "F" "" "Italy" "" "0" "" "" "" "III-4" "00411282" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "F" "" "Italy" "" "0" "" "" "" "IV-7" "00411283" "" "" "" "1" "" "00000" "{PMID:Kim 1993:8240108}" "" "F" "" "Italy" "" "0" "" "" "" "IV-8" "00411286" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s sister" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "M-6191_III:2" "00411287" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s brother" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "M-6191_III:5" "00411288" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "M-6191_III:7" "00411289" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "K-6056_III:4" "00411290" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "B-6183_II:4" "00411291" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s daughter" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "B-6183_III:6" "00411292" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "F-6246_III:1" "00411293" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s maternal uncle" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_II:2" "00411294" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s maternal aunt 1" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_II:5" "00411295" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s maternal grandmother" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_II:8" "00411296" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s maternal aunt 2" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_II:9" "00411297" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s maternal aunt 3" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_II:10" "00411298" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s cousin 1" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_III:1" "00411299" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother\'s cousin 2" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_III:3" "00411300" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s mother" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_III:6" "00411301" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s maternal uncle" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_III:8" "00411302" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_IV:1" "00411303" "" "" "" "1" "" "00000" "{PMID:Bell 1994:7819178}" "proband\'s sister" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Scottish" "adRP3_IV:2" "00411304" "" "" "" "1" "" "00000" "{PMID:Al-Maghtheh 1994:8162031}" "proband" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "II-3" "00411305" "" "" "" "1" "" "00000" "{PMID:Al-Maghtheh 1994:8162031}" "proband\'s daughter 1" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "III-2" "00411306" "" "" "" "1" "" "00000" "{PMID:Al-Maghtheh 1994:8162031}" "proband\'s daughter 2" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "III-3" "00411307" "" "" "" "1" "" "00000" "{PMID:Saga 1994:7850270}" "proband" "F" "" "Japan" "" "0" "" "" "" "?" "00411308" "" "" "" "1" "" "00000" "{PMID:Fuchs 1994:7981701}" "large Australian pedigre" "" "" "" "" "0" "" "" "Australian" "Family 1" "00411309" "" "" "" "1" "" "00000" "{PMID:Fuchs 1994:7981701}" "four-generation pedigree from Germany" "" "" "" "" "0" "" "" "German" "Family 2" "00411310" "" "" "" "1" "" "00000" "{PMID:Fuchs 1994:7981701}" "family from Germany" "" "" "" "" "0" "" "" "German" "Family 3" "00411311" "" "" "" "1" "" "00000" "{PMID:Antinolo 1994:7987326}" "Spanish family with diffuse ADRP" "" "" "Spain" "" "0" "" "" "" "?" "00411312" "" "" "" "1" "" "00000" "{PMID:Souied 1994:7987331}" "Family 1" "" "" "France" "" "0" "" "" "" "?" "00411313" "" "" "" "1" "" "00000" "{PMID:Souied 1994:7987331}" "Family 2" "" "" "France" "" "0" "" "" "" "?" "00411314" "" "" "" "1" "" "00000" "{PMID:Souied 1994:7987331}" "Family 3" "" "" "France" "" "0" "" "" "" "?" "00411315" "" "" "" "1" "" "00000" "{PMID:Souied 1994:7987331}" "Family 4" "" "" "France" "" "0" "" "" "" "?" "00411316" "" "" "" "1" "" "00000" "{PMID:Souied 1994:7987331}" "Family 5" "" "" "France" "" "0" "" "" "" "?" "00411317" "" "" "" "1" "" "00000" "{PMID:Kumaramanickavel 1994:7987385}" "" "M" "yes" "" "" "0" "" "" "Indian" "PMK 197_IV:3" "00411318" "" "" "" "1" "" "00000" "{PMID:Kumaramanickavel 1994:7987385}" "" "M" "yes" "" "" "0" "" "" "Indian" "PMK 197_IV:7" "00411319" "" "" "" "1" "" "00000" "{PMID:Kumaramanickavel 1994:7987385}" "" "F" "yes" "" "" "0" "" "" "Indian" "PMK 197_IV:8" "00411320" "" "" "" "1" "" "00000" "{PMID:Kumaramanickavel 1994:7987385}" "" "F" "yes" "" "" "0" "" "" "Indian" "PMK 197_IV:9" "00411368" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P2" "00411369" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "M" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P3" "00411370" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P4" "00411371" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P5" "00411372" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P6" "00411373" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "M" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P7" "00411374" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "M" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P9" "00411375" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "M" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P10" "00411376" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P11" "00411377" "" "" "" "1" "" "00000" "{PMID:Rosas 1994:8045708}" "14-generation pedigree" "F" "" "Argentina" "" "0" "" "" "Spanish ancestry" "P12" "00411380" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "5979_II:1" "00411381" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "5979_III:1" "00411382" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "5979_III:3" "00411383" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "5979_III:5" "00411384" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "6204_II:2" "00411385" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "6204_II:7" "00411386" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "6204_II:10" "00411387" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "6204_III:2" "00411388" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "5267_II:5" "00411389" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "5267_II:6" "00411390" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "5267_III:2" "00411391" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "6881_I:1" "00411392" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "6881_I:3" "00411393" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "6881_I:5" "00411394" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "6881_II:1" "00411395" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "6881_II:2" "00411396" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "6881_II:4" "00411397" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "5706_I:2" "00411398" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "5706_II:3" "00411399" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "5706_III:2" "00411400" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "D865_I:2" "00411401" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "4048_I:1" "00411402" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "4048_II:2" "00411403" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "4048_II:3" "00411404" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "4048_III:2" "00411405" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "4048_III:3" "00411406" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "M" "" "United States" "" "0" "" "" "" "7419_II:1" "00411407" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "" "F" "" "United States" "" "0" "" "" "" "7419_II:4" "00411408" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "mutation present, asymptomatic, not available for examination" "M" "" "United States" "" "0" "" "" "" "7419_III:1" "00411409" "" "" "" "1" "" "00000" "{PMID:Vaithinathan 1994:8088850}" "mutation present, asymptomatic, not available for examination" "F" "" "United States" "" "0" "" "" "" "7419_III:3" "00411411" "" "" "" "1" "" "00000" "{PMID:Al-Maghtheh_1994:8081400}" "no family name or number of individuals or pedigree" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "family 1" "00411412" "" "" "" "1" "" "00000" "{PMID:Al-Maghtheh_1994:8081400}" "no family name or number of individuals or pedigree" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "family 2" "00411417" "" "" "" "1" "" "00000" "{PMID:Reig 1994:8076945}" "" "M" "yes" "Spain" "" "0" "" "" "" "?" "00411419" "" "" "" "1" "" "00000" "{PMID:Reig 1994:8162026}" "" "M" "" "Spain" "" "0" "" "" "" "1" "00411420" "" "" "" "1" "" "00000" "{PMID:Reig 1994:8162026}" "" "F" "" "Spain" "" "0" "" "" "" "3" "00411421" "" "" "" "1" "" "00000" "{PMID:Reig 1994:8162026}" "" "F" "" "Spain" "" "0" "" "" "" "4" "00411427" "" "" "" "1" "" "00000" "{PMID:Rosenfeld 1995:7558711}" "family BGL-D586 - 2 members heterozygous for this mutation, both asymptomatic" "F" "" "United States" "" "0" "" "" "" "BGL-D586_III:1(N88)" "00411428" "" "" "" "1" "" "00000" "{PMID:Rosenfeld 1995:7558711}" "family BGL-6965 - 23 members heterozygous for this mutation, only one with RP" "M" "" "United States" "" "0" "" "" "" "BGL-6965_II:23" "00411429" "" "" "" "1" "" "00000" "{PMID:Macke 1995:7633434}" "proband" "F" "" "United States" "" "0" "" "" "" "1 (HS713)" "00411430" "" "" "" "1" "" "00000" "{PMID:Macke 1995:7633434}" "" "F" "" "United States" "" "0" "" "" "" "2" "00411431" "" "" "" "1" "" "00000" "{PMID:Macke 1995:7633434}" "" "F" "" "United States" "" "0" "" "" "" "4" "00411432" "" "" "" "1" "" "00000" "{PMID:Macke 1995:7633434}" "" "F" "" "United States" "" "0" "" "" "" "5" "00411433" "" "" "" "1" "" "00000" "{PMID:Macke 1995:7633434}" "" "M" "" "United States" "" "0" "" "" "" "7" "00411437" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "III:10" "00411438" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "F" "" "United States" "" "0" "" "" "" "IV-3" "00411439" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-5" "00411440" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-7" "00411441" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-14" "00411442" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-16" "00411443" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-19" "00411444" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "IV-21" "00411445" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "V-2" "00411446" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "F" "" "United States" "" "0" "" "" "" "V-14" "00411447" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "F" "" "United States" "" "0" "" "" "" "V-15" "00411448" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "V-16" "00411449" "" "" "" "1" "" "00000" "{PMID:Richards 1995:7724183}" "" "M" "" "United States" "" "0" "" "" "" "V-21" "00411459" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V490" "M" "" "United States" "" "0" "" "" "" "II-1" "00411460" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V491" "M" "" "United States" "" "0" "" "" "" "II-3" "00411461" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V492" "M" "" "United States" "" "0" "" "" "" "II-5" "00411462" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V493" "M" "" "United States" "" "0" "" "" "" "II-8" "00411463" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V494" "M" "" "United States" "" "0" "" "" "" "III-1" "00411464" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V495" "M" "" "United States" "" "0" "" "" "" "III-6" "00411465" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V496" "F" "" "United States" "" "0" "" "" "" "III-9" "00411466" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V497" "F" "" "United States" "" "0" "" "" "" "III-10" "00411467" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V498" "F" "" "United States" "" "0" "" "" "" "III-12" "00411468" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V499" "M" "" "United States" "" "0" "" "" "" "III-13" "00411469" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V500" "F" "" "United States" "" "0" "" "" "" "III-14" "00411470" "" "" "" "1" "" "00000" "{PMID:Sieving 1995:7846071}" "pedigree: UM:V501" "M" "" "United States" "" "0" "" "" "" "IV-1" "00411471" "" "" "" "1" "" "00000" "{PMID:Souied 1996:8554077}" "" "F" "" "France" "79y" "0" "" "" "" "I-2" "00411472" "" "" "" "1" "" "00000" "{PMID:Souied 1996:8554077}" "" "F" "yes" "France" "" "0" "" "" "" "II-3" "00411473" "" "" "" "1" "" "00000" "{PMID:Souied 1996:8554077}" "" "M" "yes" "France" "" "0" "" "" "" "II-5" "00411474" "" "" "" "1" "" "00000" "{PMID:Souied 1996:8554077}" "" "F" "" "France" "" "0" "" "" "" "III-2" "00411475" "" "" "" "1" "" "00000" "{PMID:Souied 1996:8554077}" "" "F" "" "France" "" "0" "" "" "" "III-3" "00411476" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "M" "yes" "Spain" "" "0" "" "" "" "VI.1" "00411477" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "M" "yes" "Spain" "" "0" "" "" "" "VI.3" "00411478" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VI.4" "00411479" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "M" "yes" "Spain" "" "0" "" "" "" "VI.5" "00411480" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VI.6" "00411481" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.1" "00411482" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.2" "00411483" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.3" "00411484" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.4" "00411485" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.5" "00411486" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.6" "00411487" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.7" "00411488" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "M" "yes" "Spain" "" "0" "" "" "" "VII.8" "00411489" "" "" "" "1" "" "00000" "{PMID:Ayuso 1996:8682506}" "" "F" "yes" "Spain" "" "0" "" "" "" "VII.9" "00411490" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "M" "" "Spain" "" "0" "" "" "Basque" "II:2" "00411491" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "M" "" "Spain" "" "0" "" "" "Basque" "II:4" "00411492" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "F" "" "Spain" "" "0" "" "" "Basque" "II:5" "00411493" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "F" "" "Spain" "" "0" "" "" "Basque" "III:1" "00411494" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "M" "" "Spain" "" "0" "" "" "Basque" "III:2" "00411495" "" "" "" "1" "" "00000" "{PMID:Reig 1996:8807346}" "Basque family" "F" "" "Spain" "" "0" "" "" "Basque" "III:3" "00411497" "" "" "" "1" "" "00000" "{PMID:Sanchez 1996:8829640}" "single family, no patient number, consecutive numbers given" "?" "" "Spain" "" "0" "" "" "" "1" "00411498" "" "" "" "1" "" "00000" "{PMID:Sanchez 1996:8829640}" "single family, no patient number, consecutive numbers given" "?" "" "Spain" "" "0" "" "" "" "1" "00411499" "" "" "" "1" "" "00000" "{PMID:Sanchez 1996:8829640}" "single family, no patient number, consecutive numbers given" "?" "" "Spain" "" "0" "" "" "" "1" "00411500" "" "" "" "1" "" "00000" "{PMID:Sanchez 1996:8829640}" "single family, no patient number, consecutive numbers given" "?" "" "Spain" "" "0" "" "" "" "1" "00411502" "" "" "" "1" "" "00000" "{PMID:Borrego 1996:8829641}" "single family, abstract unavailable, full text not available" "?" "" "Spain" "" "0" "" "" "" "?" "00411503" "" "" "" "1" "" "00000" "{PMID:Haim 1996:9010870}" "Danish family; proband" "F" "" "Denmark" "" "0" "" "" "" "IV:1" "00411506" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s mother" "F" "" "Italy" "" "0" "" "" "Sicilian" "III-1" "00411507" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband" "M" "" "Italy" "" "0" "" "" "Sicilian" "IV-3" "00411508" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s brother 2" "M" "" "Italy" "" "0" "" "" "Sicilian" "IV-4" "00411509" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s brother 3" "M" "" "Italy" "" "0" "" "" "Sicilian" "IV-5" "00411510" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s daughter 1" "F" "" "Italy" "" "0" "" "" "Sicilian" "V-7" "00411511" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s daughter 2" "F" "" "Italy" "" "0" "" "" "Sicilian" "V-8" "00411512" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s son" "M" "" "Italy" "" "0" "" "" "Sicilian" "V-10" "00411513" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s brother 2\'s daughter" "F" "" "Italy" "" "0" "" "" "Sicilian" "V-12" "00411514" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s brother 3\'s son 1" "M" "" "Italy" "" "0" "" "" "Sicilian" "V-13" "00411515" "" "" "" "1" "" "00000" "{PMID:Pannarale 1996:8841304}" "proband\'s brother 3\'s son 2" "M" "" "Italy" "" "0" "" "" "Sicilian" "V-14" "00411516" "" "" "" "1" "" "00000" "{PMID:Goliath 1998:9452035}" "South African family, 4 generations" "?" "" "South Africa" "" "0" "" "" "" "?" "00411517" "" "" "" "1" "" "00000" "{PMID:Milla 1998:9810568}" "Swiss family" "M" "" "Switzerland" "" "0" "" "" "" "III.1" "00411518" "" "" "" "1" "" "00000" "{PMID:Milla 1998:9810568}" "Swiss family" "F" "" "Switzerland" "" "0" "" "" "" "IV.2" "00411519" "" "" "" "1" "" "00000" "{PMID:Milla 1998:9810568}" "Swiss family" "M" "" "Switzerland" "" "0" "" "" "" "IV.3" "00411520" "" "" "" "1" "" "00000" "{PMID:Milla 1998:9810568}" "Swiss family" "F" "" "Switzerland" "" "0" "" "" "" "V.2" "00411522" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family, proband" "F" "" "Pakistan" "" "0" "" "" "" "II:4" "00411523" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family" "?" "" "Pakistan" "" "0" "" "" "" "III:1" "00411524" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family" "F" "" "Pakistan" "" "0" "" "" "" "III:4" "00411525" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family, proband\'s child 1" "?" "" "Pakistan" "" "0" "" "" "" "III:5" "00411526" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family, proband\'s child 2" "?" "" "Pakistan" "" "0" "" "" "" "III:6" "00411527" "" "" "" "1" "" "00000" "{PMID:Bessant 1998:10189219}" "Pakistani family, proband\'s child 3" "?" "" "Pakistan" "" "0" "" "" "" "III:10" "00411532" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "proband" "M" "" "France" "" "0" "" "" "" "Rho3" "00411533" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "proband\'s paternal cousin 1" "F" "" "France" "" "0" "" "" "" "?" "00411534" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "proband\'s paternal cousin 2" "F" "" "France" "" "0" "" "" "" "?" "00411535" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "pedigree unavailable, consecutive numbers given; proband" "M" "" "France" "" "0" "" "" "" "Rho1" "00411536" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "pedigree unavailable, consecutive numbers given; proband\'s son 1" "M" "" "France" "" "0" "" "" "" "?" "00411537" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "pedigree unavailable, consecutive numbers given; proband\'s son 2" "M" "" "France" "" "0" "" "" "" "?" "00411538" "" "" "" "1" "" "00000" "{PMID:Bareil 1999:10521250}" "pedigree unavailable; proband; not mentioned which family members were also tested" "F" "" "France" "" "0" "" "" "Greek" "Rho2" "00411539" "" "" "" "1" "" "00000" "{PMID:Alvarez 1999:10668933}" "proband" "M" "" "Spain" "" "0" "" "" "Basque" "II 1" "00411540" "" "" "" "1" "" "00000" "{PMID:Alvarez 1999:10668933}" "proband\'s son 1" "M" "" "Spain" "" "0" "" "" "Basque" "III 1" "00411541" "" "" "" "1" "" "00000" "{PMID:Alvarez 1999:10668933}" "proband\'s son 2" "M" "" "Spain" "" "0" "" "" "Basque" "III 2" "00411542" "" "" "" "1" "" "00000" "{PMID:Alvarez 1999:10668933}" "proband\'s daugther" "F" "" "Spain" "" "0" "" "" "Basque" "III 3" "00411543" "" "" "" "1" "" "00000" "{PMID:Martinez-Gimeno 2000:10874327}" "no individual ID, whole family in a mutation report" "?" "" "Spain" "" "0" "" "" "" "?" "00411544" "" "" "" "1" "" "00000" "{PMID:Martinez-Gimeno 2000:10874327}" "no individual ID, whole family in a mutation report" "?" "" "Spain" "" "0" "" "" "" "?" "00411545" "" "" "" "1" "" "00000" "{PMID:Martinez-Gimeno 2000:10874327}" "no individual ID, whole family in a mutation report" "?" "" "Spain" "" "0" "" "" "" "?" "00411554" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411555" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411556" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411557" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411558" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411559" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411560" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411561" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411562" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411563" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411564" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband" "F" "" "United States" "" "0" "" "" "" "II:6" "00411565" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s brother 1" "M" "" "United States" "" "0" "" "" "" "II:1" "00411566" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s brother 4" "M" "" "United States" "" "0" "" "" "" "II:5" "00411567" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s brother 2\'s daughter\'s son" "F" "" "United States" "" "0" "" "" "" "III:1" "00411568" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s brother 2\'s daughter\'s son" "M" "" "United States" "" "0" "" "" "" "IV:1" "00411569" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411570" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411571" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband" "F" "" "United States" "" "0" "" "" "" "I:2" "00411572" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s daughter" "M" "" "United States" "" "0" "" "" "" "II:1" "00411573" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s son" "M" "" "United States" "" "0" "" "" "" "II:4" "00411574" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411575" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411576" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411577" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "no individual ID, only number of individuals with the mutation; mutation report" "?" "" "United States" "" "0" "" "" "" "?" "00411578" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband" "F" "" "United States" "" "0" "" "" "" "II:2" "00411579" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s brother" "M" "" "United States" "" "0" "" "" "" "II:1" "00411580" "" "" "" "1" "" "00000" "{PMID:Dryja 2000:10967073}" "proband\'s daughter" "F" "" "United States" "" "0" "" "" "" "III:1" "00411584" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "F" "" "United States" "" "0" "" "" "" "I:2" "00411585" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "M" "" "United States" "" "0" "" "" "" "II:2" "00411586" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "F" "" "United States" "" "0" "" "" "" "III:2" "00411587" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "M" "" "United States" "" "0" "" "" "" "III:3" "00411588" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "M" "" "United States" "" "0" "" "" "" "IV:1" "00411589" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "F" "" "United States" "" "0" "" "" "" "IV:2" "00411590" "" "" "" "1" "" "00000" "{PMID:Budu 2000:11094174}" "proband" "M" "" "Japan" "" "0" "" "" "" "Patient II-2" "00411591" "" "" "" "1" "" "00000" "{PMID:Budu 2000:11094174}" "proband\'s daughter 1" "F" "" "Japan" "" "0" "" "" "" "Patient III-1" "00411592" "" "" "" "1" "" "00000" "{PMID:Budu 2000:11094174}" "proband\'s daughter 2" "F" "" "Japan" "" "0" "" "" "" "Patient III-2" "00411593" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "proband, (family 1) patient 1" "F" "" "China" "" "0" "" "" "" "?" "00411594" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "proband\'s daughter" "F" "" "China" "" "0" "" "" "" "?" "00411595" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "proband, (family 2) patient 2" "?" "" "China" "" "0" "" "" "" "?" "00411596" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "proband, (family 3) patient 3" "F" "" "China" "" "0" "" "" "" "?" "00411597" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "(family 3) proband\'s child 1" "?" "" "China" "" "0" "" "" "" "?" "00411598" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "(family 3) proband\'s child 2" "?" "" "China" "" "0" "" "" "" "?" "00411599" "" "" "" "1" "" "00000" "{PMID:Chan 2001:11520753}" "(family 3) proband\'s child 3" "?" "" "China" "" "0" "" "" "" "?" "00411600" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband" "M" "" "China" "" "0" "" "" "" "II-1" "00411601" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s brother 1" "M" "" "China" "" "0" "" "" "" "II-3" "00411602" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s brother 2" "M" "" "China" "" "0" "" "" "" "II-5" "00411603" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s paternal cousin 1" "F" "" "China" "" "0" "" "" "" "II-9" "00411604" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s paternal cousin 2" "M" "" "China" "" "0" "" "" "" "II-10" "00411605" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s daughter" "F" "" "China" "" "0" "" "" "" "III-1" "00411606" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s son 1" "M" "" "China" "" "0" "" "" "" "III-3" "00411607" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s son 2" "M" "" "China" "" "0" "" "" "" "III-4" "00411608" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s paternal cousin 1\'s son" "M" "" "China" "" "0" "" "" "" "III-8" "00411609" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s daughter\'s son" "M" "" "China" "" "0" "" "" "" "IV-1" "00411610" "" "" "" "1" "" "00000" "{PMID:Zhao 2001:11559857}" "Chinese family, proband\'s son 1\'s son" "M" "" "China" "" "0" "" "" "" "IV-2" "00411613" "" "" "" "1" "" "00000" "{PMID:Dikshit 2001:11910130}" "Indian family, proband" "F" "" "India" "" "0" "" "" "" "A_II-1" "00411614" "" "" "" "1" "" "00000" "{PMID:Dikshit 2001:11910130}" "Indian family, proband\'s son 1" "M" "" "India" "" "0" "" "" "" "A_III-1" "00411615" "" "" "" "1" "" "00000" "{PMID:Dikshit 2001:11910130}" "Indian family, proband\'s son 2" "M" "" "India" "" "0" "" "" "" "A_III-2" "00411616" "" "" "" "1" "" "00000" "{PMID:Dikshit 2001:11910130}" "isolated patients" "M" "" "India" "" "0" "" "" "" "B_II-1" "00411617" "" "" "" "1" "" "00000" "{PMID:Greenberg 2003:14566652}" "South African family, proband" "M" "yes" "South Africa" "" "0" "" "" "" "?" "00411620" "" "" "" "1" "" "00000" "{PMID:To 2004:15126168}" "no numbering in the original paper" "" "" "" "77y" "0" "" "" "" "?" "00411621" "" "" "" "1" "" "00000" "{PMID:To 2004:15126168}" "no numbering in the original paper" "" "" "" "84y" "0" "" "" "" "?" "00411622" "" "" "" "1" "" "00000" "{PMID:To 2004:15126168}" "no numbering in the original paper" "" "" "" "76y" "0" "" "" "" "?" "00411623" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation X, left loop" "F" "" "United States" "" "0" "" "" "North Carolina" "X-17" "00411624" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, left loop" "?" "" "United States" "" "0" "" "" "North Carolina" "XI-?" "00411625" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, left loop" "?" "" "United States" "" "0" "" "" "North Carolina" "XI-?" "00411626" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, left loop" "?" "" "United States" "" "0" "" "" "North Carolina" "XI-?" "00411627" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, left loop" "?" "" "United States" "" "0" "" "" "North Carolina" "XI-?" "00411628" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, left loop" "?" "" "United States" "" "0" "" "" "North Carolina" "XI-?" "00411629" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, left loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XII-9" "00411630" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, left loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XII-10" "00411631" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XI-28" "00411632" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XI-30" "00411633" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XI-32" "00411634" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XI-34" "00411635" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XI-36" "00411636" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XI-41" "00411637" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XI, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XI-46" "00411638" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XII-13" "00411639" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XII-14" "00411640" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XII-16" "00411641" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XII-17" "00411642" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XII-18" "00411643" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XII-19" "00411644" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XII, right loop" "F" "" "United States" "" "0" "" "" "North Carolina" "XII-26" "00411645" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XIII, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XIII-1" "00411646" "" "" "" "1" "" "00000" "{PMID:Oh 2004:15548806}" "no numbering in the original paper, calculated manually when possible; generation XIII, right loop" "M" "" "United States" "" "0" "" "" "North Carolina" "XIII-2" "00411647" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband (inferred)" "F" "" "Singapore" "" "0" "" "" "Chinese" "I-1" "00411648" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s daughter 1" "F" "" "Singapore" "" "0" "" "" "Chinese" "II-1" "00411649" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s daughter 2" "F" "" "Singapore" "" "0" "" "" "Chinese" "II-2" "00411650" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s son 1" "M" "" "Singapore" "" "0" "" "" "Chinese" "II-3" "00411651" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s son 3" "M" "" "Singapore" "" "0" "" "" "Chinese" "II-5" "00411652" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s son 4" "M" "" "Singapore" "" "0" "" "" "Chinese" "II-6" "00411653" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s daughter 1\'s son" "M" "" "Singapore" "" "0" "" "" "Chinese" "III-2" "00411654" "" "" "" "1" "" "00000" "{PMID:Yong 2005:15726226}" "proband\'s daughter 2\'s son" "M" "" "Singapore" "" "0" "" "" "Chinese" "III-3" "00411835" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 1; proband; 5 generation family" "F" "" "Germany" "" "0" "" "" "German" "IV-4" "00411836" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 2; proband; 2 generation family" "M" "" "Germany" "" "0" "" "" "Bosnian" "II-5" "00411837" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 3; proband; 3 generation family" "F" "" "Germany" "" "0" "" "" "German" "II-6" "00411838" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 3; proband\'s father; 3 generation family" "M" "" "Germany" "" "0" "" "" "German" "I-11" "00411839" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 3; proband\'s paternal cousin; 3 generation family" "M" "" "Germany" "" "0" "" "" "German" "II-3" "00411840" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 3; proband\'s sister; 3 generation family" "F" "" "Germany" "" "0" "" "" "German" "II-8" "00411841" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 3; proband\'s son; 3 generation family" "M" "" "Germany" "" "0" "" "" "German" "III-4" "00411842" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband; 3 generation family" "M" "" "Germany" "" "0" "" "" "Austrian" "III-13" "00411843" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband\'s father; 3 generation family" "M" "" "Germany" "" "0" "" "" "Austrian" "II-7" "00411844" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband\'s sister 1; 3 generation family" "F" "" "Germany" "" "0" "" "" "Austrian" "III-2" "00411845" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband\'s brother 2; 3 generation family" "M" "" "Germany" "" "0" "" "" "Austrian" "III-3" "00411846" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband\'s sister 2; 3 generation family" "F" "" "Germany" "" "0" "" "" "Austrian" "III-4" "00411847" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 4; proband\'s brother 6; 3 generation family" "M" "" "Germany" "" "0" "" "" "Austrian" "III-12" "00411848" "" "" "" "1" "" "00000" "{PMID:Schuster 2005:16170112}" "Family 5; proband; father asymptomatic, father\'s brother affected; 3 generation family" "M" "" "Germany" "" "0" "" "" "Austrian" "III-1" "00411849" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 1, proband (no numbering in the article)" "F" "" "China" "" "0" "" "" "" "I:1" "00411850" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 1, proband\'s child 1 (no numbering in the article)" "?" "" "China" "" "0" "" "" "" "II:1" "00411851" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 1, proband\'s child 2 (no numbering in the article)" "?" "" "China" "" "0" "" "" "" "II:2" "00411852" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 1, proband\'s child 3 (no numbering in the article)" "?" "" "China" "" "0" "" "" "" "II:3" "00411853" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 2, proband (no numbering in the article)" "F" "" "China" "" "0" "" "" "" "I:1" "00411854" "" "" "" "1" "" "00000" "{PMID:Zhang 2006:16229860}" "Family 2, proband\'s daughter (no numbering in the article)" "F" "" "China" "" "0" "" "" "" "II:1" "00411855" "" "" "" "1" "" "00000" "{PMID:Iannaccone 2006:17014888}" "Family 1, proband\'s father (no family numbering in the article; other two families have previously been published in Del Porto et al., 1993 and Pannarale et al., 1996)" "M" "" "United States" "" "0" "" "" "" "1_V:3" "00411856" "" "" "" "1" "" "00000" "{PMID:Iannaccone 2006:17014888}" "Family 1, proband (no family numbering in the article; other two families have previously been published in Del Porto et al., 1993 and Pannarale et al., 1996)" "F" "" "United States" "" "0" "" "" "" "1_VI:2" "00411857" "" "" "" "1" "" "00000" "{PMID:Iannaccone 2006:17014888}" "Family 3, proband\'s mother (no family numbering in the article; other two families have previously been published in Del Porto et al., 1993 and Pannarale et al., 1996)" "F" "" "United States" "" "0" "" "" "black" "3_III:2" "00411858" "" "" "" "1" "" "00000" "{PMID:Iannaccone 2006:17014888}" "Family 3, proband (no family numbering in the article; other two families have previously been published in Del Porto et al., 1993 and Pannarale et al., 1996)" "M" "" "United States" "" "0" "" "" "black" "3_IV:4" "00411859" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family A" "F" "" "Norway" "" "0" "" "" "Norwegian" "A1" "00411860" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family A" "M" "" "Norway" "" "0" "" "" "Norwegian" "A2" "00411861" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family A" "F" "" "Norway" "" "0" "" "" "Norwegian" "A3" "00411862" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family B" "F" "" "Norway" "" "0" "" "" "Norwegian" "B1" "00411863" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family B" "F" "" "Norway" "" "0" "" "" "Norwegian" "B2" "00411864" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family B" "M" "" "Norway" "" "0" "" "" "Norwegian" "B3" "00411865" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family B" "F" "" "Norway" "" "0" "" "" "Norwegian" "B4" "00411866" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family B" "F" "" "Norway" "" "0" "" "" "Norwegian" "B5" "00411867" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family C" "F" "" "Norway" "" "0" "" "" "Norwegian" "C1" "00411868" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family C" "F" "" "Norway" "" "0" "" "" "Norwegian" "C2" "00411869" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "F" "" "Norway" "" "0" "" "" "Norwegian" "H1" "00411870" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "F" "" "Norway" "" "0" "" "" "Norwegian" "H3" "00411871" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "M" "" "Norway" "" "0" "" "" "Norwegian" "H4" "00411872" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "F" "" "Norway" "" "0" "" "" "Norwegian" "H5" "00411873" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "M" "" "Norway" "" "0" "" "" "Norwegian" "H6" "00411874" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "F" "" "Norway" "" "0" "" "" "Norwegian" "H7" "00411875" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family H" "F" "" "Norway" "" "0" "" "" "Norwegian" "H8" "00411876" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family J" "M" "" "Norway" "" "0" "" "" "Norwegian" "J2" "00411877" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family K" "F" "" "Norway" "" "0" "" "" "Norwegian" "K6" "00411878" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family K" "F" "" "Norway" "" "0" "" "" "Norwegian" "K10" "00411879" "" "" "" "1" "" "00000" "{PMID:Grondahl 2006:17488458}" "Family K" "M" "" "Norway" "" "0" "" "" "Norwegian" "K11" "00411880" "" "" "" "1" "" "00000" "{PMID:Ando 2007:17653048}" "unaffected control individual" "" "" "" "" "0" "" "" "" "?" "00411881" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "1_P1" "00411882" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "1_P2" "00411883" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "1_P3" "00411884" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "2_P1" "00411885" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "2_P2" "00411886" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "3_P1" "00411887" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "4_P1" "00411888" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "5_P1" "00411889" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "6_P1" "00411890" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "7_P1" "00411891" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "7_P2" "00411892" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "7_P3" "00411893" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "8_P1" "00411894" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "9_P1" "00411895" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "9_P2" "00411896" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "9_P3" "00411897" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "9_P4" "00411898" "" "" "" "1" "" "00000" "{PMID:Tanner 2009:18837008}" "" "?" "" "" "" "0" "" "" "" "?" "00411899" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2006:16565402}" "Swiss family (23505)" "M" "" "Switzerland" "" "0" "" "" "Swiss" "II-1" "00411900" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2006:16565402}" "Swiss family (23505)" "F" "" "Switzerland" "" "0" "" "" "Swiss" "II-2" "00411901" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2006:16565402}" "Swiss family (23505)" "M" "" "Switzerland" "" "0" "" "" "Swiss" "II-4" "00411902" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2006:16565402}" "Swiss family (23505)" "M" "" "Switzerland" "" "0" "" "" "Swiss" "III-1" "00411903" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2006:16565402}" "Swiss family (23505)" "M" "" "Switzerland" "" "0" "" "" "Swiss" "III-2" "00411904" "" "" "" "1" "" "00000" "{PMID:Tsui 2008:19085385}" "proband" "M" "" "" "" "0" "" "" "" "Case 1" "00411905" "" "" "" "1" "" "00000" "{PMID:Tsui 2008:19085385}" "proband\'s son 1" "M" "" "" "" "0" "" "" "" "Case 2" "00411906" "" "" "" "1" "" "00000" "{PMID:Tsui 2008:19085385}" "proband\'s son 3" "M" "" "" "" "0" "" "" "" "Case 4" "00411907" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411908" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411909" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411910" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411911" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411912" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411913" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411914" "" "" "" "1" "" "00000" "{PMID:Krebs_2010:19913029}" "cell line data" "?" "" "" "" "0" "" "" "" "?" "00411916" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP21" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP21_IV:1" "00411917" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP21" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP21_IV:2" "00411918" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP21" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP21_IV:3" "00411919" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP21" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP21_IV:9" "00411920" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP21" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP21_IV:10" "00411921" "" "" "" "1" "" "00000" "{PMID:Azam 2009:19960070}" "family RP53" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "RP53_V:3" "00411923" "" "" "" "1" "" "00000" "{PMID:Roberts 2008:20072635}" "proband" "F" "" "South Africa" "" "0" "" "" "white" "63" "00411924" "" "" "" "1" "" "00000" "{PMID:Roberts 2008:20072635}" "proband\'s sister 1\'s son" "M" "" "South Africa" "" "0" "" "vitamin A supplementation from 1999-2006, vision reported to be stable during this time" "white" "63" "00411995" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB41, proband\'s granddaughter (error in annotation, III:12 in the table and III:3 in the pedigree)" "F" "" "France" "" "0" "" "" "French" "2752 III.3" "00411996" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB41, proband" "F" "" "France" "" "0" "" "" "French" "2810 I.1" "00411997" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB41, proband\'s daughter" "F" "" "France" "" "0" "" "" "French" "2808 II.2" "00411998" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB41, proband\'s grandson" "F" "" "France" "" "0" "" "" "French" "2799 III.1" "00411999" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB42, proband" "F" "" "France" "" "0" "" "" "French" "2923 I.2" "00412000" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB42, proband\'s daughter 3" "F" "" "France" "" "0" "" "" "French" "2929 II.4" "00412001" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB42, proband\'s son" "M" "" "France" "" "0" "" "" "French" "2927 II.8" "00412002" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family PB42, proband\'s grandson (son of II.8)" "M" "" "France" "" "0" "" "" "French" "2938 III.12" "00412003" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 155, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00218" "00412004" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 155, proband\'s brother 1\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 02741" "00412005" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 155, proband\'s brother 3" "M" "" "France" "" "0" "" "" "French" "CIC 02517" "00412006" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 155, proband\'s brother 3\'s daugther" "F" "" "France" "" "0" "" "" "French" "CIC 01329" "00412007" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00123" "00412008" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s mother\'s sister 2" "F" "" "France" "" "0" "" "" "French" "CIC 03071" "00412009" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s mother\'s sister 3" "F" "" "France" "" "0" "" "" "French" "CIC 00249" "00412010" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s mother\'s sister 3\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 03181" "00412011" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s mother\'s sister 2\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 00799" "00412012" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s sister 3" "F" "" "France" "" "0" "" "" "French" "CIC 00500" "00412013" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 96/172, proband\'s brother 4" "M" "" "France" "" "0" "" "" "French" "CIC 00501" "00412014" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband" "F" "" "France" "" "0" "" "" "French" "CIC 00364" "00412015" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s brother" "M" "" "France" "" "0" "" "" "French" "CIC 01052" "00412016" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s brother\'s daughter 1" "F" "" "France" "" "0" "" "" "French" "CIC 01050" "00412017" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s brother\'s daughter 2" "F" "" "France" "" "0" "" "" "French" "CIC 01068" "00412018" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s father" "M" "" "France" "" "0" "" "" "French" "CIC 01045" "00412019" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s sister" "F" "" "France" "" "0" "" "" "French" "CIC 01055" "00412020" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s sister\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 01054" "00412021" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 247, proband\'s sister\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 01047" "00412022" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00974" "00412023" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s mother" "F" "" "France" "" "0" "" "" "French" "CIC 01246" "00412024" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s mother\'s sister 1" "F" "" "France" "" "0" "" "" "French" "CIC 01252" "00412025" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s mother\'s sister 2" "F" "" "France" "" "0" "" "" "French" "CIC 01262" "00412026" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s mother\'s sister 2\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 01261" "00412027" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 00976" "00412028" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 610, proband\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 00977" "00412029" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00716" "00412030" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband\'s mother" "F" "" "France" "" "0" "" "" "French" "CIC 00715" "00412031" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband\'s maternal grandmother" "F" "" "France" "" "0" "" "" "French" "CIC 00717" "00412032" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband\'s maternal grandmother\'s mother" "F" "" "France" "" "0" "" "" "French" "CIC 02608" "00412033" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband\'s maternal grandmother\'s sister" "F" "" "France" "" "0" "" "" "French" "CIC 02609" "00412034" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 475, proband\'s sister" "F" "" "France" "" "0" "" "" "French" "CIC 02599" "00412035" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband" "M" "" "France" "" "0" "" "" "French" "2296 V.8" "00412036" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s sister" "F" "" "France" "" "0" "" "" "French" "2327 V.6" "00412037" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s father\'s sister" "F" "" "France" "" "0" "" "" "French" "2378 IV.1" "00412038" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s father\'s sister\'s daughter" "F" "" "France" "" "0" "" "" "French" "2379 V.3" "00412039" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s father\'s sister\'s son 1" "M" "" "France" "" "0" "" "" "French" "2377 V.1" "00412040" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s father\'s sister\'s son 2" "M" "" "France" "" "0" "" "" "French" "2380 V.2" "00412041" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family RP827, proband\'s father" "M" "" "France" "" "0" "" "" "French" "2324 IV.5" "00412042" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 394, proband" "F" "" "France" "" "0" "" "" "French" "CIC 00590" "00412043" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 394, proband\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 00592" "00412044" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00161" "00412045" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s brother" "M" "" "France" "" "0" "" "" "French" "CIC 02677" "00412046" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother" "F" "" "France" "" "0" "" "" "French" "CIC 02545" "00412047" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 1\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 02892" "00412048" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 2" "F" "" "France" "" "0" "" "" "French" "CIC 02574" "00412049" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 2\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 02547" "00412050" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 2\'s son 3" "M" "" "France" "" "0" "" "" "French" "CIC 02575" "00412051" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 5\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 02639" "00412052" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 5\'s son 3" "M" "" "France" "" "0" "" "" "French" "CIC 02601" "00412053" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 119, proband\'s mother\'s sister 5\'s son 3\'s son" "M" "" "France" "" "0" "" "" "French" "CIC 02602" "00412054" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 546, proband" "M" "" "France" "" "0" "" "" "French" "CIC 00841" "00412055" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 546, proband\'s daughter" "F" "" "France" "" "0" "" "" "French" "CIC 00842" "00412056" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 598, proband" "F" "" "France" "" "0" "" "" "French" "CIC 00944" "00412057" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 598, proband\'s mother" "F" "" "France" "" "0" "" "" "French" "CIC 00945" "00412058" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband" "F" "" "France" "" "0" "" "" "French" "CIC 01125" "00412059" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s brother 4" "M" "" "France" "" "0" "" "" "French" "CIC 02667" "00412060" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s daughter 1" "F" "" "France" "" "0" "" "" "French" "CIC 01126" "00412061" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s daughter 2" "F" "" "France" "" "0" "" "" "French" "CIC 02634" "00412062" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s sister 3" "F" "" "France" "" "0" "" "" "French" "CIC 02632" "00412063" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s sister 3\'s daughter 1" "F" "" "France" "" "0" "" "" "French" "CIC 02636" "00412064" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s sister 3\'s daughter 2" "F" "" "France" "" "0" "" "" "French" "CIC 02633" "00412065" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s sister 4" "F" "" "France" "" "0" "" "" "French" "CIC 02638" "00412066" "" "" "" "1" "" "00000" "{PMID:Audo 2010:20164459}" "Family 681, proband\'s sister 4\'s son 1" "M" "" "France" "" "0" "" "" "French" "CIC 02635" "00412067" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband" "F" "" "China" "" "0" "" "" "Chinese Bai" "IV:1" "00412068" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s brother" "M" "" "China" "" "0" "" "" "Chinese Bai" "IV:2" "00412069" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s brother\'s daughter" "F" "" "China" "" "0" "" "" "Chinese Bai" "V:1" "00412070" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s mother" "F" "" "China" "" "0" "" "" "Chinese Bai" "III:2" "00412071" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s mother\'s brother" "M" "" "China" "" "0" "" "" "Chinese Bai" "III:8" "00412072" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s mother\'s brother\'s daughter" "F" "" "China" "" "0" "" "" "Chinese Bai" "IV:4" "00412073" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother" "F" "" "China" "" "0" "" "" "Chinese Bai" "II:2" "00412074" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother" "M" "" "China" "" "0" "" "" "Chinese Bai" "II:3" "00412075" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother\'s son 1" "M" "" "China" "" "0" "" "" "Chinese Bai" "III:9" "00412076" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother\'s son 2" "M" "" "China" "" "0" "" "" "Chinese Bai" "III:10" "00412077" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother\'s son 3" "M" "" "China" "" "0" "" "" "Chinese Bai" "III:12" "00412078" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother\'s son 2\'s son" "M" "" "China" "" "0" "" "" "Chinese Bai" "IV:5" "00412079" "" "" "" "1" "" "00000" "{PMID:Guo 2010:20555336}" "Bai family, proband\'s maternal grandmother\'s brother\'s son 3\'s son" "F" "" "China" "" "0" "" "" "Chinese Bai" "IV:6" "00412092" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "Z610180" "00412093" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610035" "00412094" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610132" "00412095" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "Z610113" "00412096" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "Z610017" "00412097" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610090" "00412098" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610057" "00412099" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "Z610187" "00412100" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610257" "00412101" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "Z610082" "00412102" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610121" "00412103" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610150" "00412104" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610098" "00412105" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "M" "" "China" "" "0" "" "" "" "Z610071" "00412106" "" "" "" "1" "" "00000" "{PMID:Li 2010:20832389}" "" "F" "" "China" "" "0" "" "" "" "NC00296" "00412112" "" "" "" "1" "" "00000" "{PMID:Kartasasmita 2011:21174529}" "Family 1, individual II-1" "F" "" "Indonesia" "" "0" "" "" "West Javanese" "1: II-1" "00412113" "" "" "" "1" "" "00000" "{PMID:Kartasasmita 2011:21174529}" "Family 1, individual II-2; proband" "M" "" "Indonesia" "" "0" "" "" "West Javanese" "1: II-2" "00412114" "" "" "" "1" "" "00000" "{PMID:Kartasasmita 2011:21174529}" "Family 2, individual II-2; proband" "F" "" "Indonesia" "" "0" "" "" "West Javanese" "2: II-1" "00412115" "" "" "" "1" "" "00000" "{PMID:Kartasasmita 2011:21174529}" "Family 2, individual II-6" "M" "" "Indonesia" "" "0" "" "" "West Javanese" "2: II-6" "00412116" "" "" "" "1" "" "00000" "{PMID:Hernan 2011:21357407}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412117" "" "" "" "1" "" "00000" "{PMID:Hernan 2011:21357407}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412118" "" "" "" "1" "" "00000" "{PMID:Hernan 2011:21357407}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412119" "" "" "" "1" "" "00000" "{PMID:Hernan 2011:21357407}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412120" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family A, proband" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "III-5" "00412121" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family B, proband" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-2" "00412122" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family B, proband\'s brother" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-4" "00412123" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family B, proband\'s brother\'s daughter" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "III-2" "00412124" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family C, proband" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-1" "00412125" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family D, proband" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-3" "00412126" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family E, proband" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "I-1" "00412127" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family E, proband\'s daughter 1" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-1" "00412128" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family E, proband\'s daughter 2" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-2" "00412129" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family E, proband\'s son 1" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-3" "00412130" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family E, proband\'s son 2" "M" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-4" "00412131" "" "" "" "1" "" "00000" "{PMID:Kim 2011:21677794}" "Family F, proband" "F" "" "Korea, South (Republic)" "" "0" "" "" "Korean" "II-3" "00412134" "" "" "" "1" "" "00000" "{PMID:Toledo 2011:21940625}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412135" "" "" "" "1" "" "00000" "{PMID:Toledo 2011:21940625}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412136" "" "" "" "1" "" "00000" "{PMID:Nalbantoglu 2012:22321012}" "proband" "M" "" "Turkey" "" "0" "" "" "Turkish" "I-1" "00412137" "" "" "" "1" "" "00000" "{PMID:Nalbantoglu 2012:22321012}" "proband\'s son" "M" "" "Turkey" "" "0" "" "" "Turkish" "II-2" "00412138" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband" "M" "" "France" "" "0" "" "" "French (Dijon)" "V.2" "00412139" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband\'s father\'s sister 2" "F" "" "France" "" "0" "" "" "French (Dijon)" "IV.6" "00412140" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband\'s great grandmother\'s brother\'s grandson" "M" "" "France" "" "0" "" "" "French (Dijon)" "IV.11" "00412141" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband\'s father\'s sister 1\'s son" "M" "" "France" "" "0" "" "" "French (Dijon)" "V.4" "00412142" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband\'s father\'s sister 2\'s son" "M" "" "France" "" "0" "" "" "French (Dijon)" "V.8" "00412143" "" "" "" "1" "" "00000" "{PMID:Maubaret 2012:22419850}" "six-generation French family (numbering of tested individuals is different from numbering in the actual pedigree), proband\'s grandfather\'s sister\'s grandson" "M" "" "France" "" "0" "" "" "French (Dijon)" "V.11" "00412144" "" "" "" "1" "" "00000" "{PMID:Davies_2012:22791210}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "1" "00412145" "" "" "" "1" "" "00000" "{PMID:Davies_2012:22791210}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "2" "00412146" "" "" "" "1" "" "00000" "{PMID:Davies_2012:22791210}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "3" "00412147" "" "" "" "1" "" "00000" "{PMID:Davies_2012:22791210}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "4" "00412148" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 83" "M" "" "China" "" "0" "" "" "Chinese" "II-1" "00412149" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 83" "M" "" "China" "" "0" "" "" "Chinese" "III-1" "00412150" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 83" "M" "" "China" "" "0" "" "" "Chinese" "IV-1" "00412151" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 83" "F" "" "China" "" "0" "" "" "Chinese" "III-5" "00412152" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 83" "F" "" "China" "" "0" "" "" "Chinese" "III-6" "00412153" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-1" "00412154" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "IV-1" "00412155" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-3" "00412156" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "IV-2" "00412157" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-5" "00412158" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-6" "00412159" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-7" "00412160" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "F" "" "China" "" "0" "" "" "Chinese" "IV-4" "00412161" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "F" "" "China" "" "0" "" "" "Chinese" "II-7" "00412162" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "M" "" "China" "" "0" "" "" "Chinese" "III-10" "00412163" "" "" "" "1" "" "00000" "{PMID:Pan 2012:23288993}" "family 112" "F" "" "China" "" "0" "" "" "Chinese" "IV-5" "00412166" "" "" "" "1" "" "00000" "{PMID:Rivera-DelaParra 2013:23402891}" "" "M" "" "Mexico" "" "0" "" "" "Mexican" "Patient # 1" "00412167" "" "" "" "1" "" "00000" "{PMID:Rivera-DelaParra 2013:23402891}" "" "F" "" "Mexico" "" "0" "" "" "Mexican" "Patient # 2" "00412168" "" "" "" "1" "" "00000" "{PMID:Rivera-DelaParra 2013:23402891}" "" "M" "" "Mexico" "" "0" "" "" "Mexican" "Patient # 3" "00412169" "" "" "" "1" "" "00000" "{PMID:Rivera-DelaParra 2013:23402891}" "" "M" "" "Mexico" "" "0" "" "" "Mexican" "Patient # 4" "00412173" "" "" "" "1" "" "00000" "{PMID:Hollingsworth 2013:23940033}" "cell line experiment" "" "" "" "" "0" "" "" "" "?" "00412180" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 12, proband" "F" "" "China" "" "0" "" "" "" "III:1" "00412181" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 12, proband\'s father" "M" "" "China" "" "0" "" "" "" "II:1" "00412182" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 12, proband\'s father\'s brother 3" "M" "" "China" "" "0" "" "" "" "II:7" "00412183" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 12, proband\'s sister 1" "F" "" "China" "" "0" "" "" "" "III:2" "00412184" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 12, proband\'s sister 2" "F" "" "China" "" "0" "" "" "" "III:3" "00412185" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 245, proband" "F" "" "China" "" "0" "" "" "" "II:4" "00412186" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 30, proband" "M" "" "China" "" "0" "" "" "" "III:1" "00412187" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 13, proband" "F" "" "China" "" "0" "" "" "" "II:7" "00412188" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 22, proband" "F" "" "China" "" "0" "" "" "" "II:5" "00412189" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 22, proband\'s daughter" "F" "" "China" "" "0" "" "" "" "III:2" "00412190" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 7, proband" "F" "" "China" "" "0" "" "" "" "III:3" "00412191" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 171, proband" "M" "" "China" "" "0" "" "" "" "II:5" "00412192" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 21, proband" "M" "" "China" "" "0" "" "" "" "III:1" "00412193" "" "" "" "1" "" "00000" "{PMID:Yang 2014:25221422}" "Family 21, proband\'s mother" "F" "" "China" "" "0" "" "" "" "II:4" "00412194" "" "" "" "1" "" "00000" "{PMID:Shah 2014:24918165}" "proband" "M" "" "New Zealand" "" "0" "" "" "" "III:5" "00412195" "" "" "" "1" "" "00000" "{PMID:Shah 2014:24918165}" "proband\'s mother" "F" "" "New Zealand" "" "0" "" "" "" "II:4" "00412196" "" "" "" "1" "" "00000" "{PMID:Shah 2014:24918165}" "proband\'s half-brother" "M" "" "New Zealand" "" "0" "" "" "" "III:8" "00412198" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 1 (JU#0678-062JIKEI), proband" "M" "" "Japan" "" "0" "" "" "Japanese" "Fam1patII-2" "00412199" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 1 (JU#0678-062JIKEI), proband\'s mother" "F" "" "Japan" "" "0" "" "" "Japanese" "Fam1patI-2" "00412200" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 1 (JU#0678-062JIKEI), proband\'s daughter" "F" "" "Japan" "" "0" "" "" "Japanese" "Fam1patIII-1" "00412201" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 2 (JU#0575-037JIKEI), proband" "F" "" "Japan" "" "0" "" "" "Japanese" "Fam2patI-1" "00412202" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 2 (JU#0575-037JIKEI), proband\'s father" "M" "" "Japan" "" "0" "" "" "Japanese" "Fam2patII-1" "00412203" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25485142}" "Family 2 (JU#0575-037JIKEI), proband\'s son" "M" "" "Japan" "" "0" "" "" "Japanese" "Fam2patIII-1" "00412204" "" "" "" "1" "" "00000" "{PMID:Napier 2015:25265376}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Northern Irish" "?" "00412207" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_I.1" "00412208" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_I.2" "00412209" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_II.2" "00412210" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_II.3" "00412211" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_II.4" "00412212" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_III.3" "00412213" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT100_III.4" "00412214" "" "" "" "8" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT65_II.1" "00412215" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT65_III.3" "00412216" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "M" "" "Spain" "" "0" "" "" "" "RPT65_III.5" "00412217" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "M" "" "Spain" "" "0" "" "" "" "RPT65_III.8" "00412218" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "M" "" "Spain" "" "0" "" "" "" "RPT65_III.10" "00412219" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "M" "" "Spain" "" "0" "" "" "" "RPT65_IV.2" "00412220" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT65_IV.3" "00412221" "" "" "00412214" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "F" "" "Spain" "" "0" "" "" "" "RPT65_IV.4" "00412223" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "?" "" "Spain" "" "0" "" "" "" "RP227" "00412224" "" "" "" "1" "" "00000" "{PMID:deSousa Dias 2015:26321861}" "" "?" "" "Spain" "" "0" "" "" "" "RPN240" "00412225" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband" "M" "" "China" "" "0" "" "" "" "IV:15" "00412226" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s son" "M" "" "China" "" "0" "" "" "" "V:2" "00412227" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s daughter" "F" "" "China" "" "0" "" "" "" "V:3" "00412228" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father\'s brother" "M" "" "China" "" "0" "" "" "" "III:1" "00412229" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father" "M" "" "China" "" "0" "" "" "" "III:9" "00412230" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father\'s brother\'s daughter" "F" "" "China" "" "0" "" "" "" "IV:1" "00412231" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father\'s sister\'s son 1" "M" "" "China" "" "0" "" "" "" "IV:6" "00412232" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father\'s sister\'s son 2" "M" "" "China" "" "0" "" "" "" "IV:8" "00412233" "" "" "" "1" "" "00000" "{PMID:Yu 2016:26794436}" "proband\'s father\'s sister\'s son 1\'s son" "M" "" "China" "" "0" "" "" "" "V:1" "00412244" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "Turkmenistan Jewish" "MOL0418 II:1" "00412245" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "Turkmenistan Jewish" "MOL0418 II:2" "00412246" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "" "MOL0553 III:2" "00412247" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "" "MOL0596 III:7" "00412248" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "" "MOL0692 III:1" "00412249" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "North African Jewish" "MOL0843 II:2" "00412250" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "" "MOL0908 II:1" "00412251" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "F" "" "Israel" "" "0" "" "" "" "MOL0923 III:4" "00412252" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "F" "" "Israel" "" "0" "" "" "" "MOL1076 III:4" "00412253" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "F" "" "Israel" "" "0" "" "" "" "MOL1076 III:1" "00412254" "" "" "" "1" "" "00000" "{PMID:Beryozkin 2016:26962691}" "" "M" "" "Israel" "" "0" "" "" "" "MOL0156 III:2" "00412256" "" "" "" "1" "" "00000" "{PMID:Van Schil 2016:26887858}" "" "M" "yes" "" "" "0" "" "" "Turkish" "IV:5" "00412257" "" "" "" "1" "" "00000" "{PMID:Van Schil 2016:26887858}" "" "F" "yes" "" "" "0" "" "" "Turkish" "IV:8" "00412258" "" "" "" "1" "" "00000" "{PMID:Van Schil 2016:26887858}" "" "M" "yes" "" "" "0" "" "" "Turkish" "IV:6" "00412259" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "F" "" "" "" "0" "" "" "" "III:1" "00412260" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "F" "" "" "" "0" "" "" "" "III:2" "00412261" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "M" "" "" "" "0" "" "" "" "III:6" "00412262" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "F" "" "" "" "0" "" "" "" "I:2" "00412263" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "M" "" "" "" "0" "" "" "" "II:2" "00412264" "" "" "" "1" "" "00000" "{PMID:Reiff 2016:27812022}" "" "F" "" "" "" "0" "" "" "" "II:3" "00412274" "" "" "" "1" "" "00000" "{PMID:Xiao 2019:30390055}" "" "M" "" "China" "" "0" "" "" "" "19217" "00412275" "" "" "" "1" "" "00000" "{PMID:Xiao 2019:30390055}" "" "M" "" "China" "" "0" "" "" "" "19717" "00412276" "" "" "" "1" "" "00000" "{PMID:Xiao 2019:30390055}" "" "F" "" "China" "" "0" "" "" "" "19945" "00412277" "" "" "" "1" "" "00000" "{PMID:Xiao 2019:30390055}" "" "F" "" "China" "" "0" "" "" "" "19768" "00412278" "" "" "" "1" "" "00000" "{PMID:Xiao 2019:30390055}" "" "M" "" "China" "" "0" "" "" "" "10418" "00412281" "" "" "" "1" "" "00000" "{PMID:Vilela 2018:30538586}" "parents first cousins" "F" "yes" "Brazil" "" "0" "" "" "Italian" "?" "00412282" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 1, proband" "M" "" "Iran" "" "0" "" "" "Iranian" "1_3:7" "00412283" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 1, proband\'s brother" "M" "" "Iran" "" "0" "" "" "Iranian" "1_3:8" "00412284" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 1, proband\'s mother" "F" "" "Iran" "" "0" "" "" "Iranian" "1_2:7" "00412285" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 2, proband" "M" "" "Iran" "" "0" "" "" "Iranian" "2_3:8" "00412286" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 2, proband\'s daughter" "F" "" "Iran" "" "0" "" "" "Iranian" "2_4:12" "00412287" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 3, proband" "M" "" "Iran" "" "0" "" "" "Iranian" "3_2:9" "00412288" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 4, proband" "F" "" "Iran" "" "0" "" "" "Iranian" "4_3:5" "00412289" "" "" "" "1" "" "00000" "{PMID:Roshandel 2019:30972525}" "Family 5, proband" "F" "" "Iran" "" "0" "" "" "Iranian" "5_3:10" "00412291" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother" "F" "" "China" "" "0" "" "" "Han-Chinese" "II-3" "00412292" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother\'s sister 1" "F" "" "China" "" "0" "" "" "Han-Chinese" "II-5" "00412293" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother\'s brother 2" "M" "" "China" "" "0" "" "" "Han-Chinese" "II-7" "00412294" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother\'s brother 1\'s son" "M" "" "China" "" "0" "" "" "Han-Chinese" "III-1" "00412295" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s brother" "M" "" "China" "" "0" "" "" "Han-Chinese" "III-2" "00412296" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband" "F" "" "China" "" "0" "" "" "Han-Chinese" "III-4" "00412297" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother\'s sister 1\'s daughter" "F" "" "China" "" "0" "" "" "Han-Chinese" "III-6" "00412298" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s mother\'s brother 2\'s daughter" "F" "" "China" "" "0" "" "" "Han-Chinese" "III-11" "00412299" "" "" "" "1" "" "00000" "{PMID:Wu 2019:31239368}" "proband\'s brother\'s son" "M" "" "China" "" "0" "" "" "Han-Chinese" "IV-1" "00412315" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family A, proband" "M" "" "China" "" "0" "" "" "" "A_III:2" "00412316" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family B, proband" "M" "" "China" "" "0" "" "" "" "B_II:4" "00412317" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family B, proband\'s son" "M" "" "China" "" "0" "" "" "" "B_III:2" "00412318" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family C, proband" "M" "" "China" "" "0" "" "" "" "C_II:1" "00412319" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family D, proband" "M" "" "China" "" "0" "" "" "" "D_II:1" "00412320" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family E, proband" "F" "" "China" "" "0" "" "" "" "E_IV:2" "00412321" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family E, proband\'s subclinically affected father" "M" "" "China" "" "0" "" "" "" "E_III:1" "00412322" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family E, proband\'s subclinically affected mother" "F" "" "China" "" "0" "" "" "" "E_III:2" "00412323" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family E, unaffected proband\'s sister" "F" "" "China" "" "0" "" "" "" "E_IV:3" "00412324" "" "" "" "1" "" "00000" "{PMID:Wang_2019:31319082}" "Family E, unaffected proband\'s brother" "M" "" "China" "" "0" "" "" "" "E_IV:5" "00412382" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "11326 II: 1" "00412383" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "11668 III: 2" "00412384" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "18408 II: 4" "00412385" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "1119 II: 7" "00412386" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6337 II: 1" "00412387" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "18402 III: 1" "00412388" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "8795 IV: 1" "00412389" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "8549 III: 4" "00412390" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "8549 IV: 3" "00412391" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "15241 III: 5" "00412392" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "15541 III: 1" "00412393" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "10932 III: 2" "00412394" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "10932 IV: 1" "00412395" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "9055 III: 10" "00412396" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "13721 III: 9" "00412397" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "13721 IV: 5" "00412398" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "13721 IV: 6" "00412399" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "6534 II: 3" "00412400" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 II: 12" "00412401" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 II: 6" "00412402" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 III: 1" "00412403" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 III: 3" "00412404" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 III: 4" "00412405" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 III: 7" "00412406" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "6534 III: 15" "00412407" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "6534 III: 16" "00412408" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "6534 IV: 2" "00412409" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "13466 II: 1" "00412410" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "9682 II: 1" "00412411" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "15747 II: 1" "00412412" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "19306 III: 1" "00412413" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "15567 II: 1" "00412414" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "15746 II: 4" "00412415" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "20586 III: 10" "00412416" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "8351 II: 11" "00412417" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "M" "" "China" "" "0" "" "" "" "12664 III: 6" "00412418" "" "" "" "1" "" "00000" "{PMID:Luo 2020:33347869}" "" "F" "" "China" "" "0" "" "" "" "12664 IV: 2" "00412419" "" "" "" "1" "" "00000" "{PMID:Strubbe 2021:33420188}" "mother of two sons with RP - phenocopy of X-linked RP" "F" "" "Belgium" "" "0" "" "" "" "II:1" "00412420" "" "" "" "1" "" "00000" "{PMID:Strubbe 2021:33420188}" "son 1" "M" "" "Belgium" "" "0" "" "" "" "III:1" "00412421" "" "" "" "1" "" "00000" "{PMID:Strubbe 2021:33420188}" "son 2" "M" "" "Belgium" "" "0" "" "" "" "III:2" "00412422" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 1" "M" "" "Slovenia" "" "0" "" "" "" "A:III-10" "00412423" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 5" "M" "" "Slovenia" "" "0" "" "" "" "A:III-11" "00412424" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband" "F" "" "Slovenia" "" "0" "" "" "" "A:III-12" "00412425" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s brother 2" "M" "" "Slovenia" "" "0" "" "" "" "A:III-14" "00412426" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s brother 3" "M" "" "Slovenia" "" "0" "" "" "" "A:III-17" "00412427" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 4\'s son" "M" "" "Slovenia" "" "0" "" "" "" "A:IV-1" "00412428" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 5\'s son 2" "M" "" "Slovenia" "" "0" "" "" "" "A:IV-3" "00412429" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 5\'s son 3" "M" "" "Slovenia" "" "0" "" "" "" "A:IV-4" "00412430" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 5\'s son 1" "M" "" "Slovenia" "" "0" "" "" "" "A:IV-5" "00412431" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s brother 3\'s daughter" "F" "" "Slovenia" "" "0" "" "" "" "A:IV-17" "00412432" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s father\'s sister\'s son 4\'s grandson" "M" "" "Slovenia" "" "0" "" "" "" "A:V-1" "00412433" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband" "M" "" "Slovenia" "" "0" "" "" "" "B:III-3" "00412434" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s mother" "F" "" "Slovenia" "" "0" "" "" "" "C:I-1" "00412435" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband" "M" "" "Slovenia" "" "0" "" "" "" "C:II-2" "00412436" "" "" "" "1" "" "00000" "{PMID:Kobal 2021:33669941}" "proband\'s son" "M" "" "Slovenia" "" "0" "" "" "" "C:III-2" "00412439" "" "" "" "1" "" "00000" "{PMID:Ruppert 2020:33777460}" "mother" "" "" "Slovenia" "" "0" "" "" "" "Case 1" "00412440" "" "" "" "1" "" "00000" "{PMID:Ruppert 2020:33777460}" "offspring" "" "" "Slovenia" "" "0" "" "" "" "Case 2" "00414359" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP26" "00415394" "" "" "" "1" "" "00006" "{PMID:Zanoni 2021:33941880}" "" "F" "no" "" "" "0" "" "" "white" "Pat3-I" "00420424" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F045" "00420467" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F129" "00420589" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F307" "00426940" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 43, individual 52" "M" "" "" "" "0" "" "" "" "43_52" "00429483" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429533" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429567" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429574" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429586" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429617" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429639" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429646" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429648" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429684" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429719" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429740" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429822" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429833" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429840" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429850" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429859" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429905" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429939" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429974" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429981" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430000" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430072" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430080" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430108" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430133" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430136" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430139" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430146" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00435410" "" "" "" "2" "" "00006" "{PMID:De Sousa Dias 2013:23559859}" "2-generation family, affected mother/son" "F;M" "" "Spain" "" "0" "" "" "" "Fam3" "00444308" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat75" "00446947" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "M" "" "Germany" "" "0" "" "" "" "ADRP-491" "00446948" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "ADRP-495" "00446950" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "ADRP-497" "00446951" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "ADRP-499" "00446952" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "ADRP-500" "00446958" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ADRP-515" "00446963" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "M" "" "Germany" "" "0" "" "" "" "ADRP--521" "00446968" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-262" "00446990" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-437" "00447008" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-473" "00447309" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1225" "00447550" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "CSNB-143" "00447617" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1250" "00447621" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1281" "00461075" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "white" "Pat10" "00461081" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "F" "" "South Africa" "" "0" "" "" "white" "Pat16" "00461085" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat20" "00461089" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "F" "" "South Africa" "" "0" "" "" "white" "Pat24" "00461109" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat44" "00461114" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat49" "00461138" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "F" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat73" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 1943 "{{individualid}}" "{{diseaseid}}" "00000101" "04214" "00000208" "01157" "00001781" "00112" "00033120" "04214" "00033140" "04214" "00033159" "04214" "00207607" "04214" "00232421" "04214" "00232422" "04214" "00232423" "04214" "00232424" "04214" "00232425" "04214" "00232426" "04214" "00232427" "04214" "00232428" "04214" "00232429" "04214" "00232430" "04214" "00232431" "04214" "00232432" "04214" "00232433" "04214" "00232434" "04214" "00232435" "04214" "00232436" "04214" "00232437" "04214" "00232438" "04214" "00232439" "04214" "00232440" "04214" "00232441" "04214" "00232442" "04214" "00232443" "04214" "00232444" "04214" "00232445" "04214" "00232446" "04214" "00232447" "04214" "00232448" "04214" "00232449" "04214" "00232450" "04214" "00232451" "04214" "00232452" "04214" "00233657" "04214" "00233658" "04214" "00246668" "05130" "00246669" "05130" "00246670" "05130" "00269943" "04214" "00293212" "00198" "00293213" "00198" "00300246" "00244" "00304924" "00198" "00308543" "04214" "00308544" "04214" "00308545" "04214" "00308546" "04214" "00308547" "04214" "00308548" "04214" "00308549" "04214" "00308640" "04214" "00308641" "04214" "00309358" "04214" "00309359" "04214" "00309360" "04214" "00309361" "04214" "00309362" "04214" "00309363" "04214" "00309364" "04214" "00309365" "04214" "00309366" "04214" "00309367" "04214" "00309368" "04214" "00319822" "04214" "00319835" "04214" "00325450" "04214" "00325494" "04214" "00326679" "04214" "00326680" "04214" "00326681" "04214" "00326692" "04214" "00326702" "04214" "00326703" "04214" "00326704" "04214" "00326705" "04214" "00326706" "04214" "00326707" "04214" "00326708" "04214" "00326709" "04214" "00326710" "04214" "00326711" "04214" "00326712" "04214" "00326713" "04214" "00326714" "04214" "00326715" "04214" "00326716" "04214" "00326717" "04214" "00326718" "04214" "00326719" "04214" "00326720" "04214" "00326721" "04214" "00326722" "04214" "00326723" "04214" "00326724" "04214" "00326725" "04214" "00326726" "04214" "00326727" "04214" "00326728" "04214" "00326729" "04214" "00326730" "04214" "00326731" "04214" "00326732" "04214" "00326733" "04214" "00326734" "04214" "00326735" "04214" "00326736" "04214" "00326737" "04214" "00326738" "04214" "00326739" "04214" "00326740" "04214" "00326741" "04214" "00326742" "04214" "00326743" "04214" "00326744" "04214" "00326745" "04214" "00326746" "04214" "00326747" "04214" "00326748" "04214" "00326749" "04214" "00326750" "04214" "00326751" "04214" "00326752" "04214" "00326753" "04214" "00326754" "04214" "00326755" "04214" "00326756" "04214" "00326757" "04214" "00326758" "04214" "00326759" "04214" "00328037" "04214" "00328052" "04214" "00328088" "04214" "00328090" "04214" "00328166" "04214" "00328174" "04214" "00328299" "04214" "00328401" "04214" "00328435" "04214" "00328479" "04214" "00331270" "04214" "00331271" "04214" "00332499" "04214" "00332526" "04214" "00332529" "04214" "00332532" "04214" "00332538" "04214" "00333359" "04214" "00333386" "04214" "00333406" "04214" "00333407" "04214" "00333408" "04214" "00333409" "04214" "00333512" "04214" "00333513" "04214" "00333514" "04214" "00333515" "04214" "00333516" "04214" "00333517" "04214" "00333518" "04214" "00333570" "04214" "00333571" "04214" "00333572" "04214" "00333573" "04214" "00333574" "04214" "00333575" "04214" "00333576" "04214" "00333595" "04214" "00333596" "04214" "00333597" "04214" "00333598" "04214" "00333599" "04214" "00333600" "04214" "00333601" "04214" "00333602" "04214" "00333603" "04214" "00333604" "04214" "00333605" "04214" "00333606" "04214" "00333607" "04214" "00333608" "04214" "00333853" "04214" "00333854" "04214" "00333918" "04214" "00333978" "04214" "00333979" "04214" "00333980" "04214" "00334430" "04214" "00335149" "00198" "00335219" "04214" "00335299" "04214" "00335300" "04214" "00335301" "04214" "00335385" "04214" "00335386" "04214" "00335403" "04214" "00335439" "04214" "00335492" "04214" "00335543" "04214" "00335544" "04214" "00335545" "04214" "00335546" "04214" "00335547" "04214" "00335548" "04214" "00335549" "04214" "00335550" "04214" "00335551" "04214" "00335552" "04214" "00335553" "04214" "00335554" "04214" "00335680" "04214" "00335681" "04214" "00335682" "04214" "00335683" "04214" "00335684" "04214" "00335685" "04214" "00335686" "04214" "00335687" "04214" "00335688" "04214" "00335689" "04214" "00335690" "04214" "00335691" "04214" "00335692" "04214" "00335693" "04214" "00335694" "04214" "00335695" "04214" "00335696" "04214" "00335697" "04214" "00335698" "04214" "00335699" "04214" "00335700" "04214" "00335701" "04214" "00335702" "04214" "00335703" "04214" "00335704" "04214" "00335705" "04214" "00335706" "04214" "00335734" "04214" "00335735" "04214" "00335736" "04214" "00335737" "04214" "00335949" "04214" "00358734" "04214" "00358735" "04214" "00358736" "04214" "00358794" "04214" "00358928" "04214" "00358950" "04214" "00359001" "04214" "00359129" "04214" "00359141" "04214" "00359154" "04214" "00359170" "04214" "00359192" "04214" "00359212" "04214" "00361426" "04214" "00361444" "04214" "00362253" "05415" "00362890" "04214" "00362891" "04214" "00363392" "04214" "00363405" "04214" "00363406" "04214" "00363407" "04214" "00363408" "04214" "00363409" "04214" "00363410" "04214" "00363411" "04214" "00363412" "04214" "00363413" "04214" "00363414" "04214" "00363421" "04214" "00363440" "04214" "00363467" "04214" "00363468" "04214" "00363504" "04214" "00363505" "04214" "00363506" "04214" "00372081" "04214" "00372084" "04214" "00372500" "04214" "00372623" "04214" "00372624" "04214" "00372625" "04214" "00372626" "04214" "00372627" "04214" "00372628" "04214" "00372629" "04214" "00372630" "04214" "00372631" "04214" "00372701" "04214" "00373339" "04214" "00373370" "04214" "00373467" "04214" "00373510" "04214" "00373512" "04214" "00373513" "04214" "00373514" "04214" "00373515" "04214" "00373516" "04214" "00373517" "04214" "00373816" "04214" "00373819" "04214" "00373912" "04214" "00373915" "04214" "00373920" "04214" "00373945" "04214" "00373950" "04214" "00373958" "04214" "00373959" "04214" "00373960" "04214" "00373961" "04214" "00373962" "04214" "00373963" "04214" "00373964" "04214" "00373965" "04214" "00373966" "04214" "00373967" "04214" "00373968" "04214" "00373969" "04214" "00373970" "04214" "00373971" "04214" "00373972" "04214" "00373973" "04214" "00373974" "04214" "00373975" "04214" "00373976" "04214" "00373977" "04214" "00373978" "04214" "00373979" "04214" "00373980" "04214" "00373981" "04214" "00373982" "04214" "00373983" "04214" "00373984" "04214" "00373985" "04214" "00373986" "04214" "00373987" "04214" "00373988" "04214" "00373989" "04214" "00373990" "04214" "00373991" "04214" "00373992" "04214" "00373993" "04214" "00373994" "04214" "00373995" "04214" "00373996" "04214" "00373997" "04214" "00373998" "04214" "00373999" "04214" "00374910" "04214" "00374926" "04214" "00374928" "04214" "00374935" "04214" "00375283" "04214" "00375284" "04214" "00375285" "04214" "00375286" "04214" "00375304" "04214" "00375305" "04214" "00375306" "04214" "00375410" "04214" "00375453" "04214" "00376168" "04214" "00376176" "04214" "00376177" "04214" "00376183" "04214" "00376185" "04214" "00376294" "04214" "00376482" "04214" "00376483" "04214" "00376484" "04214" "00376485" "04214" "00376486" "04214" "00376487" "04214" "00376488" "04214" "00376489" "04214" "00376501" "04214" "00376502" "04214" "00376503" "04214" "00376504" "04214" "00376505" "04214" "00376525" "04214" "00376526" "04214" "00376527" "04214" "00376528" "04214" "00376746" "04214" "00376769" "04214" "00376776" "04214" "00376783" "04214" "00376993" "04214" "00376994" "04214" "00376995" "04214" "00376996" "04214" "00376997" "04214" "00377215" "04214" "00377241" "04214" "00377246" "04214" "00377247" "04214" "00377248" "04214" "00377249" "04214" "00377250" "04214" "00377252" "04214" "00377416" "04214" "00377417" "04214" "00377418" "04214" "00377419" "04214" "00377420" "04214" "00377421" "04214" "00377422" "04214" "00377423" "04214" "00377424" "04214" "00377425" "04214" "00377426" "04214" "00377427" "04214" "00377428" "04214" "00377429" "04214" "00377430" "04214" "00377431" "04214" "00377432" "04214" "00377433" "04214" "00377434" "04214" "00377435" "04214" "00377436" "04214" "00377437" "04214" "00377438" "04214" "00377439" "04214" "00377440" "04214" "00377441" "04214" "00377442" "04214" "00377443" "04214" "00377444" "04214" "00377445" "04214" "00377446" "04214" "00377447" "04214" "00377448" "04214" "00377449" "04214" "00377450" "04214" "00377451" "04214" "00377452" "04214" "00377453" "04214" "00377454" "04214" "00377455" "04214" "00377456" "04214" "00377457" "04214" "00377458" "04214" "00377459" "04214" "00377460" "04214" "00377461" "04214" "00377462" "04214" "00377463" "04214" "00377464" "04214" "00377465" "04214" "00377466" "04214" "00377467" "04214" "00377468" "04214" "00377512" "04214" "00377729" "04214" "00377730" "04214" "00379393" "04214" "00379411" "04214" "00379450" "04214" "00379550" "00112" "00379601" "04214" "00379602" "04214" "00379603" "04214" "00379604" "04214" "00379605" "04214" "00379606" "04214" "00379607" "04214" "00379608" "04214" "00379609" "04214" "00379667" "00112" "00379798" "00112" "00379799" "00112" "00379869" "04214" "00379870" "04214" "00379871" "04214" "00379872" "04214" "00379873" "04214" "00379874" "04214" "00380229" "04214" "00380230" "04214" "00380231" "04214" "00380232" "04214" "00380233" "04214" "00380234" "04214" "00380235" "04214" "00380236" "04214" "00380237" "04214" "00380238" "04214" "00380239" "04214" "00380240" "04214" "00380241" "04214" "00380242" "04214" "00380243" "04214" "00380244" "04214" "00380245" "04214" "00380248" "04214" "00380249" "04214" "00380250" "04214" "00380259" "04214" "00380260" "04214" "00380261" "04214" "00380997" "04214" "00380999" "04214" "00381016" "04214" "00381098" "04214" "00381613" "04214" "00381620" "04214" "00381637" "04214" "00381647" "04214" "00381668" "04214" "00381674" "04214" "00381680" "04214" "00381695" "04214" "00381734" "04214" "00381735" "04214" "00381736" "04214" "00381737" "04214" "00381738" "04214" "00381739" "04214" "00381740" "04214" "00381741" "04214" "00381742" "04214" "00381743" "04214" "00381744" "04214" "00381745" "04214" "00381746" "04214" "00381747" "04214" "00381748" "04214" "00381749" "04214" "00381750" "04214" "00381751" "04214" "00381805" "04214" "00381904" "04214" "00381905" "04214" "00381906" "04214" "00381907" "04214" "00382380" "04214" "00382381" "04214" "00382382" "04214" "00382383" "04214" "00382384" "04214" "00382385" "04214" "00382386" "04214" "00382387" "04214" "00382388" "04214" "00382389" "04214" "00382390" "04214" "00382391" "04214" "00382392" "04214" "00382393" "04214" "00382394" "04214" "00382395" "04214" "00382396" "04214" "00382397" "04214" "00382398" "04214" "00382399" "04214" "00382400" "04214" "00382789" "04214" "00382794" "04214" "00382831" "04214" "00382833" "04214" "00382834" "04214" "00382836" "04214" "00382837" "04214" "00383059" "04214" "00383061" "04214" "00383072" "04214" "00383073" "04214" "00383080" "04214" "00383087" "04214" "00383093" "04214" "00383095" "04214" "00383486" "04214" "00383487" "04214" "00383710" "04214" "00383806" "04214" "00383837" "04214" "00384076" "04214" "00384274" "04214" "00384331" "04214" "00384746" "04214" "00384747" "04214" "00384774" "04214" "00384775" "04214" "00385051" "04214" "00385724" "04214" "00385725" "04214" "00385877" "04214" "00385955" "04214" "00386164" "04214" "00386165" "04214" "00386203" "04214" "00386302" "04214" "00386547" "04214" "00386549" "04214" "00386554" "04214" "00386565" "04214" "00386589" "04214" "00386619" "04214" "00386646" "04214" "00386675" "04214" "00386686" "04214" "00386715" "04214" "00386720" "04214" "00386840" "04214" "00386996" "04214" "00386997" "04214" "00386998" "04214" "00386999" "04214" "00387000" "04214" "00387001" "04214" "00387002" "04214" "00387003" "04214" "00387004" "04214" "00387005" "04214" "00387006" "04214" "00387007" "04214" "00387008" "04214" "00387009" "04214" "00387010" "04214" "00387011" "04214" "00387012" "04214" "00387013" "04214" "00387014" "04214" "00387015" "04214" "00387016" "04214" "00387384" "04214" "00387385" "04214" "00387514" "04214" "00388551" "04214" "00388724" "04214" "00388725" "04214" "00388726" "04214" "00388807" "04214" "00388847" "04214" "00388883" "04214" "00388884" "04214" "00388885" "04214" "00388981" "04214" "00388982" "04214" "00388983" "04214" "00388984" "04214" "00389107" "04214" "00389108" "04214" "00389109" "04214" "00389213" "04214" "00389214" "04214" "00389264" "04214" "00389265" "04214" "00389395" "04214" "00389479" "04214" "00389480" "04214" "00389489" "04214" "00389496" "04214" "00389497" "04214" "00389513" "04214" "00389514" "04214" "00389532" "04214" "00389533" "04214" "00389534" "04214" "00389538" "04214" "00389539" "04214" "00389543" "04214" "00389582" "04214" "00389583" "04214" "00389607" "04214" "00389623" "04214" "00389649" "04214" "00389650" "04214" "00389674" "04214" "00389678" "04214" "00389686" "04214" "00389688" "04214" "00389689" "04214" "00389690" "04214" "00389691" "04214" "00389693" "04214" "00389694" "04214" "00389696" "04214" "00389697" "04214" "00389701" "04214" "00389702" "04214" "00389706" "04214" "00389707" "04214" "00389714" "04214" "00389715" "04214" "00389716" "04214" "00389717" "04214" "00389813" "04214" "00389833" "04214" "00389894" "04214" "00389940" "04214" "00389955" "04214" "00389957" "04214" "00389991" "04214" "00390008" "04214" "00390036" "04214" "00390363" "04214" "00390364" "04214" "00390365" "04214" "00390366" "04214" "00390367" "04214" "00390368" "04214" "00390369" "04214" "00391388" "04214" "00391585" "04214" "00392314" "04214" "00392316" "04214" "00392321" "04214" "00392322" "04214" "00392325" "04214" "00392336" "04214" "00392341" "04214" "00392347" "04214" "00392348" "04214" "00392349" "04214" "00392352" "04214" "00392357" "04214" "00392361" "04214" "00392364" "04214" "00392367" "04214" "00392368" "04214" "00392375" "04214" "00392376" "04214" "00392382" "04214" "00392383" "04214" "00392386" "04214" "00392387" "04214" "00392393" "04214" "00392552" "04214" "00392553" "04214" "00392554" "04214" "00392555" "04214" "00392556" "04214" "00392557" "04214" "00392558" "04214" "00392559" "04214" "00392560" "04214" "00392561" "04214" "00392581" "04214" "00392609" "04214" "00392658" "04214" "00392778" "04214" "00392779" "04214" "00393440" "04214" "00393534" "04214" "00393599" "04214" "00393606" "04214" "00393611" "04214" "00393640" "04214" "00393733" "04214" "00393910" "04214" "00393914" "04214" "00394329" "04214" "00394506" "04214" "00394507" "04214" "00394508" "04214" "00394509" "04214" "00394510" "04214" "00394511" "04214" "00394512" "04214" "00394513" "04214" "00394514" "04214" "00394515" "04214" "00394516" "04214" "00394517" "04214" "00394518" "04214" "00394519" "04214" "00394520" "04214" "00394521" "04214" "00394522" "04214" "00395559" "04214" "00395918" "04214" "00395934" "04214" "00395951" "04214" "00395971" "04214" "00395972" "04214" "00395973" "04214" "00395974" "04214" "00395975" "04214" "00395976" "04214" "00395977" "04214" "00395978" "04214" "00395979" "04214" "00395980" "04214" "00396486" "04214" "00396509" "04214" "00396513" "04214" "00408421" "04214" "00409498" "01680" "00410607" "04214" "00410608" "04214" "00410609" "04214" "00410610" "04214" "00410611" "04214" "00410612" "04214" "00410613" "04214" "00410614" "04214" "00410615" "04214" "00410616" "04214" "00410617" "04214" "00410618" "04214" "00410619" "04214" "00410620" "04214" "00410621" "04214" "00410622" "04214" "00410623" "04214" "00410624" "04214" "00410625" "04214" "00410626" "04214" "00410627" "04214" "00410628" "04214" "00410629" "04214" "00410630" "04214" "00410631" "04214" "00410632" "04214" "00410633" "04214" "00410634" "04214" "00410635" "04214" "00410636" "04214" "00410637" "04214" "00410638" "04214" "00410639" "04214" "00410640" "04214" "00410641" "04214" "00410642" "04214" "00410643" "04214" "00410644" "04214" "00410645" "04214" "00410646" "04214" "00410647" "04214" "00410648" "04214" "00410649" "04214" "00410650" "04214" "00410651" "04214" "00410652" "04214" "00410653" "04214" "00410654" "04214" "00410655" "04214" "00410656" "04214" "00410657" "04214" "00410658" "04214" "00410659" "04214" "00410660" "04214" "00410661" "04214" "00410662" "04214" "00410663" "04214" "00410664" "04214" "00410665" "04214" "00410666" "04214" "00410667" "04214" "00410668" "04214" "00410669" "04214" "00410670" "04214" "00410671" "04214" "00410672" "04214" "00410673" "04214" "00410674" "04214" "00410675" "04214" "00410676" "04214" "00410677" "04214" "00410678" "04214" "00410679" "04214" "00410680" "04214" "00410681" "04214" "00410682" "04214" "00410683" "04214" "00410684" "04214" "00410685" "04214" "00410686" "04214" "00410687" "04214" "00410688" "04214" "00410689" "04214" "00410690" "04214" "00410691" "04214" "00410692" "04214" "00410693" "04214" "00410694" "04214" "00410695" "04214" "00410696" "04214" "00410697" "04214" "00410698" "04214" "00410699" "04214" "00410700" "04214" "00410701" "04214" "00410702" "04214" "00410703" "04214" "00410704" "04214" "00410705" "04214" "00410706" "04214" "00410707" "04214" "00410708" "04214" "00410709" "04214" "00410710" "04214" "00410711" "04214" "00410712" "04214" "00410713" "04214" "00410714" "04214" "00410715" "04214" "00410716" "04214" "00410717" "04214" "00410718" "04214" "00410719" "04214" "00410720" "04214" "00410721" "04214" "00410722" "04214" "00410723" "04214" "00410724" "04214" "00410725" "04214" "00410726" "04214" "00410727" "04214" "00410728" "04214" "00410729" "04214" "00410730" "04214" "00410731" "04214" "00410732" "04214" "00410733" "04214" "00410734" "04214" "00410736" "04214" "00410737" "04214" "00410738" "04214" "00410739" "04214" "00410740" "04214" "00410741" "04214" "00410742" "04214" "00410743" "04214" "00410744" "04214" "00410745" "04214" "00410746" "04214" "00410771" "04214" "00410772" "04214" "00410773" "04214" "00410774" "04214" "00410775" "04214" "00410776" "04214" "00410777" "04214" "00410778" "04214" "00410779" "04214" "00410780" "04214" "00410781" "04214" "00410782" "04214" "00410783" "04214" "00410784" "04214" "00410785" "04214" "00410786" "04214" "00410787" "04214" "00410788" "04214" "00410789" "04214" "00410790" "04214" "00410791" "04214" "00410792" "04214" "00410793" "04214" "00410794" "04214" "00410795" "04214" "00410796" "04214" "00410797" "04214" "00410798" "04214" "00410813" "04214" "00410814" "04214" "00410815" "04214" "00410816" "04214" "00410817" "04214" "00410818" "04214" "00410819" "04214" "00410820" "04214" "00410821" "04214" "00410822" "04214" "00410823" "04214" "00410824" "04214" "00410825" "04214" "00410826" "04214" "00410827" "04214" "00410828" "04214" "00410829" "04214" "00410830" "04214" "00410831" "04214" "00410832" "04214" "00410833" "04214" "00410834" "04214" "00410835" "04214" "00410836" "04214" "00410837" "04214" "00410838" "04214" "00410839" "04214" "00410840" "04214" "00410841" "04214" "00410842" "04214" "00410843" "04214" "00410844" "04214" "00410845" "04214" "00410846" "04214" "00410847" "04214" "00410848" "04214" "00410849" "04214" "00410850" "04214" "00410851" "04214" "00410852" "04214" "00410853" "04214" "00410854" "04214" "00410855" "04214" "00410856" "04214" "00410857" "04214" "00410858" "04214" "00410859" "04214" "00410860" "04214" "00410861" "04214" "00410862" "04214" "00410863" "04214" "00410864" "04214" "00410865" "04214" "00410866" "04214" "00410867" "04214" "00410868" "04214" "00410869" "04214" "00410870" "04214" "00410871" "04214" "00410872" "04214" "00410873" "04214" "00410874" "04214" "00410875" "04214" "00410876" "04214" "00410877" "04214" "00410878" "04214" "00410879" "04214" "00410880" "04214" "00410881" "04214" "00410882" "04214" "00410883" "04214" "00410884" "04214" "00410885" "04214" "00410886" "04214" "00410887" "04214" "00410888" "04214" "00410889" "04214" "00410890" "04214" "00410891" "04214" "00410892" "04214" "00410893" "04214" "00410894" "04214" "00410895" "04214" "00410896" "04214" "00410897" "04214" "00410898" "04214" "00410899" "04214" "00410900" "04214" "00410901" "04214" "00410902" "04214" "00410903" "04214" "00410904" "04214" "00410905" "04214" "00410906" "04214" "00410907" "04214" "00410908" "04214" "00410909" "04214" "00410910" "04214" "00410911" "04214" "00410912" "04214" "00410913" "04214" "00410914" "04214" "00410929" "04214" "00410930" "04214" "00410931" "04214" "00410932" "04214" "00410933" "04214" "00410934" "04214" "00410935" "04214" "00410936" "04214" "00410937" "04214" "00410938" "04214" "00411072" "04214" "00411073" "04214" "00411074" "04214" "00411075" "04214" "00411076" "04214" "00411077" "04214" "00411078" "04214" "00411079" "04214" "00411080" "04214" "00411081" "04214" "00411082" "04214" "00411083" "04214" "00411084" "04214" "00411085" "04214" "00411086" "04214" "00411087" "04214" "00411088" "04214" "00411096" "04214" "00411097" "04214" "00411098" "04214" "00411099" "04214" "00411100" "04214" "00411101" "04214" "00411102" "04214" "00411103" "04214" "00411107" "04214" "00411108" "04214" "00411109" "04214" "00411110" "04214" "00411111" "04214" "00411118" "04214" "00411130" "04214" "00411131" "04214" "00411132" "04214" "00411133" "04214" "00411134" "04214" "00411137" "04214" "00411138" "04214" "00411139" "04214" "00411140" "04214" "00411141" "04214" "00411142" "04214" "00411143" "04214" "00411144" "04214" "00411145" "04214" "00411146" "04214" "00411147" "04214" "00411148" "04214" "00411149" "04214" "00411150" "04214" "00411151" "04214" "00411152" "04214" "00411153" "04214" "00411154" "04214" "00411155" "04214" "00411156" "04214" "00411157" "04214" "00411158" "04214" "00411170" "04214" "00411171" "04214" "00411172" "04214" "00411200" "04214" "00411201" "04214" "00411202" "04214" "00411203" "04214" "00411204" "04214" "00411205" "04214" "00411206" "04214" "00411207" "04214" "00411208" "04214" "00411209" "04214" "00411210" "04214" "00411211" "04214" "00411212" "04214" "00411213" "04214" "00411214" "04214" "00411215" "04214" "00411216" "04214" "00411217" "04214" "00411218" "04214" "00411219" "04214" "00411220" "04214" "00411221" "04214" "00411222" "04214" "00411223" "04214" "00411224" "04214" "00411225" "04214" "00411226" "04214" "00411227" "04214" "00411228" "04214" "00411229" "04214" "00411230" "04214" "00411231" "04214" "00411232" "04214" "00411233" "04214" "00411234" "04214" "00411235" "04214" "00411236" "04214" "00411237" "04214" "00411238" "04214" "00411239" "04214" "00411240" "04214" "00411241" "04214" "00411242" "04214" "00411243" "04214" "00411244" "04214" "00411245" "04214" "00411246" "04214" "00411247" "04214" "00411248" "04214" "00411249" "04214" "00411250" "04214" "00411251" "04214" "00411252" "04214" "00411253" "04214" "00411254" "04214" "00411255" "04214" "00411257" "04214" "00411258" "04214" "00411259" "04214" "00411260" "04214" "00411265" "04214" "00411266" "04214" "00411267" "04214" "00411268" "04214" "00411269" "04214" "00411278" "04214" "00411279" "04214" "00411280" "04214" "00411281" "04214" "00411282" "04214" "00411283" "04214" "00411286" "04214" "00411287" "04214" "00411288" "04214" "00411289" "04214" "00411290" "04214" "00411291" "04214" "00411292" "04214" "00411293" "04214" "00411294" "04214" "00411295" "04214" "00411296" "04214" "00411297" "04214" "00411298" "04214" "00411299" "04214" "00411300" "04214" "00411301" "04214" "00411302" "04214" "00411303" "04214" "00411304" "04214" "00411305" "04214" "00411306" "04214" "00411307" "04214" "00411308" "04214" "00411309" "04214" "00411310" "04214" "00411311" "04214" "00411312" "04214" "00411313" "04214" "00411314" "04214" "00411315" "04214" "00411316" "04214" "00411317" "04214" "00411318" "04214" "00411319" "04214" "00411320" "04214" "00411368" "04214" "00411369" "04214" "00411370" "04214" "00411371" "04214" "00411372" "04214" "00411373" "04214" "00411374" "04214" "00411375" "04214" "00411376" "04214" "00411377" "04214" "00411380" "04214" "00411381" "04214" "00411382" "04214" "00411383" "04214" "00411384" "04214" "00411385" "04214" "00411386" "04214" "00411387" "04214" "00411388" "04214" "00411389" "04214" "00411390" "04214" "00411391" "04214" "00411392" "04214" "00411393" "04214" "00411394" "04214" "00411395" "04214" "00411396" "04214" "00411397" "04214" "00411398" "04214" "00411399" "04214" "00411400" "04214" "00411401" "04214" "00411402" "04214" "00411403" "04214" "00411404" "04214" "00411405" "04214" "00411406" "04214" "00411407" "04214" "00411408" "04214" "00411409" "04214" "00411411" "04214" "00411412" "04214" "00411417" "04214" "00411419" "04214" "00411420" "04214" "00411421" "04214" "00411427" "04214" "00411428" "04214" "00411429" "04214" "00411430" "04214" "00411431" "04214" "00411432" "04214" "00411433" "04214" "00411437" "04214" "00411438" "04214" "00411439" "04214" "00411440" "04214" "00411441" "04214" "00411442" "04214" "00411443" "04214" "00411444" "04214" "00411445" "04214" "00411446" "04214" "00411447" "04214" "00411448" "04214" "00411449" "04214" "00411459" "04214" "00411460" "04214" "00411461" "04214" "00411462" "04214" "00411463" "04214" "00411464" "04214" "00411465" "04214" "00411466" "04214" "00411467" "04214" "00411468" "04214" "00411469" "04214" "00411470" "04214" "00411471" "04214" "00411472" "04214" "00411473" "04214" "00411474" "04214" "00411475" "04214" "00411476" "04214" "00411477" "04214" "00411478" "04214" "00411479" "04214" "00411480" "04214" "00411481" "04214" "00411482" "04214" "00411483" "04214" "00411484" "04214" "00411485" "04214" "00411486" "04214" "00411487" "04214" "00411488" "04214" "00411489" "04214" "00411490" "04214" "00411491" "04214" "00411492" "04214" "00411493" "04214" "00411494" "04214" "00411495" "04214" "00411497" "04214" "00411498" "04214" "00411499" "04214" "00411500" "04214" "00411502" "04214" "00411503" "04214" "00411506" "04214" "00411507" "04214" "00411508" "04214" "00411509" "04214" "00411510" "04214" "00411511" "04214" "00411512" "04214" "00411513" "04214" "00411514" "04214" "00411515" "04214" "00411516" "04214" "00411517" "04214" "00411518" "04214" "00411519" "04214" "00411520" "04214" "00411522" "04214" "00411523" "04214" "00411524" "04214" "00411525" "04214" "00411526" "04214" "00411527" "04214" "00411532" "04214" "00411533" "04214" "00411534" "04214" "00411535" "04214" "00411536" "04214" "00411537" "04214" "00411538" "04214" "00411539" "04214" "00411540" "04214" "00411541" "04214" "00411542" "04214" "00411543" "04214" "00411544" "04214" "00411545" "04214" "00411554" "04214" "00411555" "04214" "00411556" "04214" "00411557" "04214" "00411558" "04214" "00411559" "04214" "00411560" "04214" "00411561" "04214" "00411562" "04214" "00411563" "04214" "00411564" "04214" "00411565" "04214" "00411566" "04214" "00411567" "04214" "00411568" "04214" "00411569" "04214" "00411570" "04214" "00411571" "04214" "00411572" "04214" "00411573" "04214" "00411574" "04214" "00411575" "04214" "00411576" "04214" "00411577" "04214" "00411578" "04214" "00411579" "04214" "00411580" "04214" "00411584" "04214" "00411585" "04214" "00411586" "04214" "00411587" "04214" "00411588" "04214" "00411589" "04214" "00411590" "04214" "00411591" "04214" "00411592" "04214" "00411593" "04214" "00411594" "04214" "00411595" "04214" "00411596" "04214" "00411597" "04214" "00411598" "04214" "00411599" "04214" "00411600" "04214" "00411601" "04214" "00411602" "04214" "00411603" "04214" "00411604" "04214" "00411605" "04214" "00411606" "04214" "00411607" "04214" "00411608" "04214" "00411609" "04214" "00411610" "04214" "00411613" "04214" "00411614" "04214" "00411615" "04214" "00411616" "04214" "00411617" "04214" "00411620" "04214" "00411621" "04214" "00411622" "04214" "00411623" "04214" "00411624" "04214" "00411625" "04214" "00411626" "04214" "00411627" "04214" "00411628" "04214" "00411629" "04214" "00411630" "04214" "00411631" "04214" "00411632" "04214" "00411633" "04214" "00411634" "04214" "00411635" "04214" "00411636" "04214" "00411637" "04214" "00411638" "04214" "00411639" "04214" "00411640" "04214" "00411641" "04214" "00411642" "04214" "00411643" "04214" "00411644" "04214" "00411645" "04214" "00411646" "04214" "00411647" "04214" "00411648" "04214" "00411649" "04214" "00411650" "04214" "00411651" "04214" "00411652" "04214" "00411653" "04214" "00411654" "04214" "00411835" "04214" "00411836" "04214" "00411837" "04214" "00411838" "04214" "00411839" "04214" "00411840" "04214" "00411841" "04214" "00411842" "04214" "00411843" "04214" "00411844" "04214" "00411845" "04214" "00411846" "04214" "00411847" "04214" "00411848" "04214" "00411849" "04214" "00411850" "04214" "00411851" "04214" "00411852" "04214" "00411853" "04214" "00411854" "04214" "00411855" "04214" "00411856" "04214" "00411857" "04214" "00411858" "04214" "00411859" "04214" "00411860" "04214" "00411861" "04214" "00411862" "04214" "00411863" "04214" "00411864" "04214" "00411865" "04214" "00411866" "04214" "00411867" "04214" "00411868" "04214" "00411869" "04214" "00411870" "04214" "00411871" "04214" "00411872" "04214" "00411873" "04214" "00411874" "04214" "00411875" "04214" "00411876" "04214" "00411877" "04214" "00411878" "04214" "00411879" "04214" "00411880" "00198" "00411881" "04214" "00411882" "04214" "00411883" "04214" "00411884" "04214" "00411885" "04214" "00411886" "04214" "00411887" "04214" "00411888" "04214" "00411889" "04214" "00411890" "04214" "00411891" "04214" "00411892" "04214" "00411893" "04214" "00411894" "04214" "00411895" "04214" "00411896" "04214" "00411897" "04214" "00411898" "04214" "00411899" "04214" "00411900" "04214" "00411901" "04214" "00411902" "04214" "00411903" "04214" "00411904" "04214" "00411905" "04214" "00411906" "04214" "00411907" "04214" "00411908" "04214" "00411909" "04214" "00411910" "04214" "00411911" "04214" "00411912" "04214" "00411913" "04214" "00411914" "04214" "00411916" "04214" "00411917" "04214" "00411918" "04214" "00411919" "04214" "00411920" "04214" "00411921" "04214" "00411923" "04214" "00411924" "04214" "00411995" "04214" "00411996" "04214" "00411997" "04214" "00411998" "04214" "00411999" "04214" "00412000" "04214" "00412001" "04214" "00412002" "04214" "00412003" "04214" "00412004" "04214" "00412005" "04214" "00412006" "04214" "00412007" "04214" "00412008" "04214" "00412009" "04214" "00412010" "04214" "00412011" "04214" "00412012" "04214" "00412013" "04214" "00412014" "04214" "00412015" "04214" "00412016" "04214" "00412017" "04214" "00412018" "04214" "00412019" "04214" "00412020" "04214" "00412021" "04214" "00412022" "04214" "00412023" "04214" "00412024" "04214" "00412025" "04214" "00412026" "04214" "00412027" "04214" "00412028" "04214" "00412029" "04214" "00412030" "04214" "00412031" "04214" "00412032" "04214" "00412033" "04214" "00412034" "04214" "00412035" "04214" "00412036" "04214" "00412037" "04214" "00412038" "04214" "00412039" "04214" "00412040" "04214" "00412041" "04214" "00412042" "04214" "00412043" "04214" "00412044" "04214" "00412045" "04214" "00412046" "04214" "00412047" "04214" "00412048" "04214" "00412049" "04214" "00412050" "04214" "00412051" "04214" "00412052" "04214" "00412053" "04214" "00412054" "04214" "00412055" "04214" "00412056" "04214" "00412057" "04214" "00412058" "04214" "00412059" "04214" "00412060" "04214" "00412061" "04214" "00412062" "04214" "00412063" "04214" "00412064" "04214" "00412065" "04214" "00412066" "04214" "00412067" "04214" "00412068" "04214" "00412069" "04214" "00412070" "04214" "00412071" "04214" "00412072" "04214" "00412073" "04214" "00412074" "04214" "00412075" "04214" "00412076" "04214" "00412077" "04214" "00412078" "04214" "00412079" "04214" "00412092" "04214" "00412093" "04214" "00412094" "04214" "00412095" "04214" "00412096" "04214" "00412097" "04214" "00412098" "04214" "00412099" "04214" "00412100" "04214" "00412101" "04214" "00412102" "04214" "00412103" "04214" "00412104" "04214" "00412105" "04214" "00412106" "04214" "00412112" "04214" "00412113" "04214" "00412114" "04214" "00412115" "04214" "00412116" "04214" "00412117" "04214" "00412118" "04214" "00412119" "04214" "00412120" "04214" "00412121" "04214" "00412122" "04214" "00412123" "04214" "00412124" "04214" "00412125" "04214" "00412126" "04214" "00412127" "04214" "00412128" "04214" "00412129" "04214" "00412130" "04214" "00412131" "04214" "00412134" "04214" "00412135" "04214" "00412136" "04214" "00412137" "04214" "00412138" "04214" "00412139" "04214" "00412140" "04214" "00412141" "04214" "00412142" "04214" "00412143" "04214" "00412144" "04214" "00412145" "04214" "00412146" "04214" "00412147" "04214" "00412148" "04214" "00412149" "04214" "00412150" "04214" "00412151" "04214" "00412152" "04214" "00412153" "04214" "00412154" "04214" "00412155" "04214" "00412156" "04214" "00412157" "04214" "00412158" "04214" "00412159" "04214" "00412160" "04214" "00412161" "04214" "00412162" "04214" "00412163" "04214" "00412166" "04214" "00412167" "04214" "00412168" "04214" "00412169" "04214" "00412173" "04214" "00412180" "04214" "00412181" "04214" "00412182" "04214" "00412183" "04214" "00412184" "04214" "00412185" "04214" "00412186" "04214" "00412187" "04214" "00412188" "04214" "00412189" "04214" "00412190" "04214" "00412191" "04214" "00412192" "04214" "00412193" "04214" "00412194" "04214" "00412195" "04214" "00412196" "04214" "00412198" "04214" "00412199" "04214" "00412200" "04214" "00412201" "04214" "00412202" "04214" "00412203" "04214" "00412204" "04214" "00412207" "04214" "00412208" "04214" "00412209" "04214" "00412210" "04214" "00412211" "04214" "00412212" "04214" "00412213" "04214" "00412214" "04214" "00412215" "04214" "00412216" "04214" "00412217" "04214" "00412218" "04214" "00412219" "04214" "00412220" "04214" "00412221" "04214" "00412223" "04214" "00412224" "04214" "00412225" "04214" "00412226" "04214" "00412227" "04214" "00412228" "04214" "00412229" "04214" "00412230" "04214" "00412231" "04214" "00412232" "04214" "00412233" "04214" "00412244" "04214" "00412245" "04214" "00412246" "04214" "00412247" "04214" "00412248" "04214" "00412249" "04214" "00412250" "04214" "00412251" "04214" "00412252" "04214" "00412253" "04214" "00412254" "04214" "00412256" "04214" "00412257" "04214" "00412258" "04214" "00412259" "04214" "00412260" "04214" "00412261" "04214" "00412262" "04214" "00412263" "04214" "00412264" "04214" "00412274" "04214" "00412275" "04214" "00412276" "04214" "00412277" "04214" "00412278" "04214" "00412281" "04214" "00412282" "04214" "00412283" "04214" "00412284" "04214" "00412285" "04214" "00412286" "04214" "00412287" "04214" "00412288" "04214" "00412289" "04214" "00412291" "04214" "00412292" "04214" "00412293" "04214" "00412294" "04214" "00412295" "04214" "00412296" "04214" "00412297" "04214" "00412298" "04214" "00412299" "04214" "00412315" "04214" "00412316" "04214" "00412317" "04214" "00412318" "04214" "00412319" "04214" "00412320" "04214" "00412321" "04214" "00412322" "04214" "00412323" "04214" "00412324" "04214" "00412382" "04214" "00412383" "04214" "00412384" "04214" "00412385" "04214" "00412386" "04214" "00412387" "04214" "00412388" "04214" "00412389" "04214" "00412390" "04214" "00412391" "04214" "00412392" "04214" "00412393" "04214" "00412394" "04214" "00412395" "04214" "00412396" "04214" "00412397" "04214" "00412398" "04214" "00412399" "04214" "00412400" "04214" "00412401" "04214" "00412402" "04214" "00412403" "04214" "00412404" "04214" "00412405" "04214" "00412406" "04214" "00412407" "04214" "00412408" "04214" "00412409" "04214" "00412410" "04214" "00412411" "04214" "00412412" "04214" "00412413" "04214" "00412414" "04214" "00412415" "04214" "00412416" "04214" "00412417" "04214" "00412418" "04214" "00412419" "04214" "00412420" "04214" "00412421" "04214" "00412422" "04214" "00412423" "04214" "00412424" "04214" "00412425" "04214" "00412426" "04214" "00412427" "04214" "00412428" "04214" "00412429" "04214" "00412430" "04214" "00412431" "04214" "00412432" "04214" "00412433" "04214" "00412434" "04214" "00412435" "04214" "00412436" "04214" "00412439" "04214" "00412440" "04214" "00414359" "00198" "00415394" "05611" "00420424" "04214" "00420467" "04214" "00420589" "04214" "00426940" "04214" "00429483" "00112" "00429533" "00112" "00429567" "00112" "00429574" "00112" "00429586" "00112" "00429617" "00112" "00429639" "00112" "00429646" "00112" "00429648" "00112" "00429684" "00112" "00429719" "00112" "00429740" "00112" "00429822" "00112" "00429833" "00112" "00429840" "00112" "00429850" "00112" "00429859" "00112" "00429905" "00112" "00429939" "00112" "00429974" "00112" "00429981" "00112" "00430000" "00112" "00430072" "00112" "00430080" "00112" "00430108" "00112" "00430133" "00112" "00430136" "00112" "00430139" "00112" "00430146" "00112" "00435410" "00112" "00444308" "04214" "00446947" "00198" "00446948" "00198" "00446950" "00198" "00446951" "00198" "00446952" "00198" "00446958" "00198" "00446963" "00198" "00446968" "00198" "00446990" "00198" "00447008" "00198" "00447309" "00198" "00447550" "00198" "00447617" "00198" "00447621" "00198" "00461075" "04214" "00461081" "04214" "00461085" "04214" "00461089" "04214" "00461109" "04214" "00461114" "04214" "00461138" "04214" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00112, 00198, 00244, 01157, 01339, 01680, 02943, 03409, 04214, 05130, 05415, 05611 ## Count = 1903 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000026549" "04214" "00033120" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026569" "04214" "00033140" "00229" "Unknown" "10y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026588" "04214" "00033159" "00229" "Unknown" "40y" "secundary diabetes mellitus type 1 (due to pancreatitis)" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000155418" "04214" "00207607" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000186515" "05130" "00246668" "00006" "Unknown" "34y" "see paper; ..." "" "" "" "" "" "" "" "" "CSNBAD-1" "congenital stationary night blindness" "" "0000186516" "05130" "00246669" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CSNBAD-1" "congenital stationary night blindness" "" "0000186517" "05130" "00246670" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CSNBAD-1" "congenital stationary night blindness" "" "0000207738" "04214" "00269943" "01848" "Familial, autosomal dominant" "14y" "Pericentral RP, night blindness , pericentral field loss" "09y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000227548" "00244" "00300246" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "myopia" "" "0000233971" "04214" "00308543" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233972" "04214" "00308544" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233973" "04214" "00308545" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233974" "04214" "00308546" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233975" "04214" "00308547" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233976" "04214" "00308548" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233977" "04214" "00308549" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234068" "04214" "00308640" "00004" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234069" "04214" "00308641" "00004" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234678" "04214" "00309358" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234679" "04214" "00309359" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234680" "04214" "00309360" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234681" "04214" "00309361" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234682" "04214" "00309362" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234683" "04214" "00309363" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234684" "04214" "00309364" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234685" "04214" "00309365" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234686" "04214" "00309366" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234687" "04214" "00309367" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234688" "04214" "00309368" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000241926" "04214" "00319822" "00008" "Familial, autosomal dominant" "" "Age: 19y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RPAD)" "" "0000241939" "04214" "00319835" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RPAD)" "" "0000243937" "04214" "00325450" "00006" "Familial, autosomal dominant" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243981" "04214" "00325494" "00006" "Familial, autosomal dominant" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000245145" "04214" "00326679" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (ADRP)" "" "0000245146" "04214" "00326680" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (ADRP)" "" "0000245147" "04214" "00326681" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (ADRP)" "" "0000245158" "04214" "00326692" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000245168" "04214" "00326702" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245169" "04214" "00326703" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245170" "04214" "00326704" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245171" "04214" "00326705" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245172" "04214" "00326706" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245173" "04214" "00326707" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245174" "04214" "00326708" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245175" "04214" "00326709" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245176" "04214" "00326710" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245177" "04214" "00326711" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245178" "04214" "00326712" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245179" "04214" "00326713" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245180" "04214" "00326714" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245181" "04214" "00326715" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245182" "04214" "00326716" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245183" "04214" "00326717" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245184" "04214" "00326718" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245185" "04214" "00326719" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245186" "04214" "00326720" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245187" "04214" "00326721" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245188" "04214" "00326722" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245189" "04214" "00326723" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245190" "04214" "00326724" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245191" "04214" "00326725" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245192" "04214" "00326726" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245193" "04214" "00326727" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245194" "04214" "00326728" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245195" "04214" "00326729" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245196" "04214" "00326730" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245197" "04214" "00326731" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245198" "04214" "00326732" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245199" "04214" "00326733" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245200" "04214" "00326734" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245201" "04214" "00326735" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245202" "04214" "00326736" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245203" "04214" "00326737" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245204" "04214" "00326738" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245205" "04214" "00326739" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245206" "04214" "00326740" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245207" "04214" "00326741" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245208" "04214" "00326742" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245209" "04214" "00326743" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245210" "04214" "00326744" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245211" "04214" "00326745" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245212" "04214" "00326746" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245213" "04214" "00326747" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245214" "04214" "00326748" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245215" "04214" "00326749" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245216" "04214" "00326750" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245217" "04214" "00326751" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245218" "04214" "00326752" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245219" "04214" "00326753" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245220" "04214" "00326754" "00008" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245221" "04214" "00326755" "00008" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245222" "04214" "00326756" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245223" "04214" "00326757" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245224" "04214" "00326758" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000245225" "04214" "00326759" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (sectorald)" "" "0000246264" "04214" "00328037" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246279" "04214" "00328052" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246315" "04214" "00328088" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246317" "04214" "00328090" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246393" "04214" "00328166" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246401" "04214" "00328174" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246526" "04214" "00328299" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246627" "04214" "00328401" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "0000246661" "04214" "00328435" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia" "" "0000246705" "04214" "00328479" "00000" "Unknown" "4y" "congenital stationary night blindness (HP:0007642)" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "0000249464" "04214" "00331270" "00000" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249465" "04214" "00331271" "00000" "Isolated (sporadic)" "30y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000250683" "04214" "00332499" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (AD)" "" "0000250714" "04214" "00332526" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000250717" "04214" "00332529" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000250720" "04214" "00332532" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000250726" "04214" "00332538" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000251546" "04214" "00333359" "00000" "Familial, autosomal dominant" "37y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251573" "04214" "00333386" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251593" "04214" "00333406" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251594" "04214" "00333407" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251595" "04214" "00333408" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251596" "04214" "00333409" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251696" "04214" "00333512" "00000" "Familial, autosomal dominant" "48y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251697" "04214" "00333513" "00000" "Familial, autosomal dominant" "20y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251698" "04214" "00333514" "00000" "Familial, autosomal dominant" "65y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251699" "04214" "00333515" "00000" "Familial, autosomal dominant" "59y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251700" "04214" "00333516" "00000" "Familial, autosomal dominant" "36y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251701" "04214" "00333517" "00000" "Familial, autosomal dominant" "43y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251702" "04214" "00333518" "00000" "Familial, autosomal dominant" "55y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251754" "04214" "00333570" "00000" "Familial, autosomal dominant" "59y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251755" "04214" "00333571" "00000" "Familial, autosomal dominant" "42y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251756" "04214" "00333572" "00000" "Familial, autosomal dominant" "76y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251757" "04214" "00333573" "00000" "Familial, autosomal dominant" "52y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251758" "04214" "00333574" "00000" "Familial, autosomal dominant" "19y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251759" "04214" "00333575" "00000" "Familial, autosomal dominant" "55y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251760" "04214" "00333576" "00000" "Familial, autosomal dominant" "45y" "clinical category IA1aii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (with rho signs)" "" "0000251779" "04214" "00333595" "00000" "Familial, autosomal dominant" "56y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251780" "04214" "00333596" "00000" "Familial, autosomal dominant" "32y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251781" "04214" "00333597" "00000" "Familial, autosomal dominant" "28y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251782" "04214" "00333598" "00000" "Familial, autosomal dominant" "52y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251783" "04214" "00333599" "00000" "Familial, autosomal dominant" "28y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251784" "04214" "00333600" "00000" "Familial, autosomal dominant" "13y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251785" "04214" "00333601" "00000" "Familial, autosomal dominant" "59y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251786" "04214" "00333602" "00000" "Familial, autosomal dominant" "68y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251787" "04214" "00333603" "00000" "Familial, autosomal dominant" "36y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251788" "04214" "00333604" "00000" "Familial, autosomal dominant" "27y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251789" "04214" "00333605" "00000" "Isolated (sporadic)" "47y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251790" "04214" "00333606" "00000" "Familial, autosomal dominant" "63y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251791" "04214" "00333607" "00000" "Familial, autosomal dominant" "57y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251792" "04214" "00333608" "00000" "Familial, autosomal dominant" "39y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252038" "04214" "00333853" "00000" "Isolated (sporadic)" "11y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252039" "04214" "00333854" "00000" "Isolated (sporadic)" "14y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252103" "04214" "00333918" "00000" "Isolated (sporadic)" "28y" "clinical category IA1aiv" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252163" "04214" "00333978" "00000" "Isolated (sporadic)" "7y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252164" "04214" "00333979" "00000" "Isolated (sporadic)" "40y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252165" "04214" "00333980" "00000" "Isolated (sporadic)" "5y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252519" "04214" "00334430" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252864" "00198" "00335149" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252934" "04214" "00335219" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253014" "04214" "00335299" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253015" "04214" "00335300" "02485" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253016" "04214" "00335301" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253331" "04214" "00335385" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253332" "04214" "00335386" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253349" "04214" "00335403" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253385" "04214" "00335439" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253437" "04214" "00335492" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253488" "04214" "00335543" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253489" "04214" "00335544" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253490" "04214" "00335545" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253491" "04214" "00335546" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253492" "04214" "00335547" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253493" "04214" "00335548" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253494" "04214" "00335549" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253495" "04214" "00335550" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253496" "04214" "00335551" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253497" "04214" "00335552" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253498" "04214" "00335553" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253499" "04214" "00335554" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253600" "04214" "00335680" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253601" "04214" "00335681" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253602" "04214" "00335682" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253603" "04214" "00335683" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253604" "04214" "00335684" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253605" "04214" "00335685" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253606" "04214" "00335686" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253607" "04214" "00335687" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253608" "04214" "00335688" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253609" "04214" "00335689" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253610" "04214" "00335690" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253611" "04214" "00335691" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253612" "04214" "00335692" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253613" "04214" "00335693" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253614" "04214" "00335694" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253615" "04214" "00335695" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253616" "04214" "00335696" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253617" "04214" "00335697" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253618" "04214" "00335698" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253619" "04214" "00335699" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253620" "04214" "00335700" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253621" "04214" "00335701" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253622" "04214" "00335702" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253623" "04214" "00335703" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253624" "04214" "00335704" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253625" "04214" "00335705" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253626" "04214" "00335706" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" "" "0000253652" "04214" "00335734" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253653" "04214" "00335735" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253654" "04214" "00335736" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253655" "04214" "00335737" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253850" "04214" "00335949" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000253949" "04214" "00358734" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253950" "04214" "00358735" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253951" "04214" "00358736" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254009" "04214" "00358794" "00000" "Unknown" "58y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254227" "04214" "00358928" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254248" "04214" "00358950" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000254299" "04214" "00359001" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254426" "04214" "00359129" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254438" "04214" "00359141" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254451" "04214" "00359154" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254467" "04214" "00359170" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254489" "04214" "00359192" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254509" "04214" "00359212" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000256831" "04214" "00361426" "04036" "Familial, autosomal dominant" "" "visual acuity: OD = 0.2, OS = 0.2. ERG: Not performed." "55y" "" "Poor vision" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000256849" "04214" "00361444" "04036" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000257667" "05415" "00362253" "02404" "Familial, autosomal recessive" "" "Patient is regarded as only partially resolved and has co-occurring vision and hearing loss." "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000258256" "04214" "00362890" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258257" "04214" "00362891" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258757" "04214" "00363392" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early onset high myopia" "" "0000258766" "04214" "00363405" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258767" "04214" "00363406" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258768" "04214" "00363407" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258769" "04214" "00363408" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258770" "04214" "00363409" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258771" "04214" "00363410" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258772" "04214" "00363411" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258773" "04214" "00363412" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258774" "04214" "00363413" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258775" "04214" "00363414" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258782" "04214" "00363421" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258801" "04214" "00363440" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258828" "04214" "00363467" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258829" "04214" "00363468" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258854" "04214" "00363504" "00000" "Familial, autosomal dominant" "51y" "visual acuity R 0.2, L hand movement; bilateral retinal vascular attenuation, bone spicule like pigmentation throughout the fundus, chorioretinal degeneration, pale optic disc" "25y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258855" "04214" "00363505" "00000" "Familial, autosomal dominant" "38y" "visual acuity R 0.5, L 0.4; bilateral attenuation of retinal arterioles, bone spicule like pigmentation in the mid-periphery retina, RPE degeneration, pale optic disc" "28y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258856" "04214" "00363506" "00000" "Familial, autosomal dominant" "36y" "visual acuity R 0.4, L 0.3; bilateral attenuation of retinal arterioles, bone spicule like pigmentation in the mid-periphery retina, RPE degeneration, pale optic disc" "24y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267410" "04214" "00372081" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267413" "04214" "00372084" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267815" "04214" "00372500" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267902" "04214" "00372623" "00000" "Familial, autosomal dominant" "28y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267903" "04214" "00372624" "00000" "Isolated (sporadic)" "41y" "see paper; ..." "31y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267904" "04214" "00372625" "00000" "Familial, autosomal dominant" "33y" "see paper; ..." "31y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267905" "04214" "00372626" "00000" "Familial, autosomal dominant" "34y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267906" "04214" "00372627" "00000" "Isolated (sporadic)" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267907" "04214" "00372628" "00000" "Familial, autosomal dominant" "45y" "see paper; ..." "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267908" "04214" "00372629" "00000" "Familial, autosomal dominant" "26y" "see paper; ..." "9y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267909" "04214" "00372630" "00000" "Familial, autosomal dominant" "24y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267910" "04214" "00372631" "00000" "Familial, autosomal dominant" "34y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267980" "04214" "00372701" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268620" "04214" "00373339" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000268646" "04214" "00373370" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268743" "04214" "00373467" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268786" "04214" "00373510" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, macula degeneration" "" "0000268788" "04214" "00373512" "00000" "Familial, autosomal dominant" "33y" "night blindness then visual field constriction leaving only the central 20° functional and preserved visual acuity; photophobia; bone spicules in periphery, optic disc pallor and preserved macula" "10y" "" "night blindness" "" "" "" "" "" "" "retinal dystrophy" "" "0000268789" "04214" "00373513" "00000" "Familial, autosomal dominant" "57y" "night blindness then visual field constriction leaving only 5° functional, 35y- decreased visual acuity; photophobia; posterior subcapsular cataract; widespread deposition of bone-spicules, narrowed vessels" "7y" "" "night blindness" "" "" "" "" "" "" "retinal dystrophy" "" "0000268790" "04214" "00373514" "00000" "Familial, autosomal dominant" "54y" "night blindness then visual field constriction, 30y-decreased visual acuity; epiretinal membrane (macular pucker) one eye; widespread deposition of bone-spicules, optic disc pallor and narrowed vessels" "6y" "" "night blindness" "" "" "" "" "" "" "retinal dystrophy" "" "0000268791" "04214" "00373515" "00000" "Familial, autosomal dominant" "49y" "night blindness then visual field constriction leaving only 15° functional and decreased visual acuity; diffuse hypopigmentation with bone spicules changes in the periphery; preserved macula" "12y" "" "night blindness" "" "" "" "" "" "" "retinal dystrophy" "" "0000268792" "04214" "00373516" "00000" "Familial, autosomal dominant" "13y" "night blindness then visual field constriction leaving only 20° functional; preserved visual acuity; bone spicule pigmentation in the periphery; preserved macula" "9y" "" "night blindness and decrease of visual field" "" "" "" "" "" "" "retinal dystrophy" "" "0000268793" "04214" "00373517" "00000" "Familial, autosomal dominant" "14y" "night blindness; some bone spicules in periphery, preserved macula and optic disc; narrowed vessels" "13y" "" "night blindness" "" "" "" "" "" "" "retinal dystrophy" "" "0000269025" "04214" "00373816" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269028" "04214" "00373819" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269121" "04214" "00373912" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269124" "04214" "00373915" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269129" "04214" "00373920" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269154" "04214" "00373945" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269159" "04214" "00373950" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269167" "04214" "00373958" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269168" "04214" "00373959" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269169" "04214" "00373960" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269170" "04214" "00373961" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269171" "04214" "00373962" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269172" "04214" "00373963" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269173" "04214" "00373964" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269174" "04214" "00373965" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269175" "04214" "00373966" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269176" "04214" "00373967" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269177" "04214" "00373968" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269178" "04214" "00373969" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269179" "04214" "00373970" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269180" "04214" "00373971" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269181" "04214" "00373972" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269182" "04214" "00373973" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269183" "04214" "00373974" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269184" "04214" "00373975" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269185" "04214" "00373976" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269186" "04214" "00373977" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269187" "04214" "00373978" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269188" "04214" "00373979" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269189" "04214" "00373980" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269190" "04214" "00373981" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269191" "04214" "00373982" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269192" "04214" "00373983" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269193" "04214" "00373984" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269194" "04214" "00373985" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269195" "04214" "00373986" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269196" "04214" "00373987" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269197" "04214" "00373988" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269198" "04214" "00373989" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269199" "04214" "00373990" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269200" "04214" "00373991" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269201" "04214" "00373992" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269202" "04214" "00373993" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269203" "04214" "00373994" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269204" "04214" "00373995" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269205" "04214" "00373996" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269206" "04214" "00373997" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269207" "04214" "00373998" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269208" "04214" "00373999" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270120" "04214" "00374910" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity 0.8/0.8" "26y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270136" "04214" "00374926" "00000" "Isolated (sporadic)" "38y" "best corrected visual acuity 0.04/0.01" "5y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270138" "04214" "00374928" "00000" "Isolated (sporadic)" "67y" "best corrected visual acuity fingers count/fingers count" "10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270145" "04214" "00374935" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity 0.4/0.15" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270497" "04214" "00375283" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270498" "04214" "00375284" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270499" "04214" "00375285" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270500" "04214" "00375286" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270518" "04214" "00375304" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270519" "04214" "00375305" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270520" "04214" "00375306" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270624" "04214" "00375410" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270667" "04214" "00375453" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271378" "04214" "00376168" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271386" "04214" "00376176" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271387" "04214" "00376177" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271393" "04214" "00376183" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271395" "04214" "00376185" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271502" "04214" "00376294" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa ( RP)" "" "0000271689" "04214" "00376482" "00000" "Familial" "48y" "bone-spicule pigmentation,narrow vessels, pale disc." "5y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271690" "04214" "00376483" "00000" "Familial" "45y" "bone-spicule pigmentation, depigmentation." "20y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271691" "04214" "00376484" "00000" "Familial" "42y" "bone-spicule pigmentation, depigmentation,narrow vessels, pale disc." "10y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271692" "04214" "00376485" "00000" "Familial" "40y" "bone-spicule pigmentation, depigmentation, narrow vessels, pale disc, choriocapillaris atrophy," "10y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271693" "04214" "00376486" "00000" "Familial" "38y" "bone-spicule pigmentation,depigmentation,narrow vessels,pale disc, macular lesion" "15y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271694" "04214" "00376487" "00000" "Familial" "35y" "bone-spicule pigmentation, depigmentation" "25y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271695" "04214" "00376488" "00000" "Familial" "33y" "narrow vessels, pale disc" "15y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271696" "04214" "00376489" "00000" "Familial" "24y" "narrow vessels, pale disc" "4y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271708" "04214" "00376501" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271709" "04214" "00376502" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271710" "04214" "00376503" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271711" "04214" "00376504" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271712" "04214" "00376505" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271732" "04214" "00376525" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000271733" "04214" "00376526" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000271734" "04214" "00376527" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000271735" "04214" "00376528" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000271957" "04214" "00376746" "00000" "Familial, autosomal dominant" "7y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, bone spicules, optic disc pallor, nyctalopia," "" "0000271980" "04214" "00376769" "00000" "Familial, autosomal recessive" "8y" "" "" "" "" "" "" "" "" "" "" "Progressive pigmentary retinopathy" "" "0000271987" "04214" "00376776" "00000" "Familial, autosomal dominant" "70y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271994" "04214" "00376783" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, macular subatrophy, pseudohole" "" "0000272184" "04214" "00376993" "00000" "Familial, autosomal dominant" "" "" "29y" "" "" "" "" "" "" "" "" "Autosomal Dominant Retinitis Pigmentosa" "" "0000272185" "04214" "00376994" "00000" "Familial, autosomal dominant" "" "" "65y" "" "" "" "" "" "" "" "" "Autosomal Dominant Retinitis Pigmentosa" "" "0000272186" "04214" "00376995" "00000" "Familial, autosomal dominant" "" "" "73y" "" "" "" "" "" "" "" "" "Autosomal Dominant Retinitis Pigmentosa" "" "0000272187" "04214" "00376996" "00000" "Familial, autosomal dominant" "" "" "16y" "" "" "" "" "" "" "" "" "Autosomal Dominant Retinitis Pigmentosa" "" "0000272188" "04214" "00376997" "00000" "Familial, autosomal dominant" "" "" "36y" "" "" "" "" "" "" "" "" "Autosomal Dominant Retinitis Pigmentosa" "" "0000272373" "04214" "00377215" "00000" "Isolated (sporadic)" "12y" "see paper" "3y" "4y" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272399" "04214" "00377241" "00000" "Isolated (sporadic)" "29y" "see paper" "16y" "21y" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272404" "04214" "00377246" "00000" "Familial, autosomal dominant" "51y" "see paper" "6y" "33y" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272405" "04214" "00377247" "00000" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272406" "04214" "00377248" "00000" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272407" "04214" "00377249" "00000" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272408" "04214" "00377250" "00000" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 4 (RP4)" "retinal disease" "" "0000272410" "04214" "00377252" "00000" "Familial, autosomal dominant" "30y" "see paper; ..." "13y" "17y" "" "" "" "" "" "" "" "retinal disease" "" "0000272566" "04214" "00377416" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272567" "04214" "00377417" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272568" "04214" "00377418" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272569" "04214" "00377419" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272570" "04214" "00377420" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272571" "04214" "00377421" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272572" "04214" "00377422" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272573" "04214" "00377423" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272574" "04214" "00377424" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272575" "04214" "00377425" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272576" "04214" "00377426" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272577" "04214" "00377427" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272578" "04214" "00377428" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272579" "04214" "00377429" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272580" "04214" "00377430" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272581" "04214" "00377431" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272582" "04214" "00377432" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272583" "04214" "00377433" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272584" "04214" "00377434" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272585" "04214" "00377435" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272586" "04214" "00377436" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272587" "04214" "00377437" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272588" "04214" "00377438" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272589" "04214" "00377439" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272590" "04214" "00377440" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272591" "04214" "00377441" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272592" "04214" "00377442" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272593" "04214" "00377443" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272594" "04214" "00377444" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272595" "04214" "00377445" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272596" "04214" "00377446" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272597" "04214" "00377447" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272598" "04214" "00377448" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272599" "04214" "00377449" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272600" "04214" "00377450" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272601" "04214" "00377451" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272602" "04214" "00377452" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272603" "04214" "00377453" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272604" "04214" "00377454" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272605" "04214" "00377455" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272606" "04214" "00377456" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272607" "04214" "00377457" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272608" "04214" "00377458" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272609" "04214" "00377459" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272610" "04214" "00377460" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272611" "04214" "00377461" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272612" "04214" "00377462" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272613" "04214" "00377463" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272614" "04214" "00377464" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272615" "04214" "00377465" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272616" "04214" "00377466" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272617" "04214" "00377467" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272618" "04214" "00377468" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000272662" "04214" "00377512" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP4" "retinitis pigmentosa" "" "0000273266" "04214" "00379393" "00000" "Familial, autosomal recessive" "18y" "" "16y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273284" "04214" "00379411" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia (eoHM)" "" "0000273323" "04214" "00379450" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia (eoHM)" "" "0000273423" "00112" "00379550" "03508" "Familial, autosomal dominant" "" "HP:0000662, HP:0000613, HP:0001133, HP:0032037, HP:0000006, HP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273455" "04214" "00379601" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273456" "04214" "00379602" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273457" "04214" "00379603" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273458" "04214" "00379604" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273459" "04214" "00379605" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273460" "04214" "00379606" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273461" "04214" "00379607" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273462" "04214" "00379608" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273463" "04214" "00379609" "00008" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant retinitis pigmentosa (adRP)" "" "0000273511" "00112" "00379667" "03508" "Familial, autosomal dominant" "" "HP:0030515,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000551,\tHP:0000006,\tHP:0000510" "" "" "" "" "" "" "" "" "" "HP:0030515\tHP:0000662\tHP:0000613\tHP:0001133\tHP:0000551\tHP:0000006\tHP:0000510" "" "0000273653" "00112" "00379798" "03508" "Familial, autosomal dominant" "" "HP:0032037,\tHP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273654" "00112" "00379799" "03508" "Familial, autosomal dominant" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273723" "04214" "00379869" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273724" "04214" "00379870" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273725" "04214" "00379871" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273726" "04214" "00379872" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273727" "04214" "00379873" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273728" "04214" "00379874" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000274080" "04214" "00380229" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274081" "04214" "00380230" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274082" "04214" "00380231" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274083" "04214" "00380232" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274084" "04214" "00380233" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274085" "04214" "00380234" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274086" "04214" "00380235" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274087" "04214" "00380236" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274088" "04214" "00380237" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274089" "04214" "00380238" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274090" "04214" "00380239" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274091" "04214" "00380240" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274092" "04214" "00380241" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274093" "04214" "00380242" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274094" "04214" "00380243" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274095" "04214" "00380244" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274096" "04214" "00380245" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274099" "04214" "00380248" "00000" "Familial, autosomal dominant" "45y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274100" "04214" "00380249" "00000" "Familial, autosomal dominant" "22y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274101" "04214" "00380250" "00000" "Familial, autosomal dominant" "59y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274110" "04214" "00380259" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274111" "04214" "00380260" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274112" "04214" "00380261" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000274848" "04214" "00380997" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274850" "04214" "00380999" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274867" "04214" "00381016" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (RP)" "" "0000274949" "04214" "00381098" "00000" "Familial" "44y" "" "" "" "" "" "" "" "" "" "" "isolated retinitis pigmentaria" "" "0000275455" "04214" "00381613" "00000" "Familial, autosomal dominant" "" "" "71y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" "" "0000275462" "04214" "00381620" "00000" "Isolated (sporadic)" "" "" "47y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" "" "0000275479" "04214" "00381637" "00000" "Isolated (sporadic)" "" "" "30y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275489" "04214" "00381647" "00000" "Familial, autosomal dominant" "" "" "31y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" "" "0000275510" "04214" "00381668" "00000" "Familial, autosomal dominant" "" "" "25y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" "" "0000275516" "04214" "00381674" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275522" "04214" "00381680" "00000" "Isolated (sporadic)" "" "" "14y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275537" "04214" "00381695" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa Simplex" "" "0000275576" "04214" "00381734" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275577" "04214" "00381735" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275578" "04214" "00381736" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275579" "04214" "00381737" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275580" "04214" "00381738" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275581" "04214" "00381739" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275582" "04214" "00381740" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275583" "04214" "00381741" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275584" "04214" "00381742" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275585" "04214" "00381743" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275586" "04214" "00381744" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275587" "04214" "00381745" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275588" "04214" "00381746" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275589" "04214" "00381747" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275590" "04214" "00381748" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275591" "04214" "00381749" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275592" "04214" "00381750" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275593" "04214" "00381751" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" "" "0000275647" "04214" "00381805" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinosis pigmentosa" "" "0000275746" "04214" "00381904" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275747" "04214" "00381905" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275748" "04214" "00381906" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275749" "04214" "00381907" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000276229" "04214" "00382380" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276230" "04214" "00382381" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276231" "04214" "00382382" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276232" "04214" "00382383" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276233" "04214" "00382384" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276234" "04214" "00382385" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276235" "04214" "00382386" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276236" "04214" "00382387" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276237" "04214" "00382388" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276238" "04214" "00382389" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276239" "04214" "00382390" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276240" "04214" "00382391" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276241" "04214" "00382392" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276242" "04214" "00382393" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276243" "04214" "00382394" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276244" "04214" "00382395" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy" "" "0000276245" "04214" "00382396" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276246" "04214" "00382397" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276247" "04214" "00382398" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276248" "04214" "00382399" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276249" "04214" "00382400" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276645" "04214" "00382789" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276650" "04214" "00382794" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276687" "04214" "00382831" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (ADRP)" "" "0000276689" "04214" "00382833" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (ADRP)" "" "0000276690" "04214" "00382834" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000276692" "04214" "00382836" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000276693" "04214" "00382837" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000276849" "04214" "00383059" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276851" "04214" "00383061" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276862" "04214" "00383072" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276863" "04214" "00383073" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276870" "04214" "00383080" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276877" "04214" "00383087" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276883" "04214" "00383093" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276885" "04214" "00383095" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000277271" "04214" "00383486" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277272" "04214" "00383487" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277495" "04214" "00383710" "00000" "Isolated (sporadic)" "54y" "" "" "" "" "" "" "" "" "" "retinal disease" "atypical autoimmune retinopathy" "" "0000277591" "04214" "00383806" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277622" "04214" "00383837" "00000" "Familial, autosomal dominant" "9y" "BCVA OD-OS: 20/70-20/40" "" "8y" "" "" "" "" "" "" "" "" "" "0000277861" "04214" "00384076" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278059" "04214" "00384274" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Low vision" "" "0000278116" "04214" "00384331" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278359" "04214" "00000101" "00000" "Familial, autosomal dominant" "64y" "diffuse retinal, retinal pigment epithelium, and choroidal atrophy without evidence for choroidal neovascularization" "55y" "" "" "" "" "" "" "" "" "Sorsby fundus dystrophy" "" "0000278529" "04214" "00384746" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278530" "04214" "00384747" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278557" "04214" "00384774" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278558" "04214" "00384775" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278835" "04214" "00385051" "00000" "Isolated (sporadic)" "30y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.5/0.6" "5y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000279537" "04214" "00385724" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279538" "04214" "00385725" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279680" "04214" "00385877" "00000" "Familial, autosomal dominant" "48y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinal disease" "" "0000279756" "04214" "00385955" "00000" "Familial" "" "" "3y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000279967" "04214" "00386164" "00000" "Familial, autosomal dominant" "57y" "" "" "40y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000279968" "04214" "00386165" "00000" "Familial, autosomal dominant" "50y" "" "" "40y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000280006" "04214" "00386203" "00000" "Familial, X-linked" "16y" "" "" "6y" "" "" "" "" "" "" "early onset retinitis pigmentosa" "" "" "0000280105" "04214" "00386302" "00000" "Familial, autosomal recessive" "64y" "" "" "18y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000280347" "04214" "00386547" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280349" "04214" "00386549" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280354" "04214" "00386554" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280365" "04214" "00386565" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280389" "04214" "00386589" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280419" "04214" "00386619" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280446" "04214" "00386646" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280475" "04214" "00386675" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280486" "04214" "00386686" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280515" "04214" "00386715" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280520" "04214" "00386720" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280640" "04214" "00386840" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280774" "04214" "00386996" "00000" "Familial, autosomal dominant" "69y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280775" "04214" "00386997" "00000" "Familial, autosomal dominant" "43y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280776" "04214" "00386998" "00000" "Familial, autosomal dominant" "15y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280777" "04214" "00386999" "00000" "Familial, autosomal dominant" "23y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280778" "04214" "00387000" "00000" "Familial, autosomal dominant" "15y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280779" "04214" "00387001" "00000" "Familial, autosomal dominant" "36y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280780" "04214" "00387002" "00000" "Familial, autosomal dominant" "36y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280781" "04214" "00387003" "00000" "Familial, autosomal dominant" "32y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280782" "04214" "00387004" "00000" "Familial, autosomal dominant" "72y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280783" "04214" "00387005" "00000" "Familial, autosomal dominant" "57y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280784" "04214" "00387006" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280785" "04214" "00387007" "00000" "Familial, autosomal dominant" "40y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280786" "04214" "00387008" "00000" "Familial, autosomal dominant" "27y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280787" "04214" "00387009" "00000" "Familial, autosomal dominant" "43y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280788" "04214" "00387010" "00000" "Familial, autosomal dominant" "34y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280789" "04214" "00387011" "00000" "Familial, autosomal dominant" "28y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280790" "04214" "00387012" "00000" "Familial, autosomal dominant" "46y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280791" "04214" "00387013" "00000" "Familial, autosomal dominant" "19y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280792" "04214" "00387014" "00000" "Familial, autosomal dominant" "25y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280793" "04214" "00387015" "00000" "Familial, autosomal dominant" "37y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280794" "04214" "00387016" "00000" "Familial, autosomal dominant" "55y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "" "" "0000280947" "04214" "00387384" "00000" "Familial, autosomal dominant" "62y" "nuclear lens opacity, peripheral choroidal atrophy, positive family history, BCVA OD/OS: 0.01/0.03, red–green color blindne" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000280948" "04214" "00387385" "00000" "Familial, autosomal dominant" "79y" "anterior subcapsular cataract, posterior pole choroidal atrophy, positive family history, BCVA OD/OS: 0.1/HM, blue color blindness" "7y" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000281077" "04214" "00387514" "00000" "Familial, autosomal dominant" "" "" "48y" "" "" "" "" "" "" "" "" "Pericentral Retinal Degeneration (PRD)" "" "0000282091" "04214" "00388551" "00000" "Familial, autosomal dominant" "" "Non‐syndrom" "" "31y" "" "" "" "" "" "" "Retinitis pigmentosa type 4" "Retinitis pigmentosa" "" "0000282265" "04214" "00388724" "00000" "Familial, autosomal dominant" "59y" "age at genetic diagnosis mentioned" "" "56y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282266" "04214" "00388725" "00000" "Familial, autosomal dominant" "81y" "age at genetic diagnosis mentioned" "" "79y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282267" "04214" "00388726" "00000" "Familial, autosomal dominant" "22y" "age at genetic diagnosis mentioned" "" "20y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282348" "04214" "00388807" "00000" "Isolated (sporadic)" "33y" "age at genetic diagnosis mentioned" "" "27y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000282388" "04214" "00388847" "00000" "Isolated (sporadic)" "32y" "age at genetic diagnosis mentioned" "" "28y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000282424" "04214" "00388883" "00000" "Familial, autosomal dominant" "70y" "age at genetic diagnosis mentioned" "" "64y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282425" "04214" "00388884" "00000" "Familial, autosomal dominant" "60y" "age at genetic diagnosis mentioned" "" "55y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282426" "04214" "00388885" "00000" "Familial, autosomal dominant" "64y" "age at genetic diagnosis mentioned" "" "58y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282522" "04214" "00388981" "00000" "Familial, autosomal dominant" "57y" "age at genetic diagnosis mentioned" "" "53y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282523" "04214" "00388982" "00000" "Familial, autosomal dominant" "85y" "age at genetic diagnosis mentioned" "" "81y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282524" "04214" "00388983" "00000" "Familial, autosomal dominant" "60y" "age at genetic diagnosis mentioned" "" "56y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282525" "04214" "00388984" "00000" "Familial, autosomal dominant" "89y" "age at genetic diagnosis mentioned" "" "85y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282648" "04214" "00389107" "00000" "Familial, autosomal dominant" "37y" "age at genetic diagnosis mentioned" "" "36y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282649" "04214" "00389108" "00000" "Familial, autosomal dominant" "71y" "age at genetic diagnosis mentioned" "" "70y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282650" "04214" "00389109" "00000" "Familial, autosomal dominant" "63y" "age at genetic diagnosis mentioned" "" "62y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282754" "04214" "00389213" "00000" "Familial, autosomal dominant" "47y" "age at genetic diagnosis mentioned" "" "44y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282755" "04214" "00389214" "00000" "Familial, autosomal dominant" "39y" "age at genetic diagnosis mentioned" "" "35y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282805" "04214" "00389264" "00000" "Familial, autosomal dominant" "51y" "age at genetic diagnosis mentioned" "" "45y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282806" "04214" "00389265" "00000" "Familial, autosomal dominant" "23y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000282936" "04214" "00389395" "00000" "Familial, autosomal dominant" "69y" "age at genetic diagnosis mentioned" "" "67y" "" "" "" "" "" "" "unclassified / mixed" "" "" "0000283020" "04214" "00389479" "00000" "Familial, autosomal dominant" "66y" "age at genetic diagnosis mentioned" "" "64y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283021" "04214" "00389480" "00000" "Familial, autosomal dominant" "46y" "age at genetic diagnosis mentioned" "" "44y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283030" "04214" "00389489" "00000" "Familial, autosomal dominant" "71y" "age at genetic diagnosis mentioned" "" "63y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283037" "04214" "00389496" "00000" "Familial, autosomal dominant" "70y" "age at genetic diagnosis mentioned" "" "62y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283038" "04214" "00389497" "00000" "Familial, autosomal dominant" "43y" "age at genetic diagnosis mentioned" "" "35y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283054" "04214" "00389513" "00000" "Familial, autosomal dominant" "55y" "age at genetic diagnosis mentioned" "" "48y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283055" "04214" "00389514" "00000" "Familial, autosomal dominant" "26y" "age at genetic diagnosis mentioned" "" "19y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283073" "04214" "00389532" "00000" "Familial, autosomal dominant" "21y" "age at genetic diagnosis mentioned" "" "14y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283074" "04214" "00389533" "00000" "Familial, autosomal dominant" "53y" "age at genetic diagnosis mentioned" "" "46y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283075" "04214" "00389534" "00000" "Familial, autosomal dominant" "16y" "age at genetic diagnosis mentioned" "" "10y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283079" "04214" "00389538" "00000" "Familial, autosomal dominant" "64y" "age at genetic diagnosis mentioned" "" "57y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283080" "04214" "00389539" "00000" "Familial, autosomal dominant" "51y" "age at genetic diagnosis mentioned" "" "45y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283084" "04214" "00389543" "00000" "Familial, autosomal dominant" "39y" "age at genetic diagnosis mentioned" "" "32y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283123" "04214" "00389582" "00000" "Familial, autosomal dominant" "32y" "age at genetic diagnosis mentioned" "" "26y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283124" "04214" "00389583" "00000" "Familial, autosomal dominant" "55y" "age at genetic diagnosis mentioned" "" "49y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283148" "04214" "00389607" "00000" "Isolated (sporadic)" "50y" "age at genetic diagnosis mentioned" "" "45y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283164" "04214" "00389623" "00000" "Familial, autosomal dominant" "63y" "age at genetic diagnosis mentioned" "" "59y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283190" "04214" "00389649" "00000" "Familial, autosomal dominant" "26y" "age at genetic diagnosis mentioned" "" "22y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283191" "04214" "00389650" "00000" "Familial, autosomal dominant" "66y" "age at genetic diagnosis mentioned" "" "62y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283215" "04214" "00389674" "00000" "Familial, autosomal dominant" "46y" "age at genetic diagnosis mentioned" "" "45y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283219" "04214" "00389678" "00000" "Familial, autosomal dominant" "65y" "age at genetic diagnosis mentioned" "" "63y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283227" "04214" "00389686" "00000" "Familial, autosomal dominant" "25y" "age at genetic diagnosis mentioned" "" "23y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283229" "04214" "00389688" "00000" "Familial, autosomal dominant" "57y" "age at genetic diagnosis mentioned" "" "55y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283230" "04214" "00389689" "00000" "Familial, autosomal dominant" "25y" "age at genetic diagnosis mentioned" "" "23y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283231" "04214" "00389690" "00000" "Familial, autosomal dominant" "60y" "age at genetic diagnosis mentioned" "" "58y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283232" "04214" "00389691" "00000" "Familial, autosomal dominant" "84y" "age at genetic diagnosis mentioned" "" "82y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283234" "04214" "00389693" "00000" "Familial, autosomal dominant" "65y" "age at genetic diagnosis mentioned" "" "63y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283235" "04214" "00389694" "00000" "Familial, autosomal dominant" "43y" "age at genetic diagnosis mentioned" "" "42y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283237" "04214" "00389696" "00000" "Familial, autosomal dominant" "57y" "age at genetic diagnosis mentioned" "" "55y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283238" "04214" "00389697" "00000" "Familial, autosomal dominant" "34y" "age at genetic diagnosis mentioned" "" "33y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283242" "04214" "00389701" "00000" "Familial, autosomal dominant" "40y" "age at genetic diagnosis mentioned" "" "39y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283243" "04214" "00389702" "00000" "Familial, autosomal dominant" "15y" "age at genetic diagnosis mentioned" "" "14y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283247" "04214" "00389706" "00000" "Familial, autosomal dominant" "43y" "age at genetic diagnosis mentioned" "" "42y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283248" "04214" "00389707" "00000" "Familial, autosomal dominant" "17y" "age at genetic diagnosis mentioned" "" "16y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283255" "04214" "00389714" "00000" "Familial, autosomal dominant" "34y" "age at genetic diagnosis mentioned" "" "33y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283256" "04214" "00389715" "00000" "Familial, autosomal dominant" "54y" "age at genetic diagnosis mentioned" "" "53y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283257" "04214" "00389716" "00000" "Familial, autosomal dominant" "24y" "age at genetic diagnosis mentioned" "" "23y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283258" "04214" "00389717" "00000" "Familial, autosomal dominant" "21y" "age at genetic diagnosis mentioned" "" "20y" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa" "" "" "0000283354" "04214" "00389813" "00000" "Isolated (sporadic)" "72y" "age at genetic diagnosis mentioned" "" "64y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283374" "04214" "00389833" "00000" "Isolated (sporadic)" "43y" "age at genetic diagnosis mentioned" "" "43y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283435" "04214" "00389894" "00000" "Isolated (sporadic)" "53y" "age at genetic diagnosis mentioned" "" "49y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283481" "04214" "00389940" "00000" "Isolated (sporadic)" "34y" "age at genetic diagnosis mentioned" "" "32y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283496" "04214" "00389955" "00000" "Isolated (sporadic)" "58y" "age at genetic diagnosis mentioned" "" "55y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283498" "04214" "00389957" "00000" "Isolated (sporadic)" "19y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283532" "04214" "00389991" "00000" "Isolated (sporadic)" "55y" "age at genetic diagnosis mentioned" "" "54y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283549" "04214" "00390008" "00000" "Isolated (sporadic)" "25y" "age at genetic diagnosis mentioned" "" "25y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283576" "04214" "00390036" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "early-onset primary angle closure glaucoma" "early-onset primary angle closure glaucoma" "" "0000283901" "04214" "00390363" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283902" "04214" "00390364" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283903" "04214" "00390365" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283904" "04214" "00390366" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283905" "04214" "00390367" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283906" "04214" "00390368" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283907" "04214" "00390369" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284828" "04214" "00391388" "00000" "Unknown" "" "diagnosis unsure" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "" "0000284921" "04214" "00391585" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "0000285590" "04214" "00392314" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity right/left eye: 0.3/0.5, electroretinograhy responses: extinguished" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285592" "04214" "00392316" "00000" "Familial, autosomal dominant" "34y" "best corrected visual acuity right/left eye: 0.04/0.04, electroretinograhy responses: not available" "<5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285597" "04214" "00392321" "00000" "Familial, autosomal dominant" "17y" "best corrected visual acuity right/left eye: 0.5/0.7, electroretinograhy responses: rod absent, severe defect of cone function" "1y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285598" "04214" "00392322" "00000" "Familial, autosomal dominant" "37y" "best corrected visual acuity right/left eye: 0.1/0.5, electroretinograhy responses: extinguished" "3y6m" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285601" "04214" "00392325" "00000" "Familial, autosomal dominant" "59y" "best corrected visual acuity right/left eye: 0.4/0.5, electroretinograhy responses: rod absent, severe defect of cone function" "4y6m" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285612" "04214" "00392336" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right/left eye: 0.03/0.02, electroretinograhy responses: extinguished" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285617" "04214" "00392341" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity right/left eye: 0.6/0.4, electroretinograhy responses: extinguished" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285623" "04214" "00392347" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity right/left eye: 0.4/0.3, electroretinograhy responses: extinguished" "2y6m" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285624" "04214" "00392348" "00000" "Familial, autosomal dominant" "30y" "best corrected visual acuity right/left eye: 0.1/0.2, electroretinograhy responses: not available" "3y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285625" "04214" "00392349" "00000" "Familial, autosomal dominant" "21y" "best corrected visual acuity right/left eye: 0.6/0.3, electroretinograhy responses: rod absent, severe defect of cone function" "11y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285628" "04214" "00392352" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity right/left eye: 1/0.8, electroretinograhy responses: not available" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285633" "04214" "00392357" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity right/left eye: 0.6/0.5, electroretinograhy responses: not available" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285637" "04214" "00392361" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right/left eye: 0.2/0.08, electroretinograhy responses: not available" "8y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285640" "04214" "00392364" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity right/left eye: no light perception/0.03, electroretinograhy responses: not available" "4y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285643" "04214" "00392367" "00000" "Familial, autosomal dominant" "29y" "best corrected visual acuity right/left eye: 0.7/0.7, electroretinograhy responses: not available" "6y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285644" "04214" "00392368" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right/left eye: 0.08/0.08, electroretinograhy responses: not available" "3y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285651" "04214" "00392375" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right/left eye: 0.3/0.2, electroretinograhy responses: not available" "5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285652" "04214" "00392376" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity right/left eye: 0.3/0.2, electroretinograhy responses: not available" "21y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285658" "04214" "00392382" "00000" "Familial, autosomal dominant" "50y" "best corrected visual acuity right/left eye: 0.6/0.7, electroretinograhy responses: not available" "45y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285659" "04214" "00392383" "00000" "Familial, autosomal dominant" "32y" "best corrected visual acuity right/left eye: 0.5/0.8, electroretinograhy responses: extinguished" "4y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285662" "04214" "00392386" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right/left eye: 0.7/0.7, electroretinograhy responses: extinguished" "3y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285663" "04214" "00392387" "00000" "Familial, autosomal dominant" "25y" "best corrected visual acuity right/left eye: 0.2/0.1, electroretinograhy responses: not available" "15y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285669" "04214" "00392393" "00000" "Familial, autosomal dominant" "48y" "best corrected visual acuity right/left eye: 0.1/0.3, electroretinograhy responses: extinguished" "<5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal dominant" "Retinitis pigmentosa, autosomal dominant" "" "0000285799" "04214" "00392552" "00000" "Familial, autosomal dominant" "69y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior, nasal_inferior, nasal" "40y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285800" "04214" "00392553" "00000" "Familial, autosomal dominant" "65y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "36y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285801" "04214" "00392554" "00000" "Isolated (sporadic)" "57y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "44y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285802" "04214" "00392555" "00000" "Isolated (sporadic)" "64y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior, temporal_inferior, temporal" "62y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285803" "04214" "00392556" "00000" "Isolated (sporadic)" "40y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "40y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285804" "04214" "00392557" "00000" "Familial, autosomal dominant" "63y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "52y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285805" "04214" "00392558" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior, nasal_inferior, nasal" "21y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285806" "04214" "00392559" "00000" "Familial, autosomal dominant" "22y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: nasal_temporal" "21y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285807" "04214" "00392560" "00000" "Familial, autosomal dominant" "57y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "48y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285808" "04214" "00392561" "00000" "Familial, autosomal dominant" "29y" "best corrected visual acuity right_left eye: 20/20_20/20, affected sector: inferior_inferior" "28y" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "0000285828" "04214" "00392581" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285856" "04214" "00392609" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285905" "04214" "00392658" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286024" "04214" "00392778" "00000" "Unknown" "4y" "" "" "" "" "" "" "" "" "" "Retinitis punctata albescens" "Retinitis punctata albescens" "" "0000286025" "04214" "00392779" "00000" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "Retinitis punctata albescens" "Retinitis punctata albescens" "" "0000286646" "04214" "00393440" "00000" "Familial, autosomal dominant" "28y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286740" "04214" "00393534" "00000" "Familial, autosomal dominant" "39y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286805" "04214" "00393599" "00000" "Familial, autosomal dominant" "6y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286812" "04214" "00393606" "00000" "Familial, autosomal dominant" "35y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286817" "04214" "00393611" "00000" "Familial, autosomal dominant" "28y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286846" "04214" "00393640" "00000" "Familial, autosomal dominant" "17y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286939" "04214" "00393733" "00000" "Familial, autosomal dominant" "37y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287116" "04214" "00393910" "00000" "Familial, autosomal dominant" "12y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287120" "04214" "00393914" "00000" "Familial, autosomal dominant" "37y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287533" "04214" "00394329" "00000" "Familial, autosomal dominant" "" "Early-onset RP, ERG consistent with RP" "" "" "" "" "" "" "" "" "retinits pigmentosa" "" "" "0000287709" "04214" "00394506" "00000" "Familial, autosomal dominant" "59y" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287710" "04214" "00394507" "00000" "Familial, autosomal dominant" "36y" "" "18y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287711" "04214" "00394508" "00000" "Familial, autosomal dominant" "75y" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287712" "04214" "00394509" "00000" "Unknown" "35y" "" "27y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287713" "04214" "00394510" "00000" "Familial, autosomal dominant" "39y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287714" "04214" "00394511" "00000" "Familial, autosomal dominant" "24y" "" "13y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287715" "04214" "00394512" "00000" "Familial, autosomal dominant" "50y" "" "11y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287716" "04214" "00394513" "00000" "Familial, autosomal dominant" "30y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287717" "04214" "00394514" "00000" "Familial, autosomal dominant" "31y" "" "4y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287718" "04214" "00394515" "00000" "Familial, autosomal dominant" "72y" "" "5y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287719" "04214" "00394516" "00000" "Familial, autosomal dominant" "48y" "" "7y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287720" "04214" "00394517" "00000" "Familial, autosomal dominant" "64y" "" "44y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287721" "04214" "00394518" "00000" "Familial, autosomal dominant" "34y" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287722" "04214" "00394519" "00000" "Familial, autosomal dominant" "47y" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287723" "04214" "00394520" "00000" "Familial, autosomal dominant" "31y" "" "16y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287724" "04214" "00394521" "00000" "Familial, autosomal dominant" "40y" "" "13y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287725" "04214" "00394522" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000288757" "04214" "00395559" "00000" "Familial, autosomal dominant" "" "early onset rod-cone dystrophy, photophobia, type i diabetes mellitus, abnormal sperm motility and morphology" "" "" "" "" "" "" "" "" "Early onset retinitis pigmentosa, diabetes" "" "" "0000289080" "04214" "00395918" "00000" "Unknown" "36y6m" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289096" "04214" "00395934" "00000" "Unknown" "35y8m" "" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289113" "04214" "00395951" "00000" "Unknown" "38y11m" "" "36y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289133" "04214" "00395971" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289134" "04214" "00395972" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289135" "04214" "00395973" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289136" "04214" "00395974" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289137" "04214" "00395975" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289138" "04214" "00395976" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289139" "04214" "00395977" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289140" "04214" "00395978" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289141" "04214" "00395979" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289142" "04214" "00395980" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289647" "04214" "00396486" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (Dominant)" "" "" "0000289670" "04214" "00396509" "00000" "Familial, autosomal recessive" "58y" "night blindness" "40y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289674" "04214" "00396513" "00000" "Isolated (sporadic)" "63y" "night blindness" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000300537" "04214" "00408421" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301615" "01680" "00409498" "00000" "Familial, autosomal recessive" "47y" "27y: night vision difficulties; more rapid vision loss during the course of two pregnancies; over the next 20 years, the vision in the right eye continued to decline to a current best corrected visual acuity right, left eye: of 20/200 (1.0 logMAR), 20/50 (0.4 logMAR); visual fields: progressive loss of sensitivity, greater in the pericentral region between 10 deg and 20 deg from fixation, with eventual development of scotomas that deepened and enlarged with time; full field electroretinography: initially normal in both eyes (27y), slowly declined over time, became statistically significant at 39y ; relatively symmetric progressive attenuation of rod-dependent and cone-dependent responses in both eyes; multifocal electroretinography: markedly attenuated central macular cone-dependent function, notably worse in the right eye; perimetry also showed asymmetric central and paracentral scotomas with the III4e and V4e isopters that were worse in the right, which deepened and enlarged especially over the past several years; III4e isopter area shows a progressively steep decline during ages 39-46. Retinal crystalline deposits visualised on colour photography and infrared imaging; corneal limbal crystalline deposits did not manifest clinically until 33y; wide-field fundus autofluorescence: confluent hypoautofluorescence of the posterior pole correlating with extensive retinal pigment epithelium atrophy in both eyes; 47y some intact macular autofluorescence remained, correlating with residual retinal pigment epithelium and better visual acuity in the left eye. Early phase wide-field fundus autofluorescence: confluent hyperfluorescent window defect of the posterior pole with patchy hypofluorescent choroidal atrophy; 44y, cystoid macular oedema (CME), worse in the right eye on optical coherence tomography" "25y" "" "reduced visual acuity in the right eye - 20/50 (0.4 logMAR)" "" "" "" "" "" "dystrophy, corneoretinal, crystalline, Bietti (BCD)" "" "" "0000302699" "04214" "00410607" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302700" "04214" "00410608" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302701" "04214" "00410609" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302702" "04214" "00410610" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302703" "04214" "00410611" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302704" "04214" "00410612" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302705" "04214" "00410613" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302706" "04214" "00410614" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302707" "04214" "00410615" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302708" "04214" "00410616" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302709" "04214" "00410617" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302710" "04214" "00410618" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302711" "04214" "00410619" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302712" "04214" "00410620" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302713" "04214" "00410621" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302714" "04214" "00410622" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302715" "04214" "00410623" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302716" "04214" "00410624" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302717" "04214" "00410625" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302718" "04214" "00410626" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302719" "04214" "00410627" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302720" "04214" "00410628" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302721" "04214" "00410629" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302722" "04214" "00410630" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302723" "04214" "00410631" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302724" "04214" "00410632" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302725" "04214" "00410633" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302726" "04214" "00410634" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302727" "04214" "00410635" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302728" "04214" "00410636" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302729" "04214" "00410637" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302730" "04214" "00410638" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302731" "04214" "00410639" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302732" "04214" "00410640" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302733" "04214" "00410641" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302734" "04214" "00410642" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302735" "04214" "00410643" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302736" "04214" "00410644" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302737" "04214" "00410645" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302738" "04214" "00410646" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302739" "04214" "00410647" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302740" "04214" "00410648" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302741" "04214" "00410649" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302742" "04214" "00410650" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302743" "04214" "00410651" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302744" "04214" "00410652" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302745" "04214" "00410653" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302746" "04214" "00410654" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302747" "04214" "00410655" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302748" "04214" "00410656" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302749" "04214" "00410657" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302750" "04214" "00410658" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302751" "04214" "00410659" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302752" "04214" "00410660" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302753" "04214" "00410661" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302754" "04214" "00410662" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302755" "04214" "00410663" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302756" "04214" "00410664" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302757" "04214" "00410665" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302758" "04214" "00410666" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302759" "04214" "00410667" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302760" "04214" "00410668" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302761" "04214" "00410669" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302762" "04214" "00410670" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302763" "04214" "00410671" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302764" "04214" "00410672" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302765" "04214" "00410673" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302766" "04214" "00410674" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302767" "04214" "00410675" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302768" "04214" "00410676" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302769" "04214" "00410677" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302770" "04214" "00410678" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302771" "04214" "00410679" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302772" "04214" "00410680" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302773" "04214" "00410681" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302774" "04214" "00410682" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302775" "04214" "00410683" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302776" "04214" "00410684" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302777" "04214" "00410685" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302778" "04214" "00410686" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302779" "04214" "00410687" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302780" "04214" "00410688" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302781" "04214" "00410689" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302782" "04214" "00410690" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302783" "04214" "00410691" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302784" "04214" "00410692" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302785" "04214" "00410693" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302786" "04214" "00410694" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302787" "04214" "00410695" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302788" "04214" "00410696" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302789" "04214" "00410697" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302790" "04214" "00410698" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302791" "04214" "00410699" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302792" "04214" "00410700" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302793" "04214" "00410701" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302794" "04214" "00410702" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302795" "04214" "00410703" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302796" "04214" "00410704" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302797" "04214" "00410705" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302798" "04214" "00410706" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302799" "04214" "00410707" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302800" "04214" "00410708" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302801" "04214" "00410709" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302802" "04214" "00410710" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302803" "04214" "00410711" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302804" "04214" "00410712" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302805" "04214" "00410713" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302806" "04214" "00410714" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302807" "04214" "00410715" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302808" "04214" "00410716" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302809" "04214" "00410717" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302810" "04214" "00410718" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302811" "04214" "00410719" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302812" "04214" "00410720" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302813" "04214" "00410721" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302814" "04214" "00410722" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302815" "04214" "00410723" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302816" "04214" "00410724" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302817" "04214" "00410725" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302818" "04214" "00410726" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302819" "04214" "00410727" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302820" "04214" "00410728" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302821" "04214" "00410729" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302822" "04214" "00410730" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302823" "04214" "00410731" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302824" "04214" "00410732" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302825" "04214" "00410733" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302826" "04214" "00410734" "00000" "Familial, autosomal dominant" "" "data for the whole family: mild myopia and marked myopic oblique astigmatism in most patients; cataracta complicata frequent >40y; earlier mild irregularities of the posterior lens capsule; >10y: loss of visual field resulting in an extreme constriction to tunnel vision at the age of 50-60y; full-field rod-cone electroretinography: cone and particularly the rod ERG greatly reduced from the early twenties on; cone b-waves: markedly reduced, the implicit time: delayed 18-22y; virtual blindness: 40-60y; <40y no retinal hyperpigmentation (\"\"sine pigmento\"\" form); most of the patients present with typical atrophic changes and pigmentation at later" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302827" "04214" "00410736" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302828" "04214" "00410737" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302829" "04214" "00410738" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302830" "04214" "00410739" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302831" "04214" "00410740" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302832" "04214" "00410741" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302833" "04214" "00410742" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302834" "04214" "00410743" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302835" "04214" "00410744" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302836" "04214" "00410745" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302837" "04214" "00410746" "00000" "Familial, autosomal dominant" "" "whole family description: onset in early life, daylight visual difficulties: >20y; good visual acuity retained until 60-70y; visual field restriction; by the age of 2y, even >60y scotopic field of 5-10deg; fundi: irregularity of pigment in the retinal pigment epithelium, with areas of hypo- and hyperpigmentation, pigment migration into the neuroretina sparse even in late life; patchy choroidal atrophy by the age of 30y, widespread in the affected areas by the <65y; macula: relatively normal into late life, with sharp demarcation between the affected and unaffected retina" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302862" "04214" "00410771" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302863" "04214" "00410772" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302864" "04214" "00410773" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302865" "04214" "00410774" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302866" "04214" "00410775" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302867" "04214" "00410776" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302868" "04214" "00410777" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302869" "04214" "00410778" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302870" "04214" "00410779" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302871" "04214" "00410780" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302872" "04214" "00410781" "00000" "Familial, autosomal dominant" "" "whole family description: patients often registered blind by the fourth decade; cataracts frequently reported in the third and fourth decades" "" "" "night blindness from early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302873" "04214" "00410782" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302874" "04214" "00410783" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302875" "04214" "00410784" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302876" "04214" "00410785" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302877" "04214" "00410786" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302878" "04214" "00410787" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302879" "04214" "00410788" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302880" "04214" "00410789" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302881" "04214" "00410790" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302882" "04214" "00410791" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302883" "04214" "00410792" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302884" "04214" "00410793" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302885" "04214" "00410794" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302886" "04214" "00410795" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302887" "04214" "00410796" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302888" "04214" "00410797" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302889" "04214" "00410798" "00000" "Familial, autosomal dominant" "" "mild phenotype, with relatively good preservation of visual field in the fourth decade of life" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302904" "04214" "00410813" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302905" "04214" "00410814" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302906" "04214" "00410815" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302907" "04214" "00410816" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302908" "04214" "00410817" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302909" "04214" "00410818" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302910" "04214" "00410819" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302911" "04214" "00410820" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302912" "04214" "00410821" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302913" "04214" "00410822" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302914" "04214" "00410823" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302915" "04214" "00410824" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302916" "04214" "00410825" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302917" "04214" "00410826" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302918" "04214" "00410827" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302919" "04214" "00410828" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302920" "04214" "00410829" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302921" "04214" "00410830" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302922" "04214" "00410831" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302923" "04214" "00410832" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302924" "04214" "00410833" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302925" "04214" "00410834" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302926" "04214" "00410835" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302927" "04214" "00410836" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302928" "04214" "00410837" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302929" "04214" "00410838" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302930" "04214" "00410839" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302931" "04214" "00410840" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302932" "04214" "00410841" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302933" "04214" "00410842" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302934" "04214" "00410843" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302935" "04214" "00410844" "00000" "Familial, autosomal dominant" "" "affected based upon measurements of rod electroretinograms, dark adaptometry, and rhodopsin levels; no visual impairment" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302936" "04214" "00410845" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302937" "04214" "00410846" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302938" "04214" "00410847" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302939" "04214" "00410848" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302940" "04214" "00410849" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302941" "04214" "00410850" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302942" "04214" "00410851" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302943" "04214" "00410852" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302944" "04214" "00410853" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302945" "04214" "00410854" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302946" "04214" "00410855" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302947" "04214" "00410856" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302948" "04214" "00410857" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302949" "04214" "00410858" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302950" "04214" "00410859" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302951" "04214" "00410860" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302952" "04214" "00410861" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302953" "04214" "00410862" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302954" "04214" "00410863" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302955" "04214" "00410864" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302956" "04214" "00410865" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302957" "04214" "00410866" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302958" "04214" "00410867" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302959" "04214" "00410868" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302960" "04214" "00410869" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302961" "04214" "00410870" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302962" "04214" "00410871" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302963" "04214" "00410872" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302964" "04214" "00410873" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302965" "04214" "00410874" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302966" "04214" "00410875" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302967" "04214" "00410876" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302968" "04214" "00410877" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302969" "04214" "00410878" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302970" "04214" "00410879" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302971" "04214" "00410880" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302972" "04214" "00410881" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302973" "04214" "00410882" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302974" "04214" "00410883" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302975" "04214" "00410884" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302976" "04214" "00410885" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302977" "04214" "00410886" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302978" "04214" "00410887" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302979" "04214" "00410888" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302980" "04214" "00410889" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302981" "04214" "00410890" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302982" "04214" "00410891" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302983" "04214" "00410892" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302984" "04214" "00410893" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302985" "04214" "00410894" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302986" "04214" "00410895" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302987" "04214" "00410896" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302988" "04214" "00410897" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302989" "04214" "00410898" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302990" "04214" "00410899" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302991" "04214" "00410900" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302992" "04214" "00410901" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302993" "04214" "00410902" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302994" "04214" "00410903" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302995" "04214" "00410904" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302996" "04214" "00410905" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302997" "04214" "00410906" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302998" "04214" "00410907" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000302999" "04214" "00410908" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303000" "04214" "00410909" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303001" "04214" "00410910" "00000" "Familial, autosomal dominant" "" "affected based upon measurements of rod electroretinograms, dark adaptometry, and rhodopsin levels; no visual impairment" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303002" "04214" "00410911" "00000" "Familial, autosomal dominant" "" "affected based upon measurements of rod electroretinograms, dark adaptometry, and rhodopsin levels; no visual impairment" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303003" "04214" "00410912" "00000" "Familial, autosomal dominant" "" "affected based upon measurements of rod electroretinograms, dark adaptometry, and rhodopsin levels; no visual impairment" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303004" "04214" "00410913" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303005" "04214" "00410914" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303020" "04214" "00410929" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303021" "04214" "00410930" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303022" "04214" "00410931" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303023" "04214" "00410932" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303024" "04214" "00410933" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303025" "04214" "00410934" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303026" "04214" "00410935" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303027" "04214" "00410936" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303028" "04214" "00410937" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303029" "04214" "00410938" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303162" "04214" "00411072" "00000" "Familial, autosomal dominant" "28y" "visual field loss 18y; problems adapting to dark condition; significant history of light exposure; for 8 years he was a life guard on the beach during the summers and a ski instructor during the winters (skiing up to 150 days per year; 28y: visual acuity 20/25 both eyes with a low myopic astigmatic correction; biomicroscopy: clear lenses and occasional pigmented flecks in the anterior vitreous space; indirect ophthalmoscopy: a diffuse pigmentary retinopathy with slightly more pigment clumping inferiorly; photopic electroretinogram (ERG): barely recordable, rod-isolated and dark-adapted bright flash ERGs: nonrecordable; flicker stimulus: barely recordable; final rod threshold after 40 minutes of dark adaptation: 4.8 log unit elevation of the final rod threshold in each eye at 12deg using a 2deg target; Goldmann visual field testing: superior loss of visual field in both eyes (sectoral RP pattern)" "" "23y" "night blindness since grade school" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303163" "04214" "00411073" "00000" "Familial, autosomal dominant" "52y" "no history night blindness or peripheral visual difficulties; photosensitivity ~32y; uncorrected visual acuity: 20/20 both eyes; biomicroscopy: a clear lens and syneresis of the anterior vitreous; indirect ophthalmoscopy: inferior and nasal retinal degeneration with sparse pigmentation more evident on fluorescein angiography; photopic electroretinogram (ERG): subnormal, rod-isolated ERG: barely recordable, bright flash dark-adapted ERG: greatly diminished; Goldmann visual field testing: superior depression and contraction with smaller isopters and a dense scotoma superiorly with the IV-4 and III-4 isopters; visual field was better than that of her son" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303164" "04214" "00411074" "00000" "Familial, autosomal dominant" "27y" "visual acuity : 20/20 both eyes with a mild myopic astigmatic correction; biomicroscopy: clear lenses, syneresis, no pigmented flecks in the anterior vitreous space; indirect ophthalmoscopy: sparse pigmentary changes, with greater involvement in the superonasal region; abnormal photopic electroretinogram, with delayed implicit times, rod-isolated electroretinogram: nonrecordable; bright flash dark-adapted ERG: diminished, with delayed implicit times; Goldmann visual field: contraction of smaller isopters with large scotomatous areas inferiorly; final rod threshold at 12deg - a 2.4 log unit elevation, 5.0 log units, at 30deg" "" "18y" "mild night blindness from childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303165" "04214" "00411075" "00000" "Familial, autosomal dominant" "62y" "vision poor in the left eye since a car accident in his 50s; visual acuity right, left eye: 20/20, counting fingers; indirect ophthalmoscopy: diffuse retinal pigment atrophy with pigment clumps that were more dense inferiorly than in the superior retina; left eye: macular scar" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303166" "04214" "00411076" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303167" "04214" "00411077" "00000" "Familial, autosomal dominant" "" "D type adRP" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303168" "04214" "00411078" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303169" "04214" "00411079" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303170" "04214" "00411080" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303171" "04214" "00411081" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303172" "04214" "00411082" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303173" "04214" "00411083" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303174" "04214" "00411084" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303175" "04214" "00411085" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303176" "04214" "00411086" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303177" "04214" "00411087" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303178" "04214" "00411088" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease within the first decade of life, diffuse funduscopic disturbances, electroretinography: extinguished rod responses, cone responses retained until the third decade, although significantly reduced in amplitude and delayed in latency; two colour dark adaptometry: a diffuse loss of rod and cone photoreceptor sensitivity with a greater involvement of rods" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303187" "04214" "00411096" "00000" "Familial, autosomal dominant" "30y" "no decreased central visual acuity; gradual worsening of her night vision during the preceding 5 years and peripheral vision during the previous 3 years; best corrected visual acuity; refraction: right, left eye: 20/20+1; -1.50 +2.50 x75, 20/20+2; -1.00 + 1.75 x110; slit-lamp examination findings in the cornea, anterior chamber, iris, and lens: normal in both eyes; the vitreous: a small number of cells and posterior vitreous detachment in both eyes; . intraocular pressure right/left eye: 14 / 16 mm; fundus: nonspecific pigment mottling within both foveae, and epiretinal membranes in both maculae, retinal arterioles: mildly attenuated, optic discs normal, apparent regions of hypopigmentation within the midperipheral region of the retina extending posteriorly to the vascular arcades also readily apparent nasal to the optic discs and extended approximately 3 disc diameters temporal to the foveal margin; sparse amount of bone spicule-like pigment clumping primarily in the inferior and inferonasal portions of the retina; visual field: bilateral partial ring scotomas to a II-4-e test target in both eyes. 30y: findings moderately worse than those obtained 7 years previously; Tuebinger perimeter: rods: mediating thresholds in the far peripheral portions of the retina while cones mediated thresholds to both long- and middle wavelength stimuli within approximately the central 30deg; threshold elevations: somewhat more noticeable in the inferior than in the superior portion of the retina; pattern of elevation: consistent with the Massof and Finkelstein25 type 2 autosomal dominant RP; electroretinogram: a reduction in cone single-flash b-wave amplitude to 40% below the lower normal limit for the age group with a prolonged implicit time; 30-Hz flicker stimulus, the cone response: reduced 36% below the lower normal limit with a prolonged implicit time. Isolated rod b-wave function to a single-flash blue stimulus: reduced 60% from our lower normal limit with a prolonged implicit time; blue-flicker stimulus at 10 Hz, also isolating rod responses,: a 56% reduction below the normal range with a prolonged implicit time. A comparison of electroretinogram: amplitudes during a 10-year period: essentially no change" "10y" "20y" "poor night vision and photoaversion" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303188" "04214" "00411097" "00000" "Familial, autosomal dominant" "61y" "no peripheral visual field impairment; 14-year history of diabetes mellitus controlled with oral hypoglycemia agents; mild subjective change in both night vision and peripheral vision during the previous 10 years. 61y:, best corrected visual acuity; refraction: right, left eye: 20/20-2; -1.00 +1.25 x110, 20/20-1; -1.25 +1.75 x120; slit-lamp examination: cornea, anterior chamber, and iris: normal, lens in both eyes: mild posterior subcapsular opacity and nuclear yellowing, vitreous: trace cells in both eyes; applanation pressures right / left eye: 12 / 13 mm Hg in the left eye; fundus: hypopigmentation along the vascular arcades - 1.5 disc diameters temporal to the foveal margin, also nasally to the optic discs, with bone spicule-like pigment clumping; retinal vessels: mildly to moderately attenuated; optic nerves: a moderate amount of pallor; macula of the right eye: minimal background diabetic retinopathy, including dot hemorrhages and hard exudates; left macula: a linear-shaped nerve fiber layer hemorrhage and a few intraretinal dot hemorrhages; foveae of both eyes: normal. angioid streaks in the parapapillary regions of both eyes; visual field: a primarily superotemporal partial ring scotoma in both eyes that broke through to the periphery in the superotemporal quadrant (similar to 8 years previously); Tuebinger perimeter: thresholds in the far periphery: rod-mediated but elevated for both long- and middle-wavelength test stimuli; within the central 20deg, long-wavelength test stimulus: similar to that of his daughter, thresholds for the middle-wavelength test stimulus: rod-mediated, elevated, at a few locations within this region; moderately more elevated in the inferior and nasal portions of the retina than in the superior and temporal quadrants; pattern of elevation: consistent with the Massof and Finkelstein25 type 2 autosomal dominant RP; prolonged recovery of rod threshold at 30deg superior to the foveola after a 5-minute bleach with a Goldmann-Weekers dark adaptometer, thresholds remained elevated 1.3 log units above baseline dark-adapted thresholds even after 1 hour 40 minutes of dark adaptation (control: by 39 minutes under similar test conditions); electroretinogram: reduction in cone single-flash b-wave amplitude to 40% below the lower normal limit, while a 30-Hz flicker stimulus: a cone amplitude reduction to 60% below the lower normal limit for his age, prolonged b-wave implicit time. Isolated rod function to a single-flash blue stimulus: nondetectable, blue-flicker stimulus at 10 Hz, also isolating rod responses: a 79% reduction in amplitude below the lower normal range with a prolonged b-wave implicit time, essentially unchanged from those obtained approximately 10 years previously" ">10y" "" "difficulty adjusting to dark environments" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303189" "04214" "00411098" "00000" "Familial, autosomal dominant" "24y" "no difficulty with peripheral or central vision; best corrected visual acuity; refraction: right, left eye: 20/20-2; -1.25 +1.50 x100, 20/20-1; -1.00 + 1.50 x80; motility examination: mild alternating exotropia; slit-lamp examination findings in the cornea, anterior chamber, and lens: normal. the vitreous contained a small number of cells in each eye; applanation pressures: 14 mm Hg in both eyes; fundus: hypopigmentation most apparent anterior to the vascular arcades and temporal to the macula, a sparse amount of bone spicule-like pigment clumping predominantly in the inferior and nasal quadrants; foveae: normal on gross examination, except for epiretinal membranes, optic discs: mild waxy-appearing pallor and peripapillary atrophy; retinal vessels: attenuated; visual field with a Goldmann perimeter: mild to moderate restriction in the superior hemisphere of both eyes to the II-4-e and V-4-e test targets and generalized restriction to the II-2-e target, Tuebinger perimeter: marked elevation of rod thresholds to the middle-wavelength stimulus that: most notable in the far peripheral region of the retina, a slightly greater predilection for threshold elevation: noted in the inferior than in the superior portion of the retina, which did not appear to be distinctive, threshold profile: most consistent with a Massof and Finkelstein25 type 2 autosomal dominant RP; electroretinogram: nondetectable rod function and a markedly reduced single-flash cone b-wave response decreased 68% below the lower limit of normal with a prolonged b-wave implicit time, 85% reduction below the lower limit for cone function with a prolonged implicit time: also seen for a 30-Hz flicker stimulus" ">12y" "" "poor night vision in early teens" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303190" "04214" "00411099" "00000" "Familial, autosomal dominant" "52y" "25y: poor peripheral vision, photoaversion since childhood and decreased central vision, nyctalopia had not subjectively changed since its onset; ~40y: peripheral vision began to worsen; cataract surgery in both eyes in 5 years prior; best corrected visual acuity; refraction: right, left eye: 20/ 25-2; -2.50 +1.75 x95 20/60+2; -1.75 +1.75 x95; motility examination: an alternating exotropia of 15deg; slit lamp - cornea, anterior chamber, and iris: normal in both eyes; intraocular lens with a residual lens cortex both eyes; the vitreous in both eyes: fibrillar and contained a small number of cells; applanation pressures right/left eye: 13 / 15 mm Hg; fundus: degenerative pigment changes consisting of both hypopigmentation and bone spicule-like pigment clumping within the midperipheral region of the retina for 360deg, extending posterior to the retinal vascular arcades, atrophic-appearing retinal pigment epithelium and choroidal changes indicative of cobblestone retinal degeneration apparent in the inferotemporal quadrant of both eyes; the foveae: minimal pigment mottling, retinal vessels: attenuated; optic discs: waxy appearance; visual field: marked concentric restriction to II-4-e and V-4-e test targets" "9y" "" "poor night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303191" "04214" "00411100" "00000" "Familial, autosomal dominant" "80y" "77y: best corrected visual acuity: 20/30; -2.25 +1.75 x150, 20/40; -3.00 +2.00 x170, minimal posterior subcapsular lens opacities and a modest degree of nuclear yellowing in both eyes, pseudoexfoliation of the lens capsule; ocular pressures: normal, right eye: an epiretinal membrane and bull\'s-eye-like hypopigmentation of the fovea; hypopigmentation and mild pigment clumping, primarily along retinal vessels apparent predominantly in the inferior portion of the retina; left eye: similar changes in the fovea as well as pigmentary changes predominantly in the inferior portion of the retina, midperipheral superior field restriction both eyes; 69y electroretinogram: subnormal cone and rod amplitudes, the only complaint: mildly impaired night vision which worsened during the last 20 years; no impaired peripheral vision" "<50y" "" "poor night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303192" "04214" "00411101" "00000" "Familial, autosomal dominant" "56y" "mild and nonprogressive impaired night vision, no impaired peripheral vision" "25y" "" "mild and nonprogressive impaired night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303193" "04214" "00411102" "00000" "Familial, autosomal dominant" "46y" "moderately impaired night vision of 5 years\' duration that she believed had gradually worsened;no history of decreased central vision, poor color vision, or difficulty with peripheral vision; 39y:no impaired night vision or peripheral vision; best corrected visual acuity; refraction: right, left eye: 20/15-2; -1.00 +1.50 x130 20/15; -1.50 +1.50 x65; slit-lamp examination cornea, anterior chamber, iris, and lens: normal, tvitreous: trace cells, applanation pressures right/left eye: 16 / 12 mm Hg in the left eye; fundus: normal-appearing foveae and optic discs in both eyes; inferior retinal vessels: attenuated. Both eyes: a region of retinal pigment epithelial cell hypopigmentation that began just posterior to the inferior vascular arcade and extended to the midperipheral region of the retina, sparse pigment clumping in the inferior portion of the retina; visual field: bilateral, superior, midperipheral arcuate-like defects to a II-4-e test target that: essentially similar to those noted 5 years previously; dark-adapted rod thresholds determined with a Goldmann-Weekers dark adaptometer: elevated approximately 1 log unit above the normal range at 15deg, 30deg, and 45deg above the fovea and approximately 3.0 log units above the normal range at 15deg below the fovea; 36y electroretinogram: reduction in cone single-flash b-wave amplitude to 30% below the lower normal limit for the age with a normal implicit time; 30 Hz-flicker stimulus, the cone response: reduced 48% below the lower normal limit with a normal implicit time, isolated rod function to a single-flash blue stimulus: reduced 58% from our lower normal limit with a normal implicit time; blue-flicker stimulus at 10 Hz: a 47% reduction in rod function below the normal limit with a normal implicit time" "33y" "" "impaired visual field and atrophy changes of the retina" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303194" "04214" "00411103" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303198" "04214" "00411107" "00000" "Familial, autosomal dominant" "76y" "increased glare sensitivity from ~55y; side vision impairment noticeable: 66y, when the diagnosis of RP was established; central vision and reading acuity deteriorating for about 1 year; visual fields: constricted; funduscopy, overall loss of retinal pigment epithelium sparing only the fovea, with some apparent choroidal sclerosis in the midperiphery and typical bone-spicule pigmentation scattered in all quadrants; rod and cone electroretinogram: nonrecordable" ">20y" "66y" "difficulties with night vision at the beginning of his third decade of life" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303199" "04214" "00411108" "00000" "Familial, autosomal dominant" "34y" "strabismus of the left eye 2y; only recently, a slight increase in glare sensitivity; no problems with side vision or visual acuity30y: reduced electroretinogram; perimetry:beginning of ring scotoma formation in the lower temporal and, to a smaller extent, in the lower nasal quadrants of both eyes; funduscopy: pigment epithelium mottling in the peripapillary and perimacular region and in the midperiphery, sparse bone-spicule pigmentation; the dark adaptation curve, determined at 20deg temporally: absence of rod function and an elevated cone threshold; electroretinogram:, rod amplitudes detectable but severely reduced with implicit times being normal; cone responses in the photopic electroretinogram: low normal amplitudes and prolonged implicit times" "16y" "" "impaired night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303200" "04214" "00411109" "00000" "Familial, autosomal dominant" "4y" "no visual impairment up to now; fundus: wrinkling of the inner limiting membrane at the posterior poles, and a fine granularity of the retinal pigment epithelium in some areas midperipherally" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303201" "04214" "00411110" "00000" "Familial, autosomal dominant" "59y" "first noted night vision problems 22y; no visual field loss until 39 years of age; perimetry 59y: complete loss of visual field except for 20deg around fixation; both rod and cone responses were virtually extinguished on electroretinogram" "" "" "night vision problems" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303202" "04214" "00411111" "00000" "Familial, autosomal dominant" "25y" "25y: perimetry: loss superiorly in both eyes, signs of retinal dystrophy in the inferior retina" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303208" "04214" "00411118" "00000" "Familial, autosomal recessive" "29y" "constricted visual fields, funduscopic features of RP, markedly abnormal electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303221" "04214" "00411130" "00000" "Familial, autosomal dominant" "59y" "middle 50s: mild degree of difficulty with night vision, subjective worsening of symptoms; best corrected visual acuity right; left eye: 20/25 -3, + 0.50-diopter (D) sphere, 20/25 -3 ;+1.00-D sphere; slit-lamp: cornea, anterior chamber, iris: normal; lenses: minimal posterior subcapsular lens changes, the vitreous: trace cells in each eye; applanation pressures right/left eye: 15 /16 mm Hg; fundus: a distinct regional predilection for retinal pigmentary degenerative changes to occur in the inferior hemisphere of each eye, including hypopigmentation, as well as pigment clumping and anterior migration in a bone-spicule-like fashion; choroidal atrophy inferiorly and in the peripapillary region of each eye; inferior retinal arterioles: attenuated, situated superiorly: normal; optic discs: normal, foveae grossly normal; visual field: predominant impairment in the superior hemisphere progressing slightly during 11 years between tests; Goldmann-Weekers dark adaptometer: an approximate rod threshold elevation of 0.8 to 1.3 log units above the normal limit at 15deg, 30deg, and 45deg in the superior retina, with a notable delay in the recovery time to reach pre-bleach thresholds when tested at 23deg in the superior retina; thresholds elevated more than 3 log units at 15deg, 30deg, and 45deg in the inferior retina; electroretinogram: cone b-wave amplitudes were reduced to 50% and 45% of the lower limits of normal for the single-flash and 30-Hz flicker stimuli, respectively; the rod function was reduced to 63% and 50% of the lower normal limit for single-flash and 10-Hz blue flicker stimuli, respectively; implicit times for both the cone and rod responses: normal, moderate additional reduction in scotopic amplitude during a 9-year period between recordings" ">35y" "42y" "impairment of his superior visual field: middle to late 30s" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303222" "04214" "00411131" "00000" "Familial, autosomal dominant" "32y" "no subjective ocular complaints; best corrected visual acuity and refraction right; left eye: 20/15 -1 ; plano +0.75x60 and 20/15 ;-0.50 + 0.50x60; slit-lamp: cornea, anterior chamber, iris, lens and vitreous: normal; fundus: hypopigmentation along the inferior vascular arcade and inferiorly in the right eye and along the inferior vascular arcade and inferonasally in the left eye; sparse amount of clumped pigment was noted inferonasally in the left eye; retinal vessels, optic disc, and fovea: normal in each eye; visual field: isolated scotomas or arcuate defects in the midsuperior field of each eye; electroretinogram: cone function of normal amplitude - both a single-flash and 30-Hz flicker stimulus implicit times: normal, amplitudes greater in the right eye than in the left eye; rod amplitudes: reduced 27% and 37% below the normal range to 10-Hz blue flicker and single-flash blue stimuli, respectively; implicit times: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303223" "04214" "00411132" "00000" "Familial, autosomal dominant" "19y" "no subjective ocular complaints; best corrected visual acuity and refraction right; left eye: 20/20 -2 ;-0.50+1.50x75 and 20/20 -3 ;-0.50 + 1.50x100; slit-lamp: cornea, anterior chamber, lens and vitreous: normal; fundus: normal optic disc, fovea, and retinal vessels in each eye; hypopigmentation along the inferior vascular arcades as well as in the inferonasal retina in each eye, isolated pigment clumps; visual field testing: a partial arcuate-like scotoma in the midperipheral superior field of each eye; electroretinogram: cone b-wave: reduced only 8% below the lower normal range to a single-flash stimulus, other ERG parameters normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303224" "04214" "00411133" "00000" "Familial, autosomal dominant" "47y" "no night blindness or difficulty with his central vision; best corrected visual acuity and refraction right; left eye: 20/15 -1 ;-5.00 + 1.50x150, 20/15 -1 ;-4.50 + 0.25x105; slit-lamp: cornea, anterior chamber, iris, and lens: normal in each eye; the vitreous: trace cells bilaterally; intraocular pressures: 16 mm Hg in each eye; fundus: regional pigmentary changes in the inferior and inferonasal retina, which included hypopigmentation and bone spicule-like pigment clumping; inferior retinal vessels: attenuated, superior vessels: normal; optic discs: no pallor, foveae: grossly normal; visual field: a midperipheral arcuate defect in the superior field of each eye which progressed a small extent during an 11-year period; dark-adaptation testing: elevated thresholds inferior to the fovea that varied from 2 log units at 15deg to 2.5 log units at 30deg and between 0.25 log units at 45deg to 1 log unit at 15deg superior to the fovea, with rods mediating thresholds at all loci; electroretinogram: normal" "" "30y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303225" "04214" "00411134" "00000" "Familial, autosomal dominant" "75y" "73y: visual acuity was corrected to 20/40 both eyes; 75y: visual acuity:10/700 using a Feinbloom chart; +2.50 + 0.75x15, 20/50 ;+2.50 + 0.75x140; difficulty with night vision, slit-lamp: cornea: anterior crocodile shagreen and Terrien\'s marginal degeneration in each eye; anterior chambers: clear, and the lenses: mild nuclear sclerosis; the vitreous: trace cells in each eye; intraocular pressures: 15 /16 mm Hg; fundus: patchy areas of choroidal atrophy in the inferior retina with attenuation of the inferior retinal arterioles; optic discs: glaucomatous atrophy that was more apparent in the right eye; visual field: restriction of the superior field in each eye; dark-adaptation testing: elevated thresholds at 15deg, 30deg, and 45deg inferior to the fovea of approximately 1.5 to 2 log units and between 1 log unit at 45deg to 1.5 log units at 15deg superior to the fovea, with rods mediating thresholds at the above locations; electroretinogram: cone b-wave amplitudes: reduced 33% and 54% below the normal range for single-flash and 30-Hz flicker stimuli, respectively, with prolonged implicit times; isolated rod b-wave amplitudes: reduced 89% and 88% below the normal range for single-flash and 10-Hz blue flicker stimuli, respectively, with prolonged implicit times; combined scotopic rod and cone response to a bright white light: b-wave amplitude reduced 45% below the normal range" "" "64y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303227" "04214" "00411137" "00000" "Familial, autosomal dominant" "40y" "extensive retinal degeneration with more bone spicule pigmentation in the inferior than superior retina and visual field showed loss of the superior field of both eyes. electroretinogram: amplitudes of b-wave in scotopic ERG and single flash ERG reduced, but not extinguished; flicker ERG: moderately diminished amplitude; diagnosed to be type 2 ADRP" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303228" "04214" "00411138" "00000" "Familial, autosomal dominant" "" "significantly concentric visual field loss and non-recordable electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303229" "04214" "00411139" "00000" "Familial, autosomal dominant" "44y" "fundus: diffuse bone corpuscle pigmentation with concentric visual field loss; electroretinographic response: not recordable; type 1 ADRP" "15y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303230" "04214" "00411140" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303231" "04214" "00411141" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303232" "04214" "00411142" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303233" "04214" "00411143" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303234" "04214" "00411144" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303235" "04214" "00411145" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303236" "04214" "00411146" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303237" "04214" "00411147" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303238" "04214" "00411148" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303239" "04214" "00411149" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303240" "04214" "00411150" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303241" "04214" "00411151" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303242" "04214" "00411152" "00000" "Familial, autosomal dominant" "" "whole family description: diffuse type7 of ADRP; significantly decreased levels of certain polyunsaturated acids in the plasma of affected subjects compared to unaffected relatives (possibly a gene involved in the synthesis or transport of these fatty acids is linked to the rhodopsin gene)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303243" "04214" "00411153" "00000" "Familial, autosomal dominant" "69y" "night blindness since early childhood, visual field losses before 20y; Goldmann perimeter: no residual visual field; ophthalmoscopy: spicular pigment and narrowed vessels in all four quadrants with no asymmetry between the superior and inferior retina detectable; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303244" "04214" "00411154" "00000" "Familial, autosomal dominant" "65y" "night blindness since early childhood, visual field losses before 20y; Goldmann perimeter: no residual visual field; ophthalmoscopy: spicular pigment and narrowed vessels in all four quadrants with no asymmetry between the superior and inferior retina detectable; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303245" "04214" "00411155" "00000" "Familial, autosomal dominant" "61y" "night blindness since early childhood, visual field losses before 20y; Goldmann perimeter: no residual visual field; ophthalmoscopy: spicular pigment and narrowed vessels in all four quadrants with no asymmetry between the superior and inferior retina detectable; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303246" "04214" "00411156" "00000" "Familial, autosomal dominant" "40y" "night blindness since early childhood, visual field losses before 20y; Goldmann perimeter: a 5-8\"\" concentric residual field with the V:4e object; rod threshold sensitivity after 40 minutes of dark adaptation: 4.0 log unit elevation; ophthalmoscopy: spicular pigment and narrowed vessels in all four quadrants with no asymmetry between the superior and inferior retina detectable; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303247" "04214" "00411157" "00000" "Familial, autosomal dominant" "54y" "night blindness since early childhood, visual field losses before 20y; Goldmann perimeter: a 5-8\"\" concentric residual field with the V:4e object; rod threshold sensitivity after 40 minutes of dark adaptation: 4.0 log unit elevation; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation; residual cone b-wave amplitudes (0.05 pV)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303248" "04214" "00411158" "00000" "Familial, autosomal dominant" "19y" "night blindness since early childhood, visual field losses before 20y; 15deg remaining concentric visual fields with the V:4e object and 5deg fields with the I:4e object; rod threshold sensitivity after 40 minutes of dark adaptation: 2.5 log unit elevation; electroretinogram: no responses were recordable with blue or red light flashes and full-field stimulation; when stimulating with white light: small residual responses (1 5 pV); residual cone b-wave amplitudes (0.05 pV)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303251" "04214" "00411170" "00000" "Familial, autosomal dominant" "" "sectorial type RP, with involvement of the inferior half of the fundus in all affected members and with no or only mild pigmentary changes occurring along the vascular arcades above the midline; visual field loss corresponded to the altitudinal distribution of the retinal pigmentary changes, maintaining a central island of 5deg to 10deg and also an arc of inferior visual field between about 20deg and 60deg from fixation; dark adaptation: abnormal, elevation of rod thresholds by between 2 and 3.5 log units when the less-affected superior retina (30deg above the fovea) was stimulated, dark adaptation thresholds were 1 log unit lower than when the more affected paracentral retina had test stimuli presented; visual acuity of 20/30 (6/9), 20/200 (6/60) due to macular involvement (67y); electroretinography: recordable traces, with a greater decrease of b-wave amplitudes for photopic testing than for scotopic testing" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303252" "04214" "00411171" "00000" "Familial, autosomal dominant" "43y" "sectorial type RP, with involvement of the inferior half of the fundus and with moderate pigmentary changes occurring along the vascular arcades above the midline 40y; most severely affected; visual field loss corresponded to the altitudinal distribution of the retinal pigmentary changes, maintaining a central island of 5deg to 10deg and also an arc of inferior visual field between about 20deg and 60deg from fixation; dark adaptation: abnormal, elevation of rod thresholds by between 2 and 3.5 log units, when the less-affected superior retina (30deg above the fovea) was stimulated, dark adaptation thresholds were 1 log unit lower than when the more affected paracentral retina had test stimuli presented; electroretinography: recordable traces, with a greater decrease of b-wave amplitudes for photopic testing than for scotopic testing; 43y photopic and scotopic b-wave implicit times within normal limits, photopic b-wave amplitudes unrecordable in the left eye and only 20% of normal in the right eye; scotopic b-wave amplitudes decreased to 50% of the lower limit of normal in the right eye and to 80% of the lower limit of normal in the left eye; flicker response markedly attenuated" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303253" "04214" "00411172" "00000" "Familial, autosomal dominant" "" "sectorial type RP, with involvement of the inferior half of the fundus in all affected members and with no or only mild pigmentary changes occurring along the vascular arcades above the midline; visual field loss corresponded to the altitudinal distribution of the retinal pigmentary changes, maintaining a central island of 5deg to 10deg and also an arc of inferior visual field between about 20deg and 60deg from fixation; dark adaptation: abnormal, elevation of rod thresholds by between 2 and 3.5 log units, when the less-affected superior retina (30deg above the fovea) was stimulated, dark adaptation thresholds were 1 log unit lower than when the more affected paracentral retina had test stimuli presented; electroretinography: recordable traces, with a greater decrease of b-wave amplitudes for photopic testing than for scotopic testing; normal b-wave implicit times, with only mildly decreased amplitudes, scotopic b-wave amplitudes at the lower limit of normal in the left eye and 75% of the lower normal limit in the right eye; photopic b-wave amplitude 60% of the lower normal limit in the right eye and 80% of the lower limit in the left eye; flicker response: normal" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303276" "04214" "00411200" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303277" "04214" "00411201" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303278" "04214" "00411202" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303279" "04214" "00411203" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303280" "04214" "00411204" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303281" "04214" "00411205" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303282" "04214" "00411206" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303283" "04214" "00411207" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303284" "04214" "00411208" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303285" "04214" "00411209" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303286" "04214" "00411210" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303287" "04214" "00411211" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303288" "04214" "00411212" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303289" "04214" "00411213" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303290" "04214" "00411214" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303291" "04214" "00411215" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303292" "04214" "00411216" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303293" "04214" "00411217" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303294" "04214" "00411218" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303295" "04214" "00411219" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303296" "04214" "00411220" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303297" "04214" "00411221" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303298" "04214" "00411222" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303299" "04214" "00411223" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303300" "04214" "00411224" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303301" "04214" "00411225" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303302" "04214" "00411226" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303303" "04214" "00411227" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303304" "04214" "00411228" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303305" "04214" "00411229" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303306" "04214" "00411230" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303307" "04214" "00411231" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303308" "04214" "00411232" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303309" "04214" "00411233" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303310" "04214" "00411234" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303311" "04214" "00411235" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303312" "04214" "00411236" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303313" "04214" "00411237" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303314" "04214" "00411238" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303315" "04214" "00411239" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303316" "04214" "00411240" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303317" "04214" "00411241" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303318" "04214" "00411242" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303319" "04214" "00411243" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303320" "04214" "00411244" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303321" "04214" "00411245" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303322" "04214" "00411246" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303323" "04214" "00411247" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303324" "04214" "00411248" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303325" "04214" "00411249" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303326" "04214" "00411250" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303327" "04214" "00411251" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303328" "04214" "00411252" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303329" "04214" "00411253" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303330" "04214" "00411254" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303331" "04214" "00411255" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303333" "04214" "00411257" "00000" "Familial, autosomal dominant" "63y" "typical funduscopic features of retinitis pigmentosa, all testing was conducted in the better seeing (20/60) eye; visual field diameter: 15 degrees and the final dark-adapted threshold elevated by 4.6 log units; full-field electroretinograms: rod responses not detectable; cone b-wave implicit times: significantly delayed" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303334" "04214" "00411258" "00000" "Familial, autosomal dominant" "41y" "severe amblyopia left eye, best corrected visual acuity right, left eye: 20/60, counting fingers; visual field constriction noticed 11y, diagnosis of retinitis pigmentosa 17y based on attenuated vessels and pigmentary abnormalities; 31y: cataract surgery with an intraocular lens implant in the right eye. 40y: visual field (IV4e isopter) 10 degrees in diameter, visual threshold following 45 min of dark adaptation elevated by 3.0 log units; scattered bone-spicule pigment and marked arteriolar attenuation in both eyes; full-field electroretinograms: rod responses not detectable; cone b-wave implicit times: significantly delayed" "11y" "17y" "visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303335" "04214" "00411259" "00000" "Familial, autosomal dominant" "13y" "normal fundus appearance, 20/25 visual acuity; primary complaint - night-blindness, with an elevation in final dark-adapted visual threshold of 1.23 log units; visual fields constricted to 80 degrees diameter; full-field electroretinograms: rod responses not detectable; cone b-wave implicit times: significantly delayed; average yearly rate of amplitude loss for young members of family RFS04 ranged from 25% for the maximal response to 29% for the 30 Hz flicker response" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303336" "04214" "00411260" "00000" "Familial, autosomal dominant" "10y" "normal fundus appearance and, 20/25 visual acuity; visual field constricted to 90 degrees diameter final dark-adapted visual threshold: elevated 0.9 log unit; full-field electroretinograms: rod responses borderline detectable (3.0 pV); cone b-wave implicit times: significantly delayed; average yearly rate of amplitude loss for young members of family RFS04 ranged from 25% for the maximal response to 29% for the 30 Hz flicker response" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303340" "04214" "00411265" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303341" "04214" "00411266" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303342" "04214" "00411267" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303343" "04214" "00411268" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303344" "04214" "00411269" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303354" "04214" "00411278" "00000" "Familial, autosomal dominant" "54y" "best corrected visual acuity right, left eye: 6/24, 6/18; lenses: clear; fundus: bilateral waxy disc pallor, retinal vascular narrowing, midperipheral bone-spicule changes" "12y" "" "loss of night vision and peripheral vision" "M" "" "" "" "" "retinitis pigmentosa" "" "" "0000303355" "04214" "00411279" "00000" "Familial, autosomal dominant" "34y" "never able to see in the dark; reduced side vision by 10y; best corrected visual acuity right, left eye: 6/18, 6/36; mild posterior subcapsular lens changes; fundi: the optic discs pale and the retinal blood vessels narrow, midperipheral bone-spicule changes prominent" "" "" "nyctalopia" "M" "" "" "" "" "retinitis pigmentosa" "" "" "0000303356" "04214" "00411280" "00000" "Familial, autosomal dominant" "33y" "poor night vision as long as she could remember; no reduced peripheral vision; best corrected visual acuity right, left eye: 6/12, 6/9; visual fields: markedly constricted; lenses clear in both eyes; optic discs pale, retinal vessels attenuated, midperipheral retinal bone-spicule changes" "" "" "poor night vision" "F" "" "" "" "" "retinitis pigmentosa" "" "" "0000303357" "04214" "00411281" "00000" "Familial, autosomal dominant" "52y" "reduced peripheral vision in mid-20s; best corrected visual acuity right, left eye: 6/9, 6/6; anterior segment: normal, fundus: pallor of the optic discs, narrowing of retinal vessels, midperipheral intraretinal bone-spicule pigmentation" ">12y" "" "mild difficulty seeing at night" "F" "" "" "" "" "retinitis pigmentosa" "" "" "0000303358" "04214" "00411282" "00000" "Familial, autosomal dominant" "26y" "asymptomatic; visual acuity of 6/6 both eyes; anterior segments and fundi: normal" "" "" "" "F" "" "" "" "" "retinitis pigmentosa" "" "" "0000303359" "04214" "00411283" "00000" "Familial, autosomal dominant" "21y" "20y: mild constriction of her peripheral vision; childhood: esotropia resulting in mild amblyopia of the left eye; v best corrected visual acuity right, left eye: 6/5, 6/9; anterior segment: normal in each eye; fundi: changes limited to an irregular appearance of the retinal pigment epithelium in the midperiphery" ">12y" "" "difficulty seeing in the dark" "F" "" "" "" "" "retinitis pigmentosa" "" "" "0000303362" "04214" "00411286" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303363" "04214" "00411287" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303364" "04214" "00411288" "00000" "Familial, autosomal dominant" "" "presented 7 years ago with a 20 year history of night blindness, which had increased in severity in the past 5 years; back then, good central vision in each eye, 6/6, early retinal and visual field changes; electroretinography: normal photopic signal, but a markedly abnormal scotopic signal; recently, retention of central vision, with a progression of fundus changes and very marked constriction of visual fields (approximately 15 degrees in each eye); electroretinography photopic reduced to approximately 60% of normal, scotopic below 10% of normal" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303365" "04214" "00411289" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303366" "04214" "00411290" "00000" "Familial, autosomal dominant" "64y" "sectoral RP with a later age of onset; presented 6 years ago (58y) at a general ophthalmic clinic after referral from her general practitioner, complaining of hazy vision in both eyes; best corrected visual acuity right, left eye: 6/9, 6/12; fundus: sector RP affecting the inferior fundus, particularly along the inferotemporal vessels; visual field changes corresponded with this in that there was a marked loss of vision in the upper field in each eye; photopic electroretinogram right, left eye: 43%, 37% of normal, scotopic ERG 41%, 29% of normal in right and left eyes respectively" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303367" "04214" "00411291" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function; similar features to the mother, affecting the lower fundus" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303368" "04214" "00411292" "00000" "Familial, autosomal dominant" "28y" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function; 25y: divergent squint, some visual field defect and difficulty in dark conditions on close questioning; best corrected visual acuity right, left eye: 6/9, 6/18 classic fundus appearance of RP with markedly constricted fields to less than 10 degrees in each eye; electroretinogram: flat photopic responses and a flat left scotopic, with a small response (10% of normal) in right scotopic; marked hypermetropia with a moderate degree of astigmatism" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303369" "04214" "00411293" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303370" "04214" "00411294" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303371" "04214" "00411295" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303372" "04214" "00411296" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303373" "04214" "00411297" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303374" "04214" "00411298" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303375" "04214" "00411299" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303376" "04214" "00411300" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303377" "04214" "00411301" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303378" "04214" "00411302" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function, 12y: flat responses; best corrected visual acuity both eyes: 6/18; marked constriction of visual fields (approximately 10 degrees) in each eye" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303379" "04214" "00411303" "00000" "Familial, autosomal dominant" "" "night blindnesss (disease onset) in late childhood with preservation of central vision into the third or fourth decade; typical field losses, atrophic retinal pigment epithelial changes with characteristic bone spicule pigmentation; electroretinography: grossly reduced rod and cone function" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303380" "04214" "00411304" "00000" "Familial, autosomal dominant" "" "mild difficulty seeing at night in early teens; family description: regional distribution of photoreceptor cell degeneration of both rods and cones in the same region of the retina together with variation in the age of onset and severity of symptoms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303381" "04214" "00411305" "00000" "Familial, autosomal dominant" "26y" "asymptomatic; family description: regional distribution of photoreceptor cell degeneration of both rods and cones in the same region of the retina together with variation in the age of onset and severity of symptoms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303382" "04214" "00411306" "00000" "Familial, autosomal dominant" "21y" "difficulty seeing at night in her early teens, and more recently constriction of visual fields; family description: regional distribution of photoreceptor cell degeneration of both rods and cones in the same region of the retina together with variation in the age of onset and severity of symptoms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303383" "04214" "00411307" "00000" "Familial, autosomal dominant" "39y" "23y: best corrected visual acuity 20/70 both eyes; ophthalmoscopy: retinal pigmentation sparse, typical bone spicule appearance predominantly in the inferior midperipheral retina; cystoid macular edema both eyes; fluorescein angiography showed pooling of dye in the cystoid spaces; electroretinogram: non-recordable rod response and reduction in cone response with implicit time; dark adaptation test: biphasic pattern with elevated rod and cone thresholds; 38y: best corrected visual acuity: 20/200, ophthalmoscopy: heavy asteroid hyalosis in the right eye, pigmentation increased in all quadrants of both eyes; predominant loss of field within the superior visual field, as well as a progressive loss of the inferior field, retaining only a small central island" "10y" "10y" "poor night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303384" "04214" "00411308" "00000" "Familial, autosomal dominant" "" "primarily a loss of scotopic rod function progressing on to a loss of cone function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303385" "04214" "00411309" "00000" "Familial, autosomal dominant" "" "RP sine pigmento" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303386" "04214" "00411310" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303387" "04214" "00411311" "00000" "Familial, autosomal dominant" "" "whole family description: onset of the disease by the middle of the second decade with night blindness and progressive reduction of the visual field resulting in an extreme constriction to tunnel vision at the age of 40y; by the third decade extinguished electroretinographic responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303388" "04214" "00411312" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303389" "04214" "00411313" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303390" "04214" "00411314" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303391" "04214" "00411315" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303392" "04214" "00411316" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303393" "04214" "00411317" "00000" "Familial, autosomal recessive" "" "whole family description: fundus picture typical of RP and extinguished photopic and scotopic electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303394" "04214" "00411318" "00000" "Familial, autosomal recessive" "" "whole family description: fundus picture typical of RP and extinguished photopic and scotopic electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303395" "04214" "00411319" "00000" "Familial, autosomal recessive" "" "whole family description: fundus picture typical of RP and extinguished photopic and scotopic electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303396" "04214" "00411320" "00000" "Familial, autosomal recessive" "" "whole family description: fundus picture typical of RP and extinguished photopic and scotopic electroretinograms" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303407" "04214" "00411368" "00000" "Familial, autosomal dominant" "31y" "best corrected visual acuity right, left eye: 20/30, 20/40; refraction right, left eye: plano -0.50 X 90, plano -0.75 X 90; appearance: cystoid macular edema, posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 55; kinetic visual field extent, I4e (% normal): 2; average rod sensitivity loss (dB): >47; average cone sensitivity loss (dB): 15.7" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303408" "04214" "00411369" "00000" "Familial, autosomal dominant" "29y" "best corrected visual acuity right, left eye: 20/40, 20/800; refraction right, left eye: -2.0; -0.75 x 170; appearance: cystoid macular edema, posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 25; kinetic visual field extent, I4e (% normal): 2; average rod sensitivity loss (dB): >47; average cone sensitivity loss (dB): 14.8" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303409" "04214" "00411370" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity right, left eye: 20/32, 20/32; refraction right, left eye: -0.50; -0.75 x 90, -0.50; -0.75 x 90; appearance: diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 14; kinetic visual field extent, I4e (% normal): 2; average rod and cone sensitivity loss (dB): not determined" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303410" "04214" "00411371" "00000" "Familial, autosomal dominant" "26y" "best corrected visual acuity right, left eye: 20/50, 20/62; refraction right, left eye: -1.0; -1.75 x 160, -0.50; -1.50 x 80; appearance: cystoid macular edema, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 4; kinetic visual field extent, I4e (% normal): 2; average rod and cone sensitivity loss (dB): not determined" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303411" "04214" "00411372" "00000" "Familial, autosomal dominant" "66y" "best corrected visual acuity right, left eye: 20/800, 20/800; refraction right, left eye: unmeasurable due to severe visual loss; appearance: cystoid macular edema, posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e and I4e (% normal): unmeasurable due to severe visual loss; average rod and cone sensitivity loss (dB): unmeasurable due to severe visual loss" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303412" "04214" "00411373" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity right, left eye: 20/25, 20/25; refraction right, left eye: plano -0.50 X 90, plano -0.50 X 90; appearance: posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 64; kinetic visual field extent, I4e (% normal): 5; average rod sensitivity loss (dB): >47; average cone sensitivity loss (dB): 13.3" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303413" "04214" "00411374" "00000" "Familial, autosomal dominant" "18y" "best corrected visual acuity right, left eye: 20/25, 20/25; refraction right, left eye: 1.00; -1.25 x 90, -0.50; -1.50 x 90; appearance: diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): normal; kinetic visual field extent, I4e (% normal): 19; average rod sensitivity loss (dB): >47; average cone sensitivity loss (dB): 8.1" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303414" "04214" "00411375" "00000" "Familial, autosomal dominant" "16y" "best corrected visual acuity right, left eye: 20/25, 20/25; refraction right, left eye: -0.75; -1.25 x 90, -0.75; -0.75 x 95; appearance: diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 68; kinetic visual field extent, I4e (% normal): 16; average rod sensitivity loss (dB): 36.l; average cone sensitivity loss (dB): 8.9" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303415" "04214" "00411376" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right, left eye: 20/60, 20/40; refraction right, left eye: -0.75; -1.50 x 80, -1.00; -2.00 X 90; appearance: cystoid macular edema, posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 35; kinetic visual field extent, I4e (% normal): 5; average rod and cone sensitivity loss (dB): not determined; average cone sensitivity loss (dB): 11.6" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303416" "04214" "00411377" "00000" "Familial, autosomal dominant" "30y" "best corrected visual acuity right, left eye: 20/20, 20/20; refraction right, left eye: -0.50; -1.00, -0.50; -0.50 x 25; appearance: cystoid macular edema, posterior subcapsular lens opacity, diffuse four quadrant bone spicule-like pigmentary changes; kinetic visual field extent, V4e (% normal): 6; kinetic visual field extent, I4e (% normal): 2; average rod and cone sensitivity loss (dB): not determined" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303420" "04214" "00411380" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303421" "04214" "00411381" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303422" "04214" "00411382" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303423" "04214" "00411383" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303424" "04214" "00411384" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303425" "04214" "00411385" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303426" "04214" "00411386" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303427" "04214" "00411387" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303428" "04214" "00411388" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303429" "04214" "00411389" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303430" "04214" "00411390" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303431" "04214" "00411391" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303432" "04214" "00411392" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303433" "04214" "00411393" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303434" "04214" "00411394" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303435" "04214" "00411395" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303436" "04214" "00411396" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303437" "04214" "00411397" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303438" "04214" "00411398" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303439" "04214" "00411399" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303440" "04214" "00411400" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303441" "04214" "00411401" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303442" "04214" "00411402" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303443" "04214" "00411403" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303444" "04214" "00411404" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303445" "04214" "00411405" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303446" "04214" "00411406" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303447" "04214" "00411407" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303448" "04214" "00411408" "00000" "Familial, autosomal dominant" "" "asymptomatic" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303449" "04214" "00411409" "00000" "Familial, autosomal dominant" "" "asymptomatic" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303451" "04214" "00411411" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303452" "04214" "00411412" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303456" "04214" "00411417" "00000" "Isolated (sporadic)" "50y" "progressive construction of the visual field in the third decade of life; 49y: a non-recordable rod electroretinogram; visual acuity: < 0.1 in both eyes; bilateral posterior subcapsular cataracts; fundus: narrowing of the retinal arteries, diffuse bone spicule pigmentations affecting both maculae, and bilateral disc pallor; visual fields: not recordable because of absolute scotoma" ">10y" "" "difficulties with night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303459" "04214" "00411419" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303460" "04214" "00411420" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303461" "04214" "00411421" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303467" "04214" "00411427" "00000" "Familial, autosomal dominant" "28y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303468" "04214" "00411428" "00000" "Familial, autosomal dominant" "45y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303469" "04214" "00411429" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303470" "04214" "00411430" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303471" "04214" "00411431" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303472" "04214" "00411432" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303473" "04214" "00411433" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303474" "04214" "00411437" "00000" "Familial, autosomal dominant" "57y" "bilaterally aphakic from cataract surgery at 2y; stopped driving at 29y due to visual field and acuity losses; 57y: both retinas showed extensive peripheral atrophy, but with a very modest amount of bone spicule pigment accumulation; both maculae had atrophic central lesions with pigment clumping; visual acuity: 20/200 in both eyes; visual field: only the large V4e Goldmann target -10deg diameter fields in both eyes; absolute thresholds elevated greater than 5.5 log units in both eyes, electroretinogram: amplitudes: >99% reduced for all stimulus conditions" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303475" "04214" "00411438" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303476" "04214" "00411439" "00000" "Familial, autosomal dominant" "51y" "marked loss of electroretinogram responses indicated extensive and widespread impairment of retinal function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303477" "04214" "00411440" "00000" "Familial, autosomal dominant" "44y" "better visual acuity, visual fields, ERG, and absolute thresholds than did three younger affected relatives, ranging from 22-38y; able to see stars at 5y but had lost this ability by 8y; stopped driving automobile at 42y; fundus: typical RP hallmarks, with constricted nasal and temporal retinal vessels, early waxy disc pallor, and peripheral retinal pigment epithelium granularity but with only sparse intraretinal bone spicule pigment accumulation; electroretinogram: largest responses, but nevertheless reduced more than 95% under photopic conditions; scotopic : no rod response" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303478" "04214" "00411441" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303479" "04214" "00411442" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303480" "04214" "00411443" "00000" "Familial, autosomal dominant" "42y" "7y: alternating esotropia; bilateral medial rectus muscle recession; visual acuity: of 20/25 in both eyes; very blond fundus showing choroidal vessels, other ocular features normal; 10y: marked constriction of the retinal vessels and the presence of a few vitreous cells; prominent pattern of choroidal vessels; bone spicule pigment not present in either eye; 12y: tangent screen testing: visual fields constricted to 20deg using a 6/1000 white target; visual acuities of20/25 yearly for both eyes until 18y, the visual acuity: 20/30, optic disc pallor, pigment epithelium irregular in the macula and granular in the periphery; visual fields tested periodically 12-18y: no changes; 21y: bone spicule pigmentation in the peripheral fundus of both eyes; 35y ��� recalled early onset of night blindness and reported progressive visual field loss early which had slowed in subsequent years; visual acuities: 20/60 in both eyes; anterior segments: normal, lenses: clear; fundi:\"\"waxy pallor\"\" of the nerve head, and the optic cup was completely filled with gliotic material, retinal vessels markedly constricted in both nasal and temporal retina; macula: fine retinal pigment epithelial (RPE) granularity, RPE in the periphery: diffuse atrophy with reticular patchy whiteness; accumulation of intraretinal pigment: very sparse; Goldmann visual fields right/left eye: 25deg / 10deg using the large V4e target; the patient could not see the I14e target with the right eye nor the III4e target with the left eye. Dark-adapted thresholds: elevated more than 5.5 log units in the right eye and 4.4 log units in the left eye, recordable only at fixation. electroretinogram responses: more than 99% amplitude reduction under all test conditions, no discernible responses for either dark or light-adapted conditions using standard stimuli 39y: visual acuities unchanged, tiny posterior supcapsular cataract. Goldmann perimetry showed further field constriction to approximately 12deg in the right eye and 7deg in the left eye with the V4e target; marked loss of electroretinogram responses indicated extensive and widespread impairment of retinal function" "7y" "10y" "strabismus" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303481" "04214" "00411444" "00000" "Familial, autosomal dominant" "" "sparse accumulation of intraretinal pigment; remarkable feature was the extensive peripheral retinal pigment epithelium atrophy; marked loss of electroretinogram responses indicated extensive and widespread impairment of retinal function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303482" "04214" "00411445" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303483" "04214" "00411446" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303484" "04214" "00411447" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303485" "04214" "00411448" "00000" "Familial, autosomal dominant" "22y" "sparse accumulation of intraretinal pigment; remarkable feature was the extensive peripheral retinal pigment epithelium atrophy; marked loss of electroretinogram responses indicated extensive and widespread impairment of retinal function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303486" "04214" "00411449" "00000" "Familial, autosomal dominant" "6y" "visual fields constricted to 20deg with the Goldmann I4e target, but fields remained full for the V4e target; visual acuities: 20/30 in both eyes; fundi: minimal but definite changes; optic nerve: early \"\"waxy pallor.\"\" Nasal retinal vessels: constricted, temporal vessels: nearly normal. Early pigmentary changes gave a granular appearance to the RPE, no accumulation of intraretinal pigmentary spicules or clumping. The foveal reflex intact" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303496" "04214" "00411459" "00000" "Familial, autosomal dominant" "64y" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; individual: visual fields: I4e constricted to 250deg" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303497" "04214" "00411460" "00000" "Familial, autosomal dominant" "63y" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; individual: fundus clinical changes present only minimally (outer retinal atrophy, \"\"bone-spicule\"\" intraretinal pigment, \"\"waxy\"\" optic nervehead pallor, attenuated arterioles); visual fields minimally constricted (1100 diameter)" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303498" "04214" "00411461" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303499" "04214" "00411462" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303500" "04214" "00411463" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303501" "04214" "00411464" "00000" "Familial, autosomal dominant" "38y" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; clinically normal retinae; peripheral retinal pigmentary changes; individual: I4e visual fields constricted to 80deg" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303502" "04214" "00411465" "00000" "Familial, autosomal dominant" "" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; individual: clinically normal retinae; visual fields (Goldmann perimetry, I4e white 0.25-mm2 target) full (>1300 horizontal diameter" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303503" "04214" "00411466" "00000" "Familial, autosomal dominant" "" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; no change of threshold after 12 hr in darkness; individual: clinically normal retinae; visual fields (Goldmann perimetry, I4e white 0.25-mm2 target) full (>1300 horizontal diameter" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303504" "04214" "00411467" "00000" "Familial, autosomal dominant" "" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; individual: clinically normal retinae; visual fields (Goldmann perimetry, I4e white 0.25-mm2 target) full (>1300 horizontal diameter" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303505" "04214" "00411468" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303506" "04214" "00411469" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303507" "04214" "00411470" "00000" "Familial, autosomal dominant" "11y" "whole family description: extensive night blindness from youngest years, which did not worsen with age; no persistent after images, phosphenes, or other visual disturbances in the dark; seven affected members, ages 11-64 evaluated clinically had normal 6/6 acuity and normal color discrimination (Farnsworth Panel D-15 panel), dark-adapted thresholds elevated by -3 logarithmic units (Goldmann-Weekers Darkadaptometer) with a blue (440-nm, 70-nm half bandwidth) stimulus of 5.7deg visual angle presented repetitively for 800 msec to central and peripheral retinal positions; individual: clinically normal retinae; visual fields (Goldmann perimetry, I4e white 0.25-mm2 target) full (>1300 horizontal diameter" "" "" "" "" "" "" "" "" "blindness, night, stationary, congenital, autosomal dominant, type 1 (CSNBAD-1)" "" "" "0000303508" "04214" "00411471" "00000" "Familial, autosomal dominant" "79y" "asymptomatic, not tested clinically" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303509" "04214" "00411472" "00000" "Familial, autosomal dominant" "" "retinitis punctata albescens (white dots deep in the retina and associated with findings typical of retinitis pigmentosa; optic nerve drusen; posterior subcapsular opacification" "" "" "" "" "" "" "" "" "fundus albipunctatus (retinitis punctata albescens (RPA))" "" "" "0000303510" "04214" "00411473" "00000" "Familial, autosomal dominant" "" "fundus: classic retinitis pigmentosa but without albescent features; posterior subcapsular opacification" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303511" "04214" "00411474" "00000" "Familial, autosomal dominant" "" "retinitis punctata albescens (white dots deep in the retina and associated with findings typical of retinitis pigmentosa, optic nerve drusen; posterior subcapsular opacification" "" "" "" "" "" "" "" "" "fundus albipunctatus (retinitis punctata albescens (RPA))" "" "" "0000303512" "04214" "00411475" "00000" "Familial, autosomal dominant" "" "retinitis punctata albescens (white dots deep in the retina and associated with findings typical of retinitis pigmentosa, optic nerve drusen; posterior subcapsular opacification" "" "" "" "" "" "" "" "" "fundus albipunctatus (retinitis punctata albescens (RPA))" "" "" "0000303513" "04214" "00411476" "00000" "Familial, autosomal dominant" "42y" "asymptomatic; no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: absent; fundus: normal; electroretinogram: normal; no cataract; other symptoms: none" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303514" "04214" "00411477" "00000" "Familial, autosomal dominant" "46y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: normal; electroretinogram: normal; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303515" "04214" "00411478" "00000" "Familial, autosomal dominant" "48y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - small white spots on atrophic areas of the retina are present in some regions; electroretinogram: decreased amplitude in rod ERG; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303516" "04214" "00411479" "00000" "Familial, autosomal dominant" "52y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - retinal parenchyma displays prominent choroidal vessels in a dark normal fundus; electroretinogram: normal; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303517" "04214" "00411480" "00000" "Familial, autosomal dominant" "45y" "night blindness; best corrected visual acuity right, left eye: 0.2, 0.3; visual field constriction: severe (10deg); fundus: typical RP appearance; electroretinogram: extinguished; cataract: (>40y); other symptoms:" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303518" "04214" "00411481" "00000" "Familial, autosomal dominant" "22y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - retinal parenchyma displays prominent choroidal vessels in a dark normal fundus; electroretinogram: normal; no cataract; other symptoms: strabism" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303519" "04214" "00411482" "00000" "Familial, autosomal dominant" "19y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: normal; electroretinogram: normal; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303520" "04214" "00411483" "00000" "Familial, autosomal dominant" "16y" "asymptomatic; no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: absent; fundus: normal; electroretinogram: normal; no cataract; other symptoms: strabism" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303521" "04214" "00411484" "00000" "Familial, autosomal dominant" "28y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - small white spots on atrophic areas of the retina are present in some regions; electroretinogram: decreased amplitude in rod ERG; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303522" "04214" "00411485" "00000" "Familial, autosomal dominant" "" "not clinically tested" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303523" "04214" "00411486" "00000" "Familial, autosomal dominant" "26y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: severe; fundus: atypical - pigmentary deposits in upper temporal sector of righ eye and some narrowing of the vessels; electroretinogram: decreased amplitude in rod ERG; no cataract; other symptoms: strabism" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303524" "04214" "00411487" "00000" "Familial, autosomal dominant" "24y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - small white spots on atrophic areas of the retina are present in some regions; electroretinogram: normal; no cataract; other symptoms: strabism" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303525" "04214" "00411488" "00000" "Familial, autosomal dominant" "19y" "no night blindness; best corrected visual acuity right, left eye: 1, 1; visual field constriction: present; fundus: atypical - small white spots on atrophic areas of the retina are present in some regions; electroretinogram: decreased amplitude in rod ERG, increased latency in rod ERG; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303526" "04214" "00411489" "00000" "Familial, autosomal dominant" "20y" "night blindness; best corrected visual acuity right, left eye: 0.8, 0.9; visual field constriction: severe; fundus: typical RP appearance; electroretinogram: extinguished; no cataract; other symptoms: none" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303527" "04214" "00411490" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303528" "04214" "00411491" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303529" "04214" "00411492" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303530" "04214" "00411493" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303531" "04214" "00411494" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303532" "04214" "00411495" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303534" "04214" "00411497" "00000" "Familial, autosomal dominant" "34y" "late onset mild autosomal dominant retinitis pigmentosa; characteristic pigmentary deposits in fundi with normal electroretinogram, indicating a well-preserved photoreceptor function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303535" "04214" "00411498" "00000" "Familial, autosomal dominant" "42y" "late onset mild autosomal dominant retinitis pigmentosa; characteristic pigmentary deposits in fundi with normal electroretinogram, indicating a well-preserved photoreceptor function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303536" "04214" "00411499" "00000" "Familial, autosomal dominant" "43y" "late onset mild autosomal dominant retinitis pigmentosa; characteristic pigmentary deposits in fundi with normal electroretinogram, indicating a well-preserved photoreceptor function" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303537" "04214" "00411500" "00000" "Familial, autosomal dominant" "75y" "late onset mild autosomal dominant retinitis pigmentosa; RP in advanced stage" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303539" "04214" "00411502" "00000" "Familial, autosomal dominant" "" "" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303540" "04214" "00411503" "00000" "Familial, autosomal dominant" "77y" "42y: largely constricted visual fields; visual acuity of 6/30 in both eyes; 71y: major difficulties in reading/writing; serious photoaversion; visual acuity: 6/30 (refraction: 0.00 - 3.50 x 180deg) right eye, 3/60 (+0.75-3.00 x 10deg) left eye; posterior subcapsular cataracts in both eyes; wax-pale optic discs, extremely attenuated vessels; macular area: diffusely hyperpigmented, contrasting with the surrounding yellowish retinal color - Bull\'seye retinopathy occupied the right foveal area, paracentrally situated round pigment epithelial atrophy in the left eye; around the papilla and outside the vascular arcades profuse scattered dark dots and clumps; only a few bone spicule-like pigmentations; visual fields reduced to 5deg tunnel vision right eye and 5-7deg left eye; no peripheral field areas remained; dark adaptation: attenuated cone adaptation followed by a distinct break after which a further one log reduction in the threshold took place, after 15 minutes, the threshold was elevated by 3 log units, to 3 x 10-3 cd/m2; electroretinogram: nonrecordable; 77y: cataract was successfdly removed from the right eye; visual acuity: 6/24 with 4- 5deg of visual field in the right eye and hand movements in the left eye due to cataract; father had suffered from nightblindness, had an extremely constricted visual field for many years before he became totally blind at the age of 60y, affected sister not tested; unaffaected son without mutation" "42y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303543" "04214" "00411506" "00000" "Familial, autosomal dominant" "" "no clinical data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303544" "04214" "00411507" "00000" "Familial, autosomal dominant" "41y" "best corrected visual acuity right, left eye: 0.1, hand movement; posterior subcapsular cataract both eyes:intraocular lens; vitreous both eyes: -; disc right/left eye: temporal atrophy, diffuse atrophy; vessels: -; pigmentation morphology: typical bone spicule; pigmentation grading: confluent; macula appearance: altered; Visual field (area, %) I4 right/left eye: -/not available, V4 right/left eye: 2.8/not available; rod electroretinogram: b amplitude both eyes: not recordable; rod electroretinogram: b amplitude maximal response both eyes: not recordable, \"\"a\"\" peak both eyes: -, \"\"b\"\" peak both eyes: -, cone 30-Hz amplitude both eyes: not recordable" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303545" "04214" "00411508" "00000" "Familial, autosomal dominant" "" "no clinical data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303546" "04214" "00411509" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right, left eye: 0.4, 0.6; posterior subcapsular cataract both eyes:intraocular lens; vitreous: pigmentary particules; disc right/left eye: temporal atrophy, temporal atrophy; vessels: thread-like appearance; pigmentation morphology: typical bone spicule; pigmentation grading: diffuse and thick; macula appearance: altered; Visual field (area, %) I4 right/left eye: < 1.0/< 1.0, V4 right/left eye: 4.8/3.3; rod electroretinogram: b amplitude both eyes: not recordable; rod electroretinogram: b amplitude maximal response both eyes: not recordable, \"\"a\"\" peak both eyes: -, \"\"b\"\" peak both eyes: -, cone 30-Hz amplitude both eyes: not recordable" "6y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303547" "04214" "00411510" "00000" "Familial, autosomal dominant" "17y" "17y: best corrected visual acuity right, left eye: 1, 0.7; posterior subcapsular cataract both eyes:none; vitreous: pigmentary particules; disc right/left eye: waxy pallor, waxy pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thin; macula appearance: normal; Visual field (area, %) I4 right/left eye: 1.8/1.3, V4 right/left eye: 26.7/25.2; rod electroretinogram: b amplitude both eyes: not available; rod electroretinogram: b amplitude maximal response right/left eye: 12.75/13.75, \"\"a\"\" peak right/left eye: 16/23, \"\"b\"\" peak right/left eye: 43/51, cone 30-Hz amplitude right/left eye: 2.1/2.1; 18y: best corrected visual acuity right, left eye: 0.9, 0.6; posterior subcapsular cataract both eyes:none; vitreous: pigmentary particules; disc right/left eye: waxy pallor, waxy pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thick; macula appearance: altered; Visual field (area, %) I4 right/left eye: <1.0/< 1.0, V4 right/left eye: 13/10; rod electroretinogram: b amplitude both eyes: not available; rod electroretinogram: b amplitude maximal response right/left eye: 6.5/5.5, \"\"a\"\" peak right/left eye: 24/25, \"\"b\"\" peak right/left eye: 60/59.5, cone 30-Hz amplitude right/left eye: 1.10/1.4" "4y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303548" "04214" "00411511" "00000" "Familial, autosomal dominant" "16y" "16y: best corrected visual acuity right, left eye: 0.7, 0.8; posterior subcapsular cataract both eyes:extension not reaching equator; vitreous: pigmentary particules; disc right/left eye: waxy pallor, waxy pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thick; macula appearance: altered; Visual field (area, %) I4 right/left eye: 3.5/1.7, V4 right/left eye: 71.2/98.8; rod electroretinogram: b amplitude both eyes: not available; rod electroretinogram: b amplitude maximal response both eyes: not available, \"\"a\"\" peak both eyes: : not available/not available, \"\"b\"\" peak both eyes: not available/not available, cone 30-Hz amplitude both eyes: not available/not available; 17y: best corrected visual acuity right, left eye: 0.7, 0.8; posterior subcapsular cataract both eyes:extension not reaching equator; vitreous: pigmentary particules; disc right/left eye: waxy pallor, waxy pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thick; macula appearance: altered; Visual field (area, %) I4 right/left eye: 1.2/< 1.0, V4 right/left eye: 56.5/49.5; rod electroretinogram: b amplitude both eyes: not available; rod electroretinogram: b amplitude maximal response right/left eye: 10/11.5, \"\"a\"\" peak right/left eye: 23/20, \"\"b\"\" peak right/left eye: 57.5/58.5, cone 30-Hz amplitude right/left eye: not recordable/1.08" "4y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303549" "04214" "00411512" "00000" "Familial, autosomal dominant" "8y" "best corrected visual acuity right, left eye: 0.5, 0.5; posterior subcapsular cataract both eyes:none; vitreous: non-pigmented particules; disc right/left eye: mild pallor, mild pallor; vessels: mild attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thin; macula appearance: normal; Visual field (area, %) I4 right/left eye: not available/not available, V4 right/left eye: not available/not available; rod electroretinogram: b amplitude both eyes: not available; rod electroretinogram: b amplitude maximal response both eyes: not available, \"\"a\"\" peak both eyes: not available/not available, \"\"b\"\" peak both eyes: not available/not available, cone 30-Hz amplitude both eyes: not available/not available" "4y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303550" "04214" "00411513" "00000" "Familial, autosomal dominant" "" "no clinical data" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303551" "04214" "00411514" "00000" "Familial, autosomal dominant" "10y" "best corrected visual acuity right, left eye: 1, 0.9; posterior subcapsular cataract both eyes:none; vitreous: pigmentary particules; disc right/left eye: waxy pallor, waxy pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thick; macula appearance: normal; Visual field (area, %) I4 right/left eye: 3.3/3, V4 right/left eye: 31.8/26.7; rod electroretinogram: b amplitude both eyes: 4; rod electroretinogram: b amplitude maximal response right/left eye: 14/15, \"\"a\"\" peak right/left eye: 26/29, \"\"b\"\" peak right/left eye: 58/56, cone 30-Hz amplitude right/left eye: 0.5/0.62" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303552" "04214" "00411515" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 1, 0.7; posterior subcapsular cataract both eyes:none; vitreous: no alteration; disc right/left eye: mild pallor, mild pallor; vessels: severe attenuation; pigmentation morphology: typical bone spicule; pigmentation grading: sparse and thin; macula appearance: normal; Visual field (area, %) I4 right/left eye: 2.2/2.4, V4 right/left eye: 11/8.5; rod electroretinogram: b amplitude right/left eye: not recordable/not available; rod electroretinogram: b amplitude maximal response right/left eye: 12.5/not available, \"\"a\"\" peak right/left eye: 29/not available, \"\"b\"\" peak right/left eye: 46/not available, cone 30-Hz amplitude right/left eye: 0.37/not available" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303553" "04214" "00411516" "00000" "Familial, autosomal dominant" "" "whole family desctiption: early onset RP (late teens to early twenties), pattern of degeneration: sectorial type" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303554" "04214" "00411517" "00000" "Familial, autosomal dominant" "76y" "best corrected visual acuity (refraction) right, left eye: 0.1 (+1.75-1/90deg), 0.15 (+1-1.25/62deg); visual field (Goldmann perimetry): tubular field 5deg (V4e target); bone-spicule pigment: all quadrants; macula: macular edema both eyes; retinal vessels: narrow; optic disks: discrete atrophy" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303555" "04214" "00411518" "00000" "Familial, autosomal dominant" "50y" "best corrected visual acuity (refraction) right, left eye: 06 (+2.5-0.5/175deg), 0.8 (+2.25-1/170deg); visual field (Goldmann perimetry): blind spot enlargement (II4e); bone-spicule pigment: none; macula: macular edema both eyes ; retinal vessels: normal; optic disks: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303556" "04214" "00411519" "00000" "Familial, autosomal dominant" "54y" "best corrected visual acuity (refraction) right, left eye: 0.7 (-0.5-0.25/110deg), 0.8 (-0.5-0.25/110deg); visual field (Goldmann perimetry): arciform defects (V4e), relative central scotoma (I4e); bone-spicule pigment: scarce in midperiphery; macula: macular edema both eyes; retinal vessels: mildly narrow; optic disks: drusen right eye" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303557" "04214" "00411520" "00000" "Familial, autosomal dominant" "29y" "best corrected visual acuity (refraction) right, left eye: 1 (-0.5/180deg), 1 (+0.05-1/3deg); visual field (Goldmann perimetry): normal; bone-spicule pigment: none; macula: normal; retinal vessels: normal; optic disks: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303558" "04214" "00411522" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity (refraction) right, left eye: 3/60, 2/60; intra- retinal pigment; optic disc pallor; retinal vessels attenuation; cataract; macular oedema" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303559" "04214" "00411523" "00000" "Familial, autosomal dominant" "16y" "best corrected visual acuity (refraction) right, left eye: 6/18, 6/12; intra- retinal pigment; optic disc pallor; retinal vessels attenuation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303560" "04214" "00411524" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity (refraction) right, left eye: 6/9, 6/18" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303561" "04214" "00411525" "00000" "Familial, autosomal dominant" "20y" "best corrected visual acuity (refraction) right, left eye: counting fingers, counting fingers; intra- retinal pigment; optic disc pallor; retinal vessels attenuation; cataract; macular oedema" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303562" "04214" "00411526" "00000" "Familial, autosomal dominant" "19y" "best corrected visual acuity (refraction) right, left eye: counting fingers, counting fingers; intra- retinal pigment; optic disc pallor; retinal vessels attenuation; cataract; macular oedema" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303563" "04214" "00411527" "00000" "Familial, autosomal dominant" "9y" "best corrected visual acuity (refraction) right, left eye: 6/18, 6/18; optic disc pallor; retinal vessels attenuation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303569" "04214" "00411532" "00000" "Familial, autosomal dominant" "55y" "20y: visual field; 55y: best corrected visual acuity right, left eye: 6/10, 1/ 20; funduscopy: numerous spots of chorioretinal atrophy at the posterior pole with dense, bone spicule-shaped pigments in the midperipheral retina; optic discs pale, retinal vessels greatly attenuated; flurorescein angiography: window defects in the macular area; Goldman perimetry: restriction of the peripheral visual field to 10 deg; electroretinogram: unrecordable; father, paternal uncle, and grandfather as well as two cousins (only cousins genetically tested) affected" "" "" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303570" "04214" "00411533" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303571" "04214" "00411534" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303572" "04214" "00411535" "00000" "Familial, autosomal dominant" "39y" "mild myopia, sectorial RP; visual acuity 10/10 both eyes; fundus: typical bone spicule-shaped pigmentary deposits located only in the lower half of the peripheral retina; Goldman perimetry: loss in the upper half of the visual field; scotopic electroretinogram (ERG) responses noticeably affected, photopic ERG: subnormal; 11- and 8-year-old sons no pigmentary changes in the retina, but subnormal scotopic ERG responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303573" "04214" "00411536" "00000" "Familial, autosomal dominant" "8y" "no pigmentary changes in the retina, but subnormal scotopic electroretinogram responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303574" "04214" "00411537" "00000" "Familial, autosomal dominant" "11y" "no pigmentary changes in the retina, but subnormal scotopic electroretinogram responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303575" "04214" "00411538" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right, left eye: 3/10, 5/10 fundus: typical bone spicule-shaped pigments throughout the peripheral retina; Goldman perimetry: peripheral visual field restriction to 30 deg; electroretinogram: unrecordable; mother and older sister affected" "" "17y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303576" "04214" "00411539" "00000" "Familial, autosomal dominant" "66y" "initially classified as a sporadic case; bad night vision with slow progression" "<8y" "55y" "bad night vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303577" "04214" "00411540" "00000" "Familial, autosomal dominant" "<30y" "asymptomatic" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303578" "04214" "00411541" "00000" "Familial, autosomal dominant" "<30y" "asymptomatic; electroretinogram: rod b-wave amplitude right/left eye: in a subnormal range with values of 14.4/12.8; cone responses: under scotopic conditions, b-wave amplitude: 85/70" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303579" "04214" "00411542" "00000" "Familial, autosomal dominant" "<30y" "asymptomatic; normal electroretinogram" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303580" "04214" "00411543" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303581" "04214" "00411544" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303582" "04214" "00411545" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303585" "04214" "00411554" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303586" "04214" "00411555" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303587" "04214" "00411556" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303588" "04214" "00411557" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303589" "04214" "00411558" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303590" "04214" "00411559" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303591" "04214" "00411560" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303592" "04214" "00411561" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303593" "04214" "00411562" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303594" "04214" "00411563" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303595" "04214" "00411564" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303596" "04214" "00411565" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303597" "04214" "00411566" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303598" "04214" "00411567" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303599" "04214" "00411568" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303600" "04214" "00411569" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303601" "04214" "00411570" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303602" "04214" "00411571" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303603" "04214" "00411572" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303604" "04214" "00411573" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303605" "04214" "00411574" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303606" "04214" "00411575" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303607" "04214" "00411576" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303608" "04214" "00411577" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303609" "04214" "00411578" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303610" "04214" "00411579" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303611" "04214" "00411580" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303612" "04214" "00411584" "00000" "Familial, autosomal dominant" "79y5m" "current best corrected visual acuity right, left eye: 20/70, 20/80; manifest refraction: -1.50 + 2.00 x 180, -1.50 +1.00 x 175; Goldmann perimetry results: Superior loss, inferior constriction; reduction scotopic dim flash electroretinogram,%: 31.8; fundus findings: bone spicule-like pigmentation and atrophy in inferior and nasal distributions of midperiphery" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303613" "04214" "00411585" "00000" "Familial, autosomal dominant" "59y7m" "current best corrected visual acuity right, left eye: 20/20, 20/25; manifest refraction: -1.25 sphere, -0.75 + 0.25 x 028; Goldmann perimetry results: Superior loss with rim; reduction scotopic dim flash electroretinogram,%: 31.3; fundus findings: bone spicule-like pigmentation and atrophy; fundus findings: bone spicule-like pigmentation and atrophy in inferior and nasal distributions of midperiphery" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303614" "04214" "00411586" "00000" "Familial, autosomal dominant" "35y7m" "current best corrected visual acuity right, left eye: 20/20 OU, 20/20; manifest refraction: Plano, ; Goldmann perimetry results: Superior loss with rim; reduction scotopic dim flash electroretinogram,%: 30.2; fundus findings: bone spicule-like pigmentation and atrophy; fundus findings: bone spicule-like pigmentation and atrophy in inferior and nasal distributions of midperiphery" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303615" "04214" "00411587" "00000" "Familial, autosomal dominant" "35y7m" "current best corrected visual acuity right, left eye: 20/20 OU, 20/20; manifest refraction: -0.75 + 0.75 x 155, -0.75 + 0.75 x 055; Goldmann perimetry results: Superior loss with Island; reduction scotopic dim flash electroretinogram,%: 35.4; fundus findings: bone spicule-like pigmentation and atrophy in inferior and nasal distributions of midperiphery" "23y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303616" "04214" "00411588" "00000" "Familial, autosomal dominant" "14y4m" "current best corrected visual acuity right, left eye: 20/20, 20/15; manifest refraction: -1.75 sphere, -1.75 sphere; Goldmann perimetry results: Mild superior constriction; reduction scotopic dim flash electroretinogram,%: 51; fundus findings: retinal pigment epithelium stippling inferior; right eye >left eye" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303617" "04214" "00411589" "00000" "Familial, autosomal dominant" "9y5m" "current best corrected visual acuity right, left eye: 20/20 OU, 20/20; manifest refraction: Plano, ; Goldmann perimetry results: Superior scotoma; reduction scotopic dim flash electroretinogram,%: not available; fundus findings: retinal pigment epithelium clumping and atrophy in inferior and nasal distributions of midperiphery" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303618" "04214" "00411590" "00000" "Familial, autosomal dominant" "66y" "night blindness and a gradual loss of vision in both eyes during the previous 5 years; visual acuity of 1.0 in both eyes until 55y; 65y: visual acuity: 0.04 with hyperopic correction (11.5 diopters) right eye and 0.5 with correction (cyl 21.0 diopters, axis 75deg) left eye; intraocular pressure: 16 mm Hg; corneas and anterior chambers: clear; cortical opacities in both lenses; liquefied vitreous bodies bilaterally; ophthalmoscopy: normal optic disc, discoloration of the fovea, mottled retina with pigmentation and visible choroidal vessels around the macula, and attenuated retinal vessels right fundus ; normal optic disc and mottled retina with pigmentation in the inferior midperiphery left fundus; fluorescein angiography: visible choroidal vessels at the lesion in both fundi, and cystoid macular edema in the right fundus; Goldmann visual field: ring scotoma in the right eye and isolated superior defects in the left eye; color vision (Farnsworth-Munsell panel D-15): tritan defect in the right eye, normal in the left eye; electroretinogram: subnormal rod responses in both eyes; cone response normal in the left eye but reduced in the right eye" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303619" "04214" "00411591" "00000" "Familial, autosomal dominant" "44y" "presented with mild night blindness; visual acuity : 1.2 both eyes; corneas, anterior chambers, and lenses: clear bilaterally; vitreous liquefaction in both eyes; subtle retinal lesions along the inferior vascular arcade in both fundi; Goldmann visual field testing: isolated scotomas consistent with retinal lesions in both eyes; colour vision: Farnsworth-Munsell panel D-15 test: normal bilaterally; fluorescein angiography: hyperfluorescence along the vascular arcade, predominantly in the inferior region of both eyes; electroretinogram: moderately reduced rod responses and normal cone responses in both eyes" "" "" "mild night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303620" "04214" "00411592" "00000" "Familial, autosomal dominant" "40y" "night blindness; visual acuity: 1.2 both eyes; corneas, anterior chambers, and lenses: clear bilaterally; vitreous liquefaction in both eyes; retinal degeneration accompanying the pigmentation along the inferior vascular arcade in both fundi; Goldmann visual field testing revealed isolated scotomas consistent with retinal lesions in both eyes; colour vision: Farnsworth-Munsell panel D-15 test: normal bilaterally; electroretinogram: moderately reduced rod responses and normal cone responses in both eyes" "30y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303621" "04214" "00411593" "00000" "Familial, autosomal dominant" "53y" "best corrected visual acuity right, left eye: 0.5/200, 5/200; waxy optic discs, attenuated arterioles, mottled retinal pigment epithelium, scattered bone spicule pigmentation" "30y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303622" "04214" "00411594" "00000" "Familial, autosomal dominant" "26y" "mottled retinal pigment epithelium" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303623" "04214" "00411595" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303624" "04214" "00411596" "00000" "Isolated (sporadic)" "55y" "49y: angle closure glaucoma in her right eye, laser peripheral iridotomy; 55y: right eye visual acuity: light perception, left eye: 20/70; right optic disc extremely pale with a cup/disc ratio (C/D) of 0.8 and optic atrophy subsequent to the acute glaucoma, left disc: mild pallor with a C/D of 0.2; left visual field: constricted; fundus: bone spicule pigments and attenuated vessels" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303625" "04214" "00411597" "00000" "Isolated (sporadic)" "33y" "visual acuity: 20/30, pinkish optic discs, bone spicule pigments, constricted visual field, poor scotopic and photopic response in electroretinogram in both eyes" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303626" "04214" "00411598" "00000" "Isolated (sporadic)" "28y" "visual acuity: 20/30, pinkish optic discs, bone spicule pigments, constricted visual field, poor scotopic and photopic response in electroretinogram in both eyes" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303627" "04214" "00411599" "00000" "Isolated (sporadic)" "17y" "visual acuity: 20/30, pinkish optic discs, bone spicule pigments, constricted visual field, poor scotopic and photopic response in electroretinogram in both eyes" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303628" "04214" "00411600" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right, left eye: finger count/30 cm, light perception only; examinations right eye: kinetic visual field: not detectable; electroretinogram (scotopic): not detectable; electroretinogram (bright flash): not detectable; electroretinogram (photopic): not detectable" "23y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303629" "04214" "00411601" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303630" "04214" "00411602" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303631" "04214" "00411603" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303632" "04214" "00411604" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303633" "04214" "00411605" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right, left eye: 20/100, 0.1; examinations right eye: kinetic visual field: paracentral 10-15deg; electroretinogram (scotopic): not detectable; electroretinogram (bright flash): not detectable; electroretinogram (photopic): not detectable" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303634" "04214" "00411606" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity right, left eye: 30/200, 0.1; examinations right eye: kinetic visual field: paracentral 10-15deg; electroretinogram (scotopic): not detectable; electroretinogram (bright flash): not detectable; electroretinogram (photopic): not detectable" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303635" "04214" "00411607" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity right, left eye: 20/80, 0.2; examinations right eye: kinetic visual field: paracentral 30-40deg; electroretinogram (scotopic): not detectable; electroretinogram (bright flash): w a 47 uV, w b 36 uV; electroretinogram (photopic): w a 40 uV, w b 8.7 uV" "23y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303636" "04214" "00411608" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303637" "04214" "00411609" "00000" "Familial, autosomal dominant" "11y" "visual acuity: 20/20 in both eyes; fundus: retinal vessels slightly attenuated, a few bone-spicule pigments in super-periphery" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303638" "04214" "00411610" "00000" "Familial, autosomal dominant" "6y" "visual acuity: 20/20 in both eyes; fundus: retinal vessels slightly attenuated, a few bone-spicule pigments in super-periphery" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303640" "04214" "00411613" "00000" "Familial, autosomal dominant" "" "early-onset, severe form of disease" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303641" "04214" "00411614" "00000" "Familial, autosomal dominant" "" "early-onset, severe form of disease" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303642" "04214" "00411615" "00000" "Familial, autosomal dominant" "" "early-onset, severe form of disease" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303643" "04214" "00411616" "00000" "Isolated (sporadic)" "" "late-onset mild form of disease" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303644" "04214" "00411617" "00000" "Familial, autosomal recessive" "68y" "night blindness, sensitivity to bright light, visual field loss, loss of visual acuity" "" "12y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303647" "04214" "00411620" "00000" "Familial, autosomal dominant" "77y" "post-mortem eye morphology: no rod photoreceptors; remaining cones shortened or absent outer segments; the inner segments abutting the retinal pigment epithelium; only patches of retinal pigment epithelium and choroid; intraretinal pigment was seen in all these cases in the periphery" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303648" "04214" "00411621" "00000" "Familial, autosomal dominant" "84y" "post-mortem eye morphology: no rod photoreceptors; remaining cones shortened or absent outer segments; the inner segments abutting the retinal pigment epithelium; cone photoreceptors: inclusion bodies in the inner segments; intact retinal pigment epithelium and choroid; intraretinal pigment was seen in all these cases in the periphery" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303649" "04214" "00411622" "00000" "Familial, autosomal dominant" "76y" "post-mortem eye morphology: no rod photoreceptors; remaining cones shortened or absent outer segments; the inner segments abutting the retinal pigment epithelium; cone photoreceptors: inclusion bodies in the inner segments; perinuclear membranous swirls; only patches of retinal pigment epithelium and choroid; intraretinal pigment was seen in all these cases in the periphery" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303650" "04214" "00411623" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303651" "04214" "00411624" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303652" "04214" "00411625" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303653" "04214" "00411626" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303654" "04214" "00411627" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303655" "04214" "00411628" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303656" "04214" "00411629" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303657" "04214" "00411630" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303658" "04214" "00411631" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303659" "04214" "00411632" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303660" "04214" "00411633" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303661" "04214" "00411634" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303662" "04214" "00411635" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303663" "04214" "00411636" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303664" "04214" "00411637" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303665" "04214" "00411638" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303666" "04214" "00411639" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303667" "04214" "00411640" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303668" "04214" "00411641" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303669" "04214" "00411642" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303670" "04214" "00411643" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303671" "04214" "00411644" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303672" "04214" "00411645" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303673" "04214" "00411646" "00000" "Familial, autosomal dominant" "" "whole family description: age 7-64y; visual acuity: from 20/20 to light perception, stable until the development of posterior subcapsular cataracts in the third to fourth decade of life; nearly all evaluated patients over 16y had cataracts or intraocular lenses with maintained central visual acuity until the fourth to fifth decade of life; 9/16 patients > 20y: some degree of macular atrophy that compromised central vision; 6/7 examined patients < 20y: widespread white dots and minimal retinal pigment epithelium changes with only the youngest patient (7y) not demonstrating any definite signs; second to third decade, the white dots fade and are replaced by retinal pigment epithelium atrophy and bone spicule; finally, the fundus shows marked retinal pigment epithelium atrophy and choroidal sclerosis; electroretinographic findings: eight patients with full field electroretinography (11-50y) 3 patients with multifocal electroretinography (mfERG): ffERG: all non-recordable responses, mfERG: only the 16y old recordable retinal function (no other patients younger than 40 years tested). Repeat mfERG for this patient 13 months later: considerable further loss of recordable amplitude; perimetric findings: 15 patients Goldmann perimetry: no measurable field with the I4e isoptre by the fourth decade of life; the V4e test target became undetectable by the sixth decade of life" "<5y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303674" "04214" "00411647" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303675" "04214" "00411648" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303676" "04214" "00411649" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303677" "04214" "00411650" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303678" "04214" "00411651" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303679" "04214" "00411652" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303680" "04214" "00411653" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303681" "04214" "00411654" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303862" "04214" "00411835" "00000" "Familial, autosomal dominant" "" "13y: night blindness, 30y: loss visual acuity; best corrected visual acuity right; left eye: loss visual acuity (30y) 60/100; 60/100 (33y); refractive error right/left eye: 21.75/21.75; visual field right/left eye: constriction to 15deg (III/4e 90deg) (33y); electroretinogram: scotopic: noise level; cone 30hz-flicker: residual responses (33y); fundus: slight optic atrophy, vessel narrowing, absent macular reflexes, peripheral pigment mottling, slight peripheral hyperpigmentation; colour vision DA/panel D15: significant elevation/ desaturated: normal" "13y" "" "night blindness; field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303863" "04214" "00411836" "00000" "Familial, autosomal dominant" "" "33y: night blindness, glare sensitivity, field constriction; best corrected visual acuity right; left eye: 100/100; 120/100 (36y); refractive error right/left eye: emmetropic; visual field right/left eye: constriction to 50-60deg with large scotomas 15-40deg (III/4e 90deg) (36y); electroretinogram: scotopic: amplitude reduction to 10% normal range, photopic: amplitude reduction to 50% normal range; multifocal electroretinography: preserved foveal cone responses; fundus: mild optic atrophy, moderately narrowed vessels, atypical macular ilm reflexes; bone-spicules in lower sector, diffuse retinal pigment epithelium atrophy; colour vision DA/panel D15: significant elevation/ desaturated: normal" "33y" "" "night blindness, glare sensitivity, field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303864" "04214" "00411837" "00000" "Familial, autosomal dominant" "" "visual field right/left eye: constriction to 5-10deg (III/4e 90deg) (35y) constriction to 10-25deg; electroretinogram: noise level (35y) rod responses: noise level;; fundus: no details normal optic disc, slightly narrowed; colour vision DA/panel D15: significant elevation" "0m" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303865" "04214" "00411838" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303866" "04214" "00411839" "00000" "Familial, autosomal dominant" "" "33y: visual acuity loss, field constriction, glare sensitivity (45y); best corrected visual acuity right; left eye: 10/200; 10/200 (48y); refractive error right/left eye: +1,25/+1,25; visual both eyes: constriction to 5-7deg (III/4e 90deg) (48y); electroretinogram: noise level (48y); fundus: waxy optic nerve atrophy, vessel attenuation, retinal pigment epithelium atrophy, and hyperpigmentation; colour vision DA/panel D15: significant elevation/saturated: disturbances all axes" "0m" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303867" "04214" "00411840" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303868" "04214" "00411841" "00000" "Familial, autosomal dominant" "" "33y: visual acuity loss, field constriction, glare sensitivity (45y); best corrected visual acuity right; left eye: 120/100; 80/100 (16y); refractive error right/left eye: +2.75/+2.75; visual field right/left eye: constriction to 10–25deg right eye, 7-15deg left eye (III/4e 90deg) (16y); electroretinogram: cone 30 hz: residual responses (16y); fundus: vessels, cystoid macula oedema, peripheral retinal pigment epithelium atrophy with hyperpigmentation; colour vision DA/panel D15: desaturated: slight disturbances all ax" "0m" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303869" "04214" "00411842" "00000" "Familial, autosomal dominant" "" "best corrected visual acuity right; left eye: 100/100; 80/100 (34y); refractive error right/left eye: 0; +3.5 re: (27y): cataract surgery; visual field right/left eye: not performed; electroretinogram: scotopic and photopic amplitude reduction with rest function; electro-oculogram no light peak, pathological arden ratio; fundus: absent macular reflexes, narrowed vessels, mid-peripheral hyperpigmentation; colour vision DA/panel D15: no details" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303870" "04214" "00411843" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303871" "04214" "00411844" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303872" "04214" "00411845" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303873" "04214" "00411846" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303874" "04214" "00411847" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303875" "04214" "00411848" "00000" "Familial, autosomal dominant" "" "3y: night blindness, field constriction, color vision (9y), glare sensitivity (12y), visual extraction (27y) acuity (18y), cataract; best corrected visual acuity right; left eye: 10/250; 10/250 (27y); refractive error right/left eye: emmetropic; visual field right/left eye: constriction to <5deg(III/4e 90deg; electroretinogram: scotopic/photopic noise level; multifocal electroretinography: noise level; fundus: temporal optic disc pallor, no macular reflexes, mid-peripheral hyperpigmentation; colour vision DA/panel D15: significant elevation" "3y" "" "night blindness, field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303876" "04214" "00411849" "00000" "Familial, autosomal dominant" "55y" "constricted visual fields in both eyes; fundi: diffuse bone-spicule pigments, attenuated vessels and pale optic discs; no scotopic and photopic responses in electroretinogram" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303877" "04214" "00411850" "00000" "Familial, autosomal dominant" "33y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303878" "04214" "00411851" "00000" "Familial, autosomal dominant" "28y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303879" "04214" "00411852" "00000" "Familial, autosomal dominant" "17y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303880" "04214" "00411853" "00000" "Familial, autosomal dominant" "53y" "fundi: waxy optic discs, attenuated vessels, mottled retinal pigment epithelium (RPE) and scattered bone spicule pigments; visual field: constricted; electroretinogram: both scotopic and photopic phases" "30y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303881" "04214" "00411854" "00000" "Familial, autosomal dominant" "26y" "mottled retinal pigment epithelium, moderately decreased both rod and cone responses in electroretinogram" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303882" "04214" "00411855" "00000" "Familial, autosomal dominant" "36y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303883" "04214" "00411856" "00000" "Familial, autosomal dominant" "10y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303884" "04214" "00411857" "00000" "Familial, autosomal dominant" "47y" "unaware of being affected" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303885" "04214" "00411858" "00000" "Familial, autosomal dominant" "22y" "state of affection discovered in the course of a routine eye exam following a trauma to the head region" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303886" "04214" "00411859" "00000" "Familial, autosomal dominant" "71y" "best corrected visual acuity right/left eye: 0.8/0.6; visual field mean angle in degrees (scotoma), object V-4e: 29 (23-50); electroretinogram amplitude (uV) rod: not recordable, cone: not recordable; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 2.5; Farnsworth D-15 colour vision defect: minor; visual field scotoma in number of quadrants: 1" "20y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303887" "04214" "00411860" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 49 (21-40); electroretinogram amplitude (uV): not recordable, cone: 6; visual field scotoma in number of quadrants: 2" "20y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303888" "04214" "00411861" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 57 (14-33), object I-4e: 5; electroretinogram amplitude (uV): not recordable, cone: not recordable; Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 1" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303889" "04214" "00411862" "00000" "Familial, autosomal dominant" "65y" "best corrected visual acuity right/left eye: 0.3/0.6; visual field mean angle in degrees (scotoma), object V-4e: 17; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 3.2; visual field scotoma: small central, rest peripheral islands" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303890" "04214" "00411863" "00000" "Familial, autosomal dominant" "47y" "best corrected visual acuity right/left eye: 0.8/0.8; visual field mean angle in degrees (scotoma), object V-4e: 56, object I-4e: 24 (10-26); electroretinogram amplitude (uV): not recordable, cone: 19; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 1.4; Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 1" "30y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303891" "04214" "00411864" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: , object I-4e: 12, other: II-4e:50 (20-36); visual field scotoma in number of quadrants: 1" "15y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303892" "04214" "00411865" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity right/left eye: 0.8/1.0; visual field mean angle in degrees (scotoma), object V-4e: 65, other: II-4e:37 (13-30); Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 2.1; Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 1" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303893" "04214" "00411866" "00000" "Familial, autosomal dominant" "19y" "best corrected visual acuity right/left eye: 0.8/0.8; visual field mean angle in degrees (scotoma), object V-4e: , object I-4e: 42 (17-29), other: I-2e:7; visual field scotoma in number of quadrants: 1" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303894" "04214" "00411867" "00000" "Familial, autosomal dominant" "59y" "best corrected visual acuity right/left eye: 0.03/0.2; visual field mean angle in degrees (scotoma), object V-4e: 5; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 3.8" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303895" "04214" "00411868" "00000" "Familial, autosomal dominant" "32y" "best corrected visual acuity right/left eye: 0.25/0.8; visual field mean angle in degrees (scotoma), object V-4e: 16, other: II-4e:9; electroretinogram amplitude (uV): not recordable, cone: not recordable" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303896" "04214" "00411869" "00000" "Familial, autosomal dominant" "52y" "best corrected visual acuity right/left eye: 0.01/0.15; visual field mean angle in degrees (scotoma), object V-4e: 4; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 2" "10y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303897" "04214" "00411870" "00000" "Familial, autosomal dominant" "55y" "best corrected visual acuity right/left eye: 0.5/0.33; visual field mean angle in degrees (scotoma), object V-4e: 10; visual field scotoma: small central, rest peripheral islands" "15y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303898" "04214" "00411871" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 65 (14-30); visual field scotoma in number of quadrants: 4" "20y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303899" "04214" "00411872" "00000" "Familial, autosomal dominant" "51y" "no nyctalopia; best corrected visual acuity right/left eye: 0.4/1.0; visual field mean angle in degrees (scotoma), object V-4e: 62, object I-4e: 52; electroretinogram amplitude (uV): 135, cone: 74; Farnsworth D-15 colour vision defect: none" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303900" "04214" "00411873" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 65, object I-4e: 36 (3-20); electroretinogram amplitude (uV): 53, cone: 75; Farnsworth D-15 colour vision defect: minor tritan; visual field scotoma in number of quadrants: 4" "50y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303901" "04214" "00411874" "00000" "Familial, autosomal dominant" "61y" "best corrected visual acuity right/left eye: 0.16/0.16; visual field mean angle in degrees (scotoma), object V-4e: 2; electroretinogram amplitude (uV): not recordable, cone: 26; Farnsworth D-15 colour vision defect: tritan" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303902" "04214" "00411875" "00000" "Familial, autosomal dominant" "53y" "no nyctalopia; best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: , object I-4e: 51 (10-15), other: I-2e:19; electroretinogram amplitude (uV): 140, cone: 47; Goldmann-Weeker dark adaptation, elevation of rod final threshold in log units: 0; Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 1" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303903" "04214" "00411876" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity: Schiotz reading test 0.5 m" "15y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303904" "04214" "00411877" "00000" "Familial, autosomal dominant" "55y" "best corrected visual acuity right/left eye: 1.0/0.8; visual field mean angle in degrees (scotoma), object V-4e: 69, object I-4e: 39 (3-21); electroretinogram amplitude (uV): 85, cone: 76; Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 4" "40y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303905" "04214" "00411878" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 61, object I-4e: 21 (4-20); Farnsworth D-15 colour vision defect: minor; visual field scotoma in number of quadrants: 3" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303906" "04214" "00411879" "00000" "Familial, autosomal dominant" "48y" "best corrected visual acuity right/left eye: 1.0/1.0; visual field mean angle in degrees (scotoma), object V-4e: 64, object I-4e: 21 (4-17); Farnsworth D-15 colour vision defect: none; visual field scotoma in number of quadrants: 2" "19y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303907" "00198" "00411880" "00000" "Unknown" "" "unaffected - control individual" "" "" "" "" "" "" "" "" "mixed" "" "" "0000303908" "04214" "00411881" "00000" "Familial, autosomal dominant" "14y" "best corrected visual acuity right, left eye: 20/40, 20/32; refraction: +1.5; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 28; electroretinogram amplitude rod b-Wave: not performed; cone flicker: not performed" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303909" "04214" "00411882" "00000" "Familial, autosomal dominant" "20y" "best corrected visual acuity right, left eye: 20/25; refraction: -8.25; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 57; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: 5" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303910" "04214" "00411883" "00000" "Familial, autosomal dominant" "46y" "best corrected visual acuity right, left eye: 20/40, 20/32; refraction: -0.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 4; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303911" "04214" "00411884" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 20/63,20/100; refraction: +1; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 53; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: 4" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303912" "04214" "00411885" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity right, left eye: 20/100-light perception; refraction: +1; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 4, not detectable; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303913" "04214" "00411886" "00000" "Familial, autosomal dominant" "52y" "best corrected visual acuity right, left eye: 20/50; refraction: +1.5; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: <1; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303914" "04214" "00411887" "00000" "Familial, autosomal dominant" "32y" "best corrected visual acuity right, left eye: 20/40, 20/32; refraction: -1.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 2; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303915" "04214" "00411888" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right, left eye: light perception; refraction: +0.25; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: not detectable; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303916" "04214" "00411889" "00000" "Familial, autosomal dominant" "54y" "best corrected visual acuity right, left eye: 20/80, hand motions; refraction: +2; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 1; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303917" "04214" "00411890" "00000" "Familial, autosomal dominant" "18y" "best corrected visual acuity right, left eye: 20/20; refraction: -4.25; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 84; electroretinogram amplitude rod b-Wave: not performed; cone flicker: not performed" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303918" "04214" "00411891" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity right, left eye: 20/20; refraction: -6.5; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 21; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: 6" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303919" "04214" "00411892" "00000" "Familial, autosomal dominant" "73y" "best corrected visual acuity right, left eye: light perception; refraction: +3.25; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: not detectable; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: not detectable" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303920" "04214" "00411893" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right, left eye: 20/125; refraction: -1.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 39; electroretinogram amplitude rod b-Wave: 34; cone flicker: 34" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303921" "04214" "00411894" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right, left eye: 20/20; refraction: -0.25; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 59; electroretinogram amplitude rod b-Wave: 17; cone flicker: 40" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303922" "04214" "00411895" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right, left eye: 20/20; refraction: plano; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 93; electroretinogram amplitude rod b-Wave: 37; cone flicker: 82" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303923" "04214" "00411896" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity right, left eye: 20/20; refraction: -0.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 93; electroretinogram amplitude rod b-Wave: 55; cone flicker: 81" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303924" "04214" "00411897" "00000" "Familial, autosomal dominant" "63y" "best corrected visual acuity right, left eye: 20/20; refraction: +3.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 79; electroretinogram amplitude rod b-Wave: 25; cone flicker: 38" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303925" "04214" "00411898" "00000" "Familial, autosomal dominant" "42y" "primary complaint: night blindness; visual acuity: 20/20 both eyes; slight myopia both eyes: 1 diopters in the right eye and 2.75 diopters in the left; slight bilateral posterior subcapsular cataract, anterior segment morphology: normal; intraocular pressure: 12 mm Hg both eyes; fundus: slightly pale discs in both eyes as well as rarefied and attenuated vessels, pigment mottling and bone spicules in the periphery; both maculae: fine epiretinal gliosis and an atrophic aspect of the retina; a subtle cystoid macular edema was detected in the left eye; dark adaptometry: a loss of rod sensitivity of about 2 log units, cone sensitivity: normal; Goldmann kinetic perimetry: concentric constriction of the visual field; full-field electroretinography: extinguished rod-driven signals, cone-driven signal amplitudes and implicit times severely impaired, signals could only be recorded in single flash stimulation" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303926" "04214" "00411899" "00000" "Familial, autosomal dominant" "48y" "intraocular pressure: normal; visual field: normal; dark adapted electroretinography responses: normal; light adapted electroretinography responses: normal; anterior segment morphology: normal; pigment clumping: normal; narrowed vessels: normal; macular edema: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303927" "04214" "00411900" "00000" "Familial, autosomal dominant" "46y" "intraocular pressure: normal; visual field: severely impaired; dark adapted electroretinography responses: diminished; light adapted electroretinography responses: severely impaired; anterior segment morphology: normal; pigment clumping: strong phenotype; narrowed vessels: strong phenotype; macular edema: weak phenotype" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303928" "04214" "00411901" "00000" "Familial, autosomal dominant" "42y" "intraocular pressure: normal; visual field: severely impaired; dark adapted electroretinography responses: diminished; light adapted electroretinography responses: diminished; anterior segment morphology: normal; pigment clumping: intermediate phenotype; narrowed vessels: intermediate phenotype; macular edema: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303929" "04214" "00411902" "00000" "Familial, autosomal dominant" "19y" "intraocular pressure: normal; visual field: diminished; dark adapted electroretinography responses: severely impaired; light adapted electroretinography responses: impaired; anterior segment morphology: normal; pigment clumping: weak phenotype; narrowed vessels: weak phenotype; macular edema: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303930" "04214" "00411903" "00000" "Familial, autosomal dominant" "21y" "intraocular pressure: normal; visual field: diminished; dark adapted electroretinography responses: severely impaired; light adapted electroretinography responses: impaired; anterior segment morphology: normal; pigment clumping: weak phenotype; narrowed vessels: weak phenotype; macular edema: normal" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303931" "04214" "00411904" "00000" "Familial, autosomal dominant" "47y" "mother: nyctalopia and vision loss more severe and of earlier onset than patient; herpes simplex keratitis in the left eye treated with topical steroids resulted in steroid-induced glaucoma; patient underwent a trabeculectomy; best corrected visual acuity right, left eye: 20/25, 20/80; intraocular pressure right, left eye: 14, 5 mmHg; slit lamp exam: elevated filtering bleb in the superotemporal quadrant of the left eye with a posterior intraocular lens; fundus: optic nerve pallor with attenuated arterioles and retinal pigment epithelium migration in the mid-periphery of both eyes; right eye: incidental choroidal nevus along the inferior temporal arcade; fundus autofluorescence: small ring of high-density hyperfluorescence correlating with a central field threshold elevation; full-field electroretinogram: rod responses more severely decreased than cone responses, consistent with late-stage rod-cone dystrophy; compared over time, photopic 30-Hz flicker ERG decreased by about an average of 3% per year" "22y" "" "poor vision and night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303932" "04214" "00411905" "00000" "Familial, autosomal dominant" "11y" "visual acuity: 20/15 in each eye; eyes orthophoric with cover testing; anterior exam: unremarkable; fundus: attenuated arterioles and mild, early retinal pigment migration in the mid-peripheral retina; mean electroretinogram from both eyes: delayed b-wave implicit time at 99.5 ms under scotopic conditions with no delay under photopic conditions, maximal scotopic b-wave: abnormally broad peak; fundus autofluorescence: large hyperfluorescent rings in both maculae not correlating with any fundoscopic abnormalities" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303933" "04214" "00411906" "00000" "Familial, autosomal dominant" "7y" "visual acuity: 20/15 in each eye; eyes orthophoric with cover testing; anterior exam: unremarkable; fundus: healthy foveal reflex without optic nerve pallor; mean electroretinogram from both eyes: delayed b-wave implicit time 110 ms (normal = 96 ms), normal b-wave photopic implicit time, maximal scotopic b-wave had an abnormal waveform; fundus autofluorescence: large high-density hyperfluorescent ring" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303934" "04214" "00411907" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303935" "04214" "00411908" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303936" "04214" "00411909" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303937" "04214" "00411910" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303938" "04214" "00411911" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303939" "04214" "00411912" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303940" "04214" "00411913" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303941" "04214" "00411914" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303942" "04214" "00411916" "00000" "Familial, autosomal dominant" "" "whole family description: onset: first decade, typical symptoms of the disease - night blindness, progressive visual field loss; fundus: typical features of RP, including optic disc pallor, attenuation of the retinal vessels, atrophy of the peripheral retinal pigment epithelium, bone spicule pigmentation; macular edema in the posterior pole and small white dots in the mid-periphery at the level of the retinal pigment epithelium; electroretinogram: unrecordable rod and cone responses with undetectable 30-Hz flicker" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303943" "04214" "00411917" "00000" "Familial, autosomal dominant" "" "whole family description: onset: first decade, typical symptoms of the disease - night blindness, progressive visual field loss; fundus: typical features of RP, including optic disc pallor, attenuation of the retinal vessels, atrophy of the peripheral retinal pigment epithelium, bone spicule pigmentation; macular edema in the posterior pole and small white dots in the mid-periphery at the level of the retinal pigment epithelium; electroretinogram: unrecordable rod and cone responses with undetectable 30-Hz flicker" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303944" "04214" "00411918" "00000" "Familial, autosomal dominant" "" "whole family description: onset: first decade, typical symptoms of the disease - night blindness, progressive visual field loss; fundus: typical features of RP, including optic disc pallor, attenuation of the retinal vessels, atrophy of the peripheral retinal pigment epithelium, bone spicule pigmentation; macular edema in the posterior pole and small white dots in the mid-periphery at the level of the retinal pigment epithelium; electroretinogram: unrecordable rod and cone responses with undetectable 30-Hz flicker" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303945" "04214" "00411919" "00000" "Familial, autosomal dominant" "" "whole family description: onset: first decade, typical symptoms of the disease - night blindness, progressive visual field loss; fundus: typical features of RP, including optic disc pallor, attenuation of the retinal vessels, atrophy of the peripheral retinal pigment epithelium, bone spicule pigmentation; macular edema in the posterior pole and small white dots in the mid-periphery at the level of the retinal pigment epithelium; electroretinogram: unrecordable rod and cone responses with undetectable 30-Hz flicker" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303946" "04214" "00411920" "00000" "Familial, autosomal dominant" "" "whole family description: onset: first decade, typical symptoms of the disease - night blindness, progressive visual field loss; fundus: typical features of RP, including optic disc pallor, attenuation of the retinal vessels, atrophy of the peripheral retinal pigment epithelium, bone spicule pigmentation; macular edema in the posterior pole and small white dots in the mid-periphery at the level of the retinal pigment epithelium; electroretinogram: unrecordable rod and cone responses with undetectable 30-Hz flicker" "<10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303947" "04214" "00411921" "00000" "Familial, autosomal dominant" "" "onset of night blindness in the second decade of life" "<20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303950" "04214" "00411923" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303951" "04214" "00411924" "00000" "Familial, autosomal dominant" "66y" "diffuse RP, night blindness, restricted visual field and myopia, loss of central vision in left eye at age 64" "20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304011" "04214" "00411995" "00000" "Familial, autosomal dominant" "39y" "best corrected visual acuity, refraction right; left eye:20/20; 20/20; no cataract; fundus: bone spicules in lower sector; optical coherence tomography: normal foveal lamination; visual field: central scotoma (15deg) isopter V4; electroretinogram: 50% of normal value for scotopic responses; 60% of normal value for photopic responses: no implicit time sh" "" "" "mild night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304012" "04214" "00411996" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304013" "04214" "00411997" "00000" "Familial, autosomal dominant" "59y" "best corrected visual acuity, refraction right; left eye:20/20, +2.50 (-1.25; 170deg); 20/20, +2.00 (-0.50; 50deg); no cataract; fundus: bone spicules in lower sector; optical coherence tomography: normal foveal lamination; visual field: 60degN, 70degT isopter V4 65degN, 70degT; electroretinogram: 20% of normal value for scotopic responses; 35% of normal value for photopic responses; no implicit time shift; 30% of normal value for scotopic responses" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304014" "04214" "00411998" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304015" "04214" "00411999" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304016" "04214" "00412000" "00000" "Familial, autosomal dominant" "60y" "best corrected visual acuity, refraction right; left eye:20/25, +3.25 (1.00; 144deg); 20/25, +2.75 (0.50; 10deg); no cataract; fundus: bone spicules in lower sector; optical coherence tomography: normal foveal lamination; visual field: isopter V4 80degN, 70degT; electroretinogram: photopic 30-hz electroretinogram slightly reduced; no implicit time shift" "" "" "no night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304017" "04214" "00412001" "00000" "Familial, autosomal dominant" "52y" "best corrected visual acuity, refraction right; left eye:20/20, +2.50 (-2.75; 20deg); 20/20, +2.75 (-2.50; 170deg); no cataract; fundus: bone spicules in lower sector epiretinal membrane both eyes; optical coherence tomography: normal foveal lamination; visual field: isopter V4 80degN, 90degT; electroretinogram: 30% of normal value for scotopic responses; 80% of normal value for photo pic responses; no implicit time shift" "30y" "30y" "peripheral visual field impairment at 30; no night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304018" "04214" "00412002" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity, refraction right; left eye:20/20, -0.25 (-0.50: 15deg); 20/20, -0.5; no cataract; fundus: bone spicules in lower sector; optical coherence tomography: normal foveal lamination; visual field: normal; electroretinogram: normal scotopic responses, photopic 30-hz electroretinogram slightly reduced; no implicit time shift" "" "" "mild photophobia, no night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304019" "04214" "00412003" "00000" "Familial, autosomal dominant" "62y" "photophobia at age 59, followed by progressive loss of central vision; best corrected visual acuity, refraction right; left eye:20/63; 20/80; intraocular lens at age 48; fundus: bone spicules 360deg; some areas of central atrophy; optical coherence tomography: foveal thinning; visual field: isopter V4 20deg central both eyes; electroretinogram: not detectable" "<18y" "15y" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304020" "04214" "00412004" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304021" "04214" "00412005" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304022" "04214" "00412006" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304023" "04214" "00412007" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity, refraction right; left eye:20/32, +1.25(-1.25)85deg; 20/32, +1(-1)90deg; no cataract; fundus: bone spicules 360deg; some areas of central atrophy; a few white dots; optical coherence tomography: normal foveal lamination; visual field: isopter V4 right eye 15deg central left eye <10deg; electroretinogram: not detectable" "<18y" "10y" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304024" "04214" "00412008" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304025" "04214" "00412009" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity, refraction right; left eye:20/400, +3.505(-1.75)90deg; 20/500, +3(-1.50)90deg; no cataract; fundus: bone spicules 360deg; some areas of central atrophy; no ring on autofluorescence; optical coherence tomography: foveal thinning; visual field: isopter III4, 20deg central both eyes; electroretinogram: not detectable" "<18y" "30y" "night blindness since childhood, progressive decreased vision and photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304026" "04214" "00412010" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304027" "04214" "00412011" "00000" "Familial, autosomal dominant" "31y" "best corrected visual acuity, refraction right; left eye:20/32, -1(-1)50deg; 20/32, -1(-1.25)135deg; no cataract; fundus: few peripheral retinal pigment epithelium changes 360deg; white dots; small perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: isopter II4 110deg horizontally and 90deg vertically; electroretinogram: no responses detectable in scotopic conditions, some residual flicker respons" "<18y" "<20y" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304028" "04214" "00412012" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity, refraction right; left eye:20/40, +0.25(-0.75)120deg; 20/40, + 0(-1)60deg; cataract; fundus: bone spicules 360deg; some areas of central atrophy; white dots; small perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: isopter III4 60deg horizontally and 30deg vertically; electroretinogram: not detectable" "<18y" "<20y" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304029" "04214" "00412013" "00000" "Familial, autosomal dominant" "51y" "best corrected visual acuity, refraction right; left eye:20/40, +0.75(-0.25)95; 20/40 pl(-1.25)90deg; no cataract; fundus: bone spicules 360deg; some areas of central atrophy; no ring on autofluorescence; optical coherence tomography: foveal thinning; visual field: isopter V4 20deg ; electroretinogram: not detectable" "<18y" "28y" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304030" "04214" "00412014" "00000" "Familial, autosomal dominant" "52y" "best corrected visual acuity, refraction right; left eye:20/40, +3.75(-0.25)35deg; 20/63 =5.75(-1)130deg; cataract; fundus: bone spicules 360deg; some areas of central atrophy; no ring on autofluorescence; optical coherence tomography: foveal thinning; visual field: isopter III4 30deg ; electroretinogram: not detectable" "<18y" "" "night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304031" "04214" "00412015" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304032" "04214" "00412016" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304033" "04214" "00412017" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304034" "04214" "00412018" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304035" "04214" "00412019" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304036" "04214" "00412020" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304037" "04214" "00412021" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304038" "04214" "00412022" "00000" "Familial, autosomal dominant" "37y" "best corrected visual acuity, refraction right; left eye:20/40, -8(-2.75)0deg; 20/40, -8(-2.25)175deg; no cataract; fundus: peripheral retinal pigment epithelium/choroidal atrophy with bone spicules 360deg, small perifoveal ring of hyperautofluorescence; optical coherence tomography: foveal thinning; visual field: isopter III4 170deg horizontal 100deg vertical; electroretinogram: not detectable" "" "10y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304039" "04214" "00412023" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304040" "04214" "00412024" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304041" "04214" "00412025" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304042" "04214" "00412026" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304043" "04214" "00412027" "00000" "Familial, autosomal dominant" "8y" "best corrected visual acuity, refraction right; left eye:20/63, -2(-3.25)0deg; 20/40, +0.75(-2.25)180deg; no cataract; fundus: nearly normal fundus, perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: isopter III4 140deg horizontal; 100deg vertical; electroretinogram: both scotopic and photopic amplitudes reduction*" "" "8y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304044" "04214" "00412028" "00000" "Familial, autosomal dominant" "11y" "best corrected visual acuity, refraction right; left eye:20/20, +0.25(-2.75)5deg; 20/20, +0.25(-2.50)170deg; no cataract; fundus: few retinal pigment epithelium changes with no bone spicules bilateral cystoid macular edema; perifoveal ring of hyperautofluorescence; optical coherence tomography: cystoid macular edema; visual field: isopter III4 140deg horizontal 120deg vertical; electroretinogram: scotopic responses 10% of normal; photopic responses 50% normal; both amplitude reduction and implicit time shift" "" "10y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304045" "04214" "00412029" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity, refraction right; left eye:20/13, 0(-1)160deg; 20/15, 0(-1.50)15deg; no cataract; fundus: preserved macula besides some perifoveolar retinal pigment epithelium clumps; moderate salt-and-pepper appearance of retinal periphery; optical coherence tomography: normal foveal lamination; visual field: normal; electroretinogram: scotopic response amplitudes 80% of normal, normal photopic responses, no implicit time shift" "" "23y" "none" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304046" "04214" "00412030" "00000" "Familial, autosomal dominant" "46y" "best corrected visual acuity, refraction right; left eye:20/25, +1(-0.50)160deg, hand movement; no cataract; fundus: patchy chorioretinal atrophy with some retinal pigment epithelium clumps in posterior pole and mid periphery; no pale disc and no narrowing of blood vessels; salt- and-pepper aspect in retinal periphery; no bone spicules; optical coherence tomography: right eye normal foveal lamination left eye foveal thinning; visual field: right eye normal left eye normal peripheral isopter; electroretinogram: 65% of normal for scotopic response amplitudes and 90% for scotopic responses; no implicit time shift" "" "38y" "decreased visual acuity; some degree of night vision disturbances" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304047" "04214" "00412031" "00000" "Familial, autosomal dominant" "58y" "best corrected visual acuity, refraction right; left eye:20/200, +1.75(-0.50)20deg 20/25, +2.25(-0.50)140deg; cataract; fundus: patchy chorioretinal atrophy with some retinal pigment epithelium clumps in the posterior pole and mid periphery; no pale disc and no narrowing of blood vessels, salt and pepper aspect in retinal periphery; no bone spicules; optical coherence tomography: right eye foveal thinning left eye normal foveal lamination; visual field: normal peripheral isopter; electroretinogram: not performed" "40y" "40y" "night blindness since age 40; decreased visual acuity" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304048" "04214" "00412032" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304049" "04214" "00412033" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304050" "04214" "00412034" "00000" "Familial, autosomal dominant" "26y" "best corrected visual acuity, refraction right; left eye:20/15, both eyes with no correction; no cataract; fundus: normal aspect of posterior poles besides some perifoveolar retinal pigment epithelium clumps and one small area of atrophy; moderate salt and pepper; appearance of retinal periphery; optical coherence tomography: normal foveal lamination; visual field: normal ; electroretinogram: not performed" "" "26y" "none" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304051" "04214" "00412035" "00000" "Familial, autosomal dominant" "34y" "best corrected visual acuity, refraction right; left eye:20/40, +5.50 (-0.50; 165deg); 20/30, +5.00 (-0.50; 170deg); cataract; fundus: bone spicules 360deg; cystoid macular edema; optical coherence tomography: cystoid macular edema; visual field: 15deg; electroretinogram: not detectable" "<8y" "13y" "night blindness at early childhood; peripheral visual field impairment at 13; intense photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304052" "04214" "00412036" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity, refraction right; left eye:20/100, +5.00; 20/400, +6.00 (-0.75; 60deg); cataract; fundus: bone spicules 360deg; foveal photoreceptor loss; optical coherence tomography: foveal thinning; visual field: 15deg; electroretinogram: not detectable except for residual 30-hz flicker electroretinogr" "11y" "11y" "night blindness at 11; progressive decreased vision at 20; photophobia at 25" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304053" "04214" "00412037" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304054" "04214" "00412038" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity, refraction right; left eye:20/30, (-2.00; 90deg); 20/40 (-1.25; 105deg); cataract; fundus: bone spicules 360deg; small perifoveal ring of hyperautofluorescence; optical coherence tomography: foveal thinning; visual field: 20deg; electroretinogram: not detectable" "<8y" "<18y" "night blindness since early childhood; photophobia at 5" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304055" "04214" "00412039" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304056" "04214" "00412040" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304057" "04214" "00412041" "00000" "Familial, autosomal dominant" "60y" "best corrected visual acuity, refraction right; left eye:20/400, +1.50 (-1.00; 95deg); 20/200, +2.00 (-1.00; 85deg); intraocular lens ; fundus: bone spicules 360deg ; optical coherence tomography: foveal thinning; visual field: 10deg ; electroretinogram: not detectable except for residual 30-hz flicker electroretinogr" "<8y" "50y" "night blindness at early childhood; peripheral visual field impairment at 25; photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304058" "04214" "00412042" "00000" "Familial, autosomal dominant" "53y" "best corrected visual acuity, refraction right; left eye:20/125, -1.50(-1)35deg; 20/200, -1.25(-1)150deg; intraocular lens at 48; fundus: bone spicules 360deg, no ring on autofluorescence; perifoveal atrophy; optical coherence tomography: foveal thinning; visual field: 20deg; electroretinogram: not detectable" "4y" "32y" "night blindness since 4y; peripheral visual field impairment 19y" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304059" "04214" "00412043" "00000" "Familial, autosomal dominant" "13y" "best corrected visual acuity, refraction right; left eye:20/25, +1.5(-1.75)170deg; 20/32, +2(-2.75)175deg; no cataract; fundus: peripheral retinal pigment epithelium changes; 360deg with white dots; perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: normal; electroretinogram: scotopic responses 10% of normal; photopic responses 80% normal; both amplitude reduction and implicit time shift" "" "13y" "moderate night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304060" "04214" "00412044" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity, refraction right; left eye:20/32, plano(-1)90deg; 20/25 plano(-0.50)80deg; no cataract; fundus: bone spicules 360deg; perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: 20deg; electroretinogram: not detectable" "" "11y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304061" "04214" "00412045" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304062" "04214" "00412046" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304063" "04214" "00412047" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304064" "04214" "00412048" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304065" "04214" "00412049" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304066" "04214" "00412050" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304067" "04214" "00412051" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304068" "04214" "00412052" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304069" "04214" "00412053" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304070" "04214" "00412054" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity, refraction right; left eye:20/40, 0(-1)115deg; 20/63, -1(-0.25)15deg; cataract; fundus: bone spicules 360deg; white dots; bilateral cystoid macular edema, small perifoveal ring of hyperautofluorescence; optical coherence tomography: cystoid macular edema; visual field: isopter III4 20deg; electroretinogram: not detectable" "<8y" ">12y" "night blindness since early childhood, peripheral visual field impairment at 25, recent photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304071" "04214" "00412055" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304072" "04214" "00412056" "00000" "Familial, autosomal dominant" "14y" "best corrected visual acuity, refraction right; left eye:20/20, +2(-1.25)5deg; 20/20, +1.5(-05)10deg; no cataract; fundus: some peripheral retinal pigment epithelium changes over 360deg; cystoid macular edema; perifoveal ring of hyperautofluorescence; optical coherence tomography: cystoid macular edema; visual field: normal ; electroretinogram: scotopic responses 10% of normal; photopic responses 80% normal; both amplitude reduction and implicit time shift" "" "10y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304073" "04214" "00412057" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity, refraction right; left eye:20/32, +3.5(-1.25)10deg; 20/32, +3.75(-0.75)5deg; no cataract; fundus: bone spicules 360deg; no ring on autofluorescence; optical coherence tomography: foveal thinning; visual field: 20deg; electroretinogram: not detectable" "" "9y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304074" "04214" "00412058" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity, refraction right; left eye:20/400, +1.50(-0.75)20deg 20/200, +3.25(-0.75)10deg; right eye: intraocular lens, left eye: cataract; fundus: a few bone spicules 360deg; some areas of central atrophy, incomplete perifoveal ring of hyperautofluorescence; optical coherence tomography: foveal thinning; visual field: isopter III4 40deg ; electroretinogram: not detectable" "" "49y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304075" "04214" "00412059" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304076" "04214" "00412060" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity, refraction right; left eye:20/20; 20/20; no cataract; fundus: few bone spicules 360deg; perifoveal ring of hyperautofluorescence; optical coherence tomography: normal foveal lamination; visual field: isopter III4 150deg horizontally 60deg vertically; electroretinogram: not detectable scotopic responses; some residual flicker respons" "" "29y" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304077" "04214" "00412061" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304078" "04214" "00412062" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304079" "04214" "00412063" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304080" "04214" "00412064" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304081" "04214" "00412065" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304082" "04214" "00412066" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304083" "04214" "00412067" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304084" "04214" "00412068" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304085" "04214" "00412069" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304086" "04214" "00412070" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304087" "04214" "00412071" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304088" "04214" "00412072" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304089" "04214" "00412073" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304090" "04214" "00412074" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304091" "04214" "00412075" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304092" "04214" "00412076" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304093" "04214" "00412077" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304094" "04214" "00412078" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304095" "04214" "00412079" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304108" "04214" "00412092" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity right; left eye: 0.1; 0.06; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "<8y" "" "poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304109" "04214" "00412093" "00000" "Isolated (sporadic)" "27y" "best corrected visual acuity right; left eye: not available; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304110" "04214" "00412094" "00000" "Isolated (sporadic)" "5y" "best corrected visual acuity right; left eye: 0.7; 0.7; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: undetectable" "4y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304111" "04214" "00412095" "00000" "Familial, autosomal dominant" "26y" "best corrected visual acuity right; left eye: not available; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304112" "04214" "00412096" "00000" "Isolated (sporadic)" "28y" "best corrected visual acuity right; left eye: 0.6; 0.5; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304113" "04214" "00412097" "00000" "Familial, autosomal dominant" "24y" "best corrected visual acuity right; left eye: 1.0; 0.9; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: undetectable" "6y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304114" "04214" "00412098" "00000" "Isolated (sporadic)" "41y" "best corrected visual acuity right; left eye: 0.4; 0.25; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "38y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304115" "04214" "00412099" "00000" "Isolated (sporadic)" "5y" "best corrected visual acuity right; left eye: 0.9; 0.8; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: reduced" "5y" "" "strabismus" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304116" "04214" "00412100" "00000" "Isolated (sporadic)" "38y" "best corrected visual acuity right; left eye: 0.7; 0.5; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: reduced" "25y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304117" "04214" "00412101" "00000" "Isolated (sporadic)" "5y" "best corrected visual acuity right; left eye: 0.6; 0.6; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: reduced" "3y" "" "poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304118" "04214" "00412102" "00000" "Isolated (sporadic)" "36y" "best corrected visual acuity right; left eye: 0.05; 0.04; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "28y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304119" "04214" "00412103" "00000" "Familial, autosomal recessive" "32y" "best corrected visual acuity right; left eye: 0.3; 0.4; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "22y" "" "reduced vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304120" "04214" "00412104" "00000" "Isolated (sporadic)" "9y" "best corrected visual acuity right; left eye: 0.2; 0.3; typical RP fundus changes; electroretinogram responses, rod: undetectable, cone: undetectable" "2y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304121" "04214" "00412105" "00000" "Familial, autosomal recessive" "10y" "best corrected visual acuity right; left eye: 0.5; 0.5; typical RP fundus changes; electroretinogram responses, rod: not available, cone: not available" "4y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304122" "04214" "00412106" "00000" "Unknown" "21y" "best corrected visual acuity right; left eye: 1.0; 1.5; normal fundus; electroretinogram responses, rod: normal, cone: mildly reduced" "" "" "no symptoms" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304128" "04214" "00412112" "00000" "Familial, autosomal dominant" "" "fundus: intraretinal bone spicule pigment deposits accompanying attenuation of the perifoveal retinal pigment epithelium; arterioles narrowed, prominent intraretinal pigment deposits in the periphery; symmetric involvement of both eyes (in heterozygous unaffected family members normal appearance of fundus but slight delay and decrease of b-wave in scotopic electroretinogram response)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304129" "04214" "00412113" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right, left eye: hand movement, finger counting; disturbance of visual acuity starting at around 25y; fundus: bilateral pigmentary retinal degeneration, intraretinal bone spicule pigment deposits accompanying attenuation of the perifoveal retinal pigment epithelium; edematous macula; arterioles narrowed, prominent intraretinal pigment deposits in the periphery; symmetric involvement of both eyes; typical electroretinogram findings, with reductions in both rod-dominated 0.5-Hz responses and cone isolated 30-Hz responses (in heterozygous unaffected family members normal appearance of fundus but slight delay and decrease of b-wave in scotopic electroretinogram response)" "15y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304130" "04214" "00412114" "00000" "Familial, autosomal dominant" "46y" "best corrected visual acuity right, left eye: 20/200, finger counting; disturbance of visual acuity starting at around 25y; fundus: bilateral pigmentary retinal degeneration , intraretinal bone spicule pigment deposits accompanying attenuation of the perifoveal retinal pigment epithelium; edematous macula; arterioles narrowed, prominent intraretinal pigment deposits in the periphery; symmetric involvement of both eyes; typical electroretinogram findings, with reductions in both rod-dominated 0.5-Hz responses and cone isolated 30-Hz responses (in heterozygous unaffected family members normal appearance of fundus but slight delay and decrease of b-wave in scotopic electroretinogram response)" "15y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304131" "04214" "00412115" "00000" "Familial, autosomal dominant" "" "fundus: intraretinal bone spicule pigment deposits accompanying attenuation of the perifoveal retinal pigment epithelium; arterioles narrowed, prominent intraretinal pigment deposits in the periphery; symmetric involvement of both eyes (in heterozygous unaffected family members normal appearance of fundus but slight delay and decrease of b-wave in scotopic electroretinogram response)" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304132" "04214" "00412116" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304133" "04214" "00412117" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304134" "04214" "00412118" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304135" "04214" "00412119" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304136" "04214" "00412120" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity right/left eye: 0.6/0.5; lens opacities: nuclear sclerosis; visual field right/left eye: central/5deg; electroretinogram cone/rod: not available; optical coherence tomography (central foveal thickness, um) right/left eye: not available" "14y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304137" "04214" "00412121" "00000" "Familial, autosomal dominant" "47y" "best corrected visual acuity right/left eye: finger count/no light perception; lens opacities: intraocular lens; visual field right/left eye: failure; electroretinogram cone/rod: failure; optical coherence tomography (central foveal thickness, um) right/left eye: 202/188" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304138" "04214" "00412122" "00000" "Familial, autosomal dominant" "45y" "best corrected visual acuity right/left eye: 0.15/0.4; lens opacities: intraocular lens; visual field right/left eye: not available; electroretinogram cone/rod: non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 282/298" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304139" "04214" "00412123" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity right/left eye: 0.8/0.6; lens opacities: clear; visual field right/left eye: not available; electroretinogram cone/rod: not available; optical coherence tomography (central foveal thickness, um) right/left eye: 207/213" "13y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304140" "04214" "00412124" "00000" "Familial, autosomal dominant" "31y" "best corrected visual acuity right/left eye: 0.3/0.4; lens opacities: posterior subcapsular opacity; visual field right/left eye: central/7deg; electroretinogram cone/rod: not available; optical coherence tomography (central foveal thickness, um) right/left eye: not available" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304141" "04214" "00412125" "00000" "Isolated (sporadic)" "55y" "best corrected visual acuity right/left eye: hand motion/LP; lens opacities: posterior subcapsular opacity; visual field right/left eye: failure; electroretinogram cone/rod: non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 231/267" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304142" "04214" "00412126" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity right/left eye: light perception/light perception; lens opacities: nuclear sclerosis; visual field right/left eye: failure; electroretinogram cone/rod: non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 161/152" ">12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304143" "04214" "00412127" "00000" "Familial, autosomal dominant" "17y" "best corrected visual acuity right/left eye: 1.0/0.7; lens opacities: clear; visual field right/left eye: peripheral constriction; electroretinogram cone/rod: reduction/non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 387/560" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304144" "04214" "00412128" "00000" "Familial, autosomal dominant" "15y" "best corrected visual acuity right/left eye: 0.8/0.8; lens opacities: clear; visual field right/left eye: normal; electroretinogram cone/rod: normal range/non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 376/428" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304145" "04214" "00412129" "00000" "Familial, autosomal dominant" "13y" "best corrected visual acuity right/left eye: 1.2/1.0; lens opacities: clear; visual field right/left eye: normal; electroretinogram cone/rod: normal range/non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 295/291" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304146" "04214" "00412130" "00000" "Familial, autosomal dominant" "11y" "best corrected visual acuity right/left eye: 0.7/0.5; lens opacities: clear; visual field right/left eye: normal; electroretinogram cone/rod: normal range/reduction; optical coherence tomography (central foveal thickness, um) right/left eye: 400/499" "" "" "presymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304147" "04214" "00412131" "00000" "Isolated (sporadic)" "26y" "best corrected visual acuity right/left eye: 0.6/0.7; lens opacities: posterior subcapsular opacity; visual field right/left eye: central/10deg; electroretinogram cone/rod: non-detectable; optical coherence tomography (central foveal thickness, um) right/left eye: 216/175" "23y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304150" "04214" "00412134" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304151" "04214" "00412135" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000304152" "04214" "00412136" "00000" "Familial, autosomal dominant" "49y" "fundus: diffuse retinal pigmentation, progressive decrease in recordable electroretinogram and concentric visual field loss noticeable by 28y, severe retinal atrophy and nonrecordable electroretinogram by 35y" "17y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304153" "04214" "00412137" "00000" "Familial, autosomal dominant" "19y" "attenuation of blood vessels, pale optic disc, stippling of macula with bony spicules 18y" "18y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304154" "04214" "00412138" "00000" "Familial, autosomal dominant" "55y" "bone-spicule pigmentation, decreased visual acuity, attenuation of the retinal blood vessels; pale optic discs and night blindness; best corrected visual acuity right, left eye: 6/24, 6/12; bilateral cataract surgery; severe constriction of the visual field" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304155" "04214" "00412139" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304156" "04214" "00412140" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304157" "04214" "00412141" "00000" "Familial, autosomal dominant" "50y" "bone-spicule pigmentation, decreased visual acuity, attenuation of the retinal blood vessels; pale optic discs and night blindness; macular atrophy - best corrected visual acuity right, left eye: 6/60, 6/18; registered partially sighted at that visit" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304158" "04214" "00412142" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304159" "04214" "00412143" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304160" "04214" "00412144" "00000" "Familial, autosomal dominant" "49y" "best corrected visual acuity, refraction right; left eye:6/15, 6/10; clinical phenotype at review: typical retinitis pigmentosa; functional phenotype: constricted fields, electrodiagnostic (electrophysiology) testing not available; systemic features: none; cellular trafficking: mostly endoplasmic reticulum retention with some correct transportation to the plasma membrane; photopigment function: reduced amount of viable protein (19% of wild type levels); spectral peak similar to wild type" "27y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304161" "04214" "00412145" "00000" "Isolated (sporadic)" "20y" "best corrected visual acuity, refraction right; left eye:3/60, 3/60; clinical phenotype at review: intraretinal bone spicules in the mid-periphery; yellow deposits with striae at maculae; functional phenotype: constricted visual fields; electrodiagnostic (electrophysiology) testing consistent with severe rod-cone dystrophy with severe macular involvement; systemic features: congenital myasthenic syndrome caused by a mutation in glutaminefructose-6- phosphate transaminase 1 (GFPT1); cellular trafficking: normal trafficking to the plasma membrane; photopigment function: both the levels of viable pigment and spectral sensitivity comparable to wild type rhodopsin" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304162" "04214" "00412146" "00000" "Isolated (sporadic)" "15y" "best corrected visual acuity, refraction right; left eye:6/12, 6/10; clinical phenotype at review: typical bone spicule pigmentation in the mid-periphery and central edema; functional phenotype: full visual fields but decreased central sensitivity; annulus of increased signal in maculae on autofluorescence imaging; electrodiagnostic (electrophysiology) testing consistent with a cone-rod dystrophy; systemic features: none; cellular trafficking: endoplasmic reticulum retention, with no pigment found at the plasma membrane; photopigment function: reduced amount of viable protein (20% of wild type levels); spectral peak similar to wild type" "3y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304163" "04214" "00412147" "00000" "Isolated (sporadic)" "48y" "best corrected visual acuity, refraction right; left eye:6/12, 6/12; clinical phenotype at review: pattern dystrophy with atrophy sparing the fovea; no pigment deposition; functional phenotype: normal fields, speckled/linear pattern on autofluorescence imaging with peripapillary sparing; mildly abnormal electroretinogram and extinguished pattern electroretinogram; systemic features: none; mitochondrial mutations were excluded in view of phenotype; cellular trafficking: normal trafficking to the plasma membrane ; photopigment function: both the levels of viable pigment and spectral sensitivity comparable to wild type rhodopsin" "45y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304164" "04214" "00412148" "00000" "Familial, autosomal dominant" "78y" "best corrected visual acuity right/left eye: light perception/light perception; cataract; fundus appearance: not available; visual field: not available; no glaucoma" "<18y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304165" "04214" "00412149" "00000" "Familial, autosomal dominant" "58y" "best corrected visual acuity right/left eye: 0.5/0.6; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: constriction, central 20 degrees; no glaucoma" "<18y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304166" "04214" "00412150" "00000" "Familial, autosomal dominant" "30y" "best corrected visual acuity right/left eye: 1.0/1.0; no cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: constriction, central 30 degrees; no glaucoma" "<18y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304167" "04214" "00412151" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity right/left eye: 0.8/0.7; no cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: constriction, central 30 degrees; no glaucoma" "<18y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304168" "04214" "00412152" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right/left eye: 1.2/1.2; no cataract; fundus appearance: intraretinal bone spicule pigments only in inferior quadrant; visual field: mild constriction; no glaucoma" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304169" "04214" "00412153" "00000" "Familial, autosomal dominant" "74y" "best corrected visual acuity: no light perception; cataract; fundus appearance: not available; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304170" "04214" "00412154" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right/left eye: 0.3/0.5; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304171" "04214" "00412155" "00000" "Familial, autosomal dominant" "67y" "best corrected visual acuity right/left eye: 0.05/0.05; cataract; fundus appearance: not available; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304172" "04214" "00412156" "00000" "Familial, autosomal dominant" "40y" "best corrected visual acuity right/left eye: 0.5/0.5; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304173" "04214" "00412157" "00000" "Familial, autosomal dominant" "63y" "best corrected visual acuity right/left eye: 0.1/0.1; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304174" "04214" "00412158" "00000" "Familial, autosomal dominant" "57y" "best corrected visual acuity: hand movement; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304175" "04214" "00412159" "00000" "Familial, autosomal dominant" "49y" "best corrected visual acuity right/left eye: 0.1/0.1; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304176" "04214" "00412160" "00000" "Familial, autosomal dominant" "20y" "best corrected visual acuity right/left eye: 0.5/0.5; no cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304177" "04214" "00412161" "00000" "Familial, autosomal dominant" "87y" "best corrected visual acuity: no light perception; cataract; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: not available; no glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304178" "04214" "00412162" "00000" "Familial, autosomal dominant" "48y" "best corrected visual acuity right/left eye: 0.6/0.01; cataract- intraocular lens; fundus appearance: intraretinal bone spicule pigments in four quadrants; visual field: constriction, central 10 degrees; glaucoma" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304179" "04214" "00412163" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304182" "04214" "00412166" "00000" "Familial, autosomal dominant" "60y" "sector retinitis pigmentosa, best corrected visual acuity: 20/20 visual acuity; no anterior segment anomalies; fundus: pigmentary changes and retinal pigment epithelium atrophy in the inferior hemiretina with no foveal affectation; incipient involvement of the inferior macula inside the temporal vascular arcade; superior scotoma affecting both eyes, sparing the central 20deg both eyes; right eye: visual field had a preserved area of vision of 20degx50deg in the superior hemifield; optical coherence tomography: slightly thickened retina with multiple retinal pigment epithelium detachments in foveal area; electroretinogram: poor scotopic and photopic responses in both eyes" "" "" "mild nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304183" "04214" "00412167" "00000" "Familial, autosomal dominant" "58y" "sector retinitis pigmentosa, best corrected visual acuity: 20/200 both eyes, no anterior segment anomalies; fundus: pigmentary changes predominantly in the inferior hemiretina, macula and fovea, with diffuse atrophic areas, as well as bone spicules in the affected area; kinetic visual fields: cecocentral scotoma of approximately 30deg along with a peripheral ring scotoma in both eyes; optical coherence tomography: retinal atrophy, foveal thinning and subtle retinal pigment epithelium changes; electroretinogram: abnormally low photopic phase responses scotopic phase responses were within normal values" ">12y" "" "progressive visual loss and nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304184" "04214" "00412168" "00000" "Familial, autosomal dominant" "50y" "sector retinitis pigmentosa, best corrected visual acuity: 20/20; normal anterior segments both eyes; funduscopy: pigmentary changes, retinal pigment epithelium atrophy, and bone spicules in the inferior hemiretina without involvement of the macular area; kinetic visual fields: scotoma involving the superior temporal and nasal visual field, inferior and central 5deg; no scotoma; optical coherence tomography: slight macular thickening with a hyperreflective line beneath the photoreceptor layer and above the retinal pigment epithelium; electroretinogram: severely diminished values in both scotopic and photopic phases" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304185" "04214" "00412169" "00000" "Familial, autosomal dominant" "67y" "sector retinitis pigmentosa, best corrected visual acuity right, left eye: 20/50, 20/60; fundus: atrophic retinal pigment epithelium and peripheral bone spicules in a sectorial distribution" "" "" "mild nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304188" "04214" "00412173" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304194" "04214" "00412180" "00000" "Familial, autosomal dominant" "24y" "best corrected visual acuity right/left eye: 0.25/0.25; fundus: no bone spicule pigment deposits; electroretinogram: no rod responses" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304195" "04214" "00412181" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304196" "04214" "00412182" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304197" "04214" "00412183" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304198" "04214" "00412184" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304199" "04214" "00412185" "00000" "Isolated (sporadic)" "39y" "best corrected visual acuity right/left eye: 0.10/0.10; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304200" "04214" "00412186" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right/left eye: 0.12/0.12; fundus: bone spicule pigment deposits; electroretinogram: data not available" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304201" "04214" "00412187" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right/left eye: 0.15/0.12; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304202" "04214" "00412188" "00000" "Familial, autosomal dominant" "48y" "best corrected visual acuity right/left eye: 0.30/0.30; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304203" "04214" "00412189" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304204" "04214" "00412190" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right/left eye: 0.15/0.12; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304205" "04214" "00412191" "00000" "Isolated (sporadic)" "39y" "best corrected visual acuity right/left eye: 0.20/0.30; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304206" "04214" "00412192" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity right/left eye: 0.40/0.30; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304207" "04214" "00412193" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity right/left eye: 0.40/0.30; fundus: bone spicule pigment deposits; electroretinogram: no rod responses" "<8y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304208" "04214" "00412194" "00000" "Familial, autosomal dominant" "33y" "routine eye examination: abnormal retinal pigmentation bilaterally; no past ocular or medical history of note; Snellen visual acuity: 6/6 in each eye (with low myopic correction); anterior segments and intraocular pressures: normal; pigmented cells in the anterior vitreous; fundus:a band of atrophic retina with classical bone-spicule deposits, running from inferonasal to inferotemporal bilaterally; fundus autofluorescence: increased hyperfluorescence at the margin of these hypofluorescent atrophic changes - a corresponding superior visual field scotoma in both eyes; optical coherence tomography: normal; electroretinogram: normal rod-mediated Flash ERG response, some reduction in oscillatory potentials, cone-mediated function normal for both amplitude and latency as was the pattern of ERG wave form" "" "" "asymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304209" "04214" "00412195" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304210" "04214" "00412196" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304212" "04214" "00412198" "00000" "Familial, autosomal dominant" "58y" "best corrected visual acuity (refraction) right, left eye: 1.5 (+1.50 diopter (dpt), cylinder (cyl) -1.25 dpt axial (Ax) 20deg), 0.7 (+1.50 dpt., cyl. -0.50 dpt. Ax. 150deg); slight senile cataracts in the anterior segments and media of both eyes; intraocular pressures: normal both eyes; fundus: retinal degeneration around the inferior vascular arcade; optical coherence tomography: marked thinning of the outer nuclear layer, disruption of the inner segment/outer segment line, except for the foveal region; previous exam: depression of visual fields and an arcuate scotoma at the superior visual; full-field electroretinogram: decreased amplitudes in the rod, standard combined, cone, and 30-Hz flicker responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304213" "04214" "00412199" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304214" "04214" "00412200" "00000" "Familial, autosomal dominant" "31y" "best corrected visual acuity (refraction) right, left eye: 1.5 (with cyl. -0.50 dpt. Ax. 160deg), 1.2 (with cyl. -1.00 dpt. Ax. 35deg); no abnormalities in the anterior segments and media of either eye; intraocular pressures: normal range in both eyes. fundus: retinal degeneration in the nasal area; optical coherence tomography: marked thinning of the outer nuclear layer and disruption of the inner/outer segment line except for the foveal; visual field: isolated scotomas both eyes; full-field electroretinogram: decreased amplitudes in the rod, standard combined, cone, and 30-Hz flicker responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304215" "04214" "00412201" "00000" "Familial, autosomal dominant" "35y" "visual acuity (refraction) right, left eye: 0.7 (with no correction), 0.6 (with cyl. -1.75 dpt. Ax. 30deg; no abnormalities in the anterior segments and media of either eye; intraocular pressures: normal; fundus: diffuse retinal degeneration and intraretinal pigment deposits with a bone-spicule configuration around the vascular arcade to the periphery; optical coherence tomography: marked thinning of the outer nuclear layer and entire disruption of the inner/outer segment line; visual field: a ring-like defect in both eyes; full-field electroretinogram: no responses in the rod, standard combined, and 30-Hz flicker electroretinogram" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304216" "04214" "00412202" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304217" "04214" "00412203" "00000" "Familial, autosomal dominant" "14y" "11y: dark-adapted single flash electroretinogram: reduced responses in both eyes; best corrected visual acuity (refraction) right, left eye: 1.2 (with +6.50 dpt., cyl. -2.00 dpt. Ax. 180deg), 1.0 (with +7.00 dpt., cyl. -1.50 dpt. Ax. 10deg); fundus: retinal degeneration of the inferotemporal both eyes; optical coherence tomography: marked thinning of the outer nuclear layer and disruption of the inner/outer segment line, except for the foveal region; constriction of visual fields with small scotomas; fundus autofluorescence: perifoveal hyperautofluorescent ring both eyes" "6y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304218" "04214" "00412204" "00000" "Isolated (sporadic)" "" "best corrected Snellen acuity: 6/6, no significant refractive error; fundal appearance: sector RP, although not the typical symmetric form; bilateral although asymmetric area of RP was present in the superonasal area of both eyes; right eye significantly more affected than the left, confirmed using visual field testing; multifocal electroretinography abnormal in the appropriate area corresponding to the retinal signs, reduction in response amplitude and an increase in latency in the affected region in the right eye; full-field electroretinograms and electro-oculograms reduced in the right eye but normal in the left eye" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304221" "04214" "00412207" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304222" "04214" "00412208" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304223" "04214" "00412209" "00000" "Familial, autosomal dominant" "57y" "best corrected visual acuity both eyes: 10/200; funduscopy: typical RP; electroretinogram: not detectable" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304224" "04214" "00412210" "00000" "Familial, autosomal dominant" "54y" "best corrected visual acuity right, left eye: 10/200, 20/50; funduscopy: typical RP; electroretinogram: not detectable" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304225" "04214" "00412211" "00000" "Familial, autosomal dominant" "50y" "best corrected visual acuity right, left eye: 20/30, light perception; funduscopy: typical RP; electroretinogram: not detectable" "14y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304226" "04214" "00412212" "00000" "Familial, autosomal dominant" "28y" "best corrected visual acuity both eyes: 20/30; funduscopy: typical RP; electroretinogram: not detectable" "10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304227" "04214" "00412213" "00000" "Familial, autosomal dominant" "23y" "best corrected visual acuity both eyes: 20/30; funduscopy: typical RP; electroretinogram: not detectable" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304228" "04214" "00412214" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304229" "04214" "00412215" "00000" "Familial, autosomal dominant" "61y" "best corrected visual acuity both eyes: 20/30; funduscopy: typical RP; electroretinogram: not detectable" "14y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304230" "04214" "00412216" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304231" "04214" "00412217" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304232" "04214" "00412218" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right, left eye: 20/25, 25/25; funduscopy: typical RP; electroretinogram:" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304233" "04214" "00412219" "00000" "Familial, autosomal dominant" "37y" "best corrected visual acuity both eyes: 20/20; funduscopy: typical RP; electroretinogram: not detectable" "10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304234" "04214" "00412220" "00000" "Familial, autosomal dominant" "36y" "best corrected visual acuity both eyes: 20/20; funduscopy: typical RP; electroretinogram: not detectable" "13y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304235" "04214" "00412221" "00000" "Familial, autosomal dominant" "9y" "best corrected visual acuity both eyes: 20/20; funduscopy: typical RP; electroretinogram: severe loss of amplitude in scotopic, maxima, and photopic responses" "9y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304237" "04214" "00412223" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304238" "04214" "00412224" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304239" "04214" "00412225" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right, left eye: 0.3, 0.3; refraction right/left eye: -6.50/-1.50x 160deg/-8.75/-2.00x 5" "2y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304240" "04214" "00412226" "00000" "Familial, autosomal dominant" "13y" "best corrected visual acuity right, left eye: 0.5, 0.5; refraction right/left eye: -5.5/-3" "2y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304241" "04214" "00412227" "00000" "Familial, autosomal dominant" "8y" "best corrected visual acuity right, left eye: 0.5, 0.4; refraction right/left eye: -1.50x 110deg/+0.75x 140deg" "2y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304242" "04214" "00412228" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304243" "04214" "00412229" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304244" "04214" "00412230" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304245" "04214" "00412231" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304246" "04214" "00412232" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304247" "04214" "00412233" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304257" "04214" "00412244" "00000" "Familial, autosomal dominant" "12y" "best corrected visual acuity right, left eye: 0.7, 0.8; refraction right/left eye: plano / plano; full-field electroretinogram right/left eye: not detected / not detected, cone flicker – 30 Hz (implicit time)not detected, rod response, b, uV:not detect" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304258" "04214" "00412245" "00000" "Familial, autosomal dominant" "8y" "best corrected visual acuity right, left eye: 0.5, 0.8; refraction right/left eye: plano / plano; full-field electroretinogram right/left eye: not detected / not detected; electroretinogram: not detected, rod response, b, uV:not detected" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304259" "04214" "00412246" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right, left eye: 0.9, 0.9; refraction right/left eye: not available / not available; full-field electroretinogram right/left eye: a-114, b-158 / a-79, b-152; electroretinogram: 68 (30.6), 74 (29.5), rod response, b, uV:105, 87" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304260" "04214" "00412247" "00000" "Familial, autosomal dominant" "43y" "best corrected visual acuity right, left eye: not available, not available; refraction right/left eye: not available / not available; full-field electroretinogram right/left eye: not detected / not detected; electroretinogram: 86 (5.3), 80 (4.2), rod response, b, uV:not detected" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304261" "04214" "00412248" "00000" "Familial, autosomal dominant" "17y" "best corrected visual acuity right, left eye: 1, 1; refraction right/left eye: not available / not available; full-field electroretinogram right/left eye: not available / not available; electroretinogram: not available, rod response, b, uV:not available" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304262" "04214" "00412249" "00000" "Familial, autosomal dominant" "20y" "best corrected visual acuity right, left eye: 0.5 (46), 0.33 (46); refraction right/left eye: -4.0 (46) / -5.0 (46); full-field electroretinogram right/left eye: not detected / not detected; electroretinogram: not detected, rod response, b, uV:not detected" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304263" "04214" "00412250" "00000" "Familial, autosomal dominant" "37y" "best corrected visual acuity right, left eye: 1, 1.6; refraction right/left eye: not available / not available; full-field electroretinogram right/left eye: a-125, b-289 / a-148, b-26667 (31.4),72 (31.9), rod response, b, uV:212, 219" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304264" "04214" "00412251" "00000" "Familial, autosomal dominant" "27y" "best corrected visual acuity right, left eye: 0.8, 0.3; refraction right/left eye: not available / not available; full-field electroretinogram right/left eye: not available / not availablenot available, rod response, b, uV:not available" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304265" "04214" "00412252" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 0.5, 0.6; refraction right/left eye: -6 / -7; full-field electroretinogram right/left eye: trace responses / trace responses; electroretinogram: 23 (47), 14 (44), rod response, b, uV:Trace responses" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304266" "04214" "00412253" "00000" "Familial, autosomal dominant" "10y" "best corrected visual acuity right, left eye: 0.86, 1; refraction right/left eye: -6.00 (11) / -6.00 (11); full-field electroretinogram right/left eye: a-19 b-64 / not available; electroretinogram: 13 (31) right eye, rod response, b, uV:not detected" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304267" "04214" "00412254" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304270" "04214" "00412256" "00000" "Familial, autosomal recessive" "49y" "best corrected visual acuity right, left eye: 20/50, 20/100; concentric constriction of Goldmann visual fields to the central 5deg; color vision defect in the blue-yellow axis; subcapsular cataract; fundus: major retinal atrophy with vascular attenuation and a relatively preserved macula, a remarkable aspect of pigmentation in the retinal periphery; classic spicular intraretinal pigmentations and conglomerates of grouped nummular pigment deposits" "" "20y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304271" "04214" "00412257" "00000" "Familial, autosomal recessive" "44y" "best corrected visual acuity right, left eye: 20/40 both eyes; concentric constriction of the visual fields to less than 10deg; bilateral posterior subcapsular cataracts; fundus: retinal atrophy, albeit less severe than in the other affected sibling (IV:5; particular small, nummular intraretinal pigmentations, although not grouped in her; several well-delineated areas of punched-out retinal atrophy were present" "15y" "" "night blindness and visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304272" "04214" "00412258" "00000" "Unknown" "47y" "subjective night blindness; best corrected visual acuity right, left eye: 20/30, 20/25; visual fields: normal; the patient did not allow to perform a full field electroretinogram; anterior segments: normal; fundoscopy: multiple zones of peripheral intraretinal pigmentation with either a spicular or nummular aspect, as well as multiple white dots, representing minor subclinical manifestations" "" "" "subsymptomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304273" "04214" "00412259" "00000" "Familial, autosomal dominant" "33y" "for the past 2 years worsening nyctalopia, onset of photophobia, and worsening peripheral visual fields with subjective preservation of central visual acuity; best corrected visual acuity right, left eye: 20/32, 20/25; fundus: midperipheral loss of choriocapillaris, constricted retinal vessels, isolated retinal vessel-associated pigmentary clumping and foveal thinning; Goldmann perimetry: typical midperipheral ring scotoma and concentric constriction of the remaining central 20deg; fundus autofluorescence: a ring-shaped perifoveal increase, sporadic granular decrease along the vascular arcades and a well-defined foveal increase due to cystoid retinal changes (as demonstrated by macular optical coherence tomography); dark-adapted electroretinogram pathologically reduced, but detectable and reproducible minor amplitudes in both eyes; severe amplitude reduction - a reliable measurement of a- and b-wave peak times not possible; discrete Fourier transform of the flicker response revealed minor significant cone responses of the left eye only and significant peak time prolongation; multifocal electroretinogram demonstrated a pathological central amplitude reduction and decreasing amplitudes with increasing eccentricity of the stimulus" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304274" "04214" "00412260" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness, Riggs type" "" "" "0000304275" "04214" "00412261" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness, Riggs type" "" "" "0000304276" "04214" "00412262" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness, Riggs type" "" "" "0000304277" "04214" "00412263" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness, Riggs type" "" "" "0000304278" "04214" "00412264" "00000" "Familial, autosomal dominant" "51y" "no signs of photophobia, color vision defects, and reduced peripheral visual fields; best corrected visual acuity: 20/20 both eyes; anterior segments: normal with only very mild symmetric bilateral nuclear lens opacification; the posterior pole: unremarkable; left eye: a few subtle retinal pigment epithelium irregularities only in the temporal and inferior periphery; no peripheral vessel constriction or any \'bone spicule\' shaped pattern of fundus hyperpigmentation; central fundus autofluorescence: a subtle perifoveal ring-shaped increase, peripheral fundus autofluorescence: a few irregular reductions restricted to the far temporal and inferior periphery of the left eye; macular optical coherence tomography: no cystic changes or other abnormalities in the outer or inner retinal layers; no reduction of retinal layer thickness; electroretinogram: decreased a-wave in response to the scotopic bright flash and a reduction in the b/a-wave ratio resembling an electronegative electroretinogram recording; photopic troretinogram: slightly reduced, near to normal cone responses; photopic 30 Hz flicker electroretinogram: a double peak electroretinogram-waves of a healthy person" "" "" "non-progressive nyctalopia from an early age" "" "" "" "" "" "congenital stationary night blindness, Riggs type" "" "" "0000304279" "04214" "00412274" "00000" "Familial, autosomal dominant" "61y" "best corrected visual acuity right/left eye: 1.0/0.8; glaucoma; electroretinogram: not available; visual field: superior field defect, inferotemporal visual isle in the left eye; reduction, moderate reduction of cone and rod func" "20y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304280" "04214" "00412275" "00000" "Unknown" "31y" "best corrected visual acuity right/left eye: 0.8/0.4; no glaucoma; electroretinogram: reduction; visual field: superior field de" "" "" "asypmtomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304281" "04214" "00412276" "00000" "Unknown" "32y" "best corrected visual acuity right/left eye: 0.9/0.8; no glaucoma; electroretinogram: not available; visual field: norm" "" "" "asypmtomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304282" "04214" "00412277" "00000" "Unknown" "50y" "best corrected visual acuity right/left eye: 0.6/0.8; no glaucoma; electroretinogram: not available; visual field: superior field de" "48y" "" "visual acuity decreased" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304283" "04214" "00412278" "00000" "Familial, autosomal dominant" "34y" "best corrected visual acuity right/left eye: 1.0/1.0; no glaucoma; electroretinogram: reduction; visual field: superior field de" "" "" "asypmtomatic" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304285" "04214" "00412281" "00000" "Familial, autosomal dominant" "53y" "20y after the first symptoms appeared treated with pulse therapy due to the appearance of bilateral pericentral scotomas mistakenly attributed to neuritis: no improvement; pericentral and paracentral scotomas and nyctalopia slowly progressed up until 51y; 53y: best corrected visual acuity (refraction) right, left eye: 20/20 (-2,50 spherical), 20/30 (-3,0 spherical); complete dyschromatopsy left eye, blue-green right eye; normal ocular motricity, pupils reactions and anterior segment in both eyes (both eyes); applanation tonometry: 12 mmHg both eyes; binocular indirect fundoscopy: diffuse pallor of the optic discs, generalized vascular thinning, disperse pigment spicules on the four quadrants also coming close to the posterior pole, macular alterations on pigment epithelium plane and internal surface reflexes; superficial micro-hemorrhage cluster near to left optic disc; visual fields with sensitivity alterations on all quadrants and with better perceptions in the lower hemifields of both eyes; the mean deviation, pattern SD, and visual fields indices altered in both eyes; fundus autofluorescence: inferior and temporal perimacular islands of hypo-autofluorescence in the central zone of both eyes; fluorescein angiography:preserved filling times, diffuse hypofluorescence of both discs, extensive defects in window (retinal pigment epithelium atrophy either isolated or combined with the choriocapillaris), reaching the edges of the superior and inferior temporal vascular arcades, hypofluorescence caused by spicules in both eyes; optical coherence tomography and optical coherence tomography angiography: foveal thickness right eye 255 um, left eye 321 um; presence of bilateral epiretinal membrane, more significant in left eye, with disappearance of clivus and formation of folds; bilateral sectoral discontinuities in the ellipsoid zones, points of non-perfusion in the outer retina and central choriocapillaris and peri-discs, without corresponding to pigments; visual evoked potential: alterations in the bilateral occipital cortical response, with reduction in wave amplitude and morphology, with increased retino-cortical conduction time in both eyes; electroretinogram: overall and significant reduction in cell responses at all structural levels and at all stages of the examination in both eyes; accentuated impairment of rods and with greater intensity in left eye; electrooculogram: subnormal retinal pigment epithelium functional responses, with an Arden index of 1.20 in both eyes; comorbidities: beta-blocker for systemic arterial hypertension and hearing impairment (hearing aid)" "10y" "" "hypoacusis, progressive myopia, nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304286" "04214" "00412282" "00000" "Familial, autosomal dominant" "29y" "corrected distant visual acuity right, left eye: 20/22, 20/22; refraction right, left eye: plano, plano; additional ocular findingsmild posterior subcapsular cataract both eyes, bilateral laser epithelial keratomileus" "13y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304287" "04214" "00412283" "00000" "Familial, autosomal dominant" "25y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304288" "04214" "00412284" "00000" "Familial, autosomal dominant" "50y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304289" "04214" "00412285" "00000" "Familial, autosomal dominant" "47y" "corrected distant visual acuity right, left eye: 20/50, 20/70; refraction right, left eye: - 0.50 - 1.75 x 180deg, - 1.50 - 1.50 x 150deg; additional ocular findingsphacoemulsification + posterior chamber intraocular lens both" "14y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304290" "04214" "00412286" "00000" "Familial, autosomal dominant" "21y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304291" "04214" "00412287" "00000" "Familial, autosomal dominant" "26y" "corrected distant visual acuity right, left eye: 20/25, 20/25; refraction right, left eye: + 0.50 - 2.00 x 115deg, + 0.50 - 2.00 x 85deg; additional ocular findingstrace posterior subcapsular cataract both eyes, predominant inferior bone spicul" "7y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304292" "04214" "00412288" "00000" "Familial, autosomal dominant" "37y" "corrected distant visual acuity right, left eye: counting fingers, counting fingers; refraction right, left eye: - 1.00 - 0.75 x 10deg, - 0.75 - 0.50 x 165deg; additional ocular findingsmoderate posterior subcapsular cataract both eyes, bilateral optic atrop" "10y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304293" "04214" "00412289" "00000" "Familial, autosomal dominant" "51y" "corrected distant visual acuity right, left eye: 20/25, 20/25; refraction right, left eye: plano, plano; additional ocular findingsmild posterior subcapsular cataract both ey" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304295" "04214" "00412291" "00000" "Familial, autosomal dominant" "62y" "best corrected visual acuity right/left eye: light perception (5 m/5 m); optometry, refraction right, left eye: not available, not available; axial length (mm): 21.47/21.28; fundus features: not available; cataract right/left eye: severe/severe; cataract subtype right/left eye: total cataract/total cataract; optical coherence tomography central foveal thickness right/left eye (um): not detectable" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304296" "04214" "00412292" "00000" "Familial, autosomal dominant" "60y" "best corrected visual acuity right/left eye: light perception (5 m/5 m); optometry, refraction right, left eye: not available, not available20.30/19.85; fundus features: not available; cataract right/left eye: severe/severe; cataract subtype right/left eye: total cataract/total cataract; optical coherence tomography central foveal thickness right/left eye (um): not detectable" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304297" "04214" "00412293" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity right/left eye: no light perception/no light perception; optometry, refraction right, left eye: not available, not availablenot available; fundus features: not available; cataract right/left eye: severe/severe; cataract subtype right/left eye: total cataract/total cataract; optical coherence tomography central foveal thickness right/left eye (um): not detectable" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304298" "04214" "00412294" "00000" "Familial, autosomal dominant" "39y" "best corrected visual acuity right/left eye: no light perception/0.1; optometry, refraction right, left eye: not available, -9.5/-2.0 x 165◦not detectable; fundus features: mid-peripheral pigment alterations, vessel attenuation; cataract right/left eye: no/severe; cataract subtype right/left eye: none/posterior subcapsular cataract; optical coherence tomography central foveal thickness right/left eye (um): not detectable/1" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304299" "04214" "00412295" "00000" "Familial, autosomal dominant" "42y" "best corrected visual acuity right/left eye: 0.3/0.3; optometry, refraction right, left eye: +5.50/+1.50 x 30deg, 4not detectable; fundus features: a pale fundus, mid-peripheral pigment alterations, vessel attenuation; cataract right/left eye: moderate/severe; cataract subtype right/left eye: cortical cataract/cortical cataract; optical coherence tomography central foveal thickness right/left eye (um): epiretinal membrane (310/262)" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304300" "04214" "00412296" "00000" "Familial, autosomal dominant" "41y" "best corrected visual acuity right/left eye: 0.1/0.04; optometry, refraction right, left eye: -0.75x90deg, -1.75x90◦not detectable; fundus features: a pale fundus, diffuse atrophic changes of the retinal pigment epithelium, vessel attenuation, bone spicule-like pigmentation; cataract right/left eye: no/moderate; cataract subtype right/left eye: none/posterior subcapsular cataract; optical coherence tomography central foveal thickness right/left eye (um): 160/1" "1y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304301" "04214" "00412297" "00000" "Familial, autosomal dominant" "35y" "best corrected visual acuity right/left eye: 0.2/0.2; optometry, refraction right, left eye: -5.00/-2.00x180deg, -4.75/-1.50x180◦not detectable; fundus features: a blurring pale fundus, mid-peripheral pigment alterations, vessel attenuation; cataract right/left eye: severe/severe; cataract subtype right/left eye: posterior subcapsular cataract/posterior subcapsular cataract; optical coherence tomography central foveal thickness right/left eye (um): 190/1" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304302" "04214" "00412298" "00000" "Familial, autosomal dominant" "32y" "best corrected visual acuity right/left eye: 0.04/0.06; optometry, refraction right, left eye: +0.50/-3.00x180deg, -2.75x180◦not detectable; fundus features: a pale fundus, mid-peripheral pigment alterations, vessel attenuation, bone spicule-like pigmentation; cataract right/left eye: moderate/no; cataract subtype right/left eye: posterior subcapsular cataract/none; optical coherence tomography central foveal thickness right/left eye (um): 107/1" "1y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304303" "04214" "00412299" "00000" "Familial, autosomal dominant" "9y" "best corrected visual acuity right/left eye: 0.5/0.4; optometry, refraction right, left eye: +3.00x105deg, +3.25x90◦not detectable; fundus features: Slight mid-peripheral pigment alterations, slight vessel attenuation; cataract right/left eye: none/none; cataract subtype right/left eye: none/none; optical coherence tomography central foveal thickness right/left eye (um): 209/2" "2y" "" "severe night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304320" "04214" "00412315" "00000" "Familial, autosomal dominant" "38y" "best corrected visual acuity right/left eye: 0.2; color vision: normal/0.2; fundus: attenuated vessels, pigmentry deposit; visual field: tunnel; scotopic 0.01 b wave (uV): right/left eye: 155(!)/75.2(!); scotopic 3.0 a wave (uV): 84.3(!)/9.11(!); scotopic 3.0 b wave (uV): 87.6(!)/42(!); photopic 3.0 a wave (uV): not available/not available; photopic 3.0 b wave (uV): not available/not available; photopic 30 Hz flicker (uV): not available/not available" "6y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304321" "04214" "00412316" "00000" "Familial, autosomal dominant" "56y" "best corrected visual acuity right/left eye: light perception; color vision: normal/0.2; fundus: attenuated vessels, pigmentry deposit; visual field: tunnel; scotopic 0.01 b wave (uV): right/left eye: 24.9(!)/34.2(!); scotopic 3.0 a wave (uV): 4.56(!)/5.05(!); scotopic 3.0 b wave (uV): 35(!)/9.28(!); photopic 3.0 a wave (uV): 6.02(!)/6.84(!); photopic 3.0 b wave (uV): 0.651(!)/3.26(!); photopic 30 Hz flicker (uV): 3.42(!)/4.11(!)" "40y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304322" "04214" "00412317" "00000" "Familial, autosomal dominant" "25y" "best corrected visual acuity right/left eye: 0.8; color vision: normal/0.8; fundus: attenuated vessels, pigmentry deposit; visual field: narrowed; scotopic 0.01 b wave (uV): 76(!)/119(!); scotopic 3.0 a wave (uV): 36.6(!)/42(!); scotopic 3.0 b wave (uV): 42(!)/20.7(!); photopic 3.0 a wave (uV): 30.6/8.3(!); photopic 3.0 b wave (uV): 18.1(!)/46.2(!); photopic 30 Hz flicker (uV): 2.72(!)/24.1(!)" "25y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304323" "04214" "00412318" "00000" "Isolated (sporadic)" "53y" "best corrected visual acuity right/left eye: 0.4; color vision: normal/0.6; fundus: attenuated vessels, pigmentry deposit; visual field: tunnel; scotopic 0.01 b wave (uV): 7.49(!)/3.91(!); scotopic 3.0 a wave (uV): 10.3(!)/6.84(!); scotopic 3.0 b wave (uV): 7.08(!)/6.84(!); photopic 3.0 a wave (uV): 2.15(!)/9.57(!); photopic 3.0 b wave (uV): 12.1(!)/15.7(!); photopic 30 Hz flicker (uV): not available/not available" "20y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304324" "04214" "00412319" "00000" "Isolated (sporadic)" "24y" "best corrected visual acuity right/left eye: 1; color vision: normal/0.8; fundus: right eye normal, left eye: pigmentry deposit; visual field: L:narrowed; scotopic 0.01 b wave (uV): 139/52(!); scotopic 3.0 a wave (uV): 158/106(!); scotopic 3.0 b wave (uV): 365/260(!); photopic 3.0 a wave (uV): 43.3/24.7(!); photopic 3.0 b wave (uV): 170/109; photopic 30 Hz flicker (uV): 94.6/70.9" "24y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304325" "04214" "00412320" "00000" "Familial, autosomal recessive" "32y" "best corrected visual acuity right/left eye: 0.6; color vision: normal/0.6; fundus: attenuated vessels, carpet-like retinal degeneration, pigmentry deposit; visual field: tunnel; scotopic 0.01 b wave (uV): 4.88(!)/9.52(!); scotopic 3.0 a wave (uV): 0.732(!)/2.69(!); scotopic 3.0 b wave (uV): 0.488(!)/8.79(!); photopic 3.0 a wave (uV): 0.684(!)/1.66(!); photopic 3.0 b wave (uV): 6.35(!)/8.5(!); photopic 30 Hz flicker (uV): 2.38(!)/5.19(!)" "30y" "" "night blindness" "not trafficked to the plasma membrane and accumulated intracellularly, with punctuated particles in the cytoplasm" "" "" "" "" "retinitis pigmentosa" "" "" "0000304326" "04214" "00412321" "00000" "Familial, autosomal recessive" "60y" "best corrected visual acuity right/left eye: 0.8; color vision: normal/0.6; fundus: slightly attenuated vessels; visual field: slightly reduced; scotopic 0.01 b wave (uV): 110/83.5(!); scotopic 3.0 a wave (uV): 261/230; scotopic 3.0 b wave (uV): 304/264(!); photopic 3.0 a wave (uV): 38.8/23.3(!); photopic 3.0 b wave (uV): 151/85.4(!); photopic 30 Hz flicker (uV): 94.1/48.3(!)" "" "" "asymptomatic carrier" "not trafficked to the plasma membrane and accumulated intracellularly, with punctuated particles in the cytoplasm" "" "" "" "" "retinitis pigmentosa" "" "" "0000304327" "04214" "00412322" "00000" "Familial, autosomal recessive" "57y" "best corrected visual acuity right/left eye: 0.8; color vision: normal/0.9; fundus: normal; visual field: slightly reduced; scotopic 0.01 b wave (uV): 168/125; scotopic 3.0 a wave (uV): 209/164; scotopic 3.0 b wave (uV): 439/339; photopic 3.0 a wave (uV): 48.7/42.5; photopic 3.0 b wave (uV): 239/206; photopic 30 Hz flicker (uV): 149/147" "" "" "asymptomatic carrier" "not trafficked to the plasma membrane and accumulated intracellularly, with punctuated particles in the cytoplasm" "" "" "" "" "retinitis pigmentosa" "" "" "0000304328" "04214" "00412323" "00000" "Familial, autosomal recessive" "31y" "best corrected visual acuity right/left eye: 0.5; color vision: normal/0.2; fundus: normal; visual field: normal; scotopic 0.01 b wave (uV): 286/264; scotopic 3.0 a wave (uV): 361/343; scotopic 3.0 b wave (uV): 647/603; photopic 3.0 a wave (uV): 44.8/50; photopic 3.0 b wave (uV): 229/211; photopic 30 Hz flicker (uV): 111/132" "" "" "asymptomatic carrier" "not trafficked to the plasma membrane and accumulated intracellularly, with punctuated particles in the cytoplasm" "" "" "" "" "retinitis pigmentosa" "" "" "0000304329" "04214" "00412324" "00000" "Familial, autosomal recessive" "29y" "best corrected visual acuity right/left eye: 1.2; color vision: normal/1.2; fundus: normal; visual field: normal; scotopic 0.01 b wave (uV): 237(!)/234(!); scotopic 3.0 a wave (uV): 231(!)/248(!); scotopic 3.0 b wave (uV): 394(!)/390(!); photopic 3.0 a wave (uV): 50/112; photopic 3.0 b wave (uV): 234/236; photopic 30 Hz flicker (uV): 139/156" "" "" "asymptomatic carrier" "not trafficked to the plasma membrane and accumulated intracellularly, with punctuated particles in the cytoplasm" "" "" "" "" "retinitis pigmentosa" "" "" "0000304387" "04214" "00412382" "00000" "Unknown" "38y" "visual acuity right; left eye: 0.12,0.2; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment bone spicule-like; electroretinogram, rod: reduced markedly, cone: undetectable" "36y" "" "poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304388" "04214" "00412383" "00000" "Familial, autosomal dominant" "40y" "visual acuity right; left eye: 0.3,0.4; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment deposit; electroretinogram, rod: not available, cone: not available" "20y" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304389" "04214" "00412384" "00000" "Isolated (sporadic)" "18y" "visual acuity right; left eye: 0.32,0.4; fundus change: attenuated retinal arteries, pinpoint-like retinal degeneration; electroretinogram, rod: not available, cone: not available" "3y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304390" "04214" "00412385" "00000" "Familial, autosomal dominant" "50y" "visual acuity right; left eye: 0.05,0.05; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment bone spicule-like, choroid sclerosis; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304391" "04214" "00412386" "00000" "Unknown" "74y" "visual acuity right; left eye: 0.5,1.0; fundus change: cup/disc ratio 1.0; electroretinogram, rod: not available, cone: not available" "" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304392" "04214" "00412387" "00000" "Familial, autosomal dominant" "38y" "visual acuity right; left eye: 0.6,0.6; fundus change: optic papilla wax yellow, attenuated retinal arteries, pinpoint-like retinal degeneration, pigment bone spicule-like; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304393" "04214" "00412388" "00000" "Familial, autosomal dominant" "5y" "visual acuity right; left eye: not available; fundus change: optic papilla wax yellow, attenuated retinal arteries, salt-and-pepper like retinal degeneration, pigment deposit; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304394" "04214" "00412389" "00000" "Familial, autosomal dominant" "36y" "visual acuity right; left eye: 0.3,0.3; fundus change: optic papilla wax yellow, attenuated retinal arteries, pinpoint-like retinal degeneration; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304395" "04214" "00412390" "00000" "Familial, autosomal dominant" "16y" "visual acuity right; left eye: 0.6,0.6; fundus change: optic papilla wax yellow, attenuated retinal arteries, pinpoint-like retinal degeneration; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304396" "04214" "00412391" "00000" "Familial, autosomal dominant" "29y" "visual acuity right; left eye: 0.4,0.5; fundus change: optic papilla wax yellow, attenuated retinal arteries, tapetal-like retinal degeneration, pigment deposit; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304397" "04214" "00412392" "00000" "Familial, autosomal dominant" "13y" "visual acuity right; left eye: 0.6,0.6; fundus change: not available; electroretinogram, rod: undetectable, cone: undetectable" "13y" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304398" "04214" "00412393" "00000" "Familial, autosomal dominant" "33y" "visual acuity right; left eye: not available; fundus change: retinitis pigmentosa; electroretinogram, rod: not available, cone: not available" "" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304399" "04214" "00412394" "00000" "Familial, autosomal dominant" "7y" "visual acuity right; left eye: 0.5,0.5; fundus change: attenuated retinal arteries; electroretinogram, rod: undetectable, cone: undetectable" "7y" "" "poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304400" "04214" "00412395" "00000" "Familial, autosomal dominant" "7y" "visual acuity right; left eye: 0.6,0.5; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment deposit; electroretinogram, rod: undetectable, cone: undetectable" "4y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304401" "04214" "00412396" "00000" "Familial, autosomal dominant" "26y" "visual acuity right; left eye: 0.5,0.4; fundus change: optic papilla light red, attenuated retinal arteries, tapetal-like retinal degeneration, macular degeneration; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304402" "04214" "00412397" "00000" "Familial, autosomal dominant" "6y" "visual acuity right; left eye: 0.4,0.6; fundus change: choroid sclerosis, retina lack of gloss; electroretinogram, rod: not available, cone: not available" "3y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304403" "04214" "00412398" "00000" "Familial, autosomal dominant" "3y" "visual acuity right; left eye: not available; fundus change: choroid sclerosis, retina lack of gloss; electroretinogram, rod: not available, cone: not available" "3y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304404" "04214" "00412399" "00000" "Familial, autosomal dominant" "44y" "visual acuity right; left eye: 0.8,0.8; fundus change: not available; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304405" "04214" "00412400" "00000" "Familial, autosomal dominant" "57y" "visual acuity right; left eye: 0.4,0.3; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment bone spicule-like, reduced foveal reflex; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304406" "04214" "00412401" "00000" "Familial, autosomal dominant" "42y" "visual acuity right; left eye: 0.6,0.6; fundus change: attenuated retinal arteries, pigment deposit, collagen-like retinal degeneration; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304407" "04214" "00412402" "00000" "Familial, autosomal dominant" "34y" "visual acuity right; left eye: 0.6,0.7; fundus change: optic papilla wax yellow, reduced foveal reflex, pigment bone spicule-like; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304408" "04214" "00412403" "00000" "Familial, autosomal dominant" "24y" "visual acuity right; left eye: 1.0,1.2; fundus change: normal; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304409" "04214" "00412404" "00000" "Familial, autosomal dominant" "14y" "visual acuity right; left eye: 1.2,1.5; fundus change: normal; electroretinogram, rod: undetectable, cone: reduced markedly" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304410" "04214" "00412405" "00000" "Familial, autosomal dominant" "30y" "visual acuity right; left eye: 0.6,0.6; fundus change: optic papilla wax yellow, attenuated retinal arteries, reduced foveal reflex, pigment deposit, choroid sclerosis; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304411" "04214" "00412406" "00000" "Familial, autosomal dominant" "32y" "visual acuity right; left eye: 0.5,0.5; fundus change: reduced foveal reflex, pigment deposit, pigment bone spicule-like; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304412" "04214" "00412407" "00000" "Familial, autosomal dominant" "32y" "visual acuity right; left eye: 0.3,light perception; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment deposit; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304413" "04214" "00412408" "00000" "Familial, autosomal dominant" "7y" "visual acuity right; left eye: 0.8,0.8; fundus change: normal; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304414" "04214" "00412409" "00000" "Unknown" "27y" "visual acuity right; left eye: 1.0,0.8; fundus change: not available; electroretinogram, rod: not available, cone: not available" "" "" "poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304415" "04214" "00412410" "00000" "Isolated (sporadic)" "24y" "visual acuity right; left eye: 0.8,0.5; fundus change: optic papilla wax yellow, attenuated retinal arteries, tapetal-like retinal degeneration, reduced foveal reflex; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304416" "04214" "00412411" "00000" "Unknown" "27y" "visual acuity right; left eye: 0.01,0.01; fundus change: pigment bone spicule-like,pinpoint-like retinal degeneration,macular degeneration; electroretinogram, rod: undetectable, cone: undetectable" "7y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304417" "04214" "00412412" "00000" "Familial, autosomal dominant" "15y" "visual acuity right; left eye: 0.4,0.32; fundus change: pigment bone spicule-like; electroretinogram, rod: undetectable, cone: undetectable" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304418" "04214" "00412413" "00000" "Unknown" "54y" "visual acuity right; left eye: 0.5,0.4; fundus change: retinitis pigmentosa; electroretinogram, rod: not available, cone: not available" "" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304419" "04214" "00412414" "00000" "Unknown" "39y" "visual acuity right; left eye: 0.5,0.4; fundus change: optic papilla wax yellow, attenuated retinal arteries, pigment deposit; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304420" "04214" "00412415" "00000" "Familial, autosomal dominant" "36y" "visual acuity right; left eye: 0.1,0.1; fundus change: attenuated retinal arteries, pigment bone spicule-like, macular degeneration; electroretinogram, rod: not available, cone: not available" "15y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304421" "04214" "00412416" "00000" "Familial, autosomal dominant" "" "visual acuity right; left eye: not available; fundus change: retinitis pigmentosa; electroretinogram, rod: not available, cone: not available" "" "" "not available" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304422" "04214" "00412417" "00000" "Familial, autosomal dominant" "66y" "visual acuity right; left eye: hand movement,hand movement; fundus change: not available; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304423" "04214" "00412418" "00000" "Familial, autosomal dominant" "10y" "visual acuity right; left eye: 0.9,0.4; fundus change: optic papilla wax yellow, attenuated retinal arteries, tapetal-like retinal degeneration, salt-and-pepper like retinal degeneration; electroretinogram, rod: not available, cone: not available" "<8y" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304424" "04214" "00412419" "00000" "Unknown" "" "undergone radial keratotomy to correct moderate myopia in both eyes in her twenties; best-corrected visual acuity: 20/20 both eyes; slit-lamp biomicroscopy: scars of the radial keratotomies in both eyes, otherwise unremarkable; only when questioned specifically about symptoms of RP, she reported difficulty navigating at night, as well as mild photophobia; fundoscopy: bilateral, but only very limited sectors of intraretinal pigment migration and retinal pigment epithelium alterations, especially nasally to the optic disc; blue light autofluorescence: patches of hyperautofluorescence randomly distributed and interspersed by normal areas throughout the retina in both eyes. The left eye was more affected than the right eye – a patchy distribution is typically seen in female carriers of X-linked RP, due to the female X-inactivation, also known as lionization (here a phenocopy); Goldmann visual fields: normal except for a very mild decrease in sensitivity in the midperipheral fields; full field-flash electroretinram: a reduction of the amplitudes of scotopic, rod-specific and mixed rod-cone responses as well as photopic cone-specific responses to 70% of normal values, with a mild delay of the peak times for all" "" "45y" "subsymptomatic; difficulty navigating at night, as well as mild photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304425" "04214" "00412420" "00000" "Familial, autosomal dominant" "" "best-corrected visual acuity: 20/20 both eyes; slit-lamp examination: unremarkable; fundoscopy: attenuated retinal blood vessels, peripheral outer retinal atrophy and retinal pigment epithelium alterations together with spicular intraretinal pigment migrations; optical coherence tomography: confirmed perimacular outer retinal atrophy plus bilateral cystoid macular edema; blue-light autofluorescence: a mottled aspect of a mostly hypoautofluorescent retinal periphery, with a small hyperautofluorescent ring surrounding the central macula; near-infrared autofluorescence: a fairly homogeneous hyperautofluorescent central macular area with diffuse hypo-autofluorescence around it; both eyes affected equally; Goldmann visual fields: a normal central sensitivity and a loss of sensitivity in both the pericentral and midperipheral regions, however with normal peripheral limits; color vision testing: normal; full-field flash electroretinogram: absent scotopic rod-specific responses, significantly decreased combined rod-cone responses to intense flashes and significantly decreased and delayed photopic cone-specific responses" "6y" "21y" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304426" "04214" "00412421" "00000" "Familial, autosomal dominant" "" "general medical history: attention deficit disorder; best-corrected visual acuity: 20/20 both eyes; slit-lamp examination: unremarkable; fundoscopy: spicular intraretinal pigment migration and retinal pigment epithelium alterations in the retinal periphery; autofluorescence with blue light: a mottled hypo-autofluorescent retinal periphery; around the macula, a small, hyperautofluorescent ring with a hypo-autofluorescent zone around it; Goldmann visual fields: decreased pericentral sensitivity with normal peripheral limits; color vision testing: normal; full-field flash electroretinogram: considerably reduced and delayed scotopic rod-specific and photopic cone-specific all responses were decreased and delayed; imaging and functional testing showed individual III.2 was less severely affected than his elder brother (III.1)" "<3y" "19y" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304427" "04214" "00412422" "00000" "Familial, autosomal dominant" "71y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/0.9; color vision plates read; =<9/15 = abnormal): 12/15/12/15; visual field-II/1 isopter field area (deg sq.): 610/385; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent ring; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: mildly reduced, full field electroretinogram: undetectable, dark adapted 0.01 electroretinogram, normal light adapted amplitudes with prolonged peak times; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304428" "04214" "00412423" "00000" "Familial, autosomal dominant" "64y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 2045/1592; fundus: bone spicule pigmentation; fundus autofluorescence pattern: sectoral degeneration; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: normal, full field electroretinogram: undetectable, dark adapted 0.01 electroretinogram, normal light adapted responses, undetectable S-cone electroretinogram; phenotype classification: sector retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304429" "04214" "00412424" "00000" "Familial, autosomal dominant" "64y" "problems with daytime vision (age at onset): yes (63y); best corrected visual acuity right/left eye: 0.7/0.6; color vision plates read; =<9/15 = abnormal): 1/15/1/15; visual field-II/1 isopter field area (deg sq.): N/A/N/A; fundus: bone spicule pigmentation; fundus autofluorescence pattern: sectoral degeneration; no cystoid macular edema; electroretinography: not available; phenotype classification: sector retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304430" "04214" "00412425" "00000" "Familial, autosomal dominant" "55y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): NIA/NIA; visual field-II/1 isopter field area (deg sq.): 2298/2309; fundus: bone spicule pigmentation; fundus autofluorescence pattern: sectoral degeneration; no cystoid macular edema; electroretinography: not available; phenotype classification: sector retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304431" "04214" "00412426" "00000" "Familial, autosomal dominant" "65y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 0.9/0.8; color vision plates read; =<9/15 = abnormal): 4/15/2/15; visual field-II/1 isopter field area (deg sq.): 342/81; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent ring; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: reduced, full field electroretinogram: undetectable, dark adapted 0.01 electroretinogram, reduced light adapted responses, undetectable S-cone electroretinogram; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304432" "04214" "00412427" "00000" "Familial, autosomal dominant" "48y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 2073/; fundus: no bone spicule pigmentation; fundus autofluorescence pattern: normal; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: mildly reduced, full field electroretinogram: undetectable, dark adapted 0.01 electroretinogram, normal to slightly reduced light adapted responses with normal peak times, reduced S-cone electroretinogram; phenotype classification: congenital stationary night blindness" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000304433" "04214" "00412428" "00000" "Familial, autosomal dominant" "42y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 0.9/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 1220/1147; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent; no cystoid macular edema; electroretinography: not available; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304434" "04214" "00412429" "00000" "Familial, autosomal dominant" "39y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 876/927; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent; no cystoid macular edema; electroretinography: not available; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304435" "04214" "00412430" "00000" "Familial, autosomal dominant" "36y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 537/553; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent; no cystoid macular edema; electroretinography: not available; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304436" "04214" "00412431" "00000" "Familial, autosomal dominant" "38y" "problems with daytime vision (age at onset): yes (15y); best corrected visual acuity right/left eye: 0.6/0.4; color vision plates read; =<9/15 = abnormal): 1/15/1/15; visual field-II/1 isopter field area (deg sq.): 0/0; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: undetectable, full field electroretinogram: undetectable; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304437" "04214" "00412432" "00000" "Familial, autosomal dominant" "17y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1/1; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 3189/3377; fundus: no bone spicule pigmentation; fundus autofluorescence pattern: sectoral degeneration; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: normal, full field electroretinogram: undetectable, dark adapted 0.01 electroretinogram, normal to slightly reduced light adapted responses with normal peak times, normal S-cone electroretinogram; phenotype classification: congenital stationary night blindness" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000304438" "04214" "00412433" "00000" "Familial, autosomal dominant" "29y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1.0/1.0 ; color vision plates read; =<9/15 = abnormal): 10/15/13/15 ; visual field-II/1 isopter field area (deg sq.): 511/443; fundus: bone spicule pigmentation; fundus autofluorescence pattern: double hyperautofluorescent ring; no cystoid macular edema; electroretinography: both eyes: multifocal electroretinogram: reduced, full field electroretinogram: reduced, dark adapted 0.01 electroretinogram, reduced light adapted amplitudes with prolonged peak times ; phenotype classification: pericentral retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304439" "04214" "00412434" "00000" "Familial, autosomal dominant" "66y" "problems with daytime vision (age at onset): yes (46y); best corrected visual acuity right/left eye: 0.1/0.1; color vision plates read; =<9/15 = abnormal): 1/15/1/15; visual field-II/1 isopter field area (deg sq.): /; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent ring; cystoid macular edema; electroretinography: both eyes: full field electroretinogram: undetectable dark adapted 0.01 electroretinogram, undetectable light adapted electroretinogram amplitudes, undetectable S-cone electroretinogram, pattern electroretinogram significantly reduced; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304440" "04214" "00412435" "00000" "Familial, autosomal dominant" "41y" "problems with daytime vision (age at onset): yes (37y); best corrected visual acuity right/left eye: 0.2/0.1; color vision plates read; =<9/15 = abnormal): 0/15/0/15; visual field-II/1 isopter field area (deg sq.): 91/107; fundus: bone spicule pigmentation; fundus autofluorescence pattern: hyperautofluorescent ring; cystoid macular edema; electroretinography: both eyes: multifocal: undetectable in the foveolar region and reduced towards periphery; full field electroretinogram: undetectable dark adapted 0.01 electroretinogram, reduced light adapted electroretinogram amplitudes with severely prolonged peak times, undetectable S-cone electroretinogram; phenotype classification: classic retinitis pigmentosa" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304441" "04214" "00412436" "00000" "Familial, autosomal dominant" "8y" "problems with daytime vision (age at onset): no; best corrected visual acuity right/left eye: 1.0/1.0; color vision plates read; =<9/15 = abnormal): 15/15/15/15; visual field-II/1 isopter field area (deg sq.): 933/252; fundus: no bone spicule pigmentation; fundus autofluorescence pattern: normal; no cystoid macular edema; electroretinography: both eyes: full field electroretinogram: undetectable dark adapted 0.01 electroretinogram, borderline light adapted electroretinogram amplitudes with borderline prolonged peak times; phenotype classification: congenital stationary night blindness" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000304444" "04214" "00412439" "00000" "Familial, autosomal dominant" "58y" "affected paternal grandmother and her 2 daughters, father asymptomatic; progressive loss of vision and flashes of light in both eyes; ocular history: progressive nyctalopia gradually worsening since her childhood; medical history: asthma, depression, musculoskeletal pain, well-controlled hypertension, and hyperlipidemia, systemic medications included hydrochlorothiazide, lisinopril, aspirin, albuterol, buspirone, duloxetine, lorazepam, gabapentin, hydrocodone-acetaminophen, tizanidine, and trazodone; best-corrected visual acuity right, left eye: 20/40, 20/30; intraocular pressure right/left eye: 20 / 19; anterior segment examination: unremarkable; fundoscopy right eye: normal optic nerve with a cup-to-disc ratio of 0.1 bilaterally, posterior pole: perimacular pigmentary changes in a bull\'s-eye pattern, large area of retinal atrophy in a doughnut shape around vascular arcades; attenuated vasculature in the area of the dystrophic retina; periphery - bone spicule pigmentation along the inferonasal quadrant; fuoscopy left eye: similar findings, bone spicules in the inferotemporal quadrant; color scanning laser ophthalmoscopy: minimal bone spicule pigmentation largely in the right eye, with circumferential midperipheral atrophy in both eyes; ultra-wide-field fundus autofluorescence: macular autofluorescence changes in a bull\'s-eye pattern both eyes with a midperipheral ring of hyperautofluorescence, denoting the border between the functional and dysfunctional retina; atrophic area measured 160.7 sq. mm in right eye and 128.4 sq. mm in left eye; hyperreflective autofluorescent area measured 160.7 sq. mm in right eye and 128.4 sq. mm in left eye; structural optical coherence tomography: severe perifoveal ellipsoid zone disruption; central subfield thickness right/left eye: 234 / 233 um; photoreceptor layer - 75 um in right eye and 91 um in left eye optical coherence tomography-angiography: a large area superficial capillary nonperfusion corresponding the area of retinal degeneration - 514 sq. mm iye and 547 sq. mm in left eye; visual fields: visual fields: loss right, left eye: (- 14.46 dB, -13.19 dB), with generalized constriction and ring scotomas corresponding to the midperipheral ring of hyperautofluorescence seen on UWF-FAF; electroretinography: full-field electroretinogram: b-wave amplitudes were attenuated in both scotopic and photopic conditions; scotopic electroretinogram b-wave amplitudes (at 0.01 electroretinogram and 3.0 electroretinogram scotopic modes): 80.29 (normal 225.4+/-101.4) and 110.47 (312.9+/-134.1); photopic electroretinogram b-wave amplitude was 64.38 (normal 123.6+/-50.93) in right eye; scotopic electroretinogram b-wave amplitudes (at 0.01 electroretinogram and 3.0 electroretinogram scotopic modes): 116.8 (normal 225.4+/-101.4), 182.4 (312.9+/-134.1); photopic electroretinogram b-wave amplitude: 86.7 (normal 123.6+/-50.93) in left ey" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000304445" "04214" "00412440" "00000" "Familial, autosomal dominant" "38y" "no distortions, floaters, or flashing lights; best-corrected visual acuity right, left eye: 20/40-2 , 20/60-2; intraocular pressure 20 / 19 mmHg anterior segment examination: unremarkable; fundoscopy right eye: normal optic nerve with a cup-to-disc ratio of 0.1 bilaterally; fovea normal, large area of retinal atrophy along the inferior arcade, attenuated vasculature in the area of the dystrophic retina; periphery: bone spicule pigmentation along the inferonasal quadrant; fundoscopy left eye: similar findings, bone spicules in the inferotemporal quadrant; color scanning laser ophthalmoscopy: the area of retinal dystrophy largely confined to the inferior retina outside the vascular arcades; inferonasal perivascular pigmentary clumping and bone spicule formation in both eyes; ultra-wide-field fundus autofluorescence: ultra-wide-field fundus autofluorescence: lack of the bull\'s-eye pattern of the maculae, relative increase in the area of the dystrophic retina. The atrophic area measured 286 sq. mm in right eyed 281.5 sq. mm in left eye. The hyperreflective autofluorescent area: 247.1 sq. mm in right eye and 240.9 sq. mm in left eye; optical coherence tomography: severe perifoveal ellipsoid zone disruption; central subfield thickness right/left eye: 158 / 190 um, photoreceptor layer - 35 um in right eye and 41 um in left eye; degree of retinal atrophy much more pronounced compared to his mother; optical coherence tomography-angiography: revealed a large area of superficial capillary nonperfusion corresponding to the area of retinal degeneration - 690 sq. mm in right eye and 596 sq. mm in left eye; visual fields: more severe visual field loss; electroretinography: full-field electroretinogram: b-wave amplitudes were attenuated in both scotopic and photopic conditions; scotopic electroretinogram b-wave amplitudes (at 0.01 electroretinogram and 3.0 electroretinogram scotopic modes): 100.2 (normal 225.4+/-101.4), 63.1 (312.9+/-134.1); photopic electroretinogram b-wave amplitude: 51.48 (normal 123.6+/-50.93) in right eyotopic electroretinogram b-wave amplitudes: (at 0.01 electroretinogram and 3.0 electroretinogram scotopic modes): 84.82 (normal 225.4+/-101.4), 76.8 (312.9+/-134.1); photopic electroretinogram b-wave amplitude: 54.32 (normal 123.6+/-50.93) in left eye" "<18y" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000306194" "00198" "00414359" "00000" "Familial, autosomal dominant" "41y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa 4" "" "" "0000307188" "05611" "00415394" "00006" "Unknown" "50y" "40w-birth spontaneous vaginal, length 48 cm (-1.68), weight 2170 g (-3.09); hypotonia, failure to thrive; height 148cm (-2.28), weight 60Kg (+0.24)/ OFC: 48.5cm (-6.34), BMI 27.4 (1.59); severe intellectual disability; 8m-sit; 14m-stand; 18m-walk; not toilet trained; dependent for all cares; delayed speech, can speak few words and sing songs; not scholarized; autistic features; happy, <20y-aggressive; no sleep disturbances; no seizures; 35y-MRI brain/spinal normal; hypotonia; no hearing loss; bilateral keratoconus, retinitis pigmentosa, optic atrophy, 32y-corneal transplant; no pulmonary abnormalities; no cardiovascular abnormalities; constipation; no genitourinary abnormalities; no endocrinological abnormalities; no metabolic abnormalities; no skeletal/limb abnormalities; high forehead, deeply set eyes, bulbous tip of the nose, short philtrum, prominent upper central incisors" "" "" "" "" "" "" "" "" "" "" "" "0000311672" "04214" "00420424" "00000" "Familial, autosomal dominant" "36y6m" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311715" "04214" "00420467" "00000" "Familial, autosomal dominant" "35y8m" "" "5y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311837" "04214" "00420589" "00000" "Familial, autosomal dominant" "38y11m" "" "36y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000318078" "04214" "00426940" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "rod-cone dystrophy" "" "0000320355" "00112" "00429483" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320405" "00112" "00429533" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320439" "00112" "00429567" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320446" "00112" "00429574" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320458" "00112" "00429586" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320489" "00112" "00429617" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320511" "00112" "00429639" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320518" "00112" "00429646" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320520" "00112" "00429648" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320556" "00112" "00429684" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320591" "00112" "00429719" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320612" "00112" "00429740" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320694" "00112" "00429822" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320705" "00112" "00429833" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320712" "00112" "00429840" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320722" "00112" "00429850" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320731" "00112" "00429859" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320777" "00112" "00429905" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320811" "00112" "00429939" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320846" "00112" "00429974" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320853" "00112" "00429981" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320872" "00112" "00430000" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320944" "00112" "00430072" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320952" "00112" "00430080" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320980" "00112" "00430108" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321005" "00112" "00430133" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321008" "00112" "00430136" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321011" "00112" "00430139" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321018" "00112" "00430146" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000325601" "00112" "00435410" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000333561" "04214" "00444308" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "0000336146" "00198" "00446947" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336147" "00198" "00446948" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336149" "00198" "00446950" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336150" "00198" "00446951" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336151" "00198" "00446952" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336157" "00198" "00446958" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336162" "00198" "00446963" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal dominant" "" "0000336167" "00198" "00446968" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336189" "00198" "00446990" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336207" "00198" "00447008" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336508" "00198" "00447309" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336749" "00198" "00447550" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "0000336816" "00198" "00447617" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336820" "00198" "00447621" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000348575" "04214" "00461075" "00006" "Familial, autosomal dominant" "" "" "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348581" "04214" "00461081" "00006" "Familial, autosomal dominant" "" "" "50y-59y" "" "" "" "" "" "" "" "" "retinal disease" "" "0000348585" "04214" "00461085" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348589" "04214" "00461089" "00006" "Familial, autosomal dominant" "" "" "5y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348609" "04214" "00461109" "00006" "Familial, autosomal dominant" "" "" "42y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348614" "04214" "00461114" "00006" "Familial, autosomal dominant" "" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348638" "04214" "00461138" "00006" "Familial, autosomal dominant" "" "" "23y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ## Screenings ## Do not remove or alter this header ## ## Count = 1946 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000008" "00000008" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000029" "00000029" "1" "00004" "" "2012-05-11 13:18:42" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000041" "00000041" "1" "00004" "" "2012-05-11 13:18:46" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000101" "00000101" "1" "00004" "" "2012-05-11 13:19:44" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000001584" "00001781" "1" "00102" "00102" "2013-08-08 17:08:33" "" "" "SEQ-NG-I" "DNA" "" "" "0000033188" "00033120" "1" "00229" "00229" "2012-02-04 15:57:29" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033208" "00033140" "1" "00229" "00229" "2012-02-04 15:57:29" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033227" "00033159" "1" "00229" "00229" "2012-02-04 15:57:29" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000208645" "00207607" "1" "01244" "01244" "2018-11-26 16:02:40" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000233520" "00232421" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233521" "00232422" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233522" "00232423" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233523" "00232424" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233524" "00232425" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233525" "00232426" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233526" "00232427" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233527" "00232428" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233528" "00232429" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233529" "00232430" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233530" "00232431" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233531" "00232432" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233532" "00232433" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233533" "00232434" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233534" "00232435" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233535" "00232436" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233536" "00232437" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233537" "00232438" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233538" "00232439" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233539" "00232440" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233540" "00232441" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233541" "00232442" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233542" "00232443" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233543" "00232444" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233544" "00232445" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233545" "00232446" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233546" "00232447" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233547" "00232448" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233548" "00232449" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233549" "00232450" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233550" "00232451" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233551" "00232452" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234756" "00233657" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234757" "00233658" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000247779" "00246668" "1" "00006" "00006" "2019-07-15 21:30:54" "" "" "SEQ" "DNA" "" "" "0000247780" "00246669" "1" "00006" "00006" "2019-07-15 21:38:14" "" "" "SEQ" "DNA" "" "" "0000247781" "00246670" "1" "00006" "00006" "2019-07-15 21:44:04" "" "" "SEQ" "DNA" "" "" "0000271096" "00269943" "1" "01848" "01848" "2019-12-10 15:30:23" "" "" "SEQ-NG" "DNA" "" "clinical exome sequencing" "0000294380" "00293212" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294381" "00293213" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000301364" "00300246" "1" "00006" "00006" "2020-04-24 14:53:56" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000306053" "00304924" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309688" "00308543" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309689" "00308544" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309690" "00308545" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309691" "00308546" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309692" "00308547" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309693" "00308548" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309694" "00308549" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309785" "00308640" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000309786" "00308641" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000310503" "00309358" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310504" "00309359" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310505" "00309360" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310506" "00309361" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310507" "00309362" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310508" "00309363" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310509" "00309364" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310510" "00309365" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310511" "00309366" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310512" "00309367" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310513" "00309368" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000321003" "00319822" "1" "00008" "00008" "2020-11-08 09:25:19" "" "" "?" "DNA" "" "" "0000321016" "00319835" "1" "00008" "00008" "2020-11-08 09:25:19" "" "" "DGGE; SSCA" "DNA" "" "" "0000326661" "00325450" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326705" "00325494" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000327892" "00326679" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "DHPLC" "DNA" "blood" "" "0000327893" "00326680" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "DHPLC" "DNA" "blood" "" "0000327894" "00326681" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "DHPLC" "DNA" "blood" "" "0000327905" "00326692" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "arraySEQ" "DNA" "blood" "" "0000327915" "00326702" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327916" "00326703" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327917" "00326704" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327918" "00326705" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327919" "00326706" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327920" "00326707" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327921" "00326708" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327922" "00326709" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327923" "00326710" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327924" "00326711" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327925" "00326712" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327926" "00326713" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327927" "00326714" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327928" "00326715" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327929" "00326716" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327930" "00326717" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327931" "00326718" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327932" "00326719" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327933" "00326720" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327934" "00326721" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327935" "00326722" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327936" "00326723" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327937" "00326724" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327938" "00326725" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327939" "00326726" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327940" "00326727" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327941" "00326728" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327942" "00326729" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327943" "00326730" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327944" "00326731" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327945" "00326732" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327946" "00326733" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327947" "00326734" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327948" "00326735" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327949" "00326736" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327950" "00326737" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327951" "00326738" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327952" "00326739" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327953" "00326740" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327954" "00326741" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327955" "00326742" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327956" "00326743" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327957" "00326744" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327958" "00326745" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327959" "00326746" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327960" "00326747" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327961" "00326748" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327962" "00326749" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327963" "00326750" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327964" "00326751" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327965" "00326752" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327966" "00326753" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327967" "00326754" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327968" "00326755" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327969" "00326756" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327970" "00326757" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327971" "00326758" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000327972" "00326759" "1" "00008" "00008" "2021-01-14 12:40:33" "" "" "SSCA; SEQ" "DNA" "" "" "0000329252" "00328037" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329267" "00328052" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329303" "00328088" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329305" "00328090" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS" "0000329381" "00328166" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329389" "00328174" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329514" "00328299" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329615" "00328401" "1" "00000" "00006" "2021-01-27 14:27:38" "" "" "SEQ-NG" "DNA" "" "WES" "0000329649" "00328435" "1" "00000" "00006" "2021-01-27 14:27:38" "" "" "SEQ-NG" "DNA" "" "WES" "0000329694" "00328479" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000332490" "00331270" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332491" "00331271" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000333723" "00332499" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000333750" "00332526" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333753" "00332529" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333756" "00332532" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333762" "00332538" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000334584" "00333359" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334611" "00333386" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334631" "00333406" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334632" "00333407" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334633" "00333408" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334634" "00333409" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334738" "00333512" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334739" "00333513" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334740" "00333514" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334741" "00333515" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334742" "00333516" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334743" "00333517" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334744" "00333518" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334796" "00333570" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334797" "00333571" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334798" "00333572" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334799" "00333573" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334800" "00333574" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334801" "00333575" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334802" "00333576" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334821" "00333595" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334822" "00333596" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334823" "00333597" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334824" "00333598" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334825" "00333599" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334826" "00333600" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334827" "00333601" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334828" "00333602" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334829" "00333603" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334830" "00333604" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334831" "00333605" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334832" "00333606" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334833" "00333607" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000334834" "00333608" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" "" "0000335079" "00333853" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335080" "00333854" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335144" "00333918" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335204" "00333978" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335205" "00333979" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335206" "00333980" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335659" "00334430" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000336378" "00335149" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000336448" "00335219" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel" "0000336528" "00335299" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336529" "00335300" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336530" "00335301" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336614" "00335385" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336615" "00335386" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336632" "00335403" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336668" "00335439" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336721" "00335492" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336771" "00335543" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336772" "00335544" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336773" "00335545" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336774" "00335546" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336775" "00335547" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336776" "00335548" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336777" "00335549" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336778" "00335550" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336779" "00335551" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ-NG" "DNA" "" "" "0000336780" "00335552" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ-NG" "DNA" "" "" "0000336781" "00335553" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336782" "00335554" "1" "00000" "00006" "2021-03-07 17:58:39" "" "" "SEQ" "DNA" "" "" "0000336908" "00335680" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336909" "00335681" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336910" "00335682" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336911" "00335683" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336912" "00335684" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336913" "00335685" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336914" "00335686" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336915" "00335687" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336916" "00335688" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336917" "00335689" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336918" "00335690" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336919" "00335691" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336920" "00335692" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336921" "00335693" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336922" "00335694" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336923" "00335695" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336924" "00335696" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336925" "00335697" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336926" "00335698" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336927" "00335699" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336928" "00335700" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336929" "00335701" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336930" "00335702" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336931" "00335703" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336932" "00335704" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336933" "00335705" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336934" "00335706" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "SEQ" "DNA" "" "" "0000336963" "00335734" "1" "00000" "00006" "2021-03-08 18:54:41" "" "" "SEQ-NG" "DNA" "" "31-gene panel" "0000336964" "00335735" "1" "00000" "00006" "2021-03-08 18:54:41" "" "" "SEQ-NG" "DNA" "" "31-gene panel" "0000336965" "00335736" "1" "00000" "00006" "2021-03-08 18:54:41" "" "" "SEQ-NG" "DNA" "" "31-gene panel" "0000336966" "00335737" "1" "00000" "00006" "2021-03-08 18:54:41" "" "" "SEQ-NG" "DNA" "" "31-gene panel" "0000337179" "00335949" "1" "00000" "00006" "2021-03-09 16:40:10" "" "" "SEQ-NG" "DNA" "" "WES" "0000359964" "00358734" "1" "00000" "00006" "2021-03-11 13:59:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000359965" "00358735" "1" "00000" "00006" "2021-03-11 13:59:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000359966" "00358736" "1" "00000" "00006" "2021-03-11 13:59:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360024" "00358794" "1" "00000" "00006" "2021-03-12 09:26:03" "" "" "SEQ-NG" "DNA" "" "226-gene panel" "0000360161" "00358928" "1" "00000" "00006" "2021-03-17 15:00:07" "" "" "SEQ-NG" "DNA" "" "WES" "0000360187" "00358950" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360238" "00359001" "1" "00006" "00006" "2021-03-18 13:35:02" "" "" "arraySEQ;SEQ" "DNA" "" "" "0000360367" "00359129" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360379" "00359141" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360392" "00359154" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360408" "00359170" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360430" "00359192" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360450" "00359212" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000362654" "00361426" "1" "04036" "00006" "2021-04-06 16:50:09" "" "" "PCR;SEQ;SEQ-NG" "DNA" "blood" "WES" "0000362672" "00361444" "1" "04036" "00006" "2021-04-06 16:50:09" "" "" "DHPLC;PCR;SEQ" "DNA" "blood" "" "0000363482" "00362253" "1" "02404" "02404" "2021-04-17 14:28:44" "" "" "SEQ-NG-I" "DNA" "" "Exome sequencing" "0000364118" "00362890" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364119" "00362891" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364620" "00363392" "1" "00000" "00006" "2021-04-26 18:22:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000364633" "00363405" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364634" "00363406" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364635" "00363407" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364636" "00363408" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364637" "00363409" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364638" "00363410" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364639" "00363411" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364640" "00363412" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364641" "00363413" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364642" "00363414" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364649" "00363421" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ" "DNA" "" "gene panel" "0000364668" "00363440" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364695" "00363467" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364696" "00363468" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364732" "00363504" "1" "00000" "00006" "2021-04-29 10:58:03" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364733" "00363505" "1" "00000" "00006" "2021-04-29 10:58:03" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364734" "00363506" "1" "00000" "00006" "2021-04-29 10:58:03" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373309" "00372081" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel" "0000373312" "00372084" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel" "0000373733" "00372500" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373855" "00372623" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373856" "00372624" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373857" "00372625" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373858" "00372626" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373859" "00372627" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373860" "00372628" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373861" "00372629" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373862" "00372630" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373863" "00372631" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373933" "00372701" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374574" "00373339" "1" "00006" "00006" "2021-05-13 19:53:56" "" "" "arraySNP;SEQ" "DNA" "" "" "0000374605" "00373370" "1" "00000" "00006" "2021-05-14 10:24:46" "" "" "PE;SEQ" "DNA" "" "APEX" "0000374702" "00373467" "1" "00000" "00006" "2021-05-14 16:56:19" "" "" "SEQ-NG" "DNA" "" "73-gene panel" "0000374745" "00373510" "1" "00000" "00006" "2021-05-14 19:24:06" "" "" "SEQ-NG" "DNA" "" "316-gene panel" "0000374747" "00373512" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000374748" "00373513" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000374749" "00373514" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000374750" "00373515" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000374751" "00373516" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000374752" "00373517" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000375048" "00373816" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "arraySEQ" "DNA" "" "Reseq" "0000375051" "00373819" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "arraySEQ" "DNA" "" "Reseq" "0000375144" "00373912" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375147" "00373915" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375152" "00373920" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375177" "00373945" "1" "00000" "00006" "2021-05-21 15:48:04" "" "" "SEQ-NG" "DNA" "" "" "0000375182" "00373950" "1" "00000" "00006" "2021-05-21 15:48:04" "" "" "SEQ-NG" "DNA" "" "" "0000375190" "00373958" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375191" "00373959" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375192" "00373960" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375193" "00373961" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375194" "00373962" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375195" "00373963" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375196" "00373964" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375197" "00373965" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375198" "00373966" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375199" "00373967" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375200" "00373968" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375201" "00373969" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375202" "00373970" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375203" "00373971" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375204" "00373972" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375205" "00373973" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375206" "00373974" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375207" "00373975" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375208" "00373976" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375209" "00373977" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375210" "00373978" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375211" "00373979" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375212" "00373980" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375213" "00373981" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375214" "00373982" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375215" "00373983" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375216" "00373984" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ" "DNA" "" "" "0000375217" "00373985" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ;SSCA" "DNA" "" "" "0000375218" "00373986" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375219" "00373987" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375220" "00373988" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375221" "00373989" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375222" "00373990" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375223" "00373991" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "SEQ;SSCA" "DNA" "" "" "0000375224" "00373992" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375225" "00373993" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375226" "00373994" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375227" "00373995" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "DGGE;SEQ" "DNA" "" "" "0000375228" "00373996" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375229" "00373997" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375230" "00373998" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000375231" "00373999" "1" "00000" "00006" "2021-05-21 16:51:46" "" "" "arraySEQ" "DNA" "" "RP chip" "0000376104" "00374910" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel" "0000376120" "00374926" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel" "0000376122" "00374928" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel" "0000376129" "00374935" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel" "0000376480" "00375283" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376481" "00375284" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376482" "00375285" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376483" "00375286" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376501" "00375304" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376502" "00375305" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376503" "00375306" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376607" "00375410" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376650" "00375453" "1" "00000" "00006" "2021-06-04 11:36:57" "" "" "SEQ-NG" "DNA" "" "179-gene panel" "0000377364" "00376168" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377372" "00376176" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377373" "00376177" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377379" "00376183" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377381" "00376185" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377490" "00376294" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377687" "00376482" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377688" "00376483" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377689" "00376484" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377690" "00376485" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377691" "00376486" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377692" "00376487" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377693" "00376488" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377694" "00376489" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377706" "00376501" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377707" "00376502" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377708" "00376503" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377709" "00376504" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377710" "00376505" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SSCA" "DNA" "blood" "" "0000377730" "00376525" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "arraySEQ" "DNA" "" "" "0000377731" "00376526" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "arraySEQ" "DNA" "" "" "0000377732" "00376527" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "arraySEQ" "DNA" "" "" "0000377733" "00376528" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ; arraySEQ" "DNA" "blood" "" "0000377952" "00376746" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377975" "00376769" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377982" "00376776" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377989" "00376783" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000378198" "00376993" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" "" "0000378199" "00376994" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" "" "0000378200" "00376995" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" "" "0000378201" "00376996" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" "" "0000378202" "00376997" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" "" "0000378420" "00377215" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378446" "00377241" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378451" "00377246" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378452" "00377247" "1" "00000" "03840" "2021-07-16 14:18:12" "" "" "SEQ" "DNA" "buccal cells" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378453" "00377248" "1" "00000" "03840" "2021-07-16 14:18:12" "" "" "SEQ" "DNA" "buccal cells" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378454" "00377249" "1" "00000" "03840" "2021-07-16 14:18:12" "" "" "SEQ" "DNA" "buccal cells" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378455" "00377250" "1" "00000" "03840" "2021-07-16 14:18:12" "" "" "SEQ" "DNA" "buccal cells" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378457" "00377252" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378619" "00377416" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378620" "00377417" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378621" "00377418" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378622" "00377419" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378623" "00377420" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378624" "00377421" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378625" "00377422" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378626" "00377423" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378627" "00377424" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378628" "00377425" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378629" "00377426" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378630" "00377427" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378631" "00377428" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378632" "00377429" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378633" "00377430" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378634" "00377431" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378635" "00377432" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378636" "00377433" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378637" "00377434" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378638" "00377435" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378639" "00377436" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378640" "00377437" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378641" "00377438" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378642" "00377439" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378643" "00377440" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378644" "00377441" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378645" "00377442" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378646" "00377443" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378647" "00377444" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378648" "00377445" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378649" "00377446" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378650" "00377447" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378651" "00377448" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378652" "00377449" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378653" "00377450" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378654" "00377451" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378655" "00377452" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378656" "00377453" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378657" "00377454" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378658" "00377455" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378659" "00377456" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378660" "00377457" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378661" "00377458" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378662" "00377459" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378663" "00377460" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378664" "00377461" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378665" "00377462" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378666" "00377463" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378667" "00377464" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378668" "00377465" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378669" "00377466" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378670" "00377467" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378671" "00377468" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378715" "00377512" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "MLPA" "DNA" "" "+SEQ-NG" "0000378933" "00377729" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "Lymphoblast" "" "0000378934" "00377730" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "Lymphoblast" "" "0000380593" "00379393" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380611" "00379411" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "WES" "0000380650" "00379450" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "WES" "0000380750" "00379550" "1" "03508" "03508" "2021-08-05 10:19:58" "" "" "SEQ-NG-I" "DNA" "" "" "0000380800" "00379601" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380801" "00379602" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380802" "00379603" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380803" "00379604" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380804" "00379605" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380805" "00379606" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ" "DNA" "blood" "adRP genotyping microarray" "0000380806" "00379607" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380807" "00379608" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380808" "00379609" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "arraySNP" "DNA" "blood" "adRP genotyping microarray" "0000380867" "00379667" "1" "03508" "03508" "2021-08-06 08:40:11" "" "" "SEQ-NG-I" "DNA" "" "" "0000381001" "00379798" "1" "03508" "03508" "2021-08-10 04:39:04" "" "" "SEQ-NG-I" "DNA" "" "" "0000381002" "00379799" "1" "03508" "03508" "2021-08-10 05:14:21" "" "" "SEQ-NG-I" "DNA" "" "" "0000381071" "00379869" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381072" "00379870" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381073" "00379871" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381074" "00379872" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381075" "00379873" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381076" "00379874" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381443" "00380229" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381444" "00380230" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381445" "00380231" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381446" "00380232" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381447" "00380233" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381448" "00380234" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381449" "00380235" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381450" "00380236" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381451" "00380237" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381452" "00380238" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381453" "00380239" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381454" "00380240" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381455" "00380241" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381456" "00380242" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381457" "00380243" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381458" "00380244" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381459" "00380245" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR;SSCA" "DNA" "blood" "" "0000381462" "00380248" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000381463" "00380249" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000381464" "00380250" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000381473" "00380259" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000381474" "00380260" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000381475" "00380261" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "PCR" "DNA" "blood" "" "0000382211" "00380997" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay" "0000382213" "00380999" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay" "0000382230" "00381016" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySEQ;SEQ;PCR" "DNA" "blood" "" "0000382312" "00381098" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "RT-PCR" "DNA" "blood" "" "0000382829" "00381613" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382836" "00381620" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382853" "00381637" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382863" "00381647" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382884" "00381668" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382890" "00381674" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382896" "00381680" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382911" "00381695" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000382950" "00381734" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382951" "00381735" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382952" "00381736" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382953" "00381737" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382954" "00381738" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382955" "00381739" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382956" "00381740" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382957" "00381741" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382958" "00381742" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382959" "00381743" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382960" "00381744" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382961" "00381745" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382962" "00381746" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382963" "00381747" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382964" "00381748" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382965" "00381749" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382966" "00381750" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000382967" "00381751" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ;PCR" "DNA" "blood" "" "0000383021" "00381805" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR" "DNA" "blood" "" "0000383120" "00381904" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383121" "00381905" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383122" "00381906" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383123" "00381907" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383594" "00382380" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383595" "00382381" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383596" "00382382" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383597" "00382383" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383598" "00382384" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383599" "00382385" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383600" "00382386" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383601" "00382387" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383602" "00382388" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383603" "00382389" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383604" "00382390" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383605" "00382391" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383606" "00382392" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383607" "00382393" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383608" "00382394" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383609" "00382395" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383610" "00382396" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383611" "00382397" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383612" "00382398" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383613" "00382399" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383614" "00382400" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000384005" "00382789" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "microsat" "DNA" "" "" "0000384010" "00382794" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "microsat" "DNA" "" "" "0000384047" "00382831" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000384049" "00382833" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000384050" "00382834" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000384052" "00382836" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000384053" "00382837" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000384283" "00383059" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384285" "00383061" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384296" "00383072" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384297" "00383073" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384304" "00383080" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384311" "00383087" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384317" "00383093" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384319" "00383095" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384711" "00383486" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384712" "00383487" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384935" "00383710" "1" "00000" "03840" "2021-09-29 12:27:27" "" "" "SEQ-NG" "DNA" "blood" "267 gene panel" "0000385031" "00383806" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385062" "00383837" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis" "0000385301" "00384076" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385499" "00384274" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385556" "00384331" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385972" "00384746" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385973" "00384747" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386000" "00384774" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386001" "00384775" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386280" "00385051" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386952" "00385724" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 2 containing 316 genes" "0000386953" "00385725" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Whole exome sequencing" "0000387105" "00385877" "1" "00000" "03840" "2021-10-18 10:31:04" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387183" "00385955" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" "" "0000387393" "00386164" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387394" "00386165" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387432" "00386203" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387531" "00386302" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387775" "00386547" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387777" "00386549" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387782" "00386554" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387793" "00386565" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387817" "00386589" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387847" "00386619" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387874" "00386646" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387903" "00386675" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387914" "00386686" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387943" "00386715" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387948" "00386720" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388068" "00386840" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388222" "00386996" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388223" "00386997" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388224" "00386998" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388225" "00386999" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388226" "00387000" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388227" "00387001" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388228" "00387002" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388229" "00387003" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388230" "00387004" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388231" "00387005" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388232" "00387006" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388233" "00387007" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388234" "00387008" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388235" "00387009" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388236" "00387010" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388237" "00387011" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388238" "00387012" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388239" "00387013" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388240" "00387014" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388241" "00387015" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388242" "00387016" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388610" "00387384" "1" "00000" "03840" "2021-10-29 09:42:54" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000388611" "00387385" "1" "00000" "03840" "2021-10-29 09:42:54" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000388740" "00387514" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "PE" "DNA" "" "" "0000389793" "00388551" "1" "00000" "03840" "2021-11-04 19:02:37" "" "" "SEQ-NG-I;SEQ" "DNA" "blood;saliva" "targeted sequencing with 1 of 4 panels of OFTALMOgenics probes" "0000389967" "00388724" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000389968" "00388725" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000389969" "00388726" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390050" "00388807" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390090" "00388847" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390126" "00388883" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper" "0000390127" "00388884" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390128" "00388885" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390224" "00388981" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390225" "00388982" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390226" "00388983" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390227" "00388984" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390350" "00389107" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390351" "00389108" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390352" "00389109" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390456" "00389213" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390457" "00389214" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390507" "00389264" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper" "0000390508" "00389265" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390638" "00389395" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390722" "00389479" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390723" "00389480" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390732" "00389489" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET1 targeted sequencing panel - see paper" "0000390739" "00389496" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390740" "00389497" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET1 targeted sequencing panel - see paper" "0000390756" "00389513" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390757" "00389514" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390775" "00389532" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390776" "00389533" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390777" "00389534" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390781" "00389538" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390782" "00389539" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390786" "00389543" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390825" "00389582" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390826" "00389583" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390850" "00389607" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390866" "00389623" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390892" "00389649" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390893" "00389650" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390917" "00389674" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390921" "00389678" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390929" "00389686" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390931" "00389688" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390932" "00389689" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390933" "00389690" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390934" "00389691" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390936" "00389693" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390937" "00389694" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390939" "00389696" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390940" "00389697" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390944" "00389701" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390945" "00389702" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390949" "00389706" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390950" "00389707" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390957" "00389714" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390958" "00389715" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390959" "00389716" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390960" "00389717" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000391056" "00389813" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000391076" "00389833" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391137" "00389894" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000391183" "00389940" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391198" "00389955" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391200" "00389957" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391234" "00389991" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391251" "00390008" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391277" "00390036" "1" "00000" "03840" "2021-11-08 12:45:13" "" "" "SEQ-NG-I" "DNA" "blood" "326 selected genes from whole exome sequencing" "0000391604" "00390363" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391605" "00390364" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391606" "00390365" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391607" "00390366" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391608" "00390367" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391609" "00390368" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391610" "00390369" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000392630" "00391388" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing" "0000392827" "00391585" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000393556" "00392314" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "microsat;PCRq" "DNA" "blood" "linkage analysis and qPCR" "0000393558" "00392316" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393563" "00392321" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393564" "00392322" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393567" "00392325" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393578" "00392336" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393583" "00392341" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393589" "00392347" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ-NG" "DNA" "blood" "gene panel testing" "0000393590" "00392348" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393591" "00392349" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393594" "00392352" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393599" "00392357" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393603" "00392361" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393606" "00392364" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393609" "00392367" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393610" "00392368" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393617" "00392375" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393618" "00392376" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393624" "00392382" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393625" "00392383" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393628" "00392386" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393629" "00392387" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000393635" "00392393" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "microsat;PCRq" "DNA" "blood" "linkage analysis and qPCR" "0000393799" "00392552" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393800" "00392553" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393801" "00392554" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393802" "00392555" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393803" "00392556" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393804" "00392557" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393805" "00392558" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393806" "00392559" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393807" "00392560" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393808" "00392561" "1" "00000" "03840" "2021-11-23 11:29:41" "" "" "SEQ-NG" "DNA" "blood" "panel of 137 genes associated with retinal dystrophies" "0000393828" "00392581" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393856" "00392609" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393905" "00392658" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000394025" "00392778" "1" "00000" "03840" "2021-11-24 16:18:10" "" "" "SEQ" "DNA" "blood" "Sanger sequencing of 4 genes" "0000394026" "00392779" "1" "00000" "03840" "2021-11-24 16:18:10" "" "" "SEQ" "DNA" "blood" "Sanger sequencing of 4 genes" "0000394688" "00393440" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394782" "00393534" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394847" "00393599" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394854" "00393606" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394859" "00393611" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394888" "00393640" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394981" "00393733" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395158" "00393910" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395162" "00393914" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395576" "00394329" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis" "0000395753" "00394506" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395754" "00394507" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395755" "00394508" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395756" "00394509" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395757" "00394510" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395758" "00394511" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395759" "00394512" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395760" "00394513" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395761" "00394514" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395762" "00394515" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395763" "00394516" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395764" "00394517" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395765" "00394518" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395766" "00394519" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395767" "00394520" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395768" "00394521" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395769" "00394522" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000396797" "00395559" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "whole exome sequencing" "0000397157" "00395918" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397173" "00395934" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397190" "00395951" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397210" "00395971" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397211" "00395972" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397212" "00395973" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397213" "00395974" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397214" "00395975" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397215" "00395976" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397216" "00395977" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397217" "00395978" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397218" "00395979" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397219" "00395980" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397729" "00396486" "1" "00000" "03840" "2021-12-16 12:35:05" "" "" "SEQ-NG-I" "DNA" "blood" "panel of 254 genes implicated in retinopathies" "0000397752" "00396509" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397756" "00396513" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000409678" "00408421" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000410762" "00409498" "1" "00000" "03840" "2022-05-09 15:31:45" "" "" "SEQ" "DNA" "blood" "" "0000411872" "00410607" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "SEQ" "DNA" "" "" "0000411873" "00410608" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411874" "00410609" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411875" "00410610" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411876" "00410611" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411877" "00410612" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411878" "00410613" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411879" "00410614" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411880" "00410615" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411881" "00410616" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "SEQ" "DNA" "" "" "0000411882" "00410617" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411883" "00410618" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411884" "00410619" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411885" "00410620" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411886" "00410621" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "SEQ" "DNA" "" "" "0000411887" "00410622" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411888" "00410623" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411889" "00410624" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411890" "00410625" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411891" "00410626" "1" "00000" "03840" "2022-05-29 18:20:03" "" "" "RFLP" "DNA" "" "" "0000411892" "00410627" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411893" "00410628" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411894" "00410629" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411895" "00410630" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411896" "00410631" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411897" "00410632" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411898" "00410633" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411899" "00410634" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411900" "00410635" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411901" "00410636" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411902" "00410637" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411903" "00410638" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411904" "00410639" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411905" "00410640" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411906" "00410641" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411907" "00410642" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411908" "00410643" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411909" "00410644" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411910" "00410645" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411911" "00410646" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411912" "00410647" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411913" "00410648" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411914" "00410649" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411915" "00410650" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411916" "00410651" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411917" "00410652" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411918" "00410653" "1" "00000" "03840" "2022-05-29 19:25:05" "" "" "SEQ" "DNA" "" "" "0000411919" "00410654" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411920" "00410655" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411921" "00410656" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411922" "00410657" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411923" "00410658" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411924" "00410659" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411925" "00410660" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411926" "00410661" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411927" "00410662" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411928" "00410663" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411929" "00410664" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411930" "00410665" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411931" "00410666" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411932" "00410667" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411933" "00410668" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411934" "00410669" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411935" "00410670" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411936" "00410671" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411937" "00410672" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411938" "00410673" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411939" "00410674" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411940" "00410675" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411941" "00410676" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411942" "00410677" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411943" "00410678" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411944" "00410679" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411945" "00410680" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411946" "00410681" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411947" "00410682" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411948" "00410683" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411949" "00410684" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411950" "00410685" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411951" "00410686" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411952" "00410687" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411953" "00410688" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411954" "00410689" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411955" "00410690" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411956" "00410691" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411957" "00410692" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411958" "00410693" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411959" "00410694" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411960" "00410695" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411961" "00410696" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411962" "00410697" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411963" "00410698" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411964" "00410699" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411965" "00410700" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411966" "00410701" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411967" "00410702" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411968" "00410703" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411969" "00410704" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411970" "00410705" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411971" "00410706" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411972" "00410707" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411973" "00410708" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411974" "00410709" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411975" "00410710" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411976" "00410711" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411977" "00410712" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411978" "00410713" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411979" "00410714" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411980" "00410715" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411981" "00410716" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411982" "00410717" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411983" "00410718" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411984" "00410719" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411985" "00410720" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411986" "00410721" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411987" "00410722" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411988" "00410723" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411989" "00410724" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411990" "00410725" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411991" "00410726" "1" "00000" "03840" "2022-05-30 09:12:06" "" "" "SSCA" "DNA" "" "" "0000411992" "00410727" "1" "00000" "03840" "2022-05-30 09:26:36" "" "" "?" "DNA" "" "own laboratory results mentioned within a lecture, no technique mentioned" "0000411993" "00410728" "1" "00000" "03840" "2022-05-30 09:26:36" "" "" "?" "DNA" "" "own laboratory results mentioned within a lecture, no technique mentioned" "0000411994" "00410729" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SEQ;SSCA" "DNA" "" "" "0000411995" "00410730" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SSCA" "DNA" "" "" "0000411996" "00410731" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SSCA" "DNA" "" "" "0000411997" "00410732" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SSCA" "DNA" "" "" "0000411998" "00410733" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SSCA" "DNA" "" "" "0000411999" "00410734" "1" "00000" "03840" "2022-05-30 10:05:40" "" "" "SSCA" "DNA" "" "" "0000412001" "00410736" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412002" "00410737" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412003" "00410738" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412004" "00410739" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412005" "00410740" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412006" "00410741" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412007" "00410742" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412008" "00410743" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412009" "00410744" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412010" "00410745" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412011" "00410746" "1" "00000" "03840" "2022-05-30 11:11:24" "" "" "SEQ;Southern;SSCA" "DNA" "" "" "0000412036" "00410771" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412037" "00410772" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412038" "00410773" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412039" "00410774" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412040" "00410775" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412041" "00410776" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412042" "00410777" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412043" "00410778" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412044" "00410779" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412045" "00410780" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412046" "00410781" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412047" "00410782" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412048" "00410783" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412049" "00410784" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412050" "00410785" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412051" "00410786" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412052" "00410787" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412053" "00410788" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412054" "00410789" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412055" "00410790" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412056" "00410791" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412057" "00410792" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412058" "00410793" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412059" "00410794" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412060" "00410795" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412061" "00410796" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD" "DNA" "" "" "0000412062" "00410797" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD;RFLP" "DNA" "" "" "0000412063" "00410798" "1" "00000" "03840" "2022-05-30 14:24:40" "" "" "SEQ;HD;RFLP" "DNA" "" "" "0000412078" "00410813" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412079" "00410814" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412080" "00410815" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412081" "00410816" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412082" "00410817" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412083" "00410818" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412084" "00410819" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412085" "00410820" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412086" "00410821" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412087" "00410822" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412088" "00410823" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412089" "00410824" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412090" "00410825" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412091" "00410826" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412092" "00410827" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412093" "00410828" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412094" "00410829" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412095" "00410830" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412096" "00410831" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412097" "00410832" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412098" "00410833" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412099" "00410834" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412100" "00410835" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412101" "00410836" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412102" "00410837" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412103" "00410838" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412104" "00410839" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412105" "00410840" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412106" "00410841" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412107" "00410842" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412108" "00410843" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412109" "00410844" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412110" "00410845" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412111" "00410846" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412112" "00410847" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412113" "00410848" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412114" "00410849" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412115" "00410850" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412116" "00410851" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412117" "00410852" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412118" "00410853" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412119" "00410854" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412120" "00410855" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412121" "00410856" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412122" "00410857" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412123" "00410858" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412124" "00410859" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412125" "00410860" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412126" "00410861" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412127" "00410862" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412128" "00410863" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412129" "00410864" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412130" "00410865" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412131" "00410866" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412132" "00410867" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412133" "00410868" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412134" "00410869" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412135" "00410870" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412136" "00410871" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412137" "00410872" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412138" "00410873" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412139" "00410874" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412140" "00410875" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412141" "00410876" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412142" "00410877" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412143" "00410878" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412144" "00410879" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412145" "00410880" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412146" "00410881" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412147" "00410882" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412148" "00410883" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412149" "00410884" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412150" "00410885" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412151" "00410886" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412152" "00410887" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412153" "00410888" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412154" "00410889" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412155" "00410890" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412156" "00410891" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412157" "00410892" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412158" "00410893" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412159" "00410894" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412160" "00410895" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412161" "00410896" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412162" "00410897" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412163" "00410898" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412164" "00410899" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412165" "00410900" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412166" "00410901" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412167" "00410902" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412168" "00410903" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412169" "00410904" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412170" "00410905" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412171" "00410906" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412172" "00410907" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412173" "00410908" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412174" "00410909" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412175" "00410910" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412176" "00410911" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412177" "00410912" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412178" "00410913" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412179" "00410914" "1" "00000" "03840" "2022-05-30 15:44:16" "" "" "DGGE;ASO" "DNA" "" "" "0000412194" "00410929" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE;SEQ" "DNA" "" "" "0000412195" "00410930" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412196" "00410931" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412197" "00410932" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412198" "00410933" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412199" "00410934" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412200" "00410935" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE;SEQ" "DNA" "" "" "0000412201" "00410936" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412202" "00410937" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE" "DNA" "" "" "0000412203" "00410938" "1" "00000" "03840" "2022-05-30 16:02:30" "" "" "DGGE;SEQ" "DNA" "" "" "0000412336" "00411072" "1" "00000" "03840" "2022-06-01 12:27:42" "" "" "Southern" "DNA" "blood" "" "0000412337" "00411073" "1" "00000" "03840" "2022-06-01 12:27:42" "" "" "Southern" "DNA" "blood" "" "0000412338" "00411074" "1" "00000" "03840" "2022-06-01 12:27:42" "" "" "Southern" "DNA" "blood" "" "0000412339" "00411075" "1" "00000" "03840" "2022-06-01 12:27:42" "" "" "Southern" "DNA" "blood" "" "0000412340" "00411076" "1" "00000" "03840" "2022-06-01 12:51:14" "" "" "SEQ" "DNA" "blood" "" "0000412341" "00411077" "1" "00000" "03840" "2022-06-01 12:51:14" "" "" "SEQ" "DNA" "blood" "" "0000412342" "00411078" "1" "00000" "03840" "2022-06-01 12:51:14" "" "" "SEQ" "DNA" "blood" "" "0000412343" "00411079" "1" "00000" "03840" "2022-06-01 12:51:14" "" "" "SEQ" "DNA" "blood" "" "0000412344" "00411080" "1" "00000" "03840" "2022-06-01 12:51:14" "" "" "SEQ" "DNA" "blood" "" "0000412345" "00411081" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412346" "00411082" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412347" "00411083" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412348" "00411084" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412349" "00411085" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412350" "00411086" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412351" "00411087" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412352" "00411088" "1" "00000" "03840" "2022-06-01 13:32:40" "" "" "SEQ" "DNA" "blood" "" "0000412359" "00411096" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412360" "00411097" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412361" "00411098" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412362" "00411099" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412363" "00411100" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412364" "00411101" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412365" "00411102" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412366" "00411103" "1" "00000" "03840" "2022-06-01 15:00:43" "" "" "DGGE" "DNA" "blood" "" "0000412370" "00411107" "1" "00000" "03840" "2022-06-01 15:25:44" "" "" "DGGE" "DNA" "blood" "" "0000412371" "00411108" "1" "00000" "03840" "2022-06-01 15:25:44" "" "" "DGGE" "DNA" "blood" "" "0000412372" "00411109" "1" "00000" "03840" "2022-06-01 15:25:44" "" "" "DGGE" "DNA" "blood" "" "0000412373" "00411110" "1" "00000" "03840" "2022-06-01 15:25:44" "" "" "DGGE" "DNA" "blood" "" "0000412374" "00411111" "1" "00000" "03840" "2022-06-01 15:25:44" "" "" "DGGE" "DNA" "blood" "" "0000412381" "00411118" "1" "00000" "03840" "2022-06-01 15:57:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412395" "00411130" "1" "00000" "03840" "2022-06-01 23:03:16" "" "" "DGGE" "DNA" "blood" "" "0000412396" "00411131" "1" "00000" "03840" "2022-06-01 23:03:16" "" "" "DGGE" "DNA" "blood" "" "0000412397" "00411132" "1" "00000" "03840" "2022-06-01 23:03:16" "" "" "DGGE" "DNA" "blood" "" "0000412398" "00411133" "1" "00000" "03840" "2022-06-01 23:03:16" "" "" "DGGE" "DNA" "blood" "" "0000412399" "00411134" "1" "00000" "03840" "2022-06-01 23:03:16" "" "" "DGGE" "DNA" "blood" "" "0000412402" "00411137" "1" "00000" "03840" "2022-06-02 10:52:38" "" "" "Southern" "DNA" "blood" "" "0000412403" "00411138" "1" "00000" "03840" "2022-06-02 10:52:38" "" "" "Southern" "DNA" "blood" "" "0000412404" "00411139" "1" "00000" "03840" "2022-06-02 10:52:38" "" "" "Southern" "DNA" "blood" "" "0000412405" "00411140" "1" "00000" "03840" "2022-06-02 10:52:38" "" "" "Southern" "DNA" "blood" "" "0000412406" "00411141" "1" "00000" "03840" "2022-06-02 10:52:38" "" "" "Southern" "DNA" "blood" "" "0000412407" "00411142" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412408" "00411143" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412409" "00411144" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412410" "00411145" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412411" "00411146" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412412" "00411147" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412413" "00411148" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412414" "00411149" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412415" "00411150" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412416" "00411151" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412417" "00411152" "1" "00000" "03840" "2022-06-02 15:07:12" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412418" "00411153" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412419" "00411154" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412420" "00411155" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412421" "00411156" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412422" "00411157" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412423" "00411158" "1" "00000" "03840" "2022-06-03 10:28:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412435" "00411170" "1" "00000" "03840" "2022-06-06 10:55:17" "03840" "2022-06-06 11:07:29" "CMC;SEQ" "DNA" "blood" "" "0000412436" "00411171" "1" "00000" "03840" "2022-06-06 10:55:17" "03840" "2022-06-06 11:08:06" "CMC;SEQ" "DNA" "blood" "" "0000412437" "00411172" "1" "00000" "03840" "2022-06-06 10:55:17" "03840" "2022-06-06 11:09:05" "CMC;SEQ" "DNA" "blood" "" "0000412465" "00411200" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412466" "00411201" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412467" "00411202" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412468" "00411203" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412469" "00411204" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412470" "00411205" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412471" "00411206" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412472" "00411207" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412473" "00411208" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412474" "00411209" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412475" "00411210" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412476" "00411211" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412477" "00411212" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412478" "00411213" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412479" "00411214" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412480" "00411215" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412481" "00411216" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412482" "00411217" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412483" "00411218" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412484" "00411219" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412485" "00411220" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412486" "00411221" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412487" "00411222" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412488" "00411223" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412489" "00411224" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412490" "00411225" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412491" "00411226" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412492" "00411227" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412493" "00411228" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412494" "00411229" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412495" "00411230" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412496" "00411231" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412497" "00411232" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412498" "00411233" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412499" "00411234" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412500" "00411235" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412501" "00411236" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412502" "00411237" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412503" "00411238" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "SEQ" "DNA" "blood" "" "0000412504" "00411239" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412505" "00411240" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412506" "00411241" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412507" "00411242" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412508" "00411243" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412509" "00411244" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412510" "00411245" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412511" "00411246" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412512" "00411247" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412513" "00411248" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412514" "00411249" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412515" "00411250" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412516" "00411251" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412517" "00411252" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412518" "00411253" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412519" "00411254" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412520" "00411255" "1" "00000" "03840" "2022-06-08 11:16:42" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412522" "00411257" "1" "00000" "03840" "2022-06-09 10:57:25" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412523" "00411258" "1" "00000" "03840" "2022-06-09 10:57:25" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412524" "00411259" "1" "00000" "03840" "2022-06-09 10:57:25" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412525" "00411260" "1" "00000" "03840" "2022-06-09 10:57:25" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412530" "00411265" "1" "00000" "03840" "2022-06-09 20:33:07" "" "" "PCR;SEQ" "DNA" "" "" "0000412531" "00411266" "1" "00000" "03840" "2022-06-09 20:33:07" "" "" "PCR;SEQ" "DNA" "" "" "0000412532" "00411267" "1" "00000" "03840" "2022-06-09 20:33:07" "" "" "PCR;SEQ" "DNA" "" "" "0000412533" "00411268" "1" "00000" "03840" "2022-06-09 20:33:07" "" "" "PCR;SEQ" "DNA" "" "" "0000412534" "00411269" "1" "00000" "03840" "2022-06-09 20:33:07" "" "" "PCR;SEQ" "DNA" "" "" "0000412547" "00411278" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412548" "00411279" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412549" "00411280" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412550" "00411281" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412551" "00411282" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412552" "00411283" "1" "00000" "03840" "2022-06-10 10:28:29" "" "" "SEQ" "DNA" "blood" "" "0000412555" "00411286" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412556" "00411287" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412557" "00411288" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412558" "00411289" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412559" "00411290" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412560" "00411291" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412561" "00411292" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412562" "00411293" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412563" "00411294" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412564" "00411295" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412565" "00411296" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412566" "00411297" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412567" "00411298" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412568" "00411299" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412569" "00411300" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412570" "00411301" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412571" "00411302" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412572" "00411303" "1" "00000" "03840" "2022-06-10 13:51:43" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412573" "00411304" "1" "00000" "03840" "2022-06-10 14:18:32" "" "" "PCR;SEQ" "DNA" "blood" "" "0000412574" "00411305" "1" "00000" "03840" "2022-06-10 14:18:32" "" "" "PCR;SEQ" "DNA" "blood" "" "0000412575" "00411306" "1" "00000" "03840" "2022-06-10 14:18:32" "" "" "PCR;SEQ" "DNA" "blood" "" "0000412576" "00411307" "1" "00000" "03840" "2022-06-10 14:42:31" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412577" "00411308" "1" "00000" "03840" "2022-06-10 14:53:40" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412578" "00411309" "1" "00000" "03840" "2022-06-10 14:53:40" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412579" "00411310" "1" "00000" "03840" "2022-06-10 14:53:40" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412580" "00411311" "1" "00000" "03840" "2022-06-10 15:04:35" "" "" "SSCA;RFLP;SEQ" "DNA" "" "" "0000412581" "00411312" "1" "00000" "03840" "2022-06-10 15:13:46" "" "" "SSCA;SEQ" "DNA" "" "" "0000412582" "00411313" "1" "00000" "03840" "2022-06-10 15:13:46" "" "" "SSCA;SEQ" "DNA" "" "" "0000412583" "00411314" "1" "00000" "03840" "2022-06-10 15:13:46" "" "" "SSCA;SEQ" "DNA" "" "" "0000412584" "00411315" "1" "00000" "03840" "2022-06-10 15:13:46" "" "" "SSCA;SEQ" "DNA" "" "" "0000412585" "00411316" "1" "00000" "03840" "2022-06-10 15:13:46" "" "" "SSCA;SEQ" "DNA" "" "" "0000412586" "00411317" "1" "00000" "03840" "2022-06-10 15:29:07" "" "" "RFLP;SEQ" "DNA" "" "" "0000412587" "00411318" "1" "00000" "03840" "2022-06-10 15:29:07" "" "" "RFLP;SEQ" "DNA" "" "" "0000412588" "00411319" "1" "00000" "03840" "2022-06-10 15:29:07" "" "" "RFLP;SEQ" "DNA" "" "" "0000412589" "00411320" "1" "00000" "03840" "2022-06-10 15:29:07" "" "" "RFLP;SEQ" "DNA" "" "" "0000412637" "00411368" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412638" "00411369" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412639" "00411370" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412640" "00411371" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412641" "00411372" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412642" "00411373" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412643" "00411374" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412644" "00411375" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412645" "00411376" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412646" "00411377" "1" "00000" "03840" "2022-06-13 10:30:33" "" "" "RFLP;SEQ" "DNA" "" "" "0000412649" "00411380" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412650" "00411381" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412651" "00411382" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412652" "00411383" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412653" "00411384" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412654" "00411385" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412655" "00411386" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412656" "00411387" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412657" "00411388" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412658" "00411389" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412659" "00411390" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412660" "00411391" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412661" "00411392" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412662" "00411393" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412663" "00411394" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412664" "00411395" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412665" "00411396" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412666" "00411397" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412667" "00411398" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412668" "00411399" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412669" "00411400" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412670" "00411401" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412671" "00411402" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412672" "00411403" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412673" "00411404" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412674" "00411405" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412675" "00411406" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412676" "00411407" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412677" "00411408" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412678" "00411409" "1" "00000" "03840" "2022-06-13 11:08:11" "" "" "SSCA;SEQ" "DNA" "" "" "0000412680" "00411411" "1" "00000" "03840" "2022-06-13 11:23:46" "" "" "HD;RFLP;SEQ" "DNA" "" "" "0000412681" "00411412" "1" "00000" "03840" "2022-06-13 11:23:46" "" "" "HD;RFLP;SEQ" "DNA" "" "" "0000412685" "00411417" "1" "00000" "03840" "2022-06-13 12:08:59" "" "" "HD;RFLP;SEQ" "DNA" "" "" "0000412688" "00411419" "1" "00000" "03840" "2022-06-13 12:30:15" "" "" "DGGE;SEQ" "DNA" "" "" "0000412689" "00411420" "1" "00000" "03840" "2022-06-13 12:30:15" "" "" "DGGE;SEQ" "DNA" "" "" "0000412690" "00411421" "1" "00000" "03840" "2022-06-13 12:30:15" "" "" "DGGE;SEQ" "DNA" "" "" "0000412696" "00411427" "1" "00000" "03840" "2022-06-13 14:13:40" "" "" "HD;RFLP;SEQ" "DNA" "" "" "0000412697" "00411428" "1" "00000" "03840" "2022-06-13 14:13:40" "" "" "HD;RFLP;SEQ" "DNA" "" "" "0000412698" "00411429" "1" "00000" "03840" "2022-06-13 15:30:27" "" "" "DGGE;SEQ" "DNA" "" "" "0000412699" "00411430" "1" "00000" "03840" "2022-06-13 15:30:27" "" "" "RFLP;SEQ" "DNA" "" "" "0000412700" "00411431" "1" "00000" "03840" "2022-06-13 15:30:27" "" "" "RFLP;SEQ" "DNA" "" "" "0000412701" "00411432" "1" "00000" "03840" "2022-06-13 15:30:27" "" "" "RFLP;SEQ" "DNA" "" "" "0000412702" "00411433" "1" "00000" "03840" "2022-06-13 15:30:27" "" "" "RFLP;SEQ" "DNA" "" "" "0000412706" "00411437" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412707" "00411438" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412708" "00411439" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412709" "00411440" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412710" "00411441" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412711" "00411442" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412712" "00411443" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412713" "00411444" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412714" "00411445" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412715" "00411446" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412716" "00411447" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412717" "00411448" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412718" "00411449" "1" "00000" "03840" "2022-06-13 18:45:16" "" "" "SEQ" "DNA" "blood" "" "0000412729" "00411459" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412730" "00411460" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412731" "00411461" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412732" "00411462" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412733" "00411463" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412734" "00411464" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412735" "00411465" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412736" "00411466" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412737" "00411467" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412738" "00411468" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412739" "00411469" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412740" "00411470" "1" "00000" "03840" "2022-06-14 10:17:33" "" "" "SEQ" "DNA" "blood" "" "0000412741" "00411471" "1" "00000" "03840" "2022-06-14 10:43:30" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412742" "00411472" "1" "00000" "03840" "2022-06-14 10:43:30" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412743" "00411473" "1" "00000" "03840" "2022-06-14 10:43:30" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412744" "00411474" "1" "00000" "03840" "2022-06-14 10:43:30" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412745" "00411475" "1" "00000" "03840" "2022-06-14 10:43:30" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412746" "00411476" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412747" "00411477" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412748" "00411478" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412749" "00411479" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412750" "00411480" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412751" "00411481" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412752" "00411482" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412753" "00411483" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412754" "00411484" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412755" "00411485" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412756" "00411486" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412757" "00411487" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412758" "00411488" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412759" "00411489" "1" "00000" "03840" "2022-06-14 11:24:20" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412760" "00411490" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412761" "00411491" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412762" "00411492" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412763" "00411493" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412764" "00411494" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412765" "00411495" "1" "00000" "03840" "2022-06-14 11:39:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412767" "00411497" "1" "00000" "03840" "2022-06-14 11:52:18" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412768" "00411498" "1" "00000" "03840" "2022-06-14 11:52:18" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412769" "00411499" "1" "00000" "03840" "2022-06-14 11:52:18" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412770" "00411500" "1" "00000" "03840" "2022-06-14 11:52:18" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412772" "00411502" "1" "00000" "03840" "2022-06-14 12:01:30" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412773" "00411503" "1" "00000" "03840" "2022-06-14 13:04:14" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412776" "00411506" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412777" "00411507" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412778" "00411508" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412779" "00411509" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412780" "00411510" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412781" "00411511" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412782" "00411512" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412783" "00411513" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412784" "00411514" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412785" "00411515" "1" "00000" "03840" "2022-06-14 14:34:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000412786" "00411516" "1" "00000" "03840" "2022-06-14 14:47:31" "" "" "SSCA;SEQ" "DNA" "" "" "0000412787" "00411517" "1" "00000" "03840" "2022-06-14 15:16:33" "" "" "DGGE;SEQ" "DNA" "" "" "0000412788" "00411518" "1" "00000" "03840" "2022-06-14 15:16:33" "" "" "DGGE;SEQ" "DNA" "" "" "0000412789" "00411519" "1" "00000" "03840" "2022-06-14 15:16:33" "" "" "DGGE;SEQ" "DNA" "" "" "0000412790" "00411520" "1" "00000" "03840" "2022-06-14 15:16:33" "" "" "DGGE;SEQ" "DNA" "" "" "0000412792" "00411522" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412793" "00411523" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412794" "00411524" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412795" "00411525" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412796" "00411526" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412797" "00411527" "1" "00000" "03840" "2022-06-14 17:44:04" "" "" "RFLP;SEQ" "DNA" "" "" "0000412802" "00411532" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "SEQ" "DNA" "blood" "" "0000412803" "00411533" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "SEQ" "DNA" "blood" "" "0000412804" "00411534" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "SEQ" "DNA" "blood" "" "0000412805" "00411535" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412806" "00411536" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412807" "00411537" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412808" "00411538" "1" "00000" "03840" "2022-06-15 11:11:02" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412809" "00411539" "1" "00000" "03840" "2022-06-15 11:28:37" "" "" "SEQ" "DNA" "blood" "" "0000412810" "00411540" "1" "00000" "03840" "2022-06-15 11:28:37" "" "" "SEQ" "DNA" "blood" "" "0000412811" "00411541" "1" "00000" "03840" "2022-06-15 11:28:37" "" "" "SEQ" "DNA" "blood" "" "0000412812" "00411542" "1" "00000" "03840" "2022-06-15 11:28:37" "" "" "SEQ" "DNA" "blood" "" "0000412813" "00411543" "1" "00000" "03840" "2022-06-15 11:47:45" "" "" "DGGE;SEQ" "DNA" "blood" "" "0000412814" "00411544" "1" "00000" "03840" "2022-06-15 11:47:45" "" "" "DGGE;SEQ" "DNA" "blood" "" "0000412815" "00411545" "1" "00000" "03840" "2022-06-15 11:47:45" "" "" "DGGE;SEQ" "DNA" "blood" "" "0000412824" "00411554" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412825" "00411555" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412826" "00411556" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412827" "00411557" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412828" "00411558" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412829" "00411559" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412830" "00411560" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412831" "00411561" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412832" "00411562" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412833" "00411563" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412834" "00411564" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412835" "00411565" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412836" "00411566" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412837" "00411567" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412838" "00411568" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412839" "00411569" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412840" "00411570" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412841" "00411571" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412842" "00411572" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412843" "00411573" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412844" "00411574" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412845" "00411575" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412846" "00411576" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412847" "00411577" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412848" "00411578" "1" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412849" "00411579" "0" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412850" "00411580" "0" "00000" "03840" "2022-06-16 13:43:39" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412856" "00411584" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412857" "00411585" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412858" "00411586" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412859" "00411587" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412860" "00411588" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412861" "00411589" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412862" "00411590" "1" "00000" "03840" "2022-06-16 19:34:29" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412863" "00411591" "1" "00000" "03840" "2022-06-16 19:34:29" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412864" "00411592" "1" "00000" "03840" "2022-06-16 19:34:29" "" "" "RFLP;SEQ" "DNA" "blood" "" "0000412865" "00411593" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412866" "00411594" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412867" "00411595" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412868" "00411596" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412869" "00411597" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412870" "00411598" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412871" "00411599" "1" "00000" "03840" "2022-06-16 20:29:44" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412872" "00411600" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412873" "00411601" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412874" "00411602" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412875" "00411603" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412876" "00411604" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412877" "00411605" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412878" "00411606" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412879" "00411607" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412880" "00411608" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412881" "00411609" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412882" "00411610" "1" "00000" "03840" "2022-06-17 10:21:15" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000412885" "00411613" "1" "00000" "03840" "2022-06-17 16:34:59" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412886" "00411614" "1" "00000" "03840" "2022-06-17 16:34:59" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412887" "00411615" "1" "00000" "03840" "2022-06-17 16:34:59" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412888" "00411616" "1" "00000" "03840" "2022-06-17 16:34:59" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412889" "00411617" "1" "00000" "03840" "2022-06-17 17:08:24" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000412892" "00411620" "1" "00000" "03840" "2022-06-17 18:03:47" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412893" "00411621" "1" "00000" "03840" "2022-06-17 18:03:47" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412894" "00411622" "1" "00000" "03840" "2022-06-17 18:03:47" "" "" "ARMS;RFLP" "DNA" "blood" "" "0000412895" "00411623" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412896" "00411624" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412897" "00411625" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412898" "00411626" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412899" "00411627" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412900" "00411628" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412901" "00411629" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412902" "00411630" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412903" "00411631" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412904" "00411632" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412905" "00411633" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412906" "00411634" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412907" "00411635" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412908" "00411636" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412909" "00411637" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412910" "00411638" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412911" "00411639" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412912" "00411640" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412913" "00411641" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412914" "00411642" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412915" "00411643" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412916" "00411644" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412917" "00411645" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412918" "00411646" "1" "00000" "03840" "2022-06-17 18:38:18" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000412919" "00411647" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412920" "00411648" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412921" "00411649" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412922" "00411650" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412923" "00411651" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412924" "00411652" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412925" "00411653" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000412926" "00411654" "1" "00000" "03840" "2022-06-17 19:19:02" "" "" "SEQ" "DNA" "blood" "" "0000413107" "00411835" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413108" "00411836" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413109" "00411837" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413110" "00411838" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413111" "00411839" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413112" "00411840" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413113" "00411841" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413114" "00411842" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413115" "00411843" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413116" "00411844" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413117" "00411845" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413118" "00411846" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413119" "00411847" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413120" "00411848" "1" "00000" "03840" "2022-06-18 12:21:31" "" "" "SEQ" "DNA" "blood" "" "0000413121" "00411849" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413122" "00411850" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413123" "00411851" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413124" "00411852" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413125" "00411853" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413126" "00411854" "1" "00000" "03840" "2022-06-18 13:02:37" "" "" "CSGE;SEQ" "DNA" "blood" "" "0000413127" "00411855" "1" "00000" "03840" "2022-06-18 14:12:23" "" "" "SEQ" "DNA" "blood" "" "0000413128" "00411856" "1" "00000" "03840" "2022-06-18 14:12:23" "" "" "SEQ" "DNA" "blood" "" "0000413129" "00411857" "1" "00000" "03840" "2022-06-18 14:12:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000413130" "00411858" "1" "00000" "03840" "2022-06-18 14:12:23" "" "" "RFLP;SSCA;SEQ" "DNA" "blood" "" "0000413131" "00411859" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413132" "00411860" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413133" "00411861" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413134" "00411862" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413135" "00411863" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413136" "00411864" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413137" "00411865" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413138" "00411866" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413139" "00411867" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413140" "00411868" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413141" "00411869" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413142" "00411870" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413143" "00411871" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413144" "00411872" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413145" "00411873" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413146" "00411874" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413147" "00411875" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413148" "00411876" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413149" "00411877" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413150" "00411878" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413151" "00411879" "1" "00000" "03840" "2022-06-19 12:38:44" "" "" "SEQ" "DNA" "blood" "" "0000413152" "00411880" "1" "00000" "03840" "2022-06-19 16:37:48" "" "" "SEQ" "DNA" "blood" "" "0000413153" "00411881" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413154" "00411882" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413155" "00411883" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413156" "00411884" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413157" "00411885" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413158" "00411886" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413159" "00411887" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413160" "00411888" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413161" "00411889" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413162" "00411890" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413163" "00411891" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413164" "00411892" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413165" "00411893" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413166" "00411894" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413167" "00411895" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413168" "00411896" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413169" "00411897" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413170" "00411898" "1" "00000" "03840" "2022-06-19 17:52:22" "" "" "SEQ" "DNA" "blood" "" "0000413171" "00411899" "1" "00000" "03840" "2022-06-19 19:07:26" "" "" "SEQ" "DNA" "blood" "" "0000413172" "00411900" "1" "00000" "03840" "2022-06-19 19:07:26" "" "" "SEQ" "DNA" "blood" "" "0000413173" "00411901" "1" "00000" "03840" "2022-06-19 19:07:26" "" "" "SEQ" "DNA" "blood" "" "0000413174" "00411902" "1" "00000" "03840" "2022-06-19 19:07:26" "" "" "SEQ" "DNA" "blood" "" "0000413175" "00411903" "1" "00000" "03840" "2022-06-19 19:07:26" "" "" "SEQ" "DNA" "blood" "" "0000413176" "00411904" "1" "00000" "03840" "2022-06-19 19:31:47" "" "" "SEQ" "DNA" "blood" "" "0000413177" "00411905" "1" "00000" "03840" "2022-06-19 19:31:47" "" "" "SEQ" "DNA" "blood" "" "0000413178" "00411906" "1" "00000" "03840" "2022-06-19 19:31:47" "" "" "SEQ" "DNA" "blood" "" "0000413179" "00411907" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413180" "00411908" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413181" "00411909" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413182" "00411910" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413183" "00411911" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413184" "00411912" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413185" "00411913" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413186" "00411914" "1" "00000" "03840" "2022-06-19 20:36:04" "" "" "?" "DNA" "" "" "0000413188" "00411916" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413189" "00411917" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413190" "00411918" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413191" "00411919" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413192" "00411920" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413193" "00411921" "1" "00000" "03840" "2022-06-20 11:58:41" "" "" "?" "DNA" "" "" "0000413195" "00411923" "1" "00000" "03840" "2022-06-20 13:16:15" "" "" "SEQ" "DNA" "blood" "" "0000413196" "00411924" "1" "00000" "03840" "2022-06-20 13:16:15" "" "" "RFLP" "DNA" "blood" "" "0000413268" "00411995" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413269" "00411996" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413270" "00411997" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413271" "00411998" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413272" "00411999" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413273" "00412000" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413274" "00412001" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413275" "00412002" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413276" "00412003" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413277" "00412004" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413278" "00412005" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413279" "00412006" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413280" "00412007" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413281" "00412008" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413282" "00412009" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413283" "00412010" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413284" "00412011" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413285" "00412012" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413286" "00412013" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413287" "00412014" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413288" "00412015" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413289" "00412016" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413290" "00412017" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413291" "00412018" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413292" "00412019" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413293" "00412020" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413294" "00412021" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413295" "00412022" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413296" "00412023" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413297" "00412024" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413298" "00412025" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413299" "00412026" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413300" "00412027" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413301" "00412028" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413302" "00412029" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413303" "00412030" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413304" "00412031" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413305" "00412032" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413306" "00412033" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413307" "00412034" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413308" "00412035" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413309" "00412036" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413310" "00412037" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413311" "00412038" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413312" "00412039" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413313" "00412040" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413314" "00412041" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413315" "00412042" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413316" "00412043" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413317" "00412044" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413318" "00412045" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413319" "00412046" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413320" "00412047" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413321" "00412048" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413322" "00412049" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413323" "00412050" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413324" "00412051" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413325" "00412052" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413326" "00412053" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413327" "00412054" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413328" "00412055" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413329" "00412056" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413330" "00412057" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413331" "00412058" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413332" "00412059" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413333" "00412060" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413334" "00412061" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413335" "00412062" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413336" "00412063" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413337" "00412064" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413338" "00412065" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413339" "00412066" "1" "00000" "03840" "2022-06-21 13:19:22" "" "" "SEQ" "DNA" "blood" "" "0000413340" "00412067" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413341" "00412068" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413342" "00412069" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413343" "00412070" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413344" "00412071" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413345" "00412072" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413346" "00412073" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413347" "00412074" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413348" "00412075" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413349" "00412076" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413350" "00412077" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413351" "00412078" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413352" "00412079" "1" "00000" "03840" "2022-06-21 13:58:30" "" "" "STR;SEQ;RFLP" "DNA" "blood" "" "0000413365" "00412092" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413366" "00412093" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413367" "00412094" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413368" "00412095" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413369" "00412096" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413370" "00412097" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413371" "00412098" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413372" "00412099" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413373" "00412100" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413374" "00412101" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413375" "00412102" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413376" "00412103" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413377" "00412104" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413378" "00412105" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413379" "00412106" "1" "00000" "03840" "2022-06-21 16:53:27" "" "" "SEQ" "DNA" "blood" "" "0000413385" "00412112" "1" "00000" "03840" "2022-06-21 17:43:36" "" "" "STR;SEQ" "DNA" "blood" "" "0000413386" "00412113" "1" "00000" "03840" "2022-06-21 17:43:36" "" "" "STR;SEQ" "DNA" "blood" "" "0000413387" "00412114" "1" "00000" "03840" "2022-06-21 17:43:36" "" "" "STR;SEQ" "DNA" "blood" "" "0000413388" "00412115" "1" "00000" "03840" "2022-06-21 17:43:36" "" "" "STR;SEQ" "DNA" "blood" "" "0000413389" "00412116" "1" "00000" "03840" "2022-06-21 20:19:12" "" "" "?" "DNA" "" "" "0000413390" "00412117" "1" "00000" "03840" "2022-06-21 20:19:12" "" "" "?" "DNA" "" "" "0000413391" "00412118" "1" "00000" "03840" "2022-06-21 20:19:12" "" "" "?" "DNA" "" "" "0000413392" "00412119" "1" "00000" "03840" "2022-06-21 20:19:12" "" "" "?" "DNA" "" "" "0000413393" "00412120" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413394" "00412121" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413395" "00412122" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413396" "00412123" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413397" "00412124" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413398" "00412125" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413399" "00412126" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413400" "00412127" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413401" "00412128" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413402" "00412129" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413403" "00412130" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413404" "00412131" "1" "00000" "03840" "2022-06-21 22:09:29" "" "" "SEQ" "DNA" "blood" "" "0000413407" "00412134" "1" "00000" "03840" "2022-06-22 10:17:49" "" "" "?" "DNA" "" "" "0000413408" "00412135" "1" "00000" "03840" "2022-06-22 10:17:49" "" "" "?" "DNA" "" "" "0000413409" "00412136" "1" "00000" "03840" "2022-06-22 10:43:56" "" "" "SEQ" "DNA" "blood" "" "0000413410" "00412137" "1" "00000" "03840" "2022-06-22 10:43:56" "" "" "SEQ" "DNA" "blood" "" "0000413411" "00412138" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413412" "00412139" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413413" "00412140" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413414" "00412141" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413415" "00412142" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413416" "00412143" "1" "00000" "03840" "2022-06-22 11:22:52" "" "" "STR;SEQ" "DNA" "blood" "" "0000413417" "00412144" "1" "00000" "03840" "2022-06-22 14:01:23" "" "" "SEQ" "DNA" "blood" "" "0000413418" "00412145" "1" "00000" "03840" "2022-06-22 14:01:23" "" "" "SEQ-NG-R" "DNA" "blood" "" "0000413419" "00412146" "1" "00000" "03840" "2022-06-22 14:01:23" "" "" "SEQ-NG-R" "DNA" "blood" "" "0000413420" "00412147" "1" "00000" "03840" "2022-06-22 14:01:23" "" "" "SEQ-NG-R" "DNA" "blood" "" "0000413421" "00412148" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413422" "00412149" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413423" "00412150" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413424" "00412151" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413425" "00412152" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413426" "00412153" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413427" "00412154" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413428" "00412155" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413429" "00412156" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413430" "00412157" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413431" "00412158" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413432" "00412159" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413433" "00412160" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413434" "00412161" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413435" "00412162" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413436" "00412163" "1" "00000" "03840" "2022-06-22 14:48:33" "" "" "STR;SEQ" "DNA" "blood" "" "0000413439" "00412166" "1" "00000" "03840" "2022-06-22 16:47:12" "" "" "SEQ" "DNA" "blood" "" "0000413440" "00412167" "1" "00000" "03840" "2022-06-22 16:47:12" "" "" "SEQ" "DNA" "blood" "" "0000413441" "00412168" "1" "00000" "03840" "2022-06-22 16:47:12" "" "" "SEQ" "DNA" "blood" "" "0000413442" "00412169" "1" "00000" "03840" "2022-06-22 16:47:12" "" "" "SEQ" "DNA" "blood" "" "0000413446" "00412173" "1" "00000" "03840" "2022-06-22 19:54:31" "" "" "SEQ" "DNA" "blood" "" "0000413453" "00412180" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413454" "00412181" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413455" "00412182" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413456" "00412183" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413457" "00412184" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413458" "00412185" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413459" "00412186" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413460" "00412187" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413461" "00412188" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413462" "00412189" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413463" "00412190" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413464" "00412191" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413465" "00412192" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413466" "00412193" "1" "00000" "03840" "2022-06-23 15:08:54" "" "" "SEQ" "DNA" "blood" "" "0000413467" "00412194" "1" "00000" "03840" "2022-06-23 15:16:45" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000413468" "00412195" "1" "00000" "03840" "2022-06-23 15:16:45" "" "" "SEQ" "DNA" "blood" "" "0000413469" "00412196" "1" "00000" "03840" "2022-06-23 15:16:45" "" "" "SEQ" "DNA" "blood" "" "0000413471" "00412198" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413472" "00412199" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413473" "00412200" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413474" "00412201" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413475" "00412202" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413476" "00412203" "1" "00000" "03840" "2022-06-23 20:35:04" "" "" "SEQ" "DNA" "blood" "" "0000413477" "00412204" "1" "00000" "03840" "2022-06-23 21:08:57" "" "" "SEQ" "DNA" "blood" "" "0000413480" "00412207" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413481" "00412208" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413482" "00412209" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413483" "00412210" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413484" "00412211" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413485" "00412212" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413486" "00412213" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413487" "00412214" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413488" "00412215" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413489" "00412216" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413490" "00412217" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413491" "00412218" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413492" "00412219" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413493" "00412220" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413494" "00412221" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ-NG;SEQ" "DNA" "blood" "" "0000413496" "00412223" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413497" "00412224" "1" "00000" "03840" "2022-06-24 13:46:21" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000413498" "00412225" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413499" "00412226" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413500" "00412227" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413501" "00412228" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413502" "00412229" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413503" "00412230" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413504" "00412231" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413505" "00412232" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413506" "00412233" "1" "00000" "03840" "2022-06-24 14:10:50" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413516" "00412244" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413517" "00412245" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413518" "00412246" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413519" "00412247" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413520" "00412248" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413521" "00412249" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413522" "00412250" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413523" "00412251" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413524" "00412252" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413525" "00412253" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413526" "00412254" "1" "00000" "03840" "2022-06-24 15:17:56" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000413529" "00412256" "1" "00000" "03840" "2022-06-25 09:31:58" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000413530" "00412257" "1" "00000" "03840" "2022-06-25 09:31:58" "" "" "arraySNP;SEQ" "DNA" "blood" "" "0000413531" "00412258" "1" "00000" "03840" "2022-06-25 09:31:58" "" "" "SEQ" "DNA" "blood" "" "0000413532" "00412259" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413533" "00412260" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413534" "00412261" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413535" "00412262" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413536" "00412263" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413537" "00412264" "1" "00000" "03840" "2022-06-25 20:54:23" "" "" "SEQ" "DNA" "blood" "" "0000413547" "00412274" "1" "00000" "03840" "2022-06-26 18:31:34" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing (TES) panel - 188 known inherited retinal degeneration" "0000413548" "00412275" "1" "00000" "03840" "2022-06-26 18:31:34" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing (TES) panel - 188 known inherited retinal degeneration" "0000413549" "00412276" "1" "00000" "03840" "2022-06-26 18:31:34" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing (TES) panel - 188 known inherited retinal degeneration" "0000413550" "00412277" "1" "00000" "03840" "2022-06-26 18:31:34" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing (TES) panel - 188 known inherited retinal degeneration" "0000413551" "00412278" "1" "00000" "03840" "2022-06-26 18:31:34" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing (TES) panel - 188 known inherited retinal degeneration" "0000413553" "00412281" "1" "00000" "03840" "2022-06-27 10:02:53" "" "" "SEQ-NG" "DNA" "blood" "targeted exome sequencing panel - over 200 known inherited retinal degeneration" "0000413554" "00412282" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413555" "00412283" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413556" "00412284" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413557" "00412285" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413558" "00412286" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413559" "00412287" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413560" "00412288" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413561" "00412289" "1" "00000" "03840" "2022-06-27 10:49:09" "" "" "SEQ" "DNA" "blood" "" "0000413563" "00412291" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413564" "00412292" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413565" "00412293" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413566" "00412294" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413567" "00412295" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413568" "00412296" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413569" "00412297" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413570" "00412298" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413571" "00412299" "1" "00000" "03840" "2022-06-27 11:59:33" "" "" "SEQ" "DNA" "blood" "" "0000413587" "00412315" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000413588" "00412316" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000413589" "00412317" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ" "DNA" "blood" "" "0000413590" "00412318" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000413591" "00412319" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000413592" "00412320" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000413593" "00412321" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ" "DNA" "blood" "" "0000413594" "00412322" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ" "DNA" "blood" "" "0000413595" "00412323" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ" "DNA" "blood" "" "0000413596" "00412324" "1" "00000" "03840" "2022-06-27 16:29:51" "" "" "SEQ" "DNA" "blood" "" "0000413654" "00412382" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413655" "00412383" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413656" "00412384" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413657" "00412385" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413658" "00412386" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413659" "00412387" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413660" "00412388" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413661" "00412389" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413662" "00412390" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413663" "00412391" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413664" "00412392" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413665" "00412393" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413666" "00412394" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413667" "00412395" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413668" "00412396" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413669" "00412397" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413670" "00412398" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413671" "00412399" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413672" "00412400" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413673" "00412401" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413674" "00412402" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413675" "00412403" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413676" "00412404" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413677" "00412405" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413678" "00412406" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413679" "00412407" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413680" "00412408" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413681" "00412409" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413682" "00412410" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413683" "00412411" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413684" "00412412" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413685" "00412413" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413686" "00412414" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413687" "00412415" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413688" "00412416" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413689" "00412417" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413690" "00412418" "1" "00000" "03840" "2022-06-27 22:34:38" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing or targeted exome sequencing" "0000413691" "00412419" "1" "00000" "03840" "2022-06-28 10:18:43" "" "" "SEQ-NG;SEQ" "DNA" "blood" "targeted next generation sequencing of known XLRP genes and whole exome sequencing (WES) of known inherited retinal disease genes (RetNet-WES)" "0000413692" "00412420" "1" "00000" "03840" "2022-06-28 10:18:43" "" "" "SEQ-NG;SEQ" "DNA" "blood" "targeted next generation sequencing of known XLRP genes and whole exome sequencing (WES) of known inherited retinal disease genes (RetNet-WES)" "0000413693" "00412421" "1" "00000" "03840" "2022-06-28 10:18:43" "" "" "SEQ-NG;SEQ" "DNA" "blood" "targeted next generation sequencing of known XLRP genes and whole exome sequencing (WES) of known inherited retinal disease genes (RetNet-WES)" "0000413694" "00412422" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413695" "00412423" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413696" "00412424" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing" "0000413697" "00412425" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413698" "00412426" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413699" "00412427" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413700" "00412428" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413701" "00412429" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413702" "00412430" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413703" "00412431" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413704" "00412432" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413705" "00412433" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing" "0000413706" "00412434" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413707" "00412435" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole exome sequencing" "0000413708" "00412436" "1" "00000" "03840" "2022-06-28 13:35:55" "" "" "SEQ" "DNA" "blood" "" "0000413711" "00412439" "1" "00000" "03840" "2022-06-28 15:08:17" "" "" "?" "DNA" "" "" "0000413712" "00412440" "1" "00000" "03840" "2022-06-28 15:08:17" "" "" "?" "DNA" "" "" "0000415639" "00414359" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000416675" "00415394" "1" "00006" "00006" "2022-08-13 16:30:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000421733" "00420424" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421776" "00420467" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421898" "00420589" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000428260" "00426940" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing" "0000430896" "00429483" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430946" "00429533" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430980" "00429567" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430987" "00429574" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430999" "00429586" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431030" "00429617" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431052" "00429639" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431059" "00429646" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431061" "00429648" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431097" "00429684" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431132" "00429719" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431153" "00429740" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431235" "00429822" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431246" "00429833" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431253" "00429840" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431263" "00429850" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431272" "00429859" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431318" "00429905" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431352" "00429939" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431387" "00429974" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431394" "00429981" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431413" "00430000" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431485" "00430072" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431493" "00430080" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431521" "00430108" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431546" "00430133" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431549" "00430136" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431552" "00430139" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431559" "00430146" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000436890" "00435410" "1" "00006" "00006" "2023-07-24 13:52:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000445882" "00444308" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000448524" "00446947" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448525" "00446948" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448527" "00446950" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448528" "00446951" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448529" "00446952" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448535" "00446958" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448540" "00446963" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448545" "00446968" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448567" "00446990" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448585" "00447008" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448886" "00447309" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449127" "00447550" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449194" "00447617" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449198" "00447621" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000462707" "00461075" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462713" "00461081" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462717" "00461085" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462721" "00461089" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462741" "00461109" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462746" "00461114" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462770" "00461138" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1927 "{{screeningid}}" "{{geneid}}" "0000000008" "ACADM" "0000000008" "ADA" "0000000008" "ATP7B" "0000000008" "CFTR" "0000000008" "ETFB" "0000000008" "FKTN" "0000000008" "HESX1" "0000000008" "HGSNAT" "0000000008" "MYO5A" "0000000008" "NPHS1" "0000000008" "SERPINA1" "0000000008" "USH2A" "0000000029" "ALG9" "0000000029" "ASPM" "0000000029" "B3GLCT" "0000000029" "BBS1" "0000000029" "CBS" "0000000029" "CC2D1A" "0000000029" "CDK5RAP2" "0000000029" "DLG3" "0000000029" "DNMT3B" "0000000029" "DPM1" "0000000029" "DPP3" "0000000029" "GLI3" "0000000029" "JAG1" "0000000029" "KRAS" "0000000029" "MECP2" "0000000029" "MPDU1" "0000000029" "NLGN4X" "0000000029" "NSD1" "0000000029" "PHF8" "0000000029" "PMM2" "0000000029" "RAI1" "0000000029" "REST" "0000000029" "SATB2" "0000000029" "SCN8A" "0000000029" "SHANK3" "0000000029" "SLC35C1" "0000000029" "TCF4" "0000000029" "TSC1" "0000000029" "UPF3B" "0000000029" "ZEB2" "0000000029" "ZNF41" "0000000041" "ATP7A" "0000000041" "ATP7B" "0000000041" "DPYD" "0000000041" "ETFB" "0000000041" "IGHMBP2" "0000000041" "MPL" "0000000041" "MYO5A" "0000000041" "NHLRC1" "0000000041" "NPHP4" "0000000041" "NPHS1" "0000000041" "PLP1" "0000000041" "SERPINA1" "0000000101" "ATP7B" "0000000101" "ETFB" "0000000101" "GLB1" "0000000101" "NPHS1" "0000000101" "SERPINA1" "0000033188" "RHO" "0000033188" "RPGR" "0000033208" "AIPL1" "0000033208" "RHO" "0000033227" "AIPL1" "0000033227" "RHO" "0000233520" "RHO" "0000233521" "RHO" "0000233522" "RHO" "0000233523" "RHO" "0000233524" "RHO" "0000233525" "RHO" "0000233526" "RHO" "0000233527" "RHO" "0000233528" "RHO" "0000233529" "RHO" "0000233530" "RHO" "0000233531" "RHO" "0000233532" "RHO" "0000233533" "RHO" "0000233534" "RHO" "0000233535" "RHO" "0000233536" "RHO" "0000233537" "RHO" "0000233538" "RHO" "0000233539" "RHO" "0000233540" "RHO" "0000233541" "RHO" "0000233542" "RHO" "0000233543" "RHO" "0000233544" "RHO" "0000233545" "RHO" "0000233546" "RHO" "0000233547" "RHO" "0000233548" "RHO" "0000233549" "RHO" "0000233550" "RHO" "0000233551" "RHO" "0000234756" "RHO" "0000234757" "RHO" "0000247779" "RHO" "0000247780" "RHO" "0000247781" "RHO" "0000301364" "NDUFAF7" "0000309688" "RHO" "0000309689" "RHO" "0000309690" "RHO" "0000309691" "RHO" "0000309692" "RHO" "0000309693" "RHO" "0000309694" "RHO" "0000309785" "RHO" "0000309786" "RHO" "0000310503" "RHO" "0000310504" "RHO" "0000310505" "RHO" "0000310506" "RHO" "0000310507" "RHO" "0000310508" "RHO" "0000310509" "RHO" "0000310510" "RHO" "0000310511" "RHO" "0000310512" "RHO" "0000310513" "RHO" "0000321003" "RHO" "0000321016" "CRX" "0000321016" "NRL" "0000321016" "PRPH2" "0000321016" "RHO" "0000321016" "ROM1" "0000321016" "RP1" "0000326661" "RHO" "0000326705" "RHO" "0000327892" "RHO" "0000327893" "RHO" "0000327894" "RHO" "0000327905" "RHO" "0000327915" "RHO" "0000327916" "RHO" "0000327917" "RHO" "0000327918" "RHO" "0000327919" "RHO" "0000327920" "RHO" "0000327921" "RHO" "0000327922" "RHO" "0000327923" "RHO" "0000327924" "RHO" "0000327925" "RHO" "0000327926" "RHO" "0000327927" "RHO" "0000327928" "RHO" "0000327929" "RHO" "0000327930" "RHO" "0000327931" "RHO" "0000327932" "RHO" "0000327933" "RHO" "0000327934" "RHO" "0000327935" "RHO" "0000327936" "RHO" "0000327937" "RHO" "0000327938" "RHO" "0000327939" "RHO" "0000327940" "RHO" "0000327941" "RHO" "0000327942" "RHO" "0000327943" "RHO" "0000327944" "RHO" "0000327945" "RHO" "0000327946" "RHO" "0000327947" "RHO" "0000327948" "RHO" "0000327949" "RHO" "0000327950" "RHO" "0000327951" "RHO" "0000327952" "RHO" "0000327953" "RHO" "0000327954" "RHO" "0000327955" "RHO" "0000327956" "RHO" "0000327957" "RHO" "0000327958" "RHO" "0000327959" "RHO" "0000327960" "RHO" "0000327961" "RHO" "0000327962" "RHO" "0000327963" "RHO" "0000327964" "RHO" "0000327965" "RHO" "0000327966" "RHO" "0000327967" "RHO" "0000327968" "RHO" "0000327969" "RHO" "0000327970" "RHO" "0000327971" "RHO" "0000327972" "RHO" "0000329252" "RHO" "0000329267" "RHO" "0000329303" "RHO" "0000329305" "RHO" "0000329381" "RHO" "0000329389" "RHO" "0000329514" "RHO" "0000329615" "RHO" "0000329649" "RHO" "0000329694" "RHO" "0000332490" "RHO" "0000332491" "RHO" "0000333723" "MYO7A" "0000333723" "RHO" "0000333750" "RHO" "0000333753" "RHO" "0000333756" "RHO" "0000333762" "RHO" "0000334584" "RHO" "0000334611" "RHO" "0000334631" "RHO" "0000334632" "RHO" "0000334633" "RHO" "0000334634" "RHO" "0000334738" "RHO" "0000334739" "RHO" "0000334740" "RHO" "0000334741" "RHO" "0000334742" "RHO" "0000334743" "RHO" "0000334744" "RHO" "0000334796" "RHO" "0000334797" "RHO" "0000334798" "RHO" "0000334799" "RHO" "0000334800" "RHO" "0000334801" "RHO" "0000334802" "RHO" "0000334821" "RHO" "0000334822" "RHO" "0000334823" "RHO" "0000334824" "RHO" "0000334825" "RHO" "0000334826" "RHO" "0000334827" "RHO" "0000334828" "RHO" "0000334829" "RHO" "0000334830" "RHO" "0000334831" "RHO" "0000334832" "RHO" "0000334833" "RHO" "0000334834" "RHO" "0000335079" "RHO" "0000335080" "RHO" "0000335144" "RHO" "0000335204" "RHO" "0000335205" "RHO" "0000335206" "RHO" "0000335659" "RHO" "0000336378" "RHO" "0000336448" "RHO" "0000336528" "RHO" "0000336529" "RHO" "0000336530" "RHO" "0000336614" "RHO" "0000336615" "RHO" "0000336632" "RHO" "0000336668" "RHO" "0000336721" "RHO" "0000336771" "RHO" "0000336772" "RHO" "0000336773" "RHO" "0000336774" "RHO" "0000336775" "RHO" "0000336776" "RHO" "0000336777" "RHO" "0000336778" "RHO" "0000336779" "RHO" "0000336780" "RHO" "0000336781" "RHO" "0000336782" "RHO" "0000336908" "RHO" "0000336909" "RHO" "0000336910" "RHO" "0000336911" "RHO" "0000336912" "RHO" "0000336913" "RHO" "0000336914" "RHO" "0000336915" "RHO" "0000336916" "RHO" "0000336917" "RHO" "0000336918" "RHO" "0000336919" "RHO" "0000336920" "RHO" "0000336921" "RHO" "0000336922" "RHO" "0000336923" "RHO" "0000336924" "RHO" "0000336925" "RHO" "0000336926" "RHO" "0000336927" "RHO" "0000336928" "RHO" "0000336929" "RHO" "0000336930" "RHO" "0000336931" "RHO" "0000336932" "RHO" "0000336933" "RHO" "0000336934" "RHO" "0000336963" "RHO" "0000336964" "RHO" "0000336965" "RHO" "0000336966" "RHO" "0000337179" "RHO" "0000359964" "RHO" "0000359965" "RHO" "0000359966" "RHO" "0000360024" "RHO" "0000360161" "RHO" "0000362654" "PRPH2" "0000362672" "PRPH2" "0000364118" "RHO" "0000364119" "RHO" "0000364620" "RHO" "0000364633" "RHO" "0000364634" "RHO" "0000364635" "RHO" "0000364636" "RHO" "0000364637" "RHO" "0000364638" "RHO" "0000364639" "RHO" "0000364640" "RHO" "0000364641" "RHO" "0000364642" "RHO" "0000364649" "RHO" "0000364668" "RHO" "0000364695" "RHO" "0000364696" "RHO" "0000364732" "RHO" "0000364733" "RHO" "0000364734" "RHO" "0000373309" "RHO" "0000373312" "RHO" "0000373733" "AIPL1" "0000373733" "RHO" "0000374574" "RHO" "0000374702" "RHO" "0000374745" "ABCA4" "0000374747" "RHO" "0000374748" "RHO" "0000374749" "RHO" "0000374750" "RHO" "0000374751" "RHO" "0000374752" "RHO" "0000375048" "RHO" "0000375051" "RHO" "0000375144" "RHO" "0000375147" "RHO" "0000375152" "RHO" "0000375177" "RHO" "0000375182" "RHO" "0000375190" "RHO" "0000375191" "RHO" "0000375192" "RHO" "0000375193" "RHO" "0000375194" "RHO" "0000375195" "RHO" "0000375196" "RHO" "0000375197" "RHO" "0000375198" "RHO" "0000375199" "RHO" "0000375200" "RHO" "0000375201" "RHO" "0000375202" "RHO" "0000375203" "RHO" "0000375204" "RHO" "0000375205" "RHO" "0000375206" "RHO" "0000375207" "RHO" "0000375208" "RHO" "0000375209" "RHO" "0000375210" "RHO" "0000375211" "RHO" "0000375212" "RHO" "0000375213" "RHO" "0000375214" "RHO" "0000375215" "RHO" "0000375216" "RHO" "0000375217" "RHO" "0000375218" "RHO" "0000375219" "RHO" "0000375220" "RHO" "0000375221" "RHO" "0000375222" "RHO" "0000375223" "RHO" "0000375224" "RHO" "0000375225" "RHO" "0000375226" "RHO" "0000375227" "RHO" "0000375228" "RHO" "0000375229" "RHO" "0000375230" "RHO" "0000375231" "RHO" "0000376480" "RHO" "0000376481" "RHO" "0000376482" "RHO" "0000376483" "RHO" "0000376501" "RHO" "0000376502" "RHO" "0000376503" "RHO" "0000376650" "RHO" "0000377364" "RHO" "0000377372" "RHO" "0000377373" "RHO" "0000377379" "RHO" "0000377381" "RHO" "0000377490" "RHO" "0000377687" "PRPF31" "0000377687" "RHO" "0000377688" "PRPF31" "0000377688" "RHO" "0000377689" "PRPF31" "0000377689" "RHO" "0000377690" "PRPF31" "0000377690" "RHO" "0000377691" "PRPF31" "0000377691" "RHO" "0000377692" "PRPF31" "0000377692" "RHO" "0000377693" "PRPF31" "0000377693" "RHO" "0000377694" "PRPF31" "0000377694" "RHO" "0000377706" "RHO" "0000377707" "RHO" "0000377708" "RHO" "0000377709" "RHO" "0000377710" "RHO" "0000377730" "RHO" "0000377731" "RHO" "0000377732" "RHO" "0000377733" "RHO" "0000378198" "RHO" "0000378199" "RHO" "0000378200" "RHO" "0000378201" "RHO" "0000378202" "RHO" "0000378420" "RHO" "0000378446" "RHO" "0000378451" "RHO" "0000378452" "RHO" "0000378453" "RHO" "0000378454" "RHO" "0000378455" "RHO" "0000378457" "RHO" "0000378619" "RHO" "0000378620" "RHO" "0000378621" "RHO" "0000378622" "RHO" "0000378623" "RHO" "0000378624" "RHO" "0000378625" "RHO" "0000378626" "RHO" "0000378627" "RHO" "0000378628" "RHO" "0000378629" "RHO" "0000378630" "RHO" "0000378631" "RHO" "0000378632" "RHO" "0000378633" "RHO" "0000378634" "RHO" "0000378635" "RHO" "0000378636" "RHO" "0000378637" "RHO" "0000378638" "RHO" "0000378639" "RHO" "0000378640" "RHO" "0000378641" "RHO" "0000378642" "RHO" "0000378643" "RHO" "0000378644" "RHO" "0000378645" "RHO" "0000378646" "RHO" "0000378647" "RHO" "0000378648" "RHO" "0000378649" "RHO" "0000378650" "RHO" "0000378651" "RHO" "0000378652" "RHO" "0000378653" "RHO" "0000378654" "RHO" "0000378655" "RHO" "0000378656" "RHO" "0000378657" "RHO" "0000378658" "RHO" "0000378659" "RHO" "0000378660" "RHO" "0000378661" "RHO" "0000378662" "RHO" "0000378663" "RHO" "0000378664" "RHO" "0000378665" "RHO" "0000378666" "RHO" "0000378667" "RHO" "0000378668" "RHO" "0000378669" "RHO" "0000378670" "RHO" "0000378671" "RHO" "0000378715" "RHO" "0000378933" "RHO" "0000378934" "RHO" "0000380593" "RHO" "0000380611" "RHO" "0000380650" "RHO" "0000380800" "RHO" "0000380801" "RHO" "0000380802" "RHO" "0000380803" "RHO" "0000380804" "RHO" "0000380805" "RHO" "0000380806" "RHO" "0000380807" "RHO" "0000380808" "RHO" "0000381071" "RHO" "0000381072" "RHO" "0000381073" "RHO" "0000381074" "RHO" "0000381075" "RHO" "0000381076" "RHO" "0000381443" "RHO" "0000381444" "RHO" "0000381445" "RHO" "0000381446" "RHO" "0000381447" "RHO" "0000381448" "RHO" "0000381449" "RHO" "0000381450" "RHO" "0000381451" "RHO" "0000381452" "RHO" "0000381453" "RHO" "0000381454" "RHO" "0000381455" "RHO" "0000381456" "RHO" "0000381457" "RHO" "0000381458" "RHO" "0000381459" "RHO" "0000381462" "RHO" "0000381463" "RHO" "0000381464" "RHO" "0000381473" "RHO" "0000381474" "RHO" "0000381475" "RHO" "0000382211" "RHO" "0000382213" "RHO" "0000382230" "RHO" "0000382312" "RHO" "0000382829" "RHO" "0000382836" "RHO" "0000382853" "MERTK" "0000382863" "ROM1" "0000382884" "ABCA4" "0000382890" "ABCA4" "0000382896" "RHO" "0000382911" "RHO" "0000382950" "RHO" "0000382951" "RHO" "0000382952" "RHO" "0000382953" "RHO" "0000382954" "RHO" "0000382955" "RHO" "0000382956" "RHO" "0000382957" "RHO" "0000382958" "RHO" "0000382959" "RHO" "0000382960" "RHO" "0000382961" "RHO" "0000382962" "RHO" "0000382963" "RHO" "0000382964" "RHO" "0000382965" "RHO" "0000382966" "RHO" "0000382967" "RHO" "0000383021" "RHO" "0000383120" "RHO" "0000383121" "RHO" "0000383122" "RHO" "0000383123" "RHO" "0000383594" "RHO" "0000383595" "RHO" "0000383596" "RHO" "0000383597" "RHO" "0000383598" "RHO" "0000383599" "RHO" "0000383600" "RHO" "0000383601" "RHO" "0000383602" "RHO" "0000383603" "RHO" "0000383604" "RHO" "0000383605" "RHO" "0000383606" "RHO" "0000383607" "RHO" "0000383608" "RHO" "0000383609" "RHO" "0000383610" "RHO" "0000383611" "RHO" "0000383612" "RHO" "0000383613" "RHO" "0000383614" "RHO" "0000384005" "RHO" "0000384010" "RHO" "0000384047" "RHO" "0000384049" "RHO" "0000384050" "RHO" "0000384052" "RHO" "0000384053" "RHO" "0000384283" "RHO" "0000384285" "RHO" "0000384296" "RHO" "0000384297" "RHO" "0000384304" "ROM1" "0000384311" "RHO" "0000384317" "CRB1" "0000384319" "RHO" "0000384711" "RHO" "0000384712" "RHO" "0000384935" "RHO" "0000385031" "RHO" "0000385301" "RHO" "0000385499" "RHO" "0000385556" "RHO" "0000385972" "RHO" "0000385973" "RHO" "0000386000" "RHO" "0000386001" "RHO" "0000386280" "RHO" "0000386952" "RHO" "0000386953" "RHO" "0000387105" "RHO" "0000387183" "RHO" "0000387393" "RHO" "0000387394" "RHO" "0000387432" "RPGR" "0000387531" "EYS" "0000387775" "RHO" "0000387777" "RHO" "0000387782" "RHO" "0000387793" "RHO" "0000387817" "RHO" "0000387847" "RHO" "0000387874" "RHO" "0000387903" "RHO" "0000387914" "RHO" "0000387943" "RHO" "0000387948" "RHO" "0000388068" "RHO" "0000388222" "RHO" "0000388223" "RHO" "0000388224" "RHO" "0000388225" "RHO" "0000388226" "RHO" "0000388227" "RHO" "0000388228" "RHO" "0000388229" "RHO" "0000388230" "RHO" "0000388231" "RHO" "0000388232" "RHO" "0000388233" "RHO" "0000388234" "RHO" "0000388235" "RHO" "0000388236" "RHO" "0000388237" "RHO" "0000388238" "RHO" "0000388239" "RHO" "0000388240" "RHO" "0000388241" "RHO" "0000388242" "RHO" "0000388740" "RHO" "0000389793" "RHO" "0000389967" "RHO" "0000389968" "RHO" "0000389969" "RHO" "0000390050" "RHO" "0000390090" "RHO" "0000390126" "RHO" "0000390127" "RHO" "0000390128" "RHO" "0000390224" "RHO" "0000390225" "RHO" "0000390226" "RHO" "0000390227" "RHO" "0000390350" "RHO" "0000390351" "RHO" "0000390352" "RHO" "0000390456" "RHO" "0000390457" "RHO" "0000390507" "RHO" "0000390508" "RHO" "0000390638" "RHO" "0000390722" "RHO" "0000390723" "RHO" "0000390732" "RHO" "0000390739" "RHO" "0000390740" "RHO" "0000390756" "RHO" "0000390757" "RHO" "0000390775" "RHO" "0000390776" "RHO" "0000390777" "RHO" "0000390781" "RHO" "0000390782" "RHO" "0000390786" "RHO" "0000390825" "RHO" "0000390826" "RHO" "0000390850" "RHO" "0000390866" "RHO" "0000390892" "RHO" "0000390893" "RHO" "0000390917" "RHO" "0000390921" "RHO" "0000390929" "RHO" "0000390931" "RHO" "0000390932" "RHO" "0000390933" "RHO" "0000390934" "RHO" "0000390936" "RHO" "0000390937" "RHO" "0000390939" "RHO" "0000390940" "RHO" "0000390944" "RHO" "0000390945" "RHO" "0000390949" "RHO" "0000390950" "RHO" "0000390957" "RHO" "0000390958" "RHO" "0000390959" "RHO" "0000390960" "RHO" "0000391056" "RHO" "0000391076" "RHO" "0000391137" "RHO" "0000391183" "RHO" "0000391198" "RHO" "0000391200" "RHO" "0000391234" "RHO" "0000391251" "RHO" "0000391277" "RHO" "0000391604" "RHO" "0000391605" "RHO" "0000391606" "RHO" "0000391607" "RHO" "0000391608" "RHO" "0000391609" "RHO" "0000391610" "RHO" "0000392630" "CNGA3" "0000392827" "RHO" "0000393556" "RHO" "0000393558" "RHO" "0000393563" "RHO" "0000393564" "RHO" "0000393567" "RHO" "0000393578" "RHO" "0000393583" "RHO" "0000393589" "RHO" "0000393590" "RHO" "0000393591" "RHO" "0000393594" "RHO" "0000393599" "RHO" "0000393603" "RHO" "0000393606" "RHO" "0000393609" "RHO" "0000393610" "RHO" "0000393617" "RHO" "0000393618" "RHO" "0000393624" "RHO" "0000393625" "RHO" "0000393628" "RHO" "0000393629" "RHO" "0000393635" "RHO" "0000393799" "RHO" "0000393800" "RHO" "0000393801" "RHO" "0000393802" "RHO" "0000393803" "RHO" "0000393804" "RHO" "0000393805" "RHO" "0000393806" "RHO" "0000393807" "RHO" "0000393808" "RHO" "0000393828" "RHO" "0000393856" "RHO" "0000393905" "RHO" "0000394025" "PRPH2" "0000394026" "PRPH2" "0000394688" "RHO" "0000394782" "RHO" "0000394847" "RHO" "0000394854" "RHO" "0000394859" "RHO" "0000394888" "RHO" "0000394981" "RHO" "0000395158" "RHO" "0000395162" "RHO" "0000395576" "RHO" "0000395753" "RHO" "0000395754" "RHO" "0000395755" "RHO" "0000395756" "RHO" "0000395757" "RHO" "0000395758" "RHO" "0000395759" "RHO" "0000395760" "RHO" "0000395761" "RHO" "0000395762" "RHO" "0000395763" "RHO" "0000395764" "RHO" "0000395765" "RHO" "0000395766" "RHO" "0000395767" "RHO" "0000395768" "RHO" "0000395769" "RHO" "0000396797" "RHO" "0000397157" "RHO" "0000397173" "RHO" "0000397190" "RHO" "0000397210" "RHO" "0000397211" "RHO" "0000397212" "RHO" "0000397213" "RHO" "0000397214" "RHO" "0000397215" "RHO" "0000397216" "RHO" "0000397217" "RHO" "0000397218" "RHO" "0000397219" "RHO" "0000397729" "RHO" "0000397752" "EYS" "0000397756" "EYS" "0000409678" "RHO" "0000410762" "CYP4V2" "0000411872" "RHO" "0000411873" "RHO" "0000411874" "RHO" "0000411875" "RHO" "0000411876" "RHO" "0000411877" "RHO" "0000411878" "RHO" "0000411879" "RHO" "0000411880" "RHO" "0000411881" "RHO" "0000411882" "RHO" "0000411883" "RHO" "0000411884" "RHO" "0000411885" "RHO" "0000411886" "RHO" "0000411887" "RHO" "0000411888" "RHO" "0000411889" "RHO" "0000411890" "RHO" "0000411891" "RHO" "0000411892" "RHO" "0000411893" "RHO" "0000411894" "RHO" "0000411895" "RHO" "0000411896" "RHO" "0000411897" "RHO" "0000411898" "RHO" "0000411899" "RHO" "0000411900" "RHO" "0000411901" "RHO" "0000411902" "RHO" "0000411903" "RHO" "0000411904" "RHO" "0000411905" "RHO" "0000411906" "RHO" "0000411907" "RHO" "0000411908" "RHO" "0000411909" "RHO" "0000411910" "RHO" "0000411911" "RHO" "0000411912" "RHO" "0000411913" "RHO" "0000411914" "RHO" "0000411915" "RHO" "0000411916" "RHO" "0000411917" "RHO" "0000411918" "RHO" "0000411919" "RHO" "0000411920" "RHO" "0000411921" "RHO" "0000411922" "RHO" "0000411923" "RHO" "0000411924" "RHO" "0000411925" "RHO" "0000411926" "RHO" "0000411927" "RHO" "0000411928" "RHO" "0000411929" "RHO" "0000411930" "RHO" "0000411931" "RHO" "0000411932" "RHO" "0000411933" "RHO" "0000411934" "RHO" "0000411935" "RHO" "0000411936" "RHO" "0000411937" "RHO" "0000411938" "RHO" "0000411939" "RHO" "0000411940" "RHO" "0000411941" "RHO" "0000411942" "RHO" "0000411943" "RHO" "0000411944" "RHO" "0000411945" "RHO" "0000411946" "RHO" "0000411947" "RHO" "0000411948" "RHO" "0000411949" "RHO" "0000411950" "RHO" "0000411951" "RHO" "0000411952" "RHO" "0000411953" "RHO" "0000411954" "RHO" "0000411955" "RHO" "0000411956" "RHO" "0000411957" "RHO" "0000411958" "RHO" "0000411959" "RHO" "0000411960" "RHO" "0000411961" "RHO" "0000411962" "RHO" "0000411963" "RHO" "0000411964" "RHO" "0000411965" "RHO" "0000411966" "RHO" "0000411967" "RHO" "0000411968" "RHO" "0000411969" "RHO" "0000411970" "RHO" "0000411971" "RHO" "0000411972" "RHO" "0000411973" "RHO" "0000411974" "RHO" "0000411975" "RHO" "0000411976" "RHO" "0000411977" "RHO" "0000411978" "RHO" "0000411979" "RHO" "0000411980" "RHO" "0000411981" "RHO" "0000411982" "RHO" "0000411983" "RHO" "0000411984" "RHO" "0000411985" "RHO" "0000411986" "RHO" "0000411987" "RHO" "0000411988" "RHO" "0000411989" "RHO" "0000411990" "RHO" "0000411991" "RHO" "0000411992" "RHO" "0000411993" "RHO" "0000411994" "RHO" "0000411995" "RHO" "0000411996" "RHO" "0000411997" "RHO" "0000411998" "RHO" "0000411999" "RHO" "0000412001" "RHO" "0000412002" "RHO" "0000412003" "RHO" "0000412004" "RHO" "0000412005" "RHO" "0000412006" "RHO" "0000412007" "RHO" "0000412008" "RHO" "0000412009" "RHO" "0000412010" "RHO" "0000412011" "RHO" "0000412036" "RHO" "0000412037" "RHO" "0000412038" "RHO" "0000412039" "RHO" "0000412040" "RHO" "0000412041" "RHO" "0000412042" "RHO" "0000412043" "RHO" "0000412044" "RHO" "0000412045" "RHO" "0000412046" "RHO" "0000412047" "RHO" "0000412048" "RHO" "0000412049" "RHO" "0000412050" "RHO" "0000412051" "RHO" "0000412052" "RHO" "0000412053" "RHO" "0000412054" "RHO" "0000412055" "RHO" "0000412056" "RHO" "0000412057" "RHO" "0000412058" "RHO" "0000412059" "RHO" "0000412060" "RHO" "0000412061" "RHO" "0000412062" "RHO" "0000412063" "RHO" "0000412078" "RHO" "0000412079" "RHO" "0000412080" "RHO" "0000412081" "RHO" "0000412082" "RHO" "0000412083" "RHO" "0000412084" "RHO" "0000412085" "RHO" "0000412086" "RHO" "0000412087" "RHO" "0000412088" "RHO" "0000412089" "RHO" "0000412090" "RHO" "0000412091" "RHO" "0000412092" "RHO" "0000412093" "RHO" "0000412094" "RHO" "0000412095" "RHO" "0000412096" "RHO" "0000412097" "RHO" "0000412098" "RHO" "0000412099" "RHO" "0000412100" "RHO" "0000412101" "RHO" "0000412102" "RHO" "0000412103" "RHO" "0000412104" "RHO" "0000412105" "RHO" "0000412106" "RHO" "0000412107" "RHO" "0000412108" "RHO" "0000412109" "RHO" "0000412110" "RHO" "0000412111" "RHO" "0000412112" "RHO" "0000412113" "RHO" "0000412114" "RHO" "0000412115" "RHO" "0000412116" "RHO" "0000412117" "RHO" "0000412118" "RHO" "0000412119" "RHO" "0000412120" "RHO" "0000412121" "RHO" "0000412122" "RHO" "0000412123" "RHO" "0000412124" "RHO" "0000412125" "RHO" "0000412126" "RHO" "0000412127" "RHO" "0000412128" "RHO" "0000412129" "RHO" "0000412130" "RHO" "0000412131" "RHO" "0000412132" "RHO" "0000412133" "RHO" "0000412134" "RHO" "0000412135" "RHO" "0000412136" "RHO" "0000412137" "RHO" "0000412138" "RHO" "0000412139" "RHO" "0000412140" "RHO" "0000412141" "RHO" "0000412142" "RHO" "0000412143" "RHO" "0000412144" "RHO" "0000412145" "RHO" "0000412146" "RHO" "0000412147" "RHO" "0000412148" "RHO" "0000412149" "RHO" "0000412150" "RHO" "0000412151" "RHO" "0000412152" "RHO" "0000412153" "RHO" "0000412154" "RHO" "0000412155" "RHO" "0000412156" "RHO" "0000412157" "RHO" "0000412158" "RHO" "0000412159" "RHO" "0000412160" "RHO" "0000412161" "RHO" "0000412162" "RHO" "0000412163" "RHO" "0000412164" "RHO" "0000412165" "RHO" "0000412166" "RHO" "0000412167" "RHO" "0000412168" "RHO" "0000412169" "RHO" "0000412170" "RHO" "0000412171" "RHO" "0000412172" "RHO" "0000412173" "RHO" "0000412174" "RHO" "0000412175" "RHO" "0000412176" "RHO" "0000412177" "RHO" "0000412178" "RHO" "0000412179" "RHO" "0000412194" "RHO" "0000412195" "RHO" "0000412196" "RHO" "0000412197" "RHO" "0000412198" "RHO" "0000412199" "RHO" "0000412200" "RHO" "0000412201" "RHO" "0000412202" "RHO" "0000412203" "RHO" "0000412336" "RHO" "0000412337" "RHO" "0000412338" "RHO" "0000412339" "RHO" "0000412340" "RHO" "0000412341" "RHO" "0000412342" "RHO" "0000412343" "RHO" "0000412344" "RHO" "0000412345" "RHO" "0000412346" "RHO" "0000412347" "RHO" "0000412348" "RHO" "0000412349" "RHO" "0000412350" "RHO" "0000412351" "RHO" "0000412352" "RHO" "0000412359" "RHO" "0000412360" "RHO" "0000412361" "RHO" "0000412362" "RHO" "0000412363" "RHO" "0000412364" "RHO" "0000412365" "RHO" "0000412366" "RHO" "0000412370" "RHO" "0000412371" "RHO" "0000412372" "RHO" "0000412373" "RHO" "0000412374" "RHO" "0000412381" "RHO" "0000412395" "RHO" "0000412396" "RHO" "0000412397" "RHO" "0000412398" "RHO" "0000412399" "RHO" "0000412402" "RHO" "0000412403" "RHO" "0000412404" "RHO" "0000412405" "RHO" "0000412406" "RHO" "0000412407" "RHO" "0000412408" "RHO" "0000412409" "RHO" "0000412410" "RHO" "0000412411" "RHO" "0000412412" "RHO" "0000412413" "RHO" "0000412414" "RHO" "0000412415" "RHO" "0000412416" "RHO" "0000412417" "RHO" "0000412418" "RHO" "0000412419" "RHO" "0000412420" "RHO" "0000412421" "RHO" "0000412422" "RHO" "0000412423" "RHO" "0000412435" "RHO" "0000412465" "RHO" "0000412466" "RHO" "0000412467" "RHO" "0000412468" "RHO" "0000412469" "RHO" "0000412470" "RHO" "0000412471" "RHO" "0000412472" "RHO" "0000412473" "RHO" "0000412474" "RHO" "0000412475" "RHO" "0000412476" "RHO" "0000412477" "RHO" "0000412478" "RHO" "0000412479" "RHO" "0000412480" "RHO" "0000412481" "RHO" "0000412482" "RHO" "0000412483" "RHO" "0000412484" "RHO" "0000412485" "RHO" "0000412486" "RHO" "0000412487" "RHO" "0000412488" "RHO" "0000412489" "RHO" "0000412490" "RHO" "0000412491" "RHO" "0000412492" "RHO" "0000412493" "RHO" "0000412494" "RHO" "0000412495" "RHO" "0000412496" "RHO" "0000412497" "RHO" "0000412498" "RHO" "0000412499" "RHO" "0000412500" "RHO" "0000412501" "RHO" "0000412502" "RHO" "0000412503" "RHO" "0000412504" "RHO" "0000412505" "RHO" "0000412506" "RHO" "0000412507" "RHO" "0000412508" "RHO" "0000412509" "RHO" "0000412510" "RHO" "0000412511" "RHO" "0000412512" "RHO" "0000412513" "RHO" "0000412514" "RHO" "0000412515" "RHO" "0000412516" "RHO" "0000412517" "RHO" "0000412518" "RHO" "0000412519" "RHO" "0000412520" "RHO" "0000412522" "RHO" "0000412523" "RHO" "0000412524" "RHO" "0000412525" "RHO" "0000412530" "RHO" "0000412531" "RHO" "0000412532" "RHO" "0000412533" "RHO" "0000412534" "RHO" "0000412547" "RHO" "0000412548" "RHO" "0000412549" "RHO" "0000412550" "RHO" "0000412551" "RHO" "0000412552" "RHO" "0000412555" "RHO" "0000412556" "RHO" "0000412557" "RHO" "0000412558" "RHO" "0000412559" "RHO" "0000412560" "RHO" "0000412561" "RHO" "0000412562" "RHO" "0000412563" "RHO" "0000412564" "RHO" "0000412565" "RHO" "0000412566" "RHO" "0000412567" "RHO" "0000412568" "RHO" "0000412569" "RHO" "0000412570" "RHO" "0000412571" "RHO" "0000412572" "RHO" "0000412573" "RHO" "0000412574" "RHO" "0000412575" "RHO" "0000412576" "RHO" "0000412577" "RHO" "0000412578" "RHO" "0000412579" "RHO" "0000412580" "RHO" "0000412581" "RHO" "0000412582" "RHO" "0000412583" "RHO" "0000412584" "RHO" "0000412585" "RHO" "0000412586" "RHO" "0000412587" "RHO" "0000412588" "RHO" "0000412589" "RHO" "0000412637" "RHO" "0000412638" "RHO" "0000412639" "RHO" "0000412640" "RHO" "0000412641" "RHO" "0000412642" "RHO" "0000412643" "RHO" "0000412644" "RHO" "0000412645" "RHO" "0000412646" "RHO" "0000412649" "RHO" "0000412650" "RHO" "0000412651" "RHO" "0000412652" "RHO" "0000412653" "RHO" "0000412654" "RHO" "0000412655" "RHO" "0000412656" "RHO" "0000412657" "RHO" "0000412658" "RHO" "0000412659" "RHO" "0000412660" "RHO" "0000412661" "RHO" "0000412662" "RHO" "0000412663" "RHO" "0000412664" "RHO" "0000412665" "RHO" "0000412666" "RHO" "0000412667" "RHO" "0000412668" "RHO" "0000412669" "RHO" "0000412670" "RHO" "0000412671" "RHO" "0000412672" "RHO" "0000412673" "RHO" "0000412674" "RHO" "0000412675" "RHO" "0000412676" "RHO" "0000412677" "RHO" "0000412678" "RHO" "0000412680" "RHO" "0000412681" "RHO" "0000412685" "RHO" "0000412688" "RHO" "0000412689" "RHO" "0000412690" "RHO" "0000412696" "RHO" "0000412697" "RHO" "0000412698" "RHO" "0000412699" "RHO" "0000412700" "RHO" "0000412701" "RHO" "0000412702" "RHO" "0000412706" "RHO" "0000412707" "RHO" "0000412708" "RHO" "0000412709" "RHO" "0000412710" "RHO" "0000412711" "RHO" "0000412712" "RHO" "0000412713" "RHO" "0000412714" "RHO" "0000412715" "RHO" "0000412716" "RHO" "0000412717" "RHO" "0000412718" "RHO" "0000412729" "RHO" "0000412730" "RHO" "0000412731" "RHO" "0000412732" "RHO" "0000412733" "RHO" "0000412734" "RHO" "0000412735" "RHO" "0000412736" "RHO" "0000412737" "RHO" "0000412738" "RHO" "0000412739" "RHO" "0000412740" "RHO" "0000412741" "RHO" "0000412742" "RHO" "0000412743" "RHO" "0000412744" "RHO" "0000412745" "RHO" "0000412746" "RHO" "0000412747" "RHO" "0000412748" "RHO" "0000412749" "RHO" "0000412750" "RHO" "0000412751" "RHO" "0000412752" "RHO" "0000412753" "RHO" "0000412754" "RHO" "0000412755" "RHO" "0000412756" "RHO" "0000412757" "RHO" "0000412758" "RHO" "0000412759" "RHO" "0000412760" "RHO" "0000412761" "RHO" "0000412762" "RHO" "0000412763" "RHO" "0000412764" "RHO" "0000412765" "RHO" "0000412767" "RHO" "0000412768" "RHO" "0000412769" "RHO" "0000412770" "RHO" "0000412772" "RHO" "0000412773" "RHO" "0000412776" "RHO" "0000412777" "RHO" "0000412778" "RHO" "0000412779" "RHO" "0000412780" "RHO" "0000412781" "RHO" "0000412782" "RHO" "0000412783" "RHO" "0000412784" "RHO" "0000412785" "RHO" "0000412786" "RHO" "0000412787" "RHO" "0000412788" "RHO" "0000412789" "RHO" "0000412790" "RHO" "0000412792" "RHO" "0000412793" "RHO" "0000412794" "RHO" "0000412795" "RHO" "0000412796" "RHO" "0000412797" "RHO" "0000412802" "RHO" "0000412803" "RHO" "0000412804" "RHO" "0000412805" "RHO" "0000412806" "RHO" "0000412807" "RHO" "0000412808" "RHO" "0000412809" "RHO" "0000412810" "RHO" "0000412811" "RHO" "0000412812" "RHO" "0000412813" "RHO" "0000412814" "RHO" "0000412815" "RHO" "0000412824" "RHO" "0000412825" "RHO" "0000412826" "RHO" "0000412827" "RHO" "0000412828" "RHO" "0000412829" "RHO" "0000412830" "RHO" "0000412831" "RHO" "0000412832" "RHO" "0000412833" "RHO" "0000412834" "RHO" "0000412835" "RHO" "0000412836" "RHO" "0000412837" "RHO" "0000412838" "RHO" "0000412839" "RHO" "0000412840" "RHO" "0000412841" "RHO" "0000412842" "RHO" "0000412843" "RHO" "0000412844" "RHO" "0000412845" "RHO" "0000412846" "RHO" "0000412847" "RHO" "0000412848" "RHO" "0000412849" "RHO" "0000412850" "RHO" "0000412856" "RHO" "0000412857" "RHO" "0000412858" "RHO" "0000412859" "RHO" "0000412860" "RHO" "0000412861" "RHO" "0000412862" "RHO" "0000412863" "RHO" "0000412864" "RHO" "0000412865" "RHO" "0000412866" "RHO" "0000412867" "RHO" "0000412868" "RHO" "0000412869" "RHO" "0000412870" "RHO" "0000412871" "RHO" "0000412872" "RHO" "0000412873" "RHO" "0000412874" "RHO" "0000412875" "RHO" "0000412876" "RHO" "0000412877" "RHO" "0000412878" "RHO" "0000412879" "RHO" "0000412880" "RHO" "0000412881" "RHO" "0000412882" "RHO" "0000412885" "RHO" "0000412886" "RHO" "0000412887" "RHO" "0000412888" "RHO" "0000412889" "RHO" "0000412892" "RHO" "0000412895" "RHO" "0000412919" "RHO" "0000412920" "RHO" "0000412921" "RHO" "0000412922" "RHO" "0000412923" "RHO" "0000412924" "RHO" "0000412925" "RHO" "0000412926" "RHO" "0000413107" "RHO" "0000413108" "RHO" "0000413109" "RHO" "0000413110" "RHO" "0000413111" "RHO" "0000413112" "RHO" "0000413113" "RHO" "0000413114" "RHO" "0000413115" "RHO" "0000413116" "RHO" "0000413117" "RHO" "0000413118" "RHO" "0000413119" "RHO" "0000413120" "RHO" "0000413121" "RHO" "0000413122" "RHO" "0000413123" "RHO" "0000413124" "RHO" "0000413125" "RHO" "0000413126" "RHO" "0000413127" "RHO" "0000413128" "RHO" "0000413129" "RHO" "0000413130" "RHO" "0000413131" "RHO" "0000413132" "RHO" "0000413133" "RHO" "0000413134" "RHO" "0000413135" "RHO" "0000413136" "RHO" "0000413137" "RHO" "0000413138" "RHO" "0000413139" "RHO" "0000413140" "RHO" "0000413141" "RHO" "0000413142" "RHO" "0000413143" "RHO" "0000413144" "RHO" "0000413145" "RHO" "0000413146" "RHO" "0000413147" "RHO" "0000413148" "RHO" "0000413149" "RHO" "0000413150" "RHO" "0000413151" "RHO" "0000413152" "RHO" "0000413153" "RHO" "0000413154" "RHO" "0000413155" "RHO" "0000413156" "RHO" "0000413157" "RHO" "0000413158" "RHO" "0000413159" "RHO" "0000413160" "RHO" "0000413161" "RHO" "0000413162" "RHO" "0000413163" "RHO" "0000413164" "RHO" "0000413165" "RHO" "0000413166" "RHO" "0000413167" "RHO" "0000413168" "RHO" "0000413169" "RHO" "0000413170" "RHO" "0000413171" "RHO" "0000413172" "RHO" "0000413173" "RHO" "0000413174" "RHO" "0000413175" "RHO" "0000413176" "RHO" "0000413177" "RHO" "0000413178" "RHO" "0000413179" "RHO" "0000413180" "RHO" "0000413181" "RHO" "0000413182" "RHO" "0000413183" "RHO" "0000413184" "RHO" "0000413185" "RHO" "0000413186" "RHO" "0000413188" "RHO" "0000413189" "RHO" "0000413190" "RHO" "0000413191" "RHO" "0000413192" "RHO" "0000413193" "RHO" "0000413195" "RHO" "0000413196" "RHO" "0000413268" "RHO" "0000413269" "RHO" "0000413270" "RHO" "0000413271" "RHO" "0000413272" "RHO" "0000413273" "RHO" "0000413274" "RHO" "0000413275" "RHO" "0000413276" "RHO" "0000413277" "RHO" "0000413278" "RHO" "0000413279" "RHO" "0000413280" "RHO" "0000413281" "RHO" "0000413282" "RHO" "0000413283" "RHO" "0000413284" "RHO" "0000413285" "RHO" "0000413286" "RHO" "0000413287" "RHO" "0000413288" "RHO" "0000413289" "RHO" "0000413290" "RHO" "0000413291" "RHO" "0000413292" "RHO" "0000413293" "RHO" "0000413294" "RHO" "0000413295" "RHO" "0000413296" "RHO" "0000413297" "RHO" "0000413298" "RHO" "0000413299" "RHO" "0000413300" "RHO" "0000413301" "RHO" "0000413302" "RHO" "0000413303" "RHO" "0000413304" "RHO" "0000413305" "RHO" "0000413306" "RHO" "0000413307" "RHO" "0000413308" "RHO" "0000413309" "RHO" "0000413310" "RHO" "0000413311" "RHO" "0000413312" "RHO" "0000413313" "RHO" "0000413314" "RHO" "0000413315" "RHO" "0000413316" "RHO" "0000413317" "RHO" "0000413318" "RHO" "0000413319" "RHO" "0000413320" "RHO" "0000413321" "RHO" "0000413322" "RHO" "0000413323" "RHO" "0000413324" "RHO" "0000413325" "RHO" "0000413326" "RHO" "0000413327" "RHO" "0000413328" "RHO" "0000413329" "RHO" "0000413330" "RHO" "0000413331" "RHO" "0000413332" "RHO" "0000413333" "RHO" "0000413334" "RHO" "0000413335" "RHO" "0000413336" "RHO" "0000413337" "RHO" "0000413338" "RHO" "0000413339" "RHO" "0000413340" "RHO" "0000413341" "RHO" "0000413342" "RHO" "0000413343" "RHO" "0000413344" "RHO" "0000413345" "RHO" "0000413346" "RHO" "0000413347" "RHO" "0000413348" "RHO" "0000413349" "RHO" "0000413350" "RHO" "0000413351" "RHO" "0000413352" "RHO" "0000413365" "RHO" "0000413366" "RHO" "0000413367" "RHO" "0000413368" "RHO" "0000413369" "RHO" "0000413370" "RHO" "0000413371" "RHO" "0000413372" "RHO" "0000413373" "RHO" "0000413374" "RHO" "0000413375" "RHO" "0000413376" "RHO" "0000413377" "RHO" "0000413378" "RHO" "0000413379" "RHO" "0000413385" "RHO" "0000413386" "RHO" "0000413387" "RHO" "0000413388" "RHO" "0000413389" "RHO" "0000413390" "RHO" "0000413391" "RHO" "0000413392" "RHO" "0000413393" "RHO" "0000413394" "RHO" "0000413395" "RHO" "0000413396" "RHO" "0000413397" "RHO" "0000413398" "RHO" "0000413399" "RHO" "0000413400" "RHO" "0000413401" "RHO" "0000413402" "RHO" "0000413403" "RHO" "0000413404" "RHO" "0000413407" "RHO" "0000413408" "RHO" "0000413409" "RHO" "0000413410" "RHO" "0000413411" "RHO" "0000413412" "RHO" "0000413413" "RHO" "0000413414" "RHO" "0000413415" "RHO" "0000413416" "RHO" "0000413417" "RHO" "0000413418" "RHO" "0000413419" "RHO" "0000413420" "RHO" "0000413421" "RHO" "0000413422" "RHO" "0000413423" "RHO" "0000413424" "RHO" "0000413425" "RHO" "0000413426" "RHO" "0000413427" "RHO" "0000413428" "RHO" "0000413429" "RHO" "0000413430" "RHO" "0000413431" "RHO" "0000413432" "RHO" "0000413433" "RHO" "0000413434" "RHO" "0000413435" "RHO" "0000413436" "RHO" "0000413439" "RHO" "0000413440" "RHO" "0000413441" "RHO" "0000413442" "RHO" "0000413446" "RHO" "0000413453" "RHO" "0000413454" "RHO" "0000413455" "RHO" "0000413456" "RHO" "0000413457" "RHO" "0000413458" "RHO" "0000413459" "RHO" "0000413460" "RHO" "0000413461" "RHO" "0000413462" "RHO" "0000413463" "RHO" "0000413464" "RHO" "0000413465" "RHO" "0000413466" "RHO" "0000413467" "RHO" "0000413468" "RHO" "0000413469" "RHO" "0000413471" "RHO" "0000413472" "RHO" "0000413473" "RHO" "0000413474" "RHO" "0000413475" "RHO" "0000413476" "RHO" "0000413477" "RHO" "0000413480" "RHO" "0000413481" "RHO" "0000413482" "RHO" "0000413483" "RHO" "0000413484" "RHO" "0000413485" "RHO" "0000413486" "RHO" "0000413487" "RHO" "0000413488" "RHO" "0000413489" "RHO" "0000413490" "RHO" "0000413491" "RHO" "0000413492" "RHO" "0000413493" "RHO" "0000413494" "RHO" "0000413496" "RHO" "0000413497" "RHO" "0000413498" "RHO" "0000413499" "RHO" "0000413500" "RHO" "0000413501" "RHO" "0000413502" "RHO" "0000413503" "RHO" "0000413504" "RHO" "0000413505" "RHO" "0000413506" "RHO" "0000413516" "RHO" "0000413517" "RHO" "0000413518" "RHO" "0000413519" "RHO" "0000413520" "RHO" "0000413521" "RHO" "0000413522" "RHO" "0000413523" "RHO" "0000413524" "RHO" "0000413525" "RHO" "0000413526" "RHO" "0000413529" "RHO" "0000413530" "RHO" "0000413531" "RHO" "0000413532" "RHO" "0000413533" "RHO" "0000413534" "RHO" "0000413535" "RHO" "0000413536" "RHO" "0000413537" "RHO" "0000413547" "RHO" "0000413548" "RHO" "0000413549" "RHO" "0000413550" "RHO" "0000413551" "RHO" "0000413553" "RHO" "0000413554" "RHO" "0000413555" "RHO" "0000413556" "RHO" "0000413557" "RHO" "0000413558" "RHO" "0000413559" "RHO" "0000413560" "RHO" "0000413561" "RHO" "0000413563" "RHO" "0000413564" "RHO" "0000413565" "RHO" "0000413566" "RHO" "0000413567" "RHO" "0000413568" "RHO" "0000413569" "RHO" "0000413570" "RHO" "0000413571" "RHO" "0000413587" "RHO" "0000413588" "RHO" "0000413589" "RHO" "0000413590" "RHO" "0000413591" "RHO" "0000413592" "RHO" "0000413593" "RHO" "0000413594" "RHO" "0000413595" "RHO" "0000413596" "RHO" "0000413654" "RHO" "0000413655" "RHO" "0000413656" "RHO" "0000413657" "RHO" "0000413658" "RHO" "0000413659" "RHO" "0000413660" "RHO" "0000413661" "RHO" "0000413662" "RHO" "0000413663" "RHO" "0000413664" "RHO" "0000413665" "RHO" "0000413666" "RHO" "0000413667" "RHO" "0000413668" "RHO" "0000413669" "RHO" "0000413670" "RHO" "0000413671" "RHO" "0000413672" "RHO" "0000413673" "RHO" "0000413674" "RHO" "0000413675" "RHO" "0000413676" "RHO" "0000413677" "RHO" "0000413678" "RHO" "0000413679" "RHO" "0000413680" "RHO" "0000413681" "RHO" "0000413682" "RHO" "0000413683" "RHO" "0000413684" "RHO" "0000413685" "RHO" "0000413686" "RHO" "0000413687" "RHO" "0000413688" "RHO" "0000413689" "RHO" "0000413690" "RHO" "0000413691" "RHO" "0000413692" "RHO" "0000413693" "RHO" "0000413694" "RHO" "0000413695" "RHO" "0000413696" "RHO" "0000413697" "RHO" "0000413698" "RHO" "0000413699" "RHO" "0000413700" "RHO" "0000413701" "RHO" "0000413702" "RHO" "0000413703" "RHO" "0000413704" "RHO" "0000413705" "RHO" "0000413706" "RHO" "0000413707" "RHO" "0000413708" "RHO" "0000413711" "RHO" "0000413712" "RHO" "0000415639" "RHO" "0000421733" "RHO" "0000421776" "RHO" "0000421898" "RHO" "0000428260" "RHO" "0000430896" "RHO" "0000430946" "RHO" "0000430980" "RHO" "0000430987" "RHO" "0000430999" "RHO" "0000431030" "RHO" "0000431052" "RHO" "0000431059" "RHO" "0000431061" "RHO" "0000431097" "RHO" "0000431132" "RHO" "0000431153" "RHO" "0000431235" "RHO" "0000431246" "RHO" "0000431253" "RHO" "0000431263" "RHO" "0000431272" "RHO" "0000431318" "RHO" "0000431352" "RHO" "0000431387" "RHO" "0000431394" "RHO" "0000431413" "RHO" "0000431485" "RHO" "0000431493" "RHO" "0000431521" "RHO" "0000431546" "RHO" "0000431549" "RHO" "0000431552" "RHO" "0000431559" "RHO" "0000436890" "RHO" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 2067 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000000101" "0" "50" "1" "43804340" "43804340" "subst" "0.0247897" "00002" "MPL_000001" "g.43804340G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.43338669G>A" "" "VUS" "" "0000000232" "3" "50" "11" "45832935" "45832935" "subst" "0.626881" "00002" "SLC35C1_000001" "g.45832935G>A" "" "{PMID:Almomani 2011:21102627}" "" "" "" "Germline" "" "rs1139266" "0" "" "" "g.45811384G>A" "" "VUS" "" "0000003895" "3" "50" "3" "129251263" "129251263" "subst" "0.0814613" "00037" "RHO_000005" "g.129251263C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129532420C>T" "" "VUS" "" "0000019478" "0" "90" "3" "129252554" "129252554" "subst" "0" "00102" "RHO_000004" "g.129252554C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "" "0000060185" "1" "70" "3" "129249760" "129249760" "subst" "0" "00229" "RHO_000001" "g.129249760C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion; potentially de novo" "Germline" "" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000060186" "1" "70" "3" "129251101" "129251101" "subst" "0" "00229" "RHO_000002" "g.129251101C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "De novo" "yes" "" "0" "" "" "g.129532258C>T" "" "likely pathogenic" "" "0000060187" "1" "70" "3" "129251204" "129251204" "subst" "0" "00229" "RHO_000003" "g.129251204T>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "" "" "0" "" "" "g.129532361T>A" "" "likely pathogenic" "" "0000253767" "0" "10" "3" "129247551" "129247551" "subst" "0.273979" "01943" "RHO_000006" "g.129247551A>G" "" "" "" "RHO(NM_000539.3):c.-26A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528708A>G" "" "benign" "" "0000254866" "0" "30" "3" "129252495" "129252495" "subst" "1.62463E-5" "01943" "RHO_000024" "g.129252495A>T" "" "" "" "RHO(NM_000539.3):c.981A>T (p.P327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129533652A>T" "" "likely benign" "" "0000255429" "0" "90" "3" "129251132" "129251132" "subst" "0" "01943" "RHO_000019" "g.129251132A>G" "" "" "" "RHO(NM_000539.3):c.569A>G (p.D190G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532289A>G" "" "pathogenic" "" "0000255557" "0" "90" "3" "129247620" "129247620" "subst" "0" "01943" "RHO_000007" "g.129247620A>G" "" "" "" "RHO(NM_000539.3):c.44A>G (p.N15S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528777A>G" "" "pathogenic" "" "0000255677" "0" "90" "3" "129252449" "129252449" "subst" "0" "01943" "RHO_000023" "g.129252449A>C" "" "" "" "RHO(NM_000539.3):c.937-2A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129533606A>C" "" "pathogenic" "" "0000294840" "0" "10" "3" "129247728" "129247728" "subst" "0.000799942" "02330" "RHO_000010" "g.129247728G>C" "" "" "" "RHO(NM_000539.3):c.152G>C (p.G51A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528885G>C" "" "benign" "" "0000294841" "0" "50" "3" "129247817" "129247817" "subst" "4.06091E-6" "02330" "RHO_000012" "g.129247817G>A" "" "" "" "RHO(NM_000539.3):c.241G>A (p.V81M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528974G>A" "" "VUS" "" "0000294842" "0" "10" "3" "129247936" "129247936" "subst" "0.00347512" "02330" "RHO_000013" "g.129247936C>T" "" "" "" "RHO(NM_000539.3):c.360C>T (p.G120=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129529093C>T" "" "benign" "" "0000294843" "0" "10" "3" "129249873" "129249873" "subst" "9.35355E-5" "02330" "RHO_000015" "g.129249873C>T" "" "" "" "RHO(NM_000539.3):c.516C>T (p.L172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129531030C>T" "" "benign" "" "0000294844" "0" "30" "3" "129247627" "129247627" "subst" "4.06114E-6" "02330" "RHO_000008" "g.129247627G>A" "" "" "" "RHO(NM_000539.3):c.51G>A (p.T17=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528784G>A" "" "likely benign" "" "0000294845" "0" "10" "3" "129249907" "129249907" "subst" "0.000349165" "02330" "RHO_000017" "g.129249907G>A" "" "" "" "RHO(NM_000539.3):c.530+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129531064G>A" "" "benign" "" "0000294846" "0" "10" "3" "129251130" "129251130" "subst" "8.12242E-6" "02330" "RHO_000018" "g.129251130C>T" "" "" "" "RHO(NM_000539.3):c.567C>T (p.I189=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532287C>T" "" "benign" "" "0000307075" "0" "50" "3" "129247728" "129247728" "subst" "0" "01943" "RHO_000011" "g.129247728G>T" "" "" "" "RHO(NM_000539.3):c.152G>T (p.G51V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528885G>T" "" "VUS" "" "0000307076" "0" "90" "3" "129249839" "129249839" "subst" "4.06157E-6" "01943" "RHO_000014" "g.129249839G>A" "" "" "" "RHO(NM_000539.3):c.482G>A (p.W161*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129530996G>A" "" "pathogenic" "" "0000307077" "0" "30" "3" "129249876" "129249876" "subst" "0.000667236" "01943" "RHO_000016" "g.129249876C>T" "" "" "" "RHO(NM_000539.3):c.519C>T (p.A173=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129531033C>T" "" "likely benign" "" "0000307078" "0" "10" "3" "129251263" "129251263" "subst" "0.0814613" "01943" "RHO_000005" "g.129251263C>T" "" "" "" "RHO(NM_000539.3):c.696+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532420C>T" "" "benign" "" "0000307079" "0" "50" "3" "129251264" "129251264" "subst" "4.06702E-5" "01943" "RHO_000020" "g.129251264G>A" "" "" "" "RHO(NM_000539.3):c.696+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532421G>A" "" "VUS" "" "0000307080" "0" "70" "3" "129251438" "129251438" "subst" "2.84269E-5" "01943" "RHO_000021" "g.129251438G>T" "" "" "" "RHO(NM_000539.3):c.759G>T (p.M253I, p.(Met253Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532595G>T" "" "likely pathogenic" "" "0000307081" "0" "90" "3" "129247660" "129247660" "subst" "0" "01943" "RHO_000009" "g.129247660G>T" "" "" "" "RHO(NM_000539.3):c.84G>T (p.Q28H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528817G>T" "" "pathogenic" "" "0000307082" "0" "30" "3" "129251570" "129251570" "subst" "0.000929904" "01943" "RHO_000022" "g.129251570C>T" "" "" "" "RHO(NM_000539.3):c.891C>T (p.S297=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532727C>T" "" "likely benign" "" "0000337120" "0" "10" "3" "129247551" "129247551" "subst" "0.273979" "02327" "RHO_000006" "g.129247551A>G" "" "" "" "RHO(NM_000539.3):c.-26A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528708A>G" "" "benign" "" "0000340773" "0" "30" "3" "129247936" "129247936" "subst" "0.00347512" "02327" "RHO_000013" "g.129247936C>T" "" "" "" "RHO(NM_000539.3):c.360C>T (p.G120=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129529093C>T" "" "likely benign" "" "0000341876" "0" "90" "3" "129249760" "129249760" "subst" "0" "02327" "RHO_000001" "g.129249760C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000342610" "0" "50" "3" "129252455" "129252455" "subst" "2.44248E-5" "02327" "RHO_000034" "g.129252455G>A" "" "" "" "RHO(NM_000539.3):c.941G>A (p.R314Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129533612G>A" "" "VUS" "" "0000343976" "0" "90" "3" "129251132" "129251132" "subst" "0" "02327" "RHO_000019" "g.129251132A>G" "" "" "" "RHO(NM_000539.3):c.569A>G (p.D190G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532289A>G" "" "pathogenic" "" "0000343977" "0" "90" "3" "129251131" "129251131" "subst" "0" "02327" "RHO_000031" "g.129251131G>T" "" "" "" "RHO(NM_000539.3):c.568G>T (p.D190Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532288G>T" "" "pathogenic" "" "0000344736" "0" "90" "3" "129247660" "129247660" "subst" "0" "02327" "RHO_000009" "g.129247660G>T" "" "" "" "RHO(NM_000539.3):c.84G>T (p.Q28H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528817G>T" "" "pathogenic" "" "0000345197" "0" "90" "3" "129251104" "129251104" "subst" "0" "02327" "RHO_000030" "g.129251104G>A" "" "" "" "RHO(NM_000539.3):c.541G>A (p.E181K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0000345494" "0" "50" "3" "129247590" "129247590" "subst" "0" "02327" "RHO_000025" "g.129247590A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528747A>C" "" "VUS" "" "0000347153" "0" "50" "3" "129247695" "129247695" "subst" "0" "02327" "RHO_000027" "g.129247695T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528852T>C" "" "VUS" "" "0000347772" "0" "90" "3" "129251183" "129251183" "subst" "0" "02327" "RHO_000032" "g.129251183T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129532340T>G" "" "pathogenic" "" "0000348239" "0" "70" "3" "129249869" "129249869" "subst" "0" "02327" "RHO_000029" "g.129249869C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129531026C>A" "" "likely pathogenic" "" "0000348308" "0" "90" "3" "129247644" "129247644" "subst" "0" "02327" "RHO_000026" "g.129247644C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129528801C>T" "" "pathogenic" "" "0000348953" "0" "50" "3" "129252542" "129252542" "subst" "0" "02327" "RHO_000035" "g.129252542G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129533699G>A" "" "VUS" "" "0000350324" "0" "50" "3" "129249826" "129249826" "subst" "0.000134015" "02327" "RHO_000028" "g.129249826G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129530983G>A" "" "VUS" "" "0000350877" "0" "70" "3" "129252449" "129252449" "subst" "0" "02327" "RHO_000023" "g.129252449A>C" "" "" "" "RHO(NM_000539.3):c.937-2A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129533606A>C" "" "likely pathogenic" "" "0000438568" "0" "90" "3" "129252547" "129252547" "subst" "0" "01244" "RHO_000036" "g.129252547G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129533704G>C" "" "pathogenic" "" "0000476228" "0" "90" "3" "129247587" "129247587" "subst" "0" "02591" "RHO_000037" "g.129247587C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528744C>A" "" "pathogenic" "" "0000476229" "0" "50" "3" "129247609" "129247609" "del" "0" "02591" "RHO_000038" "g.129247609del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528766del" "" "VUS" "" "0000476230" "0" "50" "3" "129247614" "129247614" "subst" "0" "02591" "RHO_000039" "g.129247614T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528771T>C" "" "VUS" "" "0000476231" "0" "90" "3" "129247626" "129247626" "subst" "0" "02591" "RHO_000040" "g.129247626C>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893769" "0" "" "" "g.129528783C>T" "" "pathogenic" "" "0000476232" "0" "90" "3" "129247644" "129247644" "subst" "0" "02591" "RHO_000026" "g.129247644C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>T" "" "pathogenic" "" "0000476233" "0" "50" "3" "129247658" "129247658" "subst" "0" "02591" "RHO_000041" "g.129247658C>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528815C>G" "" "VUS" "" "0000476234" "3" "50" "3" "129247700" "129247700" "subst" "1.62433E-5" "02591" "RHO_000042" "g.129247700G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs538820015" "0" "" "" "g.129528857G>A" "" "VUS" "" "0000476235" "0" "90" "3" "129247772" "129247772" "subst" "0" "02591" "RHO_000043" "g.129247772A>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528929A>T" "" "pathogenic" "" "0000476236" "0" "90" "3" "129247809" "129247809" "subst" "0" "02591" "RHO_000044" "g.129247809A>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528966A>T" "" "pathogenic" "" "0000476237" "0" "90" "3" "129247839" "129247839" "subst" "0" "02591" "RHO_000045" "g.129247839T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129528996T>C" "" "pathogenic" "" "0000476238" "0" "50" "3" "129247872" "129247872" "subst" "0" "02591" "RHO_000046" "g.129247872T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129529029T>C" "" "VUS" "" "0000476239" "0" "50" "3" "129247886" "129247886" "subst" "0.000207702" "02591" "RHO_000047" "g.129247886G>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs144317206" "0" "" "" "g.129529043G>A" "" "VUS" "" "0000476240" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "02591" "RHO_000048" "g.129247892G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893773" "0" "" "" "g.129529049G>A" "" "pathogenic" "" "0000476241" "0" "50" "3" "129247895" "129247895" "subst" "0" "02591" "RHO_000049" "g.129247895C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129529052C>T" "" "VUS" "" "0000476242" "0" "90" "3" "129249737" "129249737" "subst" "0" "02591" "RHO_000050" "g.129249737C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129530894C>T" "" "pathogenic" "" "0000476243" "0" "90" "3" "129249760" "129249760" "subst" "0" "02591" "RHO_000001" "g.129249760C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893775" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000476244" "0" "50" "3" "129249761" "129249761" "subst" "8.12117E-6" "02591" "RHO_000051" "g.129249761G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893774" "0" "" "" "g.129530918G>A" "" "VUS" "" "0000476245" "0" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "02591" "RHO_000052" "g.129249848C>T" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893793" "0" "" "" "g.129531005C>T" "" "pathogenic" "" "0000476246" "0" "50" "3" "129249877" "129249877" "subst" "1.2212E-5" "02591" "RHO_000053" "g.129249877G>A" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236103" "0" "" "" "g.129531034G>A" "" "VUS" "" "0000476247" "0" "90" "3" "129251104" "129251104" "subst" "0" "02591" "RHO_000030" "g.129251104G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0000476248" "0" "50" "3" "129251123" "129251123" "subst" "0" "02591" "RHO_000054" "g.129251123G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129532280G>C" "" "VUS" "" "0000476249" "0" "90" "3" "129251125" "129251125" "subst" "0" "02591" "RHO_000055" "g.129251125G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236100" "0" "" "" "g.129532282G>A" "" "pathogenic" "" "0000476250" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "02591" "RHO_000056" "g.129251131G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893779" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000476251" "0" "50" "3" "129251141" "129251141" "subst" "4.06154E-6" "02591" "RHO_000057" "g.129251141C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs373974298" "0" "" "" "g.129532298C>A" "" "VUS" "" "0000476252" "0" "50" "3" "129251141" "129251141" "subst" "3.65539E-5" "02591" "RHO_000058" "g.129251141C>T" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs373974298" "0" "" "" "g.129532298C>T" "" "VUS" "" "0000476253" "0" "10" "3" "129251263" "129251263" "subst" "0.0814613" "02591" "RHO_000005" "g.129251263C>T" "97/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs56340615" "0" "" "" "g.129532420C>T" "" "benign" "" "0000476254" "0" "50" "3" "129251515" "129251515" "subst" "0" "02591" "RHO_000059" "g.129251515A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129532672A>C" "" "VUS" "" "0000476255" "0" "50" "3" "129251548" "129251548" "subst" "0" "02591" "RHO_000060" "g.129251548T>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129532705T>A" "" "VUS" "" "0000476256" "0" "50" "3" "129252455" "129252455" "subst" "2.44248E-5" "02591" "RHO_000034" "g.129252455G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs753609310" "0" "" "" "g.129533612G>A" "" "VUS" "" "0000476257" "0" "90" "3" "129252462" "129252462" "subst" "0" "02591" "RHO_000061" "g.129252462C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.129533619C>A" "" "pathogenic" "" "0000476258" "0" "90" "3" "129252544" "129252544" "subst" "0" "02591" "RHO_000062" "g.129252544C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893778" "0" "" "" "g.129533701C>T" "" "pathogenic" "" "0000476259" "0" "90" "3" "129252554" "129252554" "subst" "0" "02591" "RHO_000004" "g.129252554C>T" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic" "" "0000477464" "3" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "02591" "RHO_000048" "g.129247892G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs104893773" "0" "" "" "g.129529049G>A" "" "pathogenic" "" "0000477465" "3" "10" "3" "129251263" "129251263" "subst" "0.0814613" "02591" "RHO_000005" "g.129251263C>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs56340615" "0" "" "" "g.129532420C>T" "" "benign" "" "0000500662" "0" "90" "3" "129251554" "129251554" "subst" "0" "00006" "RHO_000063" "g.129251554C>A" "" "{PMID:Dryja 1993:08358437}" "" "" "" "Germline" "" "rs104893789" "0" "" "" "g.129532711C>A" "" "pathogenic (dominant)" "" "0000500663" "0" "90" "3" "129247845" "129247845" "subst" "0" "00006" "RHO_000064" "g.129247845G>A" "" "{PMID:Rao 1994:08107847}" "" "" "" "Germline" "" "rs104893790" "0" "" "" "g.129529002G>A" "" "pathogenic (dominant)" "" "0000500664" "1" "90" "3" "129247857" "129247857" "subst" "0" "00006" "RHO_000065" "g.129247857C>T" "" "{PMID:al-Jandal 1999:09888392}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129529014C>T" "" "pathogenic (dominant)" "" "0000517829" "0" "90" "3" "129247620" "129247620" "subst" "0" "02330" "RHO_000007" "g.129247620A>G" "" "" "" "RHO(NM_000539.3):c.44A>G (p.N15S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528777A>G" "" "pathogenic" "" "0000517830" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "02330" "RHO_000066" "g.129247637C>T" "" "" "" "RHO(NM_000539.3):c.61C>T (p.R21C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528794C>T" "" "likely pathogenic" "" "0000517831" "0" "90" "3" "129247660" "129247660" "subst" "0" "02330" "RHO_000009" "g.129247660G>T" "" "" "" "RHO(NM_000539.3):c.84G>T (p.Q28H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528817G>T" "" "pathogenic" "" "0000517832" "0" "90" "3" "129247766" "129247766" "subst" "0" "02327" "RHO_000067" "g.129247766C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528923C>T" "" "pathogenic" "" "0000517833" "0" "50" "3" "129247779" "129247779" "subst" "6.09097E-5" "02330" "RHO_000068" "g.129247779T>G" "" "" "" "RHO(NM_000539.3):c.203T>G (p.L68R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528936T>G" "" "VUS" "" "0000517834" "0" "10" "3" "129247946" "129247946" "subst" "5.40109E-5" "02330" "RHO_000069" "g.129247946C>T" "" "" "" "RHO(NM_000539.3):c.361+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129529103C>T" "" "benign" "" "0000517835" "0" "10" "3" "129249837" "129249837" "subst" "0.00155945" "02330" "RHO_000070" "g.129249837C>A" "" "" "" "RHO(NM_000539.3):c.480C>A (p.T160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129530994C>A" "" "benign" "" "0000517836" "0" "30" "3" "129249837" "129249837" "subst" "0.00155945" "01943" "RHO_000070" "g.129249837C>A" "" "" "" "RHO(NM_000539.3):c.480C>A (p.T160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129530994C>A" "" "likely benign" "" "0000517837" "0" "10" "3" "129249892" "129249892" "subst" "2.4487E-5" "02330" "RHO_000071" "g.129249892T>C" "" "" "" "RHO(NM_000539.3):c.530+5T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129531049T>C" "" "benign" "" "0000517838" "0" "50" "3" "129249892" "129249892" "subst" "2.4487E-5" "01943" "RHO_000071" "g.129249892T>C" "" "" "" "RHO(NM_000539.3):c.530+5T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129531049T>C" "" "VUS" "" "0000517839" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "01943" "RHO_000056" "g.129251131G>A" "" "" "" "RHO(NM_000539.3):c.568G>A (p.D190N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532288G>A" "" "pathogenic" "" "0000517840" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "02327" "RHO_000056" "g.129251131G>A" "" "" "" "RHO(NM_000539.3):c.568G>A (p.D190N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532288G>A" "" "pathogenic" "" "0000517841" "0" "10" "3" "129251264" "129251264" "subst" "4.47373E-5" "02330" "RHO_000072" "g.129251264G>C" "" "" "" "RHO(NM_000539.3):c.696+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532421G>C" "" "benign" "" "0000517842" "0" "50" "3" "129251264" "129251264" "subst" "4.47373E-5" "01943" "RHO_000072" "g.129251264G>C" "" "" "" "RHO(NM_000539.3):c.696+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532421G>C" "" "VUS" "" "0000517843" "0" "50" "3" "129251264" "129251264" "subst" "4.47373E-5" "02327" "RHO_000072" "g.129251264G>C" "" "" "" "RHO(NM_000539.3):c.696+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532421G>C" "" "VUS" "" "0000517844" "0" "50" "3" "129251434" "129251434" "subst" "8.93452E-5" "02327" "RHO_000073" "g.129251434G>C" "" "" "" "RHO(NM_000539.3):c.755G>C (p.(Arg252Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532591G>C" "" "VUS" "" "0000517845" "0" "50" "3" "129251438" "129251438" "subst" "2.84269E-5" "02327" "RHO_000021" "g.129251438G>T" "" "" "" "RHO(NM_000539.3):c.759G>T (p.M253I, p.(Met253Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129532595G>T" "" "VUS" "" "0000517847" "0" "30" "3" "129252473" "129252473" "subst" "0.000105667" "01943" "RHO_000075" "g.129252473C>A" "" "" "" "RHO(NM_000539.3):c.959C>A (p.T320N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533630C>A" "" "likely benign" "" "0000517848" "0" "50" "3" "129252502" "129252502" "subst" "0" "02327" "RHO_000076" "g.129252502G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533659G>A" "" "VUS" "" "0000517849" "0" "10" "3" "129252504" "129252504" "subst" "2.43688E-5" "02330" "RHO_000077" "g.129252504C>T" "" "" "" "RHO(NM_000539.3):c.990C>T (p.D330=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533661C>T" "" "benign" "" "0000517850" "0" "50" "3" "129252546" "129252546" "subst" "8.12532E-6" "01943" "RHO_000078" "g.129252546G>C" "" "" "" "RHO(NM_000539.3):c.1032G>C (p.Q344H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533703G>C" "" "VUS" "" "0000517851" "0" "50" "3" "129252546" "129252546" "subst" "8.12532E-6" "02327" "RHO_000078" "g.129252546G>C" "" "" "" "RHO(NM_000539.3):c.1032G>C (p.Q344H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533703G>C" "" "VUS" "" "0000517852" "0" "70" "3" "129252554" "129252554" "subst" "0" "02327" "RHO_000004" "g.129252554C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000621176" "0" "30" "3" "129252483" "129252483" "subst" "0.000666369" "02330" "RHO_000079" "g.129252483C>T" "" "" "" "RHO(NM_000539.3):c.969C>T (p.C323=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129533640C>T" "" "likely benign" "" "0000624955" "0" "70" "3" "129251123" "129251123" "subst" "0" "01848" "RHO_000080" "g.129251123G>T" "" " {PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.129532280G>T" "" "likely pathogenic (dominant)" "ACMG" "0000651069" "1" "90" "3" "129249805" "129249805" "subst" "5.27876E-5" "03575" "RHO_000081" "g.129249805G>A" "4/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 heterozygous, no homozygous; {DB:CLININrs104893791}" "Germline" "" "rs104893791" "0" "" "" "g.129530962G>A" "" "pathogenic" "" "0000651070" "1" "30" "3" "129252874" "129252874" "subst" "0" "03575" "RHO_000082" "g.129252874C>T" "143/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "143 heterozygous; {DB:CLININrs55941599}" "Germline" "" "rs55941599" "0" "" "" "g.129534031C>T" "" "likely benign" "" "0000654796" "0" "90" "3" "129247620" "129247620" "subst" "0" "02327" "RHO_000007" "g.129247620A>G" "" "" "" "RHO(NM_000539.3):c.44A>G (p.N15S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528777A>G" "" "pathogenic" "" "0000654797" "0" "50" "3" "129247754" "129247754" "subst" "3.65461E-5" "02327" "RHO_000083" "g.129247754T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129528911T>C" "" "VUS" "" "0000654798" "0" "10" "3" "129249738" "129249738" "subst" "0.000337037" "02330" "RHO_000084" "g.129249738C>G" "" "" "" "RHO(NM_000539.3):c.381C>G (p.S127=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129530895C>G" "" "benign" "" "0000664285" "21" "10" "3" "129247886" "129247886" "subst" "0.000207702" "00006" "RHO_000047" "g.129247886G>A" "" "{PMID:Wang 2017:28837730}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129529043G>A" "" "benign" "" "0000669741" "3" "30" "3" "129252874" "129252874" "subst" "0" "03575" "RHO_000082" "g.129252874C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs55941599}" "Germline" "" "rs55941599" "0" "" "" "g.129534031C>T" "" "likely benign" "" "0000676816" "0" "50" "3" "129247592" "129247592" "subst" "4.06204E-6" "02327" "RHO_000085" "g.129247592G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000676817" "0" "50" "3" "129252445" "129252445" "subst" "0" "02330" "RHO_000086" "g.129252445T>A" "" "" "" "RHO(NM_000539.3):c.937-6T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000676818" "0" "50" "3" "129252455" "129252455" "subst" "2.44248E-5" "02330" "RHO_000034" "g.129252455G>A" "" "" "" "RHO(NM_000539.3):c.941G>A (p.R314Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000676819" "0" "50" "3" "129252497" "129252497" "subst" "0" "02330" "RHO_000087" "g.129252497T>G" "" "" "" "RHO(NM_000539.3):c.983T>G (p.L328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000684561" "1" "70" "3" "129247626" "129247626" "subst" "0" "00004" "RHO_000040" "g.129247626C>T" "4/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000684562" "1" "70" "3" "129249760" "129249760" "subst" "0" "00004" "RHO_000001" "g.129249760C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000684563" "1" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00004" "RHO_000052" "g.129249848C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic" "" "0000684564" "1" "70" "3" "129251098" "129251098" "subst" "0" "00004" "RHO_000093" "g.129251098A>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic" "" "0000684565" "1" "70" "3" "129251114" "129251114" "subst" "0" "00004" "RHO_000095" "g.129251114A>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic" "" "0000684566" "1" "70" "3" "129251131" "129251131" "subst" "0" "00004" "RHO_000097" "g.129251131G>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.129532288G>C" "" "likely pathogenic" "" "0000684567" "1" "70" "3" "129252517" "129252517" "del" "0" "00004" "RHO_000099" "g.129252517del" "4/899 cases" "{PMID:Holtan 2020:31429209}" "" "c.1003delG" "" "Germline" "" "" "0" "" "" "g.129533674del" "" "likely pathogenic" "" "0000684658" "1" "70" "3" "129247626" "129247626" "subst" "0" "00004" "RHO_000040" "g.129247626C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000684659" "1" "70" "3" "129247626" "129247626" "subst" "0" "00004" "RHO_000040" "g.129247626C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000685414" "0" "90" "3" "129247629" "129247629" "subst" "7.71624E-5" "00004" "RHO_000088" "g.129247629G>A" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685415" "0" "70" "3" "129247734" "129247734" "subst" "0" "00004" "RHO_000089" "g.129247734C>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685416" "0" "70" "3" "129247842" "129247842" "subst" "0" "00004" "RHO_000090" "g.129247842G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685417" "0" "90" "3" "129249760" "129249760" "subst" "0" "00004" "RHO_000001" "g.129249760C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685418" "0" "70" "3" "129249854" "129249854" "subst" "0" "00004" "RHO_000091" "g.129249854C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685419" "1" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00004" "RHO_000092" "g.129249868C>T" "1/2420 IRD families" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685420" "0" "70" "3" "129251104" "129251104" "subst" "0" "00004" "RHO_000030" "g.129251104G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685421" "0" "90" "3" "129251111" "129251201" "dup" "0" "00004" "RHO_000094" "g.129251111_129251201dup" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685422" "1" "70" "3" "129251123" "129251123" "subst" "0" "00004" "RHO_000096" "g.129251123G>A" "1/2420 IRD families" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685423" "0" "70" "3" "129251479" "129251479" "subst" "0" "00004" "RHO_000098" "g.129251479C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685424" "0" "70" "3" "129252554" "129252554" "subst" "0" "00004" "RHO_000100" "g.129252554C>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000688930" "0" "50" "3" "129251141" "129251141" "subst" "3.65539E-5" "01943" "RHO_000058" "g.129251141C>T" "" "" "" "RHO(NM_000539.3):c.578C>T (p.T193M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688931" "0" "70" "3" "129251447" "129251449" "del" "0" "02330" "RHO_000101" "g.129251447_129251449del" "" "" "" "RHO(NM_000539.3):c.768_770delCAT (p.I256del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000688932" "0" "50" "3" "129251592" "129251592" "subst" "2.03054E-5" "01943" "RHO_000102" "g.129251592A>C" "" "" "" "RHO(NM_000539.3):c.913A>C (p.I305L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688933" "0" "70" "3" "129252559" "129252559" "subst" "0" "02330" "RHO_000103" "g.129252559T>C" "" "" "" "RHO(NM_000539.3):c.1045T>C (p.*349Qext*51)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000703770" "1" "50" "3" "129252544" "129252544" "subst" "0" "00008" "RHO_000062" "g.129252544C>T" "" "{PMID:Scholl 2001:11372548}" "" "Q344ter" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000703789" "1" "50" "3" "129252554" "129252554" "subst" "0" "00008" "RHO_000004" "g.129252554C>T" "" "{PMID:Milla 2002:12221539}" "" "Pro347Leu (CCG-CTG)" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000710253" "1" "90" "3" "129251120" "129251120" "subst" "0" "00006" "RHO_000105" "g.129251120C>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.129532277C>G" "" "pathogenic" "" "0000710297" "1" "90" "3" "129249848" "129249848" "subst" "0" "00006" "RHO_000104" "g.129249848C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.129531005C>A" "" "pathogenic" "" "0000711685" "1" "70" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Ziviello 2005:15994872}" "" "R135W" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000711686" "1" "70" "3" "129252554" "129252554" "subst" "0" "00008" "RHO_000004" "g.129252554C>T" "" "{PMID:Ziviello 2005:15994872}" "" "P347L" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000711687" "1" "70" "3" "129249856" "129249856" "subst" "0" "00008" "RHO_000112" "g.129249856T>C" "" "{PMID:Ziviello 2005:15994872}" "" "C167R" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000711698" "1" "70" "3" "129252473" "129252473" "subst" "0.000105667" "00008" "RHO_000075" "g.129252473C>A" "" "{PMID:Mandal 2005:16123440}" "" "C959A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000711708" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711709" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711710" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711711" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711712" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711713" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711714" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711715" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711716" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711717" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711718" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711719" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711720" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711721" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711722" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711723" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711724" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711725" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711726" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711727" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711728" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711729" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711730" "1" "90" "3" "129247713" "129247713" "subst" "0" "00008" "RHO_000107" "g.129247713T>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711731" "1" "90" "3" "0" "0" "" "0" "00008" "RHO_000000" "g.?" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:170C>G, CCC?CGC Leu57Arg" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711732" "1" "90" "3" "129247892" "129247892" "subst" "0" "00008" "RHO_000108" "g.129247892G>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711733" "1" "90" "3" "0" "0" "" "0" "00008" "RHO_000000" "g.?" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:318A>G, GGA?GGG Gly106Arg" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711734" "1" "90" "3" "0" "0" "" "0" "00008" "RHO_000000" "g.?" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:318A>G, GGA?GGG Gly106Arg" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711735" "1" "90" "3" "129247905" "129247905" "subst" "0" "00008" "RHO_000109" "g.129247905G>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711736" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711737" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711738" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711739" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711740" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711741" "1" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00008" "RHO_000052" "g.129249848C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711742" "1" "90" "3" "129249866" "129249866" "subst" "0" "00008" "RHO_000113" "g.129249866C>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711743" "1" "90" "3" "129249868" "129249868" "subst" "4.06517E-6" "00008" "RHO_000092" "g.129249868C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711744" "1" "90" "3" "129249869" "129249869" "subst" "0" "00008" "RHO_000029" "g.129249869C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711745" "1" "90" "3" "129251104" "129251104" "subst" "0" "00008" "RHO_000030" "g.129251104G>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711746" "1" "90" "3" "129251104" "129251104" "subst" "0" "00008" "RHO_000030" "g.129251104G>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711747" "1" "90" "3" "129251116" "129251116" "subst" "0" "00008" "RHO_000115" "g.129251116T>C" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711748" "1" "90" "3" "129251116" "129251116" "subst" "0" "00008" "RHO_000115" "g.129251116T>C" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711749" "1" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00008" "RHO_000056" "g.129251131G>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711750" "1" "90" "3" "129251183" "129251183" "subst" "0" "00008" "RHO_000032" "g.129251183T>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711751" "1" "90" "3" "0" "0" "" "0" "00008" "RHO_000000" "g.?" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:629C>T, CCT?CTT Pro210Leu" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711752" "1" "90" "3" "129251195" "129251195" "subst" "0" "00008" "RHO_000117" "g.129251195A>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711753" "1" "90" "3" "129251489" "129251489" "subst" "0" "00008" "RHO_000118" "g.129251489C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711754" "1" "90" "3" "129251567" "129251567" "subst" "0" "00008" "RHO_000119" "g.129251567G>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711755" "1" "90" "3" "129252509" "129252525" "del" "0" "00008" "RHO_000121" "g.129252509_129252525del" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:995-1011del Frameshift after Glu332" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711756" "1" "90" "3" "129252553" "129252553" "subst" "0" "00008" "RHO_000122" "g.129252553C>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711757" "1" "90" "3" "129252554" "129252554" "subst" "0" "00008" "RHO_000004" "g.129252554C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711758" "1" "90" "3" "129252554" "129252554" "subst" "0" "00008" "RHO_000004" "g.129252554C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711759" "1" "90" "3" "129252553" "129252553" "subst" "0" "00008" "RHO_000123" "g.129252553C>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711760" "1" "90" "3" "129251101" "129251101" "subst" "0" "00008" "RHO_000114" "g.129251101C>G" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000711761" "1" "90" "3" "129252467" "129252469" "del" "0" "00008" "RHO_000120" "g.129252467_129252469del" "" "{PMID:Sohocki 2001:11139241}" "" "U49742:953-955del Leu318del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000711762" "1" "90" "3" "129249761" "129249762" "delins" "0" "00008" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711763" "1" "90" "3" "129249761" "129249762" "delins" "0" "00008" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711764" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711765" "1" "90" "3" "129247626" "129247626" "subst" "0" "00008" "RHO_000040" "g.129247626C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000711804" "1" "30" "3" "129247936" "129247936" "subst" "0.00347512" "00008" "RHO_000013" "g.129247936C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000711805" "1" "30" "3" "129249837" "129249837" "subst" "0" "00008" "RHO_000111" "g.129249837C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000711806" "1" "30" "3" "129249876" "129249876" "subst" "0.000667236" "00008" "RHO_000016" "g.129249876C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000711807" "1" "30" "3" "129251121" "129251121" "subst" "0.000511762" "00008" "RHO_000116" "g.129251121G>A" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000711808" "1" "30" "3" "129251570" "129251570" "subst" "0.000929904" "00008" "RHO_000022" "g.129251570C>T" "" "{PMID:Sohocki 2001:11139241}" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000713375" "0" "90" "3" "129247659" "129247659" "subst" "0" "00000" "RHO_000124" "g.129247659A>G" "" "{PMID:Carss 2017:28041643}" "" "3:129247659A>G ENST00000296271.3:c.83A>G (Gln28Arg)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713390" "0" "90" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000113" "g.129249866C>G" "" "{PMID:Carss 2017:28041643}" "" "3:129249866C>G ENST00000296271.3:c.509C>G (Pro170Arg)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713426" "0" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Carss 2017:28041643}" "" "3:129251131G>T ENST00000296271.3:c.568G>T (Asp190Tyr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713428" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Carss 2017:28041643}" "" "3:129251104G>A ENST00000296271.3:c.541G>A (Glu181Lys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713504" "0" "90" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Carss 2017:28041643}" "" "3:129247734C>G ENST00000296271.3:c.158C>G (Pro53Arg)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713512" "0" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Carss 2017:28041643}" "" "3:129251131G>T ENST00000296271.3:c.568G>T (Asp190Tyr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713637" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Carss 2017:28041643}" "" "3:129252554C>T ENST00000296271.3:c.1040C>T (Pro347Leu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000713963" "1" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Zhou 2018:29453956}" "" "" "" "Germline" "" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000713997" "1" "50" "3" "129251574" "129251574" "subst" "2.03039E-5" "00000" "RHO_000127" "g.129251574G>A" "" "{PMID:Zhou 2018:29453956}" "" "" "" "Germline" "" "" "0" "" "" "g.129532731G>A" "" "VUS" "" "0000714051" "0" "70" "3" "129247904" "129247904" "subst" "0" "00000" "RHO_000125" "g.129247904T>C" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.129529061T>C" "" "likely pathogenic" "" "0000719179" "0" "50" "3" "129251490" "129251490" "subst" "2.84255E-5" "02329" "RHO_000074" "g.129251490G>A" "" "" "" "RHO(NM_000539.3):c.811G>A (p.V271M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000719180" "0" "50" "3" "129252445" "129252445" "subst" "0" "02327" "RHO_000086" "g.129252445T>A" "" "" "" "RHO(NM_000539.3):c.937-6T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000719181" "0" "30" "3" "129252483" "129252483" "subst" "0.000666369" "01943" "RHO_000079" "g.129252483C>T" "" "" "" "RHO(NM_000539.3):c.969C>T (p.C323=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729745" "0" "90" "3" "129252519" "129252519" "del" "0" "00000" "RHO_000128" "g.129252519del" "" "{PMID:Maeda 2018:29785639}" "" "c.1005delT" "" "Germline" "" "" "0" "" "" "g.129533676del" "" "pathogenic" "" "0000729746" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "De novo" "" "rs104893775" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000731486" "1" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000731540" "1" "90" "3" "129247878" "129247878" "subst" "0" "00000" "RHO_000131" "g.129247878G>T" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.129529035G>T" "" "pathogenic" "" "0000731543" "1" "90" "3" "129247629" "129247629" "subst" "7.71624E-5" "00000" "RHO_000088" "g.129247629G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.129528786G>A" "" "pathogenic" "" "0000731546" "1" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "" "0000731552" "1" "90" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.129528884G>C" "" "pathogenic" "" "0000731568" "2" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.129528906C>G" "" "pathogenic" "" "0000732440" "1" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000732543" "1" "90" "3" "129251137" "129251137" "dup" "0" "00000" "RHO_000141" "g.129251137dup" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129532294dup" "" "pathogenic (dominant)" "" "0000732563" "0" "50" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "VUS" "" "0000732564" "0" "50" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "VUS" "" "0000732565" "0" "90" "3" "129251124" "129251124" "subst" "0" "00000" "RHO_000139" "g.129251124T>G" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129532281T>G" "" "pathogenic" "" "0000732566" "0" "50" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Wang 2017:28838317}" "" "IVS4+1G>T" "" "Germline" "" "" "0" "" "" "g.129532773G>T" "" "VUS" "" "0000732610" "0" "90" "3" "129251137" "129251137" "dup" "0" "00000" "RHO_000141" "g.129251137dup" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129532294dup" "" "pathogenic" "" "0000732622" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "pathogenic" "" "0000732624" "0" "90" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Wang 2017:28838317}" "" "IVS4+1G>T" "" "Germline" "" "" "0" "" "" "g.129532773G>T" "" "pathogenic" "" "0000732745" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732746" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732747" "0" "70" "3" "129251613" "129251613" "subst" "0" "00000" "RHO_000143" "g.129251613C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129532770C>T" "" "likely pathogenic" "" "0000732748" "0" "70" "3" "129251613" "129251613" "subst" "0" "00000" "RHO_000143" "g.129251613C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129532770C>T" "" "likely pathogenic" "" "0000732749" "0" "70" "3" "129252550" "129252550" "subst" "0" "00000" "RHO_000145" "g.129252550G>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129533707G>C" "" "likely pathogenic" "" "0000732750" "0" "70" "3" "129247752" "129247752" "subst" "0" "00000" "RHO_000133" "g.129247752T>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528909T>A" "" "likely pathogenic" "" "0000732751" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000138" "g.129249869C>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129531026C>G" "" "likely pathogenic" "" "0000732803" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732804" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732805" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732806" "0" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic" "" "0000732807" "0" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic" "" "0000732808" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic" "" "0000732809" "0" "70" "3" "129247836" "129247836" "subst" "0" "00000" "RHO_000134" "g.129247836T>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528993T>A" "" "likely pathogenic" "" "0000732828" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732829" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732830" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732831" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732832" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000732833" "0" "70" "3" "129249854" "129249854" "subst" "0" "00000" "RHO_000137" "g.129249854C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129531011C>A" "" "likely pathogenic" "" "0000732834" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000732835" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000732836" "0" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Stone 2017:28559085}" "" "404-45GG>TT Arg135Leu" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000732837" "0" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000135" "g.129247917G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129529074G>A" "" "likely pathogenic" "" "0000732838" "0" "70" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129532283G>A" "" "likely pathogenic" "" "0000732839" "0" "70" "3" "129247584" "129247584" "subst" "4.06329E-6" "00000" "RHO_000132" "g.129247584G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528741G>A" "" "likely pathogenic" "" "0000732840" "0" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic" "" "0000732841" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000733088" "0" "70" "3" "129249854" "129249854" "subst" "0" "00000" "RHO_000137" "g.129249854C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129531011C>A" "" "likely pathogenic" "" "0000733089" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000733153" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000733213" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000733214" "0" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Stone 2017:28559085}" "" "789_791delCTG" "" "De novo" "" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic" "" "0000733215" "0" "70" "3" "129249731" "129249731" "subst" "0" "00000" "RHO_000136" "g.129249731T>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "De novo" "" "" "0" "" "" "g.129530888T>G" "" "likely pathogenic" "" "0000734353" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Unknown" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000735653" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0000735823" "0" "70" "3" "129251551" "129251551" "subst" "0" "00000" "RHO_000153" "g.129251551C>G" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "" "" "0" "" "" "g.129532708C>G" "" "likely pathogenic" "" "0000735924" "0" "70" "3" "129252449" "129252458" "del" "0" "02485" "RHO_000307" "g.129252449_129252458del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "c.(937-2_944)del" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "likely pathogenic" "" "0000735925" "0" "70" "3" "129249760" "129249760" "subst" "0" "02485" "RHO_000001" "g.129249760C>T" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "De novo" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000735926" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "02485" "RHO_000048" "g.129247892G>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000736059" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "" "0000736060" "0" "90" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.129531041C>T" "" "pathogenic" "" "0000736077" "0" "70" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.129531041C>T" "" "likely pathogenic" "" "0000736113" "1" "70" "3" "129251163" "129251163" "subst" "0" "00000" "RHO_000151" "g.129251163C>G" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.129532320C>G" "" "likely pathogenic" "" "0000736154" "2" "70" "3" "129251171" "129251171" "subst" "0" "00000" "RHO_000152" "g.129251171T>C" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.129532328T>C" "" "likely pathogenic" "" "0000736211" "1" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.129532288G>T" "" "pathogenic" "" "0000736307" "1" "90" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "" "" "0" "" "" "g.129528777A>G" "" "pathogenic (dominant)" "ACMG" "0000736308" "1" "70" "3" "129247841" "129247841" "subst" "0" "00000" "RHO_000147" "g.129247841G>C" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "" "" "0" "" "" "g.129528998G>C" "" "likely pathogenic (dominant)" "ACMG" "0000736309" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic (dominant)" "ACMG" "0000736310" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic (dominant)" "ACMG" "0000736311" "1" "90" "3" "129251095" "129251095" "subst" "0" "00000" "RHO_000150" "g.129251095T>G" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532252T>G" "" "pathogenic (dominant)" "ACMG" "0000736312" "1" "90" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "" "" "0" "" "" "g.129532283G>A" "" "pathogenic (dominant)" "ACMG" "0000736313" "1" "90" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "763_765del" "" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "pathogenic (dominant)" "ACMG" "0000736314" "1" "50" "3" "129251590" "129251590" "subst" "0" "00000" "RHO_000154" "g.129251590T>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532747T>A" "" "VUS" "ACMG" "0000736315" "1" "90" "3" "129252542" "129252542" "subst" "0" "00000" "RHO_000035" "g.129252542G>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533699G>A" "" "pathogenic (dominant)" "ACMG" "0000736316" "1" "90" "3" "129252542" "129252542" "subst" "0" "00000" "RHO_000035" "g.129252542G>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533699G>A" "" "pathogenic (dominant)" "ACMG" "0000736317" "1" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "" "" "0" "" "" "g.129533704G>A" "" "pathogenic (dominant)" "ACMG" "0000736318" "1" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Van Cauwenbergh 2017:28076437}" "" "" "" "Germline" "" "" "0" "" "" "g.129533704G>A" "" "pathogenic (dominant)" "ACMG" "0000736446" "1" "90" "3" "129247626" "129247626" "subst" "0" "00008" "RHO_000040" "g.129247626C>T" "" "{PMID:Sullivan 2006:16799052}" "" "50C>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736447" "1" "90" "3" "129247644" "129247644" "subst" "0" "00008" "RHO_000106" "g.129247644C>A" "" "{PMID:Sullivan 2006:16799052}" "" "68C>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736448" "1" "90" "3" "129247746" "129247746" "subst" "0" "00008" "RHO_000000" "g.129247746C>T" "" "{PMID:Sullivan 2006:16799052}" "" "170C>T" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736449" "1" "90" "3" "129247749" "129247749" "subst" "0" "00008" "RHO_000130" "g.129247749C>G" "" "{PMID:Sullivan 2006:16799052}" "" "173C>G" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736450" "1" "90" "3" "129247894" "129247894" "subst" "0" "00008" "RHO_000148" "g.129247894G>A" "" "{PMID:Sullivan 2006:16799052}" "" "318G>A(Gly106Arg)" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736451" "1" "90" "3" "129247892" "129247892" "subst" "0" "00008" "RHO_000108" "g.129247892G>T" "" "{PMID:Sullivan 2006:16799052}" "" "316G>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736452" "1" "90" "3" "129247905" "129247905" "subst" "0" "00008" "RHO_000109" "g.129247905G>T" "" "{PMID:Sullivan 2006:16799052}" "" "329G>T" "Disulfide bond" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736453" "1" "90" "3" "129249760" "129249760" "subst" "0" "00008" "RHO_000001" "g.129249760C>T" "" "{PMID:Sullivan 2006:16799052}" "" "403C>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736454" "1" "90" "3" "129249761" "129249762" "delins" "0" "00008" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sullivan 2006:16799052}" "" "404 G>T 405 G>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736455" "1" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00008" "RHO_000052" "g.129249848C>T" "" "{PMID:Sullivan 2006:16799052}" "" "491C>T" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736456" "1" "90" "3" "129249866" "129249866" "subst" "0" "00008" "RHO_000113" "g.129249866C>G" "" "{PMID:Sullivan 2006:16799052}" "" "509C>G" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736457" "1" "90" "3" "129249868" "129249868" "subst" "4.06517E-6" "00008" "RHO_000092" "g.129249868C>T" "" "{PMID:Sullivan 2006:16799052}" "" "511C>T" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736458" "1" "90" "3" "129249869" "129249869" "subst" "0" "00008" "RHO_000029" "g.129249869C>A" "" "{PMID:Sullivan 2006:16799052}" "" "512C>A" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736459" "1" "90" "3" "129251104" "129251104" "subst" "0" "00008" "RHO_000030" "g.129251104G>A" "" "{PMID:Sullivan 2006:16799052}" "" "541G>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736460" "1" "90" "3" "129251123" "129251123" "subst" "0" "00008" "RHO_000096" "g.129251123G>A" "" "{PMID:Sullivan 2006:16799052}" "" "560G>A" "Disulfide bond" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736461" "1" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00008" "RHO_000056" "g.129251131G>A" "" "{PMID:Sullivan 2006:16799052}" "" "568G>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736462" "1" "90" "3" "129251195" "129251195" "subst" "0" "00008" "RHO_000117" "g.129251195A>G" "" "{PMID:Sullivan 2006:16799052}" "" "632A>G" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736463" "1" "90" "3" "129251479" "129251479" "subst" "0" "00008" "RHO_000098" "g.129251479C>T" "" "{PMID:Sullivan 2006:16799052}" "" "800C>T" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736464" "1" "90" "3" "129252450" "129252450" "subst" "0" "00008" "RHO_000155" "g.129252450G>A" "" "{PMID:Sullivan 2006:16799052}" "" "IVS4-1G>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736465" "1" "90" "3" "129252547" "129252547" "subst" "0" "00008" "RHO_000156" "g.129252547G>A" "" "{PMID:Sullivan 2006:16799052}" "" "1033G>A" "BNG binding site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736466" "1" "90" "3" "129252553" "129252553" "subst" "0" "00008" "RHO_000122" "g.129252553C>G" "" "{PMID:Sullivan 2006:16799052}" "" "1039C>G" "BNG binding site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736467" "1" "90" "3" "129252553" "129252553" "subst" "0" "00008" "RHO_000123" "g.129252553C>A" "" "{PMID:Sullivan 2006:16799052}" "" "1039C>A" "BNG binding site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736468" "1" "90" "3" "129252554" "129252554" "subst" "0" "00008" "RHO_000004" "g.129252554C>T" "" "{PMID:Sullivan 2006:16799052}" "" "1040C>T" "BNG binding site" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000736469" "1" "70" "3" "129247713" "129247713" "subst" "0" "00008" "RHO_000107" "g.129247713T>G" "" "{PMID:Sullivan 2006:16799052}" "" "137T>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000736470" "1" "70" "3" "129251489" "129251489" "subst" "0" "00008" "RHO_000118" "g.129251489C>A" "" "{PMID:Sullivan 2006:16799052}" "" "810C>A" "Transmembrane site" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000736471" "1" "70" "3" "129252559" "129252559" "subst" "0" "00008" "RHO_000103" "g.129252559T>C" "" "{PMID:Sullivan 2006:16799052}" "" "1045T>C" "58 Amino acids added" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000736472" "1" "10" "3" "129247785" "129247785" "subst" "9.33942E-5" "00008" "RHO_000146" "g.129247785C>T" "" "{PMID:Sullivan 2006:16799052}" "" "209C>T" "" "Germline" "no" "" "0" "" "" "" "" "benign" "" "0000736503" "1" "90" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Germline" "" "" "0" "" "" "g.129533607G>T" "" "pathogenic (dominant)" "" "0000736504" "1" "50" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000103" "g.129252559T>C" "" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Germline" "" "" "0" "" "" "g.129533716T>C" "" "VUS" "" "0000736505" "1" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Germline" "" "" "0" "" "" "g.129532288G>A" "" "pathogenic (dominant)" "" "0000736506" "1" "90" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Ezquerra-Inchausti 2017:28045043}" "" "" "" "Germline" "" "" "0" "" "" "g.129533607G>T" "" "pathogenic (dominant)" "" "0000736803" "1" "70" "3" "129247730" "129247730" "subst" "0" "00000" "RHO_000157" "g.129247730T>G" "" "{PMID:Roberts 2016:27898983}" "" "" "" "Germline" "" "" "0" "" "" "g.129528887T>G" "" "likely pathogenic (dominant)" "ACMG" "0000759595" "1" "90" "3" "129249796" "129249796" "subst" "0.000182726" "00000" "RHO_000159" "g.129249796C>T" "" "{PMID:Carrigan 2016:27624628}" "" "" "" "Germline" "" "" "0" "" "" "g.129530953C>T" "" "pathogenic" "" "0000759596" "1" "90" "3" "129251433" "129251433" "dup" "0" "00000" "RHO_000160" "g.129251433dup" "" "{PMID:Carrigan 2016:27624628}" "" "754dupC" "" "Germline" "" "" "0" "" "" "g.129532590dup" "" "pathogenic" "" "0000759597" "1" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Carrigan 2016:27624628}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0000759666" "3" "90" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Zhang 2016:27596865}" "" "c.C408A" "" "Germline" "" "" "0" "" "" "g.129530922C>A" "" "pathogenic (recessive)" "ACMG" "0000759888" "1" "90" "3" "129247746" "129247746" "subst" "0" "00000" "RHO_000162" "g.129247746T>G" "" "{PMID:Tiwari 2016:27391102}" "" "" "" "Germline" "" "" "0" "" "" "g.129528903T>G" "" "pathogenic (dominant)" "" "0000759981" "0" "50" "3" "129251222" "129251222" "subst" "2.03257E-5" "00000" "RHO_000163" "g.129251222T>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.129532379T>G" "" "VUS" "" "0000760128" "0" "90" "3" "129249760" "129249760" "subst" "0" "00006" "RHO_000001" "g.129249760C>T" "" "{PMID:Abdulridha-Aboud 2016:27212874}" "" "R135W" "one patient (FamBPatIV1) carries this variant but not the GUCY2D variant" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000760259" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic" "" "0000760271" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000760284" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000760300" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000760322" "0" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000113" "g.129249866C>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129531023C>G" "" "likely pathogenic" "" "0000760342" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.129532636C>T" "" "likely pathogenic" "" "0000764169" "1" "70" "3" "129251222" "129251222" "subst" "2.03257E-5" "02404" "RHO_000163" "g.129251222T>G" "" "{PMID:Bahena 2021:34148116}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532379T>G" "" "likely pathogenic" "ACMG" "0000764880" "1" "70" "3" "129251553" "129251553" "subst" "0" "00000" "RHO_000164" "g.129251553G>A" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.129532710G>A" "" "likely pathogenic (dominant)" "" "0000764881" "1" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000765485" "1" "70" "3" "129251234" "129251234" "subst" "1.21979E-5" "00000" "RHO_000168" "g.129251234G>A" "1/596 chromosomes" "{PMID:Sun 2015:26747767}" "" "" "not in 624 control chromosomes" "Germline" "" "" "0" "" "" "g.129532391G>A" "" "likely pathogenic" "" "0000765508" "1" "90" "3" "129252545" "129252545" "subst" "0" "00000" "RHO_000170" "g.129252545A>C" "1/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129533702A>C" "" "pathogenic (dominant)" "" "0000765509" "1" "90" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "3/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129528884G>C" "" "pathogenic (dominant)" "" "0000765510" "1" "90" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "3/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129528884G>C" "" "pathogenic (dominant)" "" "0000765511" "1" "90" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "3/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129528884G>C" "" "pathogenic (dominant)" "" "0000765512" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000166" "g.129249760C>G" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129530917C>G" "" "pathogenic (dominant)" "" "0000765513" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000166" "g.129249760C>G" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129530917C>G" "" "pathogenic (dominant)" "" "0000765514" "1" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000765515" "1" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000765516" "1" "90" "3" "129251116" "129251116" "subst" "0" "00000" "RHO_000115" "g.129251116T>C" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129532273T>C" "" "pathogenic (dominant)" "" "0000765517" "1" "90" "3" "129251116" "129251116" "subst" "0" "00000" "RHO_000115" "g.129251116T>C" "2/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129532273T>C" "" "pathogenic (dominant)" "" "0000765524" "1" "70" "3" "129251488" "129251488" "subst" "0" "00000" "RHO_000169" "g.129251488G>T" "1/60 cases" "{PMID:Coussa 2015:26720483}" "" "" "not in 192 controls" "Germline" "" "" "0" "" "" "g.129532645G>T" "" "likely pathogenic (dominant)" "" "0000765543" "1" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "" "0000765570" "0" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.129531005C>T" "" "pathogenic" "" "0000765571" "0" "90" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.129531026C>T" "" "pathogenic" "" "0000765636" "0" "70" "3" "129247612" "129247612" "del" "0" "00000" "RHO_000165" "g.129247612del" "" "{PMID:Yang 2015:26496393}" "" "34delC" "not in 100 controls" "Germline" "" "" "0" "" "" "g.129528769del" "" "likely pathogenic (dominant)" "" "0000765637" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Yang 2015:26496393}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000765638" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000167" "g.129251195A>T" "" "{PMID:Yang 2015:26496393}" "" "" "not in 100 controls" "Germline" "" "" "0" "" "" "g.129532352A>T" "" "likely pathogenic (dominant)" "" "0000783281" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Yoon 2015:26155838}" "" "" "" "Germline" "" "rs29001566" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000783284" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Yoon 2015:26155838}" "" "" "" "Germline" "" "rs104893776" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000783899" "0" "50" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.129529043G>A" "" "VUS" "" "0000784161" "0" "50" "3" "129247782" "129247782" "subst" "1.62435E-5" "00000" "RHO_000172" "g.129247782G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs118173887" "0" "" "" "g.129528939G>A" "" "VUS" "" "0000784168" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129530917C>T" "" "pathogenic (dominant)" "" "0000784169" "0" "90" "3" "129249838" "129249838" "subst" "0" "00000" "RHO_000173" "g.129249838T>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129530995T>C" "" "pathogenic (dominant)" "" "0000784170" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000784171" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000784172" "0" "90" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129532352A>G" "" "pathogenic (dominant)" "" "0000784173" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000174" "g.129252547G>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129533704G>T" "" "pathogenic (dominant)" "" "0000784174" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000784175" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000784176" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000784555" "0" "50" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs144317206" "0" "" "" "g.129529043G>A" "" "VUS" "" "0000785365" "3" "90" "3" "129249805" "129249805" "subst" "5.27876E-5" "00006" "RHO_000081" "g.129249805G>A" "" "{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000785397" "3" "90" "3" "129251438" "129251438" "subst" "2.84269E-5" "00000" "RHO_000021" "g.129251438G>T" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.129532595G>T" "" "pathogenic (recessive)" "" "0000785525" "0" "90" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Fernandez-San Jose 2015:25698705}" "" "" "" "Germline" "" "rs104893786" "0" "" "" "g.129528777A>G" "" "pathogenic (dominant)" "" "0000785579" "0" "50" "3" "129247612" "129247612" "del" "0" "00000" "RHO_000165" "g.129247612del" "" "{PMID:Liu 2015:25611614}" "" "c.34del" "variant found in controls" "Germline" "no" "" "0" "" "" "g.129528769del" "" "VUS" "" "0000785587" "21" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000785588" "11" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000785589" "11" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000785590" "11" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000785591" "11" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000785592" "21" "90" "3" "129252449" "129252458" "del" "0" "00000" "RHO_000307" "g.129252449_129252458del" "" "{PMID:González-del Pozo 2014:25544989}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533606_129533615del" "" "pathogenic (dominant)" "" "0000786309" "3" "90" "3" "129252539" "129252539" "subst" "2.43722E-5" "00000" "RHO_000190" "g.129252539C>T" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Germline" "" "" "0" "" "" "g.129533696C>T" "" "pathogenic" "" "0000786312" "1" "90" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Germline" "" "" "0" "" "" "g.129532264G>A" "" "pathogenic" "" "0000786439" "1" "90" "3" "129252535" "129252535" "subst" "8.12334E-6" "00000" "RHO_000189" "g.129252535G>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533692G>A" "" "pathogenic (dominant)" "" "0000786442" "3" "90" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "pathogenic (recessive)" "" "0000786447" "1" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "" "" "0" "" "" "g.129533704G>A" "" "pathogenic (dominant)" "" "0000786506" "1" "70" "3" "129251108" "129251108" "subst" "0" "00000" "RHO_000185" "g.129251108G>T" "" "{PMID:Pierrottet 2014:25366773}" "" "" "" "Germline" "" "" "0" "" "" "g.129532265G>T" "" "likely pathogenic" "" "0000786511" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Pierrottet 2014:25366773}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000786523" "0" "90" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "pathogenic (dominant)" "" "0000786524" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129528783C>T" "" "pathogenic (dominant)" "" "0000786525" "0" "70" "3" "129247660" "129247660" "subst" "0" "00000" "RHO_000175" "g.129247660G>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129528817G>C" "" "likely pathogenic (dominant)" "" "0000786526" "0" "90" "3" "129247707" "129247707" "subst" "4.06055E-6" "00000" "RHO_000176" "g.129247707T>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129528864T>C" "" "pathogenic (dominant)" "" "0000786527" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000786528" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000786529" "0" "70" "3" "129247812" "129247812" "subst" "0" "00000" "RHO_000177" "g.129247812T>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129528969T>C" "" "likely pathogenic (dominant)" "" "0000786530" "0" "70" "3" "129247866" "129247866" "subst" "0" "00000" "RHO_000178" "g.129247866C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129529023C>T" "" "likely pathogenic (dominant)" "" "0000786531" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "pathogenic (dominant)" "" "0000786532" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "pathogenic (dominant)" "" "0000786533" "0" "70" "3" "129249735" "129249735" "subst" "0" "00000" "RHO_000179" "g.129249735G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129530892G>A" "" "likely pathogenic (dominant)" "" "0000786534" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic (dominant)" "" "0000786535" "0" "90" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "pathogenic (dominant)" "" "0000786536" "0" "90" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129530918G>T" "" "pathogenic (dominant)" "" "0000786537" "0" "70" "3" "129249845" "129249845" "subst" "0" "00000" "RHO_000181" "g.129249845T>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129531002T>C" "" "likely pathogenic (dominant)" "" "0000786538" "0" "90" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129531005C>A" "" "pathogenic (dominant)" "" "0000786539" "0" "90" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129531005C>A" "" "pathogenic (dominant)" "" "0000786540" "0" "70" "3" "129249857" "129249857" "subst" "0" "00000" "RHO_000182" "g.129249857G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129531014G>A" "" "likely pathogenic (dominant)" "" "0000786541" "0" "70" "3" "129249857" "129249857" "subst" "0" "00000" "RHO_000182" "g.129249857G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129531014G>A" "" "likely pathogenic (dominant)" "" "0000786542" "0" "90" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000113" "g.129249866C>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129531023C>G" "" "pathogenic (dominant)" "" "0000786543" "0" "90" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "pathogenic (dominant)" "" "0000786544" "0" "90" "3" "129251092" "129251092" "subst" "0" "00000" "RHO_000183" "g.129251092A>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532249A>G" "" "pathogenic (dominant)" "" "0000786545" "0" "90" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "pathogenic (dominant)" "" "0000786546" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "pathogenic (dominant)" "" "0000786547" "0" "90" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532264G>A" "" "pathogenic (dominant)" "" "0000786548" "0" "90" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532264G>A" "" "pathogenic (dominant)" "" "0000786549" "0" "70" "3" "129251108" "129251108" "subst" "0" "00000" "RHO_000185" "g.129251108G>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532265G>T" "" "likely pathogenic (dominant)" "" "0000786550" "0" "90" "3" "129251119" "129251119" "subst" "0" "00000" "RHO_000186" "g.129251119T>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129532276T>C" "" "pathogenic (dominant)" "" "0000786551" "0" "90" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "pathogenic (dominant)" "" "0000786552" "0" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532288G>T" "" "pathogenic (dominant)" "" "0000786553" "0" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532288G>T" "" "pathogenic (dominant)" "" "0000786554" "0" "90" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "pathogenic (dominant)" "" "0000786555" "0" "90" "3" "129251544" "129251544" "subst" "0" "00000" "RHO_000188" "g.129251544A>C" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532701A>C" "" "pathogenic (dominant)" "" "0000786556" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786557" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786558" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786559" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786560" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786561" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786562" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786563" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000786564" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fernandez 2014:25408095}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000787637" "1" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic" "" "0000787653" "1" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000787655" "1" "70" "3" "129251191" "129251191" "subst" "1.21908E-5" "00000" "RHO_000191" "g.129251191G>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129532348G>T" "" "likely pathogenic" "" "0000787662" "1" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000788088" "1" "90" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129528777A>G" "" "pathogenic" "" "0000788089" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000788090" "1" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000788091" "1" "90" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129532282G>A" "" "pathogenic" "" "0000788109" "1" "90" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129528913C>A" "" "pathogenic" "" "0000788110" "1" "90" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.129528913C>A" "" "pathogenic" "" "0000788111" "1" "90" "3" "129252493" "129252496" "del" "0" "00000" "RHO_000194" "g.129252493_129252496del" "" "{PMID:Oishi 2014:25324289}" "" "977_980del" "" "Germline" "" "" "0" "" "" "g.129533650_129533653del" "" "pathogenic" "" "0000788361" "0" "50" "3" "129252449" "129252449" "subst" "0" "00000" "RHO_000193" "g.129252449A>G" "" "{PMID:Katagiri 2014:25268133}" "" "" "" "Germline" "" "" "0" "" "" "g.129533606A>G" "" "VUS" "" "0000788543" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Pan 2014:24940031}" "" "" "" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000789681" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789691" "0" "90" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789692" "0" "90" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789698" "0" "55" "3" "129252493" "129252496" "del" "0" "00000" "RHO_000194" "g.129252493_129252496del" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000789700" "0" "90" "3" "129249877" "129249877" "subst" "1.2212E-5" "00000" "RHO_000053" "g.129249877G>A" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789848" "0" "70" "3" "129251567" "129251567" "subst" "0" "00000" "RHO_000195" "g.129251567G>C" "" "{PMID:Avela 2019:31087526}" "" "c.888G>C" "Check also: Sohocki 2001" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790103" "3" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790105" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790107" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790109" "3" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790111" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790113" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790115" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790117" "3" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Lim-2009:19506198}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790129" "0" "10" "3" "129247275" "129247277" "del" "0" "00000" "RHO_000000" "g.129247275_129247277delTTT" "" "{PMID:Lim-2009:19506198}" "" "c.-300_-302delTTT" "" "Unknown" "" "" "0" "" "" "" "" "benign" "" "0000790130" "0" "10" "3" "129247376" "129247376" "subst" "0" "00000" "RHO_000000" "g.129247376C>T" "" "{PMID:Lim-2009:19506198}" "" "c.-201C T" "" "Unknown" "" "" "0" "" "" "" "" "benign" "" "0000790131" "0" "10" "3" "129251188" "129251188" "subst" "1.21904E-5" "00000" "RHO_000196" "g.129251188G>A" "" "{PMID:Lim-2009:19506198}" "" "c.625G A" "" "Unknown" "no" "" "0" "" "" "" "" "benign" "" "0000790132" "0" "10" "3" "129251570" "129251570" "subst" "0.000929904" "00000" "RHO_000022" "g.129251570C>T" "" "{PMID:Lim-2009:19506198}" "" "c.891C T" "" "Unknown" "no" "" "0" "" "" "" "" "benign" "" "0000790133" "0" "10" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Lim-2009:19506198}" "" "c.895G T" "" "Unknown" "" "" "0" "" "" "" "" "benign" "" "0000790155" "0" "50" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Zeitz-2009:19578023}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790156" "0" "50" "3" "129247857" "129247857" "subst" "0" "00000" "RHO_000065" "g.129247857C>T" "" "{PMID:Zeitz-2009:19578023}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790157" "0" "50" "3" "129251554" "129251554" "subst" "0" "00000" "RHO_000063" "g.129251554C>A" "" "{PMID:Zeitz-2009:19578023}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790158" "0" "50" "3" "129251563" "129251563" "subst" "0" "00000" "RHO_000198" "g.129251563C>T" "" "{PMID:Zeitz-2009:19578023} {PMID:Zeitz 2008:18487375}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790402" "0" "70" "3" "129251365" "129251365" "subst" "6.0989E-5" "00000" "RHO_000197" "g.129251365G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.129532522G>A" "" "likely pathogenic" "" "0000790432" "0" "70" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic" "" "0000790439" "1" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic" "" "0000790553" "0" "50" "3" "129251592" "129251592" "subst" "2.03054E-5" "00000" "RHO_000102" "g.129251592A>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs199701338" "0" "" "" "g.129532749A>C" "" "VUS" "" "0000790883" "0" "70" "3" "129249722" "129249722" "subst" "4.06072E-6" "00000" "RHO_000201" "g.129249722A>G" "" "{PMID:Matias-Florentino-2009:19958124}" "" "Glu122Gly*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790884" "0" "70" "3" "129247809" "129247809" "subst" "0" "00000" "RHO_000044" "g.129247809A>T" "" "{PMID:Matias-Florentino-2009:19958124}" "" "Asn78Ile*" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790885" "0" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Matias-Florentino-2009:19958124}" "" "Phe45Leu" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790886" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Matias-Florentino-2009:19958124}" "" "Arg135Trp" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790887" "0" "70" "3" "129251120" "129251120" "subst" "0" "00000" "RHO_000105" "g.129251120C>G" "" "{PMID:Matias-Florentino-2009:19958124}" "" "Ser186Trp" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000791175" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "De novo" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000791201" "0" "70" "3" "129251102" "129251102" "subst" "0" "00000" "RHO_000202" "g.129251102C>G" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "De novo" "yes" "" "0" "" "" "g.129532259C>G" "" "likely pathogenic" "ACMG" "0000791206" "11" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000791207" "11" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000791208" "11" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000791209" "21" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000791210" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000791468" "0" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic" "" "0000791469" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000791470" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000791471" "0" "70" "3" "129247660" "129247660" "subst" "0" "00000" "RHO_000175" "g.129247660G>C" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528817G>C" "" "likely pathogenic" "" "0000791472" "0" "70" "3" "129247660" "129247660" "subst" "0" "00000" "RHO_000175" "g.129247660G>C" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528817G>C" "" "likely pathogenic" "" "0000791473" "0" "70" "3" "129247707" "129247707" "subst" "4.06055E-6" "00000" "RHO_000176" "g.129247707T>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528864T>C" "" "likely pathogenic" "" "0000791474" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000791475" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000791476" "0" "70" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528913C>A" "" "likely pathogenic" "" "0000791477" "0" "70" "3" "129247812" "129247812" "subst" "0" "00000" "RHO_000177" "g.129247812T>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129528969T>C" "" "likely pathogenic" "" "0000791478" "0" "70" "3" "129247866" "129247866" "subst" "0" "00000" "RHO_000178" "g.129247866C>T" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129529023C>T" "" "likely pathogenic" "" "0000791479" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000791480" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000791481" "0" "70" "3" "129249735" "129249735" "subst" "0" "00000" "RHO_000179" "g.129249735G>A" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530892G>A" "" "likely pathogenic" "" "0000791482" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic" "" "0000791483" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic" "" "0000791484" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "5/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000791485" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "5/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000791486" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "5/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000791487" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "5/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000791488" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "5/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000791489" "0" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic" "" "0000791490" "0" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic" "" "0000791491" "0" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic" "" "0000791492" "0" "70" "3" "129249845" "129249845" "subst" "0" "00000" "RHO_000181" "g.129249845T>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531002T>C" "" "likely pathogenic" "" "0000791493" "0" "70" "3" "129249857" "129249857" "subst" "0" "00000" "RHO_000182" "g.129249857G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531014G>A" "" "likely pathogenic" "" "0000791494" "0" "70" "3" "129249857" "129249857" "subst" "0" "00000" "RHO_000182" "g.129249857G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531014G>A" "" "likely pathogenic" "" "0000791495" "0" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000113" "g.129249866C>G" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531023C>G" "" "likely pathogenic" "" "0000791496" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic" "" "0000791497" "0" "70" "3" "129251092" "129251092" "subst" "0" "00000" "RHO_000183" "g.129251092A>G" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532249A>G" "" "likely pathogenic" "" "0000791498" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic" "" "0000791499" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000791500" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000791501" "0" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic" "" "0000791502" "0" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic" "" "0000791503" "0" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "3/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic" "" "0000791504" "0" "70" "3" "129251108" "129251108" "subst" "0" "00000" "RHO_000185" "g.129251108G>T" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532265G>T" "" "likely pathogenic" "" "0000791505" "0" "70" "3" "129251119" "129251119" "subst" "0" "00000" "RHO_000186" "g.129251119T>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532276T>C" "" "likely pathogenic" "" "0000791506" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic" "" "0000791507" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic" "" "0000791508" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "2/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic" "" "0000791509" "0" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000791510" "0" "70" "3" "129251544" "129251544" "subst" "0" "00000" "RHO_000188" "g.129251544A>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532701A>C" "" "likely pathogenic" "" "0000791511" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791512" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791513" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791514" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791515" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791516" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791517" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791518" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791519" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791520" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "10/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000791564" "0" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "?" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic" "" "0000791923" "0" "10" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "12.11%" "{PMID:Bowne 2011:20861475}" "" "c.68C>A" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000791924" "0" "10" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "10%" "{PMID:Bowne 2011:20861475}" "" "[c.404G>T,c.405G>T]" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000793738" "3" "70" "3" "129251438" "129251438" "subst" "2.84269E-5" "00000" "RHO_000021" "g.129251438G>T" "0/180 controls" "{PMID:Collin-2011:21217109}" "" "c.759G>T" "cystoid maculopathy" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000793763" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Zhou-2011:21677794}" "" "c.512C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793802" "0" "70" "3" "129251574" "129251574" "subst" "2.03039E-5" "00000" "RHO_000127" "g.129251574G>A" "" "{PMID:Zhou-2011:21677794}" "" "c.895G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793940" "0" "70" "3" "129247660" "129247660" "subst" "0" "03508" "RHO_000175" "g.129247660G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000793998" "0" "90" "3" "129247892" "129247892" "subst" "0" "00000" "RHO_000205" "g.129247892G>M" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Gly106Arg" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000793999" "0" "90" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Arg135Leu" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794000" "0" "90" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Ala164Glu" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794001" "0" "90" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Pro171Leu" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794002" "0" "90" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Tyr178Cys" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794003" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Glu181Lys" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794004" "0" "90" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Gly182Ser" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794005" "0" "90" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Asp190Tyr" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794006" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Blanco-Kelly-2012:22736939}" "" "p.Pro347Leu" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794089" "0" "70" "3" "129252450" "129252450" "subst" "0" "03508" "RHO_000155" "g.129252450G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794265" "0" "30" "3" "129251104" "129251104" "subst" "0" "03508" "RHO_000030" "g.129251104G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794266" "0" "70" "3" "129251104" "129251104" "subst" "0" "03508" "RHO_000030" "g.129251104G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794367" "0" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000209" "g.129252548T>C" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.1034T>C, NP_000530.1:p.(Val345Ala), NC_000003.11:g.129252548T>C" "" "Germline" "?" "" "0" "" "" "g.129533705T>C" "" "likely pathogenic" "ACMG" "0000794368" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.403C>T, NP_000530.1:p.(Arg135Trp), NC_000003.11:g.129249760C>T" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000794369" "0" "90" "3" "129247612" "129247612" "del" "0" "00000" "RHO_000165" "g.129247612del" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.36del, NP_000530.1:p.(Phe13SerfsTer35), NC_000003.11:g.129247612del" "" "Germline" "?" "" "0" "" "" "g.129528769del" "" "pathogenic" "ACMG" "0000794370" "0" "70" "3" "129251530" "129251530" "subst" "0" "00000" "RHO_000208" "g.129251530G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.851G>A, NP_000530.1:p.(Gly284Asp), NC_000003.11:g.129251530G>A" "" "Germline" "?" "" "0" "" "" "g.129532687G>A" "" "likely pathogenic" "ACMG" "0000794371" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.1040C>T, NP_000530.1:p.(Pro347Leu), NC_000003.11:g.129252554C>T" "" "Germline" "?" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000794372" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_000539.3:c.50C>T, NP_000530.1:p.(Thr17Met), NC_000003.11:g.129247626C>T" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "pathogenic" "ACMG" "0000794903" "0" "90" "3" "129247587" "129247587" "subst" "0" "00000" "RHO_000037" "g.129247587C>A" "" "{PMID:Bunge_1993:08406457}" "" "Thr4Lys" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794904" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Bunge_1993:08406457}" "" "Thr17Met" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794905" "0" "90" "3" "129247660" "129247660" "subst" "0" "00000" "RHO_000009" "g.129247660G>T" "" "{PMID:Bunge_1993:08406457}" "" "Gln28His" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794906" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Bunge_1993:08406457}" "" "Thr58Arg" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794907" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000166" "g.129249760C>G" "" "{PMID:Bunge_1993:08406457}" "" "Arg135Gly" "" "Unknown" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794908" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Bunge_1993:08406457}" "" "Glu181Lys" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794909" "0" "90" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Bunge_1993:08406457}" "" "Gly188Arg" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794910" "0" "90" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Bunge_1993:08406457}" "" "Asp190Gly" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794911" "0" "90" "3" "129251222" "129251222" "subst" "2.03257E-5" "00000" "RHO_000163" "g.129251222T>G" "" "{PMID:Bunge_1993:08406457}" "" "Phe220Cys" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794912" "0" "90" "3" "129251227" "129251227" "subst" "0" "00000" "RHO_000207" "g.129251227T>C" "" "{PMID:Bunge_1993:08406457}" "" "Cys222Arg" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794913" "0" "90" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Bunge_1993:08406457}" "" "del255_256Ile (3-bp del)" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794914" "0" "90" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Bunge_1993:08406457}" "" "Lys296Glu" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794915" "0" "90" "3" "129247917" "129247919" "del" "0" "00000" "RHO_000206" "g.129247917_129247919del" "" "{PMID:Bunge_1993:08406457}" "" "341_343del (8-bp del) (p.341_343del)" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794916" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Bunge_1993:08406457}" "" "Val345Met" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794917" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Bunge_1993:08406457}" "" "Pro347Leu" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794918" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Bunge_1993:08406457}" "" "Pro347Ser" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794919" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Bunge_1993:08406457}" "" "Pro347Arg" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000794922" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "1/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.403C>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000794923" "21" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "1/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.403C>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000794924" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "1/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.568G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000794933" "0" "50" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "1/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.50C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000794934" "0" "50" "3" "129251567" "129251567" "subst" "0" "00000" "RHO_000119" "g.129251567G>T" "1/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.888G>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000794935" "0" "50" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "2/336 cases; 0/360 controls" "{PMID:Kim-2012:23049240}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000795926" "0" "90" "3" "129251135" "129251135" "subst" "0" "00000" "RHO_000211" "g.129251135A>G" "" "{PMID:Schorderet-2013:23484092}" "" "p.RHO-Y191C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000795928" "0" "50" "3" "129251434" "129251434" "subst" "8.93452E-5" "00000" "RHO_000073" "g.129251434G>C" "" "{PMID:Schorderet-2013:23484092}" "" "p.RHO-R252P" "" "Unknown" "?" "" "0" "" "" "" "" "VUS" "" "0000795946" "0" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Chen-2013:23462753}" "" "c.158C>G(p.Pro53Arg)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796070" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Gandra-2008:18552984}" "" "c.316G/A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796705" "0" "90" "3" "129247611" "129247611" "subst" "0" "00000" "RHO_000212" "g.129247611C>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.35C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796719" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.541G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796757" "0" "70" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.310G>A" "" "Germline" "" "rs144317206" "0" "" "" "" "" "likely pathogenic" "" "0000796780" "0" "90" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.180C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796831" "0" "90" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.937-1G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796840" "0" "70" "3" "129252512" "129252512" "subst" "0.000105606" "00000" "RHO_000216" "g.129252512C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.998C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796847" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.533A>G" "" "Germline" "" "rs104893776" "0" "" "" "" "" "likely pathogenic" "" "0000796870" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Wang-2014:24154662}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796928" "0" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Sullivan-2013:23950152}" "" "c.44A>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796929" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.50C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796930" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sullivan-2013:23950152}" "" "c.68C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796931" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.152G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796932" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sullivan-2013:23950152}" "" "c.173C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796933" "0" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.190C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796934" "0" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Sullivan-2013:23950152}" "" "c.392T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796935" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.403C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796936" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.404G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796937" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.512C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796938" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Sullivan-2013:23950152}" "" "c.541G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796939" "0" "70" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Sullivan-2013:23950152}" "" "c.563G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796940" "0" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000214" "g.129251210T>A" "" "{PMID:Sullivan-2013:23950152}" "" "c.647T>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796941" "0" "70" "3" "129252496" "129252496" "del" "0" "00000" "RHO_000215" "g.129252496del" "" "{PMID:Sullivan-2013:23950152}" "" "c.982delC" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796942" "0" "70" "3" "129252535" "129252535" "dup" "0" "00000" "RHO_000217" "g.129252535dup" "" "{PMID:Sullivan-2013:23950152}" "" "c.1021dupG" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796943" "0" "70" "3" "129252535" "129252535" "subst" "8.12334E-6" "00000" "RHO_000189" "g.129252535G>A" "" "{PMID:Sullivan-2013:23950152}" "" "c.1021G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796944" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Sullivan-2013:23950152}" "" "c.1040C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796945" "0" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Sullivan-2013:23950152}" "" "c.1039C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000797005" "0" "10" "3" "129251263" "129251263" "subst" "0.0814613" "00000" "RHO_000005" "g.129251263C>T" "29/300 controls" "{PMID:Ma-2013:23991373}" "" "c.696+4C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000797112" "0" "90" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Birtel 2018:30543658}" "" "c.937-1G>T, Splice" "Heterozygous" "Germline" "?" "" "0" "" "" "g.129533607G>T" "" "pathogenic" "ACMG" "0000797113" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.541G>A, p.Glu181Lys" "Heterozygous" "Germline" "?" "rs775557680" "0" "" "" "g.129532261G>A" "" "pathogenic" "ACMG" "0000797114" "0" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000218" "g.129247620A>T" "" "{PMID:Birtel 2018:30543658}" "" "c.44A>T, p.Asn15Ile" "Heterozygous" "Germline" "?" "" "0" "" "" "g.129528777A>T" "" "likely pathogenic" "ACMG" "0000797115" "0" "90" "3" "129252542" "129252542" "subst" "0" "00000" "RHO_000035" "g.129252542G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.1028G>A, p.Ser343Asn" "Heterozygous" "Germline" "?" "" "0" "" "" "g.129533699G>A" "" "pathogenic" "ACMG" "0000797775" "0" "90" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.541G>A, p.(Glu181Lys)" "" "Germline" "?" "" "0" "" "" "g.129532261G>A" "" "pathogenic" "ACMG" "0000797776" "0" "90" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.533A>G, p.(Tyr178Cys)" "" "Germline" "?" "" "0" "" "" "g.129532253A>G" "" "pathogenic" "ACMG" "0000797777" "0" "70" "3" "129247841" "129247841" "subst" "0" "00000" "RHO_000147" "g.129247841G>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.265G>C, p.(Gly89Arg)" "" "Germline" "?" "" "0" "" "" "g.129528998G>C" "" "likely pathogenic" "ACMG" "0000797778" "0" "70" "3" "129251587" "129251587" "subst" "0" "00000" "RHO_000220" "g.129251587C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.908C>G, p.(Pro303Arg)" "" "Germline" "?" "" "0" "" "" "g.129532744C>G" "" "likely pathogenic" "ACMG" "0000797779" "0" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.491C>T, p.(Ala164Val)" "" "Germline" "?" "" "0" "" "" "g.129531005C>T" "" "pathogenic" "ACMG" "0000797780" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.403C>T, p.(Arg135Trp)" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000797781" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.316G>A, p.(Gly106Arg)" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000797782" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.403C>T, p.(Arg135Trp)" "" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000797783" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.316G>A, p.(Gly106Arg)" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000797784" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.50C>T, p.(Thr17Met)" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "pathogenic" "ACMG" "0000797785" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000174" "g.129252547G>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.1033G>T, p.(Val345Leu)" "" "Germline" "?" "" "0" "" "" "g.129533704G>T" "" "likely pathogenic" "ACMG" "0000797786" "0" "70" "3" "129247841" "129247841" "subst" "0" "00000" "RHO_000147" "g.129247841G>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.265G>C, p.(Gly89Arg)" "" "Germline" "?" "" "0" "" "" "g.129528998G>C" "" "likely pathogenic" "ACMG" "0000797787" "0" "70" "3" "129247841" "129247841" "subst" "0" "00000" "RHO_000147" "g.129247841G>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.265G>C, p.(Gly89Arg )" "" "Germline" "?" "" "0" "" "" "g.129528998G>C" "" "likely pathogenic" "ACMG" "0000797788" "0" "70" "3" "129247841" "129247841" "subst" "0" "00000" "RHO_000147" "g.129247841G>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.265G>C, p.(Gly89Arg)" "" "Germline" "?" "" "0" "" "" "g.129528998G>C" "" "likely pathogenic" "ACMG" "0000797789" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.316G>A, p.(Gly106Arg)" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000797790" "0" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.491C>T, p.(Ala164Val)" "" "Germline" "?" "" "0" "" "" "g.129531005C>T" "" "pathogenic" "ACMG" "0000797791" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.316G>A, p.(Gly106Arg)" "" "Germline" "?" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000797792" "0" "70" "3" "129247779" "129247779" "subst" "6.09097E-5" "00000" "RHO_000068" "g.129247779T>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.203T>G, p.(Leu68Arg)" "" "Germline" "?" "" "0" "" "" "g.129528936T>G" "" "likely pathogenic" "ACMG" "0000797793" "0" "70" "3" "129251613" "129251613" "subst" "0" "00000" "RHO_000143" "g.129251613C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.934C>T, p.(Gln312*)" "" "Germline" "?" "" "0" "" "" "g.129532770C>T" "" "likely pathogenic" "ACMG" "0000797794" "0" "90" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.491C>T, p.(Ala164Val)" "" "Germline" "?" "" "0" "" "" "g.129531005C>T" "" "pathogenic" "ACMG" "0000797795" "0" "90" "3" "129251489" "129251489" "subst" "0" "00000" "RHO_000118" "g.129251489C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RHO c.810C>A, p.(Ser270Arg)" "" "Germline" "?" "" "0" "" "" "g.129532646C>A" "" "pathogenic" "ACMG" "0000798422" "3" "50" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam-2011:21987686}" "" "c.448G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000798427" "3" "50" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam-2011:21987686}" "" "c.448G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000798476" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Mezer-2006:16767206}" "" "(Pro347Leu)*" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798478" "0" "90" "3" "129247892" "129247892" "subst" "0" "00000" "RHO_000108" "g.129247892G>T" "" "{PMID:Mezer-2006:16767206}" "" "(Gly106Trp)‡" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798479" "0" "10" "3" "0" "0" "" "0" "00000" "RHO_000000" "g.?" "" "{PMID:Mezer-2006:16767206}" "" "(Cys323Ser)" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000798481" "0" "50" "3" "129247728" "129247728" "subst" "0.000799942" "00000" "RHO_000010" "g.129247728G>C" "" "{PMID:Mezer-2006:16767206}" "" "(Gly51Ala)§" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000798483" "0" "70" "3" "129251438" "129251438" "subst" "0" "00000" "RHO_000219" "g.129251438G>C" "" "{PMID:Mezer-2006:16767206}" "" "(Met253Ile)" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000800967" "0" "30" "3" "129247606" "129247606" "subst" "0.00125904" "01943" "RHO_000221" "g.129247606C>T" "" "" "" "RHO(NM_000539.3):c.30C>T (p.Y10=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800968" "0" "50" "3" "129247908" "129247908" "subst" "8.16607E-6" "01943" "RHO_000222" "g.129247908A>G" "" "" "" "RHO(NM_000539.3):c.332A>G (p.N111S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800969" "0" "30" "3" "129249849" "129249849" "subst" "8.12592E-6" "01943" "RHO_000223" "g.129249849G>A" "" "" "" "RHO(NM_000539.3):c.492G>A (p.A164=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800970" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "02330" "RHO_000056" "g.129251131G>A" "" "" "" "RHO(NM_000539.3):c.568G>A (p.D190N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000810855" "0" "30" "3" "129252604" "129252604" "subst" "0.0813486" "00000" "RHO_000228" "g.129252604C>A" "0.08" "{PMID:Anasagasti-2013:24416769}" "" "c.*43C>A" "" "Germline" "yes" "rs2071093" "0" "" "" "" "" "likely benign (dominant)" "" "0000810856" "0" "30" "3" "129252428" "129252428" "subst" "0.0525256" "00000" "RHO_000226" "g.129252428G>A" "0.1" "{PMID:Anasagasti-2013:24416769}" "" "c.937-23G>A" "" "Germline" "yes" "rs2071092" "0" "" "" "" "" "likely benign (dominant)" "" "0000810860" "0" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Anasagasti-2013:24416769}" "" "c.937-1G>T" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000810861" "0" "30" "3" "129252604" "129252604" "subst" "0.0813486" "00000" "RHO_000228" "g.129252604C>A" "0.08" "{PMID:Anasagasti-2013:24416769}" "" "c.*43C>A" "" "Germline" "yes" "rs2071093" "0" "" "" "" "" "likely benign (dominant)" "" "0000810879" "0" "70" "3" "129247660" "129247660" "subst" "0" "00000" "RHO_000175" "g.129247660G>C" "" "{PMID:Anasagasti-2013:24416769}" "" "p.Gln28Hist" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000810881" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Anasagasti-2013:24416769}" "" "p.Pro347Gln" "" "Germline" "yes" "rs29001566" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000810882" "0" "30" "3" "129252604" "129252604" "subst" "0.0813486" "00000" "RHO_000228" "g.129252604C>A" "0.08" "{PMID:Anasagasti-2013:24416769}" "" "c.*43C>A" "" "Germline" "yes" "rs2071093" "0" "" "" "" "" "likely benign (dominant)" "" "0000810898" "0" "50" "3" "129252475" "129252475" "subst" "4.06345E-6" "00000" "RHO_000227" "g.129252475A>C" "" "{PMID:Anasagasti-2013:24416769}" "" "p.Ile321Leu" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000810917" "0" "70" "3" "129247835" "129247835" "subst" "0" "00000" "RHO_000224" "g.129247835G>C" "" "{PMID:Anasagasti-2013:24416769}" "" "p.Val87Leu" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000810925" "0" "70" "3" "129247835" "129247835" "subst" "0" "00000" "RHO_000224" "g.129247835G>C" "" "{PMID:Anasagasti-2013:24416769}" "" "g.129247835G>C" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000810927" "0" "30" "3" "129248002" "129248002" "subst" "0" "00000" "RHO_000225" "g.129248002C>T" "<0.01" "{PMID:Anasagasti-2013:24416769}" "" "c.361+65C>T" "" "Germline" "yes" "rs192412661" "0" "" "" "" "" "likely benign (dominant)" "" "0000811479" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Kim 2019:31496144}" "" "RHO c.50C>T, p.T17M" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "ACMG" "0000811480" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Kim 2019:31496144}" "" "RHO c.50C>T, p.T17M" "" "Germline" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "ACMG" "0000811772" "0" "90" "3" "129251424" "129251424" "subst" "2.43663E-5" "00000" "RHO_000229" "g.129251424G>T" "" "{PMID:Stanwyck 2019:31193260}" "" "RHO [c.745G > T (p.Glu249Ter)]" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129532581G>T" "" "pathogenic" "" "0000811872" "0" "70" "3" "129247886" "129247886" "subst" "0" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Gao 2019:31054281}" "" "c.310G>A, p.Val104Ile" "heterozygous" "Germline" "?" "" "0" "" "" "g.129529043G>A" "" "likely pathogenic" "" "0000811929" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Hariri 2018:31047384}" "" "p.Tyr178Cys:c.533A/G (heterozygous,autosomal dominant)" "" "Germline" "?" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic" "" "0000812279" "3" "70" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "RHO Ex.2 c.408C>A p.(Tyr136*), Ex.2 c.408C>A p.(Tyr136*)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129530922C>A" "" "likely pathogenic" "" "0000812567" "0" "90" "3" "129247609" "129247609" "del" "0" "00000" "RHO_000038" "g.129247609del" "" "{PMID:Wang 2019:31106028}" "" "c.33delC, p.(Phe13Serfs*35)" "error in annotation: c.33delC instead of c.33del, heterozygous" "Germline" "?" "" "0" "" "" "g.129528766del" "" "pathogenic" "" "0000812639" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Wang 2019:31106028}" "" "c.533A>G, p.(Tyr178Cys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic" "" "0000813189" "0" "70" "3" "129251570" "129251570" "subst" "0.000929904" "00000" "RHO_000022" "g.129251570C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.891C.T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813190" "3" "70" "3" "129252539" "129252539" "subst" "2.43722E-5" "00000" "RHO_000190" "g.129252539C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.1025C.T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813217" "0" "30" "3" "129249801" "129249801" "subst" "0.000186788" "00000" "RHO_000230" "g.129249801C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.444C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813218" "0" "30" "3" "129249859" "129249859" "subst" "1.21928E-5" "00000" "RHO_000231" "g.129249859G>A" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.502G>A" "" "Germline" "no" "" "0" "" "" "" "" "likely benign" "" "0000813687" "1" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xu 2020:31630094}" "" "RHO NM_000539: g.5072C>T, c.1040C>T, p.P347L" "" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000814775" "0" "90" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000103" "g.129252559T>C" "" "{PMID:Dan 2020:31960602}" "" "RHO c.1045T>C, p.(*349Glnnext*51)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.129533716T>C" "" "pathogenic" "ACMG" "0000814776" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dan 2020:31960602}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000814964" "20" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Birtel 2020:32013026}" "" "RHO c.644C>T, p.(Pro215Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000815062" "0" "90" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Shanks 2013:22968130}" "" "P53R" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000815277" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RHO:NM_000539 c.G316A, p.G106R" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000815278" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "c.316G>A; p.(Gly106Arg)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "pathogenic" "ACMG" "0000815554" "0" "50" "3" "129251529" "129251529" "subst" "2.03036E-5" "00000" "RHO_000233" "g.129251529G>T" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RHO:NM_000539 c.G850T, p.G284C" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.129532686G>T" "" "VUS" "ACMG" "0000815559" "0" "50" "3" "129249776" "129249776" "subst" "0" "00000" "RHO_000232" "g.129249776G>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RHO:NM_000539 c.G419C, p.C140S" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.129530933G>C" "" "VUS" "ACMG" "0000815933" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.68C>A, p.Pro23His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "pathogenic" "" "0000815935" "0" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000103" "g.129252559T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.1045T>C, p.Ter349GlnextTer51" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533716T>C" "" "likely pathogenic" "" "0000815940" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.512C>T, p.Pro171Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic" "" "0000815951" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.173C>G, p.Thr58Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000815975" "0" "70" "3" "129251095" "129251095" "subst" "0" "00000" "RHO_000234" "g.129251095T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.532T>C, p.Tyr178His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532252T>C" "" "likely pathogenic" "" "0000816005" "0" "70" "3" "129247629" "129247629" "subst" "7.71624E-5" "00000" "RHO_000088" "g.129247629G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.53G>A, p.Gly18Asp" "conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528786G>A" "" "likely pathogenic" "" "0000816032" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "" "0000816061" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000138" "g.129249869C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.512C>G, p.Pro171Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>G" "" "likely pathogenic" "" "0000816072" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.173C>G, p.Thr58Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000816101" "0" "70" "3" "129251101" "129251101" "subst" "0" "00000" "RHO_000235" "g.129251101C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.538C>A, p.Pro180Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532258C>A" "" "likely pathogenic" "" "0000816106" "0" "90" "3" "129249856" "129249856" "subst" "0" "00000" "RHO_000112" "g.129249856T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.499T>C, p.Cys167Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129531013T>C" "" "pathogenic" "" "0000816226" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "RHO c.173C>G, p.Thr58Arg" "frequent in gnomAD; we have seen this variant has het in patients with a different cause of disease, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000816681" "0" "70" "3" "129252460" "129252460" "del" "0" "00000" "RHO_000238" "g.129252460del" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.946delT, p.C316AfsX44" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533617del" "" "likely pathogenic" "" "0000816682" "0" "70" "3" "129247904" "129247904" "subst" "0" "00000" "RHO_000125" "g.129247904T>C" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.328T>C, p.C110R" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529061T>C" "" "likely pathogenic" "" "0000816683" "0" "70" "3" "129247904" "129247904" "subst" "0" "00000" "RHO_000125" "g.129247904T>C" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.328T>C, p.C110R" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529061T>C" "" "likely pathogenic" "" "0000816684" "0" "70" "3" "129252424" "129252432" "del" "0" "00000" "RHO_000237" "g.129252424_129252432del" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.937-27-19del, p.(?)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533581_129533589del" "" "likely pathogenic" "" "0000816685" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.568G>A, p.D190N" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic" "" "0000816687" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.404G>T, p.R135L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic" "" "0000816688" "0" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.266G>A, p.G89D" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic" "" "0000816689" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.68C>A, p.P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic" "" "0000816690" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.316G>A, p.G106R" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000816691" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.800C>T, p.P267L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532636C>T" "" "likely pathogenic" "" "0000816692" "0" "70" "3" "129252539" "129252539" "subst" "2.43722E-5" "00000" "RHO_000190" "g.129252539C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.1025G>A, p.T342M" "error in annotation, p.T342M is not caused by c.1025G>A, but by c.1025C>T, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533696C>T" "" "likely pathogenic" "" "0000816693" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000236" "g.129251195A>C" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.632A>C, p.H211P" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532352A>C" "" "likely pathogenic" "" "0000816694" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.50C>T, p.T17M" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000816695" "0" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.266G>A, p.G89D" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic" "" "0000816696" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000816697" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000816698" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000816699" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.50C>T, p.T17M" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000816700" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.50C>T, p.T17M" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000816701" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.541G>A, p.E181K" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000816702" "0" "70" "3" "129247659" "129247659" "subst" "0" "00000" "RHO_000124" "g.129247659A>G" "" "{PMID:Jauregui 2020:32098976}" "" "RHO c.83A>G, p.Q28R" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528816A>G" "" "likely pathogenic" "" "0000817308" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sun 2020:32100970}" "" "RHO c.403C > T, p.Arg135Trp, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000817309" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sun 2020:32100970}" "" "RHO c.403C > T, p.Arg135Trp, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000817493" "0" "50" "3" "0" "0" "" "0" "00000" "RHO_000000" "g.?" "" "{PMID:Matsui 2015:26393467}" "" "p.Q344X" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000819052" "3" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dineiro 2020:32483926}" "" "RHO c.173C>G, p.(Thr58Arg)" "homozygous" "Germline" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "ACMG" "0000819312" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819313" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819314" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819395" "1" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.403C>T/p.R135W" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000819435" "1" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.768_770del/p.I256del" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic" "" "0000819471" "1" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.152G>T/p.G51V" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic" "" "0000819472" "1" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.152G>T/p.G51V" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic" "" "0000819473" "1" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.152G>T/p.G51V" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic" "" "0000819569" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000819570" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000819571" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000819572" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000819695" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819696" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819697" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000819801" "1" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.514G>A/p.E181K" "error in annotation, p.E181K is caused by c.541G>A and notc.514G>A, solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000819802" "1" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.514G>A/p.E181K" "error in annotation, p.E181K is caused by c.541G>A and notc.514G>A, solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000819852" "1" "70" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.527C>T/p.S176F" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531041C>T" "" "likely pathogenic" "" "0000819853" "1" "70" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.527C>T/p.S176F" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531041C>T" "" "likely pathogenic" "" "0000819983" "1" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000214" "g.129251210T>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.647T>A/p.M216K" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532367T>A" "" "likely pathogenic" "" "0000820067" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000820068" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000820077" "1" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.173C>G/p.T58R" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000820084" "1" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.491C>A/p.A164E" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic" "" "0000820085" "1" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.491C>A/p.A164E" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic" "" "0000820101" "1" "70" "3" "129251095" "129251095" "subst" "0" "00000" "RHO_000150" "g.129251095T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.532T>G/p.Y178D" "possibly solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532252T>G" "" "likely pathogenic" "" "0000820102" "1" "70" "3" "129251095" "129251095" "subst" "0" "00000" "RHO_000150" "g.129251095T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.532T>G/p.Y178D" "possibly solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532252T>G" "" "likely pathogenic" "" "0000820120" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820121" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820122" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820126" "1" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.512C>T/p.P171L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic" "" "0000820127" "1" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.512C>T/p.P171L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic" "" "0000820131" "1" "70" "3" "129247794" "129247794" "subst" "4.06062E-6" "00000" "RHO_000240" "g.129247794A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.218A>G/p.N73S" "possibly solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528951A>G" "" "likely pathogenic" "" "0000820170" "1" "70" "3" "129251120" "129251120" "subst" "0" "00000" "RHO_000105" "g.129251120C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.557C>G/p.S186W" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532277C>G" "" "likely pathogenic" "" "0000820171" "1" "70" "3" "129251120" "129251120" "subst" "0" "00000" "RHO_000105" "g.129251120C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.557C>G/p.S186W" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532277C>G" "" "likely pathogenic" "" "0000820195" "1" "70" "3" "129252546" "129252546" "subst" "8.12532E-6" "00000" "RHO_000078" "g.129252546G>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1032G>C/p.Q344H" "possibly solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533703G>C" "" "likely pathogenic" "" "0000820211" "1" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.158C>G/p.P53R" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic" "" "0000820237" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820238" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820262" "1" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.644C>T/p.P215L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000820266" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820274" "1" "70" "3" "129247713" "129247713" "subst" "0" "00000" "RHO_000107" "g.129247713T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.137T>G/p.L46R" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528870T>G" "" "likely pathogenic" "" "0000820276" "1" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.392T>C/p.L131P" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic" "" "0000820277" "1" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.392T>C/p.L131P" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic" "" "0000820278" "1" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.392T>C/p.L131P" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic" "" "0000820279" "1" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.392T>C/p.L131P" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic" "" "0000820281" "1" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.644C>T/p.P215L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000820282" "1" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.644C>T/p.P215L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000820284" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820285" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820289" "1" "70" "3" "129249858" "129249858" "subst" "0" "00000" "RHO_000241" "g.129249858C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.501C>G/p.C167W" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531015C>G" "" "likely pathogenic" "" "0000820290" "1" "70" "3" "129249858" "129249858" "subst" "0" "00000" "RHO_000241" "g.129249858C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.501C>G/p.C167W" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129531015C>G" "" "likely pathogenic" "" "0000820294" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820295" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820302" "1" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.644C>T/p.P215L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic" "" "0000820303" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820304" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820305" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820401" "1" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.50C>T/p.T17M" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "" "0000820421" "1" "70" "3" "129252539" "129252539" "subst" "2.43722E-5" "00000" "RHO_000190" "g.129252539C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "PROM1 / RHO, variant 1: c.2050C>T/p.R684* c.1025C>T/p.T342M, variant 2: c.2050C>T/p.R684* -" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533696C>T" "" "likely pathogenic" "" "0000820482" "1" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.44A>G/p.N15S" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic" "" "0000820528" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1040C>T/p.P347L" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000820543" "1" "70" "3" "129252542" "129252542" "subst" "0" "00000" "RHO_000035" "g.129252542G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.1028G>A/p.S343N" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129533699G>A" "" "likely pathogenic" "" "0000820545" "1" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.632A>G/p.H211R" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic" "" "0000820579" "1" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.632A>G/p.H211R" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic" "" "0000820596" "1" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000029" "g.129249869C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RHO, variant 1: c.512C>A/p.P171Q" "solved, heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>A" "" "likely pathogenic" "" "0000821013" "0" "70" "3" "129247612" "129247612" "del" "0" "00000" "RHO_000165" "g.129247612del" "1/64" "{PMID:Liu 2020:32562694}" "" "RHO c.36delC, p.Pro12fs" "error in annotation: c.36del causes p.Phe13Serfs*35 and not p.Pro12fs; heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129528769del" "" "likely pathogenic" "" "0000821023" "0" "70" "3" "129247749" "129247749" "subst" "7.7153E-5" "00000" "RHO_000239" "g.129247749C>T" "1/64" "{PMID:Liu 2020:32562694}" "" "RHO c.173C>T, p.Thr58Met" "heterozygous" "Germline/De novo (untested)" "?" "rs28933394" "0" "" "" "g.129528906C>T" "" "likely pathogenic" "" "0000821353" "0" "70" "3" "129247659" "129247659" "subst" "0" "00000" "RHO_000124" "g.129247659A>G" "" "{PMID:Turro 2020:32581362}" "" "RHO c.83A>G, p.Gln28Arg" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129528816A>G" "" "likely pathogenic" "" "0000821354" "0" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000113" "g.129249866C>G" "" "{PMID:Turro 2020:32581362}" "" "RHO c.509C>G, p.Pro170Arg" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129531023C>G" "" "likely pathogenic" "" "0000821355" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Turro 2020:32581362}" "" "RHO c.568G>T, p.Asp190Tyr" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic" "" "0000821356" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Turro 2020:32581362}" "" "RHO c.541G>A, p.Glu181Lys" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic" "" "0000821357" "0" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Turro 2020:32581362}" "" "RHO c.158C>G, p.Pro53Arg" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic" "" "0000821358" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Turro 2020:32581362}" "" "RHO c.568G>T, p.Asp190Tyr" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic" "" "0000821359" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Turro 2020:32581362}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000822981" "0" "70" "3" "129247646" "129247646" "subst" "0" "00000" "RHO_000242" "g.129247646T>C" "" "{PMID:Méjécase 2020:32783370}" "" "RHO c.70T>C p.(Phe24Leu)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528803T>C" "" "likely pathogenic" "" "0000823262" "0" "50" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Hull 2020:32856788}" "" "RHO nucleotide 1, protein 1:c.403C>T, p.Arg135Trp nucleotide 2, protein 2:-," ", ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.129530917C>T" "" "VUS" "" "0000824333" "0" "90" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.505G>C, p.(A169P)" "" "Unknown" "yes" "" "0" "" "" "g.129531019G>C" "" "pathogenic" "ACMG" "0000824335" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1040C>T, p.(P347L)" "" "Unknown" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000824340" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.403C>T, p.(R135W)" "" "Unknown" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000824341" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000174" "g.129252547G>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1033G>T, p.(V345L)" "" "Unknown" "yes" "" "0" "" "" "g.129533704G>T" "" "pathogenic" "ACMG" "0000824344" "0" "90" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000167" "g.129251195A>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.632A>T, p.(H211L)" "" "Unknown" "yes" "" "0" "" "" "g.129532352A>T" "" "pathogenic" "ACMG" "0000824357" "0" "90" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.512C>T, p.(P171L)" "" "Unknown" "yes" "" "0" "" "" "g.129531026C>T" "" "pathogenic" "ACMG" "0000824362" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000174" "g.129252547G>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1033G>T, p.(V345L)" "" "Unknown" "yes" "" "0" "" "" "g.129533704G>T" "" "pathogenic" "ACMG" "0000824368" "0" "90" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.886A>G, p.(K296E)" "" "Unknown" "yes" "" "0" "" "" "g.129532722A>G" "" "pathogenic" "ACMG" "0000824369" "0" "90" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.533A>G, p.(Y178C)" "" "Unknown" "yes" "" "0" "" "" "g.129532253A>G" "" "pathogenic" "ACMG" "0000824370" "0" "90" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.180C>A, p.(Y60*)" "" "Unknown" "yes" "" "0" "" "" "g.129528913C>A" "" "pathogenic" "ACMG" "0000824374" "0" "90" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.266G>A, p.(G89D)" "" "Unknown" "yes" "" "0" "" "" "g.129528999G>A" "" "pathogenic" "ACMG" "0000824379" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.403C>T, p.(R135W)" "" "Unknown" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000824383" "0" "90" "3" "129247756" "129247756" "subst" "0" "00000" "RHO_000192" "g.129247756C>A" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.180C>A, p.(Y60*)" "" "Unknown" "yes" "" "0" "" "" "g.129528913C>A" "" "pathogenic" "ACMG" "0000824386" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1040C>T, p.(P347L)" "" "Unknown" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000824389" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1040C>T, p.(P347L)" "" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000824390" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.403C>T, p.(R135W)" "" "Unknown" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000824398" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.403C>T, p.(R135W)" "" "Unknown" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000824399" "0" "90" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.190C>T, p.(Q64*)" "" "Unknown" "yes" "" "0" "" "" "g.129528923C>T" "" "pathogenic" "ACMG" "0000824405" "0" "90" "3" "129247893" "129247893" "subst" "0" "00000" "RHO_000244" "g.129247893G>C" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.317G>C, p.(G106R)" "error in annotation, c.317G>C causes p.(Gly106Ala) and not p.(Gly106Arg)" "Unknown" "?" "" "0" "" "" "g.129529050G>C" "" "pathogenic" "ACMG" "0000824406" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1040C>T, p.(P347L)" "" "Unknown" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000824409" "0" "90" "3" "129251120" "129251120" "subst" "0" "00000" "RHO_000105" "g.129251120C>G" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.557C>G, p.(S186W)" "" "Unknown" "yes" "" "0" "" "" "g.129532277C>G" "" "pathogenic" "ACMG" "0000824410" "0" "90" "3" "129251111" "129251111" "subst" "0" "00000" "RHO_000247" "g.129251111T>G" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.548T>G, p.(L183R)" "" "Unknown" "yes" "" "0" "" "" "g.129532268T>G" "" "pathogenic" "ACMG" "0000824416" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Xiao-2021:33598457}" "" "RHO c.1040C>A, p.(P347Q)" "" "Unknown" "yes" "" "0" "" "" "g.129533711C>A" "" "pathogenic" "ACMG" "0000824617" "10" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A(p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824618" "10" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A(p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824619" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO/c.568G>A(p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824620" "0" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A(p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824621" "0" "50" "3" "129251111" "129251111" "subst" "0" "00000" "RHO_000248" "g.129251111T>C" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.548T>C (p.Leu183Pro)" "" "Germline" "yes" "" "0" "" "" "g.129532268T>C" "" "VUS" "" "0000824622" "10" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A (p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824623" "11" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A (p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824624" "11" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A (p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824625" "11" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A (p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824626" "11" "90" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Verdina 2021:33688152}" "" "RHO /c.568G>A (p.Asp190Asn)" "" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "pathogenic" "" "0000824650" "0" "50" "3" "129249859" "129249859" "subst" "0" "00000" "RHO_000245" "g.129249859G>C" "" "{PMID:Ma 2021:33691693}" "" "RHO c.G502C, p.A168P" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.129531016G>C" "" "VUS" "ACMG" "0000824678" "0" "50" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Ma 2021:33691693}" "" "RHO c.C512T, p.P171L" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.129531026C>T" "" "VUS" "ACMG" "0000824727" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Ma 2021:33691693}" "" "RHO c.C50T, p.T17M" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic" "ACMG" "0000824932" "3" "50" "3" "129247551" "129247551" "subst" "0.273979" "00000" "RHO_000006" "g.129247551A>G" "" "{PMID:Donato-2021:33801777}" "" "RHO c.-26 A > G, p.(?), rs7984" "homozygous; heterozygous in brother" "Germline" "no" "rs7984" "0" "" "" "g.129528708A>G" "" "VUS" "" "0000824936" "3" "50" "3" "129247551" "129247551" "subst" "0.273979" "00000" "RHO_000006" "g.129247551A>G" "" "{PMID:Donato-2021:33801777}" "" "RHO c.-26 A > G, p.(?), rs7984" "heterozygous; homozygous in brother" "Germline" "no" "rs7984" "0" "" "" "g.129528708A>G" "" "VUS" "" "0000825665" "0" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000209" "g.129252548T>C" "" "{PMID:Liu-2020:33090715}" "" "c.1034T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825806" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Liu-2020:33090715}" "" "c.403C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825904" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000249" "g.129247728G>A" "" "{PMID:Liu-2020:33090715}" "" "c.152G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825913" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Liu-2020:33090715}" "" "c.1040C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825919" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Liu-2020:33090715}" "" "c.50C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000825966" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Liu-2020:33090715}" "" "c.403C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000826115" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000138" "g.129249869C>G" "" "{PMID:Liu-2020:33090715}" "" "c.512C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000826388" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Liu-2020:33090715}" "" "c.1040C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000826395" "0" "70" "3" "129247916" "129247916" "subst" "0" "00000" "RHO_000251" "g.129247916G>C" "" "{PMID:Liu-2020:33090715}" "" "c.340G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000826947" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Thorsteinsson 2021:33851411}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "" "0000827155" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.403C>T" "" "Germline" "" "rs104893775" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827156" "0" "90" "3" "129252546" "129252546" "subst" "8.12532E-6" "00000" "RHO_000078" "g.129252546G>C" "" "{PMID:Colombo-2020:33576794}" "" "c.1032G>C" "" "Germline" "" "rs749753555" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827157" "0" "90" "3" "129251586" "129251590" "delins" "0" "00000" "RHO_000253" "g.129251586_129251590delinsGC" "" "{PMID:Colombo-2020:33576794}" "" "c.907_911delinsGC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827158" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.316G>A" "" "De novo" "yes" "rs104893773" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827159" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.403C>T" "" "Germline" "yes" "rs104893775" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827160" "0" "90" "3" "129251101" "129251101" "subst" "0" "00000" "RHO_000002" "g.129251101C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.538C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827161" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1040C>T" "" "Germline" "" "rs29001566" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827162" "0" "90" "3" "129251116" "129251116" "subst" "0" "00000" "RHO_000115" "g.129251116T>C" "" "{PMID:Colombo-2020:33576794}" "" "c.553T>C" "" "Germline" "yes" "rs1236550448" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827163" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.1033G>A" "" "Germline" "yes" "rs104893795" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827164" "0" "90" "3" "129251122" "129251122" "subst" "0" "00000" "RHO_000252" "g.129251122T>A" "" "{PMID:Colombo-2020:33576794}" "" "c.559T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827165" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1040C>T" "" "Germline" "" "rs29001566" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827166" "0" "90" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.329G>A" "" "Germline" "" "rs104893787" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827167" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1040C>T" "" "Germline" "" "rs29001566" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827168" "0" "90" "3" "129251108" "129251108" "subst" "0" "00000" "RHO_000185" "g.129251108G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.545G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827169" "0" "90" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Colombo-2020:33576794}" "" "c.1033G>C" "" "Germline" "yes" "rs104893795" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827170" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1040C>T" "" "Germline" "" "rs29001566" "0" "" "" "" "" "pathogenic (dominant)" "" "0000827171" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1040C>T" "" "Germline" "" "rs29001566" "0" "" "" "" "" "pathogenic (dominant)" "" "0000828475" "0" "90" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "RHO, gene that can display both dominant and recessive patterns of inheritance, c.403C>T, p.Arg135Trp, heterozygous" "" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "pathogenic" "ACMG" "0000828903" "0" "70" "3" "129251605" "129251605" "subst" "4.0622E-6" "00000" "RHO_000256" "g.129251605T>A" "" "{PMID:Chen 2021:43360855}" "" "RHO c.[926T>A];[926=], V1: c.926T>A, (p.Met309Lys)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532762T>A" "" "likely pathogenic" "ACMG" "0000828919" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Chen 2021:43360855}" "" "RHO c.[1040C>T];[1040=], V1: c.1040C>T, (p.Pro347Leu)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "ACMG" "0000828936" "0" "70" "3" "129251191" "129251191" "subst" "1.21908E-5" "00000" "RHO_000191" "g.129251191G>T" "" "{PMID:Chen 2021:43360855}" "" "RHO c.[628G>T];[628=], V1: c.628G>T, (p.Val210Phe)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532348G>T" "" "likely pathogenic" "ACMG" "0000829059" "0" "70" "3" "129247741" "129247741" "subst" "0" "00000" "RHO_000255" "g.129247741C>A" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.165C>A, p.Asn55Lys" "" "Unknown" "?" "" "0" "" "" "g.129528898C>A" "" "likely pathogenic" "" "0000829060" "0" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.937-1G>T, p.?" "" "Unknown" "?" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic" "" "0000829061" "0" "70" "3" "129247692" "129247692" "subst" "0" "00000" "RHO_000254" "g.129247692T>G" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.410G>T, p.Met39Arg" "error in annotation, p.Met39Arg is caused by c.116T>G and not c.410G>T" "Unknown" "?" "" "0" "" "" "g.129528849T>G" "" "likely pathogenic" "" "0000829062" "0" "70" "3" "129247692" "129247692" "subst" "0" "00000" "RHO_000254" "g.129247692T>G" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.410G>T, p.Met39Arg" "error in annotation, p.Met39Arg is caused by c.116T>G and not c.410G>T" "Unknown" "?" "" "0" "" "" "g.129528849T>G" "" "likely pathogenic" "" "0000829063" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.568G>A, p.Asp190Asn" "" "Unknown" "?" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic" "" "0000829064" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.568G>A, p.Asp190Asn" "" "Unknown" "?" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic" "" "0000829065" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.316G>A, p.Gly106Arg" "" "Unknown" "?" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic" "" "0000829066" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.467C>G, p.Thr58Arg" "error in annotation, p.Thr58Arg is caused by c.173C>G and not c.467C>G" "Unknown" "?" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic" "" "0000829067" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.568G>A, p.Asp190Asn" "" "Unknown" "?" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic" "" "0000829068" "0" "70" "3" "129247692" "129247692" "subst" "0" "00000" "RHO_000254" "g.129247692T>G" "" "{PMID:Georgiou 2021:32795431}" "" "RHO c.116T>G, p.Met39Arg" "" "Unknown" "?" "" "0" "" "" "g.129528849T>G" "" "likely pathogenic" "" "0000829797" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000029" "g.129249869C>A" "" "{PMID:Dockery 2017:29099798}" "" "RHO c.512C>A, p.Pro171Gln" "only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees, Missense mutations had to show segregation in pedigrees of at least 3 members, two of whom had to be affected." "Germline" "yes" "" "0" "" "" "g.129531026C>A" "" "likely pathogenic" "" "0000829837" "0" "90" "3" "129247878" "129247878" "subst" "8.13974E-6" "00000" "RHO_000257" "g.129247878G>A" "" "{PMID:Numa-2020:33247286}" "" "c.302G>A:p.G101E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829980" "0" "50" "3" "129251102" "129251102" "subst" "0" "00000" "RHO_000258" "g.129251102C>T" "" "{PMID:Numa-2020:33247286}" "" "c.539C>T:p.P180L" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000846882" "0" "70" "3" "129251567" "129251567" "subst" "0" "00000" "RHO_000195" "g.129251567G>C" "" "{PMID:Avela 2019:31087526}" "" "RHO c.888G>C , p.(Lys296Asn)" "heterozygous, not present in unaffected parents" "De novo" "?" "" "0" "" "" "g.129532724G>C" "" "likely pathogenic" "" "0000850130" "0" "30" "3" "129249765" "129249765" "subst" "6.90294E-5" "02330" "RHO_000259" "g.129249765C>T" "" "" "" "RHO(NM_000539.3):c.408C>T (p.Y136=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000850131" "0" "30" "3" "129249876" "129249876" "subst" "0.000667236" "02330" "RHO_000016" "g.129249876C>T" "" "" "" "RHO(NM_000539.3):c.519C>T (p.A173=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000850132" "0" "90" "3" "129251104" "129251104" "subst" "0" "02330" "RHO_000030" "g.129251104G>A" "" "" "" "RHO(NM_000539.3):c.541G>A (p.E181K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000850133" "0" "30" "3" "129252495" "129252495" "subst" "1.62463E-5" "02330" "RHO_000024" "g.129252495A>T" "" "" "" "RHO(NM_000539.3):c.981A>T (p.P327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858797" "0" "70" "3" "129251210" "129251210" "subst" "0" "02327" "RHO_000260" "g.129251210T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000869121" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869122" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869123" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869124" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869125" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869126" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869127" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869128" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869129" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the second nucleotide of codon 347 - Pro/Leu" "heterozygous" "Germline" "yes" "rs29001566" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869130" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the first nucleotide of codon 347 - Pro/Ser" "heterozygous" "Germline" "yes" "rs29001637" "0" "" "" "g.129533710C>T" "" "pathogenic (dominant)" "" "0000869131" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the first nucleotide of codon 347 - Pro/Ser" "heterozygous" "Germline" "yes" "rs29001637" "0" "" "" "g.129533710C>T" "" "pathogenic (dominant)" "" "0000869132" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the first nucleotide of codon 347 - Pro/Ser" "heterozygous" "Germline" "yes" "rs29001637" "0" "" "" "g.129533710C>T" "" "pathogenic (dominant)" "" "0000869133" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the first nucleotide of codon 347 - Pro/Ser" "heterozygous" "Germline" "yes" "rs29001637" "0" "" "" "g.129533710C>T" "" "pathogenic (dominant)" "" "0000869134" "0" "90" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000210" "g.129252553C>T" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-T transition in the first nucleotide of codon 347 - Pro/Ser" "heterozygous" "Germline" "yes" "rs29001637" "0" "" "" "g.129533710C>T" "" "pathogenic (dominant)" "" "0000869135" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869136" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869137" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869138" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869139" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869140" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Dryja 1990:2215617}" "" "RHO C-to-G transverion in the second nucleotide of codon 58 - Thr/Arg" "heterozygous" "Germline" "yes" "rs28933394" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869141" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869142" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869143" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869144" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869145" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869146" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869147" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869148" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869149" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869150" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869151" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869152" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869153" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869154" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869155" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869156" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869157" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869158" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869159" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869160" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869161" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869162" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869163" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869164" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869165" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869166" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869167" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1990:2137202}" "" "RHO C-to-A tranversion in codon 23 - proline to histidine" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869168" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869169" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869170" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869171" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869172" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869173" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869174" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869175" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 17, sequence: ACG->ATG, amino acid change: Thr->Met" "heterozygous" "Germline" "yes" "rs104893769" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869176" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 23, sequence: CCC->CTC, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000869177" "21" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 23, sequence: CCC->CTC, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000869178" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 23, sequence: CCC->CAC, amino acid change: Pro->His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869179" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869180" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869181" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869182" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869183" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869184" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869185" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869186" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869187" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869188" "21" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869189" "0" "70" "3" "129247728" "129247728" "subst" "0" "00000" "RHO_000011" "g.129247728G>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 51, sequence: GGC->GTC, amino acid change: Gly->Val" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528885G>T" "" "likely pathogenic (dominant)" "" "0000869190" "10" "70" "3" "129249731" "129249731" "subst" "0" "00000" "RHO_000136" "g.129249731T>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 125, sequence: CTG->CGG, amino acid change: Leu->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530888T>G" "" "likely pathogenic (dominant)" "" "0000869191" "0" "70" "3" "129249731" "129249731" "subst" "0" "00000" "RHO_000136" "g.129249731T>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 125, sequence: CTG->CGG, amino acid change: Leu->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530888T>G" "" "likely pathogenic (dominant)" "" "0000869192" "21" "70" "3" "129249731" "129249731" "subst" "0" "00000" "RHO_000136" "g.129249731T>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 125, sequence: CTG->CGG, amino acid change: Leu->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530888T>G" "" "likely pathogenic (dominant)" "" "0000869193" "0" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869194" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869195" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869196" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869197" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869198" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869199" "11" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869200" "11" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 89, sequence: GGT->GAT, amino acid change: Gly->Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869201" "0" "70" "3" "129249856" "129249856" "subst" "0" "00000" "RHO_000112" "g.129249856T>C" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 167, sequence: TGC->CGC, amino acid change: Cys->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531013T>C" "" "likely pathogenic (dominant)" "" "0000869202" "11" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 171, sequence: CCA->CTA, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000869203" "20" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 171, sequence: CCA->CTA, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000869204" "11" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 171, sequence: CCA->CTA, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000869205" "11" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 171, sequence: CCA->CTA, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000869206" "11" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 171, sequence: CCA->CTA, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000869207" "21" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 181, sequence: GAG->AAG, amino acid change: Glu->-Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic (dominant)" "" "0000869208" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 181, sequence: GAG->AAG, amino acid change: Glu->-Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic (dominant)" "" "0000869209" "21" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 181, sequence: GAG->AAG, amino acid change: Glu->-Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic (dominant)" "" "0000869210" "0" "70" "3" "129251119" "129251119" "subst" "0" "00000" "RHO_000186" "g.129251119T>C" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 186, sequence: TCG->CCG, amino acid change: Ser->Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532276T>C" "" "likely pathogenic (dominant)" "" "0000869211" "21" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 188, sequence: GGA->AGA, amino acid change: Gly->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000869212" "10" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 188, sequence: GGA->AGA, amino acid change: Gly->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000869213" "21" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 188, sequence: GGA->AGA, amino acid change: Gly->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000869214" "11" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 188, sequence: GGA->AGA, amino acid change: Gly->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000869215" "10" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869216" "10" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869217" "10" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869218" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869219" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869220" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->AAC, amino acid change: Asp-->Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869221" "11" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->GGC, amino acid change: Asp->-Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869222" "11" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->GGC, amino acid change: Asp->-Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869223" "21" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->GGC, amino acid change: Asp->-Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869224" "21" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->GGC, amino acid change: Asp->-Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869225" "0" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 190, sequence: GAC->GGC, amino acid change: Asp->-Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869226" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869227" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869228" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869229" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869230" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869231" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869232" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 345, sequence: GTG->ATG, amino acid change: Val->Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000869233" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "De novo" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869234" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869235" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869236" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869237" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869238" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869239" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869240" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 1991:1833777}" "" "RHO codon 347, sequence: CCG->CTG, amino acid change: Pro->Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869241" "0" "70" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Dryja 1992:1358680}" "" "RHO Gly51Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528884G>C" "" "likely pathogenic (dominant)" "" "0000869242" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Dryja 1992:1358680}" "" "RHO Cys110Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000869243" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869244" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869245" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869246" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869247" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869248" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Gal 1991:1840561}" "" "RHO codon 347 - Pro->Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000869251" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869252" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869253" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869254" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869255" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869256" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869257" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869258" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869259" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869260" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869261" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Inglehearn 1992:1985460}" "" "RHO 3-bp deletion of isoleucine at codon 256." "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000869293" "10" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869294" "10" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869295" "10" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869296" "20" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869297" "10" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869298" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869299" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869300" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869301" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869302" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869303" "21" "70" "3" "129251565" "129251565" "subst" "0" "00000" "RHO_000142" "g.129251565A>G" "" "{PMID:Keen 1991:1765377}" "" "codon 296, nucleotide: AAG-GAG, amino acid: Lys-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532722A>G" "" "likely pathogenic (dominant)" "" "0000869304" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000236" "g.129251195A>C" "" "{PMID:Keen 1991:1765377}" "" "codon 211, nucleotide: CAC-CCC, amino acid: His-Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>C" "" "likely pathogenic (dominant)" "" "0000869305" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000236" "g.129251195A>C" "" "{PMID:Keen 1991:1765377}" "" "codon 211, nucleotide: CAC-CCC, amino acid: His-Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>C" "" "likely pathogenic (dominant)" "" "0000869306" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000236" "g.129251195A>C" "" "{PMID:Keen 1991:1765377}" "" "codon 211, nucleotide: CAC-CCC, amino acid: His-Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>C" "" "likely pathogenic (dominant)" "" "0000869307" "10" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869308" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869309" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869310" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869311" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869312" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869313" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869314" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869315" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869316" "10" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869317" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869318" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869319" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Keen 1991:1765377}" "" "codon 190, nucleotide: GAC-AAC, amino acid: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869320" "0" "70" "3" "129247780" "129247791" "del" "0" "00000" "RHO_000261" "g.129247780_129247791del" "" "{PMID:Keen 1991:1765377}" "" "codon 68-71, nucleotide: 12 bp del, amino acids deleted: Leu, Arg, Thr, Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528937_129528948del" "" "likely pathogenic (dominant)" "" "0000869336" "10" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C344T, T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869337" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C344T, T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869338" "11" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C344T, T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869339" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C344T, T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869340" "11" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C344T, T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869341" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869342" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869343" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869344" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869345" "21" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869346" "21" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869347" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869348" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869349" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869350" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869351" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869352" "10" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869353" "20" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869354" "20" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869355" "21" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869356" "21" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Sung 1991:1862076}" "" "RHO C362A, P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869357" "0" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Sung 1991:1862076}" "" "RHO C427T, F45L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000869358" "21" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Sung 1991:1862076}" "" "RHO C427T, F45L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000869359" "21" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Sung 1991:1862076}" "" "RHO C427T, F45L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000869360" "21" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Sung 1991:1862076}" "" "RHO C427T, F45L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000869361" "21" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Sung 1991:1862076}" "" "RHO C427T, F45L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000869362" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869363" "21" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869364" "21" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869365" "11" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869366" "11" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869367" "11" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Sung 1991:1862076}" "" "RHO C467G, T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000869368" "20" "70" "3" "129247836" "129247836" "subst" "0" "00000" "RHO_000134" "g.129247836T>A" "" "{PMID:Sung 1991:1862076}" "" "RHO T554A, V87D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528993T>A" "" "likely pathogenic (dominant)" "" "0000869369" "11" "70" "3" "129247836" "129247836" "subst" "0" "00000" "RHO_000134" "g.129247836T>A" "" "{PMID:Sung 1991:1862076}" "" "RHO T554A, V87D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528993T>A" "" "likely pathogenic (dominant)" "" "0000869370" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869371" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869372" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869373" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869374" "20" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869375" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869376" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869377" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869378" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869379" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869380" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869381" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869382" "11" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869383" "21" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869384" "10" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869385" "10" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Sung 1991:1862076}" "" "RHO G560A, G89D" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000869386" "10" "70" "3" "129247892" "129247892" "subst" "0" "00000" "RHO_000108" "g.129247892G>T" "" "{PMID:Sung 1991:1862076}" "" "RHO G610T, G106W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>T" "" "likely pathogenic (dominant)" "" "0000869387" "10" "70" "3" "129247892" "129247892" "subst" "0" "00000" "RHO_000108" "g.129247892G>T" "" "{PMID:Sung 1991:1862076}" "" "RHO G610T, G106W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>T" "" "likely pathogenic (dominant)" "" "0000869388" "11" "70" "3" "129247892" "129247892" "subst" "0" "00000" "RHO_000108" "g.129247892G>T" "" "{PMID:Sung 1991:1862076}" "" "RHO G610T, G106W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>T" "" "likely pathogenic (dominant)" "" "0000869389" "10" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869390" "10" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869391" "10" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869392" "10" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869393" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869394" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869395" "20" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869396" "20" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869397" "20" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869398" "20" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869399" "20" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869400" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869401" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869402" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869403" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869404" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869405" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869406" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869407" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869408" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869409" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869410" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869411" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869412" "21" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869413" "11" "70" "3" "129249761" "129249762" "delins" "0" "00000" "RHO_000110" "g.129249761_129249762delinsTT" "" "{PMID:Sung 1991:1862076}" "" "RHO G2481T,G2482T, R135L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918_129530919delinsTT" "" "likely pathogenic (dominant)" "" "0000869414" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869415" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869416" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869417" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869418" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869419" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869420" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869421" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869422" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869423" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C2480T, R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869424" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3815G, Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869425" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3815G, Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869426" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3815G, Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869427" "20" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3851G, D190G" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869428" "20" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3851G, D190G" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869429" "11" "70" "3" "129251132" "129251132" "subst" "0" "00000" "RHO_000019" "g.129251132A>G" "" "{PMID:Sung 1991:1862076}" "" "RHO A3851G, D190G" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532289A>G" "" "likely pathogenic (dominant)" "" "0000869430" "20" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869431" "10" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869432" "10" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869433" "11" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869434" "11" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869435" "11" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5261T, Q344*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000869436" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5271T, P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869437" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Sung 1991:1862076}" "" "RHO C5271T, P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869452" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869453" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869454" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869455" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869456" "11" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869457" "11" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 17 Thr/Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869458" "0" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Sheffield 1991:1897520}" "" "RHO G-to-A transition in codon 182, Gly/Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic (dominant)" "" "0000869459" "0" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Sheffield 1991:1897520}" "" "RHO G-to-A transition in codon 182, Gly/Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic (dominant)" "" "0000869460" "21" "70" "3" "129251107" "129251107" "subst" "0" "00000" "RHO_000184" "g.129251107G>A" "" "{PMID:Sheffield 1991:1897520}" "" "RHO G-to-A transition in codon 182, Gly/Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532264G>A" "" "likely pathogenic (dominant)" "" "0000869461" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Sheffield 1991:1897520}" "" "RHO C-to-T transition in codon 267, Pro/Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532636C>T" "" "likely pathogenic (dominant)" "" "0000869666" "21" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Heckenlively 1991:1987955}" "" "RHO cytosine-to-adenine transversion in codon 23, proline-to-histidine amino acid substitution" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869667" "10" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Heckenlively 1991:1987955}" "" "RHO cytosine-to-adenine transversion in codon 23, proline-to-histidine amino acid substitution" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869668" "11" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Heckenlively 1991:1987955}" "" "RHO cytosine-to-adenine transversion in codon 23, proline-to-histidine amino acid substitution" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869669" "10" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Heckenlively 1991:1987955}" "" "RHO cytosine-to-adenine transversion in codon 23, proline-to-histidine amino acid substitution" "heterozygous" "Germline" "yes" "rs104893768" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000869670" "0" "90" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Inglehearn 1992:1301135}" "" "RHO codon: 53, sequence: CCC-CGC, protein: Pro-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528891C>G" "" "pathogenic (dominant)" "" "0000869671" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Inglehearn 1992:1301135}" "" "RHO codon: 58, sequence: ACG-AGG, protein: Thr-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869672" "0" "90" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Inglehearn 1992:1301135}" "" "RHO codon: 58, sequence: ACG-AGG, protein: Thr-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "pathogenic (dominant)" "" "0000869673" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Inglehearn 1992:1301135}" "" "RHO codon: 106, sequence: GGG-AGG, protein: Gly-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "pathogenic (dominant)" "" "0000869674" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Inglehearn 1992:1301135}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869675" "10" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869676" "10" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869677" "10" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869678" "10" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869679" "10" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869680" "20" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869681" "11" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869682" "11" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000032" "g.129251183T>G" "" "{PMID:Farrar 1992:1302614}" "" "RHO codon: 207, sequence ATG-AGG, protein: Met-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>G" "" "likely pathogenic (dominant)" "" "0000869690" "11" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence GAC-TAC, protein: Asp-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic (dominant)" "" "0000869691" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence GAC-TAC, protein: Asp-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic (dominant)" "" "0000869692" "21" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 267, sequence: CCC-CTC, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532636C>T" "" "likely pathogenic (dominant)" "" "0000869693" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 267, sequence: CCC-CTC, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532636C>T" "" "likely pathogenic (dominant)" "" "0000869694" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence: GAC-AAC, protein: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869695" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence: GAC-AAC, protein: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869696" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence: GAC-AAC, protein: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869697" "21" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Fishman 1992:1444916}" "" "RHO codon: 190, sequence: GAC-AAC, protein: Asp-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000869701" "20" "70" "3" "129252533" "129252533" "del" "0" "00000" "RHO_000262" "g.129252533del" "" "{PMID:Horn 1992:1487240}" "" "RHO codon: 340, sequence: 1 bp del, protein: frameshift" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533690del" "" "likely pathogenic (dominant)" "" "0000869702" "11" "70" "3" "129252533" "129252533" "del" "0" "00000" "RHO_000262" "g.129252533del" "" "{PMID:Horn 1992:1487240}" "" "RHO codon: 340, sequence: 1 bp del, protein: frameshift" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533690del" "" "likely pathogenic (dominant)" "" "0000869703" "21" "70" "3" "129252533" "129252533" "del" "0" "00000" "RHO_000262" "g.129252533del" "" "{PMID:Horn 1992:1487240}" "" "RHO codon: 340, sequence: 1 bp del, protein: frameshift" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533690del" "" "likely pathogenic (dominant)" "" "0000869704" "10" "70" "3" "129252535" "129252542" "del" "0" "00000" "RHO_000263" "g.129252535_129252542del" "" "{PMID:Horn 1992:1487240}" "" "RHO codon: 341-343, sequence: 8 bp del, protein: del 2 aa, frameshift" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533692_129533699del" "" "likely pathogenic (dominant)" "" "0000869705" "11" "70" "3" "129252535" "129252542" "del" "0" "00000" "RHO_000263" "g.129252535_129252542del" "" "{PMID:Horn 1992:1487240}" "" "RHO codon: 341-343, sequence: 8 bp del, protein: del 2 aa, frameshift" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533692_129533699del" "" "likely pathogenic (dominant)" "" "0000869710" "3" "70" "3" "129251424" "129251424" "subst" "2.43663E-5" "00000" "RHO_000229" "g.129251424G>T" "" "{PMID:Rosenfeld 1992:1303237}" "" "RHO codon: 249, sequence: GAG-TAG, protein: Glu-Ter" "homozygous" "Germline" "yes" "" "0" "" "" "g.129532581G>T" "" "likely pathogenic (recessive)" "" "0000869723" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fishman 1992:1580841}" "" "RHO first nucleotide of codon 106, glycine-to-arginine change" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869724" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fishman 1992:1580841}" "" "RHO first nucleotide of codon 106, glycine-to-arginine change" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869725" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fishman 1992:1580841}" "" "RHO first nucleotide of codon 106, glycine-to-arginine change" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869726" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fishman 1992:1580841}" "" "RHO first nucleotide of codon 106, glycine-to-arginine change" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869727" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Fishman 1992:1580841}" "" "RHO first nucleotide of codon 106, glycine-to-arginine change" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869730" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Fujiki 1992:1391967}" "" "RHO codon: 17, sequence: ACG-ATG, protein: Thr-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "pathogenic (dominant)" "" "0000869731" "0" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fujiki 1992:1391967}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869732" "21" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fujiki 1992:1391967}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869733" "11" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fujiki 1992:1391967}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869734" "11" "90" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Fujiki 1992:1391967}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "pathogenic (dominant)" "" "0000869735" "20" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869736" "20" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869737" "20" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869738" "20" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869739" "20" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869740" "11" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869741" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869742" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869743" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869744" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869745" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1992:1404299}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869746" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869747" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869748" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869749" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869750" "10" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869751" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Andreasson 1992:1484692}" "" "RHO codon: 135, sequence: CGG-CTG, protein: Arg-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869767" "20" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Sullivan 1993:8240107}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869768" "20" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Sullivan 1993:8240107}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869769" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Sullivan 1993:8240107}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869812" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 23, sequence: CCC-CAC, protein: P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869813" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 23, sequence: CCC-CAC, protein: P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869814" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 23, sequence: CCC-CAC, protein: P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869815" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 23, sequence: CCC-CAC, protein: P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869816" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 23, sequence: CCC-CAC, protein: P23H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000869817" "0" "70" "3" "129247728" "129247728" "subst" "0.000799942" "00000" "RHO_000010" "g.129247728G>C" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 51, sequence: GGC-GCC, protein: G51A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528885G>C" "" "likely pathogenic (dominant)" "" "0000869818" "10" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869819" "11" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869820" "11" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869821" "20" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869822" "20" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869823" "21" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869824" "21" "70" "3" "129247766" "129247766" "subst" "0" "00000" "RHO_000067" "g.129247766C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 64, sequence: CAG-TAG, protein: Q64ter" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528923C>T" "" "likely pathogenic (dominant)" "" "0000869825" "0" "30" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 104, sequence: GTC-ATC , protein: V104I" "heterozygous" "Germline" "no" "" "0" "" "" "g.129529043G>A" "" "likely benign" "" "0000869826" "0" "30" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 104, sequence: GTC-ATC , protein: V104I" "heterozygous" "Germline" "no" "" "0" "" "" "g.129529043G>A" "" "likely benign" "" "0000869827" "20" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 106, sequence: GGG-AGG, protein: G106R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869828" "21" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 106, sequence: GGG-AGG, protein: G106R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869829" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 106, sequence: GGG-AGG, protein: G106R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869830" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 106, sequence: GGG-AGG, protein: G106R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000869831" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000166" "g.129249760C>G" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-GGG, protein: R135G" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>G" "" "likely pathogenic (dominant)" "" "0000869832" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000166" "g.129249760C>G" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-GGG, protein: R135G" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>G" "" "likely pathogenic (dominant)" "" "0000869833" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-CTG, protein: R135L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869834" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-CTG, protein: R135L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000869835" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-TGG, protein: R135W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869836" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-TGG, protein: R135W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869837" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 135, sequence: CGG-TGG, protein: R135W" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869838" "21" "70" "3" "129249776" "129249776" "subst" "0" "00000" "RHO_000232" "g.129249776G>C" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 140, sequence: TGT-TCT, protein: C140S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530933G>C" "" "likely pathogenic (dominant)" "" "0000869839" "0" "70" "3" "129249776" "129249776" "subst" "0" "00000" "RHO_000232" "g.129249776G>C" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 140, sequence: TGT-TCT, protein: C140S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530933G>C" "" "likely pathogenic (dominant)" "" "0000869840" "20" "70" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 188, sequence: GGA-GAA, protein: G188E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532283G>A" "" "likely pathogenic (dominant)" "" "0000869841" "20" "70" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 188, sequence: GGA-GAA, protein: G188E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532283G>A" "" "likely pathogenic (dominant)" "" "0000869842" "11" "70" "3" "129251126" "129251126" "subst" "4.06128E-6" "00000" "RHO_000140" "g.129251126G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 188, sequence: GGA-GAA, protein: G188E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532283G>A" "" "likely pathogenic (dominant)" "" "0000869843" "0" "70" "3" "129251188" "129251188" "subst" "1.21904E-5" "00000" "RHO_000196" "g.129251188G>A" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 209, sequence: GTG-ATG, protein: V209M" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532345G>A" "" "likely pathogenic (dominant)" "" "0000869844" "0" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 211, sequence: CAC-CGC, protein: H211R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic (dominant)" "" "0000869845" "21" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 211, sequence: CAC-CGC, protein: H211R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic (dominant)" "" "0000869846" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 347, sequence: CCG-CTG, protein: P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869847" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 347, sequence: CCG-CTG, protein: P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869848" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 347, sequence: CCG-CTG, protein: P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869849" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Macke_1993:8317502}" "" "RHO codon: 347, sequence: CCG-CTG, protein: P347L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000869850" "0" "70" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Macke_1993:8317502}" "" "guanosine 4335-to thymidine, GT to TT at the donor splice junction of intron 4" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (dominant)" "" "0000869851" "21" "70" "3" "129251616" "129251616" "subst" "0" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Macke_1993:8317502}" "" "guanosine 4335-to thymidine, GT to TT at the donor splice junction of intron 5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (dominant)" "" "0000869852" "21" "70" "3" "129251616" "129251616" "subst" "0" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Macke_1993:8317502}" "" "guanosine 4335-to thymidine, GT to TT at the donor splice junction of intron 6" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (dominant)" "" "0000869853" "11" "70" "3" "129251616" "129251616" "subst" "0" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Macke_1993:8317502}" "" "guanosine 4335-to thymidine, GT to TT at the donor splice junction of intron 7" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (dominant)" "" "0000869854" "20" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869855" "20" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869856" "20" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869857" "10" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869858" "10" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869859" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869860" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869861" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869862" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869863" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869864" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869865" "11" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869866" "11" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869867" "11" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Kranich_1993:8353500}" "" "RHO codon: 15, sequence: AAT-AGT, protein: Asn-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000869869" "0" "70" "3" "129247713" "129247713" "subst" "0" "00000" "RHO_000107" "g.129247713T>G" "" "{PMID:Rodriguez_1993:8364589}" "" "RHO codon: 46, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528870T>G" "" "likely pathogenic (dominant)" "" "0000869870" "11" "70" "3" "129247713" "129247713" "subst" "0" "00000" "RHO_000107" "g.129247713T>G" "" "{PMID:Rodriguez_1993:8364589}" "" "RHO codon: 46, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528870T>G" "" "likely pathogenic (dominant)" "" "0000869871" "21" "70" "3" "129247713" "129247713" "subst" "0" "00000" "RHO_000107" "g.129247713T>G" "" "{PMID:Rodriguez_1993:8364589}" "" "RHO codon: 46, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528870T>G" "" "likely pathogenic (dominant)" "" "0000869872" "21" "70" "3" "129247713" "129247713" "subst" "0" "00000" "RHO_000107" "g.129247713T>G" "" "{PMID:Rodriguez_1993:8364589}" "" "RHO codon: 46, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528870T>G" "" "likely pathogenic (dominant)" "" "0000869876" "0" "70" "3" "129252534" "129252575" "del" "0" "00000" "RHO_000270" "g.129252534_129252575del" "" "{PMID:Restango 1993:8499910}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533691_129533732del" "" "likely pathogenic (dominant)" "" "0000869877" "21" "70" "3" "129252534" "129252575" "del" "0" "00000" "RHO_000270" "g.129252534_129252575del" "" "{PMID:Restango 1993:8499910}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533691_129533732del" "" "likely pathogenic (dominant)" "" "0000869878" "21" "70" "3" "129252534" "129252575" "del" "0" "00000" "RHO_000270" "g.129252534_129252575del" "" "{PMID:Restango 1993:8499910}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533691_129533732del" "" "likely pathogenic (dominant)" "" "0000869879" "11" "70" "3" "129252534" "129252575" "del" "0" "00000" "RHO_000270" "g.129252534_129252575del" "" "{PMID:Restango 1993:8499910}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533691_129533732del" "" "likely pathogenic (dominant)" "" "0000869880" "11" "70" "3" "129252534" "129252575" "del" "0" "00000" "RHO_000270" "g.129252534_129252575del" "" "{PMID:Restango 1993:8499910}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533691_129533732del" "" "likely pathogenic (dominant)" "" "0000869891" "20" "70" "3" "129247695" "129247695" "subst" "0" "00000" "RHO_000264" "g.129247695T>G" "" "{PMID:Kim 1993:8240108}" "" "RHO codon: 40, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528852T>G" "" "likely pathogenic (dominant)" "" "0000869892" "20" "70" "3" "129247695" "129247695" "subst" "0" "00000" "RHO_000264" "g.129247695T>G" "" "{PMID:Kim 1993:8240108}" "" "RHO codon: 40, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528852T>G" "" "likely pathogenic (dominant)" "" "0000869893" "11" "70" "3" "129247695" "129247695" "subst" "0" "00000" "RHO_000264" "g.129247695T>G" "" "{PMID:Kim 1993:8240108}" "" "RHO codon: 40, sequence: CTG-CGG, protein: Leu-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528852T>G" "" "likely pathogenic (dominant)" "" "0000869894" "0" "71" "3" "0" "0" "" "0" "00000" "RHO_000000" "g.?" "" "{PMID:Kim 1993:8240108}" "" "RHO 150-bp insertion that disrupts the 5\'-splice junction of exon 5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic (dominant)" "" "0000869895" "21" "71" "3" "0" "0" "" "0" "00000" "RHO_000000" "g.?" "" "{PMID:Kim 1993:8240108}" "" "RHO 150-bp insertion that disrupts the 5\'-splice junction of exon 5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic (dominant)" "" "0000869896" "21" "71" "3" "0" "0" "" "0" "00000" "RHO_000000" "g.?" "" "{PMID:Kim 1993:8240108}" "" "RHO 150-bp insertion that disrupts the 5\'-splice junction of exon 5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic (dominant)" "" "0000869899" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000155" "g.129252450G>A" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>A" "" "likely pathogenic (dominant)" "" "0000869900" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000155" "g.129252450G>A" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 340-348, sequence: 42 bp del, protein: inc 46 unrel aa" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>A" "" "likely pathogenic (dominant)" "" "0000869901" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000155" "g.129252450G>A" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 5167G--> A, sequence: , protein: not known" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>A" "" "likely pathogenic (dominant)" "" "0000869902" "10" "50" "3" "129252582" "129252582" "subst" "0" "00000" "RHO_000271" "g.129252582G>A" "" "{PMID:Bell 1994:7819178}" "" "RHO g>a transition at position 5299" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533739G>A" "" "VUS" "" "0000869903" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 17, sequence: ACG-ATG, protein: Thr-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869904" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 17, sequence: ACG-ATG, protein: Thr-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000869905" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000869906" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869907" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869908" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869909" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869910" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869911" "11" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869912" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869913" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869914" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869915" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869916" "21" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Bell 1994:7819178}" "" "RHO codon: 178, sequence: TAC-TGC, protein: Tyr-Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000869917" "0" "70" "3" "129252428" "129252457" "delins" "0" "00000" "RHO_000269" "g.129252428_129252457delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "{PMID:Al-Maghtheh 1994:8162031}" "" "intron 4 to seven bases into exon 5: 30 bp del and 150 bp ins: ACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533585_129533614delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "likely pathogenic (dominant)" "" "0000869918" "21" "70" "3" "129252428" "129252457" "delins" "0" "00000" "RHO_000269" "g.129252428_129252457delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "{PMID:Al-Maghtheh 1994:8162031}" "" "intron 4 to seven bases into exon 5: 30 bp del and 150 bp ins: ACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533585_129533614delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "likely pathogenic (dominant)" "" "0000869919" "21" "70" "3" "129252428" "129252457" "delins" "0" "00000" "RHO_000269" "g.129252428_129252457delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "{PMID:Al-Maghtheh 1994:8162031}" "" "intron 4 to seven bases into exon 5: 30 bp del and 150 bp ins: ACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533585_129533614delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "" "likely pathogenic (dominant)" "" "0000869920" "10" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:Saga 1994:7850270}" "" "RHO codon: 181, sequence: GAG-AAG, protein: Glu-Lys" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic (dominant)" "" "0000869921" "0" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Fuchs 1994:7981701}" "" "RHO codon: 164, sequence: GCG-GTG, protein: Ala-Val" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic (dominant)" "" "0000869922" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000265" "g.129247905G>C" "" "{PMID:Fuchs 1994:7981701}" "" "RHO codon: 110, sequence: TGC-TCC, protein: Cys-Phe" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529062G>C" "" "likely pathogenic (dominant)" "" "0000869923" "0" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Fuchs 1994:7981701}" "" "RHO codon: 131, sequence: CTG-CCG, protein: Leu-Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000869924" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000029" "g.129249869C>A" "" "{PMID:Antinolo 1994:7987326}" "" "RHO codon: 171, sequence: CCA-CAA, protein: Pro-Gln" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>A" "" "likely pathogenic (dominant)" "" "0000869925" "0" "70" "3" "129249737" "129249737" "subst" "0" "00000" "RHO_000050" "g.129249737C>T" "" "{PMID:Souied 1994:7987331}" "" "RHO codon: 127, sequence: TCC-TTC, protein: Ser-Phe" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530894C>T" "" "likely pathogenic (dominant)" "" "0000869926" "0" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Souied 1994:7987331}" "" "RHO codon: 131, sequence: CTG-CCG, protein: Leu-Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000869927" "0" "70" "3" "129251095" "129251095" "subst" "0" "00000" "RHO_000266" "g.129251095T>A" "" "{PMID:Souied 1994:7987331}" "" "RHO codon: 178, sequence: TAC-AAC, protein: Tyr-Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532252T>A" "" "likely pathogenic (dominant)" "" "0000869928" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000267" "g.129251479C>G" "" "{PMID:Souied 1994:7987331}" "" "RHO codon: 267, sequence: CCC-CGC, protein: Pro-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532636C>G" "" "likely pathogenic (dominant)" "" "0000869929" "0" "70" "3" "129251570" "129251570" "subst" "0" "00000" "RHO_000268" "g.129251570C>G" "" "{PMID:Souied 1994:7987331}" "" "RHO codon: 297, sequence: AGC-CGC, protein: Ser-Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532727C>G" "" "likely pathogenic (dominant)" "" "0000869930" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Kumaramanickavel 1994:7987385}" "" "RHO codon: 150, sequence: GAG-AAG, protein: Glu-Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000869931" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Kumaramanickavel 1994:7987385}" "" "RHO codon: 150, sequence: GAG-AAG, protein: Glu-Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000869932" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Kumaramanickavel 1994:7987385}" "" "RHO codon: 150, sequence: GAG-AAG, protein: Glu-Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000869933" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Kumaramanickavel 1994:7987385}" "" "RHO codon: 150, sequence: GAG-AAG, protein: Glu-Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000869994" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000869995" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000869996" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000869997" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000869998" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000869999" "10" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870000" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870001" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870002" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870003" "10" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Rosas 1994:8045708}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870005" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870006" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870007" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870008" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 345, sequence: GTG-CTG, protein: Val-Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870009" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 347, sequence: CCG-CAG, protein: Pro-Gln" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "likely pathogenic (dominant)" "" "0000870010" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 347, sequence: CCG-CAG, protein: Pro-Gln" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "likely pathogenic (dominant)" "" "0000870011" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 347, sequence: CCG-CAG, protein: Pro-Gln" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "likely pathogenic (dominant)" "" "0000870012" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000203" "g.129252554C>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 347, sequence: CCG-CAG, protein: Pro-Gln" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>A" "" "likely pathogenic (dominant)" "" "0000870013" "0" "70" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 51, sequence: GGC-CGC, protein: Gly-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528884G>C" "" "likely pathogenic (dominant)" "" "0000870014" "0" "70" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 51, sequence: GGC-CGC, protein: Gly-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528884G>C" "" "likely pathogenic (dominant)" "" "0000870015" "21" "70" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 51, sequence: GGC-CGC, protein: Gly-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528884G>C" "" "likely pathogenic (dominant)" "" "0000870016" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870017" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870018" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870019" "11" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870020" "11" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870021" "11" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 110, sequence: TGC - TAC, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870022" "0" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000135" "g.129247917G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 114, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529074G>A" "" "likely pathogenic (dominant)" "" "0000870023" "21" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000135" "g.129247917G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 114, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529074G>A" "" "likely pathogenic (dominant)" "" "0000870024" "21" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000135" "g.129247917G>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 114, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529074G>A" "" "likely pathogenic (dominant)" "" "0000870025" "0" "70" "3" "129249848" "129249848" "subst" "0" "00000" "RHO_000104" "g.129249848C>A" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 164, sequence: GCG-GAG, protein: Ala-Glu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531005C>A" "" "likely pathogenic (dominant)" "" "0000870026" "0" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 264, sequence: TGC del, protein: del Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic (dominant)" "" "0000870027" "11" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 264, sequence: TGC del, protein: del Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic (dominant)" "" "0000870028" "11" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 264, sequence: TGC del, protein: del Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic (dominant)" "" "0000870029" "21" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 264, sequence: TGC del, protein: del Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic (dominant)" "" "0000870030" "21" "70" "3" "129251471" "129251473" "del" "0" "00000" "RHO_000033" "g.129251471_129251473del" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 264, sequence: TGC del, protein: del Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532628_129532630del" "" "likely pathogenic (dominant)" "" "0000870031" "20" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00000" "RHO_000092" "g.129249868C>T" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 171, sequence: CCA-TCA, protein: Pro-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531025C>T" "" "likely pathogenic (dominant)" "" "0000870032" "20" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00000" "RHO_000092" "g.129249868C>T" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 171, sequence: CCA-TCA, protein: Pro-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531025C>T" "" "likely pathogenic (dominant)" "" "0000870033" "11" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00000" "RHO_000092" "g.129249868C>T" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 171, sequence: CCA-TCA, protein: Pro-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531025C>T" "" "likely pathogenic (dominant)" "" "0000870034" "21" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00000" "RHO_000092" "g.129249868C>T" "" "{PMID:Vaithinathan 1994:8088850}" "" "RHO codon: 171, sequence: CCA-TCA, protein: Pro-Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531025C>T" "" "likely pathogenic (dominant)" "" "0000870036" "0" "70" "3" "129247695" "129247695" "subst" "0" "00000" "RHO_000264" "g.129247695T>G" "" "{PMID:Al-Maghtheh_1994:8081400}" "" "RHO T->G transversion at nucleotide position 413, which results in Leu40Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528852T>G" "" "likely pathogenic (dominant)" "" "0000870037" "0" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000214" "g.129251210T>A" "" "{PMID:Al-Maghtheh_1994:8081400}" "" "RHO T->A transversion at nucleotide position 3929, resulting in Met216Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532367T>A" "" "likely pathogenic (dominant)" "" "0000870042" "0" "50" "3" "129247707" "129247707" "subst" "4.06055E-6" "00000" "RHO_000176" "g.129247707T>C" "" "{PMID:Reig 1994:8076945}" "" "RHO codon: 44, sequence: ATG-ACG, protein: Met-Thr" "heterozygous; father died at 70 with no RP symptoms; mother wild type; consanguinity, but heterozygous mutation, no other family members affected; probable de novo; unknown causality" "Unknown" "?" "" "0" "" "" "g.129528864T>C" "" "VUS" "" "0000870045" "10" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 211, sequence: CAC-CGC, protein: His-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic (dominant)" "" "0000870046" "10" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 211, sequence: CAC-CGC, protein: His-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic (dominant)" "" "0000870047" "21" "70" "3" "129251195" "129251195" "subst" "0" "00000" "RHO_000117" "g.129251195A>G" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 211, sequence: CAC-CGC, protein: His-Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532352A>G" "" "likely pathogenic (dominant)" "" "0000870048" "10" "30" "3" "129249837" "129249837" "subst" "0.00155945" "00000" "RHO_000070" "g.129249837C>A" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 160, sequence: ACC-ACA, protein: Thr= (silent)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530994C>A" "" "likely benign" "" "0000870049" "10" "30" "3" "129249837" "129249837" "subst" "0.00155945" "00000" "RHO_000070" "g.129249837C>A" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 160, sequence: ACC-ACA, protein: Thr= (silent)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530994C>A" "" "likely benign" "" "0000870050" "21" "30" "3" "129249837" "129249837" "subst" "0.00155945" "00000" "RHO_000070" "g.129249837C>A" "" "{PMID:Reig 1994:8162026}" "" "RHO codon: 160, sequence: ACC-ACA, protein: Thr= (silent)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530994C>A" "" "likely benign" "" "0000870051" "0" "30" "3" "129251263" "129251263" "subst" "0.0814613" "00000" "RHO_000005" "g.129251263C>T" "" "{PMID:Reig 1994:8162026}" "" "RHO C-to-T polymorphism four bases downstream of the 3\' end of exon 3" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532420C>T" "" "likely benign" "" "0000870057" "11" "30" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Rosenfeld 1995:7558711}" "" "RHO G->T donor splice site of intron 4" "heterozygous, non-causative" "Unknown" "no" "" "0" "" "" "g.129532773G>T" "" "likely benign" "" "0000870058" "21" "30" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Rosenfeld 1995:7558711}" "" "RHO G->T donor splice site of intron 4" "heterozygous, non-causative" "Unknown" "no" "" "0" "" "" "g.129532773G>T" "" "likely benign" "" "0000870059" "10" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Macke 1995:7633434}" "" "RHO codon: 347, sequence: CCG-GCG, protein: Pro-Ala" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic (dominant)" "" "0000870060" "10" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Macke 1995:7633434}" "" "RHO codon: 347, sequence: CCG-GCG, protein: Pro-Ala" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic (dominant)" "" "0000870061" "10" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Macke 1995:7633434}" "" "RHO codon: 347, sequence: CCG-GCG, protein: Pro-Ala" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic (dominant)" "" "0000870062" "10" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Macke 1995:7633434}" "" "RHO codon: 347, sequence: CCG-GCG, protein: Pro-Ala" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic (dominant)" "" "0000870063" "21" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000122" "g.129252553C>G" "" "{PMID:Macke 1995:7633434}" "" "RHO codon: 347, sequence: CCG-GCG, protein: Pro-Ala" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533710C>G" "" "likely pathogenic (dominant)" "" "0000870068" "20" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870069" "20" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870070" "20" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870071" "20" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870072" "10" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870073" "10" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870074" "10" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870075" "10" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870076" "21" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870077" "11" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870078" "11" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870079" "11" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870080" "11" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Richards 1995:7724183}" "" "RHO codon: 187, sequence: TGT-TAT, protein: Cys-Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000870094" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870095" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870096" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870097" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870098" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870099" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870100" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870101" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870102" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870103" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870104" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870105" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Sieving 1995:7846071}" "" "RHO codon: 90, sequence: GGC-GAC, protein: Gly-Asp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000870106" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Souied 1996:8554077}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870107" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Souied 1996:8554077}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; additionally, APOE E3/E4 haplotype" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870108" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Souied 1996:8554077}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; additionally, APOE E3/E3 haplotype" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870109" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Souied 1996:8554077}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; additionally, APOE E3/E4 haplotype" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870110" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Souied 1996:8554077}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; additionally, APOE E3/E4 haplotype" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870111" "21" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870112" "3" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870113" "21" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870114" "3" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870115" "21" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870116" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870117" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870118" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870119" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870120" "3" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870121" "3" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870122" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870123" "11" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870124" "21" "70" "3" "129249766" "129249766" "subst" "1.21817E-5" "00000" "RHO_000279" "g.129249766G>A" "" "{PMID:Ayuso 1996:8682506}" "" "RHO codon: 137, sequence: GTG-ATG, protein: Val-Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530923G>A" "" "likely pathogenic (dominant)" "" "0000870125" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870126" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870127" "10" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870128" "11" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870129" "11" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870130" "11" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Reig 1996:8807346}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870131" "0" "70" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Sanchez 1996:8829640}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530922C>A" "" "likely pathogenic (dominant)" "" "0000870132" "0" "70" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Sanchez 1996:8829640}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530922C>A" "" "likely pathogenic (dominant)" "" "0000870133" "0" "70" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Sanchez 1996:8829640}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530922C>A" "" "likely pathogenic (dominant)" "" "0000870134" "0" "70" "3" "129249765" "129249765" "subst" "0" "00000" "RHO_000158" "g.129249765C>A" "" "{PMID:Sanchez 1996:8829640}" "" "RHO G-to-T substitution, consensus acceptor splice site intron 4 changed from AG to AT" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530922C>A" "" "likely pathogenic (dominant)" "" "0000870137" "0" "50" "3" "129252550" "129252550" "subst" "0" "00000" "RHO_000145" "g.129252550G>C" "" "{PMID:Borrego 1996:8829641}" "" "RHO A346P" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533707G>C" "" "VUS" "" "0000870138" "10" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000260" "g.129251210T>G" "" "{PMID:Haim 1996:9010870}" "" "RHO codon: 216, sequence: ATG-AGG, protein: Met-Arg" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129532367T>G" "" "likely pathogenic (dominant)" "" "0000870141" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870142" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870143" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870144" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870145" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870146" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870147" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870148" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870149" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870150" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Pannarale 1996:8841304}" "" "RHO codon: 135, sequence: CGG-TGG, protein: Arg-Trp" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870151" "0" "70" "3" "129247901" "129247901" "subst" "0" "00000" "RHO_000276" "g.129247901G>A" "" "{PMID:Goliath 1998:9452035}" "" "RHO G to A transition in codon 109, substitution of glycine with arginine" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129529058G>A" "" "likely pathogenic (dominant)" "" "0000870152" "10" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Milla 1998:9810568}" "" "RHO substitution of a guanine for an adenine, converting a cysteine (TGC) into a tyronine (TAC) at codon 110 (C110Y)" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870153" "11" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Milla 1998:9810568}" "" "RHO substitution of a guanine for an adenine, converting a cysteine (TGC) into a tyronine (TAC) at codon 110 (C110Y)" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870154" "11" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Milla 1998:9810568}" "" "RHO substitution of a guanine for an adenine, converting a cysteine (TGC) into a tyronine (TAC) at codon 110 (C110Y)" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870155" "21" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Milla 1998:9810568}" "" "RHO substitution of a guanine for an adenine, converting a cysteine (TGC) into a tyronine (TAC) at codon 110 (C110Y)" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129529062G>A" "" "likely pathogenic (dominant)" "" "0000870157" "0" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870158" "0" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870159" "0" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870160" "21" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870161" "21" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870162" "21" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Bessant 1998:10189219}" "" "RHO TAA to GAA transversion at nucleotide 5276 / codon 349, replacing the normal termination codon with a glutamic acid residue (Ter-349-Glu, or X349E) adding an additional 51 amino-acid residues to the carboxy terminus" "heterozygous; no nucleotide annotation, extrapolated from protein, sequence and databases" "Germline" "yes" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870167" "10" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.998^999ins4" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870168" "10" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.998^999ins4" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870169" "10" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.998^999ins4" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870170" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.316G>A, (G106R)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870171" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.316G>A, (G106R)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870172" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.316G>A, (G106R)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870173" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Bareil 1999:10521250}" "" "RHO c.403C>T, (R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870174" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Alvarez 1999:10668933}" "" "RHO Pro23Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000870175" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Alvarez 1999:10668933}" "" "RHO Pro23Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000870176" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Alvarez 1999:10668933}" "" "RHO Pro23Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000870177" "11" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Alvarez 1999:10668933}" "" "RHO Pro23Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>T" "" "likely pathogenic (dominant)" "" "0000870178" "0" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Martinez-Gimeno 2000:10874327}" "" "RHO P215L" "heterozygous; obsolete nucleotide annotation, new extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870179" "0" "70" "3" "129251544" "129251544" "subst" "0" "00000" "RHO_000188" "g.129251544A>C" "" "{PMID:Martinez-Gimeno 2000:10874327}" "" "RHO T289P" "heterozygous; obsolete nucleotide annotation, new extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532701A>C" "" "likely pathogenic (dominant)" "" "0000870180" "0" "70" "3" "129249717" "129249717" "subst" "0" "00000" "RHO_000278" "g.129249717A>G" "" "{PMID:Martinez-Gimeno 2000:10874327}" "" "RHO IVS2-2A>G" "heterozygous; obsolete nucleotide annotation, new extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530874A>G" "" "likely pathogenic (dominant)" "" "0000870197" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO ACG to ATG, Thr17Met" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000870198" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870199" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870200" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870201" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870202" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870203" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCC to CAC, Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870204" "0" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Dryja 2000:10967073}" "" "RHO TTT to CTT, Phe45Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000870205" "0" "70" "3" "129247727" "129247727" "subst" "0" "00000" "RHO_000129" "g.129247727G>C" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to CGC, Gly51Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528884G>C" "" "likely pathogenic (dominant)" "" "0000870206" "0" "70" "3" "129247842" "129247842" "subst" "0" "00000" "RHO_000090" "g.129247842G>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGT to GAT, Gly89Asp" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528999G>A" "" "likely pathogenic (dominant)" "" "0000870207" "20" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000277" "g.129247917G>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to GTC, Gly114Val" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529074G>T" "" "likely pathogenic (dominant)" "" "0000870208" "20" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000277" "g.129247917G>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to GTC, Gly114Val" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529074G>T" "" "likely pathogenic (dominant)" "" "0000870209" "20" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000277" "g.129247917G>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to GTC, Gly114Val" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529074G>T" "" "likely pathogenic (dominant)" "" "0000870210" "11" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000277" "g.129247917G>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to GTC, Gly114Val" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529074G>T" "" "likely pathogenic (dominant)" "" "0000870211" "21" "70" "3" "129247917" "129247917" "subst" "0" "00000" "RHO_000277" "g.129247917G>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO GGC to GTC, Gly114Val" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529074G>T" "" "likely pathogenic (dominant)" "" "0000870212" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO CGG to TGG, Arg135Trp" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870213" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCA to CTA, Pro171Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000870214" "0" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000095" "g.129251114A>C" "" "{PMID:Dryja 2000:10967073}" "" "RHO CAG to CCG, Gln184Pro" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic (dominant)" "" "0000870215" "21" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000095" "g.129251114A>C" "" "{PMID:Dryja 2000:10967073}" "" "RHO CAG to CCG, Gln184Pro" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic (dominant)" "" "0000870216" "21" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000095" "g.129251114A>C" "" "{PMID:Dryja 2000:10967073}" "" "RHO CAG to CCG, Gln184Pro" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic (dominant)" "" "0000870217" "0" "70" "3" "129251570" "129251570" "subst" "0" "00000" "RHO_000268" "g.129251570C>G" "" "{PMID:Dryja 2000:10967073}" "" "RHO AGC to AGA, Ser297Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532727C>G" "" "likely pathogenic (dominant)" "" "0000870218" "0" "70" "3" "129252553" "129252553" "subst" "0" "00000" "RHO_000123" "g.129252553C>A" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCG to ACG, Pro347Thr" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533710C>A" "" "likely pathogenic (dominant)" "" "0000870219" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCG to CTG, Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870220" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Dryja 2000:10967073}" "" "RHO CCG to CTG, Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870221" "0" "70" "3" "129251223" "129251223" "subst" "4.87781E-5" "00000" "RHO_000280" "g.129251223T>G" "" "{PMID:Dryja 2000:10967073}" "" "RHO TTT to TTG, Phe220Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases; non-causative, not present in affected brother and daughter" "Germline" "no" "" "0" "" "" "g.129532380T>G" "" "likely pathogenic (dominant)" "" "0000870222" "0" "70" "3" "129251223" "129251223" "subst" "4.87781E-5" "00000" "RHO_000280" "g.129251223T>G" "" "{PMID:Dryja 2000:10967073}" "" "RHO TTT to TTG, Phe220Leu" "variant from proband not present in relative" "Germline" "no" "" "0" "" "" "g.129532380T>G" "" "likely pathogenic (dominant)" "" "0000870223" "0" "70" "3" "129251223" "129251223" "subst" "4.87781E-5" "00000" "RHO_000280" "g.129251223T>G" "" "{PMID:Dryja 2000:10967073}" "" "RHO TTT to TTG, Phe220Leu" "variant from proband not present in relative" "Germline" "no" "" "0" "" "" "g.129532380T>G" "" "likely pathogenic (dominant)" "" "0000870230" "0" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870231" "21" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870232" "11" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870233" "11" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870234" "21" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870235" "11" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870236" "0" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Budu 2000:11094174}" "" "RHO codon: 106, sequence: GGG-AGG, protein: Gly-Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870237" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Budu 2000:11094174}" "" "RHO codon: 106, sequence: GGG-AGG, protein: Gly-Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870238" "11" "70" "3" "129247892" "129247892" "subst" "1.631E-5" "00000" "RHO_000048" "g.129247892G>A" "" "{PMID:Budu 2000:11094174}" "" "RHO codon: 106, sequence: GGG-AGG, protein: Gly-Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529049G>A" "" "likely pathogenic (dominant)" "" "0000870239" "0" "70" "3" "129252494" "129252494" "del" "0" "00000" "RHO_000283" "g.129252494del" "" "{PMID:Chan 2001:11520753}" "" "RHO 5211delC" "heterozygous; obsolete nucleotide annotation, extrapolated from databases" "Germline" "yes" "" "0" "" "" "g.129533651del" "" "likely pathogenic (dominant)" "" "0000870240" "21" "70" "3" "129252494" "129252494" "del" "0" "00000" "RHO_000283" "g.129252494del" "" "{PMID:Chan 2001:11520753}" "" "RHO 5211delC" "heterozygous; obsolete nucleotide annotation, extrapolated from databases" "Germline" "yes" "" "0" "" "" "g.129533651del" "" "likely pathogenic (dominant)" "" "0000870241" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "2/190 controls" "{PMID:Chan 2001:11520753}" "" "RHO codon: 299, sequence: GCC-TCC, protein: Ala-Ser" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870242" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Chan 2001:11520753}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870243" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Chan 2001:11520753}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870244" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Chan 2001:11520753}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870245" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Chan 2001:11520753}" "" "RHO codon: 347, sequence: CCG-CTG, protein: Pro-Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870246" "10" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870247" "10" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870248" "10" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870249" "20" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870250" "20" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870251" "11" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870252" "11" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870253" "11" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870254" "21" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870255" "11" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870256" "11" "70" "3" "129252535" "129252535" "subst" "0" "00000" "RHO_000285" "g.129252535G>T" "" "{PMID:Zhao 2001:11559857}" "" "RHO E341X" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533692G>T" "" "likely pathogenic (dominant)" "" "0000870260" "10" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dikshit 2001:11910130}" "" "RHO codon: 345, sequence: GTG-ATG, protein: Val-Met" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870261" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dikshit 2001:11910130}" "" "RHO codon: 345, sequence: GTG-ATG, protein: Val-Met" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870262" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dikshit 2001:11910130}" "" "RHO codon: 345, sequence: GTG-ATG, protein: Val-Met" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870263" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Dikshit 2001:11910130}" "" "RHO codon: 345, sequence: GTG-ATG, protein: Val-Met" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870264" "3" "70" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Greenberg 2003:14566652}" "" "RHO IVS4+1 G>T" "homozygous; obsolete nucleotide annotation, new extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (recessive)" "" "0000870267" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:To 2004:15126168}" "" "RHO Pro23His" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Unknown" "?" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870268" "0" "70" "3" "129247904" "129247904" "subst" "0" "00000" "RHO_000125" "g.129247904T>C" "" "{PMID:To 2004:15126168}" "" "RHO Cys110Arg" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Unknown" "?" "" "0" "" "" "g.129529061T>C" "" "likely pathogenic (dominant)" "" "0000870269" "0" "70" "3" "129251104" "129251104" "subst" "0" "00000" "RHO_000030" "g.129251104G>A" "" "{PMID:To 2004:15126168}" "" "RHO Glu181Lys" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Unknown" "?" "" "0" "" "" "g.129532261G>A" "" "likely pathogenic (dominant)" "" "0000870270" "10" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870271" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870272" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870273" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870274" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870275" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870276" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870277" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870278" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870279" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870280" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870281" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870282" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870283" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870284" "20" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870285" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870286" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870287" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870288" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870289" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870290" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870291" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870292" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870293" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Oh 2004:15548806}" "" "RHO Arg135Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870294" "0" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870295" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870296" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870297" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870298" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870299" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870300" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870301" "21" "70" "3" "129252544" "129252544" "subst" "0" "00000" "RHO_000062" "g.129252544C>T" "" "{PMID:Yong 2005:15726226}" "" "RHO 5261C>T; Q344X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533701C>T" "" "likely pathogenic (dominant)" "" "0000870532" "10" "70" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.527C>T, Ser176Phe" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531041C>T" "" "likely pathogenic (dominant)" "" "0000870533" "10" "70" "3" "129252456" "129252456" "dup" "0" "00000" "RHO_000282" "g.129252456dup" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.942insG, Arg314fs16" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533613dup" "" "likely pathogenic (dominant)" "" "0000870534" "11" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.644C>T, Pro215Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870535" "0" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.644C>T, Pro215Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870536" "10" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.644C>T, Pro215Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870537" "11" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.644C>T, Pro215Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870538" "21" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.644C>T, Pro215Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000870539" "11" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870540" "10" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870541" "11" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870542" "11" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870543" "11" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870544" "11" "70" "3" "129247635" "129247635" "subst" "0" "00000" "RHO_000273" "g.129247635T>G" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.59T>G, Val20Gly" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528792T>G" "" "likely pathogenic (dominant)" "" "0000870545" "10" "70" "3" "129251544" "129251544" "subst" "0" "00000" "RHO_000188" "g.129251544A>C" "" "{PMID:Schuster 2005:16170112}" "" "RHO c.865A>C, Thr289Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532701A>C" "" "likely pathogenic (dominant)" "" "0000870546" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Zhang 2006:16229860}" "" "RHO Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870547" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Zhang 2006:16229860}" "" "RHO Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870548" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Zhang 2006:16229860}" "" "RHO Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870549" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Zhang 2006:16229860}" "" "RHO Pro347Leu" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870550" "0" "70" "3" "129252494" "129252494" "del" "0" "00000" "RHO_000283" "g.129252494del" "" "{PMID:Zhang 2006:16229860}" "" "RHOPro327(1-bp del)" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533651del" "" "likely pathogenic (dominant)" "" "0000870551" "21" "70" "3" "129252494" "129252494" "del" "0" "00000" "RHO_000283" "g.129252494del" "" "{PMID:Zhang 2006:16229860}" "" "RHOPro327(1-bp del)" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533651del" "" "likely pathogenic (dominant)" "" "0000870552" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Iannaccone 2006:17014888}" "" "RHO R135L" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870553" "11" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000180" "g.129249761G>T" "" "{PMID:Iannaccone 2006:17014888}" "" "RHO R135L" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129530918G>T" "" "likely pathogenic (dominant)" "" "0000870554" "20" "70" "3" "129251101" "129251101" "subst" "0" "00000" "RHO_000114" "g.129251101C>G" "" "{PMID:Iannaccone 2006:17014888}" "" "RHO P180A" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532258C>G" "" "likely pathogenic (dominant)" "" "0000870555" "21" "70" "3" "129251101" "129251101" "subst" "0" "00000" "RHO_000114" "g.129251101C>G" "" "{PMID:Iannaccone 2006:17014888}" "" "RHO P180A" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532258C>G" "" "likely pathogenic (dominant)" "" "0000870556" "0" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870557" "21" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870558" "21" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870559" "10" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870560" "21" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870561" "21" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870562" "21" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870563" "11" "70" "3" "129252517" "129252517" "del" "0" "00000" "RHO_000099" "g.129252517del" "" "{PMID:Grondahl 2006:17488458}" "" "RHO 1003delG" "heterozygous; no protein annotation, extrapolated from nucleotide and databases" "Germline" "yes" "" "0" "" "" "g.129533674del" "" "likely pathogenic (dominant)" "" "0000870564" "20" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Grondahl 2006:17488458}" "" "RHO V345M" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870565" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Grondahl 2006:17488458}" "" "RHO V345M" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000870566" "10" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870567" "10" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870568" "20" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870569" "21" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870570" "21" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870571" "11" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870572" "11" "70" "3" "129251098" "129251098" "subst" "0" "00000" "RHO_000093" "g.129251098A>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO I179F" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532255A>T" "" "likely pathogenic (dominant)" "" "0000870573" "10" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO A164V" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic (dominant)" "" "0000870574" "10" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO A164V" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic (dominant)" "" "0000870575" "20" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO A164V" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic (dominant)" "" "0000870576" "20" "70" "3" "129249848" "129249848" "subst" "4.06273E-6" "00000" "RHO_000052" "g.129249848C>T" "" "{PMID:Grondahl 2006:17488458}" "" "RHO A164V" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129531005C>T" "" "likely pathogenic (dominant)" "" "0000870577" "0" "30" "3" "129247700" "129247700" "subst" "1.62433E-5" "00000" "RHO_000042" "g.129247700G>A" "" "{PMID:Ando 2007:17653048}" "" "RHO 124G/A Ala42Thr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528857G>A" "" "likely benign" "" "0000870578" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870579" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870580" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870581" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870582" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870583" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870584" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870585" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870586" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870587" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Aleman 2008:18385078}" "" "RHO P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870588" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Aleman 2008:18385078}" "" "RHO P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870589" "0" "70" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Aleman 2008:18385078}" "" "RHO P23H" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528801C>A" "" "likely pathogenic (dominant)" "" "0000870590" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000870591" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000870592" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000870593" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000870594" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000870595" "0" "70" "3" "129251615" "129251615" "subst" "0" "00000" "RHO_000281" "g.129251615G>A" "" "{PMID:Tanner 2009:18837008}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous; inactivation of CS in mutant minigenes led to a significant increase in exon 4 skipping" "Germline" "yes" "" "0" "" "" "g.129532772G>A" "" "likely pathogenic (dominant)" "" "0000870597" "0" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "1/78 tested Swiss families; 0/340 ethnically matching control alleles" "{PMID:Neidhardt 2006:16565402}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>T" "" "likely pathogenic (dominant)" "" "0000870598" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "1/78 tested Swiss families; 0/340 ethnically matching control alleles" "{PMID:Neidhardt 2006:16565402}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>T" "" "likely pathogenic (dominant)" "" "0000870599" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "1/78 tested Swiss families; 0/340 ethnically matching control alleles" "{PMID:Neidhardt 2006:16565402}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>T" "" "likely pathogenic (dominant)" "" "0000870600" "21" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "1/78 tested Swiss families; 0/340 ethnically matching control alleles" "{PMID:Neidhardt 2006:16565402}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>T" "" "likely pathogenic (dominant)" "" "0000870601" "21" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "1/78 tested Swiss families; 0/340 ethnically matching control alleles" "{PMID:Neidhardt 2006:16565402}" "" "RHO c.936G>A (p.Gln312Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529002G>T" "" "likely pathogenic (dominant)" "" "0000870602" "20" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Tsui 2008:19085385}" "" "RHO D190N" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000870603" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Tsui 2008:19085385}" "" "RHO D190N" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000870604" "11" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Tsui 2008:19085385}" "" "RHO D190N" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000870605" "0" "70" "3" "129247587" "129247587" "subst" "0" "00000" "RHO_000272" "g.129247587C>G" "" "{PMID:Krebs_2010:19913029}" "" "RHO T4R" "cell line data; no nucleotide annotation, extrapolated from protein and databases; mild misfolding; loss of <5% of the visible peak in 37deg; no change in rhodopsin levels when 11-cis retinal was present during opsin synthesis; rhodopsin yields were slightly lower than that for WT" "In vitro (cloned)" "?" "" "0" "" "" "g.129528744C>G" "" "likely pathogenic (dominant)" "" "0000870606" "0" "90" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Krebs_2010:19913029}" "" "RHO T17M" "cell line data; no nucleotide annotation, extrapolated from protein and databases; intermediate misfolding; unlike WT rhodopsin noshift from the dark state to MII (380 nm), increased absorbance at longer wavelengths; significant loss of of the visible peak in 37deg; rhodopsin levels were increased by 3.5-fold to 4.8-fold when 11-cis retinal was present during opsin synthesis; rhodopsin yields were much lower than that for WT suggesting that the expression or folding of these proteins is defective" "In vitro (cloned)" "?" "" "0" "" "" "g.129528783C>T" "" "pathogenic (dominant)" "" "0000870607" "0" "90" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Krebs_2010:19913029}" "" "RHO P23A" "cell line data; no nucleotide annotation, extrapolated from protein and databases; intermediate misfolding; unlike WT rhodopsin noshift from the dark state to MII (380 nm), increased absorbance at longer wavelengths; significant loss of of the visible peak in 37deg; rhodopsin levels were increased by 3.5-fold to 4.8-fold when 11-cis retinal was present during opsin synthesis; rhodopsin yields were much lower than that for WT suggesting that the expression or folding of these proteins is defective" "In vitro (cloned)" "?" "" "0" "" "" "g.129528800C>G" "" "pathogenic (dominant)" "" "0000870608" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000106" "g.129247644C>A" "" "{PMID:Krebs_2010:19913029}" "" "RHO P23H" "cell line data; no nucleotide annotation, extrapolated from protein and databases; more severely misfolded than P23A; unlike WT rhodopsin noshift from the dark state to MII (380 nm), increased absorbance at longer wavelengths; significant loss of of the visible peak in 37deg; rhodopsin levels were increased by 3.5-fold to 4.8-fold when 11-cis retinal was present during opsin synthesis; rhodopsin yields were much lower than that for WT suggesting that the expression or folding of these proteins is defective" "In vitro (cloned)" "?" "" "0" "" "" "g.129528801C>A" "" "pathogenic (dominant)" "" "0000870609" "0" "90" "3" "129247644" "129247644" "subst" "0" "00000" "RHO_000026" "g.129247644C>T" "" "{PMID:Krebs_2010:19913029}" "" "RHO P23L" "cell line data; no nucleotide annotation, extrapolated from protein and databases; most severely misfolded; unlike WT rhodopsin noshift from the dark state to MII (380 nm), increased absorbance at longer wavelengths; significant loss of of the visible peak in 37deg; rhodopsin levels were increased by 3.5-fold to 4.8-fold when 11-cis retinal was present during opsin synthesis; rhodopsin yields were much lower than that for WT suggesting that the expression or folding of these proteins is defective" "In vitro (cloned)" "?" "" "0" "" "" "g.129528801C>T" "" "pathogenic (dominant)" "" "0000870610" "0" "90" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000250" "g.129247905G>A" "" "{PMID:Krebs_2010:19913029}" "" "RHO C110Y" "cell line data; no nucleotide annotation, extrapolated from protein and databases; defective in binding 11-cis retinal; nonnative disulfide linkages, misfolded; unlike WT rhodopsin noshift from the dark state to MII (380 nm), increased absorbance at longer wavelengths; significant loss of of the visible peak in 37deg; no change in rhodopsin levels when 11-cis retinal was present during opsin synthesis; rhodopsin yields were much lower than that for WT suggesting that the expression or folding of these proteins is defective" "In vitro (cloned)" "?" "" "0" "" "" "g.129529062G>A" "" "pathogenic (dominant)" "" "0000870611" "0" "10" "3" "129251223" "129251223" "subst" "4.87781E-5" "00000" "RHO_000280" "g.129251223T>G" "" "{PMID:Krebs_2010:19913029}" "" "RHO F220L" "cell line data; no nucleotide annotation, extrapolated from protein and databases; least misfolded variant; like WT rhodopsin it showed a characteristic shift from the dark state to MII; loss of <5% of the visible peak in 37deg; no change in rhodopsin levels when 11-cis retinal was present during opsin synthesis; rhodopsin yields were similar to WT" "In vitro (cloned)" "?" "" "0" "" "" "g.129532380T>G" "" "benign" "" "0000870612" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Krebs_2010:19913029}" "" "RHO A299S" "cell line data; no nucleotide annotation, extrapolated from protein and databases; least misfolded variant; like WT rhodopsin it showed a characteristic shift from the dark state to MII; loss of <5% of the visible peak in 37deg; no change in rhodopsin levels when 11-cis retinal was present during opsin synthesis; rhodopsin yields were similar to WT" "In vitro (cloned)" "?" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870614" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870615" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870616" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870617" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870618" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870619" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Azam 2009:19960070}" "" "RHO c.448G>A, p.Glu150Lys" "homozygous" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000870621" "20" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Roberts 2008:20072635}" "" "RHO c.50C>T, Thr17Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000870622" "21" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Roberts 2008:20072635}" "" "RHO c.50C>T, Thr17Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000870714" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870715" "0" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870716" "11" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870717" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870718" "0" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870719" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870720" "11" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870721" "21" "70" "3" "129247620" "129247620" "subst" "0" "00000" "RHO_000007" "g.129247620A>G" "" "{PMID:Audo 2010:20164459}" "" "RHO c.44A>G, p.Asn15Ser" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528777A>G" "" "likely pathogenic (dominant)" "" "0000870722" "10" "70" "3" "129247839" "129247839" "subst" "0" "00000" "RHO_000045" "g.129247839T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.263T>C, p.Leu88Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528996T>C" "" "likely pathogenic (dominant)" "" "0000870723" "11" "70" "3" "129247839" "129247839" "subst" "0" "00000" "RHO_000045" "g.129247839T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.263T>C, p.Leu88Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528996T>C" "" "likely pathogenic (dominant)" "" "0000870724" "10" "70" "3" "129247839" "129247839" "subst" "0" "00000" "RHO_000045" "g.129247839T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.263T>C, p.Leu88Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528996T>C" "" "likely pathogenic (dominant)" "" "0000870725" "11" "70" "3" "129247839" "129247839" "subst" "0" "00000" "RHO_000045" "g.129247839T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.263T>C, p.Leu88Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528996T>C" "" "likely pathogenic (dominant)" "" "0000870726" "20" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870727" "20" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870728" "20" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870729" "21" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870730" "21" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870731" "20" "70" "3" "129249749" "129249749" "subst" "0" "00000" "RHO_000213" "g.129249749T>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.392T>C, p.Leu131Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530906T>C" "" "likely pathogenic (dominant)" "" "0000870732" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870733" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870734" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870735" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870736" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870737" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870738" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870739" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870740" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870741" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870742" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870743" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870744" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870745" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870746" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870747" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870748" "21" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870749" "21" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870750" "21" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870751" "0" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870752" "21" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870753" "21" "70" "3" "129251183" "129251183" "subst" "0" "00000" "RHO_000295" "g.129251183T>A" "" "{PMID:Audo 2010:20164459}" "" "RHO c.620T>A, p.Met207Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532340T>A" "" "likely pathogenic (dominant)" "" "0000870754" "11" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX21" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870755" "11" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX22" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870756" "20" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX23" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870757" "21" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX23" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870758" "21" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX23" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870759" "21" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX23" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870760" "20" "70" "3" "129252509" "129252512" "dup" "0" "00000" "RHO_000284" "g.129252509_129252512dup" "" "{PMID:Audo 2010:20164459}" "" "RHO c.995_998dup, p.Ser334GlyfsX24" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533666_129533669dup" "" "likely pathogenic (dominant)" "" "0000870761" "0" "70" "3" "129252545" "129252545" "subst" "0" "00000" "RHO_000170" "g.129252545A>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1031A>C, p.Gln344Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533702A>C" "" "likely pathogenic (dominant)" "" "0000870762" "21" "70" "3" "129252545" "129252545" "subst" "0" "00000" "RHO_000170" "g.129252545A>C" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1031A>C, p.Gln344Pro" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533702A>C" "" "likely pathogenic (dominant)" "" "0000870763" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870764" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870765" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870766" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870767" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870768" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870769" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870770" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870771" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870772" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870773" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870774" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870775" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870776" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870777" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870778" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870779" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870780" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870781" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870782" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870783" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870784" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870785" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Audo 2010:20164459}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870786" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870787" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870788" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870789" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870790" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870791" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870792" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870793" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870794" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870795" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870796" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870797" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870798" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Guo 2010:20555336}" "" "RHO c.1040C>T, p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870818" "0" "70" "3" "129249884" "129249884" "subst" "0" "00000" "RHO_000149" "g.129249884C>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.527C>T, p.Ser176Phe" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531041C>T" "" "likely pathogenic (dominant)" "" "0000870819" "0" "70" "3" "129251131" "129251131" "subst" "0" "00000" "RHO_000031" "g.129251131G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.568G>T, p.Asp190Tyr" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532288G>T" "" "likely pathogenic (dominant)" "" "0000870820" "0" "70" "3" "129251191" "129251191" "subst" "1.21908E-5" "00000" "RHO_000191" "g.129251191G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.628G>T, p.Val210Phe" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532348G>T" "" "likely pathogenic (dominant)" "" "0000870821" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Li 2010:20832389}" "" "RHO c.768_770delCAT, p.Ile256del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000870822" "0" "70" "3" "129252459" "129252459" "subst" "0" "00000" "RHO_000298" "g.129252459C>G" "" "{PMID:Li 2010:20832389}" "" "RHO c.945C>G, p.Asn315Lys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533616C>G" "" "likely pathogenic (dominant)" "" "0000870823" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870824" "0" "70" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Li 2010:20832389}" "" "RHO c.310G>A, p.Val104Ile" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529043G>A" "" "likely pathogenic (dominant)" "" "0000870825" "0" "70" "3" "129247886" "129247886" "subst" "0.000207702" "00000" "RHO_000047" "g.129247886G>A" "" "{PMID:Li 2010:20832389}" "" "RHO c.310G>A, p.Val104Ile" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529043G>A" "" "likely pathogenic (dominant)" "" "0000870826" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870827" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870828" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870829" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870830" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870831" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870832" "0" "30" "3" "129251574" "129251574" "subst" "0.000223343" "00000" "RHO_000199" "g.129251574G>T" "" "{PMID:Li 2010:20832389}" "" "RHO c.895G>T, p.Ala299Ser" "heterozygous" "Germline" "no" "" "0" "" "" "g.129532731G>T" "" "likely benign" "" "0000870840" "3" "70" "3" "129249839" "129249839" "subst" "4.06157E-6" "00000" "RHO_000014" "g.129249839G>A" "" "{PMID:Kartasasmita 2011:21174529}" "" "RHO c.482G>A, p.W161X" "homozygous; families 1 and 2 have common halotype and hence ancestry (founder effect)" "Germline" "yes" "" "0" "" "" "g.129530996G>A" "" "likely pathogenic (recessive)" "" "0000870841" "3" "70" "3" "129249839" "129249839" "subst" "4.06157E-6" "00000" "RHO_000014" "g.129249839G>A" "" "{PMID:Kartasasmita 2011:21174529}" "" "RHO c.482G>A, p.W161X" "homozygous; families 1 and 2 have common halotype and hence ancestry (founder effect)" "Germline" "yes" "" "0" "" "" "g.129530996G>A" "" "likely pathogenic (recessive)" "" "0000870842" "3" "70" "3" "129249839" "129249839" "subst" "4.06157E-6" "00000" "RHO_000014" "g.129249839G>A" "" "{PMID:Kartasasmita 2011:21174529}" "" "RHO c.482G>A, p.W161X" "homozygous; families 1 and 2 have common halotype and hence ancestry (founder effect)" "Germline" "yes" "" "0" "" "" "g.129530996G>A" "" "likely pathogenic (recessive)" "" "0000870843" "3" "70" "3" "129249839" "129249839" "subst" "4.06157E-6" "00000" "RHO_000014" "g.129249839G>A" "" "{PMID:Kartasasmita 2011:21174529}" "" "RHO c.482G>A, p.W161X" "homozygous; families 1 and 2 have common halotype and hence ancestry (founder effect)" "Germline" "yes" "" "0" "" "" "g.129530996G>A" "" "likely pathogenic (recessive)" "" "0000870844" "0" "70" "3" "129251092" "129251092" "subst" "0" "00000" "RHO_000183" "g.129251092A>G" "" "{PMID:Hernan 2011:21357407}" "" "RHO c.531-2A>G" "cell line analysis; mutation induces cryptic splicing, resulting in del 144 bp in mRNA (beginning of exon 3) and another transcript with insertion of 101 intronic bp in the beginning of exon 3); both create premature termination codon - mutant is eliminated, but not completely, so the mutated protein is still expressed" "In vitro (cloned)" "?" "" "0" "" "" "g.129532249A>G" "" "likely pathogenic (dominant)" "" "0000870845" "0" "70" "3" "129252450" "129252450" "subst" "0" "00000" "RHO_000161" "g.129252450G>T" "" "{PMID:Hernan 2011:21357407}" "" "RHO c.937-1G>T" "cell line analysis; mutation induces cryptic splicing, resulting in del 39 bp in mRNA (beginning of exon 5)" "In vitro (cloned)" "?" "" "0" "" "" "g.129533607G>T" "" "likely pathogenic (dominant)" "" "0000870846" "0" "70" "3" "129251424" "129251424" "subst" "2.43663E-5" "00000" "RHO_000229" "g.129251424G>T" "" "{PMID:Hernan 2011:21357407}" "" "RHO c.745G>T" "cell line analysis; premature termination codon resulting from skipping the entire exon 4, but mRNA not undergoing nonsense-mediated decay completely - mutant proteins detected in transfected cells, but in heterozygous patient was not enough to cause dominant negative effect" "In vitro (cloned)" "?" "" "0" "" "" "g.129532581G>T" "" "likely pathogenic (recessive)" "" "0000870847" "0" "70" "3" "129251616" "129251616" "subst" "1.21946E-5" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Hernan 2011:21357407}" "" "RHO c.936+1G>T" "cell line analysis; premature termination codon, but mRNA not undergoing nonsense-mediated decay completely - mutant proteins detected in transfected cells, but in heterozygous patient was not enough to cause dominant negative effect" "In vitro (cloned)" "?" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (recessive)" "" "0000870848" "10" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.50C>T, p.Thr17Met" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000870849" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Kim 2011:21677794}" "" "RHO c.533A>G, p.Tyr178Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000870850" "10" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Kim 2011:21677794}" "" "RHO c.533A>G, p.Tyr178Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000870851" "11" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Kim 2011:21677794}" "" "RHO c.533A>G, p.Tyr178Cys" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000870852" "0" "70" "3" "129251567" "129251567" "subst" "0" "00000" "RHO_000119" "g.129251567G>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.888G>T, p.Lys296Asn" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532724G>T" "" "likely pathogenic (dominant)" "" "0000870853" "0" "70" "3" "129251572" "129251572" "subst" "0" "00000" "RHO_000297" "g.129251572C>A" "" "{PMID:Kim 2011:21677794}" "" "RHO c.893C>A, p.Ala298Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532729C>A" "" "likely pathogenic (dominant)" "" "0000870854" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870855" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870856" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870857" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870858" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870859" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Kim 2011:21677794}" "" "RHO c.1040C>T, p.Pro347Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870862" "0" "90" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000275" "g.129247845G>T" "" "{PMID:Toledo 2011:21940625}" "" "RHO G90V" "cell line analysis; mutant is correctly trafficked to the PM; photobleaching behavior is altered, with formation of a distinguishable photointermediate upon illumination; thermal stability of the chromophore, in the dark, is dramatically decreased when compared with the G90D mutant and WT protein which suggests that this mutation disturbs the SB environment; able to bind 11-cis-retinal and to form functional pigments; activates transducin constitutively, but its pathogenicity is probably due to ability to sequester cellular components needed for the shut-off process, such as arrestin and low thermal stability" "In vitro (cloned)" "?" "" "0" "" "" "g.129529002G>T" "" "pathogenic (dominant)" "" "0000870863" "0" "90" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Toledo 2011:21940625}" "" "RHO G90D" "cell line analysis; mutant is correctly trafficked to the PM; able to bind 11-cis-retinal and to form functional pigments; activates transducin constitutively" "In vitro (cloned)" "?" "" "0" "" "" "g.129529002G>A" "" "pathogenic (dominant)" "" "0000870864" "0" "70" "3" "129251209" "129251209" "subst" "4.06464E-6" "00000" "RHO_000296" "g.129251209A>T" "" "{PMID:Nalbantoglu 2012:22321012}" "" "RHO c.646A > T, p.(Met216Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532366A>T" "" "likely pathogenic (dominant)" "" "0000870865" "0" "70" "3" "129251209" "129251209" "subst" "4.06464E-6" "00000" "RHO_000296" "g.129251209A>T" "" "{PMID:Nalbantoglu 2012:22321012}" "" "RHO c.646A > T, p.(Met216Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532366A>T" "" "likely pathogenic (dominant)" "" "0000870866" "10" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870867" "10" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870868" "20" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870869" "20" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870870" "20" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870871" "10" "70" "3" "129251179" "129251187" "del" "0" "00000" "RHO_000294" "g.129251179_129251187del" "" "{PMID:Maubaret 2012:22419850}" "" "RHO c.614-622del, (p.Y206-F208del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532336_129532344del" "" "likely pathogenic (dominant)" "" "0000870872" "0" "70" "3" "129247692" "129247692" "subst" "0" "00000" "RHO_000254" "g.129247692T>G" "" "{PMID:Davies_2012:22791210}" "" "RHO c.116T>G (p.M39R)" "heterozygous" "Germline" "?" "" "0" "" "" "g.129528849T>G" "" "likely pathogenic (dominant)" "" "0000870873" "11" "70" "3" "129247709" "129247709" "subst" "1.62422E-5" "00000" "RHO_000200" "g.129247709T>C" "" "{PMID:Davies_2012:22791210}" "" "RHO c.133T>C (p.F45L)" "heterozygous, inherited from an asymptomatic father" "Unknown" "?" "" "0" "" "" "g.129528866T>C" "" "likely pathogenic (dominant)" "" "0000870874" "0" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Davies_2012:22791210}" "" "RHO c.158C>G (p.P53R)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic (dominant)" "" "0000870875" "0" "70" "3" "129247782" "129247782" "subst" "1.62435E-5" "00000" "RHO_000172" "g.129247782G>A" "" "{PMID:Davies_2012:22791210}" "" "RHO c.206G>A (p.R69H)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528939G>A" "" "likely pathogenic (dominant)" "" "0000870876" "20" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870877" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870878" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870879" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870880" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870881" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870882" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870883" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870884" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870885" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870886" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870887" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870888" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870889" "10" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870890" "21" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870891" "11" "70" "3" "129249862" "129249862" "subst" "0" "00000" "RHO_000246" "g.129249862G>C" "" "{PMID:Pan 2012:23288993}" "" "RHO c.505G>C (p.A169P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531019G>C" "" "likely pathogenic (dominant)" "" "0000870908" "0" "70" "3" "129247809" "129247809" "subst" "0" "00000" "RHO_000044" "g.129247809A>T" "" "{PMID:Rivera-DelaParra 2013:23402891}" "" "RHO c.233A>T, p.N78I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528966A>T" "" "likely pathogenic (dominant)" "" "0000870909" "0" "70" "3" "129247809" "129247809" "subst" "0" "00000" "RHO_000044" "g.129247809A>T" "" "{PMID:Rivera-DelaParra 2013:23402891}" "" "RHO c.233A>T, p.N78I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528966A>T" "" "likely pathogenic (dominant)" "" "0000870910" "0" "70" "3" "129247809" "129247809" "subst" "0" "00000" "RHO_000044" "g.129247809A>T" "" "{PMID:Rivera-DelaParra 2013:23402891}" "" "RHO c.233A>T, p.N78I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528966A>T" "" "likely pathogenic (dominant)" "" "0000870911" "0" "70" "3" "129247809" "129247809" "subst" "0" "00000" "RHO_000044" "g.129247809A>T" "" "{PMID:Rivera-DelaParra 2013:23402891}" "" "RHO c.233A>T, p.N78I" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528966A>T" "" "likely pathogenic (dominant)" "" "0000870941" "0" "70" "3" "129252559" "129252559" "subst" "0" "00000" "RHO_000286" "g.129252559T>G" "" "{PMID:Hollingsworth 2013:23940033}" "" "RHO Ter349Glu" "cell line experiment; heterozygous; binds 11-cis-retinal and undergoes photoisomerization; some mislocalization or endoplasmic reticulum retention of the mutant protein; excluding the mechanisms of misfolding and faulty signaling; not able to enter the primary cilium; altered rod outer segment - loss of proper rod outer segment morphogenesis likely contributes to the severe human phenotype" "In vitro (cloned)" "?" "" "0" "" "" "g.129533716T>G" "" "likely pathogenic (dominant)" "" "0000870948" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "00000" "RHO_000066" "g.129247637C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.R21C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528794C>T" "" "likely pathogenic (dominant)" "" "0000870949" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "00000" "RHO_000066" "g.129247637C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.R21C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528794C>T" "" "likely pathogenic (dominant)" "" "0000870950" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "00000" "RHO_000066" "g.129247637C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.R21C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528794C>T" "" "likely pathogenic (dominant)" "" "0000870951" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "00000" "RHO_000066" "g.129247637C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.R21C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528794C>T" "" "likely pathogenic (dominant)" "" "0000870952" "0" "70" "3" "129247637" "129247637" "subst" "4.06088E-6" "00000" "RHO_000066" "g.129247637C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.R21C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528794C>T" "" "likely pathogenic (dominant)" "" "0000870953" "0" "70" "3" "129247851" "129247851" "subst" "0" "00000" "RHO_000288" "g.129247851C>T" "" "{PMID:Shah 2014:24918165}" "" "RHO p.T92I" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529008C>T" "" "likely pathogenic (dominant)" "" "0000870954" "0" "70" "3" "129247905" "129247905" "subst" "0" "00000" "RHO_000265" "g.129247905G>C" "" "{PMID:Yang 2014:25221422}" "" "RHO p.C110S" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529062G>C" "" "likely pathogenic (dominant)" "" "0000870955" "0" "70" "3" "129251108" "129251108" "subst" "0" "00000" "RHO_000185" "g.129251108G>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.G182V" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532265G>T" "" "likely pathogenic (dominant)" "" "0000870956" "0" "70" "3" "129251122" "129251122" "subst" "0" "00000" "RHO_000293" "g.129251122T>G" "" "{PMID:Shah 2014:24918165}" "" "RHO p.C187G" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532279T>G" "" "likely pathogenic (dominant)" "" "0000870957" "0" "70" "3" "129251122" "129251122" "subst" "0" "00000" "RHO_000293" "g.129251122T>G" "" "{PMID:Shah 2014:24918165}" "" "RHO p.C187G" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532279T>G" "" "likely pathogenic (dominant)" "" "0000870958" "0" "70" "3" "129249766" "129249783" "del" "0" "00000" "RHO_000291" "g.129249766_129249783del" "" "{PMID:Shah 2014:24918165}" "" "RHO c.409-426del" "heterozygous; no protein annotation" "Germline" "yes" "" "0" "" "" "g.129530923_129530940del" "" "likely pathogenic (dominant)" "" "0000870959" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Yang 2014:25221422}" "" "RHO p.Y178C" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000870960" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.P347L" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870961" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Yang 2014:25221422}" "" "RHO p.P347L" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000870963" "21" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000292" "g.129249866C>A" "" "{PMID:Shah 2014:24918165}" "" "RHO c.509C>A, p.Pro170His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531023C>A" "" "likely pathogenic (dominant)" "" "0000870964" "0" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000292" "g.129249866C>A" "" "{PMID:Shah 2014:24918165}" "" "RHO c.509C>A, p.Pro170His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531023C>A" "" "likely pathogenic (dominant)" "" "0000870965" "21" "70" "3" "129249866" "129249866" "subst" "0" "00000" "RHO_000292" "g.129249866C>A" "" "{PMID:Shah 2014:24918165}" "" "RHO c.509C>A, p.Pro170His" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531023C>A" "" "likely pathogenic (dominant)" "" "0000870968" "21" "70" "3" "129249734" "129249734" "subst" "0" "00000" "RHO_000290" "g.129249734G>T" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.377G>T (p.W126L)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530891G>T" "" "likely pathogenic (dominant)" "" "0000870969" "0" "70" "3" "129249734" "129249734" "subst" "0" "00000" "RHO_000290" "g.129249734G>T" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.377G>T (p.W126L)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530891G>T" "" "likely pathogenic (dominant)" "" "0000870970" "11" "70" "3" "129249734" "129249734" "subst" "0" "00000" "RHO_000290" "g.129249734G>T" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.377G>T (p.W126L)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530891G>T" "" "likely pathogenic (dominant)" "" "0000870971" "11" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.1036G>C (p.A346P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870972" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.1036G>C (p.A346P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870973" "21" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000036" "g.129252547G>C" "" "{PMID:Katagiri 2014:25485142}" "" "RHO c.1036G>C (p.A346P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533704G>C" "" "likely pathogenic (dominant)" "" "0000870974" "0" "70" "3" "129247749" "129247749" "subst" "7.7153E-5" "00000" "RHO_000239" "g.129247749C>T" "0/360 control individuals" "{PMID:Napier 2015:25265376}" "" "RHO c.173C>T (p.Thr58Met)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528906C>T" "" "likely pathogenic (dominant)" "" "0000870977" "10" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870978" "10" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870979" "21" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870980" "21" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870981" "21" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870982" "21" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870983" "21" "70" "3" "129252548" "129252548" "subst" "0" "00000" "RHO_000299" "g.129252548T>G" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.1034T>G, p.(Val345Gly)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533705T>G" "" "likely pathogenic (dominant)" "" "0000870984" "20" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870985" "21" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870986" "21" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870987" "10" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870988" "10" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870989" "21" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870990" "21" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870991" "11" "70" "3" "129251762" "129252589" "del" "0" "00000" "RHO_000204" "g.129251762_129252589del" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.936+147_*28del, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532919_129533746del" "" "likely pathogenic (dominant)" "" "0000870993" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.512C>T, p.(Pro171Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000870994" "0" "70" "3" "129251207" "129251207" "subst" "0" "00000" "RHO_000187" "g.129251207C>T" "" "{PMID:deSousa Dias 2015:26321861}" "" "RHO c.644C>T, p.(Pro215Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532364C>T" "" "likely pathogenic (dominant)" "" "0000871003" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871004" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871005" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871006" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871007" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871008" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871009" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871010" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871011" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Yu 2016:26794436}" "" "RHO c.403C> T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871021" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871022" "20" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.403C>T, p.Arg135Trp" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871023" "10" "70" "3" "129249868" "129249868" "subst" "4.06517E-6" "00000" "RHO_000092" "g.129249868C>T" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.511C>T, p.P171S" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129531025C>T" "" "likely pathogenic (dominant)" "" "0000871024" "10" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000260" "g.129251210T>G" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.647T>G, p.M216R" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129532367T>G" "" "likely pathogenic (dominant)" "" "0000871025" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000100" "g.129252554C>G" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.1040C>G, p.Pro347Arg" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129533711C>G" "" "likely pathogenic (dominant)" "" "0000871026" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.403C>T, p.R135W" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871027" "10" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000098" "g.129251479C>T" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.800C>T, p.P267L" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129532636C>T" "" "likely pathogenic (dominant)" "" "0000871028" "20" "70" "3" "129251123" "129251123" "subst" "0" "00000" "RHO_000096" "g.129251123G>A" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.560G>A, p.C187Y" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129532280G>A" "" "likely pathogenic (dominant)" "" "0000871029" "20" "70" "3" "129251111" "129251201" "dup" "0" "00000" "RHO_000094" "g.129251111_129251201dup" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.548-638dup91bp" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129532268_129532358dup" "" "likely pathogenic (dominant)" "" "0000871030" "20" "70" "3" "129251111" "129251201" "dup" "0" "00000" "RHO_000094" "g.129251111_129251201dup" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.548-638dup91bp" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129532268_129532358dup" "" "likely pathogenic (dominant)" "" "0000871031" "20" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Beryozkin 2016:26962691}" "" "RHO c.158C>G, p.Pro53Arg" "heterozygous" "Germline" "yes" "rs104893775" "0" "" "" "g.129528891C>G" "" "likely pathogenic (dominant)" "" "0000871036" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Van Schil 2016:26887858}" "" "RHO c.448G> A, p.(Glu150Lys)" "homozygous; additional homozygous specific haplotype of CRX-binding sites of SPATA7: rs201841157, rs58507718 and rs57060963 leading to an insertion, transversion and deletion event, respectively; significantly decreasing expression of SAMD7 and probably contributing to the phenotype" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000871037" "3" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Van Schil 2016:26887858}" "" "RHO c.448G> A, p.(Glu150Lys)" "homozygous; additional homozygous specific haplotype of CRX-binding sites of SPATA7: rs201841157, rs58507718 and rs57060963 leading to an insertion, transversion and deletion event, respectively; significantly decreasing expression of SAMD7 and probably contributing to the phenotype" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000871038" "0" "70" "3" "129249805" "129249805" "subst" "5.27876E-5" "00000" "RHO_000081" "g.129249805G>A" "" "{PMID:Van Schil 2016:26887858}" "" "RHO c.448G> A, p.(Glu150Lys)" "heterozygous; additional heterozygous specific haplotype of CRX-binding sites of SPATA7: rs201841157, rs58507718 and rs57060963 leading to an insertion, transversion and deletion event, respectively; significantly decreasing expression of SAMD7 and probably contributing to the phenotype" "Germline" "yes" "" "0" "" "" "g.129530962G>A" "" "likely pathogenic (dominant)" "" "0000871039" "11" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871040" "11" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871041" "10" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871042" "0" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871043" "21" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871044" "21" "70" "3" "129247913" "129247913" "subst" "0" "00000" "RHO_000289" "g.129247913G>A" "" "{PMID:Reiff 2016:27812022}" "" "RHO c.337G>A, p.E113K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529070G>A" "" "likely pathogenic (dominant)" "" "0000871054" "0" "70" "3" "129247668" "129247668" "subst" "0" "00000" "RHO_000287" "g.129247668T>A" "" "{PMID:Xiao 2019:30390055}" "" "RHO p.L31Q" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528825T>A" "" "likely pathogenic (dominant)" "" "0000871055" "0" "70" "3" "129247668" "129247668" "subst" "0" "00000" "RHO_000287" "g.129247668T>A" "" "{PMID:Xiao 2019:30390055}" "" "RHO p.L31Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528825T>A" "" "likely pathogenic (dominant)" "" "0000871056" "0" "70" "3" "129247668" "129247668" "subst" "0" "00000" "RHO_000287" "g.129247668T>A" "" "{PMID:Xiao 2019:30390055}" "" "RHO p.L31Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528825T>A" "" "likely pathogenic (dominant)" "" "0000871057" "0" "70" "3" "129247893" "129247893" "subst" "0" "00000" "RHO_000244" "g.129247893G>C" "" "{PMID:Xiao 2019:30390055}" "" "RHO p.G106A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129529050G>C" "" "likely pathogenic (dominant)" "" "0000871058" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Xiao 2019:30390055}" "" "RHO p.T17M" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000871060" "0" "70" "3" "129247621" "129247621" "subst" "0" "00000" "RHO_000300" "g.129247621T>G" "" "{PMID:Vilela 2018:30538586}" "" "RHO c.45T>G p.Asn15Lys" "heterozygous - parents not tested" "Unknown" "?" "" "0" "" "" "g.129528778T>G" "" "likely pathogenic (dominant)" "" "0000871061" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871062" "21" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871063" "20" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871064" "10" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871065" "11" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.1040C>T, p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871066" "10" "70" "3" "129247860" "129247860" "subst" "0" "00000" "RHO_000302" "g.129247860T>C" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.284T>C, p.L95P" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129529017T>C" "" "likely pathogenic (dominant)" "" "0000871067" "10" "70" "3" "129249887" "129249887" "subst" "0" "00000" "RHO_000303" "g.129249887G>A" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.530G>A, p.R177K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531044G>A" "" "likely pathogenic (dominant)" "" "0000871068" "20" "70" "3" "129251609" "129251609" "subst" "0" "00000" "RHO_000305" "g.129251609C>G" "" "{PMID:Roshandel 2019:30972525}" "" "RHO c.930C>G, p.N310K" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532766C>G" "" "likely pathogenic (dominant)" "" "0000871071" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871072" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871073" "10" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871074" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871075" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871076" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871077" "21" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871078" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871079" "11" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Wu 2019:31239368}" "" "RHO c.403C>T (p.R135W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871096" "20" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Wang_2019:31319082}" "" "RHO c.158C>G, p.(Pro53Arg)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic (dominant)" "" "0000871097" "0" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000095" "g.129251114A>C" "" "{PMID:Wang_2019:31319082}" "" "RHO c.551A>C, p.(Gln184Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic (dominant)" "" "0000871098" "11" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000095" "g.129251114A>C" "" "{PMID:Wang_2019:31319082}" "" "RHO c.551A>C, p.(Gln184Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532271A>C" "" "likely pathogenic (dominant)" "" "0000871099" "0" "70" "3" "129251114" "129251114" "subst" "0" "00000" "RHO_000304" "g.129251114A>G" "" "{PMID:Wang_2019:31319082}" "" "RHO c.551A>G, p.(Gln184Arg)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129532271A>G" "" "likely pathogenic (dominant)" "" "0000871100" "0" "70" "3" "129247612" "129247612" "del" "0" "00000" "RHO_000165" "g.129247612del" "" "{PMID:Wang_2019:31319082}" "" "RHO c.34delC, p.(Phe13Serfs*35)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.129528769del" "" "likely pathogenic (dominant)" "" "0000871101" "3" "70" "3" "129247658" "129247658" "subst" "0" "00000" "RHO_000301" "g.129247658C>T" "" "{PMID:Wang_2019:31319082}" "" "RHO c.82C>T, p.(Gln28*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.129528815C>T" "" "likely pathogenic (dominant)" "" "0000871102" "1" "70" "3" "129247658" "129247658" "subst" "0" "00000" "RHO_000301" "g.129247658C>T" "" "{PMID:Wang_2019:31319082}" "" "RHO c.82C>T, p.(Gln28*)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528815C>T" "" "likely pathogenic (dominant)" "" "0000871103" "1" "70" "3" "129247658" "129247658" "subst" "0" "00000" "RHO_000301" "g.129247658C>T" "" "{PMID:Wang_2019:31319082}" "" "RHO c.82C>T, p.(Gln28*)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528815C>T" "" "likely pathogenic (dominant)" "" "0000871104" "1" "70" "3" "129247658" "129247658" "subst" "0" "00000" "RHO_000301" "g.129247658C>T" "" "{PMID:Wang_2019:31319082}" "" "RHO c.82C>T, p.(Gln28*)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528815C>T" "" "likely pathogenic (dominant)" "" "0000871105" "1" "70" "3" "129247658" "129247658" "subst" "0" "00000" "RHO_000301" "g.129247658C>T" "" "{PMID:Wang_2019:31319082}" "" "RHO c.82C>T, p.(Gln28*)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528815C>T" "" "likely pathogenic (dominant)" "" "0000871169" "0" "70" "3" "129247626" "129247626" "subst" "0" "00000" "RHO_000040" "g.129247626C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.50C>T p.T17M" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129528783C>T" "" "likely pathogenic (dominant)" "" "0000871170" "0" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.158C>G p.P53R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic (dominant)" "" "0000871171" "0" "70" "3" "129247734" "129247734" "subst" "0" "00000" "RHO_000089" "g.129247734C>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.158C>G p.P53R" "heterozygous" "De novo" "yes" "" "0" "" "" "g.129528891C>G" "" "likely pathogenic (dominant)" "" "0000871172" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871173" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871174" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871175" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871176" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871177" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871178" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871179" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.403C>T p.R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000871180" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.512C>T p.P171L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000871181" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.512C>T p.P171L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000871182" "0" "70" "3" "129249869" "129249869" "subst" "0" "00000" "RHO_000126" "g.129249869C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.512C>T p.P171L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129531026C>T" "" "likely pathogenic (dominant)" "" "0000871183" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.533A>G p.Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000871184" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.533A>G p.Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000871185" "0" "70" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.533A>G p.Y178C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532253A>G" "" "likely pathogenic (dominant)" "" "0000871186" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871187" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871188" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871189" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871190" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871191" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871192" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871193" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871194" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871195" "0" "70" "3" "129251125" "129251125" "subst" "0" "00000" "RHO_000055" "g.129251125G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.562G>A p.G188R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532282G>A" "" "likely pathogenic (dominant)" "" "0000871196" "0" "70" "3" "129251131" "129251131" "subst" "4.06131E-6" "00000" "RHO_000056" "g.129251131G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.568G>A p.D190N" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129532288G>A" "" "likely pathogenic (dominant)" "" "0000871197" "0" "70" "3" "129251210" "129251210" "subst" "0" "00000" "RHO_000260" "g.129251210T>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.647T>G p.M216R" "heterozygous" "De novo" "yes" "" "0" "" "" "g.129532367T>G" "" "likely pathogenic (dominant)" "" "0000871198" "0" "70" "3" "129251447" "129251449" "del" "0" "00000" "RHO_000101" "g.129251447_129251449del" "" "{PMID:Luo 2020:33347869}" "" "RHO c.768_770del p.I256del" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129532604_129532606del" "" "likely pathogenic (dominant)" "" "0000871199" "0" "70" "3" "129251479" "129251479" "subst" "0" "00000" "RHO_000267" "g.129251479C>G" "" "{PMID:Luo 2020:33347869}" "" "RHO c.800C>G p.P267R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532636C>G" "" "likely pathogenic (dominant)" "" "0000871200" "0" "70" "3" "129252483" "129252483" "subst" "0" "00000" "RHO_000306" "g.129252483C>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.969C>A p.C323*" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129533640C>A" "" "likely pathogenic (dominant)" "" "0000871201" "0" "70" "3" "129252547" "129252547" "subst" "0" "00000" "RHO_000156" "g.129252547G>A" "" "{PMID:Luo 2020:33347869}" "" "RHO c.1033G>A p.V345M" "heterozygous" "Unknown" "yes" "" "0" "" "" "g.129533704G>A" "" "likely pathogenic (dominant)" "" "0000871202" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.1040C>T p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871203" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.1040C>T p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871204" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.1040C>T p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871205" "0" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "" "{PMID:Luo 2020:33347869}" "" "RHO c.1040C>T p.P347L" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic (dominant)" "" "0000871206" "0" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000243" "g.129249761G>C" "" "{PMID:Strubbe 2021:33420188}" "" "RHO c.404G >C p.(Arg135Pro)" "mosaic; probably de novo somatic/embryonic mutation; in different tissues showed a mutation load between 25.06% and 41.72%" "Unknown" "yes" "" "0" "" "" "g.129530918G>C" "" "likely pathogenic (dominant)" "ACMG" "0000871207" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000243" "g.129249761G>C" "" "{PMID:Strubbe 2021:33420188}" "" "RHO c.404G >C p.(Arg135Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>C" "" "likely pathogenic (dominant)" "ACMG" "0000871208" "21" "70" "3" "129249761" "129249761" "subst" "0" "00000" "RHO_000243" "g.129249761G>C" "" "{PMID:Strubbe 2021:33420188}" "" "RHO c.404G >C p.(Arg135Pro)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530918G>C" "" "likely pathogenic (dominant)" "ACMG" "0000871209" "20" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871210" "20" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871211" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871212" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871213" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871214" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871215" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871216" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871217" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871218" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871219" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871220" "10" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871221" "0" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871222" "21" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871223" "11" "70" "3" "129247845" "129247845" "subst" "0" "00000" "RHO_000064" "g.129247845G>A" "" "{PMID:Kobal 2021:33669941}" "" "RHO p.G90D" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129529002G>A" "" "likely pathogenic (dominant)" "" "0000871226" "10" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Ruppert 2020:33777460}" "" "RHO c.173 C>G, p.Thr58Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000871227" "21" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Ruppert 2020:33777460}" "" "RHO c.173 C>G, p.Thr58Arg" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000873475" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "126" "{PMID:Sun 2018:30076350}" "" "RHO (NM_000539.3):c.403C>T(p.R135W)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic" "" "0000876101" "0" "70" "3" "129247768" "129247768" "subst" "0" "00006" "RHO_000308" "g.129247768G>T" "" "{PMID:Zanoni 2021:33941880}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000885550" "0" "50" "3" "129247795" "129247795" "subst" "2.43637E-5" "02330" "RHO_000309" "g.129247795C>A" "" "" "" "RHO(NM_000539.3):c.219C>A (p.N73K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885551" "0" "50" "3" "129249785" "129249785" "subst" "1.21817E-5" "02327" "RHO_000310" "g.129249785T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885552" "0" "30" "3" "129249849" "129249849" "subst" "8.12592E-6" "02330" "RHO_000223" "g.129249849G>A" "" "" "" "RHO(NM_000539.3):c.492G>A (p.A164=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885553" "0" "70" "3" "129251101" "129251101" "subst" "0" "02330" "RHO_000002" "g.129251101C>T" "" "" "" "RHO(NM_000539.3):c.538C>T (p.P180S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000885554" "0" "30" "3" "129251570" "129251570" "subst" "0.000929904" "02330" "RHO_000022" "g.129251570C>T" "" "" "" "RHO(NM_000539.3):c.891C>T (p.S297=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896499" "1" "70" "3" "129251605" "129251605" "subst" "4.0622E-6" "00000" "RHO_000256" "g.129251605T>A" "Taiwan Biobank: 0; GnomAD_exome_East: 0.0000544; GnomAD_All: 0.00000398" "{PMID:Chen 2021:33608557}" "" "RHO c.[926T>A];[926=]; p.(Met309Lys)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532762T>A" "" "likely pathogenic" "" "0000896567" "1" "70" "3" "129252554" "129252554" "subst" "0" "00000" "RHO_000004" "g.129252554C>T" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0.0000319" "{PMID:Chen 2021:33608557}" "" "RHO c.[1040C>T];[1040=]; p.(Pro347Leu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129533711C>T" "" "likely pathogenic" "" "0000896737" "1" "70" "3" "129251191" "129251191" "subst" "1.21908E-5" "00000" "RHO_000191" "g.129251191G>T" "Taiwan Biobank: 0.000659; GnomAD_exome_East: 0.000163; GnomAD_All: 0.0000119" "{PMID:Chen 2021:33608557}" "" "RHO c.[628G>T];[628=]; p.(Val210Phe)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532348G>T" "" "likely pathogenic" "" "0000905959" "0" "90" "3" "129251096" "129251096" "subst" "0" "00000" "RHO_000171" "g.129251096A>G" "" "{PMID:Zhu 2022:35456422}" "" "RHO c.533A>G, p.(Tyr178Cys)" "heterozygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.129532253A>G" "" "pathogenic" "ACMG" "0000915785" "0" "70" "3" "129247860" "129247860" "subst" "0" "04436" "RHO_000302" "g.129247860T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.284T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915850" "0" "70" "3" "129251131" "129251131" "subst" "0" "04436" "RHO_000097" "g.129251131G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.568G>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915897" "0" "70" "3" "129247587" "129247587" "subst" "0" "04436" "RHO_000037" "g.129247587C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.11C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915905" "0" "90" "3" "129252554" "129252554" "subst" "0" "04436" "RHO_000004" "g.129252554C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915927" "0" "90" "3" "129247772" "129247772" "subst" "0" "04436" "RHO_000043" "g.129247772A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.196A>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915969" "0" "90" "3" "129251565" "129251565" "subst" "0" "04436" "RHO_000142" "g.129251565A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.886A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915999" "0" "90" "3" "129249760" "129249760" "subst" "0" "04436" "RHO_000001" "g.129249760C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.403C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916009" "0" "90" "3" "129247904" "129247904" "subst" "0" "04436" "RHO_000125" "g.129247904T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.328T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916012" "0" "90" "3" "129247904" "129247904" "subst" "0" "04436" "RHO_000125" "g.129247904T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.328T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916060" "0" "90" "3" "129247904" "129247904" "subst" "0" "04436" "RHO_000125" "g.129247904T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.328T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916107" "0" "90" "3" "129252542" "129252542" "subst" "0" "04436" "RHO_000035" "g.129252542G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1028G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916142" "3" "90" "3" "129251209" "129251209" "del" "8.13008E-6" "04436" "RHO_000311" "g.129251209del" "" "{PMID:Panneman 2023:36819107}" "" "c.646del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916284" "0" "90" "3" "129247620" "129247620" "subst" "0" "04436" "RHO_000007" "g.129247620A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.44A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916299" "3" "90" "3" "129249805" "129249805" "subst" "5.27876E-5" "04436" "RHO_000081" "g.129249805G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.448G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916310" "0" "90" "3" "129251126" "129251126" "subst" "4.06128E-6" "04436" "RHO_000140" "g.129251126G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.563G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916323" "0" "90" "3" "129252554" "129252554" "subst" "0" "04436" "RHO_000004" "g.129252554C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916339" "0" "90" "3" "129249760" "129249760" "subst" "0" "04436" "RHO_000001" "g.129249760C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.403C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916409" "0" "90" "3" "129251104" "129251104" "subst" "0" "04436" "RHO_000030" "g.129251104G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.541G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916458" "0" "90" "3" "129252553" "129252553" "subst" "0" "04436" "RHO_000210" "g.129252553C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1039C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916514" "0" "90" "3" "129252554" "129252554" "subst" "0" "04436" "RHO_000004" "g.129252554C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916523" "0" "90" "3" "129249760" "129249760" "subst" "0" "04436" "RHO_000001" "g.129249760C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.403C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916550" "0" "90" "3" "129251107" "129251107" "subst" "0" "04436" "RHO_000184" "g.129251107G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.544G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916666" "0" "90" "3" "129251424" "129251424" "subst" "2.43663E-5" "04436" "RHO_000229" "g.129251424G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.745G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916678" "0" "90" "3" "129247727" "129247727" "subst" "0" "04436" "RHO_000129" "g.129247727G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.151G>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916715" "0" "90" "3" "129251195" "129251195" "subst" "0" "04436" "RHO_000117" "g.129251195A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.632A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916752" "0" "90" "3" "129252554" "129252554" "subst" "0" "04436" "RHO_000004" "g.129252554C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1040C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916755" "0" "90" "3" "129247727" "129247727" "subst" "0" "04436" "RHO_000129" "g.129247727G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.151G>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916758" "0" "90" "3" "129251125" "129251125" "subst" "0" "04436" "RHO_000055" "g.129251125G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.562G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916767" "0" "90" "3" "129251478" "129251478" "subst" "0" "04436" "RHO_000312" "g.129251478C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.799C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000931568" "1" "90" "3" "129247793" "129247795" "del" "0" "00006" "RHO_000313" "g.129247793_129247795del" "" "{PMID:De Sousa Dias 2013:23559859}" "" "g.312_314delAAC" "" "Germline" "yes" "" "0" "" "" "g.129528950_129528952del" "" "pathogenic (dominant)" "" "0000948025" "0" "30" "3" "129249801" "129249801" "subst" "0.000186788" "02330" "RHO_000230" "g.129249801C>T" "" "" "" "RHO(NM_000539.3):c.444C>T (p.F148=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948026" "0" "30" "3" "129251121" "129251121" "subst" "0.000511762" "02330" "RHO_000116" "g.129251121G>A" "" "" "" "RHO(NM_000539.3):c.558G>A (p.S186=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948027" "0" "90" "3" "129251131" "129251131" "subst" "0" "02330" "RHO_000031" "g.129251131G>T" "" "" "" "RHO(NM_000539.3):c.568G>T (p.D190Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000954067" "0" "70" "3" "129247878" "129247878" "subst" "8.13974E-6" "00006" "RHO_000257" "g.129247878G>A" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.129529035G>A" "" "likely pathogenic" "" "0000958010" "0" "70" "3" "129251102" "129251102" "subst" "0" "00006" "RHO_000202" "g.129251102C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM5, PM1_STRONG, PP2" "Germline" "" "" "0" "" "" "g.129532259C>G" "" "likely pathogenic" "ACMG" "0000958011" "0" "90" "3" "129252554" "129252554" "subst" "0" "00006" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM5, PM1_STRONG, PP2, PP5, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.129533711C>T" "13014" "pathogenic" "ACMG" "0000958013" "0" "90" "3" "129247626" "129247626" "subst" "0" "00006" "RHO_000040" "g.129247626C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM5, PM1, PP2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.129528783C>T" "13018" "pathogenic" "ACMG" "0000958014" "0" "70" "3" "129249869" "129249869" "subst" "0" "00006" "RHO_000138" "g.129249869C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PS1_MODERATE, PM2, PM5, PM1, PP2" "Germline" "" "" "0" "" "" "g.129531026C>G" "" "likely pathogenic" "ACMG" "0000958015" "0" "90" "3" "129252546" "129252546" "subst" "8.12532E-6" "00006" "RHO_000078" "g.129252546G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM1_STRONG, PP2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.129533703G>C" "" "pathogenic" "ACMG" "0000958021" "0" "90" "3" "129247892" "129247892" "subst" "1.631E-5" "00006" "RHO_000048" "g.129247892G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PS1, PM2, PM5, PM1, PP2, PP5" "Germline" "" "" "0" "" "" "g.129529049G>A" "13038" "pathogenic" "ACMG" "0000958026" "0" "90" "3" "129252554" "129252554" "subst" "0" "00006" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM5, PM1_STRONG, PP2, PP5, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000958031" "0" "70" "3" "129247590" "129247590" "subst" "0" "00006" "RHO_000025" "g.129247590A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1, PP2" "Germline" "" "" "0" "" "" "g.129528747A>C" "" "likely pathogenic" "ACMG" "0000958053" "0" "90" "3" "129247845" "129247845" "subst" "0" "00006" "RHO_000064" "g.129247845G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1, PP2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.129529002G>A" "" "pathogenic" "ACMG" "0000958071" "0" "90" "3" "129252554" "129252554" "subst" "0" "00006" "RHO_000004" "g.129252554C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM5, PM1_STRONG, PP2, PP5, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.129533711C>T" "" "pathogenic" "ACMG" "0000958372" "0" "90" "3" "129252450" "129252450" "subst" "0" "00006" "RHO_000315" "g.129252450G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.129533607G>C" "" "pathogenic" "ACMG" "0000958894" "0" "50" "3" "129254016" "129254016" "subst" "0" "00006" "RHO_000316" "g.129254016T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.129535173T>C" "" "VUS" "ACMG" "0000958965" "0" "50" "3" "129251434" "129251434" "subst" "8.93452E-5" "00006" "RHO_000073" "g.129251434G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM1_SUPPORTING, PP2" "Germline/De novo (untested)" "" "" "0" "" "" "g.129532591G>C" "" "VUS" "ACMG" "0000959404" "0" "50" "3" "129251575" "129251575" "subst" "0" "00006" "RHO_000314" "g.129251575C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM1, PP2" "Germline" "" "" "0" "" "" "g.129532732C>A" "" "VUS" "ACMG" "0000962469" "0" "50" "3" "129247611" "129247611" "subst" "0" "02327" "RHO_000212" "g.129247611C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000962470" "0" "90" "3" "129247734" "129247734" "subst" "0" "02327" "RHO_000089" "g.129247734C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000962471" "0" "70" "3" "129247860" "129247860" "subst" "0" "02327" "RHO_000302" "g.129247860T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000962473" "0" "90" "3" "129249839" "129249839" "subst" "4.06157E-6" "02327" "RHO_000014" "g.129249839G>A" "" "" "" "RHO(NM_000539.3):c.482G>A (p.W161*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000962474" "0" "90" "3" "129249868" "129249868" "subst" "4.06517E-6" "02327" "RHO_000092" "g.129249868C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000962475" "0" "50" "3" "129251149" "129251149" "subst" "0" "02330" "RHO_000317" "g.129251149C>A" "" "" "" "RHO(NM_000539.3):c.586C>A (p.P196T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975566" "0" "50" "3" "129247650" "129247650" "subst" "0" "02327" "RHO_000318" "g.129247650A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975567" "0" "30" "3" "129249710" "129249710" "subst" "0" "01804" "RHO_000319" "g.129249710G>A" "" "" "" "RHO(NM_000539.3):c.362-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975568" "0" "50" "3" "129249775" "129249775" "subst" "0" "01804" "RHO_000320" "g.129249775T>G" "" "" "" "RHO(NM_000539.3):c.418T>G (p.(Cys140Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975569" "0" "50" "3" "129251434" "129251434" "subst" "8.93452E-5" "01804" "RHO_000073" "g.129251434G>C" "" "" "" "RHO(NM_000539.3):c.755G>C (p.(Arg252Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975570" "0" "30" "3" "129251598" "129251598" "subst" "0.000259926" "02330" "RHO_000321" "g.129251598A>T" "" "" "" "RHO(NM_000539.3):c.919A>T (p.I307F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993270" "0" "50" "3" "129249892" "129249892" "subst" "2.4487E-5" "01804" "RHO_000071" "g.129249892T>C" "" "" "" "RHO(NM_000539.3):c.530+5T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000993271" "0" "30" "3" "129249892" "129249892" "subst" "2.4487E-5" "02327" "RHO_000071" "g.129249892T>C" "" "" "" "RHO(NM_000539.3):c.530+5T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993272" "0" "50" "3" "129251438" "129251438" "subst" "2.84269E-5" "01804" "RHO_000021" "g.129251438G>T" "" "" "" "RHO(NM_000539.3):c.759G>T (p.M253I, p.(Met253Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013815" "0" "90" "3" "129249884" "129249884" "subst" "0" "02330" "RHO_000149" "g.129249884C>T" "" "" "" "RHO(NM_000539.3):c.527C>T (p.S176F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001022258" "1" "90" "3" "129247842" "129247842" "subst" "0" "00006" "RHO_000090" "g.129247842G>A" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs104893772" "0" "" "" "g.129528999G>A" "" "pathogenic" "" "0001022264" "1" "70" "3" "129252546" "129252546" "subst" "0" "00006" "RHO_000322" "g.129252546G>T" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "" "0" "" "" "g.129533703G>T" "" "likely pathogenic" "" "0001022268" "1" "70" "3" "129247839" "129247839" "subst" "0" "00006" "RHO_000045" "g.129247839T>C" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs1057521112" "0" "" "" "g.129528996T>C" "" "likely pathogenic" "" "0001022272" "1" "90" "3" "129251104" "129251104" "subst" "0" "00006" "RHO_000030" "g.129251104G>A" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs775557680" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0001022292" "1" "90" "3" "129247620" "129247620" "subst" "0" "00006" "RHO_000007" "g.129247620A>G" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs104893786" "0" "" "" "g.129528777A>G" "" "pathogenic" "" "0001022297" "1" "90" "3" "129251104" "129251104" "subst" "0" "00006" "RHO_000030" "g.129251104G>A" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs775557680" "0" "" "" "g.129532261G>A" "" "pathogenic" "" "0001022321" "1" "70" "3" "129251195" "129251195" "subst" "0" "00006" "RHO_000236" "g.129251195A>C" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs28933993" "0" "" "" "g.129532352A>C" "" "likely pathogenic" "" "0001033672" "0" "50" "3" "129249797" "129249797" "subst" "1.62429E-5" "01804" "RHO_000323" "g.129249797G>A" "" "" "" "RHO(NM_000539.3):c.440G>A (p.(Arg147His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064064" "0" "50" "3" "129251434" "129251434" "subst" "8.93452E-5" "02325" "RHO_000073" "g.129251434G>C" "" "" "" "RHO(NM_000539.3):c.755G>C (p.(Arg252Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes RHO ## Count = 2067 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000000101" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.(?)" "p.?" "4i" "0000000232" "00001707" "50" "754" "0" "754" "0" "c.754C>T" "r.(?)" "p.(Arg252Cys)" "4" "0000003895" "00001707" "50" "696" "4" "696" "4" "c.696+4C>T" "r.spl?" "p.(?)" "3i" "0000019478" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000060185" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000060186" "00001707" "70" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Pro180Ser)" "3" "0000060187" "00001707" "70" "641" "0" "641" "0" "c.641T>A" "r.(?)" "p.(Ile214Asn)" "3" "0000253767" "00001707" "10" "-26" "0" "-26" "0" "c.-26A>G" "r.(?)" "p.(=)" "" "0000254866" "00001707" "30" "981" "0" "981" "0" "c.981A>T" "r.(?)" "p.(Pro327=)" "" "0000255429" "00001707" "90" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000255557" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000255677" "00001707" "90" "937" "-2" "937" "-2" "c.937-2A>C" "r.spl?" "p.?" "" "0000294840" "00001707" "10" "152" "0" "152" "0" "c.152G>C" "r.(?)" "p.(Gly51Ala)" "" "0000294841" "00001707" "50" "241" "0" "241" "0" "c.241G>A" "r.(?)" "p.(Val81Met)" "" "0000294842" "00001707" "10" "360" "0" "360" "0" "c.360C>T" "r.(?)" "p.(Gly120=)" "" "0000294843" "00001707" "10" "516" "0" "516" "0" "c.516C>T" "r.(?)" "p.(Leu172=)" "" "0000294844" "00001707" "30" "51" "0" "51" "0" "c.51G>A" "r.(?)" "p.(Thr17=)" "" "0000294845" "00001707" "10" "530" "20" "530" "20" "c.530+20G>A" "r.(=)" "p.(=)" "" "0000294846" "00001707" "10" "567" "0" "567" "0" "c.567C>T" "r.(?)" "p.(Ile189=)" "" "0000307075" "00001707" "50" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000307076" "00001707" "90" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161Ter)" "" "0000307077" "00001707" "30" "519" "0" "519" "0" "c.519C>T" "r.(?)" "p.(Ala173=)" "" "0000307078" "00001707" "10" "696" "4" "696" "4" "c.696+4C>T" "r.spl?" "p.?" "" "0000307079" "00001707" "50" "696" "5" "696" "5" "c.696+5G>A" "r.spl?" "p.?" "" "0000307080" "00001707" "70" "759" "0" "759" "0" "c.759G>T" "r.(?)" "p.(Met253Ile)" "" "0000307081" "00001707" "90" "84" "0" "84" "0" "c.84G>T" "r.(?)" "p.(Gln28His)" "" "0000307082" "00001707" "30" "891" "0" "891" "0" "c.891C>T" "r.(?)" "p.(Ser297=)" "" "0000337120" "00001707" "10" "-26" "0" "-26" "0" "c.-26A>G" "r.(?)" "p.(=)" "" "0000340773" "00001707" "30" "360" "0" "360" "0" "c.360C>T" "r.(?)" "p.(Gly120=)" "" "0000341876" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000342610" "00001707" "50" "941" "0" "941" "0" "c.941G>A" "r.(?)" "p.(Arg314Gln)" "" "0000343976" "00001707" "90" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000343977" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000344736" "00001707" "90" "84" "0" "84" "0" "c.84G>T" "r.(?)" "p.(Gln28His)" "" "0000345197" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000345494" "00001707" "50" "14" "0" "14" "0" "c.14A>C" "r.(?)" "p.(Glu5Ala)" "" "0000347153" "00001707" "50" "119" "0" "119" "0" "c.119T>C" "r.(?)" "p.(Leu40Pro)" "" "0000347772" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000348239" "00001707" "70" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "" "0000348308" "00001707" "90" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000348953" "00001707" "50" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "" "0000350324" "00001707" "50" "469" "0" "469" "0" "c.469G>A" "r.(?)" "p.(Val157Ile)" "" "0000350877" "00001707" "70" "937" "-2" "937" "-2" "c.937-2A>C" "r.spl?" "p.?" "" "0000438568" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000476228" "00001707" "90" "11" "0" "11" "0" "c.11C>A" "r.(?)" "p.(Thr4Lys)" "" "0000476229" "00001707" "50" "33" "0" "33" "0" "c.33del" "r.(?)" "p.(Phe13Serfs*35)" "" "0000476230" "00001707" "50" "38" "0" "38" "0" "c.38T>C" "r.(?)" "p.(Phe13Ser)" "" "0000476231" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000476232" "00001707" "90" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000476233" "00001707" "50" "82" "0" "82" "0" "c.82C>G" "r.(?)" "p.(Gln28Glu)" "" "0000476234" "00001707" "50" "124" "0" "124" "0" "c.124G>A" "r.(?)" "p.(Ala42Thr)" "" "0000476235" "00001707" "90" "196" "0" "196" "0" "c.196A>T" "r.(?)" "p.(Lys66*)" "" "0000476236" "00001707" "90" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "" "0000476237" "00001707" "90" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0000476238" "00001707" "50" "296" "0" "296" "0" "c.296T>C" "r.(?)" "p.(Leu99Pro)" "" "0000476239" "00001707" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000476240" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000476241" "00001707" "50" "319" "0" "319" "0" "c.319C>T" "r.(?)" "p.(Pro107Ser)" "" "0000476242" "00001707" "90" "380" "0" "380" "0" "c.380C>T" "r.(?)" "p.(Ser127Phe)" "" "0000476243" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000476244" "00001707" "50" "404" "0" "404" "0" "c.404G>A" "r.(?)" "p.(Arg135Gln)" "" "0000476245" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000476246" "00001707" "50" "520" "0" "520" "0" "c.520G>A" "r.(?)" "p.(Gly174Ser)" "" "0000476247" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000476248" "00001707" "50" "560" "0" "560" "0" "c.560G>C" "r.(?)" "p.(Cys187Ser)" "" "0000476249" "00001707" "90" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000476250" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000476251" "00001707" "50" "578" "0" "578" "0" "c.578C>A" "r.(?)" "p.(Thr193Lys)" "" "0000476252" "00001707" "50" "578" "0" "578" "0" "c.578C>T" "r.(?)" "p.(Thr193Met)" "" "0000476253" "00001707" "10" "696" "4" "696" "4" "c.696+4C>T" "r.spl?" "p.?" "" "0000476254" "00001707" "50" "836" "0" "836" "0" "c.836A>C" "r.(?)" "p.(Gln279Pro)" "" "0000476255" "00001707" "50" "869" "0" "869" "0" "c.869T>A" "r.(?)" "p.(Ile290Asn)" "" "0000476256" "00001707" "50" "941" "0" "941" "0" "c.941G>A" "r.(?)" "p.(Arg314Gln)" "" "0000476257" "00001707" "90" "948" "0" "948" "0" "c.948C>A" "r.(?)" "p.(Cys316*)" "" "0000476258" "00001707" "90" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "" "0000476259" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000477464" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000477465" "00001707" "10" "696" "4" "696" "4" "c.696+4C>T" "r.spl?" "p.?" "" "0000500662" "00001707" "90" "875" "0" "875" "0" "c.875C>A" "r.(?)" "p.(Ala292Glu)" "4" "0000500663" "00001707" "90" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000500664" "00001707" "90" "281" "0" "281" "0" "c.281C>T" "r.(?)" "p.(Thr94Ile)" "1" "0000517829" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000517830" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000517831" "00001707" "90" "84" "0" "84" "0" "c.84G>T" "r.(?)" "p.(Gln28His)" "" "0000517832" "00001707" "90" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "" "0000517833" "00001707" "50" "203" "0" "203" "0" "c.203T>G" "r.(?)" "p.(Leu68Arg)" "" "0000517834" "00001707" "10" "361" "9" "361" "9" "c.361+9C>T" "r.(=)" "p.(=)" "" "0000517835" "00001707" "10" "480" "0" "480" "0" "c.480C>A" "r.(?)" "p.(Thr160=)" "" "0000517836" "00001707" "30" "480" "0" "480" "0" "c.480C>A" "r.(?)" "p.(Thr160=)" "" "0000517837" "00001707" "10" "530" "5" "530" "5" "c.530+5T>C" "r.spl?" "p.?" "" "0000517838" "00001707" "50" "530" "5" "530" "5" "c.530+5T>C" "r.spl?" "p.?" "" "0000517839" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000517840" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000517841" "00001707" "10" "696" "5" "696" "5" "c.696+5G>C" "r.spl?" "p.?" "" "0000517842" "00001707" "50" "696" "5" "696" "5" "c.696+5G>C" "r.spl?" "p.?" "" "0000517843" "00001707" "50" "696" "5" "696" "5" "c.696+5G>C" "r.spl?" "p.?" "" "0000517844" "00001707" "50" "755" "0" "755" "0" "c.755G>C" "r.(?)" "p.(Arg252Pro)" "" "0000517845" "00001707" "50" "759" "0" "759" "0" "c.759G>T" "r.(?)" "p.(Met253Ile)" "" "0000517847" "00001707" "30" "959" "0" "959" "0" "c.959C>A" "r.(?)" "p.(Thr320Asn)" "" "0000517848" "00001707" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "" "0000517849" "00001707" "10" "990" "0" "990" "0" "c.990C>T" "r.(?)" "p.(Asp330=)" "" "0000517850" "00001707" "50" "1032" "0" "1032" "0" "c.1032G>C" "r.(?)" "p.(Gln344His)" "" "0000517851" "00001707" "50" "1032" "0" "1032" "0" "c.1032G>C" "r.(?)" "p.(Gln344His)" "" "0000517852" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000621176" "00001707" "30" "969" "0" "969" "0" "c.969C>T" "r.(?)" "p.(Cys323=)" "" "0000624955" "00001707" "70" "560" "0" "560" "0" "c.560G>T" "r.(?)" "p.(Cys187Phe)" "" "0000651069" "00001707" "90" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000651070" "00001707" "30" "1360" "0" "1360" "0" "c.*313C>T" "r.(=)" "p.(=)" "" "0000654796" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000654797" "00001707" "50" "178" "0" "178" "0" "c.178T>C" "r.(?)" "p.(Tyr60His)" "" "0000654798" "00001707" "10" "381" "0" "381" "0" "c.381C>G" "r.(?)" "p.(Ser127=)" "" "0000664285" "00001707" "10" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000669741" "00001707" "30" "1360" "0" "1360" "0" "c.*313C>T" "r.(=)" "p.(=)" "" "0000676816" "00001707" "50" "16" "0" "16" "0" "c.16G>A" "r.(?)" "p.(Gly6Ser)" "" "0000676817" "00001707" "50" "937" "-6" "937" "-6" "c.937-6T>A" "r.(=)" "p.(=)" "" "0000676818" "00001707" "50" "941" "0" "941" "0" "c.941G>A" "r.(?)" "p.(Arg314Gln)" "" "0000676819" "00001707" "50" "983" "0" "983" "0" "c.983T>G" "r.(?)" "p.(Leu328Arg)" "" "0000684561" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000684562" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000684563" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000684564" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000684565" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000684566" "00001707" "70" "568" "0" "568" "0" "c.568G>C" "r.(?)" "p.(Asp190His)" "" "0000684567" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000684658" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000684659" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000685414" "00001707" "90" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Gly18Asp)" "" "0000685415" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000685416" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000685417" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000685418" "00001707" "70" "497" "0" "497" "0" "c.497C>T" "r.(?)" "p.(Ala166Val)" "" "0000685419" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000685420" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000685421" "00001707" "90" "548" "0" "638" "0" "c.548_638dup" "r.(?)" "p.(Ile214Alafs*147)" "" "0000685422" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000685423" "00001707" "70" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.?" "" "0000685424" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000688930" "00001707" "50" "578" "0" "578" "0" "c.578C>T" "r.(?)" "p.(Thr193Met)" "" "0000688931" "00001707" "70" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000688932" "00001707" "50" "913" "0" "913" "0" "c.913A>C" "r.(?)" "p.(Ile305Leu)" "" "0000688933" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>C" "r.(?)" "p.(Ter349GlnextTer51)" "" "0000703770" "00001707" "50" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000703789" "00001707" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000710253" "00001707" "90" "557" "0" "557" "0" "c.557C>G" "r.(?)" "p.(Ser186Trp)" "" "0000710297" "00001707" "90" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "" "0000711685" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711686" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000711687" "00001707" "70" "499" "0" "499" "0" "c.499T>C" "r.(?)" "p.(Cys167Arg)" "2" "0000711698" "00001707" "70" "959" "0" "959" "0" "c.959C>A" "r.(?)" "p.(Thr320Asn)" "5" "0000711708" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711709" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711710" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711711" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711712" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711713" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711714" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711715" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711716" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711717" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711718" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711719" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711720" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711721" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711722" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711723" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711724" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711725" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711726" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711727" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711728" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711729" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000711730" "00001707" "90" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "1" "0000711731" "00001707" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000711732" "00001707" "90" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "1" "0000711733" "00001707" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000711734" "00001707" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000711735" "00001707" "90" "329" "0" "329" "0" "c.329G>T" "r.(?)" "p.(Cys110Phe)" "1" "0000711736" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711737" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711738" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711739" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711740" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711741" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "2" "0000711742" "00001707" "90" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "2" "0000711743" "00001707" "90" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "2" "0000711744" "00001707" "90" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "2" "0000711745" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000711746" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000711747" "00001707" "90" "553" "0" "553" "0" "c.553T>C" "r.(?)" "p.(Cys185Arg)" "3" "0000711748" "00001707" "90" "553" "0" "553" "0" "c.553T>C" "r.(?)" "p.(Cys185Arg)" "3" "0000711749" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000711750" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "3" "0000711751" "00001707" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000711752" "00001707" "90" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "3" "0000711753" "00001707" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Ser270Arg)" "4" "0000711754" "00001707" "90" "888" "0" "888" "0" "c.888G>T" "r.(?)" "p.(Lys296Asn)" "4" "0000711755" "00001707" "90" "995" "0" "1011" "0" "c.995_1011del" "r.(?)" "p.(Glu332Valfs*16)" "5" "0000711756" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "5" "0000711757" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000711758" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000711759" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>A" "r.(?)" "p.(Pro347Thr)" "5" "0000711760" "00001707" "90" "538" "0" "538" "0" "c.538C>G" "r.(?)" "p.(Pro180Ala)" "3" "0000711761" "00001707" "90" "953" "0" "955" "0" "c.953_955del" "r.(?)" "p.(Leu318_Thr319delinsPro)" "5" "0000711762" "00001707" "90" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000711763" "00001707" "90" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000711764" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000711765" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000711804" "00001707" "30" "360" "0" "360" "0" "c.360C>T" "r.(=)" "p.(=)" "1" "0000711805" "00001707" "30" "480" "0" "480" "0" "c.480C>T" "r.(=)" "p.(=)" "2" "0000711806" "00001707" "30" "519" "0" "519" "0" "c.519C>T" "r.(=)" "p.(=)" "2" "0000711807" "00001707" "30" "558" "0" "558" "0" "c.558G>A" "r.(=)" "p.(=)" "3" "0000711808" "00001707" "30" "891" "0" "891" "0" "c.891C>T" "r.(=)" "p.(=)" "4" "0000713375" "00001707" "90" "83" "0" "83" "0" "c.83A>G" "r.(?)" "p.(Gln28Arg)" "" "0000713390" "00001707" "90" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "" "0000713426" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000713428" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000713504" "00001707" "90" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000713512" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000713637" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000713963" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000713997" "00001707" "50" "895" "0" "895" "0" "c.895G>A" "r.(?)" "p.(Ala299Thr)" "" "0000714051" "00001707" "70" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "" "0000719179" "00001707" "50" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Val271Met)" "" "0000719180" "00001707" "50" "937" "-6" "937" "-6" "c.937-6T>A" "r.(=)" "p.(=)" "" "0000719181" "00001707" "30" "969" "0" "969" "0" "c.969C>T" "r.(?)" "p.(Cys323=)" "" "0000729745" "00001707" "90" "1005" "0" "1005" "0" "c.1005del" "r.(?)" "p.(Thr336Profs*24)" "" "0000729746" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000731486" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000731540" "00001707" "90" "302" "0" "302" "0" "c.302G>T" "r.(?)" "p.(Gly101Val)" "" "0000731543" "00001707" "90" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Gly18Asp)" "" "0000731546" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000731552" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000731568" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000732440" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000732543" "00001707" "90" "574" "0" "574" "0" "c.574dup" "r.(?)" "p.(Tyr192Leufs*139)" "" "0000732563" "00001707" "50" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732564" "00001707" "50" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732565" "00001707" "90" "561" "0" "561" "0" "c.561T>G" "r.(?)" "p.(Cys187Trp)" "" "0000732566" "00001707" "50" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "" "0000732610" "00001707" "90" "574" "0" "574" "0" "c.574dup" "r.(?)" "p.(Tyr192Leufs*139)" "" "0000732622" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732624" "00001707" "90" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "" "0000732745" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732746" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732747" "00001707" "70" "934" "0" "934" "0" "c.934C>T" "r.(?)" "p.(Gln312*)" "" "0000732748" "00001707" "70" "934" "0" "934" "0" "c.934C>T" "r.(?)" "p.(Gln312*)" "" "0000732749" "00001707" "70" "1036" "0" "1036" "0" "c.1036G>C" "r.(?)" "p.(Ala346Pro)" "" "0000732750" "00001707" "70" "176" "0" "176" "0" "c.176T>A" "r.(?)" "p.(Leu59His)" "" "0000732751" "00001707" "70" "512" "0" "512" "0" "c.512C>G" "r.(?)" "p.(Pro171Arg)" "" "0000732803" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732804" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732805" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732806" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000732807" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000732808" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000732809" "00001707" "70" "260" "0" "260" "0" "c.260T>A" "r.(?)" "p.(Val87Asp)" "" "0000732828" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732829" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732830" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732831" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732832" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000732833" "00001707" "70" "497" "0" "497" "0" "c.497C>A" "r.(?)" "p.(Ala166Asp)" "" "0000732834" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000732835" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000732836" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000732837" "00001707" "70" "341" "0" "341" "0" "c.341G>A" "r.(?)" "p.(Gly114Asp)" "" "0000732838" "00001707" "70" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "" "0000732839" "00001707" "70" "8" "0" "8" "0" "c.8G>A" "r.(?)" "p.(Gly3Asp)" "" "0000732840" "00001707" "70" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "" "0000732841" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000733088" "00001707" "70" "497" "0" "497" "0" "c.497C>A" "r.(?)" "p.(Ala166Asp)" "" "0000733089" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000733153" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000733213" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000733214" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000733215" "00001707" "70" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "" "0000734353" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000735653" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000735823" "00001707" "70" "872" "0" "872" "0" "c.872C>G" "r.(?)" "p.(Pro291Arg)" "" "0000735924" "00001707" "70" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000735925" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000735926" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000736059" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000736060" "00001707" "90" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000736077" "00001707" "70" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000736113" "00001707" "70" "600" "0" "600" "0" "c.600C>G" "r.(?)" "p.(Asn200Lys)" "" "0000736154" "00001707" "70" "608" "0" "608" "0" "c.608T>C" "r.(?)" "p.(Phe203Ser)" "" "0000736211" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000736307" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000736308" "00001707" "70" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Gly89Arg)" "1" "0000736309" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000736310" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000736311" "00001707" "90" "532" "0" "532" "0" "c.532T>G" "r.(?)" "p.(Tyr178Asp)" "3" "0000736312" "00001707" "90" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000736313" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "4" "0000736314" "00001707" "50" "911" "0" "911" "0" "c.911T>A" "r.(?)" "p.(Val304Asp)" "4" "0000736315" "00001707" "90" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "5" "0000736316" "00001707" "90" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "5" "0000736317" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000736318" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000736446" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000736447" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000736448" "00001707" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "1" "0000736449" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000736450" "00001707" "90" "318" "0" "318" "0" "c.318G>A" "r.(=)" "p.(=)" "1" "0000736451" "00001707" "90" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "1" "0000736452" "00001707" "90" "329" "0" "329" "0" "c.329G>T" "r.(?)" "p.(Cys110Phe)" "1" "0000736453" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000736454" "00001707" "90" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "2" "0000736455" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "2" "0000736456" "00001707" "90" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "2" "0000736457" "00001707" "90" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "2" "0000736458" "00001707" "90" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "2" "0000736459" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000736460" "00001707" "90" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "3" "0000736461" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000736462" "00001707" "90" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "3" "0000736463" "00001707" "90" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "4" "0000736464" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>A" "r.spl?" "p.?" "4i" "0000736465" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000736466" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "5" "0000736467" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>A" "r.(?)" "p.(Pro347Thr)" "5" "0000736468" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000736469" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "1" "0000736470" "00001707" "70" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Ser270Arg)" "4" "0000736471" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>C" "r.(?)" "p.(*349Glnext*51)" "5" "0000736472" "00001707" "10" "209" "0" "209" "0" "c.209C>T" "r.(?)" "p.(Thr70Met)" "1" "0000736503" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "" "0000736504" "00001707" "50" "1045" "0" "1045" "0" "c.1045T>C" "r.(?)" "p.(Ter349GlnextTer51)" "" "0000736505" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000736506" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "" "0000736803" "00001707" "70" "154" "0" "154" "0" "c.154T>G" "r.(?)" "p.(Phe52Val)" "" "0000759595" "00001707" "90" "439" "0" "439" "0" "c.439C>T" "r.(?)" "p.(Arg147Cys)" "" "0000759596" "00001707" "90" "754" "0" "754" "0" "c.754dup" "r.(?)" "p.(Arg252Profs*79)" "" "0000759597" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000759666" "00001707" "90" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136Ter)" "" "0000759888" "00001707" "90" "170" "0" "170" "0" "c.170T>G" "r.(?)" "p.(Leu57Arg)" "" "0000759981" "00001707" "50" "659" "0" "659" "0" "c.659T>G" "r.(?)" "p.(Phe220Cys)" "" "0000760128" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000760259" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000760271" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000760284" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000760300" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000760322" "00001707" "70" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "" "0000760342" "00001707" "70" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000764169" "00001707" "70" "659" "0" "659" "0" "c.659T>G" "r.(?)" "p.(Phe220Cys)" "3" "0000764880" "00001707" "70" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Ala292Thr)" "" "0000764881" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000765485" "00001707" "70" "671" "0" "671" "0" "c.671G>A" "r.(?)" "p.(Gly224Glu)" "" "0000765508" "00001707" "90" "1031" "0" "1031" "0" "c.1031A>C" "r.(?)" "p.(Gln344Pro)" "5" "0000765509" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "1" "0000765510" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "1" "0000765511" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "1" "0000765512" "00001707" "90" "403" "0" "403" "0" "c.403C>G" "r.(?)" "p.(Arg135Gly)" "2" "0000765513" "00001707" "90" "403" "0" "403" "0" "c.403C>G" "r.(?)" "p.(Arg135Gly)" "2" "0000765514" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000765515" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000765516" "00001707" "90" "553" "0" "553" "0" "c.553T>C" "r.(?)" "p.(Cys185Arg)" "3" "0000765517" "00001707" "90" "553" "0" "553" "0" "c.553T>C" "r.(?)" "p.(Cys185Arg)" "3" "0000765524" "00001707" "70" "809" "0" "809" "0" "c.809G>T" "r.(?)" "p.(Ser270Ile)" "4" "0000765543" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000765570" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000765571" "00001707" "90" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000765636" "00001707" "70" "36" "0" "36" "0" "c.36del" "r.(?)" "p.(Phe13SerfsTer35)" "1" "0000765637" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000765638" "00001707" "70" "632" "0" "632" "0" "c.632A>T" "r.(?)" "p.(His211Leu)" "3" "0000783281" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000783284" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000783899" "00001707" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000784161" "00001707" "50" "206" "0" "206" "0" "c.206G>A" "r.(?)" "p.(Arg69His)" "" "0000784168" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000784169" "00001707" "90" "481" "0" "481" "0" "c.481T>C" "r.(?)" "p.(Trp161Arg)" "" "0000784170" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000784171" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000784172" "00001707" "90" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "" "0000784173" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Val345Leu)" "" "0000784174" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000784175" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000784176" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000784555" "00001707" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000785365" "00001707" "90" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000785397" "00001707" "90" "759" "0" "759" "0" "c.759G>T" "r.(?)" "p.(Met253Ile)" "" "0000785525" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000785579" "00001707" "50" "36" "0" "36" "0" "c.36del" "r.(?)" "p.(Phe13SerfsTer35)" "" "0000785587" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000785588" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000785589" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000785590" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000785591" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000785592" "00001707" "90" "937" "-2" "944" "0" "c.937-2_944del" "r.spl" "p.?" "" "0000786309" "00001707" "90" "1025" "0" "1025" "0" "c.1025C>T" "r.(?)" "p.(Thr342Met)" "" "0000786312" "00001707" "90" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "" "0000786439" "00001707" "90" "1021" "0" "1021" "0" "c.1021G>A" "r.(?)" "p.(Glu341Lys)" "" "0000786442" "00001707" "90" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "" "0000786447" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000786506" "00001707" "70" "545" "0" "545" "0" "c.545G>T" "r.(?)" "p.(Gly182Val)" "" "0000786511" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000786523" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000786524" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000786525" "00001707" "70" "84" "0" "84" "0" "c.84G>C" "r.(?)" "p.(Gln28His)" "1" "0000786526" "00001707" "90" "131" "0" "131" "0" "c.131T>C" "r.(?)" "p.(Met44Thr)" "1" "0000786527" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000786528" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000786529" "00001707" "70" "236" "0" "236" "0" "c.236T>C" "r.(?)" "p.(Leu79Pro)" "1" "0000786530" "00001707" "70" "290" "0" "290" "0" "c.290C>T" "r.(?)" "p.(Thr97Ile)" "1" "0000786531" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000786532" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000786533" "00001707" "70" "378" "0" "378" "0" "c.378G>A" "r.(?)" "p.(Trp126Ter)" "1" "0000786534" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000786535" "00001707" "90" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000786536" "00001707" "90" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000786537" "00001707" "70" "488" "0" "488" "0" "c.488T>C" "r.(?)" "p.(Met163Thr)" "2" "0000786538" "00001707" "90" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "3" "0000786539" "00001707" "90" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "2" "0000786540" "00001707" "70" "500" "0" "500" "0" "c.500G>A" "r.(?)" "p.(Cys167Tyr)" "2" "0000786541" "00001707" "70" "500" "0" "500" "0" "c.500G>A" "r.(?)" "p.(Cys167Tyr)" "2" "0000786542" "00001707" "90" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "2" "0000786543" "00001707" "90" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000786544" "00001707" "90" "531" "-2" "531" "-2" "c.531-2A>G" "r.spl" "p.?" "2i" "0000786545" "00001707" "90" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000786546" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000786547" "00001707" "90" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000786548" "00001707" "90" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000786549" "00001707" "70" "545" "0" "545" "0" "c.545G>T" "r.(?)" "p.(Gly182Val)" "3" "0000786550" "00001707" "90" "556" "0" "556" "0" "c.556T>C" "r.(?)" "p.(Ser186Pro)" "3" "0000786551" "00001707" "90" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "3" "0000786552" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000786553" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000786554" "00001707" "90" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "3" "0000786555" "00001707" "90" "865" "0" "865" "0" "c.865A>C" "r.(?)" "p.(Thr289Pro)" "4" "0000786556" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786557" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786558" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786559" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786560" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786561" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786562" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786563" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000786564" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000787637" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000787653" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000787655" "00001707" "70" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Val210Phe)" "" "0000787662" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000788088" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000788089" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000788090" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000788091" "00001707" "90" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000788109" "00001707" "90" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60Ter)" "" "0000788110" "00001707" "90" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60Ter)" "" "0000788111" "00001707" "90" "979" "0" "982" "0" "c.979_982del" "r.(?)" "p.(Pro327TrpfsTer32)" "" "0000788361" "00001707" "50" "937" "-2" "937" "-2" "c.937-2A>G" "r.spl" "p.?" "5" "0000788543" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000789681" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000789691" "00001707" "90" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "1" "0000789692" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000789698" "00001707" "55" "979" "0" "982" "0" "c.979_982del" "r.(?)" "p.(Pro327Trpfs*32)" "5" "0000789700" "00001707" "90" "520" "0" "520" "0" "c.520G>A" "r.(?)" "p.(Gly174Ser)" "2" "0000789848" "00001707" "70" "888" "0" "888" "0" "c.888G>C" "r.(?)" "p.(Lys296Asn)" "4" "0000790103" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790105" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790107" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790109" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790111" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790113" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790115" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790117" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000790129" "00001707" "10" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "1" "0000790130" "00001707" "10" "0" "0" "0" "0" "c.?" "r.(=)" "p.?" "1" "0000790131" "00001707" "10" "625" "0" "625" "0" "c.625G>A" "r.(?)" "p.(Val209Met)" "3" "0000790132" "00001707" "10" "891" "0" "891" "0" "c.891C>T" "r.(=)" "p.(=)" "4" "0000790133" "00001707" "10" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "4" "0000790155" "00001707" "50" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000790156" "00001707" "50" "281" "0" "281" "0" "c.281C>T" "r.(?)" "p.(Thr94Ile)" "1" "0000790157" "00001707" "50" "875" "0" "875" "0" "c.875C>A" "r.(?)" "p.(Ala292Glu)" "4" "0000790158" "00001707" "50" "884" "0" "884" "0" "c.884C>T" "r.(?)" "p.(Ala295Val)" "4" "0000790402" "00001707" "70" "697" "-11" "697" "-11" "c.697-11G>A" "r.spl?" "p.?" "" "0000790432" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "" "0000790439" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000790553" "00001707" "50" "913" "0" "913" "0" "c.913A>C" "r.(?)" "p.(Ile305Leu)" "" "0000790883" "00001707" "70" "365" "0" "365" "0" "c.365A>G" "r.(?)" "p.(Glu122Gly)" "2" "0000790884" "00001707" "70" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "1" "0000790885" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "1" "0000790886" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000790887" "00001707" "70" "557" "0" "557" "0" "c.557C>G" "r.(?)" "p.(Ser186Trp)" "3" "0000791175" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791201" "00001707" "70" "539" "0" "539" "0" "c.539C>G" "r.(?)" "p.(Pro180Arg)" "3" "0000791206" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000791207" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000791208" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000791209" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000791210" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000791468" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000791469" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000791470" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000791471" "00001707" "70" "84" "0" "84" "0" "c.84G>C" "r.(?)" "p.(Gln28His)" "1" "0000791472" "00001707" "70" "84" "0" "84" "0" "c.84G>C" "r.(?)" "p.(Gln28His)" "1" "0000791473" "00001707" "70" "131" "0" "131" "0" "c.131T>C" "r.(?)" "p.(Met44Thr)" "1" "0000791474" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000791475" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000791476" "00001707" "70" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60*)" "1" "0000791477" "00001707" "70" "236" "0" "236" "0" "c.236T>C" "r.(?)" "p.(Leu79Pro)" "1" "0000791478" "00001707" "70" "290" "0" "290" "0" "c.290C>T" "r.(?)" "p.(Thr97Ile)" "1" "0000791479" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000791480" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000791481" "00001707" "70" "378" "0" "378" "0" "c.378G>A" "r.(?)" "p.(Tyr126*)" "2" "0000791482" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000791483" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000791484" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791485" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791486" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791487" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791488" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000791489" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "2" "0000791490" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "2" "0000791491" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "2" "0000791492" "00001707" "70" "488" "0" "488" "0" "c.488T>C" "r.(?)" "p.(Met163Thr)" "2" "0000791493" "00001707" "70" "500" "0" "500" "0" "c.500G>A" "r.(?)" "p.(Cys167Tyr)" "2" "0000791494" "00001707" "70" "500" "0" "500" "0" "c.500G>A" "r.(?)" "p.(Cys167Tyr)" "2" "0000791495" "00001707" "70" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "2" "0000791496" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000791497" "00001707" "70" "531" "-2" "531" "-2" "c.531-2A>G" "r.spl" "p.(?)" "2i" "0000791498" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000791499" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000791500" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000791501" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000791502" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000791503" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000791504" "00001707" "70" "545" "0" "545" "0" "c.545G>T" "r.(?)" "p.(Gly182Val)" "3" "0000791505" "00001707" "70" "556" "0" "556" "0" "c.556T>C" "r.(?)" "p.(Ser186Pro)" "3" "0000791506" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "3" "0000791507" "00001707" "70" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000791508" "00001707" "70" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000791509" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "3" "0000791510" "00001707" "70" "865" "0" "865" "0" "c.865A>C" "r.(?)" "p.(Thr289Pro)" "4" "0000791511" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791512" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791513" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791514" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791515" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791516" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791517" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791518" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791519" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791520" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000791564" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.spl" "p.(?)" "_5_" "0000791923" "00001707" "10" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000791924" "00001707" "10" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "2" "0000793738" "00001707" "70" "759" "0" "759" "0" "c.759G>T" "r.(?)" "p.(Met253Ile)" "4" "0000793763" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000793802" "00001707" "70" "895" "0" "895" "0" "c.895G>A" "r.(?)" "p.(Ala299Thr)" "4" "0000793940" "00001707" "70" "84" "0" "84" "0" "c.84G>C" "r.(?)" "p.(Gln28His)" "" "0000793998" "00001707" "90" "316" "0" "316" "0" "c.316G>M" "r.(?)" "p.(Gly106Arg)" "1" "0000793999" "00001707" "90" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000794000" "00001707" "90" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "2" "0000794001" "00001707" "90" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000794002" "00001707" "90" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000794003" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000794004" "00001707" "90" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000794005" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "3" "0000794006" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000794089" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>A" "r.spl?" "p.?" "" "0000794265" "00001707" "30" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000794266" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000794367" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>C" "r.(?)" "p.(Val345Ala)" "5" "0000794368" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000794369" "00001707" "90" "36" "0" "36" "0" "c.36del" "r.(?)" "p.(Phe13Serfs*35)" "1" "0000794370" "00001707" "70" "851" "0" "851" "0" "c.851G>A" "r.(?)" "p.(Gly284Asp)" "4" "0000794371" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000794372" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000794903" "00001707" "90" "11" "0" "11" "0" "c.11C>A" "r.(?)" "p.(Thr4Lys)" "1" "0000794904" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000794905" "00001707" "90" "84" "0" "84" "0" "c.84G>T" "r.(?)" "p.(Gln28His)" "1" "0000794906" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000794907" "00001707" "90" "403" "0" "403" "0" "c.403C>G" "r.(?)" "p.(Arg135Gly)" "2" "0000794908" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000794909" "00001707" "90" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "3" "0000794910" "00001707" "90" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "3" "0000794911" "00001707" "90" "659" "0" "659" "0" "c.659T>G" "r.(?)" "p.(Phe220Cys)" "3" "0000794912" "00001707" "90" "664" "0" "664" "0" "c.664T>C" "r.(?)" "p.(Cys222Arg)" "3" "0000794913" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "4" "0000794914" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000794915" "00001707" "90" "341" "0" "343" "0" "c.341_343del" "r.(?)" "p.(Gly114_Phe115delinsVal)" "1" "0000794916" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000794917" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000794918" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "5" "0000794919" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "5" "0000794922" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000794923" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000794924" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000794933" "00001707" "50" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000794934" "00001707" "50" "888" "0" "888" "0" "c.888G>T" "r.(?)" "p.(Lys296Asn)" "4" "0000794935" "00001707" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000795926" "00001707" "90" "572" "0" "572" "0" "c.572A>G" "r.(?)" "p.(Tyr191Cys)" "3" "0000795928" "00001707" "50" "755" "0" "755" "0" "c.755G>C" "r.(?)" "p.(Arg252Pro)" "4" "0000795946" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "1" "0000796070" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000796705" "00001707" "90" "35" "0" "35" "0" "c.35C>G" "r.(?)" "p.(Pro12Arg)" "1" "0000796719" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000796757" "00001707" "70" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "1" "0000796780" "00001707" "90" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60*)" "1" "0000796831" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl?" "p.?" "4i" "0000796840" "00001707" "70" "998" "0" "998" "0" "c.998C>T" "r.(?)" "p.(Ala333Val)" "5" "0000796847" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000796870" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000796928" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000796929" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000796930" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000796931" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "1" "0000796932" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "1" "0000796933" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64*)" "1" "0000796934" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "2" "0000796935" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000796936" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000796937" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000796938" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000796939" "00001707" "70" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000796940" "00001707" "70" "647" "0" "647" "0" "c.647T>A" "r.(?)" "p.(Met216Lys)" "3" "0000796941" "00001707" "70" "982" "0" "982" "0" "c.982del" "r.(?)" "p.(Leu328Trpfs*32)" "5" "0000796942" "00001707" "70" "1021" "0" "1021" "0" "c.1021dup" "r.(?)" "p.(Glu341Glyfs*13)" "5" "0000796943" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>A" "r.(?)" "p.(Glu341Lys)" "5" "0000796944" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "5" "0000796945" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "5" "0000797005" "00001707" "10" "696" "4" "696" "4" "c.696+4C>T" "r.spl?" "p.?" "3i" "0000797112" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.(?)" "4i" "0000797113" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000797114" "00001707" "70" "44" "0" "44" "0" "c.44A>T" "r.(?)" "p.(Asn15Ile)" "1" "0000797115" "00001707" "90" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "5" "0000797775" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000797776" "00001707" "90" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000797777" "00001707" "70" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Gly89Arg)" "" "0000797778" "00001707" "70" "908" "0" "908" "0" "c.908C>G" "r.(?)" "p.(Pro303Arg)" "" "0000797779" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000797780" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000797781" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000797782" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000797783" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000797784" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000797785" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Val345Leu)" "" "0000797786" "00001707" "70" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Gly89Arg)" "" "0000797787" "00001707" "70" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Gly89Arg)" "" "0000797788" "00001707" "70" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Gly89Arg)" "" "0000797789" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000797790" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000797791" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000797792" "00001707" "70" "203" "0" "203" "0" "c.203T>G" "r.(?)" "p.(Leu68Arg)" "" "0000797793" "00001707" "70" "934" "0" "934" "0" "c.934C>T" "r.(?)" "p.(Gln312*)" "" "0000797794" "00001707" "90" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000797795" "00001707" "90" "810" "0" "810" "0" "c.810C>A" "r.(?)" "p.(Ser270Arg)" "" "0000798422" "00001707" "50" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "2" "0000798427" "00001707" "50" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "2" "0000798476" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000798478" "00001707" "90" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "1" "0000798479" "00001707" "10" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000798481" "00001707" "50" "152" "0" "152" "0" "c.152G>C" "r.(?)" "p.(Gly51Ala)" "1" "0000798483" "00001707" "70" "759" "0" "759" "0" "c.759G>C" "r.(?)" "p.(Met253Ile)" "4" "0000800967" "00001707" "30" "30" "0" "30" "0" "c.30C>T" "r.(?)" "p.(Tyr10=)" "" "0000800968" "00001707" "50" "332" "0" "332" "0" "c.332A>G" "r.(?)" "p.(Asn111Ser)" "" "0000800969" "00001707" "30" "492" "0" "492" "0" "c.492G>A" "r.(?)" "p.(Ala164=)" "" "0000800970" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000810855" "00001707" "30" "1090" "0" "1090" "0" "c.*43C>A" "r.(=)" "p.(=)" "5" "0000810856" "00001707" "30" "937" "-23" "937" "-23" "c.937-23G>A" "r.(=)" "p.(=)" "4i" "0000810860" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl?" "p.?" "4i" "0000810861" "00001707" "30" "1090" "0" "1090" "0" "c.*43C>A" "r.(=)" "p.(=)" "5" "0000810879" "00001707" "70" "84" "0" "84" "0" "c.84G>C" "r.(?)" "p.(Gln28His)" "1" "0000810881" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000810882" "00001707" "30" "1090" "0" "1090" "0" "c.*43C>A" "r.(=)" "p.(=)" "5" "0000810898" "00001707" "50" "961" "0" "961" "0" "c.961A>C" "r.(?)" "p.(Ile321Leu)" "5" "0000810917" "00001707" "70" "259" "0" "259" "0" "c.259G>C" "r.(?)" "p.(Val87Leu)" "1" "0000810925" "00001707" "70" "259" "0" "259" "0" "c.259G>C" "r.(?)" "p.(Val87Leu)" "" "0000810927" "00001707" "30" "361" "65" "361" "65" "c.361+65C>T" "r.(=)" "p.(=)" "1i" "0000811479" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000811480" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000811772" "00001707" "90" "745" "0" "745" "0" "c.745G>T" "r.(?)" "p.(Glu249*)" "" "0000811872" "00001707" "70" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000811929" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000812279" "00001707" "70" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136*)" "2" "0000812567" "00001707" "90" "33" "0" "33" "0" "c.33del" "r.(?)" "p.(Phe13Serfs*35)" "" "0000812639" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000813189" "00001707" "70" "891" "0" "891" "0" "c.891C>T" "r.(=)" "p.(=)" "4" "0000813190" "00001707" "70" "1025" "0" "1025" "0" "c.1025C>T" "r.(?)" "p.(Thr342Met)" "5" "0000813217" "00001707" "30" "444" "0" "444" "0" "c.444C>T" "r.(=)" "p.(=)" "2" "0000813218" "00001707" "30" "502" "0" "502" "0" "c.502G>A" "r.(?)" "p.(Ala168Thr)" "2" "0000813687" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000814775" "00001707" "90" "1045" "0" "1045" "0" "c.1045T>C" "r.(?)" "p.(*349Glnext*51)" "5" "0000814776" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000814964" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "3" "0000815062" "00001707" "90" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "1" "0000815277" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000815278" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000815554" "00001707" "50" "850" "0" "850" "0" "c.850G>T" "r.(?)" "p.(Gly284Cys)" "" "0000815559" "00001707" "50" "419" "0" "419" "0" "c.419G>C" "r.(?)" "p.(Cys140Ser)" "" "0000815933" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000815935" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>C" "r.(?)" "p.(*349Glnext*51)" "" "0000815940" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000815951" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000815975" "00001707" "70" "532" "0" "532" "0" "c.532T>C" "r.(?)" "p.(Tyr178His)" "" "0000816005" "00001707" "70" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Gly18Asp)" "" "0000816032" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000816061" "00001707" "70" "512" "0" "512" "0" "c.512C>G" "r.(?)" "p.(Pro171Arg)" "" "0000816072" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000816101" "00001707" "70" "538" "0" "538" "0" "c.538C>A" "r.(?)" "p.(Pro180Thr)" "" "0000816106" "00001707" "90" "499" "0" "499" "0" "c.499T>C" "r.(?)" "p.(Cys167Arg)" "" "0000816226" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000816681" "00001707" "70" "946" "0" "946" "0" "c.946del" "r.(?)" "p.(Cys316Alafs*44)" "" "0000816682" "00001707" "70" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "" "0000816683" "00001707" "70" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "" "0000816684" "00001707" "70" "937" "-27" "937" "-19" "c.937-27_937-19del" "r.(?)" "p.(?)" "" "0000816685" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000816687" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000816688" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000816689" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000816690" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000816691" "00001707" "70" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000816692" "00001707" "70" "1025" "0" "1025" "0" "c.1025C>T" "r.(?)" "p.(Thr342Met)" "" "0000816693" "00001707" "70" "632" "0" "632" "0" "c.632A>C" "r.(?)" "p.(His211Pro)" "" "0000816694" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000816695" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000816696" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000816697" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000816698" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000816699" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000816700" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000816701" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000816702" "00001707" "70" "83" "0" "83" "0" "c.83A>G" "r.(?)" "p.(Gln28Arg)" "" "0000817308" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000817309" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000817493" "00001707" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Q344*)" "" "0000819052" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000819312" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819313" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819314" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819395" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000819435" "00001707" "70" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000819471" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000819472" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000819473" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000819569" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000819570" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000819571" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000819572" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000819695" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819696" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819697" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000819801" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(?)" "" "0000819802" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(?)" "" "0000819852" "00001707" "70" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000819853" "00001707" "70" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000819983" "00001707" "70" "647" "0" "647" "0" "c.647T>A" "r.(?)" "p.(Met216Lys)" "" "0000820067" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000820068" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000820077" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000820084" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "" "0000820085" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "" "0000820101" "00001707" "70" "532" "0" "532" "0" "c.532T>G" "r.(?)" "p.(Tyr178Asp)" "" "0000820102" "00001707" "70" "532" "0" "532" "0" "c.532T>G" "r.(?)" "p.(Tyr178Asp)" "" "0000820120" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820121" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820122" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820126" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000820127" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000820131" "00001707" "70" "218" "0" "218" "0" "c.218A>G" "r.(?)" "p.(Asn73Ser)" "" "0000820170" "00001707" "70" "557" "0" "557" "0" "c.557C>G" "r.(?)" "p.(Ser186Trp)" "" "0000820171" "00001707" "70" "557" "0" "557" "0" "c.557C>G" "r.(?)" "p.(Ser186Trp)" "" "0000820195" "00001707" "70" "1032" "0" "1032" "0" "c.1032G>C" "r.(?)" "p.(Gln344His)" "" "0000820211" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000820237" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820238" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820262" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000820266" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820274" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "" "0000820276" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000820277" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000820278" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000820279" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000820281" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000820282" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000820284" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820285" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820289" "00001707" "70" "501" "0" "501" "0" "c.501C>G" "r.(?)" "p.(Cys167Trp)" "" "0000820290" "00001707" "70" "501" "0" "501" "0" "c.501C>G" "r.(?)" "p.(Cys167Trp)" "" "0000820294" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820295" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820302" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000820303" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820304" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820305" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820401" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000820421" "00001707" "70" "1025" "0" "1025" "0" "c.1025C>T" "r.(?)" "p.(Thr342Met)" "" "0000820482" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000820528" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000820543" "00001707" "70" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "" "0000820545" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "" "0000820579" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "" "0000820596" "00001707" "70" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "" "0000821013" "00001707" "70" "36" "0" "36" "0" "c.36del" "r.(?)" "p.(Phe13Serfs*35)" "" "0000821023" "00001707" "70" "173" "0" "173" "0" "c.173C>T" "r.(?)" "p.(Thr58Met)" "" "0000821353" "00001707" "70" "83" "0" "83" "0" "c.83A>G" "r.(?)" "p.(Gln28Arg)" "" "0000821354" "00001707" "70" "509" "0" "509" "0" "c.509C>G" "r.(?)" "p.(Pro170Arg)" "" "0000821355" "00001707" "70" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000821356" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000821357" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000821358" "00001707" "70" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000821359" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000822981" "00001707" "70" "70" "0" "70" "0" "c.70T>C" "r.(?)" "p.(Phe24Leu)" "" "0000823262" "00001707" "50" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000824333" "00001707" "90" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "2" "0000824335" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000824340" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000824341" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Val345Leu)" "5" "0000824344" "00001707" "90" "632" "0" "632" "0" "c.632A>T" "r.(?)" "p.(His211Leu)" "3" "0000824357" "00001707" "90" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "2" "0000824362" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Val345Leu)" "5" "0000824368" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000824369" "00001707" "90" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "3" "0000824370" "00001707" "90" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60*)" "1" "0000824374" "00001707" "90" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "1" "0000824379" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000824383" "00001707" "90" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60*)" "1" "0000824386" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000824389" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000824390" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000824398" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000824399" "00001707" "90" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64*)" "1" "0000824405" "00001707" "90" "317" "0" "317" "0" "c.317G>C" "r.(?)" "p.(Gly106Ala)" "1" "0000824406" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000824409" "00001707" "90" "557" "0" "557" "0" "c.557C>G" "r.(?)" "p.(Ser186Trp)" "3" "0000824410" "00001707" "90" "548" "0" "548" "0" "c.548T>G" "r.(?)" "p.(Leu183Arg)" "3" "0000824416" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "5" "0000824617" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824618" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824619" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824620" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824621" "00001707" "50" "548" "0" "548" "0" "c.548T>C" "r.(?)" "p.(Leu183Pro)" "" "0000824622" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824623" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824624" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824625" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824626" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000824650" "00001707" "50" "502" "0" "502" "0" "c.502G>C" "r.(?)" "p.(Ala168Pro)" "" "0000824678" "00001707" "50" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000824727" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000824932" "00001707" "50" "-26" "0" "-26" "0" "c.-26A>G" "r.(?)" "p.(?)" "" "0000824936" "00001707" "50" "-26" "0" "-26" "0" "c.-26A>G" "r.(?)" "p.(?)" "" "0000825665" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>C" "r.(?)" "p.(Val345Ala)" "5" "0000825806" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000825904" "00001707" "70" "152" "0" "152" "0" "c.152G>A" "r.(?)" "p.(Gly51Asp)" "1" "0000825913" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000825919" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "1" "0000825966" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000826115" "00001707" "70" "512" "0" "512" "0" "c.512C>G" "r.(?)" "p.(Pro171Arg)" "2" "0000826388" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000826395" "00001707" "70" "340" "0" "340" "0" "c.340G>C" "r.(?)" "p.(Gly114Arg)" "1" "0000826947" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000827155" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000827156" "00001707" "90" "1032" "0" "1032" "0" "c.1032G>C" "r.(?)" "p.(Gln344His)" "5" "0000827157" "00001707" "90" "907" "0" "911" "0" "c.907_911delinsGC" "r.(?)" "p.(Pro303_Val304delinsAla)" "4" "0000827158" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000827159" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000827160" "00001707" "90" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Pro180Ser)" "3" "0000827161" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000827162" "00001707" "90" "553" "0" "553" "0" "c.553T>C" "r.(?)" "p.(Cys185Arg)" "3" "0000827163" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000827164" "00001707" "90" "559" "0" "559" "0" "c.559T>A" "r.(?)" "p.(Cys187Ser)" "3" "0000827165" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000827166" "00001707" "90" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "1" "0000827167" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000827168" "00001707" "90" "545" "0" "545" "0" "c.545G>T" "r.(?)" "p.(Gly182Val)" "3" "0000827169" "00001707" "90" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "5" "0000827170" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000827171" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000828475" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000828903" "00001707" "70" "926" "0" "926" "0" "c.926T>A" "r.(?)" "p.(Met309Lys)" "" "0000828919" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000828936" "00001707" "70" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Val210Phe)" "" "0000829059" "00001707" "70" "165" "0" "165" "0" "c.165C>A" "r.(?)" "p.(Asn55Lys)" "" "0000829060" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.(?)" "" "0000829061" "00001707" "70" "116" "0" "116" "0" "c.116T>G" "r.(?)" "p.(Met39Arg)" "" "0000829062" "00001707" "70" "116" "0" "116" "0" "c.116T>G" "r.(?)" "p.(Met39Arg)" "" "0000829063" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000829064" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000829065" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000829066" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000829067" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000829068" "00001707" "70" "116" "0" "116" "0" "c.116T>G" "r.(?)" "p.(Met39Arg)" "" "0000829797" "00001707" "70" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "" "0000829837" "00001707" "90" "302" "0" "302" "0" "c.302G>A" "r.(?)" "p.(Gly101Glu)" "1" "0000829980" "00001707" "50" "539" "0" "539" "0" "c.539C>T" "r.(?)" "p.(Pro180Leu)" "3" "0000846882" "00001707" "70" "888" "0" "888" "0" "c.888G>C" "r.(?)" "p.(Lys296Asn)" "" "0000850130" "00001707" "30" "408" "0" "408" "0" "c.408C>T" "r.(?)" "p.(Tyr136=)" "" "0000850131" "00001707" "30" "519" "0" "519" "0" "c.519C>T" "r.(?)" "p.(Ala173=)" "" "0000850132" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000850133" "00001707" "30" "981" "0" "981" "0" "c.981A>T" "r.(?)" "p.(Pro327=)" "" "0000858797" "00001707" "70" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Met216Arg)" "" "0000869121" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869122" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869123" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869124" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869125" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869126" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869127" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869128" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869129" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869130" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "" "0000869131" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "" "0000869132" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "" "0000869133" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "" "0000869134" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "" "0000869135" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869136" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869137" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869138" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869139" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869140" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869141" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869142" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869143" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869144" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869145" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869146" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869147" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869148" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869149" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869150" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869151" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869152" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869153" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869154" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869155" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869156" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869157" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869158" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869159" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869160" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869161" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869162" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869163" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869164" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869165" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869166" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869167" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869168" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869169" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869170" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869171" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869172" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869173" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869174" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869175" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869176" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000869177" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000869178" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869179" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869180" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869181" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869182" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869183" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869184" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869185" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869186" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869187" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869188" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869189" "00001707" "70" "152" "0" "152" "0" "c.152G>T" "r.(?)" "p.(Gly51Val)" "" "0000869190" "00001707" "70" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "" "0000869191" "00001707" "70" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "" "0000869192" "00001707" "70" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "" "0000869193" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869194" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869195" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869196" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869197" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869198" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869199" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869200" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869201" "00001707" "70" "499" "0" "499" "0" "c.499T>C" "r.(?)" "p.(Cys167Arg)" "" "0000869202" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000869203" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000869204" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000869205" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000869206" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000869207" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000869208" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000869209" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000869210" "00001707" "70" "556" "0" "556" "0" "c.556T>C" "r.(?)" "p.(Ser186Pro)" "" "0000869211" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000869212" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000869213" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000869214" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000869215" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869216" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869217" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869218" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869219" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869220" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869221" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869222" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869223" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869224" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869225" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869226" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869227" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869228" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869229" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869230" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869231" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869232" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000869233" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869234" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869235" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869236" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869237" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869238" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869239" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869240" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869241" "00001707" "70" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000869242" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000869243" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869244" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869245" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869246" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869247" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869248" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000869251" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869252" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869253" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869254" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869255" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869256" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869257" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869258" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869259" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869260" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869261" "00001707" "90" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000869293" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869294" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869295" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869296" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869297" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869298" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869299" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869300" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869301" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869302" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869303" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000869304" "00001707" "90" "632" "0" "632" "0" "c.632A>C" "r.(?)" "p.(His211Pro)" "3" "0000869305" "00001707" "90" "632" "0" "632" "0" "c.632A>C" "r.(?)" "p.(His211Pro)" "3" "0000869306" "00001707" "90" "632" "0" "632" "0" "c.632A>C" "r.(?)" "p.(His211Pro)" "3" "0000869307" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869308" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869309" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869310" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869311" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869312" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869313" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869314" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869315" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869316" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869317" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869318" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869319" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "3" "0000869320" "00001707" "90" "204" "0" "215" "0" "c.204_215del" "r.(?)" "p.(Arg69_Leu72del)" "1" "0000869336" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869337" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869338" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869339" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869340" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869341" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869342" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869343" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869344" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869345" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869346" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869347" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869348" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869349" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869350" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869351" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869352" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869353" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869354" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869355" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869356" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869357" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000869358" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000869359" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000869360" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000869361" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000869362" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869363" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869364" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869365" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869366" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869367" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869368" "00001707" "70" "260" "0" "260" "0" "c.260T>A" "r.(?)" "p.(Val87Asp)" "" "0000869369" "00001707" "70" "260" "0" "260" "0" "c.260T>A" "r.(?)" "p.(Val87Asp)" "" "0000869370" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869371" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869372" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869373" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869374" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869375" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869376" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869377" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869378" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869379" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869380" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869381" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869382" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869383" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869384" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869385" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000869386" "00001707" "70" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "" "0000869387" "00001707" "70" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "" "0000869388" "00001707" "70" "316" "0" "316" "0" "c.316G>T" "r.(?)" "p.(Gly106Trp)" "" "0000869389" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869390" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869391" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869392" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869393" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869394" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869395" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869396" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869397" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869398" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869399" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869400" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869401" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869402" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869403" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869404" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869405" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869406" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869407" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869408" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869409" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869410" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869411" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869412" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869413" "00001707" "70" "404" "0" "405" "0" "c.404_405delinsTT" "r.(?)" "p.(Arg135Leu)" "" "0000869414" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869415" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869416" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869417" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869418" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869419" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869420" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869421" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869422" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869423" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869424" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869425" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869426" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869427" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869428" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869429" "00001707" "70" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asp190Gly)" "" "0000869430" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869431" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869432" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869433" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869434" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869435" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344Ter)" "" "0000869436" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869437" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869452" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869453" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869454" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869455" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869456" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869457" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869458" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "" "0000869459" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "" "0000869460" "00001707" "70" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "" "0000869461" "00001707" "70" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000869666" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869667" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869668" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869669" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000869670" "00001707" "90" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000869671" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869672" "00001707" "90" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000869673" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869674" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869675" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869676" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869677" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869678" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869679" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869680" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869681" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869682" "00001707" "90" "620" "0" "620" "0" "c.620T>G" "r.(?)" "p.(Met207Arg)" "" "0000869690" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000869691" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000869692" "00001707" "90" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000869693" "00001707" "90" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000869694" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869695" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869696" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869697" "00001707" "90" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000869701" "00001707" "70" "1019" "0" "1019" "0" "c.1019del" "r.(?)" "p.(Thr340Argfs*20)" "" "0000869702" "00001707" "70" "1019" "0" "1019" "0" "c.1019del" "r.(?)" "p.(Thr340Argfs*20)" "" "0000869703" "00001707" "70" "1019" "0" "1019" "0" "c.1019del" "r.(?)" "p.(Thr340Argfs*20)" "" "0000869704" "00001707" "70" "1021" "0" "1028" "0" "c.1021_1028del" "r.(?)" "p.(Glu341Profs*10)" "" "0000869705" "00001707" "70" "1021" "0" "1028" "0" "c.1021_1028del" "r.(?)" "p.(Glu341Profs*10)" "" "0000869710" "00001707" "70" "745" "0" "745" "0" "c.745G>T" "r.(?)" "p.(Glu249*)" "" "0000869723" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869724" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869725" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869726" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869727" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000869730" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869731" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869732" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869733" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869734" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000869735" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869736" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869737" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869738" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869739" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869740" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869741" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869742" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869743" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869744" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869745" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869746" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869747" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869748" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869749" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869750" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869751" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000869767" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000869768" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000869769" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000869812" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000869813" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000869814" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000869815" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000869816" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "1" "0000869817" "00001707" "70" "152" "0" "152" "0" "c.152G>C" "r.(?)" "p.(Gly51Ala)" "1" "0000869818" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869819" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869820" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869821" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869822" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869823" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869824" "00001707" "70" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Gln64Ter)" "1" "0000869825" "00001707" "30" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "1" "0000869826" "00001707" "30" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "1" "0000869827" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000869828" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000869829" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000869830" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000869831" "00001707" "70" "403" "0" "403" "0" "c.403C>G" "r.(?)" "p.(Arg135Gly)" "2" "0000869832" "00001707" "70" "403" "0" "403" "0" "c.403C>G" "r.(?)" "p.(Arg135Gly)" "2" "0000869833" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000869834" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000869835" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000869836" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000869837" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000869838" "00001707" "70" "419" "0" "419" "0" "c.419G>C" "r.(?)" "p.(Cys140Ser)" "2" "0000869839" "00001707" "70" "419" "0" "419" "0" "c.419G>C" "r.(?)" "p.(Cys140Ser)" "2" "0000869840" "00001707" "70" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000869841" "00001707" "70" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000869842" "00001707" "70" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000869843" "00001707" "70" "625" "0" "625" "0" "c.625G>A" "r.(?)" "p.(Val209Met)" "3" "0000869844" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "3" "0000869845" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "3" "0000869846" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000869847" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000869848" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000869849" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000869850" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "4i" "0000869851" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "4i" "0000869852" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "4i" "0000869853" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "4i" "0000869854" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869855" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869856" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869857" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869858" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869859" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869860" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869861" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869862" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869863" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869864" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869865" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869866" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869867" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000869869" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "" "0000869870" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "" "0000869871" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "" "0000869872" "00001707" "70" "137" "0" "137" "0" "c.137T>G" "r.(?)" "p.(Leu46Arg)" "" "0000869876" "00001707" "70" "1020" "0" "1061" "0" "c.1020_*14del" "r.(?)" "p.(Glu341_Ala348delins45)" "" "0000869877" "00001707" "70" "1020" "0" "1061" "0" "c.1020_*14del" "r.(?)" "p.(Glu341_Ala348delins45)" "" "0000869878" "00001707" "70" "1020" "0" "1061" "0" "c.1020_*14del" "r.(?)" "p.(Glu341_Ala348delins45)" "" "0000869879" "00001707" "70" "1020" "0" "1061" "0" "c.1020_*14del" "r.(?)" "p.(Glu341_Ala348delins45)" "" "0000869880" "00001707" "70" "1020" "0" "1061" "0" "c.1020_*14del" "r.(?)" "p.(Glu341_Ala348delins45)" "" "0000869891" "00001707" "70" "119" "0" "119" "0" "c.119T>G" "r.(?)" "p.(Leu40Arg)" "" "0000869892" "00001707" "70" "119" "0" "119" "0" "c.119T>G" "r.(?)" "p.(Leu40Arg)" "" "0000869893" "00001707" "70" "119" "0" "119" "0" "c.119T>G" "r.(?)" "p.(Leu40Arg)" "" "0000869894" "00001707" "70" "" "0" "" "0" "c?" "r.spl" "p.?" "" "0000869895" "00001707" "70" "" "0" "" "0" "c?" "r.spl" "p.?" "" "0000869896" "00001707" "70" "" "0" "" "0" "c?" "r.spl" "p.?" "" "0000869899" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>A" "r.spl" "p.?" "" "0000869900" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>A" "r.spl" "p.?" "" "0000869901" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>A" "r.spl" "p.?" "" "0000869902" "00001707" "50" "1068" "0" "1068" "0" "c.*21G>A" "r.spl" "p.?" "" "0000869903" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869904" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000869905" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000869906" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869907" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869908" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869909" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869910" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869911" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869912" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869913" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869914" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869915" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869916" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000869917" "00001707" "70" "937" "-23" "943" "0" "c.937-23_943delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "r.spl?" "p.?" "" "0000869918" "00001707" "70" "937" "-23" "943" "0" "c.937-23_943delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "r.spl?" "p.?" "" "0000869919" "00001707" "70" "937" "-23" "943" "0" "c.937-23_943delinsACATATTACATTATAAGAAAAAAAAAAGGTAGAGGAAGGGAGGAAGGGAAGGGGAGGGAGGAAGTGGAGATGTGGAGACGCGAGAGGAAGAGAGAGAGGCAGAGGGAGAGGGAAAGGTGGGGAGAGAGGAGGGGGCAGAGAGAGAGGTGG" "r.spl?" "p.?" "" "0000869920" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000869921" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000869922" "00001707" "70" "329" "0" "329" "0" "c.329G>C" "r.(?)" "p.(Cys110Phe)" "" "0000869923" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000869924" "00001707" "70" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "" "0000869925" "00001707" "70" "380" "0" "380" "0" "c.380C>T" "r.(?)" "p.(Ser127Phe)" "" "0000869926" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000869927" "00001707" "70" "532" "0" "532" "0" "c.532T>A" "r.(?)" "p.(Tyr178Asn)" "" "0000869928" "00001707" "70" "800" "0" "800" "0" "c.800C>G" "r.(?)" "p.(Pro267Arg)" "" "0000869929" "00001707" "70" "891" "0" "891" "0" "c.891C>G" "r.(?)" "p.(Ser297Arg)" "" "0000869930" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000869931" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000869932" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000869933" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000869994" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000869995" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000869996" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000869997" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000869998" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000869999" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870000" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870001" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870002" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870003" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870005" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870006" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870007" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870008" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Val345Leu)" "" "0000870009" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "" "0000870010" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "" "0000870011" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "" "0000870012" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "" "0000870013" "00001707" "70" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000870014" "00001707" "70" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000870015" "00001707" "70" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000870016" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870017" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870018" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870019" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870020" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870021" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870022" "00001707" "70" "341" "0" "341" "0" "c.341G>A" "r.(?)" "p.(Gly114Asp)" "" "0000870023" "00001707" "70" "341" "0" "341" "0" "c.341G>A" "r.(?)" "p.(Gly114Asp)" "" "0000870024" "00001707" "70" "341" "0" "341" "0" "c.341G>A" "r.(?)" "p.(Gly114Asp)" "" "0000870025" "00001707" "70" "491" "0" "491" "0" "c.491C>A" "r.(?)" "p.(Ala164Glu)" "" "0000870026" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000870027" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000870028" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000870029" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000870030" "00001707" "70" "792" "0" "794" "0" "c.792_794del" "r.(?)" "p.(Cys264del)" "" "0000870031" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000870032" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000870033" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000870034" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000870036" "00001707" "70" "119" "0" "119" "0" "c.119T>G" "r.(?)" "p.(Leu40Arg)" "" "0000870037" "00001707" "70" "647" "0" "647" "0" "c.647T>A" "r.(?)" "p.(Met216Lys)" "" "0000870042" "00001707" "50" "131" "0" "131" "0" "c.131T>C" "r.(?)" "p.(Met44Thr)" "" "0000870045" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "2" "0000870046" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "2" "0000870047" "00001707" "70" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "2" "0000870048" "00001707" "30" "480" "0" "480" "0" "c.480C>A" "r.(?)" "p.(Thr160=)" "3" "0000870049" "00001707" "30" "480" "0" "480" "0" "c.480C>A" "r.(?)" "p.(Thr160=)" "3" "0000870050" "00001707" "30" "480" "0" "480" "0" "c.480C>A" "r.(?)" "p.(Thr160=)" "3" "0000870051" "00001707" "30" "696" "4" "696" "4" "c.696+4C>T" "r.(?)" "p.?" "3i" "0000870057" "00001707" "30" "936" "1" "936" "1" "c.936+1G>T" "r.(?)" "p.?" "4i" "0000870058" "00001707" "30" "936" "1" "936" "1" "c.936+1G>T" "r.(?)" "p.?" "4i" "0000870059" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000870060" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000870061" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000870062" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000870063" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>G" "r.(?)" "p.(Pro347Ala)" "" "0000870068" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870069" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870070" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870071" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870072" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870073" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870074" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870075" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870076" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870077" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870078" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870079" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870080" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000870094" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870095" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870096" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870097" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870098" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870099" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870100" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870101" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870102" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870103" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870104" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870105" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "1" "0000870106" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870107" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870108" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870109" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870110" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870111" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870112" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870113" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870114" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870115" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870116" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870117" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870118" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870119" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870120" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870121" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870122" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870123" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870124" "00001707" "70" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "2" "0000870125" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870126" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870127" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870128" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870129" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870130" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "4i" "0000870131" "00001707" "70" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136*)" "2" "0000870132" "00001707" "70" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136*)" "2" "0000870133" "00001707" "70" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136*)" "2" "0000870134" "00001707" "70" "408" "0" "408" "0" "c.408C>A" "r.(?)" "p.(Tyr136*)" "2" "0000870137" "00001707" "50" "1036" "0" "1036" "0" "c.1036G>C" "r.(?)" "p.(Ala346Pro)" "5" "0000870138" "00001707" "70" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Met216Arg)" "" "0000870141" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870142" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870143" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870144" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870145" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870146" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870147" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870148" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870149" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870150" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000870151" "00001707" "70" "325" "0" "325" "0" "c.325G>A" "r.(?)" "p.(Gly109Arg)" "1" "0000870152" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "1" "0000870153" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "1" "0000870154" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "1" "0000870155" "00001707" "70" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "1" "0000870157" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870158" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870159" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870160" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870161" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870162" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "5" "0000870167" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334Glyfs*21)" "" "0000870168" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334Glyfs*21)" "" "0000870169" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334Glyfs*21)" "" "0000870170" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000870171" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000870172" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000870173" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870174" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000870175" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000870176" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000870177" "00001707" "70" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000870178" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "3" "0000870179" "00001707" "70" "865" "0" "865" "0" "c.865A>C" "r.(?)" "p.(Thr289Pro)" "4" "0000870180" "00001707" "70" "362" "-2" "362" "-2" "c.362-2A>G" "r.(?)" "p.?" "1i" "0000870197" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000870198" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870199" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870200" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870201" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870202" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870203" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870204" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000870205" "00001707" "70" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "" "0000870206" "00001707" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0000870207" "00001707" "70" "341" "0" "341" "0" "c.341G>T" "r.(?)" "p.(Gly114Val)" "" "0000870208" "00001707" "70" "341" "0" "341" "0" "c.341G>T" "r.(?)" "p.(Gly114Val)" "" "0000870209" "00001707" "70" "341" "0" "341" "0" "c.341G>T" "r.(?)" "p.(Gly114Val)" "" "0000870210" "00001707" "70" "341" "0" "341" "0" "c.341G>T" "r.(?)" "p.(Gly114Val)" "" "0000870211" "00001707" "70" "341" "0" "341" "0" "c.341G>T" "r.(?)" "p.(Gly114Val)" "" "0000870212" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870213" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000870214" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000870215" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000870216" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000870217" "00001707" "70" "891" "0" "891" "0" "c.891C>G" "r.(?)" "p.(Ser297Arg)" "" "0000870218" "00001707" "70" "1039" "0" "1039" "0" "c.1039C>A" "r.(?)" "p.(Pro347Thr)" "" "0000870219" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870220" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870221" "00001707" "70" "660" "0" "660" "0" "c.660T>G" "r.(?)" "p.(Phe220Leu)" "" "0000870222" "00001707" "70" "660" "0" "660" "0" "c.660T>G" "r.(?)" "p.(Phe220Leu)" "" "0000870223" "00001707" "70" "660" "0" "660" "0" "c.660T>G" "r.(?)" "p.(Phe220Leu)" "" "0000870230" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870231" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870232" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870233" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870234" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870235" "00001707" "70" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870236" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000870237" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000870238" "00001707" "70" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "1" "0000870239" "00001707" "70" "980" "0" "980" "0" "c.980del" "r.(?)" "p.(Pro327Hisfs*33)" "5" "0000870240" "00001707" "70" "980" "0" "980" "0" "c.980del" "r.(?)" "p.(Pro327Hisfs*33)" "5" "0000870241" "00001707" "30" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "4" "0000870242" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000870243" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000870244" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000870245" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000870246" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870247" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870248" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870249" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870250" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870251" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870252" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870253" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870254" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870255" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870256" "00001707" "70" "1021" "0" "1021" "0" "c.1021G>T" "r.(?)" "p.(Glu341*)" "5" "0000870260" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000870261" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000870262" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000870263" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "5" "0000870264" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl?" "p.?" "" "0000870267" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870268" "00001707" "70" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "" "0000870269" "00001707" "70" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0000870270" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870271" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870272" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870273" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870274" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870275" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870276" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870277" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870278" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870279" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870280" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870281" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870282" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870283" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870284" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870285" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870286" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870287" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870288" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870289" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870290" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870291" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870292" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870293" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "2" "0000870294" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870295" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870296" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870297" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870298" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870299" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870300" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870301" "00001707" "70" "1030" "0" "1030" "0" "c.1030C>T" "r.(?)" "p.(Gln344*)" "5" "0000870532" "00001707" "70" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000870533" "00001707" "70" "942" "0" "942" "0" "c.942dup" "r.(?)" "p.(Asn315Glufs*16)" "" "0000870534" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000870535" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000870536" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000870537" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000870538" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000870539" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870540" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870541" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870542" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870543" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870544" "00001707" "70" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000870545" "00001707" "70" "865" "0" "865" "0" "c.865A>C" "r.(?)" "p.(Thr289Pro)" "" "0000870546" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870547" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870548" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870549" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870550" "00001707" "70" "980" "0" "980" "0" "c.980del" "r.(spl)" "p.(Pro327Hisfs*33)" "" "0000870551" "00001707" "70" "980" "0" "980" "0" "c.980del" "r.(spl)" "p.(Pro327Hisfs*33)" "" "0000870552" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000870553" "00001707" "70" "404" "0" "404" "0" "c.404G>T" "r.(?)" "p.(Arg135Leu)" "" "0000870554" "00001707" "70" "538" "0" "538" "0" "c.538C>G" "r.(?)" "p.(Pro180Ala)" "" "0000870555" "00001707" "70" "538" "0" "538" "0" "c.538C>G" "r.(?)" "p.(Pro180Ala)" "" "0000870556" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870557" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870558" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870559" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870560" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870561" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870562" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870563" "00001707" "70" "1003" "0" "1003" "0" "c.1003del" "r.(?)" "p.(Ala335Leufs*25)" "" "0000870564" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000870565" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000870566" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870567" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870568" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870569" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870570" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870571" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870572" "00001707" "70" "535" "0" "535" "0" "c.535A>T" "r.(?)" "p.(Ile179Phe)" "" "0000870573" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000870574" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000870575" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000870576" "00001707" "70" "491" "0" "491" "0" "c.491C>T" "r.(?)" "p.(Ala164Val)" "" "0000870577" "00001707" "30" "124" "0" "124" "0" "c.124G>A" "r.(?)" "p.(Ala42Thr)" "" "0000870578" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870579" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870580" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870581" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870582" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870583" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870584" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870585" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870586" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870587" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870588" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870589" "00001707" "70" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870590" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000870591" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000870592" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000870593" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000870594" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000870595" "00001707" "70" "936" "0" "936" "0" "c.936G>A" "r.spl" "p.(Gln312=)" "" "0000870597" "00001707" "70" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "1" "0000870598" "00001707" "70" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "1" "0000870599" "00001707" "70" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "1" "0000870600" "00001707" "70" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "1" "0000870601" "00001707" "70" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "1" "0000870602" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000870603" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000870604" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000870605" "00001707" "70" "11" "0" "11" "0" "c.11C>G" "r.(?)" "p.(Thr4Arg)" "" "0000870606" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000870607" "00001707" "90" "67" "0" "67" "0" "c.67C>G" "r.(?)" "p.(Pro23Ala)" "" "0000870608" "00001707" "90" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23His)" "" "0000870609" "00001707" "90" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000870610" "00001707" "90" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Cys110Tyr)" "" "0000870611" "00001707" "10" "660" "0" "660" "0" "c.660T>G" "r.(?)" "p.(Phe220Leu)" "" "0000870612" "00001707" "30" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870614" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870615" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870616" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870617" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870618" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870619" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000870621" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000870622" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000870714" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870715" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870716" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870717" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870718" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870719" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870720" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870721" "00001707" "70" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0000870722" "00001707" "70" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0000870723" "00001707" "70" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0000870724" "00001707" "70" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0000870725" "00001707" "70" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0000870726" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870727" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870728" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870729" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870730" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870731" "00001707" "70" "392" "0" "392" "0" "c.392T>C" "r.(?)" "p.(Leu131Pro)" "" "0000870732" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870733" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870734" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870735" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870736" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870737" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870738" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870739" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870740" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870741" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870742" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870743" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870744" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870745" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870746" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870747" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000870748" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870749" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870750" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870751" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870752" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870753" "00001707" "70" "620" "0" "620" "0" "c.620T>A" "r.(?)" "p.(Met207Lys)" "" "0000870754" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870755" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870756" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870757" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870758" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870759" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870760" "00001707" "70" "995" "0" "998" "0" "c.995_998dup" "r.(?)" "p.(Ser334GlyfsTer21)" "" "0000870761" "00001707" "70" "1031" "0" "1031" "0" "c.1031A>C" "r.(?)" "p.(Gln344Pro)" "" "0000870762" "00001707" "70" "1031" "0" "1031" "0" "c.1031A>C" "r.(?)" "p.(Gln344Pro)" "" "0000870763" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870764" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870765" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870766" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870767" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870768" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870769" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870770" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870771" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870772" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870773" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870774" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870775" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870776" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870777" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870778" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870779" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870780" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870781" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870782" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870783" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870784" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870785" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870786" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870787" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870788" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870789" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870790" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870791" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870792" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870793" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870794" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870795" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870796" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870797" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870798" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870818" "00001707" "70" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0000870819" "00001707" "70" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000870820" "00001707" "70" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Val210Phe)" "" "0000870821" "00001707" "70" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000870822" "00001707" "70" "945" "0" "945" "0" "c.945C>G" "r.(?)" "p.(Asn315Lys)" "" "0000870823" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870824" "00001707" "70" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000870825" "00001707" "70" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Val104Ile)" "" "0000870826" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870827" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870828" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870829" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870830" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870831" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870832" "00001707" "70" "895" "0" "895" "0" "c.895G>T" "r.(?)" "p.(Ala299Ser)" "" "0000870840" "00001707" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161*)" "" "0000870841" "00001707" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161*)" "" "0000870842" "00001707" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161*)" "" "0000870843" "00001707" "70" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161*)" "" "0000870844" "00001707" "70" "531" "-2" "531" "-2" "c.531-2A>G" "r.spl" "p.?" "" "0000870845" "00001707" "70" "937" "-1" "937" "-1" "c.937-1G>T" "r.spl" "p.?" "" "0000870846" "00001707" "70" "745" "0" "745" "0" "c.745G>T" "r.(?)" "p.(Glu249*)" "" "0000870847" "00001707" "70" "936" "1" "936" "1" "c.936+1G>T" "r.spl" "p.?" "" "0000870848" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.Thr17Met" "" "0000870849" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.Tyr178Cys" "" "0000870850" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.Tyr178Cys" "" "0000870851" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.Tyr178Cys" "" "0000870852" "00001707" "70" "888" "0" "888" "0" "c.888G>T" "r.(?)" "p.Lys296Asn" "" "0000870853" "00001707" "70" "893" "0" "893" "0" "c.893C>A" "r.(?)" "p.Ala298Asp" "" "0000870854" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870855" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870856" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870857" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870858" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870859" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.Pro347Leu" "" "0000870862" "00001707" "90" "269" "0" "269" "0" "c.269G>T" "r.(?)" "p.(Gly90Val)" "" "0000870863" "00001707" "90" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000870864" "00001707" "70" "646" "0" "646" "0" "c.646A > T" "r.(?)" "p.(Met216Leu)" "" "0000870865" "00001707" "70" "646" "0" "646" "0" "c.646A > T" "r.(?)" "p.(Met216Leu)" "" "0000870866" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870867" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870868" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870869" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870870" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870871" "00001707" "70" "614" "0" "622" "0" "c.614_622del" "r.(?)" "p.(Tyr206_Phe208del)" "" "0000870872" "00001707" "70" "116" "0" "116" "0" "c.116T>G" "r.(?)" "p.(Met39Arg)" "" "0000870873" "00001707" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Phe45Leu)" "" "0000870874" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000870875" "00001707" "70" "206" "0" "206" "0" "c.206G>A" "r.(?)" "p.(Arg69His)" "" "0000870876" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870877" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870878" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870879" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870880" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870881" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870882" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870883" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870884" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870885" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870886" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870887" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870888" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870889" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870890" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870891" "00001707" "70" "505" "0" "505" "0" "c.505G>C" "r.(?)" "p.(Ala169Pro)" "" "0000870908" "00001707" "70" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "" "0000870909" "00001707" "70" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "" "0000870910" "00001707" "70" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "" "0000870911" "00001707" "70" "233" "0" "233" "0" "c.233A>T" "r.(?)" "p.(Asn78Ile)" "" "0000870941" "00001707" "70" "1045" "0" "1045" "0" "c.1045T>G" "r.(?)" "p.(*349Gluext*51)" "" "0000870948" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000870949" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000870950" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000870951" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000870952" "00001707" "70" "61" "0" "61" "0" "c.61C>T" "r.(?)" "p.(Arg21Cys)" "" "0000870953" "00001707" "70" "275" "0" "275" "0" "c.275C>T" "r.(?)" "p.(Thr92Ile)" "" "0000870954" "00001707" "70" "329" "0" "329" "0" "c.329G>C" "r.(?)" "p.(Cys110Ser)" "" "0000870955" "00001707" "70" "545" "0" "545" "0" "c.545G>T" "r.(?)" "p.(Gly182Val)" "" "0000870956" "00001707" "70" "559" "0" "559" "0" "c.559T>G" "r.(?)" "p.(Cys187Gly)" "" "0000870957" "00001707" "70" "559" "0" "559" "0" "c.559T>G" "r.(?)" "p.(Cys187Gly)" "" "0000870958" "00001707" "70" "409" "0" "426" "0" "c.409_426del" "r.(?)" "p.(Val137_Pro142del)" "" "0000870959" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000870960" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870961" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000870963" "00001707" "70" "509" "0" "509" "0" "c.509C>A" "r.(?)" "p.(Pro170His)" "2" "0000870964" "00001707" "70" "509" "0" "509" "0" "c.509C>A" "r.(?)" "p.(Pro170His)" "2" "0000870965" "00001707" "70" "509" "0" "509" "0" "c.509C>A" "r.(?)" "p.(Pro170His)" "2" "0000870968" "00001707" "70" "377" "0" "377" "0" "c.377G>T" "r.(?)" "p.(Trp126Leu)" "2" "0000870969" "00001707" "70" "377" "0" "377" "0" "c.377G>T" "r.(?)" "p.(Trp126Leu)" "2" "0000870970" "00001707" "70" "377" "0" "377" "0" "c.377G>T" "r.(?)" "p.(Trp126Leu)" "2" "0000870971" "00001707" "70" "1036" "0" "1036" "0" "c.1036G>C" "r.(?)" "p.(Ala346Pro)" "5" "0000870972" "00001707" "70" "1036" "0" "1036" "0" "c.1036G>C" "r.(?)" "p.(Ala346Pro)" "5" "0000870973" "00001707" "70" "1036" "0" "1036" "0" "c.1036G>C" "r.(?)" "p.(Ala346Pro)" "5" "0000870974" "00001707" "70" "173" "0" "173" "0" "c.173C>T (p.Thr58Met)" "r.(?)" "p.(Thr58Met)" "2" "0000870977" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870978" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870979" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870980" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870981" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870982" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870983" "00001707" "70" "1034" "0" "1034" "0" "c.1034T>G" "r.(?)" "p.(Val345Gly)" "5" "0000870984" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870985" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870986" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870987" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870988" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870989" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870990" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870991" "00001707" "70" "936" "147" "1075" "0" "c.936+147_*28del" "r.(?)" "p.?" "_5_" "0000870993" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000870994" "00001707" "70" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000871003" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871004" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871005" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871006" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871007" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871008" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871009" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871010" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871011" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871021" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871022" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871023" "00001707" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000871024" "00001707" "70" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Met216Arg)" "" "0000871025" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Pro347Arg)" "" "0000871026" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871027" "00001707" "70" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Pro267Leu)" "" "0000871028" "00001707" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Cys187Tyr)" "" "0000871029" "00001707" "70" "548" "-638" "548" "-638" "c.548-638dup91bp" "r.(?)" "p.(Ile214Alafs*147)" "" "0000871030" "00001707" "70" "548" "-638" "548" "-638" "c.548-638dup91bp" "r.(?)" "p.(Ile214Alafs*147)" "" "0000871031" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000871036" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000871037" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000871038" "00001707" "70" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "" "0000871039" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871040" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871041" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871042" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871043" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871044" "00001707" "70" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Glu113Lys)" "1" "0000871054" "00001707" "70" "92" "0" "92" "0" "c.92T>A" "r.(?)" "p.(Leu31Gln)" "" "0000871055" "00001707" "70" "92" "0" "92" "0" "c.92T>A" "r.(?)" "p.(Leu31Gln)" "" "0000871056" "00001707" "70" "92" "0" "92" "0" "c.92T>A" "r.(?)" "p.(Leu31Gln)" "" "0000871057" "00001707" "70" "317" "0" "317" "0" "c.317G>C" "r.(?)" "p.(Gly106Ala)" "" "0000871058" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000871060" "00001707" "70" "45" "0" "45" "0" "c.45T>G" "r.(?)" "p.(Asn15Lys)" "" "0000871061" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871062" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871063" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871064" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871065" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871066" "00001707" "70" "284" "0" "284" "0" "c.284T>C" "r.(?)" "p.(Leu95Pro)" "" "0000871067" "00001707" "70" "530" "0" "530" "0" "c.530G>A" "r.(?)" "p.(Arg177Lys)" "" "0000871068" "00001707" "70" "930" "0" "930" "0" "c.930C>G" "r.(?)" "p.(Asn310Lys)" "" "0000871071" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871072" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871073" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871074" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871075" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871076" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871077" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871078" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871079" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871096" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000871097" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000871098" "00001707" "70" "551" "0" "551" "0" "c.551A>C" "r.(?)" "p.(Gln184Pro)" "" "0000871099" "00001707" "70" "551" "0" "551" "0" "c.551A>G" "r.(?)" "p.(Gln184Arg)" "" "0000871100" "00001707" "70" "34" "0" "34" "0" "c.34delC" "r.(?)" "p.(Phe13Serfs*35)" "" "0000871101" "00001707" "70" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "" "0000871102" "00001707" "70" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "" "0000871103" "00001707" "70" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "" "0000871104" "00001707" "70" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "" "0000871105" "00001707" "70" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "" "0000871169" "00001707" "70" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000871170" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000871171" "00001707" "70" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000871172" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871173" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871174" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871175" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871176" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871177" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871178" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871179" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000871180" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000871181" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000871182" "00001707" "70" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "" "0000871183" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000871184" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000871185" "00001707" "70" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000871186" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871187" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871188" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871189" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871190" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871191" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871192" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871193" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871194" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871195" "00001707" "70" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "" "0000871196" "00001707" "70" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Asp190Asn)" "" "0000871197" "00001707" "70" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Met216Arg)" "" "0000871198" "00001707" "70" "768" "0" "770" "0" "c.768_770del" "r.(?)" "p.(Ile256del)" "" "0000871199" "00001707" "70" "800" "0" "800" "0" "c.800C>G" "r.(?)" "p.(Pro267Arg)" "" "0000871200" "00001707" "70" "969" "0" "969" "0" "c.969C>A" "r.(?)" "p.(Cys323*AZ9)" "" "0000871201" "00001707" "70" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Val345Met)" "" "0000871202" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871203" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871204" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871205" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000871206" "00001707" "70" "404" "0" "404" "0" "c.404G>C" "r.(?)" "p.(Arg135Pro)" "" "0000871207" "00001707" "70" "404" "0" "404" "0" "c.404G>C" "r.(?)" "p.(Arg135Pro)" "" "0000871208" "00001707" "70" "404" "0" "404" "0" "c.404G>C" "r.(?)" "p.(Arg135Pro)" "" "0000871209" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871210" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871211" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871212" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871213" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871214" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871215" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871216" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871217" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871218" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871219" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871220" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871221" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871222" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871223" "00001707" "70" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000871226" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000871227" "00001707" "70" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Thr58Arg)" "" "0000873475" "00001707" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "" "0000876101" "00001707" "70" "192" "0" "192" "0" "c.192G>T" "r.(?)" "p.(Gln64His)" "" "0000885550" "00001707" "50" "219" "0" "219" "0" "c.219C>A" "r.(?)" "p.(Asn73Lys)" "" "0000885551" "00001707" "50" "428" "0" "428" "0" "c.428T>A" "r.(?)" "p.(Met143Lys)" "" "0000885552" "00001707" "30" "492" "0" "492" "0" "c.492G>A" "r.(?)" "p.(Ala164=)" "" "0000885553" "00001707" "70" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Pro180Ser)" "" "0000885554" "00001707" "30" "891" "0" "891" "0" "c.891C>T" "r.(?)" "p.(Ser297=)" "" "0000896499" "00001707" "70" "926" "0" "926" "0" "c.926T>A" "r.(?)" "p.(Met309Lys)" "" "0000896567" "00001707" "70" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000896737" "00001707" "70" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Val210Phe)" "" "0000905959" "00001707" "90" "533" "0" "533" "0" "c.533A>G" "r.(?)" "p.(Tyr178Cys)" "" "0000915785" "00001707" "70" "284" "0" "284" "0" "c.284T>C" "r.(?)" "p.(Leu95Pro)" "1" "0000915850" "00001707" "70" "568" "0" "568" "0" "c.568G>C" "r.(?)" "p.(Asp190His)" "3" "0000915897" "00001707" "70" "11" "0" "11" "0" "c.11C>A" "r.(?)" "p.(Thr4Lys)" "1" "0000915905" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000915927" "00001707" "90" "196" "0" "196" "0" "c.196A>T" "r.(?)" "p.(Lys66*)" "1" "0000915969" "00001707" "90" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Lys296Glu)" "4" "0000915999" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000916009" "00001707" "90" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "1" "0000916012" "00001707" "90" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "1" "0000916060" "00001707" "90" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" "1" "0000916107" "00001707" "90" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Ser343Asn)" "5" "0000916142" "00001707" "90" "646" "0" "646" "0" "c.646del" "r.(?)" "p.(Met216*)" "3" "0000916284" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "1" "0000916299" "00001707" "90" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Glu150Lys)" "2" "0000916310" "00001707" "90" "563" "0" "563" "0" "c.563G>A" "r.(?)" "p.(Gly188Glu)" "3" "0000916323" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000916339" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000916409" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "3" "0000916458" "00001707" "90" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Pro347Ser)" "5" "0000916514" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000916523" "00001707" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Trp)" "2" "0000916550" "00001707" "90" "544" "0" "544" "0" "c.544G>A" "r.(?)" "p.(Gly182Ser)" "3" "0000916666" "00001707" "90" "745" "0" "745" "0" "c.745G>T" "r.(?)" "p.(Glu249*)" "4" "0000916678" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "1" "0000916715" "00001707" "90" "632" "0" "632" "0" "c.632A>G" "r.(?)" "p.(His211Arg)" "3" "0000916752" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "5" "0000916755" "00001707" "90" "151" "0" "151" "0" "c.151G>C" "r.(?)" "p.(Gly51Arg)" "1" "0000916758" "00001707" "90" "562" "0" "562" "0" "c.562G>A" "r.(?)" "p.(Gly188Arg)" "3" "0000916767" "00001707" "90" "799" "0" "799" "0" "c.799C>A" "r.(?)" "p.(Pro267Thr)" "4" "0000931568" "00001707" "90" "217" "0" "219" "0" "c.217_219del" "r.(?)" "p.(Asn73del)" "" "0000948025" "00001707" "30" "444" "0" "444" "0" "c.444C>T" "r.(?)" "p.(Phe148=)" "" "0000948026" "00001707" "30" "558" "0" "558" "0" "c.558G>A" "r.(?)" "p.(Ser186=)" "" "0000948027" "00001707" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Asp190Tyr)" "" "0000954067" "00001707" "70" "302" "0" "302" "0" "c.302G>A" "r.(?)" "p.(Gly101Glu)" "" "0000958010" "00001707" "70" "539" "0" "539" "0" "c.539C>G" "r.(?)" "p.(Pro180Arg)" "" "0000958011" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000958013" "00001707" "90" "50" "0" "50" "0" "c.50C>T" "r.(?)" "p.(Thr17Met)" "" "0000958014" "00001707" "70" "512" "0" "512" "0" "c.512C>G" "r.(?)" "p.(Pro171Arg)" "" "0000958015" "00001707" "90" "1032" "0" "1032" "0" "c.1032G>C" "r.(?)" "p.(Gln344His)" "" "0000958021" "00001707" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Gly106Arg)" "" "0000958026" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000958031" "00001707" "70" "14" "0" "14" "0" "c.14A>C" "r.(?)" "p.(Glu5Ala)" "" "0000958053" "00001707" "90" "269" "0" "269" "0" "c.269G>A" "r.(?)" "p.(Gly90Asp)" "" "0000958071" "00001707" "90" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" "0000958372" "00001707" "90" "937" "-1" "937" "-1" "c.937-1G>C" "r.spl" "p.?" "" "0000958894" "00001707" "50" "2502" "0" "2502" "0" "c.*1455T>C" "r.?" "p.?" "" "0000958965" "00001707" "50" "755" "0" "755" "0" "c.755G>C" "r.(?)" "p.(Arg252Pro)" "" "0000959404" "00001707" "50" "896" "0" "896" "0" "c.896C>A" "r.(?)" "p.(Ala299Asp)" "" "0000962469" "00001707" "50" "35" "0" "35" "0" "c.35C>G" "r.(?)" "p.(Pro12Arg)" "" "0000962470" "00001707" "90" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000962471" "00001707" "70" "284" "0" "284" "0" "c.284T>C" "r.(?)" "p.(Leu95Pro)" "" "0000962473" "00001707" "90" "482" "0" "482" "0" "c.482G>A" "r.(?)" "p.(Trp161Ter)" "" "0000962474" "00001707" "90" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Pro171Ser)" "" "0000962475" "00001707" "50" "586" "0" "586" "0" "c.586C>A" "r.(?)" "p.(Pro196Thr)" "" "0000975566" "00001707" "50" "74" "0" "74" "0" "c.74A>C" "r.(?)" "p.(Glu25Ala)" "" "0000975567" "00001707" "30" "362" "-9" "362" "-9" "c.362-9G>A" "r.(=)" "p.(=)" "" "0000975568" "00001707" "50" "418" "0" "418" "0" "c.418T>G" "r.(?)" "p.(Cys140Gly)" "" "0000975569" "00001707" "50" "755" "0" "755" "0" "c.755G>C" "r.(?)" "p.(Arg252Pro)" "" "0000975570" "00001707" "30" "919" "0" "919" "0" "c.919A>T" "r.(?)" "p.(Ile307Phe)" "" "0000993270" "00001707" "50" "530" "5" "530" "5" "c.530+5T>C" "r.spl?" "p.?" "" "0000993271" "00001707" "30" "530" "5" "530" "5" "c.530+5T>C" "r.spl?" "p.?" "" "0000993272" "00001707" "50" "759" "0" "759" "0" "c.759G>T" "r.(?)" "p.(Met253Ile)" "" "0001013815" "00001707" "90" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Ser176Phe)" "" "0001022258" "00001707" "90" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Gly89Asp)" "" "0001022264" "00001707" "70" "1032" "0" "1032" "0" "c.1032G>T" "r.(?)" "p.(Gln344His)" "" "0001022268" "00001707" "70" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" "0001022272" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0001022292" "00001707" "90" "44" "0" "44" "0" "c.44A>G" "r.(?)" "p.(Asn15Ser)" "" "0001022297" "00001707" "90" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Glu181Lys)" "" "0001022321" "00001707" "70" "632" "0" "632" "0" "c.632A>C" "r.(?)" "p.(His211Pro)" "" "0001033672" "00001707" "50" "440" "0" "440" "0" "c.440G>A" "r.(?)" "p.(Arg147His)" "" "0001064064" "00001707" "50" "755" "0" "755" "0" "c.755G>C" "r.(?)" "p.(Arg252Pro)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 1958 "{{screeningid}}" "{{variantid}}" "0000000008" "0000731568" "0000000029" "0000000232" "0000000041" "0000000101" "0000000101" "0000000101" "0000000209" "0000003895" "0000001584" "0000019478" "0000033188" "0000060185" "0000033208" "0000060186" "0000033227" "0000060187" "0000208645" "0000438568" "0000233520" "0000476228" "0000233521" "0000476229" "0000233522" "0000476230" "0000233523" "0000476231" "0000233524" "0000476232" "0000233525" "0000476233" "0000233526" "0000476234" "0000233527" "0000476235" "0000233528" "0000476236" "0000233529" "0000476237" "0000233530" "0000476238" "0000233531" "0000476239" "0000233532" "0000476240" "0000233533" "0000476241" "0000233534" "0000476242" "0000233535" "0000476243" "0000233536" "0000476244" "0000233537" "0000476245" "0000233538" "0000476246" "0000233539" "0000476247" "0000233540" "0000476248" "0000233541" "0000476249" "0000233542" "0000476250" "0000233543" "0000476251" "0000233544" "0000476252" "0000233545" "0000476253" "0000233546" "0000476254" "0000233547" "0000476255" "0000233548" "0000476256" "0000233549" "0000476257" "0000233550" "0000476258" "0000233551" "0000476259" "0000234756" "0000477464" "0000234757" "0000477465" "0000247779" "0000500662" "0000247780" "0000500663" "0000247781" "0000500664" "0000271096" "0000624955" "0000294380" "0000651069" "0000294381" "0000651070" "0000301364" "0000664285" "0000306053" "0000669741" "0000309688" "0000684561" "0000309689" "0000684562" "0000309690" "0000684563" "0000309691" "0000684564" "0000309692" "0000684565" "0000309693" "0000684566" "0000309694" "0000684567" "0000309785" "0000684658" "0000309786" "0000684659" "0000310503" "0000685414" "0000310504" "0000685415" "0000310505" "0000685416" "0000310506" "0000685417" "0000310507" "0000685418" "0000310508" "0000685419" "0000310509" "0000685420" "0000310510" "0000685421" "0000310511" "0000685422" "0000310512" "0000685423" "0000310513" "0000685424" "0000321003" "0000703770" "0000321016" "0000703789" "0000326661" "0000710253" "0000326705" "0000710297" "0000327892" "0000711685" "0000327893" "0000711686" "0000327894" "0000711687" "0000327905" "0000711698" "0000327915" "0000711708" "0000327916" "0000711709" "0000327917" "0000711710" "0000327918" "0000711711" "0000327919" "0000711712" "0000327920" "0000711713" "0000327921" "0000711714" "0000327922" "0000711715" "0000327923" "0000711716" "0000327924" "0000711717" "0000327925" "0000711718" "0000327926" "0000711719" "0000327927" "0000711720" "0000327928" "0000711721" "0000327929" "0000711722" "0000327930" "0000711723" "0000327931" "0000711724" "0000327932" "0000711725" "0000327933" "0000711726" "0000327934" "0000711727" "0000327935" "0000711728" "0000327936" "0000711729" "0000327937" "0000711730" "0000327938" "0000711731" "0000327939" "0000711732" "0000327940" "0000711733" "0000327941" "0000711734" "0000327942" "0000711735" "0000327943" "0000711736" "0000327944" "0000711737" "0000327945" "0000711738" "0000327946" "0000711739" "0000327947" "0000711740" "0000327948" "0000711741" "0000327949" "0000711742" "0000327950" "0000711743" "0000327951" "0000711744" "0000327952" "0000711745" "0000327953" "0000711746" "0000327954" "0000711747" "0000327955" "0000711748" "0000327956" "0000711749" "0000327957" "0000711750" "0000327958" "0000711751" "0000327959" "0000711752" "0000327960" "0000711753" "0000327961" "0000711754" "0000327962" "0000711755" "0000327963" "0000711756" "0000327964" "0000711757" "0000327965" "0000711758" "0000327966" "0000711759" "0000327967" "0000711760" "0000327968" "0000711761" "0000327969" "0000711762" "0000327970" "0000711763" "0000327971" "0000711764" "0000327972" "0000711765" "0000329252" "0000713375" "0000329267" "0000713390" "0000329303" "0000713426" "0000329305" "0000713428" "0000329381" "0000713504" "0000329389" "0000713512" "0000329514" "0000713637" "0000329615" "0000713963" "0000329649" "0000713997" "0000329694" "0000714051" "0000332490" "0000729745" "0000332491" "0000729746" "0000333723" "0000731486" "0000333750" "0000731540" "0000333753" "0000731543" "0000333756" "0000731546" "0000333762" "0000731552" "0000334584" "0000732440" "0000334611" "0000732543" "0000334611" "0000732610" "0000334631" "0000732563" "0000334632" "0000732564" "0000334632" "0000732622" "0000334633" "0000732565" "0000334634" "0000732566" "0000334634" "0000732624" "0000334738" "0000732745" "0000334739" "0000732746" "0000334740" "0000732747" "0000334741" "0000732748" "0000334742" "0000732749" "0000334743" "0000732750" "0000334744" "0000732751" "0000334796" "0000732803" "0000334797" "0000732804" "0000334798" "0000732805" "0000334799" "0000732806" "0000334800" "0000732807" "0000334801" "0000732808" "0000334802" "0000732809" "0000334821" "0000732828" "0000334822" "0000732829" "0000334823" "0000732830" "0000334824" "0000732831" "0000334825" "0000732832" "0000334826" "0000732833" "0000334827" "0000732834" "0000334828" "0000732835" "0000334829" "0000732836" "0000334830" "0000732837" "0000334831" "0000732838" "0000334832" "0000732839" "0000334833" "0000732840" "0000334834" "0000732841" "0000335079" "0000733088" "0000335080" "0000733089" "0000335144" "0000733153" "0000335204" "0000733213" "0000335205" "0000733214" "0000335206" "0000733215" "0000335659" "0000734353" "0000336378" "0000735653" "0000336448" "0000735823" "0000336528" "0000735924" "0000336529" "0000735925" "0000336530" "0000735926" "0000336614" "0000736059" "0000336615" "0000736060" "0000336632" "0000736077" "0000336668" "0000736113" "0000336668" "0000736154" "0000336721" "0000736211" "0000336771" "0000736307" "0000336772" "0000736308" "0000336773" "0000736309" "0000336774" "0000736310" "0000336775" "0000736311" "0000336776" "0000736312" "0000336777" "0000736313" "0000336778" "0000736314" "0000336779" "0000736315" "0000336780" "0000736316" "0000336781" "0000736317" "0000336782" "0000736318" "0000336908" "0000736446" "0000336909" "0000736447" "0000336910" "0000736448" "0000336911" "0000736449" "0000336912" "0000736450" "0000336913" "0000736451" "0000336914" "0000736452" "0000336915" "0000736453" "0000336916" "0000736454" "0000336917" "0000736455" "0000336918" "0000736456" "0000336919" "0000736457" "0000336920" "0000736458" "0000336921" "0000736459" "0000336922" "0000736460" "0000336923" "0000736461" "0000336924" "0000736462" "0000336925" "0000736463" "0000336926" "0000736464" "0000336927" "0000736465" "0000336928" "0000736466" "0000336929" "0000736467" "0000336930" "0000736468" "0000336931" "0000736469" "0000336932" "0000736470" "0000336933" "0000736471" "0000336934" "0000736472" "0000336963" "0000736503" "0000336964" "0000736504" "0000336965" "0000736505" "0000336966" "0000736506" "0000337179" "0000736803" "0000359964" "0000759595" "0000359965" "0000759596" "0000359966" "0000759597" "0000360024" "0000759666" "0000360161" "0000759888" "0000360187" "0000759981" "0000360238" "0000760128" "0000360367" "0000760259" "0000360379" "0000760271" "0000360392" "0000760284" "0000360408" "0000760300" "0000360430" "0000760322" "0000360450" "0000760342" "0000362654" "0000784161" "0000362672" "0000789700" "0000363482" "0000764169" "0000364118" "0000764880" "0000364119" "0000764881" "0000364620" "0000765485" "0000364633" "0000765508" "0000364634" "0000765509" "0000364635" "0000765510" "0000364636" "0000765511" "0000364637" "0000765512" "0000364638" "0000765513" "0000364639" "0000765514" "0000364640" "0000765515" "0000364641" "0000765516" "0000364642" "0000765517" "0000364649" "0000765524" "0000364668" "0000765543" "0000364695" "0000765570" "0000364696" "0000765571" "0000364732" "0000765636" "0000364733" "0000765637" "0000364734" "0000765638" "0000373309" "0000783281" "0000373312" "0000783284" "0000373733" "0000783899" "0000373855" "0000784168" "0000373856" "0000784169" "0000373857" "0000784170" "0000373858" "0000784171" "0000373859" "0000784172" "0000373860" "0000784173" "0000373861" "0000784174" "0000373862" "0000784175" "0000373863" "0000784176" "0000373933" "0000784555" "0000374574" "0000785365" "0000374605" "0000785397" "0000374702" "0000785525" "0000374745" "0000785579" "0000374747" "0000785587" "0000374748" "0000785588" "0000374749" "0000785589" "0000374750" "0000785590" "0000374751" "0000785591" "0000374752" "0000785592" "0000375048" "0000786309" "0000375051" "0000786312" "0000375144" "0000786439" "0000375147" "0000786442" "0000375152" "0000786447" "0000375177" "0000786506" "0000375182" "0000786511" "0000375190" "0000786523" "0000375191" "0000786524" "0000375192" "0000786525" "0000375193" "0000786526" "0000375194" "0000786527" "0000375195" "0000786528" "0000375196" "0000786529" "0000375197" "0000786530" "0000375198" "0000786531" "0000375199" "0000786532" "0000375200" "0000786533" "0000375201" "0000786534" "0000375202" "0000786535" "0000375203" "0000786536" "0000375204" "0000786537" "0000375205" "0000786538" "0000375206" "0000786539" "0000375207" "0000786540" "0000375208" "0000786541" "0000375209" "0000786542" "0000375210" "0000786543" "0000375211" "0000786544" "0000375212" "0000786545" "0000375213" "0000786546" "0000375214" "0000786547" "0000375215" "0000786548" "0000375216" "0000786549" "0000375217" "0000786550" "0000375218" "0000786551" "0000375219" "0000786552" "0000375220" "0000786553" "0000375221" "0000786554" "0000375222" "0000786555" "0000375223" "0000786556" "0000375224" "0000786557" "0000375225" "0000786558" "0000375226" "0000786559" "0000375227" "0000786560" "0000375228" "0000786561" "0000375229" "0000786562" "0000375230" "0000786563" "0000375231" "0000786564" "0000376104" "0000787637" "0000376120" "0000787653" "0000376122" "0000787655" "0000376129" "0000787662" "0000376480" "0000788088" "0000376481" "0000788089" "0000376482" "0000788090" "0000376483" "0000788091" "0000376501" "0000788109" "0000376502" "0000788110" "0000376503" "0000788111" "0000376607" "0000788361" "0000376650" "0000788543" "0000377364" "0000789681" "0000377372" "0000789691" "0000377373" "0000789692" "0000377379" "0000789698" "0000377381" "0000789700" "0000377490" "0000789848" "0000377687" "0000790103" "0000377688" "0000790105" "0000377689" "0000790107" "0000377690" "0000790109" "0000377691" "0000790111" "0000377692" "0000790113" "0000377693" "0000790115" "0000377694" "0000790117" "0000377706" "0000790129" "0000377707" "0000790130" "0000377708" "0000790131" "0000377709" "0000790132" "0000377710" "0000790133" "0000377730" "0000790155" "0000377731" "0000790156" "0000377732" "0000790157" "0000377733" "0000790158" "0000377952" "0000790402" "0000377975" "0000790553" "0000377982" "0000790432" "0000377989" "0000790439" "0000378198" "0000790883" "0000378199" "0000790884" "0000378200" "0000790885" "0000378201" "0000790886" "0000378202" "0000790887" "0000378420" "0000791175" "0000378446" "0000791201" "0000378451" "0000791206" "0000378452" "0000791207" "0000378453" "0000791208" "0000378454" "0000791209" "0000378455" "0000791210" "0000378457" "0000000232" "0000378619" "0000791468" "0000378620" "0000791469" "0000378621" "0000791470" "0000378622" "0000791471" "0000378623" "0000791472" "0000378624" "0000791473" "0000378625" "0000791474" "0000378626" "0000791475" "0000378627" "0000791476" "0000378628" "0000791477" "0000378629" "0000791478" "0000378630" "0000791479" "0000378631" "0000791480" "0000378632" "0000791481" "0000378633" "0000791482" "0000378634" "0000791483" "0000378635" "0000791484" "0000378636" "0000791485" "0000378637" "0000791486" "0000378638" "0000791487" "0000378639" "0000791488" "0000378640" "0000791489" "0000378641" "0000791490" "0000378642" "0000791491" "0000378643" "0000791492" "0000378644" "0000791493" "0000378645" "0000791494" "0000378646" "0000791495" "0000378647" "0000791496" "0000378648" "0000791497" "0000378649" "0000791498" "0000378650" "0000791499" "0000378651" "0000791500" "0000378652" "0000791501" "0000378653" "0000791502" "0000378654" "0000791503" "0000378655" "0000791504" "0000378656" "0000791505" "0000378657" "0000791506" "0000378658" "0000791507" "0000378659" "0000791508" "0000378660" "0000791509" "0000378661" "0000791510" "0000378662" "0000791511" "0000378663" "0000791512" "0000378664" "0000791513" "0000378665" "0000791514" "0000378666" "0000791515" "0000378667" "0000791516" "0000378668" "0000791517" "0000378669" "0000791518" "0000378670" "0000791519" "0000378671" "0000791520" "0000378715" "0000791564" "0000378933" "0000791923" "0000378934" "0000791924" "0000380593" "0000793738" "0000380611" "0000793763" "0000380650" "0000793802" "0000380750" "0000793940" "0000380800" "0000793998" "0000380801" "0000793999" "0000380802" "0000794000" "0000380803" "0000794001" "0000380804" "0000794002" "0000380805" "0000794003" "0000380806" "0000794004" "0000380807" "0000794005" "0000380808" "0000794006" "0000380867" "0000794089" "0000381001" "0000794265" "0000381002" "0000794266" "0000381071" "0000794367" "0000381072" "0000794368" "0000381073" "0000794369" "0000381074" "0000794370" "0000381075" "0000794371" "0000381076" "0000794372" "0000381443" "0000794903" "0000381444" "0000794904" "0000381445" "0000794905" "0000381446" "0000794906" "0000381447" "0000794907" "0000381448" "0000794908" "0000381449" "0000794909" "0000381450" "0000794910" "0000381451" "0000794911" "0000381452" "0000794912" "0000381453" "0000794913" "0000381454" "0000794914" "0000381455" "0000794915" "0000381456" "0000794916" "0000381457" "0000794917" "0000381458" "0000794918" "0000381459" "0000794919" "0000381462" "0000794922" "0000381463" "0000794923" "0000381464" "0000794924" "0000381473" "0000794933" "0000381474" "0000794934" "0000381475" "0000794935" "0000382211" "0000795926" "0000382213" "0000795928" "0000382230" "0000795946" "0000382312" "0000796070" "0000382829" "0000796705" "0000382836" "0000796719" "0000382853" "0000796757" "0000382863" "0000796780" "0000382884" "0000796831" "0000382890" "0000796840" "0000382896" "0000796847" "0000382911" "0000796870" "0000382950" "0000796928" "0000382951" "0000796929" "0000382952" "0000796930" "0000382953" "0000796931" "0000382954" "0000796932" "0000382955" "0000796933" "0000382956" "0000796934" "0000382957" "0000796935" "0000382958" "0000796936" "0000382959" "0000796937" "0000382960" "0000796938" "0000382961" "0000796939" "0000382962" "0000796940" "0000382963" "0000796941" "0000382964" "0000796942" "0000382965" "0000796943" "0000382966" "0000796944" "0000382967" "0000796945" "0000383021" "0000797005" "0000383120" "0000797112" "0000383121" "0000797113" "0000383122" "0000797114" "0000383123" "0000797115" "0000383594" "0000797775" "0000383595" "0000797776" "0000383596" "0000797777" "0000383597" "0000797778" "0000383598" "0000797779" "0000383599" "0000797780" "0000383600" "0000797781" "0000383601" "0000797782" "0000383602" "0000797783" "0000383603" "0000797784" "0000383604" "0000797785" "0000383605" "0000797786" "0000383606" "0000797787" "0000383607" "0000797788" "0000383608" "0000797789" "0000383609" "0000797790" "0000383610" "0000797791" "0000383611" "0000797792" "0000383612" "0000797793" "0000383613" "0000797794" "0000383614" "0000797795" "0000384005" "0000798422" "0000384010" "0000798427" "0000384047" "0000798476" "0000384049" "0000798478" "0000384050" "0000798479" "0000384052" "0000798481" "0000384053" "0000798483" "0000384283" "0000810855" "0000384283" "0000810856" "0000384285" "0000810860" "0000384285" "0000810861" "0000384296" "0000810879" "0000384297" "0000810881" "0000384297" "0000810882" "0000384304" "0000810898" "0000384311" "0000810917" "0000384317" "0000810925" "0000384319" "0000810927" "0000384711" "0000811479" "0000384712" "0000811480" "0000384935" "0000811772" "0000385031" "0000811872" "0000385062" "0000811929" "0000385301" "0000812279" "0000385499" "0000812567" "0000385556" "0000812639" "0000385972" "0000813189" "0000385973" "0000813190" "0000386000" "0000813217" "0000386001" "0000813218" "0000386280" "0000813687" "0000386952" "0000814775" "0000386953" "0000814776" "0000387105" "0000814964" "0000387183" "0000815062" "0000387393" "0000815277" "0000387394" "0000815278" "0000387432" "0000815559" "0000387531" "0000815554" "0000387775" "0000815933" "0000387777" "0000815935" "0000387782" "0000815940" "0000387793" "0000815951" "0000387817" "0000815975" "0000387847" "0000816005" "0000387874" "0000816032" "0000387903" "0000816061" "0000387914" "0000816072" "0000387943" "0000816101" "0000387948" "0000816106" "0000388068" "0000816226" "0000388222" "0000816681" "0000388223" "0000816682" "0000388224" "0000816683" "0000388225" "0000816684" "0000388226" "0000816685" "0000388227" "0000816687" "0000388228" "0000816688" "0000388229" "0000816689" "0000388230" "0000816690" "0000388231" "0000816691" "0000388232" "0000816692" "0000388233" "0000816693" "0000388234" "0000816694" "0000388235" "0000816695" "0000388236" "0000816696" "0000388237" "0000816697" "0000388238" "0000816698" "0000388239" "0000816699" "0000388240" "0000816700" "0000388241" "0000816701" "0000388242" "0000816702" "0000388610" "0000817308" "0000388611" "0000817309" "0000388740" "0000817493" "0000389793" "0000819052" "0000389967" "0000819312" "0000389968" "0000819313" "0000389969" "0000819314" "0000390050" "0000819395" "0000390090" "0000819435" "0000390126" "0000819471" "0000390127" "0000819472" "0000390128" "0000819473" "0000390224" "0000819569" "0000390225" "0000819570" "0000390226" "0000819571" "0000390227" "0000819572" "0000390350" "0000819695" "0000390351" "0000819696" "0000390352" "0000819697" "0000390456" "0000819801" "0000390457" "0000819802" "0000390507" "0000819852" "0000390508" "0000819853" "0000390638" "0000819983" "0000390722" "0000820067" "0000390723" "0000820068" "0000390732" "0000820077" "0000390739" "0000820084" "0000390740" "0000820085" "0000390756" "0000820101" "0000390757" "0000820102" "0000390775" "0000820120" "0000390776" "0000820121" "0000390777" "0000820122" "0000390781" "0000820126" "0000390782" "0000820127" "0000390786" "0000820131" "0000390825" "0000820170" "0000390826" "0000820171" "0000390850" "0000820195" "0000390866" "0000820211" "0000390892" "0000820237" "0000390893" "0000820238" "0000390917" "0000820262" "0000390921" "0000820266" "0000390929" "0000820274" "0000390931" "0000820276" "0000390932" "0000820277" "0000390933" "0000820278" "0000390934" "0000820279" "0000390936" "0000820281" "0000390937" "0000820282" "0000390939" "0000820284" "0000390940" "0000820285" "0000390944" "0000820289" "0000390945" "0000820290" "0000390949" "0000820294" "0000390950" "0000820295" "0000390957" "0000820302" "0000390958" "0000820303" "0000390959" "0000820304" "0000390960" "0000820305" "0000391056" "0000820401" "0000391076" "0000820421" "0000391137" "0000820482" "0000391183" "0000820528" "0000391198" "0000820543" "0000391200" "0000820545" "0000391234" "0000820579" "0000391251" "0000820596" "0000391277" "0000821013" "0000391277" "0000821023" "0000391604" "0000821353" "0000391605" "0000821354" "0000391606" "0000821355" "0000391607" "0000821356" "0000391608" "0000821357" "0000391609" "0000821358" "0000391610" "0000821359" "0000392630" "0000822981" "0000392827" "0000823262" "0000393556" "0000824333" "0000393558" "0000824335" "0000393563" "0000824340" "0000393564" "0000824341" "0000393567" "0000824344" "0000393578" "0000824357" "0000393583" "0000824362" "0000393589" "0000824368" "0000393590" "0000824369" "0000393591" "0000824370" "0000393594" "0000824374" "0000393599" "0000824379" "0000393603" "0000824383" "0000393606" "0000824386" "0000393609" "0000824389" "0000393610" "0000824390" "0000393617" "0000824398" "0000393618" "0000824399" "0000393624" "0000824405" "0000393625" "0000824406" "0000393628" "0000824409" "0000393629" "0000824410" "0000393635" "0000824416" "0000393799" "0000824617" "0000393800" "0000824618" "0000393801" "0000824619" "0000393802" "0000824620" "0000393803" "0000824621" "0000393804" "0000824622" "0000393805" "0000824623" "0000393806" "0000824624" "0000393807" "0000824625" "0000393808" "0000824626" "0000393828" "0000824650" "0000393856" "0000824678" "0000393905" "0000824727" "0000394025" "0000824932" "0000394026" "0000824936" "0000394688" "0000825665" "0000394782" "0000825806" "0000394847" "0000825904" "0000394854" "0000825913" "0000394859" "0000825919" "0000394888" "0000825966" "0000394981" "0000826115" "0000395158" "0000826388" "0000395162" "0000826395" "0000395576" "0000826947" "0000395753" "0000827155" "0000395754" "0000827156" "0000395755" "0000827157" "0000395756" "0000827158" "0000395757" "0000827159" "0000395758" "0000827160" "0000395759" "0000827161" "0000395760" "0000827162" "0000395761" "0000827163" "0000395762" "0000827164" "0000395763" "0000827165" "0000395764" "0000827166" "0000395765" "0000827167" "0000395766" "0000827168" "0000395767" "0000827169" "0000395768" "0000827170" "0000395769" "0000827171" "0000396797" "0000828475" "0000397157" "0000828903" "0000397173" "0000828919" "0000397190" "0000828936" "0000397210" "0000829059" "0000397211" "0000829060" "0000397212" "0000829061" "0000397213" "0000829062" "0000397214" "0000829063" "0000397215" "0000829064" "0000397216" "0000829065" "0000397217" "0000829066" "0000397218" "0000829067" "0000397219" "0000829068" "0000397729" "0000829797" "0000397752" "0000829980" "0000397756" "0000829837" "0000409678" "0000846882" "0000410762" "0000000101" "0000411872" "0000869121" "0000411873" "0000869122" "0000411874" "0000869123" "0000411875" "0000869124" "0000411876" "0000869125" "0000411877" "0000869126" "0000411878" "0000869127" "0000411879" "0000869128" "0000411880" "0000869129" "0000411881" "0000869130" "0000411882" "0000869131" "0000411883" "0000869132" "0000411884" "0000869133" "0000411885" "0000869134" "0000411886" "0000869135" "0000411887" "0000869136" "0000411888" "0000869137" "0000411889" "0000869138" "0000411890" "0000869139" "0000411891" "0000869140" "0000411892" "0000869141" "0000411893" "0000869142" "0000411894" "0000869143" "0000411895" "0000869144" "0000411896" "0000869145" "0000411897" "0000869146" "0000411898" "0000869147" "0000411899" "0000869148" "0000411900" "0000869149" "0000411901" "0000869150" "0000411902" "0000869151" "0000411903" "0000869152" "0000411904" "0000869153" "0000411905" "0000869154" "0000411906" "0000869155" "0000411907" "0000869156" "0000411908" "0000869157" "0000411909" "0000869158" "0000411910" "0000869159" "0000411911" "0000869160" "0000411912" "0000869161" "0000411913" "0000869162" "0000411914" "0000869163" "0000411915" "0000869164" "0000411916" "0000869165" "0000411917" "0000869166" "0000411918" "0000869167" "0000411919" "0000869168" "0000411920" "0000869169" "0000411921" "0000869170" "0000411922" "0000869171" "0000411923" "0000869172" "0000411924" "0000869173" "0000411925" "0000869174" "0000411926" "0000869175" "0000411927" "0000869176" "0000411928" "0000869177" "0000411929" "0000869178" "0000411930" "0000869179" "0000411931" "0000869180" "0000411932" "0000869181" "0000411933" "0000869182" "0000411934" "0000869183" "0000411935" "0000869184" "0000411936" "0000869185" "0000411937" "0000869186" "0000411938" "0000869187" "0000411939" "0000869188" "0000411940" "0000869189" "0000411941" "0000869190" "0000411942" "0000869191" "0000411943" "0000869192" "0000411944" "0000869193" "0000411945" "0000869194" "0000411946" "0000869195" "0000411947" "0000869196" "0000411948" "0000869197" "0000411949" "0000869198" "0000411950" "0000869199" "0000411951" "0000869200" "0000411952" "0000869201" "0000411953" "0000869202" "0000411954" "0000869203" "0000411955" "0000869204" "0000411956" "0000869205" "0000411957" "0000869206" "0000411958" "0000869207" "0000411959" "0000869208" "0000411960" "0000869209" "0000411961" "0000869210" "0000411962" "0000869211" "0000411963" "0000869212" "0000411964" "0000869213" "0000411965" "0000869214" "0000411966" "0000869215" "0000411967" "0000869216" "0000411968" "0000869217" "0000411969" "0000869218" "0000411970" "0000869219" "0000411971" "0000869220" "0000411972" "0000869221" "0000411973" "0000869222" "0000411974" "0000869223" "0000411975" "0000869224" "0000411976" "0000869225" "0000411977" "0000869226" "0000411978" "0000869227" "0000411979" "0000869228" "0000411980" "0000869229" "0000411981" "0000869230" "0000411982" "0000869231" "0000411983" "0000869232" "0000411984" "0000869233" "0000411985" "0000869234" "0000411986" "0000869235" "0000411987" "0000869236" "0000411988" "0000869237" "0000411989" "0000869238" "0000411990" "0000869239" "0000411991" "0000869240" "0000411992" "0000869241" "0000411993" "0000869242" "0000411994" "0000869243" "0000411995" "0000869244" "0000411996" "0000869245" "0000411997" "0000869246" "0000411998" "0000869247" "0000411999" "0000869248" "0000412001" "0000869251" "0000412002" "0000869252" "0000412003" "0000869253" "0000412004" "0000869254" "0000412005" "0000869255" "0000412006" "0000869256" "0000412007" "0000869257" "0000412008" "0000869258" "0000412009" "0000869259" "0000412010" "0000869260" "0000412011" "0000869261" "0000412036" "0000869293" "0000412037" "0000869294" "0000412038" "0000869295" "0000412039" "0000869296" "0000412040" "0000869297" "0000412041" "0000869298" "0000412042" "0000869299" "0000412043" "0000869300" "0000412044" "0000869301" "0000412045" "0000869302" "0000412046" "0000869303" "0000412047" "0000869304" "0000412048" "0000869305" "0000412049" "0000869306" "0000412050" "0000869307" "0000412051" "0000869308" "0000412052" "0000869309" "0000412053" "0000869310" "0000412054" "0000869311" "0000412055" "0000869312" "0000412056" "0000869313" "0000412057" "0000869314" "0000412058" "0000869315" "0000412059" "0000869316" "0000412060" "0000869317" "0000412061" "0000869318" "0000412062" "0000869319" "0000412063" "0000869320" "0000412078" "0000869336" "0000412079" "0000869337" "0000412080" "0000869338" "0000412081" "0000869339" "0000412082" "0000869340" "0000412083" "0000869341" "0000412084" "0000869342" "0000412085" "0000869343" "0000412086" "0000869344" "0000412087" "0000869345" "0000412088" "0000869346" "0000412089" "0000869347" "0000412090" "0000869348" "0000412091" "0000869349" "0000412092" "0000869350" "0000412093" "0000869351" "0000412094" "0000869352" "0000412095" "0000869353" "0000412096" "0000869354" "0000412097" "0000869355" "0000412098" "0000869356" "0000412099" "0000869357" "0000412100" "0000869358" "0000412101" "0000869359" "0000412102" "0000869360" "0000412103" "0000869361" "0000412104" "0000869362" "0000412105" "0000869363" "0000412106" "0000869364" "0000412107" "0000869365" "0000412108" "0000869366" "0000412109" "0000869367" "0000412110" "0000869368" "0000412111" "0000869369" "0000412112" "0000869370" "0000412113" "0000869371" "0000412114" "0000869372" "0000412115" "0000869373" "0000412116" "0000869374" "0000412117" "0000869375" "0000412118" "0000869376" "0000412119" "0000869377" "0000412120" "0000869378" "0000412121" "0000869379" "0000412122" "0000869380" "0000412123" "0000869381" "0000412124" "0000869382" "0000412125" "0000869383" "0000412126" "0000869384" "0000412127" "0000869385" "0000412128" "0000869386" "0000412129" "0000869387" "0000412130" "0000869388" "0000412131" "0000869389" "0000412132" "0000869390" "0000412133" "0000869391" "0000412134" "0000869392" "0000412135" "0000869393" "0000412136" "0000869394" "0000412137" "0000869395" "0000412138" "0000869396" "0000412139" "0000869397" "0000412140" "0000869398" "0000412141" "0000869399" "0000412142" "0000869400" "0000412143" "0000869401" "0000412144" "0000869402" "0000412145" "0000869403" "0000412146" "0000869404" "0000412147" "0000869405" "0000412148" "0000869406" "0000412149" "0000869407" "0000412150" "0000869408" "0000412151" "0000869409" "0000412152" "0000869410" "0000412153" "0000869411" "0000412154" "0000869412" "0000412155" "0000869413" "0000412156" "0000869414" "0000412157" "0000869415" "0000412158" "0000869416" "0000412159" "0000869417" "0000412160" "0000869418" "0000412161" "0000869419" "0000412162" "0000869420" "0000412163" "0000869421" "0000412164" "0000869422" "0000412165" "0000869423" "0000412166" "0000869424" "0000412167" "0000869425" "0000412168" "0000869426" "0000412169" "0000869427" "0000412170" "0000869428" "0000412171" "0000869429" "0000412172" "0000869430" "0000412173" "0000869431" "0000412174" "0000869432" "0000412175" "0000869433" "0000412176" "0000869434" "0000412177" "0000869435" "0000412178" "0000869436" "0000412179" "0000869437" "0000412194" "0000869452" "0000412195" "0000869453" "0000412196" "0000869454" "0000412197" "0000869455" "0000412198" "0000869456" "0000412199" "0000869457" "0000412200" "0000869458" "0000412201" "0000869459" "0000412202" "0000869460" "0000412203" "0000869461" "0000412336" "0000869666" "0000412337" "0000869667" "0000412338" "0000869668" "0000412339" "0000869669" "0000412340" "0000869670" "0000412341" "0000869671" "0000412342" "0000869672" "0000412343" "0000869673" "0000412344" "0000869674" "0000412345" "0000869675" "0000412346" "0000869676" "0000412347" "0000869677" "0000412348" "0000869678" "0000412349" "0000869679" "0000412350" "0000869680" "0000412351" "0000869681" "0000412352" "0000869682" "0000412359" "0000869690" "0000412360" "0000869691" "0000412361" "0000869692" "0000412362" "0000869693" "0000412363" "0000869694" "0000412364" "0000869695" "0000412365" "0000869696" "0000412366" "0000869697" "0000412370" "0000869701" "0000412371" "0000869702" "0000412372" "0000869703" "0000412373" "0000869704" "0000412374" "0000869705" "0000412381" "0000869710" "0000412395" "0000869723" "0000412396" "0000869724" "0000412397" "0000869725" "0000412398" "0000869726" "0000412399" "0000869727" "0000412402" "0000869730" "0000412403" "0000869731" "0000412404" "0000869732" "0000412405" "0000869733" "0000412406" "0000869734" "0000412407" "0000869735" "0000412408" "0000869736" "0000412409" "0000869737" "0000412410" "0000869738" "0000412411" "0000869739" "0000412412" "0000869740" "0000412413" "0000869741" "0000412414" "0000869742" "0000412415" "0000869743" "0000412416" "0000869744" "0000412417" "0000869745" "0000412418" "0000869746" "0000412419" "0000869747" "0000412420" "0000869748" "0000412421" "0000869749" "0000412422" "0000869750" "0000412423" "0000869751" "0000412435" "0000869767" "0000412436" "0000869768" "0000412437" "0000869769" "0000412465" "0000869812" "0000412466" "0000869813" "0000412467" "0000869814" "0000412468" "0000869815" "0000412469" "0000869816" "0000412470" "0000869817" "0000412471" "0000869818" "0000412472" "0000869819" "0000412473" "0000869820" "0000412474" "0000869821" "0000412475" "0000869822" "0000412476" "0000869823" "0000412477" "0000869824" "0000412478" "0000869825" "0000412479" "0000869826" "0000412480" "0000869827" "0000412481" "0000869828" "0000412482" "0000869829" "0000412483" "0000869830" "0000412484" "0000869831" "0000412485" "0000869832" "0000412486" "0000869833" "0000412487" "0000869834" "0000412488" "0000869835" "0000412489" "0000869836" "0000412490" "0000869837" "0000412491" "0000869838" "0000412492" "0000869839" "0000412493" "0000869840" "0000412494" "0000869841" "0000412495" "0000869842" "0000412496" "0000869843" "0000412497" "0000869844" "0000412498" "0000869845" "0000412499" "0000869846" "0000412500" "0000869847" "0000412501" "0000869848" "0000412502" "0000869849" "0000412503" "0000869850" "0000412504" "0000869851" "0000412505" "0000869852" "0000412506" "0000869853" "0000412507" "0000869854" "0000412508" "0000869855" "0000412509" "0000869856" "0000412510" "0000869857" "0000412511" "0000869858" "0000412512" "0000869859" "0000412513" "0000869860" "0000412514" "0000869861" "0000412515" "0000869862" "0000412516" "0000869863" "0000412517" "0000869864" "0000412518" "0000869865" "0000412519" "0000869866" "0000412520" "0000869867" "0000412522" "0000869869" "0000412523" "0000869870" "0000412524" "0000869871" "0000412525" "0000869872" "0000412530" "0000869876" "0000412531" "0000869877" "0000412532" "0000869878" "0000412533" "0000869879" "0000412534" "0000869880" "0000412547" "0000869891" "0000412548" "0000869892" "0000412549" "0000869893" "0000412550" "0000869894" "0000412551" "0000869895" "0000412552" "0000869896" "0000412555" "0000869899" "0000412556" "0000869900" "0000412557" "0000869901" "0000412558" "0000869902" "0000412559" "0000869903" "0000412560" "0000869904" "0000412561" "0000869905" "0000412562" "0000869906" "0000412563" "0000869907" "0000412564" "0000869908" "0000412565" "0000869909" "0000412566" "0000869910" "0000412567" "0000869911" "0000412568" "0000869912" "0000412569" "0000869913" "0000412570" "0000869914" "0000412571" "0000869915" "0000412572" "0000869916" "0000412573" "0000869917" "0000412574" "0000869918" "0000412575" "0000869919" "0000412576" "0000869920" "0000412577" "0000869921" "0000412578" "0000869922" "0000412579" "0000869923" "0000412580" "0000869924" "0000412581" "0000869925" "0000412582" "0000869926" "0000412583" "0000869927" "0000412584" "0000869928" "0000412585" "0000869929" "0000412586" "0000869930" "0000412587" "0000869931" "0000412588" "0000869932" "0000412589" "0000869933" "0000412637" "0000869994" "0000412638" "0000869995" "0000412639" "0000869996" "0000412640" "0000869997" "0000412641" "0000869998" "0000412642" "0000869999" "0000412643" "0000870000" "0000412644" "0000870001" "0000412645" "0000870002" "0000412646" "0000870003" "0000412649" "0000870005" "0000412650" "0000870006" "0000412651" "0000870007" "0000412652" "0000870008" "0000412653" "0000870009" "0000412654" "0000870010" "0000412655" "0000870011" "0000412656" "0000870012" "0000412657" "0000870013" "0000412658" "0000870014" "0000412659" "0000870015" "0000412660" "0000870016" "0000412661" "0000870017" "0000412662" "0000870018" "0000412663" "0000870019" "0000412664" "0000870020" "0000412665" "0000870021" "0000412666" "0000870022" "0000412667" "0000870023" "0000412668" "0000870024" "0000412669" "0000870025" "0000412670" "0000870026" "0000412671" "0000870027" "0000412672" "0000870028" "0000412673" "0000870029" "0000412674" "0000870030" "0000412675" "0000870031" "0000412676" "0000870032" "0000412677" "0000870033" "0000412678" "0000870034" "0000412680" "0000870036" "0000412681" "0000870037" "0000412685" "0000870042" "0000412688" "0000870045" "0000412688" "0000870048" "0000412689" "0000870046" "0000412689" "0000870049" "0000412690" "0000870047" "0000412690" "0000870050" "0000412690" "0000870051" "0000412696" "0000870057" "0000412697" "0000870058" "0000412698" "0000870059" "0000412699" "0000870060" "0000412700" "0000870061" "0000412701" "0000870062" "0000412702" "0000870063" "0000412706" "0000870068" "0000412707" "0000870069" "0000412708" "0000870070" "0000412709" "0000870071" "0000412710" "0000870072" "0000412711" "0000870073" "0000412712" "0000870074" "0000412713" "0000870075" "0000412714" "0000870076" "0000412715" "0000870077" "0000412716" "0000870078" "0000412717" "0000870079" "0000412718" "0000870080" "0000412729" "0000870094" "0000412730" "0000870095" "0000412731" "0000870096" "0000412732" "0000870097" "0000412733" "0000870098" "0000412734" "0000870099" "0000412735" "0000870100" "0000412736" "0000870101" "0000412737" "0000870102" "0000412738" "0000870103" "0000412739" "0000870104" "0000412740" "0000870105" "0000412741" "0000870106" "0000412742" "0000870107" "0000412743" "0000870108" "0000412744" "0000870109" "0000412745" "0000870110" "0000412746" "0000870111" "0000412747" "0000870112" "0000412748" "0000870113" "0000412749" "0000870114" "0000412750" "0000870115" "0000412751" "0000870116" "0000412752" "0000870117" "0000412753" "0000870118" "0000412754" "0000870119" "0000412755" "0000870120" "0000412756" "0000870121" "0000412757" "0000870122" "0000412758" "0000870123" "0000412759" "0000870124" "0000412760" "0000870125" "0000412761" "0000870126" "0000412762" "0000870127" "0000412763" "0000870128" "0000412764" "0000870129" "0000412765" "0000870130" "0000412767" "0000870131" "0000412768" "0000870132" "0000412769" "0000870133" "0000412770" "0000870134" "0000412772" "0000870137" "0000412773" "0000870138" "0000412776" "0000870141" "0000412777" "0000870142" "0000412778" "0000870143" "0000412779" "0000870144" "0000412780" "0000870145" "0000412781" "0000870146" "0000412782" "0000870147" "0000412783" "0000870148" "0000412784" "0000870149" "0000412785" "0000870150" "0000412786" "0000870151" "0000412787" "0000870152" "0000412788" "0000870153" "0000412789" "0000870154" "0000412790" "0000870155" "0000412792" "0000870157" "0000412793" "0000870158" "0000412794" "0000870159" "0000412795" "0000870160" "0000412796" "0000870161" "0000412797" "0000870162" "0000412802" "0000870167" "0000412803" "0000870168" "0000412804" "0000870169" "0000412805" "0000870170" "0000412806" "0000870171" "0000412807" "0000870172" "0000412808" "0000870173" "0000412809" "0000870174" "0000412810" "0000870175" "0000412811" "0000870176" "0000412812" "0000870177" "0000412813" "0000870178" "0000412814" "0000870179" "0000412815" "0000870180" "0000412824" "0000870197" "0000412825" "0000870198" "0000412826" "0000870199" "0000412827" "0000870200" "0000412828" "0000870201" "0000412829" "0000870202" "0000412830" "0000870203" "0000412831" "0000870204" "0000412832" "0000870205" "0000412833" "0000870206" "0000412834" "0000870207" "0000412835" "0000870208" "0000412836" "0000870209" "0000412837" "0000870210" "0000412838" "0000870211" "0000412839" "0000870212" "0000412840" "0000870213" "0000412841" "0000870214" "0000412842" "0000870215" "0000412843" "0000870216" "0000412844" "0000870217" "0000412845" "0000870218" "0000412846" "0000870219" "0000412847" "0000870220" "0000412848" "0000870221" "0000412849" "0000870222" "0000412850" "0000870223" "0000412856" "0000870230" "0000412857" "0000870231" "0000412858" "0000870232" "0000412859" "0000870233" "0000412860" "0000870234" "0000412861" "0000870235" "0000412862" "0000870236" "0000412863" "0000870237" "0000412864" "0000870238" "0000412865" "0000870239" "0000412866" "0000870240" "0000412867" "0000870241" "0000412868" "0000870242" "0000412869" "0000870243" "0000412870" "0000870244" "0000412871" "0000870245" "0000412872" "0000870246" "0000412873" "0000870247" "0000412874" "0000870248" "0000412875" "0000870249" "0000412876" "0000870250" "0000412877" "0000870251" "0000412878" "0000870252" "0000412879" "0000870253" "0000412880" "0000870254" "0000412881" "0000870255" "0000412882" "0000870256" "0000412885" "0000870260" "0000412886" "0000870261" "0000412887" "0000870262" "0000412888" "0000870263" "0000412889" "0000000101" "0000412892" "0000870267" "0000412893" "0000870268" "0000412894" "0000870269" "0000412895" "0000870270" "0000412896" "0000870271" "0000412897" "0000870272" "0000412898" "0000870273" "0000412899" "0000870274" "0000412900" "0000870275" "0000412901" "0000870276" "0000412902" "0000870277" "0000412903" "0000870278" "0000412904" "0000870279" "0000412905" "0000870280" "0000412906" "0000870281" "0000412907" "0000870282" "0000412908" "0000870283" "0000412909" "0000870284" "0000412910" "0000870285" "0000412911" "0000870286" "0000412912" "0000870287" "0000412913" "0000870288" "0000412914" "0000870289" "0000412915" "0000870290" "0000412916" "0000870291" "0000412917" "0000870292" "0000412918" "0000870293" "0000412919" "0000870294" "0000412920" "0000870295" "0000412921" "0000870296" "0000412922" "0000870297" "0000412923" "0000870298" "0000412924" "0000870299" "0000412925" "0000870300" "0000412926" "0000870301" "0000413107" "0000870532" "0000413108" "0000870533" "0000413109" "0000870534" "0000413110" "0000870535" "0000413111" "0000870536" "0000413112" "0000870537" "0000413113" "0000870538" "0000413114" "0000870539" "0000413115" "0000870540" "0000413116" "0000870541" "0000413117" "0000870542" "0000413118" "0000870543" "0000413119" "0000870544" "0000413120" "0000870545" "0000413121" "0000870546" "0000413122" "0000870547" "0000413123" "0000870548" "0000413124" "0000870549" "0000413125" "0000870550" "0000413126" "0000870551" "0000413127" "0000870552" "0000413128" "0000870553" "0000413129" "0000870554" "0000413130" "0000870555" "0000413131" "0000870556" "0000413132" "0000870557" "0000413133" "0000870558" "0000413134" "0000870559" "0000413135" "0000870560" "0000413136" "0000870561" "0000413137" "0000870562" "0000413138" "0000870563" "0000413139" "0000870564" "0000413140" "0000870565" "0000413141" "0000870566" "0000413142" "0000870567" "0000413143" "0000870568" "0000413144" "0000870569" "0000413145" "0000870570" "0000413146" "0000870571" "0000413147" "0000870572" "0000413148" "0000870573" "0000413149" "0000870574" "0000413150" "0000870575" "0000413151" "0000870576" "0000413152" "0000870577" "0000413153" "0000870578" "0000413154" "0000870579" "0000413155" "0000870580" "0000413156" "0000870581" "0000413157" "0000870582" "0000413158" "0000870583" "0000413159" "0000870584" "0000413160" "0000870585" "0000413161" "0000870586" "0000413162" "0000870587" "0000413163" "0000870588" "0000413164" "0000870589" "0000413165" "0000870590" "0000413166" "0000870591" "0000413167" "0000870592" "0000413168" "0000870593" "0000413169" "0000870594" "0000413170" "0000870595" "0000413171" "0000870597" "0000413172" "0000870598" "0000413173" "0000870599" "0000413174" "0000870600" "0000413175" "0000870601" "0000413176" "0000870602" "0000413177" "0000870603" "0000413178" "0000870604" "0000413179" "0000870605" "0000413180" "0000870606" "0000413181" "0000870607" "0000413182" "0000870608" "0000413183" "0000870609" "0000413184" "0000870610" "0000413185" "0000870611" "0000413186" "0000870612" "0000413188" "0000870614" "0000413189" "0000870615" "0000413190" "0000870616" "0000413191" "0000870617" "0000413192" "0000870618" "0000413193" "0000870619" "0000413195" "0000870621" "0000413196" "0000870622" "0000413268" "0000870714" "0000413269" "0000870715" "0000413270" "0000870716" "0000413271" "0000870717" "0000413272" "0000870718" "0000413273" "0000870719" "0000413274" "0000870720" "0000413275" "0000870721" "0000413276" "0000870722" "0000413277" "0000870723" "0000413278" "0000870724" "0000413279" "0000870725" "0000413280" "0000870726" "0000413281" "0000870727" "0000413282" "0000870728" "0000413283" "0000870729" "0000413284" "0000870730" "0000413285" "0000870731" "0000413286" "0000870732" "0000413287" "0000870733" "0000413288" "0000870734" "0000413289" "0000870735" "0000413290" "0000870736" "0000413291" "0000870737" "0000413292" "0000870738" "0000413293" "0000870739" "0000413294" "0000870740" "0000413295" "0000870741" "0000413296" "0000870742" "0000413297" "0000870743" "0000413298" "0000870744" "0000413299" "0000870745" "0000413300" "0000870746" "0000413301" "0000870747" "0000413302" "0000870748" "0000413303" "0000870749" "0000413304" "0000870750" "0000413305" "0000870751" "0000413306" "0000870752" "0000413307" "0000870753" "0000413308" "0000870754" "0000413309" "0000870755" "0000413310" "0000870756" "0000413311" "0000870757" "0000413312" "0000870758" "0000413313" "0000870759" "0000413314" "0000870760" "0000413315" "0000870761" "0000413316" "0000870762" "0000413317" "0000870763" "0000413318" "0000870764" "0000413319" "0000870765" "0000413320" "0000870766" "0000413321" "0000870767" "0000413322" "0000870768" "0000413323" "0000870769" "0000413324" "0000870770" "0000413325" "0000870771" "0000413326" "0000870772" "0000413327" "0000870773" "0000413328" "0000870774" "0000413329" "0000870775" "0000413330" "0000870776" "0000413331" "0000870777" "0000413332" "0000870778" "0000413333" "0000870779" "0000413334" "0000870780" "0000413335" "0000870781" "0000413336" "0000870782" "0000413337" "0000870783" "0000413338" "0000870784" "0000413339" "0000870785" "0000413340" "0000870786" "0000413341" "0000870787" "0000413342" "0000870788" "0000413343" "0000870789" "0000413344" "0000870790" "0000413345" "0000870791" "0000413346" "0000870792" "0000413347" "0000870793" "0000413348" "0000870794" "0000413349" "0000870795" "0000413350" "0000870796" "0000413351" "0000870797" "0000413352" "0000870798" "0000413365" "0000870818" "0000413366" "0000870819" "0000413367" "0000870820" "0000413368" "0000870821" "0000413369" "0000870822" "0000413370" "0000870823" "0000413371" "0000870824" "0000413372" "0000870825" "0000413373" "0000870826" "0000413374" "0000870827" "0000413375" "0000870828" "0000413376" "0000870829" "0000413377" "0000870830" "0000413378" "0000870831" "0000413379" "0000870832" "0000413385" "0000870840" "0000413386" "0000870841" "0000413387" "0000870842" "0000413388" "0000870843" "0000413389" "0000870844" "0000413390" "0000870845" "0000413391" "0000870846" "0000413392" "0000870847" "0000413393" "0000870848" "0000413394" "0000870849" "0000413395" "0000870850" "0000413396" "0000870851" "0000413397" "0000870852" "0000413398" "0000870853" "0000413399" "0000870854" "0000413400" "0000870855" "0000413401" "0000870856" "0000413402" "0000870857" "0000413403" "0000870858" "0000413404" "0000870859" "0000413407" "0000870862" "0000413408" "0000870863" "0000413409" "0000870864" "0000413410" "0000870865" "0000413411" "0000870866" "0000413412" "0000870867" "0000413413" "0000870868" "0000413414" "0000870869" "0000413415" "0000870870" "0000413416" "0000870871" "0000413417" "0000870872" "0000413418" "0000870873" "0000413419" "0000870874" "0000413420" "0000870875" "0000413421" "0000870876" "0000413422" "0000870877" "0000413423" "0000870878" "0000413424" "0000870879" "0000413425" "0000870880" "0000413426" "0000870881" "0000413427" "0000870882" "0000413428" "0000870883" "0000413429" "0000870884" "0000413430" "0000870885" "0000413431" "0000870886" "0000413432" "0000870887" "0000413433" "0000870888" "0000413434" "0000870889" "0000413435" "0000870890" "0000413436" "0000870891" "0000413439" "0000870908" "0000413440" "0000870909" "0000413441" "0000870910" "0000413442" "0000870911" "0000413446" "0000870941" "0000413453" "0000870948" "0000413454" "0000870949" "0000413455" "0000870950" "0000413456" "0000870951" "0000413457" "0000870952" "0000413458" "0000870953" "0000413459" "0000870954" "0000413460" "0000870955" "0000413461" "0000870956" "0000413462" "0000870957" "0000413463" "0000870958" "0000413464" "0000870959" "0000413465" "0000870960" "0000413466" "0000870961" "0000413467" "0000870963" "0000413468" "0000870964" "0000413469" "0000870965" "0000413471" "0000870968" "0000413472" "0000870969" "0000413473" "0000870970" "0000413474" "0000870971" "0000413475" "0000870972" "0000413476" "0000870973" "0000413477" "0000870974" "0000413480" "0000870977" "0000413481" "0000870978" "0000413482" "0000870979" "0000413483" "0000870980" "0000413484" "0000870981" "0000413485" "0000870982" "0000413486" "0000870983" "0000413487" "0000870984" "0000413488" "0000870985" "0000413489" "0000870986" "0000413490" "0000870987" "0000413491" "0000870988" "0000413492" "0000870989" "0000413493" "0000870990" "0000413494" "0000870991" "0000413496" "0000870993" "0000413497" "0000870994" "0000413498" "0000871003" "0000413499" "0000871004" "0000413500" "0000871005" "0000413501" "0000871006" "0000413502" "0000871007" "0000413503" "0000871008" "0000413504" "0000871009" "0000413505" "0000871010" "0000413506" "0000871011" "0000413516" "0000871021" "0000413517" "0000871022" "0000413518" "0000871023" "0000413519" "0000871024" "0000413520" "0000871025" "0000413521" "0000871026" "0000413522" "0000871027" "0000413523" "0000871028" "0000413524" "0000871029" "0000413525" "0000871030" "0000413526" "0000871031" "0000413529" "0000871036" "0000413530" "0000871037" "0000413531" "0000871038" "0000413532" "0000871039" "0000413533" "0000871040" "0000413534" "0000871041" "0000413535" "0000871042" "0000413536" "0000871043" "0000413537" "0000871044" "0000413547" "0000871054" "0000413548" "0000871055" "0000413549" "0000871056" "0000413550" "0000871057" "0000413551" "0000871058" "0000413553" "0000871060" "0000413554" "0000871061" "0000413555" "0000871062" "0000413556" "0000871063" "0000413557" "0000871064" "0000413558" "0000871065" "0000413559" "0000871066" "0000413560" "0000871067" "0000413561" "0000871068" "0000413563" "0000871071" "0000413564" "0000871072" "0000413565" "0000871073" "0000413566" "0000871074" "0000413567" "0000871075" "0000413568" "0000871076" "0000413569" "0000871077" "0000413570" "0000871078" "0000413571" "0000871079" "0000413587" "0000871096" "0000413588" "0000871097" "0000413589" "0000871098" "0000413590" "0000871099" "0000413591" "0000871100" "0000413592" "0000871101" "0000413593" "0000871102" "0000413594" "0000871103" "0000413595" "0000871104" "0000413596" "0000871105" "0000413654" "0000871169" "0000413655" "0000871170" "0000413656" "0000871171" "0000413657" "0000871172" "0000413658" "0000871173" "0000413659" "0000871174" "0000413660" "0000871175" "0000413661" "0000871176" "0000413662" "0000871177" "0000413663" "0000871178" "0000413664" "0000871179" "0000413665" "0000871180" "0000413666" "0000871181" "0000413667" "0000871182" "0000413668" "0000871183" "0000413669" "0000871184" "0000413670" "0000871185" "0000413671" "0000871186" "0000413672" "0000871187" "0000413673" "0000871188" "0000413674" "0000871189" "0000413675" "0000871190" "0000413676" "0000871191" "0000413677" "0000871192" "0000413678" "0000871193" "0000413679" "0000871194" "0000413680" "0000871195" "0000413681" "0000871196" "0000413682" "0000871197" "0000413683" "0000871198" "0000413684" "0000871199" "0000413685" "0000871200" "0000413686" "0000871201" "0000413687" "0000871202" "0000413688" "0000871203" "0000413689" "0000871204" "0000413690" "0000871205" "0000413691" "0000871206" "0000413692" "0000871207" "0000413693" "0000871208" "0000413694" "0000871209" "0000413695" "0000871210" "0000413696" "0000871211" "0000413697" "0000871212" "0000413698" "0000871213" "0000413699" "0000871214" "0000413700" "0000871215" "0000413701" "0000871216" "0000413702" "0000871217" "0000413703" "0000871218" "0000413704" "0000871219" "0000413705" "0000871220" "0000413706" "0000871221" "0000413707" "0000871222" "0000413708" "0000871223" "0000413711" "0000871226" "0000413712" "0000871227" "0000415639" "0000873475" "0000416675" "0000876101" "0000421733" "0000896499" "0000421776" "0000896567" "0000421898" "0000896737" "0000428260" "0000905959" "0000430896" "0000915785" "0000430946" "0000915850" "0000430980" "0000915897" "0000430987" "0000915905" "0000430999" "0000915927" "0000431030" "0000915969" "0000431052" "0000915999" "0000431059" "0000916009" "0000431061" "0000916012" "0000431097" "0000916060" "0000431132" "0000916107" "0000431153" "0000916142" "0000431235" "0000916284" "0000431246" "0000916299" "0000431253" "0000916310" "0000431263" "0000916323" "0000431272" "0000916339" "0000431318" "0000916409" "0000431352" "0000916458" "0000431387" "0000916514" "0000431394" "0000916523" "0000431413" "0000916550" "0000431485" "0000916666" "0000431493" "0000916678" "0000431521" "0000916715" "0000431546" "0000916752" "0000431549" "0000916755" "0000431552" "0000916758" "0000431559" "0000916767" "0000436890" "0000931568" "0000445882" "0000954067" "0000448524" "0000958010" "0000448525" "0000958011" "0000448527" "0000958013" "0000448528" "0000958014" "0000448529" "0000958015" "0000448535" "0000958021" "0000448540" "0000958026" "0000448545" "0000958031" "0000448567" "0000958053" "0000448585" "0000958071" "0000448886" "0000958372" "0000449127" "0000958894" "0000449194" "0000959404" "0000449198" "0000958965" "0000462707" "0001022258" "0000462713" "0001022264" "0000462717" "0001022268" "0000462721" "0001022272" "0000462741" "0001022292" "0000462746" "0001022297" "0000462770" "0001022321"