### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = RP2)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"RP2" "retinitis pigmentosa 2 (X-linked recessive)" "X" "p11.3" "unknown" "NG_009107.1" "UD_132119043766" "" "http://www.LOVD.nl/RP2" "" "1" "10274" "6102" "300757" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/RP2_NM_006915.2_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2015-02-28 12:57:59" "00006" "2025-11-13 13:04:16"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000666" "RP2" "retinitis pigmentosa 2 (X-linked recessive)" "001" "NM_006915.2" "" "NP_008846.2" "" "" "" "-189" "3642" "1053" "46696347" "46741793" "00000" "2012-09-13 12:45:25" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 12
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00296" "CTRCT" "cataract (CTRCT)" "" "" "" "" "" "00006" "2014-01-16 08:42:13" "00006" "2015-03-07 14:30:33"
"00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25"
"01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"02156" "-" "retinitis pigmentosa, X-linked, and sinorespiratory infections, with/without deafness" "" "300455" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"02261" "RP2" "retinitis pigmentosa, type 2 (RP2)" "XL" "312600" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03367" "OCMD" "dystrophy, macular, occult (OCMD)" "AD" "613587" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-03-11 14:43:46"
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"05426" "XLRP" "retinitis pigmentosa, X-linked (XLRP)" "" "" "" "" "" "00006" "2018-05-07 19:48:33" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"RP2" "02261"
"RP2" "05426"
## Individuals ## Do not remove or alter this header ##
## Count = 411
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" ""
"00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" ""
"00016608" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" ""
"00032853" "" "" "" "6" "" "00006" "" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "M" "" "" "" "0" "" "" "" ""
"00033087" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" ""
"00033091" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033094" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033101" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033105" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00033124" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" ""
"00033162" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" ""
"00105036" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "" "F" "no" "Spain" "" "0" "" "" "" ""
"00105037" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "" "M" "no" "Spain" "" "0" "" "" "" ""
"00164010" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat10004"
"00164011" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat2553"
"00164012" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat2613"
"00164013" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat1168"
"00164014" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat3102"
"00164015" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat2448"
"00164016" "" "" "" "1" "" "00006" "{PMID:Schwahn 1998:9697692}" "" "M" "" "" "" "0" "" "" "" "09697692-Pat2967"
"00164017" "" "" "" "1" "" "00006" "{PMID:Mears 1999:10053026}" "" "M" "" "United States" "" "0" "" "" "" "10053026-PatA2240"
"00164018" "" "" "" "1" "" "00006" "{PMID:Mears 1999:10053026}" "" "M" "" "United States" "" "0" "" "" "" "10053026-PatA1137"
"00164019" "" "" "" "1" "" "00006" "{PMID:Mears 1999:10053026}" "" "M" "" "United States" "" "0" "" "" "" "10053026-PatA1135"
"00164020" "" "" "" "1" "" "00006" "{PMID:Mears 1999:10053026}" "" "M" "" "United States" "" "0" "" "" "" "10053026-PatA512"
"00164021" "" "" "" "1" "" "00006" "{PMID:Mears 1999:10053026}" "" "M" "" "United States" "" "0" "" "" "" "10053026-PatA514"
"00164022" "" "" "" "1" "" "00006" "{PMID:Hardcastle 1999:10090907}" "" "M" "" "United States" "" "0" "" "" "" "10090907-Fam72"
"00164023" "" "" "" "1" "" "00006" "{PMID:Hardcastle 1999:10090907}" "" "M" "" "United States" "" "0" "" "" "" "10090907-Fam15"
"00164024" "" "" "" "5" "" "00006" "{PMID:Hardcastle 1999:10090907}" "3-generation family, 5 affecteds (5M), 2 carrier females" "M" "" "United States" "" "0" "" "" "" "10090907-Fam71"
"00164025" "" "" "" "1" "" "00006" "{PMID:Hardcastle 1999:10090907}" "" "M" "" "United States" "" "0" "" "" "" "10090907-PatRP227"
"00164026" "" "" "" "1" "" "00006" "{PMID:Hardcastle 1999:10090907}" "" "M" "" "United States" "" "0" "" "" "" "10090907-PatNRP"
"00164027" "" "" "" "2" "" "00006" "{PMID:Hardcastle 1999:10090907}" "3-generation family, 2 affecteds (2M), 2 carrier females" "M" "" "United States" "" "0" "" "" "" "10090907-PatRP3877"
"00229651" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" ""
"00233577" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233578" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233579" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233580" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233581" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233582" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233583" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233584" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233585" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233808" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233809" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233810" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00240452" "" "" "" "1" "" "03335" "" "" "M" "" "Mexico" "" "0" "" "" "" ""
"00240453" "" "" "" "1" "" "03335" "" "" "M" "" "Mexico" "" "0" "" "" "" ""
"00240454" "" "" "" "1" "" "03335" "" "" "F" "" "Mexico" "" "0" "" "" "" ""
"00308553" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308554" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308657" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" ""
"00309375" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309376" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309377" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00309378" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00309379" "" "" "" "1" "" "00004" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "1 IRD family" "M" "" "Israel" "" "0" "" "" "" "MOL0574"
"00309672" "" "" "" "1" "" "00006" "{PMID:Jinda 2014:24618324}" "2-generation family, 3 affected (3M)" "M" "" "Thailand" "" "0" "" "" "" "RP087"
"00309731" "" "" "" "1" "" "00006" "{PMID:Kimchi 2018:29276052}" "" "" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" ""
"00325437" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "M" "" "Mexico" "" "0" "" "" "" "2637"
"00325465" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "M" "" "Mexico" "" "0" "" "" "" "3354"
"00325481" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "M" "" "Mexico" "" "0" "" "" "" "3533"
"00327042" "" "" "" "10" "" "00006" "{PMID:Rosenberg 1999:10520237}" "6-generation family, 6 affected males, 4 affected/7 non-affected carrier females" "F;M" "" "Denmark" "" "0" "" "" "" "FamRP200309"
"00327043" "" "" "" "8" "" "00006" "{PMID:Rosenberg 1999:10520237}" "5-generation family, 5 affected males, 3 affected/2 non-affected carrier females" "F;M" "" "Denmark" "" "0" "" "" "" "FamRP200307"
"00327044" "" "" "" "4" "" "00006" "{PMID:Rosenberg 1999:10520237}" "4-generation family, 4 affected males, 3 non-affected carrier females" "M" "" "Denmark" "" "0" "" "" "" "FamRP200322"
"00327052" "" "" "" "1" "" "00006" "{PMID:Parmeggiani 2017:27768226}" "" "" "" "Italy" "" "0" "" "" "" "RP-001"
"00327402" "" "" "" "1" "" "00006" "{PMID:Bader 2003:12657579}" "" "M" "" "Germany" "" "0" "" "" "" "RP04/1759"
"00327403" "" "" "" "1" "" "00006" "{PMID:Bader 2003:12657579}" "" "M" "" "Germany" "" "0" "" "" "" "RP28/1125"
"00327404" "" "" "" "1" "" "00006" "{PMID:Bader 2003:12657579}" "" "M" "" "Germany" "" "0" "" "" "" "XRP32/8801"
"00327405" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "patients" "M" "" "United States" "" "0" "" "" "" ""
"00327406" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1694"
"00327407" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "471"
"00327408" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "790"
"00327409" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1358"
"00327410" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "115"
"00327411" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1645"
"00327412" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1699"
"00327413" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1324"
"00327414" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1737"
"00327415" "" "" "" "1" "" "00000" "{PMID:Breuer 2002:11992260}" "" "M" "" "United States" "" "0" "" "" "" "1063"
"00327471" "" "" "" "6" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "3-generation family, 6 affected males, 4 unaffected carrier females" "M" "" "(United States)" "" "0" "" "" "" "FamF842Pat004-233"
"00327472" "" "" "" "5" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "4-generation family, 5 affected males, 5 unaffected carrier females" "M" "" "(United States)" "" "0" "" "" "" "Fam2799Pat004-110"
"00327473" "" "" "" "2" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "2-generation family, 2 affected brothers, unaffected carrier mother" "M" "" "(United States)" "" "0" "" "" "" "FamD993Pat004-215"
"00327474" "" "" "" "1" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "M" "" "(United States)" "" "0" "" "" "" "004-149"
"00327475" "" "" "" "5" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "4-generation family, 5 affected males, 6 unaffected carrier females" "M" "" "(United States)" "" "0" "" "" "" "Fam0844Pat004-176"
"00327476" "" "" "" "3" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "4-generation family, 3 affected males, 4 unaffected carrier females" "M" "" "(United States)" "" "0" "" "" "" "FamD202Pat004-229"
"00327477" "" "" "" "3" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "M" "" "(United States)" "" "0" "" "" "" "cases"
"00327478" "" "" "" "3" "" "00000" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "M" "" "(United States)" "" "0" "" "" "" "controls"
"00327479" "" "" "" "1" "" "00000" "{PMID:Sharon 2003:14564670}" "" "M" "" "United States" "" "0" "" "" "" "039-109"
"00327480" "" "" "" "1" "" "00000" "{PMID:Sharon 2003:14564670}" "" "M" "" "United States" "" "0" "" "" "" "121-237"
"00327481" "" "" "" "1" "" "00000" "{PMID:Sharon 2003:14564670}" "" "M" "" "United States" "" "0" "" "" "" "004-288"
"00327482" "" "" "" "1" "" "00000" "{PMID:Sharon 2003:14564670}" "" "M" "" "United States" "" "0" "" "" "" "121-211"
"00327483" "" "" "" "1" "" "00000" "{PMID:Sharon 2003:14564670}" "" "M" "" "United States" "" "0" "" "" "" "004-284"
"00327989" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001024"
"00328077" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G004993"
"00328149" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G005998"
"00328154" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G006008"
"00328326" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000329"
"00328413" "" "" "" "1" "" "00000" "{PMID:Zhou 2018:29453956}" "" "M" "" "China" "" "0" "" "" "" "690347"
"00328414" "" "" "" "1" "" "00000" "{PMID:Zhou 2018:29453956}" "" "F" "" "China" "" "0" "" "" "" "691008"
"00328549" "" "" "" "3" "" "00006" "{PMID:Andreasson 2003:14566651}" "3-generation family, 3 affected males, 3 unaffected carrier females" "M" "" "Sweden" "" "0" "" "" "" "Fam641"
"00331286" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "M" "" "Japan" "" "0" "" "" "" "Pat40"
"00332220" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB41"
"00332457" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat19"
"00332502" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat27"
"00332503" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat28"
"00332544" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "F" "" "United States" "" "0" "" "" "" "Pat31"
"00333480" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "3772"
"00333481" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "JMS_011"
"00333521" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "69"
"00333522" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "70"
"00333523" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "71"
"00333531" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "200"
"00333532" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "201"
"00333533" "" "" "" "4" "" "00000" "{PMID:Stone 2017:28559085}" "family, 4 affected" "M" "" "(United States)" "" "0" "" "" "" "202"
"00333534" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "203"
"00333580" "" "" "" "3" "" "00000" "{PMID:Stone 2017:28559085}" "family, 3 affected" "M" "" "(United States)" "" "0" "" "" "" "282"
"00334436" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "family" "" "" "China" "" "0" "" "" "" "RP-170"
"00334566" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP087"
"00335154" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "family" "" "no" "Netherlands" "" "0" "" "" "" "6492"
"00335155" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "492"
"00335254" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/42"
"00335323" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "F" "" "Spain" "" "0" "" "" "" "Pat70"
"00335391" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP059"
"00335408" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP090"
"00335412" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP006"
"00335421" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP027"
"00335494" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD033"
"00335990" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00358778" "" "" "" "1" "" "00000" "{PMID:Fujinami 2016:27623337}" "" "F" "" "Japan" "" "0" "" "" "" "Fam21PatII1"
"00359060" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "11011508"
"00359117" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13010985"
"00359148" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13011266"
"00359157" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13010104"
"00359166" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13016075"
"00362192" "" "" "" "1" "" "00000" "{PMID:Perez-Carro 2016:26806561}" "" "" "" "Spain" "" "0" "" "" "" "RP-1201"
"00362588" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362589" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362590" "" "" "" "2" "" "00008" "{PMID:Pelletier 2007:16969763}" "2 families with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362591" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with male sporadic case" "M" "" "France" "" "0" "" "" "French" ""
"00362592" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362593" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362594" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362595" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial cases of RP segregating in males and females over at least two generations with no male to male transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362596" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362597" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362598" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362599" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362600" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00362601" "" "" "" "1" "" "00008" "{PMID:Pelletier 2007:16969763}" "1 family with familial case of RP with nonambiguous X-linked transmission" "F" "" "France" "" "0" "" "" "French" ""
"00363469" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "U6Z+5.73"
"00363620" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG0873"
"00363714" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG2227"
"00372078" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "family" "" "" "Korea" "" "0" "" "" "" "F04"
"00372083" "" "" "" "1" "" "00000" "{PMID:Yoon 2015:26155838}" "family" "" "" "Korea" "" "0" "" "" "" "F12"
"00372514" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "82"
"00372684" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP263"
"00372685" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP056"
"00372686" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP223"
"00372687" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP288"
"00373477" "" "" "" "2" "" "00000" "{PMID:Fernandez-San Jose 2015:25698705}" "family, 2 affected" "" "" "Spain" "" "0" "" "" "" "RP1682"
"00373813" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat10"
"00373862" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "family" "" "" "Northern Ireland" "" "0" "" "" "" "Rp181"
"00373884" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-028-068"
"00373922" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-006-012"
"00373938" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-303-707"
"00374896" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "M" "" "China" "" "0" "" "" "" "W132-1"
"00374912" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "M" "" "China" "" "0" "" "" "" "F9-1"
"00375439" "" "" "" "1" "" "00000" "{PMID:Watson 2014:25133751}" "family" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "MA8"
"00375454" "" "" "" "1" "" "00000" "{PMID:Pan 2014:24940031}" "3-generation family, 1 affected (M)" "" "" "China" "" "0" "" "" "" "Fam07"
"00375455" "" "" "" "3" "" "00000" "{PMID:Pan 2014:24940031}" "3-generation family, 3 affected (3M)" "" "" "China" "" "0" "" "" "" "Fam08"
"00376241" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2008:18552978}" "Geographic origin either Germany, Netherlands, Denmark or Switzerland" "" "" "" "" "0" "" "" "" ""
"00376242" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2008:18552978}" "Geographic origin either Germany, Netherlands, Denmark or Switzerland" "" "" "" "" "0" "" "" "" ""
"00376243" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2008:18552978}" "Geographic origin either Germany, Netherlands, Denmark or Switzerland" "" "" "" "" "0" "" "" "" ""
"00376244" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2008:18552978}" "Geographic origin either Germany, Netherlands, Denmark or Switzerland" "" "" "" "" "0" "" "" "" ""
"00376245" "" "" "" "1" "" "00000" "{PMID:Neidhardt 2008:18552978}" "Geographic origin either Germany, Netherlands, Denmark or Switzerland" "" "" "" "" "0" "" "" "" ""
"00376676" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376677" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376678" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376679" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376680" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376681" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376682" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376683" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376684" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376685" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376686" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376687" "" "" "" "1" "" "00000" "{PMID:Prokisch 2007:17724181}" "" "" "" "Denmark" "" "0" "" "" "Danish" ""
"00376749" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "7"
"00376752" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "12"
"00376767" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "29"
"00376784" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "50"
"00376815" "" "" "" "1" "" "00000" "{PMID:Daiger 2014:24664689}" "" "" "" "United States" "" "0" "" "" "" "RFS021"
"00376991" "" "" "" "1" "" "00000" "{PMID:Ji-2010:20021257}" "" "M" "" "United States" "" "0" "" "" "Chinese" ""
"00376992" "" "" "" "1" "" "00000" "{PMID:Ji-2010:20021257}" "" "M" "" "United States" "" "0" "" "" "Chinese" ""
"00377264" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "395"
"00377499" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "RP-1313"
"00377500" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "RP-1682"
"00377527" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family EYE114" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE114"
"00379423" "" "" "" "1" "" "00000" "{PMID:Zhou 2011:29453956}" "" "M" "" "China" "" "0" "" "" "" ""
"00379424" "" "" "" "1" "" "00000" "{PMID:Zhou 2011:29453956}" "" "" "" "China" "" "0" "" "" "" ""
"00379544" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0002"
"00379647" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0029"
"00379774" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0132"
"00379800" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0160"
"00379879" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016102409"
"00380763" "" "" "" "1" "" "00000" "{PMID:Fu 2018:30280194}" "" "F" "no" "China" "" "0" "" "" "" "H-II-2"
"00380764" "" "" "" "1" "" "00000" "{PMID:Fu 2018:30280194}" "" "M" "no" "China" "" "0" "" "" "" "H-III-1"
"00380943" "" "" "" "1" "" "00000" "{PMID:Branham-2012:23150612}" "" "M" "" "" "" "0" "" "" "" ""
"00380944" "" "" "" "1" "" "00000" "{PMID:Branham-2012:23150612}" "" "M" "" "" "" "0" "" "" "" ""
"00380945" "" "" "" "1" "" "00000" "{PMID:Branham-2012:23150612}" "" "M" "" "" "" "0" "" "" "" ""
"00380946" "" "" "" "1" "" "00000" "{PMID:Branham-2012:23150612}" "" "M" "" "" "" "0" "" "" "" ""
"00380973" "" "" "" "1" "" "00000" "{PMID:Churchill-2013:23372056}" "" "" "" "United States" "" "0" "" "" "" ""
"00380974" "" "" "" "1" "" "00000" "{PMID:Churchill-2013:23372056}" "" "" "" "United States" "" "0" "" "" "" ""
"00381001" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" ""
"00381004" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" ""
"00381637" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Italy" "" "0" "" "" "" ""
"00381638" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "" "" "0" "" "" "Southeast Europe" ""
"00381647" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" ""
"00381929" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "79"
"00381930" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "80"
"00381931" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "81"
"00381956" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "25"
"00382415" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "244"
"00382416" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "245"
"00382417" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "246"
"00382420" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "249"
"00382421" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "250"
"00382422" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "251"
"00382423" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "252"
"00382780" "" "" "" "1" "" "00000" "{PMID:De Luca-2001:11465545}" "" "" "no" "" "" "0" "" "" "italian" ""
"00382781" "" "" "" "1" "" "00000" "{PMID:De Luca-2001:11465545}" "" "" "no" "" "" "0" "" "" "italian" ""
"00382782" "" "" "" "1" "" "00000" "{PMID:De Luca-2001:11465545}" "" "" "no" "" "" "0" "" "" "italian" ""
"00383503" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00383776" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18073517_A"
"00383784" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18083946_A"
"00383785" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18083947_A"
"00383838" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" ""
"00385028" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19432"
"00385034" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19517"
"00385083" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "67360"
"00385421" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31872526}" "" "M" "" "Taiwan" "" "0" "" "" "" "F32-II-1"
"00385611" "" "" "" "2" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "M" "" "" "" "0" "" "" "" "10RE"
"00385619" "" "" "" "3" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "M" "" "" "" "0" "" "" "" "20NCE"
"00385738" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "no" "China" "" "0" "" "" "" "12"
"00385739" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "no" "China" "" "0" "" "" "" "79"
"00386701" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2827_004412"
"00386770" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2919_004504"
"00386807" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2964_004549"
"00387386" "" "" "" "1" "" "00000" "{PMID:Sun 2020:32100970}" "" "M" "" "China" "" "0" "" "" "" "6"
"00388263" "" "" "" "1" "" "00000" "{PMID:Toulis 2020:32244552}" "proband" "M" "" "Spain" "" "0" "" "" "" "3.1"
"00388832" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 52, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "116"
"00389057" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 114, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "341"
"00389076" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 120, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "360"
"00389085" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 123, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "369"
"00389086" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 123, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "370"
"00389093" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 125, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "377"
"00389094" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 125, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "378"
"00389136" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 135, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "420"
"00389247" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 180, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "531"
"00389302" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 211, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "586"
"00389303" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 211, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "587"
"00389306" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 212, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "590"
"00389314" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 215, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "598"
"00389315" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 216, X-linked retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "599"
"00390385" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001024"
"00390386" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G004993"
"00390387" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005998"
"00390388" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006008"
"00390389" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000329"
"00390867" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "M" "" "Switzerland" "" "0" "" "" "" ""
"00391566" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "Asian" "63"
"00391567" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "Maori" "64"
"00392126" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-569"
"00392127" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-418"
"00392128" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-573"
"00392129" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-574"
"00392131" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-576"
"00392132" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-643"
"00392133" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-644"
"00392142" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-578"
"00392143" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-481"
"00392151" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-569"
"00392152" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-418"
"00392153" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-573"
"00392154" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-574"
"00392156" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-576"
"00392157" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-643"
"00392158" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "F" "" "Spain" "" "0" "" "" "" "RPN-644"
"00392167" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-578"
"00392168" "" "" "" "1" "" "00000" "{PMID:Rodriguez Munoz 2021:33411470}" "family ID fRPN-NB, second family loop (great-greatgrandparents of proband in common)" "M" "" "Spain" "" "0" "" "" "" "RPN-481"
"00392318" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "191024"
"00392366" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "F" "" "China" "" "0" "" "" "" "19546"
"00392651" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "137"
"00392669" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "162"
"00393506" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393655" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393717" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393718" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393794" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00394763" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394764" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394765" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394766" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00394767" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" ""
"00395866" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F146"
"00395942" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F198"
"00396487" "" "" "" "1" "" "00000" "{PMID:Dockery 2017:29099798}" "no patient numbers in the paper, consecutive numbers given" "?" "" "Ireland" "" "0" "" "" "" "20"
"00396616" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" ""
"00405216" "" "" "" "1" "" "00000" "Dickson 2019 (https://www.hilarispublisher.com/open-access/novel-emrp2em-gene-deletion-in-a-patient-with-bilateral-retinitis-pigmentosa-insights-of-technical-challenges-of-next-ge.pdf)" "" "M" "" "(United States)" "" "0" "" "" "" "P1"
"00405217" "" "" "" "1" "" "00000" "{PMID:Wada-2000:10634633}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "III-4"
"00405218" "" "" "" "1" "" "00000" "{PMID:Wada-2000:10634633}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "III-1"
"00405219" "" "" "" "2" "" "00000" "{PMID:Wada-2000:10634633}" "Carriers with no visual complaints" "F" "" "Japan" "" "0" "" "" "Japanese" "II-3, II-4"
"00405220" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "Fam:F21"
"00405221" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "Fam:GT1"
"00405222" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "1"
"00405223" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "2"
"00405224" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "3"
"00405225" "" "" "" "1" "" "00000" "{PMID:Thiseton-2000:10862093}" "" "" "" "(United Kingdom (Great Britain))" "" "0" "" "" "British" "5"
"00405226" "" "" "" "1" "" "00000" "{PMID:Mashima-2001:11262649}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "III-1"
"00405227" "" "" "" "1" "" "00000" "{PMID:Mashima-2001:11262649}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "II-2"
"00405228" "" "" "" "1" "" "00000" "{PMID:Mashima-2001:11262649}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "II-3"
"00405229" "" "" "" "2" "" "00000" "{PMID:Mashima-2001:11262649}" "Carriers" "F" "" "Japan" "" "0" "" "" "Japanese" "I-1, II-1"
"00405230" "" "" "" "1" "" "00000" "{PMID:Miano-2001:11462235}" "Also 1 female carrier confirmed" "M" "" "Italy" "" "0" "" "" "" "xlrp-MT"
"00405231" "" "" "" "3" "" "00000" "{PMID:Miano-2001:11462235}" "Also 3 female carriers confirmed" "M" "" "Italy" "" "0" "" "" "" "xlrp-10.2"
"00405232" "" "" "" "2" "" "00000" "{PMID:Miano-2001:11462235}" "Also 2 female carriers confirmed" "M" "" "Yugoslavia" "" "0" "" "" "" "xlrp-BE"
"00405233" "" "" "" "1" "" "00000" "{PMID:Miano-2001:11462235}" "Also 3 female carriers confirmed" "M" "" "Spain" "" "0" "" "" "" "xlrp- 1793"
"00405234" "" "" "" "2" "" "00000" "{PMID:Miano-2001:11462235}" "Also 2 female carriers confirmed" "M" "" "Italy" "" "0" "" "" "" "xlrp-FS"
"00405235" "" "" "" "1" "" "00000" "{PMID:Bustamanre_Aragones-2006:17108199}" "Fetus" "" "" "(Spain)" "" "0" "" "" "" ""
"00405236" "" "" "" "1" "" "00000" "{PMID:Pomares 2009:19516003}" "carrier" "F" "" "(Spain)" "" "0" "" "" "" "III.16"
"00405237" "" "" "" "1" "" "00000" "{PMID:Pomares 2009:19516003}" "carrier" "F" "" "(Spain)" "" "0" "" "" "" "IV.11"
"00405238" "" "" "" "1" "" "00000" "{PMID:Pomares 2009:19516003}" "affected" "F" "" "(Spain)" "" "0" "" "" "" "IV.14"
"00405239" "" "" "" "1" "" "00000" "{PMID:Pomares 2009:19516003}" "affected" "F" "" "(Spain)" "" "0" "" "" "" "IV.16"
"00405240" "" "" "" "1" "" "00000" "{PMID:Pomares 2009:19516003}" "affected" "M" "" "(Spain)" "" "0" "" "" "" "V.8"
"00405241" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:1090"
"00405242" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:148"
"00405243" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:1015"
"00405244" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:528"
"00405245" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:951"
"00405246" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:933"
"00405247" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:944"
"00405248" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:948"
"00405249" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:652"
"00405250" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:1029"
"00405251" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:971"
"00405252" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:548"
"00405253" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}" "" "" "" "" "" "0" "" "" "" "F:1167"
"00405254" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}, {PMID:Jin 2006:17093403}" "" "" "" "" "" "0" "" "" "" "Case#324"
"00405255" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}, {PMID:Mashima 2000:11020419}" "" "" "" "" "" "0" "" "" "" "Case#425"
"00405256" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}, {PMID:Vorster 2004:15032968}" "" "" "" "" "" "0" "" "" "" "Case#526"
"00405257" "" "" "" "1" "" "00000" "{PMID:Jayasundra-2010:20625056}, {PMID:Kuhnel 2006:16472755}" "" "" "" "" "" "0" "" "" "" "Case#717"
"00405258" "" "" "" "1" "" "00000" "{PMID:De Lin-2014:24479636}" "" "" "" "Taiwan" "" "0" "" "" "Han Taiwanese" "1"
"00405259" "" "" "" "8" "" "00000" "{PMID:De Lin-2014:24479636}" "" "" "" "Taiwan" "" "0" "" "" "Han Taiwanese" "2"
"00405260" "" "" "" "1" "" "00000" "{PMID:Misky-2016:26885761}" "" "M" "" "(France)" "" "0" "" "" "" "III:2"
"00405261" "" "" "" "1" "" "00000" "{PMID:Misky-2016:26885761}" "" "F" "" "(France)" "" "0" "" "" "" "II:5"
"00405262" "" "" "" "1" "" "00000" "{PMID:Lim-2016:27769321}" "probands mother" "F" "" "(Canada)" "" "0" "" "" "" "1"
"00405263" "" "" "" "6" "" "00000" "{PMID:Lim-2016:27769321}" "" "M" "" "(Canada)" "" "0" "" "" "" "2"
"00405264" "" "" "" "1" "" "00000" "{PMID:Zhang-2019:31071385}" "" "M" "" "China" "" "0" "" "" "Chinese" "II-6"
"00405265" "" "" "" "1" "" "00000" "{PMID:Zhang-2019:31071385}" "carrier" "F" "" "China" "" "0" "" "" "Chinese" "III-2"
"00405266" "" "" "" "1" "" "00000" "{PMID:Zhang-2019:31071385}" "" "M" "" "China" "" "0" "" "" "Chinese" "III-1"
"00405267" "" "" "" "1" "" "00000" "{PMID:Zhang-2019:31071385}" "" "M" "" "China" "" "0" "" "" "Chinese" "IV-1"
"00405268" "" "" "" "1" "" "00000" "{PMID:Zhang-2019:31071385}" "carrier" "F" "" "China" "" "0" "" "" "Chinese" "II-2"
"00405269" "" "" "" "1" "" "00000" "{PMID:Horner-2019:31079036}" "" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" ""
"00414313" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 8, Patient 8" "M" "no" "Japan" "" "0" "" "" "" "Patient 8"
"00414314" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 9, Patient 9" "M" "no" "Japan" "" "0" "" "" "" "Patient 9"
"00414315" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 10, Patient 10" "M" "no" "Japan" "" "0" "" "" "" "Patient 10"
"00414316" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 11, Patient 11" "M" "no" "Japan" "" "0" "" "" "" "Patient 11"
"00414317" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 11, Patient 12" "M" "no" "Japan" "" "0" "" "" "" "Patient 12"
"00414318" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 12, Patient 13" "M" "no" "Japan" "" "0" "" "" "" "Patient 13"
"00414329" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 8, Carrier 11" "F" "no" "Japan" "" "0" "" "" "" "Carrier 11"
"00414330" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 9, Carrier 12" "F" "no" "Japan" "" "0" "" "" "" "Carrier 12"
"00414331" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 10, Carrier 13" "F" "no" "Japan" "" "0" "" "" "" "Carrier 13"
"00414332" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 11, Carrier 14" "F" "no" "Japan" "" "0" "" "" "" "Carrier 14"
"00414333" "" "" "" "1" "" "00000" "{PMID:Kurata 2019:30917587}" "Family 12, Carrier 15" "F" "no" "Japan" "" "0" "" "" "" "Carrier 15"
"00419570" "" "" "" "2" "" "02300" "{PMID:Marinakis 2021:34008892}" "2-generation family, patient with carrier mother" "F" "" "Greece" "" "0" "" "" "" "9104"
"00420478" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F146"
"00420511" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F198"
"00426931" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 36, individual 42" "M" "" "" "" "0" "" "" "" "36_42"
"00429570" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429616" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429675" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429735" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429739" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429869" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430005" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430024" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430036" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430037" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430093" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430102" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430144" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00436458" "" "" "" "1" "" "04552" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "M" "no" "Mexico" "" "" "" "none" "Hispanic" "2694892"
"00436463" "" "" "" "1" "" "04552" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "M" "no" "Mexico" "" "" "" "none" "Hispanic" "3785275"
"00445388" "" "" "" "3" "" "00006" "{PMID:de Bruijn 2023:36524988}" "family, 3 affected" "" "" "" "" "0" "" "" "" "071067"
"00446978" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-407"
"00447120" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "CRD-844-1"
"00447121" "" "" "00447120" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "relative" "M" "" "Germany" "" "0" "" "" "" "CRD-844-2"
"00447387" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "STGD-443"
"00447453" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "XRP-184"
"00447456" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "XRP-199"
"00447458" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "XRP-224"
"00447464" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "XRP-233"
"00447468" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "F" "" "Germany" "" "0" "" "" "" "XRP-237"
"00447470" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "M" "" "Germany" "" "0" "" "" "" "XRP-239"
"00447471" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "XRP-240"
"00447477" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "XRP-246"
"00447480" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "XRP-255"
"00447587" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-508"
"00447646" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "XRP-189"
"00447648" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "F" "" "Germany" "" "0" "" "" "" "XRP-254"
"00461123" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat58"
"00468510" "" "" "" "2" "" "00006" "{PMID:Wang 2024:38184101}" "family" "M" "" "China" "" "0" "" "" "" "Pat69"
"00469294" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" ""
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 410
"{{individualid}}" "{{diseaseid}}"
"00000208" "01157"
"00000209" "01157"
"00032853" "00187"
"00033087" "04214"
"00033091" "04214"
"00033094" "04214"
"00033101" "04214"
"00033105" "04214"
"00033124" "04214"
"00033162" "04214"
"00105036" "04214"
"00105037" "04214"
"00164010" "05426"
"00164011" "05426"
"00164012" "05426"
"00164013" "05426"
"00164014" "05426"
"00164015" "05426"
"00164016" "05426"
"00164017" "05426"
"00164018" "05426"
"00164019" "05426"
"00164020" "05426"
"00164021" "05426"
"00164022" "05426"
"00164023" "05426"
"00164024" "05426"
"00164025" "05426"
"00164026" "05426"
"00164027" "05426"
"00229651" "00198"
"00233577" "04214"
"00233578" "04214"
"00233579" "04214"
"00233580" "04214"
"00233581" "04214"
"00233582" "04214"
"00233583" "04214"
"00233584" "04214"
"00233585" "04214"
"00233808" "04214"
"00233809" "04214"
"00233810" "04214"
"00240452" "00381"
"00240453" "00381"
"00240454" "00381"
"00308553" "04214"
"00308554" "04214"
"00308657" "04214"
"00309375" "04214"
"00309376" "04214"
"00309377" "04214"
"00309378" "04214"
"00309379" "04214"
"00309672" "04214"
"00309731" "04214"
"00325437" "04214"
"00325465" "04214"
"00325481" "04214"
"00327042" "04214"
"00327043" "04214"
"00327044" "04214"
"00327052" "04214"
"00327402" "04214"
"00327403" "04214"
"00327404" "04214"
"00327405" "00000"
"00327406" "04214"
"00327407" "04214"
"00327408" "04214"
"00327409" "04214"
"00327410" "04214"
"00327411" "04214"
"00327412" "04214"
"00327413" "04214"
"00327414" "04214"
"00327415" "04214"
"00327471" "04214"
"00327472" "04214"
"00327473" "04214"
"00327474" "04214"
"00327475" "04214"
"00327476" "04214"
"00327477" "04214"
"00327478" "00000"
"00327479" "04214"
"00327480" "04214"
"00327481" "04214"
"00327482" "04214"
"00327483" "04214"
"00327989" "04214"
"00328077" "04214"
"00328149" "04214"
"00328154" "04214"
"00328326" "04214"
"00328413" "04214"
"00328414" "04214"
"00328549" "04214"
"00331286" "04214"
"00332220" "04214"
"00332457" "04214"
"00332502" "04214"
"00332503" "04214"
"00332544" "04214"
"00333480" "04214"
"00333481" "04214"
"00333521" "04214"
"00333522" "04214"
"00333523" "04214"
"00333531" "04214"
"00333532" "04214"
"00333533" "04214"
"00333534" "04214"
"00333580" "04214"
"00334436" "04214"
"00334566" "04214"
"00335154" "00198"
"00335155" "00198"
"00335254" "04214"
"00335323" "04214"
"00335391" "04214"
"00335408" "04214"
"00335412" "04214"
"00335421" "04214"
"00335494" "04214"
"00335990" "04214"
"00358778" "03367"
"00359060" "04214"
"00359117" "04214"
"00359148" "04214"
"00359157" "04214"
"00359166" "04214"
"00362192" "04214"
"00362588" "04214"
"00362589" "04214"
"00362590" "04214"
"00362591" "04214"
"00362592" "04214"
"00362593" "04214"
"00362594" "04214"
"00362595" "04214"
"00362596" "04214"
"00362597" "04214"
"00362598" "04214"
"00362599" "04214"
"00362600" "04214"
"00362601" "04214"
"00363469" "04214"
"00363620" "04214"
"00363714" "04214"
"00372078" "04214"
"00372083" "04214"
"00372514" "04214"
"00372684" "04214"
"00372685" "04214"
"00372686" "04214"
"00372687" "04214"
"00373477" "04214"
"00373813" "04214"
"00373862" "04214"
"00373884" "04214"
"00373922" "04214"
"00373938" "04214"
"00374896" "04214"
"00374912" "04214"
"00375439" "04214"
"00375454" "04214"
"00375455" "04214"
"00376241" "04214"
"00376242" "04214"
"00376243" "04214"
"00376244" "04214"
"00376245" "04214"
"00376676" "04214"
"00376677" "04214"
"00376678" "04214"
"00376679" "04214"
"00376680" "04214"
"00376681" "04214"
"00376682" "04214"
"00376683" "04214"
"00376684" "04214"
"00376685" "04214"
"00376686" "04214"
"00376687" "04214"
"00376749" "04214"
"00376752" "04214"
"00376767" "04214"
"00376784" "04214"
"00376815" "04214"
"00376991" "04214"
"00376992" "04214"
"00377264" "04214"
"00377499" "04214"
"00377500" "04214"
"00377527" "04214"
"00379423" "04214"
"00379424" "04214"
"00379544" "00112"
"00379647" "00112"
"00379774" "00112"
"00379800" "00112"
"00379879" "04214"
"00380763" "04214"
"00380764" "04214"
"00380943" "04214"
"00380944" "04214"
"00380945" "04214"
"00380946" "04214"
"00380973" "04214"
"00380974" "04214"
"00381001" "04214"
"00381004" "04214"
"00381637" "04214"
"00381638" "04214"
"00381647" "04214"
"00381929" "04214"
"00381930" "04214"
"00381931" "04214"
"00381956" "04214"
"00382415" "04214"
"00382416" "04214"
"00382417" "04214"
"00382420" "04214"
"00382421" "04214"
"00382422" "04214"
"00382423" "04214"
"00382780" "04214"
"00382781" "04214"
"00382782" "04214"
"00383503" "04214"
"00383776" "04214"
"00383784" "04214"
"00383785" "04214"
"00383838" "04214"
"00385028" "04214"
"00385034" "04214"
"00385083" "04214"
"00385421" "04214"
"00385611" "04214"
"00385619" "04214"
"00385738" "04214"
"00385739" "04214"
"00386701" "04214"
"00386770" "04214"
"00386807" "04214"
"00387386" "04214"
"00388263" "04214"
"00388832" "04214"
"00389057" "04214"
"00389076" "04214"
"00389085" "04214"
"00389086" "04214"
"00389093" "04214"
"00389094" "04214"
"00389136" "04214"
"00389247" "04214"
"00389302" "04214"
"00389303" "04214"
"00389306" "04214"
"00389314" "04214"
"00389315" "04214"
"00390385" "04214"
"00390386" "04214"
"00390387" "04214"
"00390388" "04214"
"00390389" "04214"
"00390867" "04214"
"00391566" "04214"
"00391567" "04214"
"00392126" "04214"
"00392127" "04214"
"00392128" "04214"
"00392129" "04214"
"00392131" "04214"
"00392132" "04214"
"00392133" "04214"
"00392142" "04214"
"00392143" "04214"
"00392151" "04214"
"00392152" "04214"
"00392153" "04214"
"00392154" "04214"
"00392156" "04214"
"00392157" "04214"
"00392158" "04214"
"00392167" "04214"
"00392168" "04214"
"00392318" "04214"
"00392366" "04214"
"00392651" "04214"
"00392669" "04214"
"00393506" "04214"
"00393655" "04214"
"00393717" "04214"
"00393718" "04214"
"00393794" "04214"
"00394763" "04214"
"00394764" "04214"
"00394765" "04214"
"00394766" "04214"
"00394767" "04214"
"00395866" "04214"
"00395942" "04214"
"00396487" "04214"
"00396616" "04214"
"00405216" "04214"
"00405217" "04214"
"00405218" "04214"
"00405219" "00000"
"00405220" "04214"
"00405221" "04214"
"00405222" "04214"
"00405223" "04214"
"00405224" "04214"
"00405225" "04214"
"00405226" "04214"
"00405227" "04214"
"00405228" "04214"
"00405229" "00000"
"00405230" "04214"
"00405231" "04214"
"00405232" "04214"
"00405233" "04214"
"00405234" "04214"
"00405235" "04214"
"00405236" "00000"
"00405237" "00000"
"00405238" "04214"
"00405239" "04214"
"00405240" "04214"
"00405241" "04214"
"00405242" "04214"
"00405243" "04214"
"00405244" "04214"
"00405245" "04214"
"00405246" "04214"
"00405247" "04214"
"00405248" "04214"
"00405249" "04214"
"00405250" "00000"
"00405251" "04214"
"00405252" "04214"
"00405253" "04214"
"00405254" "04214"
"00405255" "04214"
"00405256" "04214"
"00405257" "04214"
"00405258" "04214"
"00405259" "00000"
"00405260" "04214"
"00405261" "04214"
"00405262" "00000"
"00405263" "04214"
"00405264" "04214"
"00405265" "00000"
"00405266" "04214"
"00405267" "04214"
"00405268" "00000"
"00405269" "04214"
"00414313" "04214"
"00414314" "04214"
"00414315" "04214"
"00414316" "04214"
"00414317" "04214"
"00414318" "04214"
"00414329" "04214"
"00414330" "04214"
"00414331" "04214"
"00414332" "04214"
"00414333" "04214"
"00419570" "00198"
"00420478" "04214"
"00420511" "04214"
"00426931" "04214"
"00429570" "00112"
"00429616" "00112"
"00429675" "00112"
"00429735" "00112"
"00429739" "00112"
"00429869" "00112"
"00430005" "00112"
"00430024" "00112"
"00430036" "00112"
"00430037" "00112"
"00430093" "00112"
"00430102" "00112"
"00430144" "00112"
"00436458" "02156"
"00436463" "02156"
"00445388" "00112"
"00446978" "00198"
"00447120" "00198"
"00447121" "00198"
"00447387" "00198"
"00447453" "00198"
"00447456" "00198"
"00447458" "00198"
"00447464" "00198"
"00447468" "00198"
"00447470" "00198"
"00447471" "00198"
"00447477" "00198"
"00447480" "00198"
"00447587" "00198"
"00447646" "00198"
"00447648" "00198"
"00461123" "04214"
"00468510" "00296"
"00469294" "00198"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00112, 00187, 00198, 00296, 00381, 01157, 02156, 02261, 03367, 04214, 05426
## Count = 392
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000026282" "00187" "00032853" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026516" "04214" "00033087" "00229" "Unknown" "7y" "clumped pigmentary retinal degeneration" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026520" "04214" "00033091" "00229" "Unknown" "<10y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026523" "04214" "00033094" "00229" "Unknown" "22y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026530" "04214" "00033101" "00229" "Unknown" "31y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026534" "04214" "00033105" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026553" "04214" "00033124" "00229" "Unknown" "10y" "dystrophy, macular, juvenile" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026591" "04214" "00033162" "00229" "Unknown" "4y" "retinal degeneration, severe, early onset (EOSRD)" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "" ""
"0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "" ""
"0000082927" "04214" "00105036" "01244" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000082928" "04214" "00105037" "01244" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000129116" "05426" "00164010" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129117" "05426" "00164011" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129118" "05426" "00164012" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129119" "05426" "00164013" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129120" "05426" "00164014" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129121" "05426" "00164015" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129122" "05426" "00164016" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129123" "05426" "00164017" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129124" "05426" "00164018" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129125" "05426" "00164019" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129126" "05426" "00164020" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129127" "05426" "00164021" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129128" "05426" "00164022" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129129" "05426" "00164023" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129134" "05426" "00164024" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129135" "05426" "00164027" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129136" "05426" "00164025" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000129137" "05426" "00164026" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-2" "retinitis pigmentosa, X-linked" ""
"0000172876" "00198" "00229651" "01807" "Unknown" "" "HP:0000510 (Rod-cone dystrophy)" "" "" "" "" "" "" "" "" "" "" "" ""
"0000233981" "04214" "00308553" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233982" "04214" "00308554" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234085" "04214" "00308657" "00004" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234695" "04214" "00309375" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234696" "04214" "00309376" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234697" "04214" "00309377" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234698" "04214" "00309378" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234699" "04214" "00309379" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234991" "04214" "00309672" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000243924" "04214" "00325437" "00006" "Unknown" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000243952" "04214" "00325465" "00006" "Unknown" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000243968" "04214" "00325481" "00006" "Familial, X-linked" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000245485" "04214" "00327042" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245486" "04214" "00327043" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245487" "04214" "00327044" "00006" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245498" "04214" "00327052" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245692" "04214" "00327402" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245693" "04214" "00327403" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245694" "04214" "00327404" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245695" "04214" "00327406" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245696" "04214" "00327407" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245697" "04214" "00327408" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245698" "04214" "00327409" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245699" "04214" "00327410" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245700" "04214" "00327411" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245701" "04214" "00327412" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245702" "04214" "00327413" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245703" "04214" "00327414" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245704" "04214" "00327415" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245757" "04214" "00327471" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245758" "04214" "00327472" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245759" "04214" "00327473" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245760" "04214" "00327474" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245761" "04214" "00327475" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245762" "04214" "00327476" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245763" "04214" "00327477" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245764" "04214" "00327479" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245765" "04214" "00327480" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245766" "04214" "00327481" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245767" "04214" "00327482" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000245768" "04214" "00327483" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000246216" "04214" "00327989" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" ""
"0000246304" "04214" "00328077" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000246376" "04214" "00328149" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246381" "04214" "00328154" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000246553" "04214" "00328326" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000246639" "04214" "00328413" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia" ""
"0000246640" "04214" "00328414" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia" ""
"0000246776" "04214" "00328549" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000249480" "04214" "00331286" "00000" "Familial, X-linked" "25y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000250407" "04214" "00332220" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000250641" "04214" "00332457" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "EORP" ""
"0000250686" "04214" "00332502" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (XL)" ""
"0000250687" "04214" "00332503" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000250732" "04214" "00332544" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" ""
"0000251665" "04214" "00333480" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000251666" "04214" "00333481" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000251705" "04214" "00333521" "00000" "Familial, X-linked" "10y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251706" "04214" "00333522" "00000" "Familial, X-linked" "19y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251707" "04214" "00333523" "00000" "Familial, X-linked" "21y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251715" "04214" "00333531" "00000" "Familial, X-linked" "19y" "clinical category IA1ai" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251716" "04214" "00333532" "00000" "Familial, X-linked" "17y" "clinical category IA1ai" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251717" "04214" "00333533" "00000" "Familial, X-linked" "35y" "clinical category IA1ai" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251718" "04214" "00333534" "00000" "Familial, X-linked" "47y" "clinical category IA1ai" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251764" "04214" "00333580" "00000" "Familial, X-linked" "13y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252525" "04214" "00334436" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252606" "04214" "00334566" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252869" "00198" "00335154" "00000" "Familial, X-linked" "" "16y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252870" "00198" "00335155" "00000" "Unknown" "" "0y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000252969" "04214" "00335254" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253038" "04214" "00335323" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253337" "04214" "00335391" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253354" "04214" "00335408" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253358" "04214" "00335412" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253367" "04214" "00335421" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253439" "04214" "00335494" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253905" "04214" "00335990" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000253993" "03367" "00358778" "00000" "Isolated (sporadic)" "66y" "ERG-full field normal, central dysfunction; funduscopy normal; spectral‐domain optical coherence tomography no blurring ellipsoid zone, absence interdigitation zone" "60y" "" "" "" "" "" "" "" "" "" "occult macular dystrophy" ""
"0000254357" "04214" "00359060" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254414" "04214" "00359117" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" ""
"0000254445" "04214" "00359148" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" ""
"0000254454" "04214" "00359157" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" ""
"0000254463" "04214" "00359166" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" ""
"0000257606" "04214" "00362192" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258001" "04214" "00362588" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258002" "04214" "00362589" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258003" "04214" "00362590" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258004" "04214" "00362591" "00008" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258005" "04214" "00362592" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258006" "04214" "00362593" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258007" "04214" "00362594" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258008" "04214" "00362595" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258009" "04214" "00362596" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258010" "04214" "00362597" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258011" "04214" "00362598" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258012" "04214" "00362599" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258013" "04214" "00362600" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258014" "04214" "00362601" "00008" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked Retinitis pigmentosa" ""
"0000258830" "04214" "00363469" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258970" "04214" "00363620" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" ""
"0000259064" "04214" "00363714" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" ""
"0000267407" "04214" "00372078" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267412" "04214" "00372083" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267829" "04214" "00372514" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267963" "04214" "00372684" "00000" "Isolated (sporadic)" "22y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267964" "04214" "00372685" "00000" "Isolated (sporadic)" "34y" "see paper; ..." "6y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267965" "04214" "00372686" "00000" "Isolated (sporadic)" "34y" "see paper; ..." "24y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000267966" "04214" "00372687" "00000" "Familial, X-linked" "23y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000268753" "04214" "00373477" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269022" "04214" "00373813" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269071" "04214" "00373862" "00000" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269093" "04214" "00373884" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000269131" "04214" "00373922" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269147" "04214" "00373938" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270106" "04214" "00374896" "00000" "Familial, X-linked" "12y" "best corrected visual acuity 0.16/0.2" "5y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270122" "04214" "00374912" "00000" "Familial, X-linked" "22y" "best corrected visual acuity 0.08/0.09" "6y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270653" "04214" "00375439" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa with maculopathy" ""
"0000270668" "04214" "00375454" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270669" "04214" "00375455" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271449" "04214" "00376241" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Familial-X linked renitis pigmentosa" ""
"0000271450" "04214" "00376242" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Familial-X linked renitis pigmentosa" ""
"0000271451" "04214" "00376243" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Familial-X linked renitis pigmentosa" ""
"0000271452" "04214" "00376244" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Familial-X linked renitis pigmentosa" ""
"0000271453" "04214" "00376245" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Familial-X linked renitis pigmentosa" ""
"0000271887" "04214" "00376676" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271888" "04214" "00376677" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271889" "04214" "00376678" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271890" "04214" "00376679" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271891" "04214" "00376680" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271892" "04214" "00376681" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271893" "04214" "00376682" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271894" "04214" "00376683" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271895" "04214" "00376684" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271896" "04214" "00376685" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271897" "04214" "00376686" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271898" "04214" "00376687" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa" ""
"0000271960" "04214" "00376749" "00000" "Familial, autosomal recessive" "25y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271963" "04214" "00376752" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, loss of peripheral vision" ""
"0000271978" "04214" "00376767" "00000" "Familial, autosomal recessive" "36y" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000271995" "04214" "00376784" "00000" "Familial, X-linked" "5y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272025" "04214" "00376815" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272182" "04214" "00376991" "00000" "Familial, X-linked" "17y" "" "" "" "" "" "" "" "" "" "" "" "X-Linked Retinitis Pigmentosa" ""
"0000272183" "04214" "00376992" "00000" "Familial, X-linked" "28y" "" "" "" "" "" "" "" "" "" "" "" "X-Linked Retinitis Pigmentosa" ""
"0000272422" "04214" "00377264" "00000" "Isolated (sporadic)" "57y" "see paper" "35y" "" "36y" "" "" "" "" "" "" "retinitis pigmentosa, type 2 (RP2)" "retinal disease" ""
"0000272649" "04214" "00377499" "00000" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000272650" "04214" "00377500" "00000" "Familial, X-linked dominant" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000272677" "04214" "00377527" "00000" "Familial, X-linked recessive" "" "see paper" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa 2" "retinal disease" ""
"0000273296" "04214" "00379423" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia (eoHM)" ""
"0000273297" "04214" "00379424" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia (eoHM)" ""
"0000273417" "00112" "00379544" "03508" "Familial, X-linked dominant" "" "HP:0001133, HP:0000639, HP:0001141, HP:0001417, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273491" "00112" "00379647" "03508" "Familial, X-linked dominant" "" "HP:0032122,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0003745,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273628" "00112" "00379774" "03508" "Familial, X-linked dominant" "" "HP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273655" "00112" "00379800" "03508" "Familial, X-linked dominant" "" "HP:0032122,\tHP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000273733" "04214" "00379879" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000274616" "04214" "00380763" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000274617" "04214" "00380764" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000274794" "04214" "00380943" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "nonsyndromic retinitis pigmentosa (RP)" ""
"0000274795" "04214" "00380944" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "nonsyndromic retinitis pigmentosa (RP)" ""
"0000274796" "04214" "00380945" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "nonsyndromic retinitis pigmentosa (RP)" ""
"0000274797" "04214" "00380946" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "nonsyndromic retinitis pigmentosa (RP)" ""
"0000274824" "04214" "00380973" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" ""
"0000274825" "04214" "00380974" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "autosomal dominant retinitis pigmentosa (adRP)" ""
"0000274852" "04214" "00381001" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000274855" "04214" "00381004" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000275479" "04214" "00381637" "00000" "Isolated (sporadic)" "" "" "30y" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275480" "04214" "00381638" "00000" "Isolated (sporadic)" "" "" "15y" "" "" "" "" "" "" "" "" "" "X-linked RP" ""
"0000275489" "04214" "00381647" "00000" "Familial, autosomal dominant" "" "" "31y" "" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" ""
"0000275771" "04214" "00381929" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275772" "04214" "00381930" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275773" "04214" "00381931" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275798" "04214" "00381956" "00000" "Familial, autosomal recessive" "45y" "BCVA OD-OS:1/35-1/35; nystagmus; strabismus" "4y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" ""
"0000276264" "04214" "00382415" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276265" "04214" "00382416" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276266" "04214" "00382417" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276269" "04214" "00382420" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276270" "04214" "00382421" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276271" "04214" "00382422" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276272" "04214" "00382423" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276636" "04214" "00382780" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276637" "04214" "00382781" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276638" "04214" "00382782" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277288" "04214" "00383503" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277561" "04214" "00383776" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277569" "04214" "00383784" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277570" "04214" "00383785" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000277623" "04214" "00383838" "00000" "Familial, autosomal dominant" "12y" "BCVA OD-OS: 20/70-20/60" "" "" "10y" "" "" "" "" "" "" "" "" ""
"0000278812" "04214" "00385028" "00000" "Isolated (sporadic)" "8y" "nyctalopia, no nystagmus, ERG extinguished, best corrected visual acuity right/left eye: 0.4/0.4" "3y" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000278818" "04214" "00385034" "00000" "Isolated (sporadic)" "3y" "photophobia, no nystagmus, ERG extinguished, best corrected visual acuity right/left eye: NA" "2y6m" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000278867" "04214" "00385083" "00000" "Familial, X-linked" "27y" "nyctalopia/photophobia, nystagmus, oculodigital sign, ERG severely declined, best corrected visual acuity right/left eye: 0.03/0.03" "1m" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000279217" "04214" "00385421" "00000" "Familial, X-linked" "59y" "59" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000279406" "04214" "00385611" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" ""
"0000279414" "04214" "00385619" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000279551" "04214" "00385738" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000279552" "04214" "00385739" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000280501" "04214" "00386701" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280570" "04214" "00386770" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280607" "04214" "00386807" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280949" "04214" "00387386" "00000" "Familial, X-linked" "39y" "posterior subcapsular cataract, posterior pole choroidal atrophy, positive family history, BCVA OD/OS: HM/HM" "5y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000281819" "04214" "00388263" "00000" "Familial, autosomal recessive" "40y" "Abolished rod ERG and 88% reduced ERG in cones, best corrected visual acuity both eyes: 20-400" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000282373" "04214" "00388832" "00000" "Familial, X-linked" "30y" "age at genetic diagnosis mentioned" "" "" "27y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282598" "04214" "00389057" "00000" "Familial, X-linked" "47y" "age at genetic diagnosis mentioned" "" "" "40y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282617" "04214" "00389076" "00000" "Familial, X-linked" "41y" "age at genetic diagnosis mentioned" "" "" "36y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282626" "04214" "00389085" "00000" "Familial, X-linked" "11y" "age at genetic diagnosis mentioned" "" "" "6y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282627" "04214" "00389086" "00000" "Familial, X-linked" "15y" "age at genetic diagnosis mentioned" "" "" "10y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282634" "04214" "00389093" "00000" "Familial, X-linked" "29y" "age at genetic diagnosis mentioned" "" "" "27y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282635" "04214" "00389094" "00000" "Familial, X-linked" "78y" "age at genetic diagnosis mentioned" "" "" "76y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282677" "04214" "00389136" "00000" "Familial, X-linked dominant" "49y" "age at genetic diagnosis mentioned" "" "" "45y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282788" "04214" "00389247" "00000" "Familial, X-linked" "37y" "age at genetic diagnosis mentioned" "" "" "37y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282843" "04214" "00389302" "00000" "Familial, X-linked dominant" "57y" "age at genetic diagnosis mentioned" "" "" "50y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282844" "04214" "00389303" "00000" "Familial, X-linked dominant" "19y" "age at genetic diagnosis mentioned" "" "" "13y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282847" "04214" "00389306" "00000" "Familial, X-linked" "86y" "age at genetic diagnosis mentioned" "" "" "84y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282855" "04214" "00389314" "00000" "Familial, X-linked dominant" "58y" "age at genetic diagnosis mentioned" "" "" "53y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000282856" "04214" "00389315" "00000" "Familial, X-linked" "22y" "age at genetic diagnosis mentioned" "" "" "17y" "" "" "" "" "" "" "X-linked retinitis pigmentosa" "" ""
"0000283923" "04214" "00390385" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283924" "04214" "00390386" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283925" "04214" "00390387" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283926" "04214" "00390388" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283927" "04214" "00390389" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000284355" "04214" "00390867" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000284902" "04214" "00391566" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" ""
"0000284903" "04214" "00391567" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" ""
"0000285404" "04214" "00392126" "00000" "Unknown" "38y" "best corrected visual acuity right/left eye: hand movement/hand movement, visual field: constricted <10deg both eyes, fundus: optic disc pallor, thin vessels, intraretinal pigment deposits, atrophy areas, optical coherence tomography: Severe atrophy, outer nuclear layer los" "" "" "" "" "" "" "" "" "" "RPN-569" "rod-cone dystrophy" ""
"0000285405" "04214" "00392127" "00000" "Unknown" "69y" "best corrected visual acuity right/left eye: fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-570" "asymptomatic carrier" ""
"0000285406" "04214" "00392128" "00000" "Unknown" "52y" "best corrected visual acuity right/left eye: 0.3/0.05, visual field: constricted <10deg both eyes (10/11), fundus: optic disc pallor, thin vessels, intraretinal pigment deposits, RPE atrophy, choroidosis, optical coherence tomography: widespread thinnin" "" "" "6y" "" "" "" "" "" "" "RPN-573" "rod-cone dystrophy" ""
"0000285407" "04214" "00392129" "00000" "Unknown" "57y" "best corrected visual acuity right/left eye: 0.8/0.8, visual field: (97/99), fundus: normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-574" "asymptomatic carrier" ""
"0000285409" "04214" "00392131" "00000" "Unknown" "30y" "best corrected visual acuity right/left eye: 0.05/0.05, visual field: constricted <10deg both eyes (10/6), fundus: optic disc pallor, thin vessels, intraretinal pigment deposits., optical coherence tomography: widespread thinnin" "" "" "2y" "" "" "" "" "" "" "RPN-576" "rod-cone dystrophy" ""
"0000285410" "04214" "00392132" "00000" "Unknown" "41y" "best corrected visual acuity right/left eye: 0.6/0.2, visual field: , fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-643" "asymptomatic carrier" ""
"0000285411" "04214" "00392133" "00000" "Unknown" "35y" "best corrected visual acuity right/left eye: 1.0/0.6, visual field: , fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-644" "asymptomatic carrier" ""
"0000285420" "04214" "00392142" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "RPN-578" "rod-cone dystrophy" ""
"0000285421" "04214" "00392143" "00000" "Unknown" "" "best corrected visual acuity right/left eye: light perception/light perception, visual field: not determined, fundus: widespread atrophy, fundus autofluorescence: pericentral hypoautofluorescenceg, optical coherence tomography: not determined" "" "" "" "" "" "" "" "" "" "RPN-481" "rod-cone dystrophy" ""
"0000285429" "04214" "00392151" "00000" "Unknown" "38y" "best corrected visual acuity right/left eye: hand movement/hand movement, visual field: constricted <10deg both eyes, fundus: optic disc pallor, thin vessels, intraretinal pigment deposits, atrophy areas, optical coherence tomography: Severe atrophy, outer nuclear layer los" "" "" "" "" "" "" "" "" "" "RPN-569" "rod-cone dystrophy" ""
"0000285430" "04214" "00392152" "00000" "Unknown" "69y" "best corrected visual acuity right/left eye: fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-570" "asymptomatic carrier" ""
"0000285431" "04214" "00392153" "00000" "Unknown" "52y" "best corrected visual acuity right/left eye: 0.3/0.05, visual field: constricted <10deg both eyes (10/11), fundus: optic disc pallor, thin vessels, intraretinal pigment deposits, RPE atrophy, choroidosis, optical coherence tomography: widespread thinnin" "" "" "6y" "" "" "" "" "" "" "RPN-573" "rod-cone dystrophy" ""
"0000285432" "04214" "00392154" "00000" "Unknown" "57y" "best corrected visual acuity right/left eye: 0.8/0.8, visual field: (97/99), fundus: normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-574" "asymptomatic carrier" ""
"0000285434" "04214" "00392156" "00000" "Unknown" "30y" "best corrected visual acuity right/left eye: 0.05/0.05, visual field: constricted <10deg both eyes (10/6), fundus: optic disc pallor, thin vessels, intraretinal pigment deposits., optical coherence tomography: widespread thinnin" "" "" "2y" "" "" "" "" "" "" "RPN-576" "rod-cone dystrophy" ""
"0000285435" "04214" "00392157" "00000" "Unknown" "41y" "best corrected visual acuity right/left eye: 0.6/0.2, visual field: , fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-643" "asymptomatic carrier" ""
"0000285436" "04214" "00392158" "00000" "Unknown" "35y" "best corrected visual acuity right/left eye: 1.0/0.6, visual field: , fundus: normal, fundus autofluorescence:normal, optical coherence tomography: normal" "" "" "" "" "" "" "" "" "" "RPN-644" "asymptomatic carrier" ""
"0000285445" "04214" "00392167" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "RPN-578" "rod-cone dystrophy" ""
"0000285446" "04214" "00392168" "00000" "Unknown" "" "best corrected visual acuity right/left eye: light perception/light perception, visual field: not determined, fundus: widespread atrophy, fundus autofluorescence: pericentral hypoautofluorescenceg, optical coherence tomography: not determined" "" "" "" "" "" "" "" "" "" "RPN-481" "rod-cone dystrophy" ""
"0000285594" "04214" "00392318" "00000" "Familial, X-linked" "9y" "best corrected visual acuity right/left eye: 1.0/1.0, electroretinograhy responses: rod absent, severe defect of cone function" "6y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, X-linked" "Retinitis pigmentosa, autosomal dominant" ""
"0000285642" "04214" "00392366" "00000" "Familial, X-linked" "24y" "best corrected visual acuity right/left eye: 0.2/0.3, electroretinograhy responses: not available" "5y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, X-linked" "Retinitis pigmentosa, autosomal dominant" ""
"0000285898" "04214" "00392651" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000285916" "04214" "00392669" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000286712" "04214" "00393506" "00000" "Isolated (sporadic)" "62y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000286861" "04214" "00393655" "00000" "Isolated (sporadic)" "32y" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" ""
"0000286923" "04214" "00393717" "00000" "Familial, X-linked" "39y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000286924" "04214" "00393718" "00000" "Familial, X-linked" "31y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000287000" "04214" "00393794" "00000" "Familial, X-linked" "12y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" ""
"0000287966" "04214" "00394763" "00000" "Familial, X-linked" "36y" "" "8y" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287967" "04214" "00394764" "00000" "Familial, X-linked" "40y" "" "6y" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287968" "04214" "00394765" "00000" "Familial, X-linked" "23y" "" "18y" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287969" "04214" "00394766" "00000" "Familial, X-linked" "64y" "" "1y" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000287970" "04214" "00394767" "00000" "Familial, X-linked" "54y" "" "12y" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" ""
"0000289028" "04214" "00395866" "00000" "Unknown" "21y1m" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000289104" "04214" "00395942" "00000" "Unknown" "29y10m" "" "3y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000289648" "04214" "00396487" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (X-Linked)" "" ""
"0000289777" "04214" "00396616" "00000" "Isolated (sporadic)" "27y" "night blindness" "12y-18y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000297765" "04214" "00405216" "00000" "Familial, X-linked" "18y" "myopia, decreased best visual acuity, moderate beaten-metal retinal pigment epithelium (RPE), retinal sheen centrally with diffuse RPE atrophy in the peripheral macula and attenuated vessel caliber throughout. On the retinal periphery, the patient has 2-3 generalized bone spicule pigmentary clumping with intervening RPE atrophy but no hemorrhages." "" "" "" "" "" "" "" "" "" "" "slowly progressive bilateral retinitis pigmentosa" ""
"0000297766" "04214" "00405217" "00000" "Familial, X-linked" "29y" "" "" "" "" "impaired night vision and visual acuity" "" "" "" "" "" "" "X-Linked Retinitis Pigmentosa" ""
"0000297767" "04214" "00405218" "00000" "Familial, X-linked" "" "visual acuity was corrected to 0.2 OD with a 26.5 diopter sphere and 0.06 OS with 29.00 to 1.00 3 180 refraction; bilateral pigmentary retinal degeneration and attenuation of retinal arteries; atrophic changes in the retinal pigment epithelial layer" "" "" "" "" "" "" "" "" "" "" "X-Linked Retinitis Pigmentosa" ""
"0000297768" "00000" "00405219" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297769" "04214" "00405220" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297770" "04214" "00405221" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297771" "04214" "00405222" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297772" "04214" "00405223" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297773" "04214" "00405224" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297774" "04214" "00405225" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297775" "04214" "00405226" "00000" "Familial, X-linked" "5y" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297776" "04214" "00405227" "00000" "Familial, X-linked" "48y" "" "<10y" "" "" "night blindness in the first decade of life" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297777" "04214" "00405228" "00000" "Familial, X-linked" "44y" "" "<10y" "" "" "night blindness in the first decade of life" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297778" "00000" "00405229" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297779" "04214" "00405230" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297780" "04214" "00405231" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297781" "04214" "00405232" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297782" "04214" "00405233" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297783" "04214" "00405234" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297784" "04214" "00405235" "00000" "Familial, X-linked" "<0d" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297785" "00000" "00405236" "00000" "-" "60y" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297786" "00000" "00405237" "00000" "-" "41y" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297787" "04214" "00405238" "00000" "Familial, X-linked" "29y" "Night blindness and visual acuity loss, RPE atrophy, vascular attenuation, bone spicules" "22y" "" "" "moderate RP symptoms" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297788" "04214" "00405239" "00000" "Familial, X-linked" "30y" "Night blindness and visual acuity loss, RPE atrophy, some vascular attenuation" "24y" "" "" "mild RP symptoms" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297789" "04214" "00405240" "00000" "Familial, X-linked" "13y" "Night blindness and visual acuity loss, General RPE atrophy, vascular attenuation, papillary drusen, and macular atrophy OU" "5y" "" "" "severe RP symptoms" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297790" "04214" "00405241" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Less severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297791" "04214" "00405242" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297792" "04214" "00405243" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297793" "04214" "00405244" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297794" "04214" "00405245" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Less severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297795" "04214" "00405246" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297796" "04214" "00405247" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297797" "04214" "00405248" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297798" "04214" "00405249" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297799" "00000" "00405250" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297800" "04214" "00405251" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297801" "04214" "00405252" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297802" "04214" "00405253" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297803" "04214" "00405254" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297804" "04214" "00405255" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297805" "04214" "00405256" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297806" "04214" "00405257" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297807" "04214" "00405258" "00000" "Familial, X-linked" "" "" ">30y" "" "" "early onset of strabismus, progressive loss of visual acuity and visual field since early childhood and total blindness" "" "" "" "" "" "" "Severe X-linked retinitis pigmentosa (XLRP)" ""
"0000297808" "00000" "00405259" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297809" "04214" "00405260" "00000" "Familial, X-linked" "" "visual acuity 0.05 in each eye with ?9.50(?2.25;20°) OD and ?7.50 (?2.00;170°) OS, retinal pigment epithelium (RPE) was atrophic" "3y" "" "" "myopia, visual acuity 0.1" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297810" "04214" "00405261" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "pattern dystrophy" ""
"0000297811" "00000" "00405262" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297812" "04214" "00405263" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297813" "04214" "00405264" "00000" "Familial, X-linked" "50y" "bone spicule deposits, attenuated retinal arterioles and waxy pale optic discs" "12y" "" "" "night blindness and progressive loss of vision field" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297814" "00000" "00405265" "00000" "-" "30y" "" "" "" "" "" "" "" "" "" "" "" "Carrier with mildly abnormal fundus photograph such as attenuated retinal arterioles" ""
"0000297815" "04214" "00405266" "00000" "Familial, X-linked" "32y" "" "15y" "" "" "night blindness and progressive loss of vision field" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297816" "04214" "00405267" "00000" "Familial, X-linked" "8y" "" "8y" "" "" "extinguished electroretinograms including both cone and rod responses" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000297817" "00000" "00405268" "00000" "-" "" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" ""
"0000297818" "04214" "00405269" "00000" "Familial, X-linked" "54y" "pendular nystagmus, bilateral pseudophakia, atrophy and bone spicule pigmentary changes of the retina bilaterally and the optic discs were pale, significant atrophy of the photoreceptor layer including at the fovea and also of the nerve fibre layer extending to the disc, central thinning of the RPE and unmasking of the underlying scleral reflectivity, but the RPE appeared well preserved around the optic nerve head and anterior to the vascular arcades" "9y" "" "" "visual acuity of 6/12" "" "" "" "" "" "" "X-linked retinitis pigmentosa (XLRP)" ""
"0000306148" "04214" "00414313" "00000" "Familial, X-linked" "14y" "night blindness, electroretinogram: non-recordable" "11y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306149" "04214" "00414314" "00000" "Familial, X-linked" "13y" "night blindness, electroretinogram: non-recordable" "9y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306150" "04214" "00414315" "00000" "Familial, X-linked" "6y" "visual loss, electroretinogram: non-recordable" "6y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306151" "04214" "00414316" "00000" "Familial, X-linked" "21y" "night blindness and visual loss, electroretinogram: non-recordable" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306152" "04214" "00414317" "00000" "Familial, X-linked" "38y" "N/A, electroretinogram: non-recordable" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306153" "04214" "00414318" "00000" "Familial, X-linked" "13y" "visual loss, electroretinogram: non-recordable" "3y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306164" "04214" "00414329" "00000" "Familial, X-linked" "" "first symptom: N/A" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306165" "04214" "00414330" "00000" "Familial, X-linked" "55y" "first symptom: photophobia" "46y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306166" "04214" "00414331" "00000" "Familial, X-linked" "47y" "asymptomatic" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306167" "04214" "00414332" "00000" "Familial, X-linked" "73y" "first symptom: photophobia" "55y" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000306168" "04214" "00414333" "00000" "Familial, X-linked" "61y" "asymptomatic" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000310851" "00198" "00419570" "02300" "Familial, X-linked recessive" "13y" "" "" "" "" "" "" "" "" "" "" "" "ocular/auditory abnormality" ""
"0000311726" "04214" "00420478" "00000" "Familial, X-linked" "21y1m" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000311759" "04214" "00420511" "00000" "Familial, X-linked" "29y10m" "" "3y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000318069" "04214" "00426931" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "rod-cone dystrophy" ""
"0000320442" "00112" "00429570" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320488" "00112" "00429616" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320547" "00112" "00429675" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320607" "00112" "00429735" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320611" "00112" "00429739" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320741" "00112" "00429869" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320877" "00112" "00430005" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320896" "00112" "00430024" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320908" "00112" "00430036" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320909" "00112" "00430037" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320965" "00112" "00430093" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320974" "00112" "00430102" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000321016" "00112" "00430144" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000326636" "02156" "00436458" "04552" "Familial, X-linked" "" "Reduced visual acuity HP:0007663; Nyctalopia HP:0000662; Peripheral visual field loss HP:0007994; Retinitis pigmentosa HP:0000510" "" "" "" "" "" "" "" "" "" "RP25" "Retinitis pigmentosa" ""
"0000326641" "02156" "00436463" "04552" "Familial, X-linked" "" "Reduced visual acuity HP:0007663; Nyctalopia HP:0000662; Peripheral visual field loss HP:0007994; Retinitis pigmentosa HP:0000510" "" "" "" "" "" "" "" "" "" "RP25" "Retinitis pigmentosa" ""
"0000334623" "00112" "00445388" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "RP2" "retinitis pigmentosa" ""
"0000336177" "00198" "00446978" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" ""
"0000336319" "00198" "00447120" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000336320" "00198" "00447121" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000336586" "00198" "00447387" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000336652" "00198" "00447453" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336655" "00198" "00447456" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336657" "00198" "00447458" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336663" "00198" "00447464" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336667" "00198" "00447468" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336669" "00198" "00447470" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336670" "00198" "00447471" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336676" "00198" "00447477" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336679" "00198" "00447480" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336786" "00198" "00447587" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" ""
"0000336845" "00198" "00447646" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000336847" "00198" "00447648" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" ""
"0000348623" "04214" "00461123" "00006" "Familial, X-linked" "" "" "7y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000353662" "00296" "00468510" "00006" "Familial, X-linked" "" "posterior subcapsular cataract; no symmetrical opacities; retinitis pigmentosa" "8y" "" "" "" "" "" "" "" "" "RP2" "bilateral cataract" ""
"0000354447" "00198" "00469294" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "abnormality of connective tissue" ""
## Screenings ## Do not remove or alter this header ##
## Count = 411
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" ""
"0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" ""
"0000016561" "00016608" "1" "00552" "00552" "2014-05-23 13:32:47" "" "" "SEQ-NG-I" "DNA" "" ""
"0000032921" "00032853" "1" "00006" "00006" "2009-10-28 15:09:48" "00006" "2012-05-18 13:59:33" "SEQ" "DNA" "" ""
"0000033155" "00033087" "1" "00229" "00229" "2012-02-04 14:23:49" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033159" "00033091" "1" "00229" "00229" "2012-02-04 16:07:37" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033162" "00033094" "1" "00229" "00229" "2012-02-04 16:07:37" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033169" "00033101" "1" "00229" "00229" "2012-02-04 16:07:37" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033173" "00033105" "1" "00229" "00229" "2012-02-04 14:49:23" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033192" "00033124" "1" "00229" "00229" "2012-02-04 14:23:49" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033230" "00033162" "1" "00229" "00229" "2012-02-04 16:07:37" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000105509" "00105036" "1" "01244" "01244" "2017-06-15 16:29:29" "" "" "SEQ-NG-I" "DNA" "Whole blood" ""
"0000105510" "00105037" "1" "01244" "01244" "2017-06-15 16:33:17" "" "" "SEQ-NG-I" "DNA" "Whole blood" ""
"0000164876" "00164010" "1" "00006" "00006" "2018-05-07 19:51:11" "" "" "SEQ;SSCA" "DNA" "" ""
"0000164877" "00164011" "1" "00006" "00006" "2018-05-07 19:55:07" "" "" "SEQ;SSCA" "DNA" "" ""
"0000164878" "00164012" "1" "00006" "00006" "2018-05-07 19:58:19" "" "" "SEQ;SSCA" "DNA" "" ""
"0000164879" "00164013" "1" "00006" "00006" "2018-05-07 20:02:49" "" "" "SEQ;SSCA" "DNA" "" ""
"0000164880" "00164014" "1" "00006" "00006" "2018-05-07 20:05:52" "" "" "SEQ;SSCA" "DNA" "" ""
"0000164881" "00164015" "1" "00006" "00006" "2018-05-07 20:09:36" "" "" "PCR;RT-PCR;SEQ" "DNA;RNA" "" ""
"0000164882" "00164016" "1" "00006" "00006" "2018-05-07 20:16:46" "" "" "PCR;SEQ;Southern" "DNA" "" ""
"0000164883" "00164017" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164884" "00164018" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164885" "00164019" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164886" "00164020" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164887" "00164021" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164888" "00164022" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164889" "00164023" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164890" "00164024" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164891" "00164025" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164892" "00164026" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000164893" "00164027" "1" "00006" "00006" "2018-05-07 21:05:05" "" "" "SEQ" "DNA" "" ""
"0000230744" "00229651" "1" "01807" "01807" "2019-04-08 10:01:31" "" "" "SEQ" "DNA" "" ""
"0000234676" "00233577" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234677" "00233578" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234678" "00233579" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234679" "00233580" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234680" "00233581" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234681" "00233582" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234682" "00233583" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234683" "00233584" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234684" "00233585" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234907" "00233808" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234908" "00233809" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234909" "00233810" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000241562" "00240452" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000241563" "00240453" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000241564" "00240454" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000309698" "00308553" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309699" "00308554" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309802" "00308657" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel"
"0000310520" "00309375" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310521" "00309376" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310522" "00309377" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310523" "00309378" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310524" "00309379" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310817" "00309672" "1" "00006" "00006" "2020-08-31 18:12:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000310876" "00309731" "1" "00006" "00006" "2020-09-02 09:29:55" "" "" "SEQ" "DNA" "" ""
"0000326648" "00325437" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000326676" "00325465" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000326692" "00325481" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000328255" "00327042" "1" "00006" "00006" "2021-01-19 12:01:21" "" "" "SEQ" "DNA" "" ""
"0000328256" "00327043" "1" "00006" "00006" "2021-01-19 12:04:35" "" "" "SEQ" "DNA" "" ""
"0000328257" "00327044" "1" "00006" "00006" "2021-01-19 12:08:47" "" "" "SEQ" "DNA" "" ""
"0000328267" "00327052" "1" "00006" "00006" "2021-01-19 21:24:47" "" "" "SEQ" "DNA" "" ""
"0000328614" "00327402" "1" "00006" "00006" "2021-01-21 09:39:42" "" "" "SEQ" "DNA" "" ""
"0000328615" "00327403" "1" "00006" "00006" "2021-01-21 09:45:33" "" "" "SEQ" "DNA" "" ""
"0000328616" "00327404" "1" "00006" "00006" "2021-01-21 09:47:54" "" "" "SEQ" "DNA" "" ""
"0000328617" "00327405" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328618" "00327406" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328619" "00327407" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328620" "00327408" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328621" "00327409" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328622" "00327410" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328623" "00327411" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328624" "00327412" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328625" "00327413" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328626" "00327414" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328627" "00327415" "1" "00000" "00006" "2021-01-21 10:27:15" "" "" "SEQ" "DNA" "" ""
"0000328685" "00327471" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328686" "00327472" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328687" "00327473" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328688" "00327474" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328689" "00327475" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328690" "00327476" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328691" "00327477" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328692" "00327478" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SEQ" "DNA" "" ""
"0000328693" "00327479" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SSCA;SEQ" "DNA" "" ""
"0000328694" "00327480" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SSCA;SEQ" "DNA" "" ""
"0000328695" "00327481" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SSCA;SEQ" "DNA" "" ""
"0000328696" "00327482" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SSCA;SEQ" "DNA" "" ""
"0000328697" "00327483" "1" "00000" "00006" "2021-01-22 09:56:51" "" "" "SSCA;SEQ" "DNA" "" ""
"0000329204" "00327989" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329292" "00328077" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329364" "00328149" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS"
"0000329369" "00328154" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS"
"0000329541" "00328326" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329627" "00328413" "1" "00000" "00006" "2021-01-27 14:27:38" "" "" "SEQ-NG" "DNA" "" "WES"
"0000329628" "00328414" "1" "00000" "00006" "2021-01-27 14:27:38" "" "" "SEQ-NG" "DNA" "" "WES"
"0000329764" "00328549" "1" "00006" "00006" "2021-01-29 10:31:39" "" "" "SEQ" "DNA" "" ""
"0000332506" "00331286" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel"
"0000333440" "00332220" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333681" "00332457" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel"
"0000333726" "00332502" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" ""
"0000333727" "00332503" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" ""
"0000333768" "00332544" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000334705" "00333480" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334706" "00333481" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334747" "00333521" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334748" "00333522" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334749" "00333523" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334757" "00333531" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334758" "00333532" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334759" "00333533" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334760" "00333534" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000334806" "00333580" "1" "00000" "00006" "2021-02-26 12:01:19" "" "" "SEQ-NG" "DNA" "" ""
"0000335665" "00334436" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES"
"0000335795" "00334566" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES"
"0000336383" "00335154" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336384" "00335155" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336483" "00335254" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel"
"0000336552" "00335323" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336620" "00335391" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel"
"0000336637" "00335408" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel"
"0000336641" "00335412" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel"
"0000336650" "00335421" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel"
"0000336723" "00335494" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel"
"0000337220" "00335990" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000360008" "00358778" "1" "00000" "00006" "2021-03-11 17:30:37" "00006" "2021-03-12 08:29:06" "SEQ-NG" "DNA" "" "WES"
"0000360298" "00359060" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360355" "00359117" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360386" "00359148" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360395" "00359157" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360404" "00359166" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000363421" "00362192" "1" "00000" "00006" "2021-04-15 17:02:42" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000363816" "00362588" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363817" "00362589" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363818" "00362590" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363819" "00362591" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363820" "00362592" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363821" "00362593" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363822" "00362594" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363823" "00362595" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363824" "00362596" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363825" "00362597" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363826" "00362598" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363827" "00362599" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363828" "00362600" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000363829" "00362601" "1" "00008" "00008" "2021-04-22 15:23:44" "" "" "SEQ" "DNA" "blood" ""
"0000364697" "00363469" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364848" "00363620" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364942" "00363714" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373306" "00372078" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel"
"0000373311" "00372083" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "SEQ-NG" "DNA" "" "53-gene panel"
"0000373747" "00372514" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373916" "00372684" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373917" "00372685" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373918" "00372686" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373919" "00372687" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000374712" "00373477" "1" "00000" "00006" "2021-05-14 16:56:19" "" "" "SEQ-NG" "DNA" "" "73-gene panel"
"0000375045" "00373813" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "SEQ" "DNA" "" ""
"0000375094" "00373862" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel"
"0000375116" "00373884" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000375154" "00373922" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000375170" "00373938" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000376090" "00374896" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376106" "00374912" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel"
"0000376636" "00375439" "1" "00000" "00006" "2021-06-04 11:16:10" "" "" "SEQ-NG" "DNA" "" "162-gene panel"
"0000376651" "00375454" "1" "00000" "00006" "2021-06-04 11:36:57" "" "" "SEQ-NG" "DNA" "" "179-gene panel"
"0000376652" "00375455" "1" "00000" "00006" "2021-06-04 11:36:57" "" "" "SEQ-NG" "DNA" "" "179-gene panel"
"0000377437" "00376241" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "PCR" "DNA" "blood" ""
"0000377438" "00376242" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "PCR" "DNA" "blood" ""
"0000377439" "00376243" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "PCR" "DNA" "blood" ""
"0000377440" "00376244" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "PCR" "DNA" "blood" ""
"0000377441" "00376245" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "PCR" "DNA" "blood" ""
"0000377882" "00376676" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377883" "00376677" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377884" "00376678" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377885" "00376679" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377886" "00376680" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377887" "00376681" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377888" "00376682" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377889" "00376683" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377890" "00376684" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377891" "00376685" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377892" "00376686" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377893" "00376687" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "SEQ" "DNA" "bood" ""
"0000377955" "00376749" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377958" "00376752" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377973" "00376767" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377990" "00376784" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000378020" "00376815" "1" "00000" "00006" "2021-06-25 15:49:34" "" "" "SEQ-NG" "DNA" "" "WES"
"0000378196" "00376991" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "" ""
"0000378197" "00376992" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "PCR" "DNA" "" ""
"0000378469" "00377264" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000378702" "00377499" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES"
"0000378703" "00377500" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES"
"0000378730" "00377527" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing"
"0000380623" "00379423" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "WES"
"0000380624" "00379424" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "WES"
"0000380744" "00379544" "1" "03508" "03508" "2021-08-05 09:33:06" "" "" "SEQ-NG-I" "DNA" "" ""
"0000380846" "00379647" "1" "03508" "03508" "2021-08-06 06:34:00" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381003" "00379800" "1" "03508" "03508" "2021-08-10 05:18:05" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381081" "00379879" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "exome sequencing"
"0000381432" "00379774" "1" "03508" "03508" "2021-08-13 05:18:22" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381977" "00380763" "1" "00000" "03840" "2021-08-23 12:12:11" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "Whole-exome sequencing"
"0000381978" "00380764" "1" "00000" "03840" "2021-08-23 12:12:11" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "Whole-exome sequencing"
"0000382157" "00380943" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382158" "00380944" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382159" "00380945" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382160" "00380946" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382187" "00380973" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "Subcloning"
"0000382188" "00380974" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "Subcloning"
"0000382215" "00381001" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay"
"0000382218" "00381004" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay"
"0000382853" "00381637" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382854" "00381638" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382863" "00381647" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000383145" "00381929" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383146" "00381930" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383147" "00381931" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383172" "00381956" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000383629" "00382415" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383630" "00382416" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383631" "00382417" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383634" "00382420" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383635" "00382421" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383636" "00382422" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383637" "00382423" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383996" "00382780" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR" "DNA" "blood" ""
"0000383997" "00382781" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR" "DNA" "blood" ""
"0000383998" "00382782" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SSCA;PCR" "DNA" "blood" ""
"0000384728" "00383503" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper"
"0000385001" "00383776" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385009" "00383784" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385010" "00383785" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" ""
"0000385063" "00383838" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis"
"0000386257" "00385028" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386263" "00385034" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386312" "00385083" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386650" "00385421" "1" "00000" "03840" "2021-10-10 19:46:50" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000386840" "00385611" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip"
"0000386848" "00385619" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip"
"0000386966" "00385738" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 1 containing 70 genes"
"0000386967" "00385739" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 1 containing 70 genes"
"0000387929" "00386701" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000387998" "00386770" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" ""
"0000388035" "00386807" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388612" "00387386" "1" "00000" "03840" "2021-10-29 09:42:54" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome"
"0000389502" "00388263" "1" "00000" "03840" "2021-11-03 12:43:56" "" "" "SEQ-NG" "DNA" "blood;saliva;hair;biopsy" "target gene panels or whole exome sequencing (WES)"
"0000390075" "00388832" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390300" "00389057" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper"
"0000390319" "00389076" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper"
"0000390328" "00389085" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000390329" "00389086" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper"
"0000390336" "00389093" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390337" "00389094" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000390379" "00389136" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper"
"0000390490" "00389247" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper"
"0000390545" "00389302" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000390546" "00389303" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper"
"0000390549" "00389306" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390557" "00389314" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper"
"0000390558" "00389315" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper"
"0000391626" "00390385" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391627" "00390386" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391628" "00390387" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391629" "00390388" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391630" "00390389" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000392108" "00390867" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" ""
"0000392808" "00391566" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392809" "00391567" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000393368" "00392126" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393369" "00392127" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393370" "00392128" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393371" "00392129" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393373" "00392131" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393374" "00392132" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393375" "00392133" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393384" "00392142" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393385" "00392143" "1" "00000" "03840" "2021-11-21 15:06:43" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393393" "00392151" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393394" "00392152" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393395" "00392153" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393396" "00392154" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393398" "00392156" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393399" "00392157" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393400" "00392158" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393409" "00392167" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393410" "00392168" "1" "00000" "03840" "2021-11-21 15:43:04" "" "" "SEQ-NG" "DNA" "blood" "custom panel of 117 IRD-associated genes"
"0000393560" "00392318" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ-NG" "DNA" "blood" "gene panel testing"
"0000393608" "00392366" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ-NG" "DNA" "blood" "gene panel testing"
"0000393898" "00392651" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000393916" "00392669" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000394754" "00393506" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "WES"
"0000394903" "00393655" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394965" "00393717" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394966" "00393718" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395042" "00393794" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000396010" "00394763" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000396011" "00394764" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000396012" "00394765" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000396013" "00394766" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000396014" "00394767" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" ""
"0000397105" "00395866" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes"
"0000397181" "00395942" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes"
"0000397730" "00396487" "1" "00000" "03840" "2021-12-16 12:35:05" "" "" "SEQ-NG-I" "DNA" "blood" "panel of 254 genes implicated in retinopathies"
"0000397859" "00396616" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000406458" "00405216" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ-NG;arrayCGH" "DNA" "blood" ""
"0000406459" "00405217" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "blood" ""
"0000406460" "00405218" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "blood" ""
"0000406461" "00405219" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "blood" ""
"0000406462" "00405220" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406463" "00405221" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406464" "00405222" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406465" "00405223" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406466" "00405224" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406467" "00405225" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ;PCR" "DNA" "blood" ""
"0000406468" "00405226" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406469" "00405227" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406470" "00405228" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406471" "00405229" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406472" "00405230" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "PCR;SSCA;RT-PCR" "DNA;RNA" "EDTA-treated whole blood" ""
"0000406473" "00405231" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "" ""
"0000406474" "00405232" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "" ""
"0000406475" "00405233" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SSCA;SEQ" "DNA" "" ""
"0000406476" "00405234" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" ""
"0000406477" "00405235" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "maternal plasma" ""
"0000406478" "00405236" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000406479" "00405237" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000406480" "00405238" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000406481" "00405239" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000406482" "00405240" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000406483" "00405241" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406484" "00405242" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406485" "00405243" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406486" "00405244" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406487" "00405245" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406488" "00405246" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406489" "00405247" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406490" "00405248" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406491" "00405249" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406492" "00405250" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406493" "00405251" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406494" "00405252" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406495" "00405253" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406496" "00405254" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406497" "00405255" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406498" "00405256" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406499" "00405257" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000406500" "00405258" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406501" "00405259" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406502" "00405260" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406503" "00405261" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "blood" ""
"0000406504" "00405262" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000406505" "00405263" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000406506" "00405264" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000406507" "00405265" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000406508" "00405266" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000406509" "00405267" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000406510" "00405268" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000406511" "00405269" "1" "00000" "00008" "2022-03-16 13:42:42" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000415593" "00414313" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415594" "00414314" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415595" "00414315" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415596" "00414316" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415597" "00414317" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415598" "00414318" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415609" "00414329" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415610" "00414330" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415611" "00414331" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415612" "00414332" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000415613" "00414333" "1" "00000" "03840" "2022-07-28 13:02:07" "" "" "SEQ-NG;SEQ" "DNA" "blood" "111-gene panel targeted resequencing"
"0000420874" "00419570" "1" "02300" "00006" "2022-10-20 16:24:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000421787" "00420478" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes"
"0000421820" "00420511" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes"
"0000428251" "00426931" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing"
"0000430983" "00429570" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431029" "00429616" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431088" "00429675" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431148" "00429735" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431152" "00429739" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431282" "00429869" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431418" "00430005" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431437" "00430024" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431449" "00430036" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431450" "00430037" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431506" "00430093" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431515" "00430102" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431557" "00430144" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000437942" "00436458" "1" "04552" "04552" "2023-09-17 04:34:12" "" "" "SEQ-NG-I" "DNA" "BUCCAL SWAB" ""
"0000437947" "00436463" "1" "04552" "04552" "2023-09-17 04:46:52" "" "" "SEQ-NG-I" "DNA" "BUCCAL SWAB" ""
"0000446959" "00445388" "1" "00006" "00006" "2024-01-12 10:11:39" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000448555" "00446978" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448697" "00447120" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448698" "00447121" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448964" "00447387" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449030" "00447453" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449033" "00447456" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449035" "00447458" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449041" "00447464" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449045" "00447468" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449047" "00447470" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449048" "00447471" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449054" "00447477" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449057" "00447480" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449164" "00447587" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449223" "00447646" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449225" "00447648" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000462755" "00461123" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000470177" "00468510" "1" "00006" "00006" "2025-11-09 20:53:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000470962" "00469294" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 421
"{{screeningid}}" "{{geneid}}"
"0000032921" "RP2"
"0000033155" "ABCA4"
"0000033155" "CA4"
"0000033155" "RP2"
"0000033159" "CC2D2A"
"0000033159" "CRB1"
"0000033159" "RP2"
"0000033159" "SEMA4A"
"0000033159" "TOPORS"
"0000033162" "GUCA1B"
"0000033162" "RP2"
"0000033169" "RP2"
"0000033173" "CACNA1F"
"0000033173" "PROM1"
"0000033173" "RP2"
"0000033173" "RPGRIP1L"
"0000033173" "SNRNP200"
"0000033192" "ABCA4"
"0000033192" "GUCA1B"
"0000033192" "RP2"
"0000033230" "BEST1"
"0000033230" "RP2"
"0000164876" "RP2"
"0000164877" "RP2"
"0000164878" "RP2"
"0000164879" "RP2"
"0000164880" "RP2"
"0000164881" "RP2"
"0000164882" "RP2"
"0000164883" "RP2"
"0000164884" "RP2"
"0000164885" "RP2"
"0000164886" "RP2"
"0000164887" "RP2"
"0000164888" "RP2"
"0000164889" "RP2"
"0000164890" "RP2"
"0000164891" "RP2"
"0000164892" "RP2"
"0000164893" "RP2"
"0000234676" "RP2"
"0000234677" "RP2"
"0000234678" "RP2"
"0000234679" "RP2"
"0000234680" "RP2"
"0000234681" "RP2"
"0000234682" "RP2"
"0000234683" "RP2"
"0000234684" "RP2"
"0000234907" "RP2"
"0000234908" "RP2"
"0000234909" "RP2"
"0000241562" "RP2"
"0000241563" "RP2"
"0000241564" "RP2"
"0000309698" "RP2"
"0000309699" "RP2"
"0000309802" "RP2"
"0000310520" "RP2"
"0000310521" "RP2"
"0000310522" "RP2"
"0000310523" "RP2"
"0000310524" "RP2"
"0000310817" "RP2"
"0000310876" "RP2"
"0000326648" "RP2"
"0000326676" "RP2"
"0000326692" "RP2"
"0000328255" "RP2"
"0000328256" "RP2"
"0000328257" "RP2"
"0000328267" "RP2"
"0000328614" "RP2"
"0000328615" "RP2"
"0000328616" "RP2"
"0000328617" "RP2"
"0000328618" "RP2"
"0000328619" "RP2"
"0000328620" "RP2"
"0000328621" "RP2"
"0000328622" "RP2"
"0000328623" "RP2"
"0000328624" "RP2"
"0000328625" "RP2"
"0000328626" "RP2"
"0000328627" "RP2"
"0000328685" "RP2"
"0000328686" "RP2"
"0000328687" "RP2"
"0000328688" "RP2"
"0000328689" "RP2"
"0000328690" "RP2"
"0000328691" "RP2"
"0000328692" "RP2"
"0000328693" "RP2"
"0000328694" "RP2"
"0000328695" "RP2"
"0000328696" "RP2"
"0000328697" "RP2"
"0000329204" "RP2"
"0000329292" "RP2"
"0000329364" "RP2"
"0000329369" "RP2"
"0000329541" "RP2"
"0000329627" "RP2"
"0000329628" "RP2"
"0000329764" "RP2"
"0000332506" "RP2"
"0000333681" "RP2"
"0000333726" "ABCA4"
"0000333726" "RP2"
"0000333727" "RP2"
"0000333768" "RP2"
"0000334705" "RP2"
"0000334706" "RP2"
"0000334747" "RP2"
"0000334748" "RP2"
"0000334749" "RP2"
"0000334757" "RP2"
"0000334758" "RP2"
"0000334759" "RP2"
"0000334760" "RP2"
"0000334806" "RP2"
"0000335665" "RP2"
"0000335795" "RP2"
"0000336383" "RP2"
"0000336384" "RP2"
"0000336483" "RP2"
"0000336552" "RP2"
"0000336552" "RPGR"
"0000336620" "RP2"
"0000336637" "RP2"
"0000336641" "RP2"
"0000336650" "RP2"
"0000336723" "RP2"
"0000337220" "RP2"
"0000360008" "RP1L1"
"0000360008" "RP2"
"0000363421" "RP2"
"0000363816" "RP2"
"0000363816" "RPGR"
"0000363817" "RP2"
"0000363817" "RPGR"
"0000363818" "RP2"
"0000363818" "RPGR"
"0000363819" "RP2"
"0000363819" "RPGR"
"0000363820" "RP2"
"0000363820" "RPGR"
"0000363821" "RP2"
"0000363821" "RPGR"
"0000363822" "RP2"
"0000363822" "RPGR"
"0000363823" "RP2"
"0000363823" "RPGR"
"0000363824" "RP2"
"0000363824" "RPGR"
"0000363825" "RP2"
"0000363825" "RPGR"
"0000363826" "RP2"
"0000363826" "RPGR"
"0000363827" "RP2"
"0000363827" "RPGR"
"0000363828" "RP2"
"0000363828" "RPGR"
"0000363829" "RP2"
"0000363829" "RPGR"
"0000364697" "RP2"
"0000364848" "RP2"
"0000364942" "RP2"
"0000373306" "RP2"
"0000373311" "RP2"
"0000373747" "RP2"
"0000374712" "RP2"
"0000375045" "RP2"
"0000375094" "RP2"
"0000375116" "RP2"
"0000375154" "RP2"
"0000375170" "RP2"
"0000376636" "RP2"
"0000376651" "RP2"
"0000376652" "RP2"
"0000377437" "RP2"
"0000377438" "RP2"
"0000377439" "RP2"
"0000377440" "RP2"
"0000377441" "RP2"
"0000377882" "RP2"
"0000377882" "RPGR"
"0000377883" "RP2"
"0000377883" "RPGR"
"0000377884" "RP2"
"0000377884" "RPGR"
"0000377885" "RP2"
"0000377885" "RPGR"
"0000377886" "RP2"
"0000377886" "RPGR"
"0000377887" "RP2"
"0000377887" "RPGR"
"0000377888" "RP2"
"0000377888" "RPGR"
"0000377889" "RP2"
"0000377889" "RPGR"
"0000377890" "RP2"
"0000377890" "RPGR"
"0000377891" "RP2"
"0000377891" "RPGR"
"0000377892" "RP2"
"0000377892" "RPGR"
"0000377893" "RP2"
"0000377893" "RPGR"
"0000378196" "RP2"
"0000378197" "RP2"
"0000378469" "RP2"
"0000378702" "RP2"
"0000378703" "RP2"
"0000380623" "RP2"
"0000380624" "RP2"
"0000381081" "RP2"
"0000381977" "RP2"
"0000381978" "RP2"
"0000382157" "RP2"
"0000382157" "RPGR"
"0000382158" "RP2"
"0000382158" "RPGR"
"0000382159" "RP2"
"0000382159" "RPGR"
"0000382160" "RP2"
"0000382160" "RPGR"
"0000382187" "RP2"
"0000382188" "RP2"
"0000382215" "RP2"
"0000382218" "RP2"
"0000382853" "MERTK"
"0000382854" "RP2"
"0000382863" "ROM1"
"0000383145" "RP2"
"0000383146" "RP2"
"0000383147" "RP2"
"0000383629" "RP2"
"0000383630" "RP2"
"0000383631" "RP1"
"0000383634" "RP2"
"0000383635" "RP2"
"0000383636" "RP2"
"0000383637" "RP2"
"0000383996" "RP2"
"0000383997" "RP2"
"0000383998" "RP2"
"0000384728" "RP2"
"0000385001" "RP2"
"0000385009" "PDE6A"
"0000385010" "PDE6A"
"0000386257" "RP2"
"0000386263" "RP2"
"0000386312" "RP2"
"0000386650" "RP2"
"0000386840" "CRB1"
"0000386848" "RP2"
"0000386966" "RP2"
"0000386967" "RP2"
"0000387929" "RP2"
"0000387998" "RP2"
"0000388035" "RP2"
"0000389502" "RP2"
"0000390075" "RP2"
"0000390300" "RP2"
"0000390319" "RP2"
"0000390328" "RP2"
"0000390329" "RP2"
"0000390336" "RP2"
"0000390337" "RP2"
"0000390379" "RP2"
"0000390490" "RP2"
"0000390545" "RP2"
"0000390546" "RP2"
"0000390549" "RP2"
"0000390557" "RP2"
"0000390558" "RP2"
"0000391626" "RP2"
"0000391627" "RP2"
"0000391628" "RP2"
"0000391629" "RP2"
"0000391630" "RP2"
"0000392108" "RP2"
"0000392808" "RP2"
"0000392809" "RP2"
"0000393368" "RP2"
"0000393369" "RP2"
"0000393370" "SNRNP200"
"0000393371" "RP2"
"0000393373" "RP2"
"0000393374" "RP2"
"0000393375" "RP2"
"0000393384" "RP2"
"0000393385" "RP2"
"0000393393" "RP2"
"0000393394" "RP2"
"0000393395" "SNRNP200"
"0000393396" "RP2"
"0000393398" "RP2"
"0000393399" "RP2"
"0000393400" "RP2"
"0000393409" "RP2"
"0000393410" "RP2"
"0000393560" "RP2"
"0000393608" "RP2"
"0000393898" "RP2"
"0000393916" "RP2"
"0000394754" "RP2"
"0000394903" "RP2"
"0000394965" "RP2"
"0000394966" "RP2"
"0000395042" "RP2"
"0000396010" "RP2"
"0000396011" "RP2"
"0000396012" "RP2"
"0000396013" "RP2"
"0000396014" "RP2"
"0000397105" "RP2"
"0000397181" "RP2"
"0000397730" "RP2"
"0000397859" "EYS"
"0000406458" "RP2"
"0000406459" "RP2"
"0000406459" "RPGR"
"0000406460" "RP2"
"0000406460" "RPGR"
"0000406461" "RP2"
"0000406461" "RPGR"
"0000406462" "RP2"
"0000406463" "RP2"
"0000406464" "RP2"
"0000406465" "RP2"
"0000406466" "RP2"
"0000406467" "RP2"
"0000406468" "RP2"
"0000406469" "RP2"
"0000406470" "RP2"
"0000406471" "RP2"
"0000406472" "RP2"
"0000406473" "RP2"
"0000406474" "RP2"
"0000406475" "RP2"
"0000406476" "RP2"
"0000406477" "RP2"
"0000406478" "RP2"
"0000406478" "RPGR"
"0000406479" "RP2"
"0000406479" "RPGR"
"0000406480" "RP2"
"0000406480" "RPGR"
"0000406481" "RP2"
"0000406481" "RPGR"
"0000406482" "RP2"
"0000406482" "RPGR"
"0000406483" "RP2"
"0000406484" "RP2"
"0000406485" "RP2"
"0000406486" "RP2"
"0000406487" "RP2"
"0000406488" "RP2"
"0000406489" "RP2"
"0000406490" "RP2"
"0000406491" "RP2"
"0000406492" "RP2"
"0000406493" "RP2"
"0000406494" "RP2"
"0000406495" "RP2"
"0000406496" "RP2"
"0000406497" "RP2"
"0000406498" "RP2"
"0000406499" "RP2"
"0000406500" "RP2"
"0000406500" "RPGR"
"0000406501" "RP2"
"0000406501" "RPGR"
"0000406502" "RP2"
"0000406503" "ABCA4"
"0000406503" "BEST1"
"0000406503" "PRPH2"
"0000406503" "RHO"
"0000406503" "RP2"
"0000406504" "RP2"
"0000406505" "RP2"
"0000406506" "RP2"
"0000406507" "RP2"
"0000406508" "RP2"
"0000406509" "RP2"
"0000406510" "RP2"
"0000406511" "RP2"
"0000415593" "RP2"
"0000415594" "RP2"
"0000415595" "RP2"
"0000415596" "RP2"
"0000415597" "RP2"
"0000415598" "RP2"
"0000415609" "RP2"
"0000415610" "RP2"
"0000415611" "RP2"
"0000415612" "RP2"
"0000415613" "RP2"
"0000421787" "RP2"
"0000421820" "RP2"
"0000428251" "RP2"
"0000430983" "RP2"
"0000431029" "RP2"
"0000431088" "RP2"
"0000431148" "RP2"
"0000431152" "RP2"
"0000431282" "RP2"
"0000431418" "RP2"
"0000431437" "RP2"
"0000431449" "RP2"
"0000431450" "RP2"
"0000431506" "RP2"
"0000431515" "RP2"
"0000431557" "RP2"
"0000437942" "RP2"
"0000437947" "RP2"
"0000446959" "RP2"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 459
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000001882" "0" "50" "X" "46737167" "46737168" "dup" "0" "00037" "RP2_000004" "g.46737167_46737168dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46877732_46877733dup" "" "VUS" ""
"0000002903" "0" "50" "X" "46737167" "46737168" "dup" "0" "00037" "RP2_000005" "g.46737167_46737168dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.46877732_46877733dup" "" "VUS" ""
"0000006684" "20" "30" "X" "46740032" "46740032" "subst" "0" "00037" "RP2_000008" "g.46740032G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46880597G>A" "" "likely benign" ""
"0000008739" "20" "30" "X" "46740032" "46740032" "subst" "0" "00037" "RP2_000008" "g.46740032G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46880597G>A" "" "likely benign" ""
"0000010910" "20" "50" "X" "46737167" "46737168" "dup" "0" "00037" "RP2_000005" "g.46737167_46737168dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.46877732_46877733dup" "" "VUS" ""
"0000036429" "3" "55" "X" "46736939" "46736939" "subst" "0" "00552" "RP2_000006" "g.46736939G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46877504G>T" "" "VUS" ""
"0000060411" "1" "50" "X" "46719498" "46719498" "subst" "0.0183613" "00006" "RP2_000001" "g.46719498C>T" "6/208 patients" "{PMID:Tarpey 2009:19377476}" "" "" "recurrent, found 6 times" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "VUS" ""
"0000060412" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00229" "RP2_000001" "g.46719498C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "no" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000060413" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00229" "RP2_000001" "g.46719498C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "not segregating with disease in other family" "Germline" "no" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000060414" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00229" "RP2_000001" "g.46719498C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000060415" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00229" "RP2_000001" "g.46719498C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000060416" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00229" "RP2_000001" "g.46719498C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign; not segregating with disease in other families" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000060417" "1" "90" "X" "46713127" "46713128" "del" "0" "00229" "RP2_000002" "g.46713127_46713128del" "" "{PMID:Neveling 2012:22334370}" "" "318_319delAG" "" "Germline" "yes" "" "0" "" "" "g.46853692_46853693del" "" "pathogenic" ""
"0000060418" "1" "70" "X" "46713131" "46713131" "subst" "0" "00229" "RP2_000003" "g.46713131G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "" "" "0" "" "" "g.46853696G>A" "" "likely pathogenic" ""
"0000170950" "21" "90" "X" "46713217" "46713219" "del" "0" "01244" "RP2_000009" "g.46713217_46713219del" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853782_46853784del" "" "pathogenic" ""
"0000170951" "21" "90" "X" "46696535" "46739205" "" "0" "01244" "RP2_000010" "g.(?_46696535)_(46739205_?)del" "" "{PMID:de Castro-Miró 2014:24516651}" "" "all gene deletion" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000247787" "0" "90" "X" "46736938" "46736938" "subst" "0" "02330" "RP2_000017" "g.46736938A>G" "" "" "" "RP2(NM_006915.3):c.884-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46877503A>G" "" "pathogenic" ""
"0000247789" "0" "50" "X" "46696624" "46696624" "subst" "0" "02330" "RP2_000011" "g.46696624A>G" "" "" "" "RP2(NM_006915.2):c.89A>G (p.(Asp30Gly)), RP2(NM_006915.3):c.89A>G (p.D30G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46837189A>G" "" "VUS" ""
"0000294989" "0" "90" "X" "46713161" "46713161" "subst" "0" "02330" "RP2_000015" "g.46713161G>A" "" "" "" "RP2(NM_006915.3):c.353G>A (p.R118H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000294990" "0" "50" "X" "46713289" "46713289" "subst" "2.23844E-5" "02330" "RP2_000016" "g.46713289G>T" "" "" "" "RP2(NM_006915.3):c.481G>T (p.D161Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853854G>T" "" "VUS" ""
"0000307304" "0" "50" "X" "46713004" "46713004" "subst" "0.0002798" "01943" "RP2_000013" "g.46713004G>A" "" "" "" "RP2(NM_006915.2):c.196G>A (p.D66N), RP2(NM_006915.3):c.196G>A (p.(Asp66Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853569G>A" "" "VUS" ""
"0000307305" "0" "10" "X" "46713068" "46713068" "subst" "0.00137625" "01943" "RP2_000014" "g.46713068C>T" "" "" "" "RP2(NM_006915.2):c.260C>T (p.T87I, p.(Thr87Ile)), RP2(NM_006915.3):c.260C>T (p.T87I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853633C>T" "" "benign" ""
"0000333866" "0" "30" "X" "46696624" "46696624" "subst" "0" "01804" "RP2_000011" "g.46696624A>G" "" "" "" "RP2(NM_006915.2):c.89A>G (p.(Asp30Gly)), RP2(NM_006915.3):c.89A>G (p.D30G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46837189A>G" "" "likely benign" ""
"0000333868" "0" "30" "X" "46713068" "46713068" "subst" "0.00137625" "01804" "RP2_000014" "g.46713068C>T" "" "" "" "RP2(NM_006915.2):c.260C>T (p.T87I, p.(Thr87Ile)), RP2(NM_006915.3):c.260C>T (p.T87I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853633C>T" "" "likely benign" ""
"0000333869" "0" "50" "X" "46736945" "46736945" "subst" "3.91646E-5" "01804" "RP2_000018" "g.46736945G>C" "" "" "" "RP2(NM_006915.2):c.889G>C (p.V297L, p.(Val297Leu)), RP2(NM_006915.3):c.889G>C (p.V297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46877510G>C" "" "VUS" ""
"0000341775" "0" "90" "X" "46713160" "46713160" "subst" "0" "02327" "RP2_000019" "g.46713160C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853725C>T" "" "pathogenic" ""
"0000341776" "0" "90" "X" "46713161" "46713161" "subst" "0" "02327" "RP2_000015" "g.46713161G>A" "" "" "" "RP2(NM_006915.3):c.353G>A (p.R118H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000345351" "0" "30" "X" "46737005" "46737005" "subst" "6.71468E-5" "02327" "RP2_000022" "g.46737005G>A" "" "" "" "RP2(NM_006915.2):c.949G>A (p.E317K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46877570G>A" "" "likely benign" ""
"0000350462" "0" "10" "X" "46736945" "46736945" "subst" "3.91646E-5" "02327" "RP2_000018" "g.46736945G>C" "" "" "" "RP2(NM_006915.2):c.889G>C (p.V297L, p.(Val297Leu)), RP2(NM_006915.3):c.889G>C (p.V297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46877510G>C" "" "benign" ""
"0000368489" "20" "90" "X" "46696551" "46696553" "del" "0" "00006" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Schwahn 1998:09697692}, {OMIM300757:0001}" "" "TCCdel Ser6del" "" "Germline" "" "rs137852284" "0" "" "" "g.46837116_46837118del" "" "pathogenic" ""
"0000368490" "20" "90" "X" "46696611" "46696611" "subst" "0" "00006" "RP2_000024" "g.46696611C>T" "" "{PMID:Schwahn 1998:09697692}, {OMIM300757:0002}" "" "CAG>TAG codon26" "" "Germline" "" "rs104894925" "0" "" "" "g.46837176C>T" "" "pathogenic" ""
"0000368491" "20" "90" "X" "46713161" "46713161" "subst" "0" "00006" "RP2_000015" "g.46713161G>A" "" "{PMID:Schwahn 1998:09697692}, {OMIM300757:0003}" "" "CGT>CAT codon118" "" "Germline" "" "rs28933687" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000368492" "20" "90" "X" "46713261" "46713261" "subst" "0" "00006" "RP2_000025" "g.46713261C>G" "" "{PMID:Schwahn 1998:09697692}, {OMIM300757:0004}" "" "TAC>TAG codon151" "" "Germline" "" "rs104894926" "0" "" "" "g.46853826C>G" "" "pathogenic" ""
"0000368493" "20" "90" "X" "46713261" "46713261" "del" "0" "00006" "RP2_000026" "g.46713261del" "" "{PMID:Schwahn 1998:09697692}, {OMIM300757:0005}" "" "TAC delC codon 151" "" "Germline" "" "" "0" "" "" "g.46853826del" "" "pathogenic" ""
"0000368494" "0" "90" "X" "46736939" "46737026" "del" "0" "00006" "RP2_000027" "g.(46719538_46736939)_(46737026_46739120)del" "" "{PMID:Schwahn 1998:09697692}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000368495" "21" "90" "X" "46696783" "46696784" "ins" "0" "00006" "RP2_000028" "g.46696783_46696784ins[AF148856.1inv;46696770_46696783]" "" "{PMID:Schwahn 1998:09697692}" "" "intron 1 L1 insertion" "positional cloning; 5.8kb L1-insertion flanked by 14-bp target site duplication" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000368496" "20" "90" "X" "46696611" "46696612" "dup" "0" "00006" "RP2_000029" "g.46696611_46696612dup" "" "{PMID:Mears 1999:10053026}" "" "77/78insCA" "" "Germline" "yes" "" "0" "" "" "g.46837176_46837177dup" "" "pathogenic" ""
"0000368497" "20" "90" "X" "46713140" "46713152" "del" "0" "00006" "RP2_000030" "g.46713140_46713152del" "" "{PMID:Mears 1999:10053026}" "" "330-342del" "" "Germline" "yes" "" "0" "" "" "g.46853705_46853717del" "" "pathogenic" ""
"0000368498" "20" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Mears 1999:10053026}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000368499" "20" "90" "X" "46713292" "46713293" "ins" "0" "00006" "RP2_000033" "g.46713292_46713293insGGCTAAG" "" "{PMID:Mears 1999:10053026}" "" "483/484insGGGCTAA" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000368500" "20" "90" "X" "46736981" "46736982" "dup" "0" "00006" "RP2_000034" "g.46736981_46736982dup" "" "{PMID:Mears 1999:10053026}" "" "925/926insAG" "" "Germline" "yes" "" "0" "" "" "g.46877546_46877547dup" "" "pathogenic" ""
"0000368501" "21" "90" "X" "46713161" "46713161" "subst" "0" "00006" "RP2_000015" "g.46713161G>A" "" "{PMID:Hardcastle 1999:10090907}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000368502" "21" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Hardcastle 1999:10090907}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000368503" "21" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Hardcastle 1999:10090907}" "" "C358T" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000368504" "21" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Hardcastle 1999:10090907}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000368505" "21" "90" "X" "46713496" "46713500" "del" "0" "00006" "RP2_000036" "g.46713496_46713500del" "" "{PMID:Hardcastle 1999:10090907}" "" "del688–692" "" "Germline" "yes" "" "0" "" "" "g.46854061_46854065del" "" "pathogenic" ""
"0000368506" "21" "90" "X" "46736985" "46736985" "dup" "0" "00006" "RP2_000035" "g.46736985dup" "" "{PMID:Hardcastle 1999:10090907}" "" "929insT" "" "Germline" "yes" "" "0" "" "" "g.46877550dup" "" "pathogenic" ""
"0000368507" "20" "50" "X" "46713130" "46713130" "subst" "0" "00006" "RP2_000032" "g.46713130T>G" "" "{PMID:Mears 1999:10053026}" "" "" "" "Germline" "" "" "0" "" "" "g.46853695T>G" "" "VUS" ""
"0000472362" "3" "50" "X" "46713374" "46713374" "subst" "0" "01807" "RP2_000037" "g.46713374T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.46853939T>C" "" "VUS" ""
"0000477384" "3" "90" "X" "46696622" "46696622" "subst" "0" "02591" "RP2_000038" "g.46696622G>A" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46837187G>A" "" "pathogenic" ""
"0000477385" "0" "50" "X" "46712935" "46712935" "subst" "5.66114E-6" "02591" "RP2_000039" "g.46712935A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs201111874" "0" "" "" "g.46853500A>G" "" "VUS" ""
"0000477386" "0" "50" "X" "46713064" "46713064" "subst" "0" "02591" "RP2_000040" "g.46713064T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46853629T>C" "" "VUS" ""
"0000477387" "3" "50" "X" "46713086" "46713086" "subst" "0" "02591" "RP2_000041" "g.46713086T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46853651T>C" "" "VUS" ""
"0000477388" "3" "50" "X" "46713106" "46713106" "subst" "2.2379E-5" "02591" "RP2_000042" "g.46713106G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs781936550" "0" "" "" "g.46853671G>A" "" "VUS" ""
"0000477389" "0" "90" "X" "46713161" "46713161" "subst" "0" "02591" "RP2_000015" "g.46713161G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs28933687" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000477390" "3" "90" "X" "46713481" "46713481" "del" "0" "02591" "RP2_000043" "g.46713481del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46854046del" "" "pathogenic" ""
"0000477391" "3" "50" "X" "46713576" "46713576" "subst" "0" "02591" "RP2_000044" "g.46713576G>C" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46854141G>C" "" "VUS" ""
"0000477392" "0" "50" "X" "46719468" "46719468" "subst" "0.000117697" "02591" "RP2_000045" "g.46719468A>G" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs143606776" "0" "" "" "g.46860033A>G" "" "VUS" ""
"0000477615" "3" "50" "X" "46713064" "46713064" "subst" "0" "02591" "RP2_000040" "g.46713064T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.46853629T>C" "" "VUS" ""
"0000477616" "3" "90" "X" "46713161" "46713161" "subst" "0" "02591" "RP2_000015" "g.46713161G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs28933687" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000477617" "3" "50" "X" "46719468" "46719468" "subst" "0.000117697" "02591" "RP2_000045" "g.46719468A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs143606776" "0" "" "" "g.46860033A>G" "" "VUS" ""
"0000487572" "20" "90" "X" "46696347" "46713577" "del" "0" "03335" "RP2_000046" "g.46696347_46713577del" "" "" "" "" "Variant Error [EMISMATCH/EUNCERTAIN]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000487573" "21" "90" "X" "46737027" "46737027" "subst" "0" "03335" "RP2_000048" "g.46737027T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46877592T>G" "" "pathogenic (recessive)" ""
"0000487574" "10" "70" "X" "46696536" "46696536" "subst" "0" "03335" "RP2_000047" "g.46696536A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46837101A>G" "" "pathogenic (recessive)" ""
"0000576069" "0" "50" "X" "46712963" "46712963" "subst" "2.24763E-5" "01943" "RP2_000049" "g.46712963G>A" "" "" "" "RP2(NM_006915.2):c.155G>A (p.R52H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853528G>A" "" "VUS" ""
"0000576070" "0" "50" "X" "46713034" "46713034" "subst" "0" "02330" "RP2_000050" "g.46713034G>T" "" "" "" "RP2(NM_006915.3):c.226G>T (p.D76Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853599G>T" "" "VUS" ""
"0000576071" "0" "50" "X" "46713056" "46713056" "subst" "3.35662E-5" "01943" "RP2_000051" "g.46713056T>C" "" "" "" "RP2(NM_006915.2):c.248T>C (p.I83T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853621T>C" "" "VUS" ""
"0000576072" "0" "90" "X" "46713217" "46713219" "del" "0" "02330" "RP2_000009" "g.46713217_46713219del" "" "" "" "RP2(NM_006915.3):c.409_411delATT (p.I137del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853782_46853784del" "" "pathogenic" ""
"0000576073" "0" "10" "X" "46713409" "46713409" "subst" "0.000828361" "02330" "RP2_000052" "g.46713409A>G" "" "" "" "RP2(NM_006915.3):c.601A>G (p.I201V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853974A>G" "" "benign" ""
"0000576074" "0" "90" "X" "46736939" "46736939" "subst" "0" "02330" "RP2_000053" "g.46736939G>C" "" "" "" "RP2(NM_006915.3):c.884-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46877504G>C" "" "pathogenic" ""
"0000576075" "0" "30" "X" "46736945" "46736945" "subst" "3.91646E-5" "02330" "RP2_000018" "g.46736945G>C" "" "" "" "RP2(NM_006915.2):c.889G>C (p.V297L, p.(Val297Leu)), RP2(NM_006915.3):c.889G>C (p.V297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46877510G>C" "" "likely benign" ""
"0000576076" "0" "50" "X" "46736945" "46736945" "subst" "3.91646E-5" "01943" "RP2_000018" "g.46736945G>C" "" "" "" "RP2(NM_006915.2):c.889G>C (p.V297L, p.(Val297Leu)), RP2(NM_006915.3):c.889G>C (p.V297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46877510G>C" "" "VUS" ""
"0000576077" "0" "30" "X" "46737005" "46737005" "subst" "6.71468E-5" "01943" "RP2_000022" "g.46737005G>A" "" "" "" "RP2(NM_006915.2):c.949G>A (p.E317K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46877570G>A" "" "likely benign" ""
"0000619579" "0" "90" "X" "46713166" "46713166" "subst" "0" "02330" "RP2_000031" "g.46713166C>T" "" "" "" "RP2(NM_006915.3):c.358C>T (p.R120*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000619580" "0" "50" "X" "46736983" "46736983" "subst" "0" "02327" "RP2_000054" "g.46736983A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46877548A>G" "" "VUS" ""
"0000682447" "0" "90" "X" "46712985" "46712985" "dup" "0" "02327" "RP2_000055" "g.46712985dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000682448" "0" "50" "X" "46713281" "46713281" "subst" "0" "02327" "RP2_000056" "g.46713281A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000682449" "0" "30" "X" "46719429" "46719429" "subst" "0" "01943" "RP2_000057" "g.46719429G>A" "" "" "" "RP2(NM_006915.2):c.775G>A (p.G259S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000684571" "1" "70" "X" "46713161" "46713161" "subst" "0" "00004" "RP2_000015" "g.46713161G>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000684572" "1" "70" "X" "46713166" "46713166" "subst" "0" "00004" "RP2_000031" "g.46713166C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000684675" "1" "70" "X" "46713130" "46713130" "subst" "0" "00004" "RP2_000059" "g.46713130T>C" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000685431" "0" "90" "X" "46696638" "46696638" "subst" "0" "00004" "RP2_000058" "g.46696638G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685432" "0" "70" "X" "46713136" "46713136" "subst" "0" "00004" "RP2_000060" "g.46713136T>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000685433" "0" "90" "X" "46713160" "46713160" "subst" "0" "00004" "RP2_000019" "g.46713160C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685434" "0" "90" "X" "46713166" "46713166" "subst" "0" "00004" "RP2_000031" "g.46713166C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685435" "20" "90" "X" "46713172" "46713172" "del" "0" "00004" "RP2_000061" "g.46713172del" "1/2420 IRD families" "{PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "c.364delT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685841" "0" "70" "X" "46713204" "46713228" "del" "0" "00006" "RP2_000062" "g.46713204_46713228del" "" "{PMID:Jinda 2014:24618324}" "" "395_419del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000686016" "0" "90" "X" "46713338" "46713339" "del" "0" "00006" "RP2_000063" "g.46713338_46713339del" "" "{PMID:Kimchi 2018:29276052}" "" "530_531delTT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000710240" "20" "90" "X" "46696347" "46713577" "del" "0" "00006" "RP2_000064" "g.(?_46696347)_(46713577_46719422)del" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "del exon 1-2" "ACMG PVS1, PM2, PP1, PP4" "Germline" "" "" "0" "" "" "g.(?_46836912)_(46854142_46859987)del" "" "pathogenic" "ACMG"
"0000710268" "20" "90" "X" "46737027" "46737027" "subst" "0" "00006" "RP2_000048" "g.46737027T>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PVS1, PM2, PP1, PP4" "Germline" "" "" "0" "" "" "g.46877592T>G" "" "pathogenic" "ACMG"
"0000710284" "20" "90" "X" "46696536" "46696536" "subst" "0" "00006" "RP2_000047" "g.46696536A>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PVS1, PS*, PM2, PP4" "Germline" "" "" "0" "" "" "g.46837101A>G" "" "pathogenic" "ACMG"
"0000712184" "1" "90" "X" "46713161" "46713161" "subst" "0" "00006" "RP2_000015" "g.46713161G>A" "" "{PMID:Rosenberg 1999:10520237}" "" "Arg118His" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (!)" ""
"0000712185" "1" "90" "X" "46696611" "46696611" "subst" "0" "00006" "RP2_000024" "g.46696611C>T" "" "{PMID:Rosenberg 1999:10520237}" "" "Gln26stop" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (!)" ""
"0000712190" "21" "90" "X" "46696551" "46696553" "del" "0" "00006" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Rosenberg 1999:10520237}" "" "delSer6" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000712215" "21" "90" "X" "46713221" "46713221" "subst" "0" "00006" "RP2_000065" "g.46713221A>G" "" "{PMID:Parmeggiani 2017:27768226}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000712572" "1" "90" "X" "46696347" "46696638" "del" "0" "00006" "RP2_000066" "g.(?_46696347)_(46696638_46712910)del" "" "{PMID:Bader 2003:12657579}" "" "" "" "Germline" "" "" "0" "" "" "g.(?_46836912)_(46837203_46853475)del" "" "pathogenic" ""
"0000712573" "1" "90" "X" "46713161" "46713161" "subst" "0" "00006" "RP2_000015" "g.46713161G>A" "" "{PMID:Bader 2003:12657579}" "" "353G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000712574" "1" "90" "X" "46713160" "46713160" "subst" "0" "00006" "RP2_000019" "g.46713160C>T" "" "{PMID:Bader 2003:12657579}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000712575" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "0.016" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000712576" "1" "90" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853782_46853784del" "" "pathogenic" ""
"0000712577" "1" "90" "X" "46713158" "46713159" "del" "0" "00000" "RP2_000073" "g.46713158_46713159del" "" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853723_46853724del" "" "pathogenic" ""
"0000712578" "1" "90" "X" "46713323" "46713323" "dup" "0" "00000" "RP2_000074" "g.46713323dup" "" "{PMID:Breuer 2002:11992260}" "" "515insG (Ser172fsTer173)" "" "Germline" "yes" "" "0" "" "" "g.46853888dup" "" "pathogenic" ""
"0000712579" "1" "90" "X" "46713481" "46713481" "dup" "0" "00000" "RP2_000076" "g.46713481dup" "" "{PMID:Breuer 2002:11992260}" "" "670insC (Arg225fsTer234)" "" "Germline" "yes" "" "0" "" "" "g.46854046dup" "" "pathogenic" ""
"0000712580" "1" "90" "X" "46696640" "46696640" "subst" "0" "00000" "RP2_000068" "g.46696640A>G" "" "{PMID:Breuer 2002:11992260}" "" "IVS1+3A>G" "" "Germline" "yes" "" "0" "" "" "g.46837205A>G" "" "pathogenic" ""
"0000712581" "1" "90" "X" "46696616" "46696616" "subst" "0" "00000" "RP2_000067" "g.46696616C>G" "" "{PMID:Breuer 2002:11992260}" "" "82C>G" "" "Germline" "yes" "" "0" "" "" "g.46837181C>G" "" "pathogenic" ""
"0000712582" "1" "90" "X" "46713008" "46713008" "subst" "0" "00000" "RP2_000070" "g.46713008G>A" "" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853573G>A" "" "pathogenic" ""
"0000712583" "1" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000712584" "1" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Breuer 2002:11992260}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000712585" "1" "90" "X" "46713371" "46713371" "subst" "0" "00000" "RP2_000075" "g.46713371T>C" "" "{PMID:Breuer 2002:11992260}" "" "565T>C (Leu188Pro)" "" "Germline" "yes" "" "0" "" "" "g.46853936T>C" "" "pathogenic" ""
"0000712701" "21" "90" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "409delATT" "" "Germline" "" "" "0" "" "" "g.46853782_46853784del" "" "pathogenic (recessive)" ""
"0000712702" "21" "90" "X" "46713496" "46713500" "del" "0" "00000" "RP2_000036" "g.46713496_46713500del" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "688delAAGAG" "" "Germline" "" "" "0" "" "" "g.46854061_46854065del" "" "pathogenic (recessive)" ""
"0000712703" "21" "90" "X" "46696640" "46696640" "subst" "0" "00000" "RP2_000069" "g.46696640A>T" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "IVS3+3A>T" "" "Germline" "" "" "0" "" "" "g.46837205A>T" "" "pathogenic (recessive)" ""
"0000712704" "1" "90" "X" "46713065" "46713065" "subst" "0" "00000" "RP2_000071" "g.46713065G>A" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "G257A" "" "Germline" "" "" "0" "" "" "g.46853630G>A" "" "pathogenic" ""
"0000712705" "21" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "G353A" "" "Germline" "" "" "0" "" "" "g.46853726G>A" "" "pathogenic (recessive)" ""
"0000712706" "21" "50" "X" "46713092" "46713092" "subst" "0" "00000" "RP2_000072" "g.46713092C>T" "" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "C284T" "" "Germline" "" "" "0" "" "" "g.46853657C>T" "" "VUS" ""
"0000712707" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "3/82 cases" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "C844T" "" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000712708" "1" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "3/148 controls" "{PMID:Sharon 2000:10937588}, {PMID:Sharon 2003:14564670}" "" "C844T" "" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "benign" ""
"0000712709" "1" "70" "X" "46719452" "46719455" "del" "0" "00000" "RP2_000077" "g.46719452_46719455del" "" "{PMID:Sharon 2003:14564670}" "" "798delGACA" "" "Germline" "" "" "0" "" "" "g.46860017_46860020del" "" "likely pathogenic (recessive)" ""
"0000712710" "1" "70" "X" "46737028" "46737028" "subst" "0" "00000" "RP2_000078" "g.46737028A>C" "" "{PMID:Sharon 2003:14564670}" "" "IVS4+3A>C" "" "Germline" "" "" "0" "" "" "g.46877593A>C" "" "likely pathogenic (recessive)" ""
"0000712711" "1" "70" "X" "46737028" "46737028" "subst" "0" "00000" "RP2_000079" "g.46737028A>G" "" "{PMID:Sharon 2003:14564670}" "" "IVS4+3A>G" "" "Germline" "" "" "0" "" "" "g.46877593A>G" "" "likely pathogenic (recessive)" ""
"0000712712" "1" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Sharon 2003:14564670}" "" "C352T" "" "Germline" "" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic (recessive)" ""
"0000712713" "1" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Sharon 2003:14564670}" "" "G353A" "" "Germline" "" "" "0" "" "" "g.46853726G>A" "" "likely pathogenic (recessive)" ""
"0000713327" "20" "90" "X" "46696544" "46696546" "del" "0" "00000" "RP2_000081" "g.46696544_46696546del" "" "{PMID:Carss 2017:28041643}" "" "X:46696543GCTT>G ENST00000218340.3:c.14_16delTCT (Phe5del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000713415" "20" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Carss 2017:28041643}" "" "X:46713166C>T ENST00000218340.3:c.358C>T (Arg120Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000713487" "20" "90" "X" "46713146" "46713146" "subst" "0" "00000" "RP2_000083" "g.46713146C>A" "" "{PMID:Carss 2017:28041643}" "" "X:46713146C>A ENST00000218340.3:c.338C>A (Ala113Asp)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000713492" "20" "90" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Carss 2017:28041643}" "" "X:46713160C>T ENST00000218340.3:c.352C>T (Arg118Cys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000713664" "20" "90" "X" "46696578" "46696578" "del" "0" "00000" "RP2_000082" "g.46696578del" "" "{PMID:Carss 2017:28041643}" "" "X:46696577GT>G ENST00000218340.3:c.43delT (Ser15ArgfsTer31)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000713975" "1" "70" "X" "46696540" "46696540" "subst" "0" "00000" "RP2_000080" "g.46696540G>T" "" "{PMID:Zhou 2018:29453956}" "" "" "" "Germline" "" "" "0" "" "" "g.46837105G>T" "" "likely pathogenic (recessive)" ""
"0000713976" "3" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Zhou 2018:29453956}" "" "" "" "Germline" "" "rs28933687" "0" "" "" "g.46853726G>A" "" "likely pathogenic (recessive)" ""
"0000714149" "21" "90" "X" "46696616" "46696616" "subst" "0" "00006" "RP2_000067" "g.46696616C>G" "" "{PMID:Andreasson 2003:14566651}" "" "82C>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000728923" "0" "50" "X" "46736945" "46736945" "subst" "3.91646E-5" "02325" "RP2_000018" "g.46736945G>C" "" "" "" "RP2(NM_006915.2):c.889G>C (p.V297L, p.(Val297Leu)), RP2(NM_006915.3):c.889G>C (p.V297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000729761" "20" "90" "X" "46719536" "46719536" "del" "0" "00000" "RP2_000084" "g.46719536del" "" "{PMID:Maeda 2018:29785639}" "" "c.882delA" "" "Germline" "" "" "0" "" "" "g.46860101del" "" "pathogenic" ""
"0000731086" "3" "50" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs1805147" "0" "" "" "g.46860063C>T" "" "VUS" ""
"0000731430" "20" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:DiIorio 2017:29053603}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000731489" "20" "90" "X" "46737028" "46737028" "subst" "0" "00000" "RP2_000079" "g.46737028A>G" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.46877593A>G" "" "pathogenic (recessive)" ""
"0000731490" "20" "70" "X" "46713155" "46713155" "subst" "0" "00000" "RP2_000085" "g.46713155A>T" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.46853720A>T" "" "likely pathogenic" ""
"0000731558" "1" "90" "X" "46713296" "46713296" "subst" "0" "00000" "RP2_000086" "g.46713296G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.46853861G>A" "" "pathogenic" ""
"0000732685" "0" "70" "X" "46696640" "46696640" "subst" "0" "00000" "RP2_000088" "g.46696640A>C" "" "{PMID:Soens 2017:28714225}" "" "" "effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.46837205A>C" "" "likely pathogenic" ""
"0000732686" "1" "70" "X" "46696637" "46696637" "subst" "0" "00000" "RP2_000087" "g.46696637G>A" "" "{PMID:Soens 2017:28714225}" "" "" "effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.46837202G>A" "" "likely pathogenic" ""
"0000732754" "0" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000732755" "0" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000732756" "0" "70" "X" "46713193" "46713194" "del" "0" "00000" "RP2_000089" "g.46713193_46713194del" "" "{PMID:Stone 2017:28559085}" "" "382_383delTT" "" "Germline" "" "" "0" "" "" "g.46853758_46853759del" "" "likely pathogenic" ""
"0000732764" "0" "70" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Stone 2017:28559085}" "" "del ex2" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000732765" "0" "70" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Stone 2017:28559085}" "" "del ex2" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000732766" "0" "70" "X" "46713496" "46713500" "del" "0" "00000" "RP2_000036" "g.46713496_46713500del" "" "{PMID:Stone 2017:28559085}" "" "686_690delAGAAG" "" "Germline" "" "" "0" "" "" "g.46854061_46854065del" "" "likely pathogenic" ""
"0000732767" "0" "70" "X" "46736939" "46736939" "subst" "0" "00000" "RP2_000092" "g.46736939G>A" "" "{PMID:Stone 2017:28559085}" "" "IVS3-1 G>A" "" "Germline" "" "" "0" "" "" "g.46877504G>A" "" "likely pathogenic" ""
"0000732813" "0" "70" "X" "46713567" "46713570" "del" "0" "00000" "RP2_000091" "g.46713567_46713570del" "" "{PMID:Stone 2017:28559085}" "" "758_761delTAAT" "" "Germline" "" "" "0" "" "" "g.46854132_46854135del" "" "likely pathogenic" ""
"0000734359" "0" "70" "X" "46713253" "46713253" "subst" "0" "00000" "RP2_000090" "g.46713253C>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.46853818C>T" "" "likely pathogenic" ""
"0000734694" "0" "70" "X" "46713204" "46713228" "del" "0" "00000" "RP2_000062" "g.46713204_46713228del" "" "{PMID:Jinda 2017:28453600}" "" "395_419delCCACTCAACCCATCATTGAGTCTTC" "" "Germline" "" "" "0" "" "" "g.46853769_46853793del" "" "likely pathogenic (recessive)" ""
"0000735658" "0" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853726G>A" "" "pathogenic" ""
"0000735659" "1" "90" "X" "46713294" "46713298" "del" "0" "00000" "RP2_000020" "g.46713294_46713298del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "De novo" "" "" "0" "" "" "g.46853859_46853863del" "" "pathogenic" ""
"0000735858" "0" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000735948" "0" "70" "X" "46739146" "46739146" "subst" "2.25995E-5" "02485" "RP2_000095" "g.46739146C>T" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.46879711C>T" "" "likely pathogenic" ""
"0000736065" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000736082" "0" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000736086" "0" "70" "X" "46713559" "46713559" "subst" "0.000253333" "00000" "RP2_000094" "g.46713559A>G" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.46854124A>G" "" "likely pathogenic" ""
"0000736095" "0" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Huang 2018:29641573}" "" "c.9_11delCTT" "" "Germline" "" "" "0" "" "" "g.46837114_46837116del" "" "likely pathogenic" ""
"0000736213" "1" "90" "X" "46713193" "46713194" "del" "0" "00000" "RP2_000089" "g.46713193_46713194del" "" "{PMID:Bernardis 2016:28127548}" "" "c.382_383delTT" "" "Germline" "" "" "0" "" "" "g.46853758_46853759del" "" "pathogenic" ""
"0000736850" "1" "70" "X" "46713068" "46713076" "del" "0" "00000" "RP2_000097" "g.46713068_46713076del" "1/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "" "0" "" "" "g.46853633_46853641del" "" "likely pathogenic" ""
"0000759650" "0" "90" "X" "46739174" "46739174" "subst" "0" "00006" "RP2_000096" "g.46739174C>A" "" "{PMID:Fujinami 2016:27623337}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000760190" "0" "50" "X" "46713068" "46713076" "del" "0" "00000" "RP2_000097" "g.46713068_46713076del" "" "{PMID:Ellingford 2016:27208204}" "" "260_268delCTAACTGCA" "" "Germline" "" "" "0" "" "" "g.46853633_46853641del" "" "VUS" ""
"0000760247" "0" "70" "X" "46737028" "46737028" "subst" "0" "00000" "RP2_000079" "g.46737028A>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.46877593A>G" "" "likely pathogenic" ""
"0000760278" "0" "50" "X" "46713315" "46713315" "del" "0" "00000" "RP2_000099" "g.46713315del" "" "{PMID:Ellingford 2016:27208204}" "" "507delT" "" "Germline" "" "" "0" "" "" "g.46853880del" "" "VUS" ""
"0000760287" "0" "70" "X" "46696638" "46696638" "subst" "0" "00000" "RP2_000098" "g.46696638G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.46837203G>A" "" "likely pathogenic" ""
"0000760296" "0" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.46853726G>A" "" "likely pathogenic" ""
"0000764059" "1" "70" "X" "46713516" "46713516" "subst" "0" "00000" "RP2_000100" "g.46713516C>G" "" "{PMID:Perez-Carro 2016:26806561}" "" "" "no variant 2nd chromosome" "Germline" "yes" "" "0" "" "" "g.46854081C>G" "" "likely pathogenic" ""
"0000764518" "1" "90" "X" "46696540" "46696540" "subst" "0" "00008" "RP2_000080" "g.46696540G>T" "" "{PMID:Pelletier 2007:16969763}" "" "c.5G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764519" "1" "90" "X" "46713123" "46713123" "subst" "0" "00008" "RP2_000105" "g.46713123C>G" "" "{PMID:Pelletier 2007:16969763}" "" "c.315C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764520" "1" "90" "X" "46713161" "46713161" "subst" "0" "00008" "RP2_000015" "g.46713161G>A" "" "{PMID:Pelletier 2007:16969763}" "" "c.353G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764521" "1" "90" "X" "46713440" "46713440" "subst" "1.67911E-5" "00008" "RP2_000110" "g.46713440G>A" "" "{PMID:Pelletier 2007:16969763}" "" "c.632G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764522" "1" "90" "X" "46696581" "46739266" "del" "0" "00008" "RP2_000101" "g.46696581_46739266del" "" "{PMID:Pelletier 2007:16969763}" "" "c.(?_46)_( * 62_?)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764523" "1" "90" "X" "46713113" "46713113" "del" "0" "00008" "RP2_000104" "g.46713113delT" "" "{PMID:Pelletier 2007:16969763}" "" "c.305delT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764524" "1" "90" "X" "46713227" "46713234" "del" "0" "00008" "RP2_000106" "g.46713227_46713234delCCTCAAAT" "" "{PMID:Pelletier 2007:16969763}" "" "c.419_426delCCTCAAAT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764525" "1" "90" "X" "46713348" "46713349" "del" "0" "00008" "RP2_000108" "g.46713348_46713349delGT" "" "{PMID:Pelletier 2007:16969763}" "" "c.540_541delGT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764526" "1" "90" "X" "46719455" "46719458" "del" "0" "00008" "RP2_000112" "g.46719455_46719458delAAAG" "" "{PMID:Pelletier 2007:16969763}" "" "c.801_804delAAAG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764527" "1" "90" "X" "46713100" "46713101" "ins" "0" "00008" "RP2_000102" "g.46713100_46713101insA" "" "{PMID:Pelletier 2007:16969763}" "" "c.292_293insA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764528" "1" "90" "X" "46713101" "46713105" "dup" "0" "00008" "RP2_000103" "g.46713101_46713105dupGCAGC" "" "{PMID:Pelletier 2007:16969763}" "" "c.293_297dupGCAGC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764529" "1" "90" "X" "46713257" "46713257" "subst" "0" "00008" "RP2_000107" "g.46713257G>A" "" "{PMID:Pelletier 2007:16969763}" "" "c.449G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764530" "1" "90" "X" "46713365" "46713365" "subst" "0" "00008" "RP2_000109" "g.46713365G>T" "" "{PMID:Pelletier 2007:16969763}" "" "c.557G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000764531" "1" "90" "X" "46719422" "46719422" "subst" "0" "00008" "RP2_000111" "g.46719422G>A" "" "{PMID:Pelletier 2007:16969763}" "" "c.769-1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000765572" "20" "90" "X" "46713527" "46713527" "del" "0" "00000" "RP2_000114" "g.46713527del" "" "{PMID:Ge 2015:26667666}" "" "718delT" "" "Germline" "" "" "0" "" "" "g.46854092del" "" "pathogenic" ""
"0000765790" "0" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" ""
"0000765884" "0" "70" "X" "46696537" "46696537" "subst" "0" "00000" "RP2_000113" "g.46696537T>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.46837102T>C" "" "likely pathogenic" ""
"0000783278" "0" "70" "X" "46713148" "46713148" "subst" "0" "00000" "RP2_000115" "g.46713148T>C" "" "{PMID:Yoon 2015:26155838}" "" "" "" "Germline" "" "" "0" "" "" "g.46853713T>C" "" "likely pathogenic" ""
"0000783283" "0" "70" "X" "46713368" "46713369" "del" "0" "00000" "RP2_000116" "g.46713368_46713369del" "" "{PMID:Yoon 2015:26155838}" "" "560_561delGC" "" "Germline" "" "" "0" "" "" "g.46853933_46853934del" "" "likely pathogenic" ""
"0000783896" "3" "50" "X" "46713559" "46713559" "subst" "0.000253333" "00000" "RP2_000094" "g.46713559A>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.46854124A>G" "" "VUS" ""
"0000784229" "20" "90" "X" "46696584" "46696584" "subst" "0" "00000" "RP2_000117" "g.46696584C>T" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46837149C>T" "" "pathogenic (recessive)" ""
"0000784230" "20" "90" "X" "46712923" "46712923" "subst" "0" "00000" "RP2_000118" "g.46712923G>A" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853488G>A" "" "pathogenic (recessive)" ""
"0000784231" "20" "90" "X" "46713236" "46713236" "subst" "0" "00000" "RP2_000119" "g.46713236T>C" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853801T>C" "" "pathogenic (recessive)" ""
"0000784232" "20" "90" "X" "46713400" "46713406" "del" "0" "00000" "RP2_000120" "g.46713400_46713406del" "" "{PMID:Xu 2014:24938718}" "" "c.591_597delCTATGTT" "" "Germline" "" "" "0" "" "" "g.46853965_46853971del" "" "pathogenic (recessive)" ""
"0000785535" "0" "90" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Fernandez-San Jose 2015:25698705}" "" "c.9_11del" "" "Germline" "" "" "0" "" "" "g.46837114_46837116del" "" "pathogenic (dominant)" ""
"0000786306" "0" "90" "X" "46713107" "46713107" "dup" "0" "00000" "RP2_000122" "g.46713107dup" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "299dupT" "" "Germline" "" "" "0" "" "" "g.46853672dup" "" "pathogenic" ""
"0000786361" "0" "90" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.46853725C>T" "" "pathogenic" ""
"0000786411" "0" "90" "X" "46713145" "46713145" "subst" "0" "00000" "RP2_000123" "g.46713145G>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853710G>A" "" "pathogenic" ""
"0000786449" "0" "90" "X" "46713066" "46713066" "subst" "0" "00000" "RP2_000121" "g.46713066T>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853631T>G" "" "pathogenic" ""
"0000786465" "0" "90" "X" "46719451" "46719451" "subst" "0" "00000" "RP2_000124" "g.46719451A>C" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46860016A>C" "" "pathogenic" ""
"0000787623" "0" "70" "X" "46736939" "46736939" "subst" "0" "00000" "RP2_000053" "g.46736939G>C" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46877504G>C" "" "likely pathogenic" ""
"0000787639" "0" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000788529" "3" "90" "X" "46736939" "46736939" "subst" "0" "00000" "RP2_000006" "g.46736939G>T" "" "{PMID:Watson 2014:25133751}" "" "" "" "Germline" "" "" "0" "" "" "g.46877504G>T" "" "pathogenic" ""
"0000788544" "1" "70" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Pan 2014:24940031}" "" "" "" "Germline" "" "" "0" "" "" "g.46853782_46853784del" "" "likely pathogenic" ""
"0000788545" "1" "70" "X" "46713001" "46713001" "subst" "0" "00000" "RP2_000125" "g.46713001C>T" "" "{PMID:Pan 2014:24940031}" "" "" "" "Germline" "" "" "0" "" "" "g.46853566C>T" "" "likely pathogenic" ""
"0000789767" "0" "90" "X" "46696548" "46696550" "del" "0" "00000" "RP2_000093" "g.46696548_46696550del" "" "{PMID:Neidhardt 2008:18552978}" "" "c.13_15del3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789768" "0" "90" "X" "46719420" "46719420" "subst" "0" "00000" "RP2_000127" "g.46719420C>A" "" "{PMID:Neidhardt 2008:18552978}" "" "c.769-3C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789769" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Neidhardt 2008:18552978}" "" "c.358C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789770" "0" "90" "X" "46736939" "46736939" "subst" "0" "00000" "RP2_000053" "g.46736939G>C" "" "{PMID:Neidhardt 2008:18552978}" "" "c.884-1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789771" "0" "90" "X" "46737024" "46737024" "delins" "0" "00000" "RP2_000128" "g.46737024delinsTCC" "" "{PMID:Neidhardt 2008:18552978}" "" "c.968delAinsTCC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000789772" "0" "90" "X" "46713128" "46713128" "subst" "0" "00000" "RP2_000126" "g.46713128T>C" "" "{PMID:Neidhardt 2008:18552978}" "" "c.310+10T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000790354" "20" "90" "X" "46696611" "46696611" "subst" "0" "00000" "RP2_000024" "g.46696611C>T" "" "{PMID:Prokisch 2007:17724181}" "" "c.76C>T (p.Q26X)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790355" "20" "90" "X" "46696611" "46696611" "subst" "0" "00000" "RP2_000024" "g.46696611C>T" "" "{PMID:Prokisch 2007:17724181}" "" "c.76C>T (p.Q26X)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790356" "20" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Prokisch 2007:17724181}" "" "c.353G>A (p.R118H)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790357" "20" "90" "X" "46719512" "46719512" "del" "0" "00000" "RP2_000131" "g.46719512delT" "" "{PMID:Prokisch 2007:17724181}" "" "c.858delT (p.D287Tfs*6)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790358" "20" "90" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Prokisch 2007:17724181}" "" "del15.2kb_incl_ex4 (Truncated)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790359" "20" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Prokisch 2007:17724181}" "" "c.16_18del (p.S6del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790360" "20" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Prokisch 2007:17724181}" "" "c.16_18del (p.S6del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790361" "20" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Prokisch 2007:17724181}" "" "c.16_18del (p.S6del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790362" "20" "90" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000129" "g.46713160C>G" "" "{PMID:Prokisch 2007:17724181}" "" "c.352C>G (p.R118G)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790363" "20" "90" "X" "46713194" "46713194" "dup" "0" "00000" "RP2_000130" "g.46713194dupT" "" "{PMID:Prokisch 2007:17724181}" "" "c.386dupT (p.L129Ffs*10)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790364" "20" "90" "X" "46737028" "46737028" "subst" "0" "00000" "RP2_000079" "g.46737028A>G" "" "{PMID:Prokisch 2007:17724181}" "" "c.969+3A>G (Exon4skipping)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790365" "20" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Prokisch 2007:17724181}" "" "c.16_18del (p.S6del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790440" "1" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000790466" "0" "50" "X" "46737015" "46737015" "subst" "2.23818E-5" "00000" "RP2_000132" "g.46737015A>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.46877580A>G" "" "VUS" ""
"0000790479" "1" "50" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "VUS" ""
"0000790543" "1" "50" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.46860063C>T" "" "VUS" ""
"0000790680" "1" "90" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Daiger 2014:24664689}" "" "del ex4-flanking" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000790881" "20" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Ji-2010:20021257}" "" "c.353G>A (p.Arg118His)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790882" "20" "70" "X" "46712911" "46739204" "del" "0" "00000" "RP2_000133" "g.46712911_46739204del" "" "{PMID:Ji-2010:20021257}" "" "(c.103_1053del, p.Val35_Ile350del)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000791224" "0" "90" "X" "46713578" "46713578" "subst" "0" "00000" "RP2_000134" "g.46713578T>C" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Somatic" "yes" "" "0" "" "" "g.46854143T>C" "" "pathogenic" "ACMG"
"0000791551" "20" "70" "X" "46696536" "46696536" "subst" "0" "00000" "RP2_000047" "g.46696536A>G" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46837101A>G" "" "likely pathogenic" ""
"0000791552" "10" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46837114_46837116del" "" "likely pathogenic" ""
"0000791583" "21" "90" "X" "46719421" "46719421" "subst" "0" "00000" "RP2_000135" "g.46719421A>G" "" "{PMID:Hosono 2018:29844330}" "" "c.769-2A>G" "hemizygous, causative variant" "Germline" "yes" "" "0" "" "" "g.46859986A>G" "" "pathogenic" "ACMG"
"0000793775" "20" "70" "X" "46696540" "46696540" "subst" "0" "00000" "RP2_000080" "g.46696540G>T" "" "{PMID:Zhou-2011:21677794}" "" "c.5G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000793776" "3" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Zhou-2011:21677794}" "" "c.353G>A" "" "Unknown" "" "rs28933687" "0" "" "" "" "" "likely pathogenic" ""
"0000793930" "0" "70" "X" "46713148" "46713148" "del" "0" "03508" "RP2_000136" "g.46713148del" "" "" "" "340delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853713del" "" "pathogenic" "ACMG"
"0000794057" "0" "70" "X" "46696635" "46696637" "del" "0" "03508" "RP2_000137" "g.46696635_46696637del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" ".46837200_46837202del" "" "VUS" "ACMG"
"0000794267" "0" "70" "X" "46713160" "46713160" "subst" "0" "03508" "RP2_000019" "g.46713160C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG"
"0000794379" "0" "90" "X" "46737003" "46737003" "dup" "0" "00000" "RP2_000139" "g.46737003dup" "" "{PMID:Wang 2018:30029497}" "" "NM_006915.2:c.947dup, NP_008846.2:p.(Asn316LysfsTer13), NC_000023.10:g.46737003dup" "" "Germline" "?" "" "0" "" "" "g.46877568dup" "" "pathogenic" "ACMG"
"0000794892" "0" "70" "X" "46696535" "46696638" "del" "0" "03508" "RP2_000138" "g.(?_46696535)_(46696638_46712910)del" "" "" "" "1-?_102+?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_46837100)_(46837203_46853475)del" "" "VUS" "ACMG"
"0000795609" "21" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Fu 2018:30280194}" "" "c.358C>T; Arg120Ter" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000795610" "21" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Fu 2018:30280194}" "" "c.358C>T; Arg120Ter" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000795870" "20" "50" "X" "46713068" "46713068" "subst" "0.00137625" "00000" "RP2_000014" "g.46713068C>T" "0/96 male controls" "{PMID:Branham-2012:23150612}" "" "p.Thr87Ile" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000795871" "20" "90" "X" "46696543" "46696543" "subst" "5.47595E-5" "00000" "RP2_000140" "g.46696543G>C" "" "{PMID:Branham-2012:23150612}" "" "c.8G>C (p.Cys3Ser)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795872" "20" "90" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219delATT" "" "{PMID:Branham-2012:23150612}" "" "c.409_411delATT (p.Ile37del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795873" "20" "90" "X" "46719457" "46719457" "del" "0" "00000" "RP2_000141" "g.46719457delA" "" "{PMID:Branham-2012:23150612}" "" "c.803delA (p.Lys268fs)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795900" "0" "90" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Churchill-2013:23372056}" "" "delEX04-flanking" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795901" "0" "90" "X" "46713496" "46713500" "del" "0" "00000" "RP2_000036" "g.46713496_46713500del" "" "{PMID:Churchill-2013:23372056}" "" "c.688_692del (p.Lys230Glnfs*3)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795931" "0" "90" "X" "46713289" "46713289" "subst" "2.23844E-5" "00000" "RP2_000016" "g.46713289G>T" "" "{PMID:Schorderet-2013:23484092}" "" "p.RP2-D161Y" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000795934" "0" "90" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Schorderet-2013:23484092}" "" "p.RP2-E20X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000796756" "0" "70" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.844C>T" "" "Germline" "" "rs1805147" "0" "" "" "" "" "likely pathogenic" ""
"0000796758" "0" "90" "X" "46713034" "46713034" "subst" "0" "00000" "RP2_000050" "g.46713034G>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.226G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796759" "0" "70" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.844C>T" "" "Germline" "" "rs1805147" "0" "" "" "" "" "likely pathogenic" ""
"0000796784" "0" "70" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.844C>T" "" "Germline" "" "rs1805147" "0" "" "" "" "" "likely pathogenic" ""
"0000797137" "21" "70" "X" "46719483" "46719483" "dup" "0" "00000" "RP2_000148" "g.46719483dup" "" "{PMID:Birtel 2018:30543658}" "" "c.829dupG, p.Ala277Glyfs*11" "Heterozygous" "Germline" "?" "" "0" "" "" "g.46860048dup" "" "likely pathogenic" "ACMG"
"0000797138" "21" "70" "X" "46713438" "46713441" "del" "0" "00000" "RP2_000145" "g.46713438_46713441del" "" "{PMID:Birtel 2018:30543658}" "" "c.630_633delTCGT, p.Arg211Phefs*26" "Heterozygous" "Germline" "?" "" "0" "" "" "g.46854003_46854006del" "" "likely pathogenic" "ACMG"
"0000797139" "21" "90" "X" "46713566" "46713566" "del" "0" "00000" "RP2_000146" "g.46713566del" "" "{PMID:Birtel 2018:30543658}" "" "c.758delT, p.Leu253Glnfs*12" "Hemizygous" "Germline" "?" "" "0" "" "" "g.46854131del" "" "pathogenic" "ACMG"
"0000797195" "0" "50" "X" "46713122" "46713122" "subst" "0" "00000" "RP2_000142" "g.46713122G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.314G>A/p.C105Y, allele 2: -" "heterozygous" "Germline" "?" "" "0" "" "" "g.46853687G>A" "" "VUS" "ACMG"
"0000797812" "0" "70" "X" "46713198" "46713198" "subst" "0" "00000" "RP2_000143" "g.46713198T>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.390T>A, p.(Cys130*)" "" "Germline" "?" "" "0" "" "" "g.46853763T>A" "" "likely pathogenic" "ACMG"
"0000797813" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.358C>T, p.(Arg120*)" "" "Germline" "?" "" "0" "" "" "g.46853731C>T" "" "pathogenic" "ACMG"
"0000797815" "0" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.16_18del, p.(Ser6del), RP1 c.1126C>T, p.(Arg376*)" "" "Germline" "?" "" "0" "" "" "g.46837116_46837118del" "" "pathogenic" "ACMG"
"0000797819" "0" "90" "X" "46696551" "46696553" "del" "0" "00000" "RP2_000023" "g.46696551_46696553del" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.16_18del, p.(Ser6del)" "" "Germline" "?" "" "0" "" "" "g.46837116_46837118del" "" "pathogenic" "ACMG"
"0000797820" "0" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000129" "g.46713160C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.352C>G, p.(Arg118Gly)" "" "Germline" "?" "" "0" "" "" "g.46853725C>G" "" "likely pathogenic" "ACMG"
"0000797821" "0" "70" "X" "46719480" "46719480" "del" "0" "00000" "RP2_000147" "g.46719480del" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.826del, p.(Asp276Metfs*17)" "" "Germline" "?" "" "0" "" "" "g.46860045del" "" "likely pathogenic" "ACMG"
"0000797822" "0" "70" "X" "46696584" "46696584" "subst" "0" "00000" "RP2_000117" "g.46696584C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "RP2 c.49C>T, p.(Pro17Ser)" "" "Germline" "?" "" "0" "" "" "g.46837149C>T" "" "likely pathogenic" "ACMG"
"0000798408" "0" "90" "X" "46713257" "46713257" "subst" "0" "00000" "RP2_000107" "g.46713257G>A" "" "{PMID:De Luca-2001:11465545}" "" "W150X G ? A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798409" "0" "90" "X" "46713355" "46713355" "subst" "0" "00000" "RP2_000144" "g.46713355G>T" "" "{PMID:De Luca-2001:11465545}" "" "E183X G ? T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798410" "0" "90" "X" "46719507" "46719507" "dup" "0" "00000" "RP2_000149" "g.46719507dup" "" "{PMID:De Luca-2001:11465545}" "" "853/854insG" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000810408" "0" "90" "X" "46713512" "46713512" "subst" "0" "02327" "RP2_000150" "g.46713512C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000810409" "0" "30" "X" "46719498" "46719498" "subst" "0.0183613" "02325" "RP2_000001" "g.46719498C>T" "" "" "" "RP2(NM_006915.3):c.844C>T (p.R282W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000811496" "0" "70" "X" "46713130" "46713130" "subst" "0" "00000" "RP2_000059" "g.46713130T>C" "" "{PMID:Kim 2019:31496144}" "" "RP2 c.322T>C, p.C108R" "" "Germline" "?" "" "0" "" "" "g.46853695T>C" "" "likely pathogenic" "ACMG"
"0000811842" "0" "70" "1" "46713304" "46713304" "subst" "0" "00000" "RP2_000002" "g.46713304A>G" "" "{PMID:Gao 2019:31054281}" "" "c.496A>G, p.Ile166Val" "heterozygous" "Germline" "?" "" "0" "" "" "g.46853869A>G" "" "likely pathogenic" ""
"0000811892" "0" "70" "1" "46696534" "46696534" "subst" "0" "00000" "RP2_000001" "g.46696534C>T" "" "{PMID:Gao 2019:31054281}" "" "c.-2C>T" "heterozygous" "Germline" "?" "" "0" "" "" "g.46837099C>T" "" "likely pathogenic" ""
"0000811893" "0" "70" "1" "46696534" "46696534" "subst" "0" "00000" "RP2_000001" "g.46696534C>T" "" "{PMID:Gao 2019:31054281}" "" "c.-2C>T" "heterozygous" "Germline" "?" "" "0" "" "" "g.46837099C>T" "" "likely pathogenic" ""
"0000811930" "0" "70" "X" "46713212" "46713212" "subst" "0" "00000" "RP2_000152" "g.46713212C>G" "" "{PMID:Hariri 2018:31047384}" "" "c.404C/G (p.Pro135Arg) (hemizygous)" "" "Germline" "?" "" "0" "" "" "g.46853777C>G" "" "likely pathogenic" ""
"0000813664" "20" "90" "X" "46719422" "46719422" "subst" "0" "00000" "RP2_000111" "g.46719422G>A" "" "{PMID:Xu 2020:31630094}" "" "RP2 NM_006915: g.23048G>A, c.769-1G>A" "" "Germline" "yes" "" "0" "" "" "g.46859987G>A" "" "pathogenic" "ACMG"
"0000813670" "20" "90" "X" "46737027" "46737027" "dup" "0" "00000" "RP2_000154" "g.46737027dup" "" "{PMID:Xu 2020:31630094}" "" "RP2 NM_006915: g.40652_40653insT, c.969+1insT" "" "Germline" "yes" "" "0" "" "" "g.46877592dup" "" "pathogenic" "ACMG"
"0000813719" "20" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Xu 2020:31630094}" "" "RP2 NM_006915: g.16792C>T, c.358C>T, p.R120X" "" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "pathogenic" "ACMG"
"0000814288" "20" "70" "X" "46736940" "46736940" "dup" "0" "00000" "RP2_000153" "g.46736940dup" "" "{PMID:Chen 2020:31872526}" "" "RP2:splicing:c.884-1_884insG" "hemizygous" "Germline" "?" "" "0" "" "" "g.46877505dup" "" "likely pathogenic" ""
"0000814605" "20" "70" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.409_411del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814606" "20" "70" "X" "46696347" "46741793" "del" "0" "00000" "RP2_000155" "g.(?_46696347_46741793_?)del" "" "{PMID:de Castro-Miró-2014:24516651}" "" "All gen deletion" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814789" "20" "90" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Dan 2020:31960602}" "" "RP2 c.409_411del, p.(Ile137del)" "hemizygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.46853782_46853784del" "" "pathogenic" "ACMG"
"0000814790" "20" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Dan 2020:31960602}" "" "RP2 c.353G>A, p.(Arg118His)" "hemizygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.46853726G>A" "" "likely pathogenic" "ACMG"
"0000816087" "0" "70" "X" "46713323" "46713323" "dup" "0" "00000" "RP2_000074" "g.46713323dup" "" "{PMID:Zampaglione 2020:32037395}" "" "RP2 c.515dup, p.Ser172ArgfsTer2" "" "Unknown" "?" "" "0" "" "" "g.46853888dup" "" "likely pathogenic" ""
"0000816156" "0" "70" "X" "46696090" "46742082" "del" "0" "00000" "RP2_000156" "g.46696090_46742082del" "" "{PMID:Zampaglione 2020:32037395}" "" "RP2 chrX:46696090_46742082del" "size 45992 bp, hemizygous" "Unknown" "?" "" "0" "" "" "g.46836655_46882647del" "" "likely pathogenic" ""
"0000816193" "0" "50" "X" "46713212" "46713212" "subst" "0" "00000" "RP2_000152" "g.46713212C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "RP2 c.404C>G, p.Pro135Arg" "" "Unknown" "?" "" "0" "" "" "g.46853777C>G" "" "VUS" ""
"0000817310" "20" "70" "X" "46853724" "46853724" "dup" "0" "00000" "RP2_000157" "g.46853724dup" "" "{PMID:Sun 2020:32100970}" "" "RP2 c.348_349insT, p.Phe117Phefs7, hemizygous" "error in annotation: c.348_349insT causes p.(Arg118SerfsTer6), and not p.(Phe117Phefs7)" "Unknown" "?" "" "0" "" "" "g.46853724dup" "" "likely pathogenic" "ACMG"
"0000818588" "0" "90" "X" "46736926" "46736926" "subst" "0" "00000" "RP2_000158" "g.46736926G>A" "" "{PMID:Toulis 2020:32244552}" "" "c.884-14G>A" "two different aberrant transcripts" "Germline" "yes" "" "0" "" "" "g.46877491G>A" "" "pathogenic" ""
"0000819420" "1" "70" "X" "46696593" "46696593" "subst" "0" "00000" "RP2_000160" "g.46696593G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.58G>T/p.E20*" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46837158G>T" "" "likely pathogenic" ""
"0000819645" "1" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.352C>T/p.R118C" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" ""
"0000819664" "1" "70" "X" "46696575" "46696575" "del" "0" "00000" "RP2_000159" "g.46696575del" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.40del/p.E14Sfs*32" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46837140del" "" "likely pathogenic" ""
"0000819673" "1" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.352C>T/p.R118C" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" ""
"0000819674" "1" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.352C>T/p.R118C" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" ""
"0000819681" "1" "70" "X" "46713173" "46713173" "subst" "0" "00000" "RP2_000162" "g.46713173G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.365G>A/p.C122Y" "possibly solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853738G>A" "" "likely pathogenic" ""
"0000819682" "1" "70" "X" "46713173" "46713173" "subst" "0" "00000" "RP2_000162" "g.46713173G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.365G>A/p.C122Y" "possibly solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853738G>A" "" "likely pathogenic" ""
"0000819724" "1" "70" "X" "46737026" "46737026" "dup" "0" "00000" "RP2_000165" "g.46737026dup" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.969+1dup/p.?" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.46877591dup" "" "likely pathogenic" ""
"0000819835" "1" "70" "X" "46713337" "46713341" "del" "0" "00000" "RP2_000163" "g.46713337_46713341del" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.529_533del/p.F177Tfs*40" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.46853902_46853906del" "" "likely pathogenic" ""
"0000819890" "1" "70" "X" "46713009" "46713010" "del" "0" "00000" "RP2_000161" "g.46713009_46713010del" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.201_202del/p.C67*" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853574_46853575del" "" "likely pathogenic" ""
"0000819891" "1" "70" "X" "46713009" "46713010" "del" "0" "00000" "RP2_000161" "g.46713009_46713010del" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.201_202del/p.C67*" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.46853574_46853575del" "" "likely pathogenic" ""
"0000819894" "1" "70" "X" "0" "0" "" "0" "00000" "USP9X_000005" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1 :Deletion exon 3" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000819902" "1" "70" "X" "46696593" "46696593" "subst" "0" "00000" "RP2_000160" "g.46696593G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.58G>T/p.E20*" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.46837158G>T" "" "likely pathogenic" ""
"0000819903" "1" "70" "X" "46713034" "46713034" "subst" "0" "00000" "RP2_000050" "g.46713034G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RP2, variant 1: c.226G>T/p.D76Y" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.46853599G>T" "" "likely pathogenic" ""
"0000821376" "20" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Turro 2020:32581362}" "" "RP2 c.14_16delTCT, p.Phe5del" "hemizygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46837114_46837116del" "" "likely pathogenic" ""
"0000821377" "20" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Turro 2020:32581362}" "" "RP2 c.358C>T, p.Arg120Ter" "hemizygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46853731C>T" "" "pathogenic" ""
"0000821378" "20" "70" "X" "46713146" "46713146" "subst" "0" "00000" "RP2_000083" "g.46713146C>A" "" "{PMID:Turro 2020:32581362}" "" "RP2 c.338C>A, p.Ala113Asp" "hemizygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46853711C>A" "" "likely pathogenic" ""
"0000821379" "20" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Turro 2020:32581362}" "" "RP2 c.352C>T, p.Arg118Cys" "hemizygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" ""
"0000821380" "20" "70" "X" "46696578" "46696578" "del" "0" "00000" "RP2_000082" "g.46696578del" "" "{PMID:Turro 2020:32581362}" "" "RP2 c.43delT, p.Ser15ArgfsTer31" "hemizygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46837143del" "" "likely pathogenic" ""
"0000822242" "1" "70" "X" "46736931" "46736931" "subst" "0" "00000" "RP2_000164" "g.46736931T>A" "" "{PMID:Maggi_2021:33546218}" "" "c.884-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000823243" "20" "50" "X" "46713221" "46713221" "subst" "0" "00000" "RP2_000065" "g.46713221A>G" "" "{PMID:Hull 2020:32856788}" "" "RP2 nucleotide 1, protein 1:c.413 A>G, p.Glu138Gly" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.46853786A>G" "" "VUS" ""
"0000823244" "20" "90" "X" "46737001" "46737002" "ins" "0" "00000" "RP2_000166" "g.46737001_46737002insT" "" "{PMID:Hull 2020:32856788}" "" "RP2 nucleotide 1, protein 1:c.945_946insT, p.Asn316*" "hemizygous, ACMG classified, novel (Table 2)" "Germline" "?" "" "0" "" "" "g.46877566_46877567insT" "" "pathogenic" "ACMG"
"0000824100" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824101" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824103" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824105" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824106" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824107" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824116" "20" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824117" "20" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824118" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824138" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824139" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824141" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824143" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824144" "21" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824145" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824154" "20" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824155" "20" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824156" "11" "70" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Rodriguez Munoz 2021:33411470}" "" "RP2 c.352C>T, p.(Arg118Cys)" "" "Germline" "yes" "" "0" "" "" "g.46853725C>T" "" "likely pathogenic" "ACMG"
"0000824337" "0" "90" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Xiao-2021:33598457}" "" "RP2 c.352C>T, p.(R118C)" "" "Unknown" "yes" "" "0" "" "" "g.46853725C>T" "" "pathogenic" "ACMG"
"0000824388" "0" "90" "X" "46736990" "46736990" "subst" "0" "00000" "RP2_000168" "g.46736990C>T" "" "{PMID:Xiao-2021:33598457}" "" "RP2 c.934C>T, p.(Q312*)" "" "Unknown" "yes" "" "0" "" "" "g.46877555C>T" "" "pathogenic" "ACMG"
"0000824720" "20" "50" "X" "46719468" "46719468" "subst" "0.000117697" "00000" "RP2_000045" "g.46719468A>G" "" "{PMID:Ma 2021:33691693}" "" "RP2 c.A814G, p.M272V" "marked as causative, hemizygous" "Unknown" "?" "" "0" "" "" "g.46860033A>G" "" "VUS" "ACMG"
"0000824738" "3" "50" "X" "46713256" "46713256" "subst" "0" "00000" "RP2_000167" "g.46713256T>C" "" "{PMID:Ma 2021:33691693}" "" "RP2 c.T448C, p.W150R" "marked as causative, homozygous" "Unknown" "?" "" "0" "" "" "g.46853821T>C" "" "VUS" "ACMG"
"0000825769" "20" "70" "X" "46737003" "46737003" "dup" "0" "00000" "RP2_000139" "g.46737003dup" "" "{PMID:Liu-2020:33090715}" "" "c.947dupA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" ""
"0000825987" "20" "70" "X" "46696593" "46696593" "subst" "0" "00000" "RP2_000160" "g.46696593G>T" "" "{PMID:Liu-2020:33090715}" "" "c.58G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" ""
"0000826088" "20" "70" "X" "46696557" "46696557" "subst" "0" "00000" "RP2_000169" "g.46696557A>T" "" "{PMID:Liu-2020:33090715}" "" "c.22A>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" ""
"0000826089" "20" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Liu-2020:33090715}" "" "c.9_11delCTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" ""
"0000826207" "20" "70" "X" "46696593" "46696593" "subst" "0" "00000" "RP2_000160" "g.46696593G>T" "" "{PMID:Liu-2020:33090715}" "" "c.58G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (maternal)" ""
"0000827572" "20" "90" "X" "46712909" "46712909" "del" "0" "00000" "RP2_000170" "g.46712909del" "" "{PMID:Colombo-2020:33576794}" "" "c.103-2del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000827573" "20" "70" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000171" "g.46713161G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.353G>T" "" "Germline" "" "rs28933687" "0" "" "" "" "" "likely pathogenic" ""
"0000827574" "20" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.358C>T" "" "Germline" "" "rs104894927" "0" "" "" "" "" "pathogenic" ""
"0000827575" "20" "90" "X" "46713355" "46713355" "subst" "0" "00000" "RP2_000144" "g.46713355G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.547G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000827576" "20" "70" "X" "46713577" "46736939" "del" "0" "00000" "RP2_000172" "g.46713577_46736939del" "" "{PMID:Colombo-2020:33576794}" "" "c.(768+?)_(884-?)del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000828851" "20" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Chen 2021:43360855}" "" "RP2 c.[14_16del];[0], V1: c.14_16delTCT, (p.Phe5del)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.46837114_46837116del" "" "likely pathogenic" "ACMG"
"0000828927" "20" "90" "X" "46696632" "46696632" "subst" "0" "00000" "RP2_000173" "g.46696632G>T" "" "{PMID:Chen 2021:43360855}" "" "RP2 c.[97G>T];[0], V1: c.97G>T, (p.Glu33Ter)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.46837197G>T" "" "pathogenic" "ACMG"
"0000829798" "20" "70" "X" "46713233" "46713233" "del" "0" "00000" "RP2_000175" "g.46713233del" "" "{PMID:Dockery 2017:29099798}" "" "RP2 c.425delA, p.Asn142fs" "only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees," "Germline" "yes" "" "0" "" "" "g.46853798del" "" "likely pathogenic" ""
"0000829923" "20" "90" "X" "46696563" "46696563" "subst" "0" "00000" "RP2_000174" "g.46696563A>T" "" "{PMID:Numa-2020:33247286}" "" "c.28A>T:p.K10X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000842785" "21" "70" "X" "46712612" "46712721" "delins" "0" "00000" "RP2_000176" "g.46712612_46712721delinsG" "" "Dickson 2019 (https://www.hilarispublisher.com/open-access/novel-emrp2em-gene-deletion-in-a-patient-with-bilateral-retinitis-pigmentosa-insights-of-technical-challenges-of-next-ge.pdf)" "" "c.103-299_190delinsG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000842786" "21" "90" "X" "46713566" "46713566" "subst" "0" "00000" "RP2_000186" "g.46713566T>G" "2/25 XlRP patients and 0/150 control X-chromosomes." "{PMID:Wada-2000:10634633}" "" "Leu253Arg" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842787" "21" "90" "X" "46713566" "46713566" "subst" "0" "00000" "RP2_000186" "g.46713566T>G" "2/25 XlRP patients and 0/150 control X-chromosomes." "{PMID:Wada-2000:10634633}" "" "Leu253Arg" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842788" "0" "90" "X" "46713566" "46713566" "subst" "0" "00000" "RP2_000186" "g.46713566T>G" "2/25 XlRP patients and 0/150 control X-chromosomes." "{PMID:Wada-2000:10634633}" "" "Leu253Arg" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842789" "21" "90" "X" "46713531" "46713531" "del" "0" "00000" "RP2_000185" "g.46713531del" "" "{PMID:Thiseton-2000:10862093}" "" "723delT" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842790" "21" "90" "X" "46719452" "46719455" "del" "0" "00000" "RP2_000077" "g.46719452_46719455del" "" "{PMID:Thiseton-2000:10862093}" "" "796-799del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842791" "21" "10" "X" "46712913" "46712913" "subst" "0" "00000" "USP9X_000005" "g.46712913A>T" "" "{PMID:Thiseton-2000:10862093}" "" "105A>T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000842792" "21" "10" "X" "46713405" "46713405" "subst" "0" "00000" "RP2_000183" "g.46713405T>C" "" "{PMID:Thiseton-2000:10862093}" "" "597T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000842793" "21" "10" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "" "{PMID:Thiseton-2000:10862093}" "" "844C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000842794" "21" "10" "X" "46739163" "46739163" "subst" "0" "00000" "RP2_000190" "g.46739163G>T" "" "{PMID:Thiseton-2000:10862093}" "" "1012G>T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000842795" "21" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Mashima-2001:11262649}" "" "R120X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842796" "21" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Mashima-2001:11262649}" "" "R120X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842797" "21" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Mashima-2001:11262649}" "" "R120X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842798" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Mashima-2001:11262649}" "" "R120X" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842799" "21" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000171" "g.46713161G>T" "0/120 controls" "{PMID:Miano-2001:11462235}" "" "c.354G>T (R118L)" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842800" "21" "90" "X" "46713221" "46713221" "subst" "0" "00000" "RP2_000065" "g.46713221A>G" "0/120 controls" "{PMID:Miano-2001:11462235}" "" "E138G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842801" "21" "90" "X" "46719498" "46719498" "subst" "0.0183613" "00000" "RP2_000001" "g.46719498C>T" "0/120 controls" "{PMID:Miano-2001:11462235}" "" "R282W" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842802" "21" "90" "X" "46713113" "46713113" "dup" "0" "00000" "RP2_000180" "g.46713113dup" "0/120 controls" "{PMID:Miano-2001:11462235}" "" "303insT" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842803" "21" "90" "X" "46712909" "46712909" "subst" "0" "00000" "RP2_000177" "g.46712909A>G" "0/120 controls" "{PMID:Miano-2001:11462235}" "" "103-2A>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842804" "11" "90" "X" "46713208" "46713208" "subst" "0" "00000" "RP2_000181" "g.46713208C>T" "" "{PMID:Bustamanre_Aragones-2006:17108199}" "" "Q134X (c.400C>T)" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842805" "0" "90" "X" "46739215" "46739215" "subst" "0" "00000" "RP2_000191" "g.46739215T>A" "0/220 control chromosomes Spanish population" "{PMID:Pomares 2009:19516003}" "" "c.1073-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842806" "0" "90" "X" "46739215" "46739215" "subst" "0" "00000" "RP2_000191" "g.46739215T>A" "0/220 control chromosomes Spanish population" "{PMID:Pomares 2009:19516003}" "" "c.1073-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842807" "0" "90" "X" "46739215" "46739215" "subst" "0" "00000" "RP2_000191" "g.46739215T>A" "0/220 control chromosomes Spanish population" "{PMID:Pomares 2009:19516003}" "" "c.1073-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842808" "0" "90" "X" "46739215" "46739215" "subst" "0" "00000" "RP2_000191" "g.46739215T>A" "0/220 control chromosomes Spanish population" "{PMID:Pomares 2009:19516003}" "" "c.1073-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842809" "0" "90" "X" "46739215" "46739215" "subst" "0" "00000" "RP2_000191" "g.46739215T>A" "0/220 control chromosomes Spanish population" "{PMID:Pomares 2009:19516003}" "" "c.1073-9T>A" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000842810" "0" "90" "X" "46696543" "46696543" "subst" "5.47595E-5" "00000" "RP2_000140" "g.46696543G>C" "" "{PMID:Jayasundra-2010:20625056}" "" "c.8TGC>TCC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842811" "0" "90" "X" "46696611" "46696612" "dup" "0" "00000" "RP2_000029" "g.46696611_46696612dup" "" "{PMID:Jayasundra-2010:20625056}" "" "c.77insCA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842812" "0" "90" "X" "46696638" "46696638" "subst" "0" "00000" "RP2_000098" "g.46696638G>A" "" "{PMID:Jayasundra-2010:20625056}" "" "IVS1+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842813" "0" "90" "X" "46696640" "46696640" "subst" "0" "00000" "RP2_000068" "g.46696640A>G" "" "{PMID:Jayasundra-2010:20625056}" "" "IVS1+3A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842814" "0" "90" "X" "46713068" "46713068" "subst" "0.00137625" "00000" "RP2_000014" "g.46713068C>T" "" "{PMID:Jayasundra-2010:20625056}" "" "c.260ACT>ATT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842815" "0" "90" "X" "46713160" "46713160" "subst" "0" "00000" "RP2_000019" "g.46713160C>T" "" "{PMID:Jayasundra-2010:20625056}" "" "c.352CGT>TGT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842816" "0" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Jayasundra-2010:20625056}" "" "c.353CGT>CAT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842817" "0" "90" "X" "46713161" "46713161" "subst" "0" "00000" "RP2_000015" "g.46713161G>A" "" "{PMID:Jayasundra-2010:20625056}" "" "c.353CGT>CAT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842818" "0" "90" "X" "46713217" "46713219" "del" "0" "00000" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Jayasundra-2010:20625056}" "" "c.409411deletedATT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842819" "0" "90" "X" "46713257" "46713257" "subst" "0" "00000" "RP2_000107" "g.46713257G>A" "" "{PMID:Jayasundra-2010:20625056}" "" "c.449TGG>TAG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842820" "0" "90" "X" "46713323" "46713323" "dup" "0" "00000" "RP2_000074" "g.46713323dup" "" "{PMID:Jayasundra-2010:20625056}" "" "c.515_516insG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842821" "0" "90" "X" "46713481" "46713481" "dup" "0" "00000" "RP2_000076" "g.46713481dup" "" "{PMID:Jayasundra-2010:20625056}" "" "c.673674insC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842822" "0" "90" "X" "46713566" "46713566" "subst" "0" "00000" "RP2_000187" "g.46713566T>C" "" "{PMID:Jayasundra-2010:20625056}" "" "c.758CTA>CCA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842823" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Jayasundra-2010:20625056}, {PMID:Jin 2006:17093403}" "" "c.358CGA>TGA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842824" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Jayasundra-2010:20625056}, {PMID:Mashima 2000:11020419}" "" "c.358CGA>TGA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842825" "0" "90" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Jayasundra-2010:20625056}, {PMID:Vorster 2004:15032968}" "" "c.358CGA>TGA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842826" "0" "90" "X" "46719452" "46719455" "del" "0" "00000" "RP2_000188" "g.46719452_46719455delGACA" "" "{PMID:Jayasundra-2010:20625056}, {PMID:Kuhnel 2006:16472755}" "" "c.798delGACA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842827" "0" "70" "X" "46712919" "46712920" "ins" "0" "00000" "RP2_000178" "g.46712919_46712920insC" "" "{PMID:De Lin-2014:24479636}" "" "c.111insC (p.Pro37fsX48)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000842828" "0" "70" "X" "46712919" "46712920" "ins" "0" "00000" "RP2_000178" "g.46712919_46712920insC" "" "{PMID:De Lin-2014:24479636}" "" "c.111insC (p.Pro37fsX48)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000842829" "21" "70" "X" "46713107" "46713107" "subst" "0" "00000" "RP2_000179" "g.46713107T>A" "" "{PMID:Misky-2016:26885761}" "" "c.299T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000842830" "0" "70" "X" "46713107" "46713107" "subst" "0" "00000" "RP2_000179" "g.46713107T>A" "" "{PMID:Misky-2016:26885761}" "" "c.299T>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000842831" "0" "90" "X" "46713473" "46713473" "del" "0" "00000" "RP2_000184" "g.46713473del" "" "{PMID:Lim-2016:27769321}" "" "c.665delC,p.Pro222fsTer237" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842832" "21" "90" "X" "46713473" "46713473" "del" "0" "00000" "RP2_000184" "g.46713473del" "" "{PMID:Lim-2016:27769321}" "" "c.665delC,p.Pro222fsTer238" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842833" "21" "90" "X" "46713281" "46713281" "subst" "0" "00000" "RP2_000182" "g.46713281A>C" "" "{PMID:Zhang-2019:31071385}" "" "Q158P" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842834" "0" "90" "X" "46713281" "46713281" "subst" "0" "00000" "RP2_000182" "g.46713281A>C" "" "{PMID:Zhang-2019:31071385}" "" "Q158P" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842835" "21" "90" "X" "46713281" "46713281" "subst" "0" "00000" "RP2_000182" "g.46713281A>C" "" "{PMID:Zhang-2019:31071385}" "" "Q158P" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842836" "21" "90" "X" "46713281" "46713281" "subst" "0" "00000" "RP2_000182" "g.46713281A>C" "" "{PMID:Zhang-2019:31071385}" "" "Q158P" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842837" "0" "90" "X" "46713281" "46713281" "subst" "0" "00000" "RP2_000182" "g.46713281A>C" "" "{PMID:Zhang-2019:31071385}" "" "Q158P" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000842838" "21" "70" "X" "46719497" "46719497" "dup" "0" "00000" "RP2_000189" "g.46719497dup" "" "{PMID:Horner-2019:31079036}" "" "c. 843_844insT (p.Arg282fs)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000856626" "0" "90" "X" "46713009" "46713010" "del" "0" "02327" "RP2_000161" "g.46713009_46713010del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000867378" "0" "50" "X" "46713538" "46713538" "subst" "1.68326E-5" "01943" "RP2_000192" "g.46713538G>A" "" "" "" "RP2(NM_006915.2):c.730G>A (p.D244N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000873419" "21" "70" "X" "46696638" "46696638" "subst" "0" "00000" "RP2_000098" "g.46696638G>A" "" "{PMID:Kurata 2019:30917587}" "" "c.102+1G>A, p.?" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46837203G>A" "" "likely pathogenic" ""
"0000873420" "21" "70" "X" "46713025" "46713025" "del" "0" "00000" "RP2_000193" "g.46713025del" "" "{PMID:Kurata 2019:30917587}" "" "c.217del, p.(Y73Ifs *18)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46853590del" "" "likely pathogenic" ""
"0000873421" "21" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Kurata 2019:30917587}" "" "c.358C>T, p.(R120 *)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000873422" "21" "70" "X" "46713221" "46713221" "subst" "0" "00000" "RP2_000065" "g.46713221A>G" "" "{PMID:Kurata 2019:30917587}" "" "c.413A>G, p.(E138G)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46853786A>G" "" "likely pathogenic" ""
"0000873423" "21" "70" "X" "46713221" "46713221" "subst" "0" "00000" "RP2_000065" "g.46713221A>G" "" "{PMID:Kurata 2019:30917587}" "" "c.413A>G, p.(E138G)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46853786A>G" "" "likely pathogenic" ""
"0000873424" "21" "70" "X" "46713493" "46713493" "subst" "0" "00000" "RP2_000194" "g.46713493C>T" "" "{PMID:Kurata 2019:30917587}" "" "c.685C>T, p.(Q229 *)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46854058C>T" "" "likely pathogenic" ""
"0000873435" "21" "70" "X" "46696638" "46696638" "subst" "0" "00000" "RP2_000098" "g.46696638G>A" "" "{PMID:Kurata 2019:30917587}" "" "c.102+1G>A, p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.46837203G>A" "" "likely pathogenic" ""
"0000873436" "21" "70" "X" "46713025" "46713025" "del" "0" "00000" "RP2_000193" "g.46713025del" "" "{PMID:Kurata 2019:30917587}" "" "c.217del, p.(Y73Ifs *18)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.46853590del" "" "likely pathogenic" ""
"0000873437" "21" "70" "X" "46713166" "46713166" "subst" "0" "00000" "RP2_000031" "g.46713166C>T" "" "{PMID:Kurata 2019:30917587}" "" "c.358C>T, p.(R120 *)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.46853731C>T" "" "likely pathogenic" ""
"0000873438" "21" "70" "X" "46713221" "46713221" "subst" "0" "00000" "RP2_000065" "g.46713221A>G" "" "{PMID:Kurata 2019:30917587}" "" "c.413A>G, p.(E138G)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.46853786A>G" "" "likely pathogenic" ""
"0000873439" "21" "70" "X" "46713493" "46713493" "subst" "0" "00000" "RP2_000194" "g.46713493C>T" "" "{PMID:Kurata 2019:30917587}" "" "c.685C>T, p.(Q229 *)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.46854058C>T" "" "likely pathogenic" ""
"0000881233" "21" "70" "X" "46737028" "46737028" "subst" "0" "02300" "RP2_000078" "g.46737028A>C" "" "{PMID:Marinakis 2021:34008892}" "" "" "ACMG PM2, PP3, PP4, PP5" "Germline" "" "" "0" "" "" "g.46877593A>C" "" "likely pathogenic (recessive)" "ACMG"
"0000896235" "0" "50" "X" "46713106" "46713106" "subst" "2.2379E-5" "02327" "RP2_000042" "g.46713106G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000896236" "0" "30" "X" "46713504" "46713504" "subst" "0.000117623" "02330" "RP2_000195" "g.46713504C>T" "" "" "" "RP2(NM_006915.3):c.696C>T (p.S232=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000896583" "21" "70" "X" "46696549" "46696551" "del" "0" "00000" "RP2_000093" "g.46696549_46696551del" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "RP2 c.[14_16del];[0]; p.(Phe5del)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46837114_46837116del" "" "likely pathogenic" ""
"0000896628" "21" "90" "X" "46696632" "46696632" "subst" "0" "00000" "RP2_000173" "g.46696632G>T" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "RP2 c.[97G>T];[0]; p.(Glu33Ter)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.46837197G>T" "" "pathogenic" ""
"0000905942" "0" "70" "X" "46713508" "46713508" "subst" "0" "00000" "RP2_000196" "g.46713508G>T" "" "{PMID:Zhu 2022:35456422}" "" "RP2 c.700G>T, p.(Glu234*)" "hemizygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46854073G>T" "" "likely pathogenic" "ACMG"
"0000915717" "0" "30" "X" "46713068" "46713068" "subst" "0.00137625" "02330" "RP2_000014" "g.46713068C>T" "" "" "" "RP2(NM_006915.2):c.260C>T (p.T87I, p.(Thr87Ile)), RP2(NM_006915.3):c.260C>T (p.T87I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000915901" "11" "50" "X" "46712935" "46712935" "subst" "5.66114E-6" "04436" "RP2_000039" "g.46712935A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.127A>G" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000915968" "11" "90" "X" "46719527" "46719527" "del" "0" "04436" "RP2_000202" "g.46719527del" "" "{PMID:Panneman 2023:36819107}" "" "c.873del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916046" "11" "70" "X" "46713495" "46713496" "del" "0" "04436" "RP2_000199" "g.46713495_46713496del" "" "{PMID:Panneman 2023:36819107}" "" "c.687_688del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916135" "11" "90" "X" "46713160" "46713160" "subst" "0" "04436" "RP2_000019" "g.46713160C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.352C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916141" "11" "70" "X" "46713365" "46713374" "del" "0" "04436" "RP2_000198" "g.46713365_46713374del" "" "{PMID:Panneman 2023:36819107}" "" "c.557_566del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916354" "11" "50" "X" "46713374" "46713374" "subst" "0" "04436" "RP2_000037" "g.46713374T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.566T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916558" "11" "70" "X" "46713199" "46713199" "dup" "0" "04436" "RP2_000197" "g.46713199dupT" "" "{PMID:Panneman 2023:36819107}" "" "c.391dupT" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916593" "11" "70" "X" "46719447" "46719447" "del" "0" "04436" "RP2_000200" "g.46719447del" "" "{PMID:Panneman 2023:36819107}" "" "c.793del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916613" "11" "70" "X" "46719464" "46719465" "del" "0" "04436" "RP2_000201" "g.46719464_46719465del" "" "{PMID:Panneman 2023:36819107}" "" "c.810_811del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916614" "11" "70" "X" "46719464" "46719465" "del" "0" "04436" "RP2_000201" "g.46719464_46719465del" "" "{PMID:Panneman 2023:36819107}" "" "c.810_811del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916696" "11" "90" "X" "46713166" "46713166" "subst" "0" "04436" "RP2_000031" "g.46713166C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.358C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916708" "11" "70" "X" "46713217" "46713219" "del" "0" "04436" "RP2_000009" "g.46713217_46713219del" "" "{PMID:Panneman 2023:36819107}" "" "c.409_411del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916764" "11" "90" "X" "46713166" "46713166" "subst" "0" "04436" "RP2_000031" "g.46713166C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.358C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000933409" "0" "90" "X" "46713350" "46713351" "del" "0" "04552" "RP2_000203" "g.46713350_46713351del" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "" "0" "" "" "g.46853915_46853916del" "{CV:2114229}" "pathogenic" "ACMG"
"0000933413" "0" "90" "X" "46696637" "46696637" "subst" "0" "04552" "RP2_000087" "g.46696637G>A" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "rs1556313552" "0" "" "" "" "{CV:1348552}" "likely pathogenic" "ACMG"
"0000951761" "0" "50" "X" "46713105" "46713105" "subst" "0" "02327" "RP2_000205" "g.46713105C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000951762" "0" "30" "X" "46713414" "46713414" "subst" "0.00108029" "02330" "RP2_000206" "g.46713414T>C" "" "" "" "RP2(NM_006915.3):c.606T>C (p.P202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000955405" "0" "70" "X" "46719004" "46723630" "del" "0" "00006" "RP2_000207" "g.46719004_46723630del" "" "{PMID:de Bruijn 2023:36524988}" "" "769-419_883+4039del" "" "Germline" "" "" "0" "" "" "g.46859569_46864195del" "" "likely pathogenic (dominant)" ""
"0000958041" "0" "70" "X" "46634266" "46989306" "del" "0" "00006" "USP9X_000005" "g.46634266_46989306del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000958183" "1" "90" "X" "46696549" "46696551" "del" "0" "00006" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM4, PP5_STRONG, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.46837114_46837116del" "437942" "pathogenic" "ACMG"
"0000958184" "20" "90" "X" "46696549" "46696551" "del" "0" "00006" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM4, PP5_STRONG, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.46837114_46837116del" "437942" "pathogenic" "ACMG"
"0000958797" "21" "90" "X" "46713160" "46713160" "subst" "0" "00006" "RP2_000019" "g.46713160C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PM1_SUPPORTING, PP5_STRONG, PS4_MODERATE" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853725C>T" "" "pathogenic" "ACMG"
"0000958800" "0" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5, PS4" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853731C>T" "" "pathogenic" "ACMG"
"0000958802" "0" "70" "X" "46719420" "46719420" "subst" "0" "00006" "RP2_000127" "g.46719420C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.46859985C>A" "" "likely pathogenic" "ACMG"
"0000958808" "0" "90" "X" "46713160" "46713160" "subst" "0" "00006" "RP2_000019" "g.46713160C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PM1_SUPPORTING, PP5_STRONG, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.46853725C>T" "" "pathogenic" "ACMG"
"0000958812" "0" "90" "X" "46713166" "46713166" "subst" "0" "00006" "RP2_000031" "g.46713166C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5, PS4" "Germline" "" "" "0" "" "" "g.46853731C>T" "" "pathogenic" "ACMG"
"0000958814" "0" "90" "X" "46737831" "46745341" "delins" "0" "00006" "USP9X_000005" "g.(46737528_46737831)_46745341delins[NC_000002.11:g.(158406216_158406544)_158695305;GTTG]" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000958815" "0" "90" "X" "46694894" "46708019" "del" "0" "00006" "USP9X_000005" "g.46694894_46708019del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000958821" "0" "90" "X" "46719492" "46719492" "del" "0" "00006" "RP2_000210" "g.46719492del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline/De novo (untested)" "" "" "0" "" "" "g.46860057del" "1184894" "pathogenic" "ACMG"
"0000958824" "21" "90" "X" "46696549" "46696551" "del" "0" "00006" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM4, PP5_STRONG, PS4_MODERATE" "Germline/De novo (untested)" "" "" "0" "" "" "g.46837114_46837116del" "" "pathogenic" "ACMG"
"0000958931" "0" "50" "X" "46713404" "46713404" "subst" "0" "00006" "RP2_000209" "g.46713404T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline/De novo (untested)" "" "" "0" "" "" "g.46853969T>C" "" "VUS" "ACMG"
"0000958990" "20" "50" "X" "46713374" "46713374" "subst" "0" "00006" "RP2_000037" "g.46713374T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2" "Germline" "" "" "0" "" "" "g.46853939T>C" "" "VUS" "ACMG"
"0000958992" "1" "50" "X" "46737028" "46737028" "subst" "0" "00006" "RP2_000078" "g.46737028A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2" "Germline" "" "" "0" "" "" "g.46877593A>C" "" "VUS" "ACMG"
"0000959173" "0" "50" "X" "46696593" "46696593" "subst" "0" "00006" "RP2_000208" "g.46696593G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.46837158G>C" "" "VUS" "ACMG"
"0000971098" "0" "50" "X" "46713149" "46713149" "subst" "0" "02327" "RP2_000211" "g.46713149G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000984696" "0" "30" "X" "46713004" "46713004" "subst" "0.0002798" "01804" "RP2_000013" "g.46713004G>A" "" "" "" "RP2(NM_006915.2):c.196G>A (p.D66N), RP2(NM_006915.3):c.196G>A (p.(Asp66Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001006764" "0" "70" "X" "46696543" "46696543" "subst" "5.47595E-5" "01804" "RP2_000140" "g.46696543G>C" "" "" "" "RP2(NM_006915.2):c.8G>C (p.(Cys3Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001016035" "0" "50" "X" "46713481" "46713481" "subst" "5.59945E-6" "02325" "RP2_000212" "g.46713481C>T" "" "" "" "RP2(NM_006915.3):c.673C>T (p.R225W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001022306" "1" "90" "X" "46696549" "46696551" "del" "0" "00006" "RP2_000093" "g.46696549_46696551del" "" "{PMID:Midgley 2024:39676705}" "" "14_16delTCT" "" "Germline" "" "rs1556313414" "0" "" "" "g.46837114_46837116del" "" "pathogenic" ""
"0001027502" "0" "30" "X" "46739101" "46739101" "subst" "0.000366103" "02330" "RP2_000213" "g.46739101T>A" "" "" "" "RP2(NM_006915.3):c.970-20T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001058264" "0" "90" "X" "46713160" "46713160" "subst" "0" "00006" "RP2_000019" "g.46713160C>T" "" "{PMID:Wang 2024:38184101}" "" "" "ACMG PS4, PM2_sup, PM5, PP1_strong, PP3, PP4" "Germline" "" "" "0" "" "" "g.46853725C>T" "" "pathogenic" "ACMG"
"0001059084" "0" "90" "X" "46696543" "46696543" "subst" "5.47595E-5" "00006" "RP2_000140" "g.46696543G>C" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.46837108G>C" "" "pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes RP2
## Count = 459
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000001882" "00000666" "50" "969" "142" "969" "143" "c.969+142_969+143dup" "r.(=)" "p.(=)" "4i"
"0000002903" "00000666" "50" "969" "142" "969" "143" "c.969+142_969+143dup" "r.(=)" "p.(=)" ""
"0000006684" "00000666" "30" "1881" "0" "1881" "0" "c.*828G>A" "r.(=)" "p.(=)" "5"
"0000008739" "00000666" "30" "1881" "0" "1881" "0" "c.*828G>A" "r.(=)" "p.(=)" "5"
"0000010910" "00000666" "50" "969" "142" "969" "143" "c.969+142_969+143dup" "r.(=)" "p.(=)" ""
"0000036429" "00000666" "55" "884" "-1" "884" "-1" "c.884-1G>T" "r.spl?" "p.?" "3i"
"0000060411" "00000666" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060412" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060413" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060414" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060415" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060416" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000060417" "00000666" "90" "319" "0" "320" "0" "c.319_320del" "r.(?)" "p.(Asp107Leufs*16)" "2"
"0000060418" "00000666" "70" "323" "0" "323" "0" "c.323G>A" "r.(?)" "p.(Cys108Tyr)" "2"
"0000170950" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000170951" "00000666" "90" "-1" "0" "1054" "0" "c.(?_-1)_(*1_?)del" "r.0" "p.0" "_1_5_"
"0000247787" "00000666" "90" "884" "-2" "884" "-2" "c.884-2A>G" "r.spl?" "p.?" ""
"0000247789" "00000666" "50" "89" "0" "89" "0" "c.89A>G" "r.(?)" "p.(Asp30Gly)" ""
"0000294989" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000294990" "00000666" "50" "481" "0" "481" "0" "c.481G>T" "r.(?)" "p.(Asp161Tyr)" ""
"0000307304" "00000666" "50" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Asp66Asn)" ""
"0000307305" "00000666" "10" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" ""
"0000333866" "00000666" "30" "89" "0" "89" "0" "c.89A>G" "r.(?)" "p.(Asp30Gly)" ""
"0000333868" "00000666" "30" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" ""
"0000333869" "00000666" "50" "889" "0" "889" "0" "c.889G>C" "r.(?)" "p.(Val297Leu)" ""
"0000341775" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000341776" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000345351" "00000666" "30" "949" "0" "949" "0" "c.949G>A" "r.(?)" "p.(Glu317Lys)" ""
"0000350462" "00000666" "10" "889" "0" "889" "0" "c.889G>C" "r.(?)" "p.(Val297Leu)" ""
"0000368489" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" "1"
"0000368490" "00000666" "90" "76" "0" "76" "0" "c.76C>T" "r.(?)" "p.(Gln26*)" "1"
"0000368491" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000368492" "00000666" "90" "453" "0" "453" "0" "c.453C>G" "r.(?)" "p.(Tyr151*)" "2"
"0000368493" "00000666" "90" "453" "0" "453" "0" "c.453del" "r.(?)" "p.(Tyr152Ilefs*4)" "2"
"0000368494" "00000666" "90" "884" "-1" "969" "1" "c.(883+1_884-1)_(969+1_970-1)del" "r.884_969del" "p.Gly295Aspfs*5" "3i_4i"
"0000368495" "00000666" "90" "102" "146" "102" "147" "c.102+146_102+147ins[AF148856.1inv;102+133_102+146]" "r.0" "p.0" "1i"
"0000368496" "00000666" "90" "76" "0" "77" "0" "c.76_77dup" "r.(?)" "p.(Gln26Hisfs*21)" "1"
"0000368497" "00000666" "90" "332" "0" "344" "0" "c.332_344del" "r.(?)" "p.(Thr111Asnfs*41)" "2"
"0000368498" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000368499" "00000666" "90" "484" "0" "485" "0" "c.484_485ins488_494" "r.(?)" "p.(Ala162Glyfs*14)" "2"
"0000368500" "00000666" "90" "925" "0" "926" "0" "c.925_926dup" "r.(?)" "p.(Val310Lysfs*7)" "4"
"0000368501" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000368502" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000368503" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000368504" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000368505" "00000666" "90" "688" "0" "692" "0" "c.688_692del" "r.(?)" "p.(Lys230Glnfs*3)" "2"
"0000368506" "00000666" "90" "929" "0" "929" "0" "c.929dup" "r.(?)" "p.(Cys311Metfs*18)" "4"
"0000368507" "00000666" "50" "322" "0" "322" "0" "c.322T>G" "r.(?)" "p.(Cys108Gly)" "2"
"0000472362" "00000666" "50" "566" "0" "566" "0" "c.566T>C" "r.(?)" "p.(Leu189Pro)" ""
"0000477384" "00000666" "90" "87" "0" "87" "0" "c.87G>A" "r.(?)" "p.(Trp29*)" ""
"0000477385" "00000666" "50" "127" "0" "127" "0" "c.127A>G" "r.(?)" "p.(Ser43Gly)" ""
"0000477386" "00000666" "50" "256" "0" "256" "0" "c.256T>C" "r.(?)" "p.(Cys86Arg)" ""
"0000477387" "00000666" "50" "278" "0" "278" "0" "c.278T>C" "r.(?)" "p.(Leu93Pro)" ""
"0000477388" "00000666" "50" "298" "0" "298" "0" "c.298G>A" "r.(?)" "p.(Val100Met)" ""
"0000477389" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000477390" "00000666" "90" "673" "0" "673" "0" "c.673del" "r.(?)" "p.(Arg225Glyfs*13)" ""
"0000477391" "00000666" "50" "768" "0" "768" "0" "c.768G>C" "r.(?)" "p.(Glu256Asp)" ""
"0000477392" "00000666" "50" "814" "0" "814" "0" "c.814A>G" "r.(?)" "p.(Met272Val)" ""
"0000477615" "00000666" "50" "256" "0" "256" "0" "c.256T>C" "r.(?)" "p.(Cys86Arg)" ""
"0000477616" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000477617" "00000666" "50" "814" "0" "814" "0" "c.814A>G" "r.(?)" "p.(Met272Val)" ""
"0000487572" "00000666" "90" "-189" "0" "768" "1" "c.(?_-189)_(768+1_769-1)del" "r.spl?" "p.?" "1_2i"
"0000487573" "00000666" "90" "969" "2" "969" "2" "c.969+2T>G" "r.spl?" "p.?" "4i"
"0000487574" "00000666" "70" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "1"
"0000576069" "00000666" "50" "155" "0" "155" "0" "c.155G>A" "r.(?)" "p.(Arg52His)" ""
"0000576070" "00000666" "50" "226" "0" "226" "0" "c.226G>T" "r.(?)" "p.(Asp76Tyr)" ""
"0000576071" "00000666" "50" "248" "0" "248" "0" "c.248T>C" "r.(?)" "p.(Ile83Thr)" ""
"0000576072" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" ""
"0000576073" "00000666" "10" "601" "0" "601" "0" "c.601A>G" "r.(?)" "p.(Ile201Val)" ""
"0000576074" "00000666" "90" "884" "-1" "884" "-1" "c.884-1G>C" "r.spl?" "p.?" ""
"0000576075" "00000666" "30" "889" "0" "889" "0" "c.889G>C" "r.(?)" "p.(Val297Leu)" ""
"0000576076" "00000666" "50" "889" "0" "889" "0" "c.889G>C" "r.(?)" "p.(Val297Leu)" ""
"0000576077" "00000666" "30" "949" "0" "949" "0" "c.949G>A" "r.(?)" "p.(Glu317Lys)" ""
"0000619579" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000619580" "00000666" "50" "927" "0" "927" "0" "c.927A>G" "r.(?)" "p.(Glu309=)" ""
"0000682447" "00000666" "90" "177" "0" "177" "0" "c.177dup" "r.(?)" "p.(Gln60ThrfsTer9)" ""
"0000682448" "00000666" "50" "473" "0" "473" "0" "c.473A>G" "r.(?)" "p.(Gln158Arg)" ""
"0000682449" "00000666" "30" "775" "0" "775" "0" "c.775G>A" "r.(?)" "p.(Gly259Ser)" ""
"0000684571" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000684572" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000684675" "00000666" "70" "322" "0" "322" "0" "c.322T>C" "r.(?)" "p.(Cys108Arg)" ""
"0000685431" "00000666" "90" "102" "1" "102" "1" "c.102+1G>T" "r.spl" "p.?" ""
"0000685432" "00000666" "70" "328" "0" "328" "0" "c.328T>C" "r.(?)" "p.(Cys110Arg)" ""
"0000685433" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000685434" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000685435" "00000666" "90" "364" "0" "364" "0" "c.364del" "r.(?)" "p.(Cys122Valfs*34)" ""
"0000685841" "00000666" "70" "396" "0" "420" "0" "c.396_420del" "r.(?)" "p.(Thr133Glnfs*15)" ""
"0000686016" "00000666" "90" "530" "0" "531" "0" "c.530_531del" "r.(?)" "p.(Phe177Tyrfs*41)" ""
"0000710240" "00000666" "90" "0" "0" "0" "0" "c.-189_(768+1_769-1){0}" "r.0?" "p.0?" "_1_2i"
"0000710268" "00000666" "90" "969" "2" "969" "2" "c.969+2T>G" "r.spl" "p.?" ""
"0000710284" "00000666" "90" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" ""
"0000712184" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000712185" "00000666" "90" "76" "0" "76" "0" "c.76C>T" "r.(?)" "p.(Gln26*)" ""
"0000712190" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" ""
"0000712215" "00000666" "90" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" ""
"0000712572" "00000666" "90" "0" "0" "0" "0" "c.-189_(102+1_103-1){0}" "r.0?" "p.0?" "_1_1i"
"0000712573" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000712574" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000712575" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000712576" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000712577" "00000666" "90" "350" "0" "351" "0" "c.350_351del" "r.(?)" "p.(Phe117Serfs*6)" "2"
"0000712578" "00000666" "90" "515" "0" "515" "0" "c.515dup" "r.(?)" "p.(Ser172Argfs*2)" "2"
"0000712579" "00000666" "90" "673" "0" "673" "0" "c.673dup" "r.(?)" "p.(Arg225Profs*10)" "2"
"0000712580" "00000666" "90" "102" "3" "102" "3" "c.102+3A>G" "r.(?)" "p.?" "1i"
"0000712581" "00000666" "90" "81" "0" "81" "0" "c.81C>G" "r.(?)" "p.(Tyr27*)" "1"
"0000712582" "00000666" "90" "200" "0" "200" "0" "c.200G>A" "r.(?)" "p.(Cys67Tyr)" "2"
"0000712583" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000712584" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000712585" "00000666" "90" "563" "0" "563" "0" "c.563T>C" "r.(?)" "p.(Leu189Pro)" "2"
"0000712701" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000712702" "00000666" "90" "688" "0" "692" "0" "c.688_692del" "r.(?)" "p.(Lys230Glnfs*3)" "2"
"0000712703" "00000666" "90" "102" "3" "102" "3" "c.102+3A>T" "r.spl" "p.?" "1i"
"0000712704" "00000666" "90" "257" "0" "257" "0" "c.257G>A" "r.(?)" "p.(Cys86Tyr)" "2"
"0000712705" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000712706" "00000666" "50" "284" "0" "284" "0" "c.284C>T" "r.(?)" "p.(Pro95Leu)" "2"
"0000712707" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000712708" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000712709" "00000666" "70" "798" "0" "801" "0" "c.798_801del" "r.(?)" "p.(Thr267Argfs*5)" "2"
"0000712710" "00000666" "70" "969" "3" "969" "3" "c.969+3A>C" "r.spl" "p.?" "4i"
"0000712711" "00000666" "70" "969" "3" "969" "3" "c.969+3A>G" "r.spl" "p.?" "4i"
"0000712712" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" "2"
"0000712713" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000713327" "00000666" "90" "9" "0" "11" "0" "c.9_11del" "r.(?)" "p.(Phe5del)" ""
"0000713415" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000713487" "00000666" "90" "338" "0" "338" "0" "c.338C>A" "r.(?)" "p.(Ala113Asp)" ""
"0000713492" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000713664" "00000666" "90" "43" "0" "43" "0" "c.43del" "r.(?)" "p.(Ser15Argfs*31)" ""
"0000713975" "00000666" "70" "5" "0" "5" "0" "c.5G>T" "r.(?)" "p.(Gly2Val)" ""
"0000713976" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000714149" "00000666" "90" "81" "0" "81" "0" "c.81C>G" "r.(?)" "p.(Tyr27*)" ""
"0000728923" "00000666" "50" "889" "0" "889" "0" "c.889G>C" "r.(?)" "p.(Val297Leu)" ""
"0000729761" "00000666" "90" "882" "0" "882" "0" "c.882del" "r.(?)" "p.(Gly295Valfs*14)" ""
"0000731086" "00000666" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" ""
"0000731430" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000731489" "00000666" "90" "969" "3" "969" "3" "c.969+3A>G" "r.spl" "p.?" ""
"0000731490" "00000666" "70" "347" "0" "347" "0" "c.347A>T" "r.(?)" "p.(Gln116Leu)" ""
"0000731558" "00000666" "90" "488" "0" "488" "0" "c.488G>A" "r.(?)" "p.(Gly163Glu)" ""
"0000732685" "00000666" "70" "102" "3" "102" "3" "c.102+3A>C" "r.spl" "p.?" ""
"0000732686" "00000666" "70" "102" "0" "102" "0" "c.102G>A" "r.spl" "p.?" ""
"0000732754" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000732755" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000732756" "00000666" "70" "385" "0" "386" "0" "c.385_386del" "r.(?)" "p.(Leu129Valfs*9)" ""
"0000732764" "00000666" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000732765" "00000666" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000732766" "00000666" "70" "688" "0" "692" "0" "c.688_692del" "r.(?)" "p.(Lys230Glnfs*3)" ""
"0000732767" "00000666" "70" "884" "-1" "884" "-1" "c.884-1G>A" "r.spl" "p.?" ""
"0000732813" "00000666" "70" "759" "0" "762" "0" "c.759_762del" "r.(?)" "p.(Ile254Metfs*10)" ""
"0000734359" "00000666" "70" "445" "0" "445" "0" "c.445C>T" "Gln149*" "p.(Gln149*)" ""
"0000734694" "00000666" "70" "396" "0" "420" "0" "c.396_420del" "r.(?)" "p.(Thr133Glnfs*15)" ""
"0000735658" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000735659" "00000666" "90" "486" "0" "490" "0" "c.486_490del" "r.(?)" "p.(Gly163Lysfs*9)" ""
"0000735858" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000735948" "00000666" "70" "995" "0" "995" "0" "c.995C>T" "r.(?)" "p.(Thr332Met)" ""
"0000736065" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000736082" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000736086" "00000666" "70" "751" "0" "751" "0" "c.751A>G" "r.(?)" "p.(Arg251Gly)" ""
"0000736095" "00000666" "70" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000736213" "00000666" "90" "382" "0" "383" "0" "c.382_383delTT" "r.(?)" "p.(Leu129Valfs*9)" "2"
"0000736850" "00000666" "70" "260" "0" "268" "0" "c.260_268del" "r.(?)" "p.(Thr87_Cys89del)" ""
"0000759650" "00000666" "90" "1023" "0" "1023" "0" "c.1023C>A" "r.(?)" "p.(Tyr341*)" ""
"0000760190" "00000666" "50" "260" "0" "268" "0" "c.260_268del" "r.(?)" "p.(Thr87_Cys89del)" ""
"0000760247" "00000666" "70" "969" "3" "969" "3" "c.969+3A>G" "r.spl" "p.?" ""
"0000760278" "00000666" "50" "507" "0" "507" "0" "c.507del" "r.(?)" "p.(Asn169Lysfs*69)" ""
"0000760287" "00000666" "70" "102" "1" "102" "1" "c.102+1G>A" "r.spl" "p.?" ""
"0000760296" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000764059" "00000666" "70" "708" "0" "708" "0" "c.708C>G" "r.(?)" "p.(Cys236Trp)" ""
"0000764518" "00000666" "90" "5" "0" "5" "0" "c.5G>T" "r.(?)" "p.(Gly2Val)" "1"
"0000764519" "00000666" "90" "315" "0" "315" "0" "c.315C>G" "r.(?)" "p.(Cys105Trp)" "2"
"0000764520" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000764521" "00000666" "90" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Arg211His)" "2"
"0000764522" "00000666" "90" "46" "0" "1115" "0" "c.46_*62del" "r.(?)" "p.(Arg16*)" "1_5"
"0000764523" "00000666" "90" "305" "0" "305" "0" "c.305del" "r.(?)" "p.(Phe102Serfs*11)" "2"
"0000764524" "00000666" "90" "419" "0" "426" "0" "c.419_426del" "r.(?)" "p.(Ser140Tyrfs*12)" "2"
"0000764525" "00000666" "90" "540" "0" "541" "0" "c.540_541del" "r.(?)" "p.(Ser181Argfs*37)" "2"
"0000764526" "00000666" "90" "801" "0" "804" "0" "c.801_804del" "r.(?)" "p.(Glu269Cysfs*3)" "3"
"0000764527" "00000666" "90" "292" "0" "293" "0" "c.292_293insA" "r.(?)" "p.(Gly98Glufs*26)" "2"
"0000764528" "00000666" "90" "294" "0" "298" "0" "c.294_298dup" "r.(?)" "p.(Val100Alafs*15)" "2"
"0000764529" "00000666" "90" "449" "0" "449" "0" "c.449G>A" "r.(?)" "p.(Trp150*)" "2"
"0000764530" "00000666" "90" "557" "0" "557" "0" "c.557G>T" "r.(?)" "p.(Trp186Leu)" "2"
"0000764531" "00000666" "90" "769" "-1" "769" "-1" "c.769-1G>A" "r.spl?" "p.?" "2i"
"0000765572" "00000666" "90" "719" "0" "719" "0" "c.719del" "r.(?)" "p.(Leu240Tyrfs*14)" ""
"0000765790" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000765884" "00000666" "70" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.(Met1?)" ""
"0000783278" "00000666" "70" "340" "0" "340" "0" "c.340T>C" "r.(?)" "p.(Cys114Arg)" "2"
"0000783283" "00000666" "70" "560" "0" "561" "0" "c.560_561delGC" "r.(?)" "p.(Ser187ThrfsTer31)" "2"
"0000783896" "00000666" "50" "751" "0" "751" "0" "c.751A>G" "r.(?)" "p.(Arg251Gly)" ""
"0000784229" "00000666" "90" "49" "0" "49" "0" "c.49C>T" "r.(?)" "p.(Pro17Ser)" ""
"0000784230" "00000666" "90" "115" "0" "115" "0" "c.115G>A" "r.(?)" "p.(Asp39Asn)" ""
"0000784231" "00000666" "90" "428" "0" "428" "0" "c.428T>C" "r.(?)" "p.(Ile143Thr)" ""
"0000784232" "00000666" "90" "591" "0" "597" "0" "c.591_597del" "r.(?)" "p.(Tyr198LeufsTer38)" ""
"0000785535" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000786306" "00000666" "90" "299" "0" "299" "0" "c.299dup" "r.(?)" "p.(Phe101ValfsTer23)" ""
"0000786361" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000786411" "00000666" "90" "337" "0" "337" "0" "c.337G>A" "r.(?)" "p.(Ala113Thr)" ""
"0000786449" "00000666" "90" "258" "0" "258" "0" "c.258T>G" "r.(?)" "p.(Cys86Trp)" ""
"0000786465" "00000666" "90" "797" "0" "797" "0" "c.797A>C" "r.(?)" "p.(Gln266Pro)" ""
"0000787623" "00000666" "70" "884" "-1" "884" "-1" "c.884-1G>C" "r.spl" "p.?" ""
"0000787639" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000788529" "00000666" "90" "884" "-1" "884" "-1" "c.884-1G>T" "r.(?)" "p.?" ""
"0000788544" "00000666" "70" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000788545" "00000666" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Gln65Ter)" "2"
"0000789767" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" "1"
"0000789768" "00000666" "90" "769" "-3" "769" "-3" "c.769-3C>A" "r.spl?" "p.?" "2i"
"0000789769" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000789770" "00000666" "90" "884" "-1" "884" "-1" "c.884-1G>C" "r.spl?" "p.?" "3i"
"0000789771" "00000666" "90" "968" "0" "968" "0" "c.968delinsTCC" "r.(?)" "p.(Lys323Ilefs*16)" "4"
"0000789772" "00000666" "90" "310" "10" "310" "10" "c.310+10T>C" "r.spl?" "p.?" "2"
"0000790354" "00000666" "90" "76" "0" "76" "0" "c.76C>T" "r.(?)" "p.(Gln26*)" "1"
"0000790355" "00000666" "90" "76" "0" "76" "0" "c.76C>T" "r.(?)" "p.(Gln26*)" "1"
"0000790356" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000790357" "00000666" "90" "858" "0" "858" "0" "c.858delT" "r.(?)" "p.(Asp287Thrfs*6)" "3"
"0000790358" "00000666" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000790359" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" "1"
"0000790360" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" "1"
"0000790361" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" "1"
"0000790362" "00000666" "90" "352" "0" "352" "0" "c.352C>G" "r.(?)" "p.(Arg118Gly)" "2"
"0000790363" "00000666" "90" "386" "0" "386" "0" "c.386dupT" "r.(?)" "p.(Leu129Phefs*10)" "2"
"0000790364" "00000666" "90" "969" "3" "969" "3" "c.969+3A>G" "r.spl?" "p.?" "4i"
"0000790365" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" "1"
"0000790440" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000790466" "00000666" "50" "959" "0" "959" "0" "c.959A>G" "r.(?)" "p.(Asn320Ser)" ""
"0000790479" "00000666" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" ""
"0000790543" "00000666" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" ""
"0000790680" "00000666" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000790881" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000790882" "00000666" "70" "103" "0" "1053" "0" "c.103_1053del" "r.?" "p.?" "2_5"
"0000791224" "00000666" "90" "768" "2" "768" "2" "c.768+2T>C" "r.(?)" "p.(?)" "2i"
"0000791551" "00000666" "70" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "1"
"0000791552" "00000666" "70" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" "1"
"0000791583" "00000666" "90" "769" "-2" "769" "-2" "c.769-2A>G" "r.(?)" "p.(?)" "2i"
"0000793775" "00000666" "70" "5" "0" "5" "0" "c.5G>T" "r.(?)" "p.(Gly2Val)" "1"
"0000793776" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000793930" "00000666" "70" "340" "0" "340" "0" "c.340del" "r.(?)" "p.(Cys114Alafs*42)" ""
"0000794057" "00000666" "70" "100" "0" "102" "0" "c.100_102del" "r.(?)" "p.(Lys34del)" ""
"0000794267" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000794379" "00000666" "90" "947" "0" "947" "0" "c.947dup" "r.(?)" "p.(Asn316Lysfs*13)" "4"
"0000794892" "00000666" "70" "-1" "0" "102" "1" "c.(?_-1)_(102+1_103-1)del" "r.?" "p.?" ""
"0000795609" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000795610" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000795870" "00000666" "50" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" "2"
"0000795871" "00000666" "90" "8" "0" "8" "0" "c.8G>C" "r.(?)" "p.(Cys3Ser)" "1"
"0000795872" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000795873" "00000666" "90" "803" "0" "803" "0" "c.803del" "r.(?)" "p.(Lys268Argfs*5)" "3"
"0000795900" "00000666" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000795901" "00000666" "90" "688" "0" "692" "0" "c.688_692del" "r.(?)" "p.(Lys230Glnfs*3)" "2"
"0000795931" "00000666" "90" "481" "0" "481" "0" "c.481G>T" "r.(?)" "p.(Asp161Tyr)" "2"
"0000795934" "00000666" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000796756" "00000666" "70" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000796758" "00000666" "90" "226" "0" "226" "0" "c.226G>T" "r.(?)" "p.(Asp76Tyr)" "2"
"0000796759" "00000666" "70" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000796784" "00000666" "70" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000797137" "00000666" "70" "829" "0" "829" "0" "c.829dup" "r.(?)" "p.(Ala277Glyfs*11)" "3"
"0000797138" "00000666" "70" "630" "0" "633" "0" "c.630_633del" "r.(?)" "p.(Arg211Phefs*26)" "2"
"0000797139" "00000666" "90" "758" "0" "758" "0" "c.758del" "r.(?)" "p.(Leu253Glnfs*12)" "2"
"0000797195" "00000666" "50" "314" "0" "314" "0" "c.314G>A" "r.(?)" "p.(Cys105Tyr)" ""
"0000797812" "00000666" "70" "390" "0" "390" "0" "c.390T>A" "r.(?)" "p.(Cys130*)" ""
"0000797813" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000797815" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" ""
"0000797819" "00000666" "90" "16" "0" "18" "0" "c.16_18del" "r.(?)" "p.(Ser6del)" ""
"0000797820" "00000666" "70" "352" "0" "352" "0" "c.352C>G" "r.(?)" "p.(Arg118Gly)" ""
"0000797821" "00000666" "70" "826" "0" "826" "0" "c.826del" "r.(?)" "p.(Asp276Metfs*17)" ""
"0000797822" "00000666" "70" "49" "0" "49" "0" "c.49C>T" "r.(?)" "p.(Pro17Ser)" ""
"0000798408" "00000666" "90" "449" "0" "449" "0" "c.449G>A" "r.(?)" "p.(Trp150*)" "2"
"0000798409" "00000666" "90" "547" "0" "547" "0" "c.547G>T" "r.(?)" "p.(Glu183*)" "2"
"0000798410" "00000666" "90" "853" "0" "853" "0" "c.853dup" "r.(?)" "p.(Ala285Glyfs*3)" "3"
"0000810408" "00000666" "90" "704" "0" "704" "0" "c.704C>A" "r.(?)" "p.(Ser235*)" ""
"0000810409" "00000666" "30" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" ""
"0000811496" "00000666" "70" "322" "0" "322" "0" "c.322T>C" "r.(?)" "p.(Cys108Arg)" ""
"0000811842" "00000666" "70" "496" "0" "496" "0" "c.496A>G" "r.(?)" "p.(Ile166Val)" ""
"0000811892" "00000666" "70" "-2" "0" "-2" "0" "c.-2C>T" "r.spl" "p.(?)" ""
"0000811893" "00000666" "70" "-2" "0" "-2" "0" "c.-2C>T" "r.spl" "p.(?)" ""
"0000811930" "00000666" "70" "404" "0" "404" "0" "c.404C>G" "r.(?)" "p.(Pro135Arg)" ""
"0000813664" "00000666" "90" "769" "-1" "769" "-1" "c.769-1G>A" "r.spl" "p.(?)" ""
"0000813670" "00000666" "90" "969" "2" "969" "2" "c.969+2dup" "r.spl?" "p.(?)" ""
"0000813719" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000814288" "00000666" "70" "884" "0" "884" "0" "c.884dup" "r.(?)" "p.(Pro296Serfs*8)" "3i"
"0000814605" "00000666" "70" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000814606" "00000666" "70" "-189" "0" "3642" "0" "c.0" "r.0" "p.0" "1_5"
"0000814789" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000814790" "00000666" "70" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000816087" "00000666" "70" "515" "0" "515" "0" "c.515dup" "r.(?)" "p.(Ser172Argfs*2)" ""
"0000816156" "00000666" "70" "-446" "0" "3931" "0" "c.-446_*2878del" "r.spl" "p.(?)" ""
"0000816193" "00000666" "50" "404" "0" "404" "0" "c.404C>G" "r.(?)" "p.(Pro135Arg)" ""
"0000817310" "00000666" "70" "348" "0" "349" "0" "c.348_349insT" "r.(?)" "p.(Arg118Serfs*6)" "2"
"0000818588" "00000666" "90" "884" "-14" "884" "-14" "c.884-14G>A" "r.spl" "p.(?)" "3i"
"0000819420" "00000666" "70" "58" "0" "58" "0" "c.58G>T" "r.(?)" "p.(Glu20*)" ""
"0000819645" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000819664" "00000666" "70" "40" "0" "40" "0" "c.40del" "r.(?)" "p.(Glu14Serfs*32)" ""
"0000819673" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000819674" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000819681" "00000666" "70" "365" "0" "365" "0" "c.365G>A" "r.(?)" "p.(Cys122Tyr)" ""
"0000819682" "00000666" "70" "365" "0" "365" "0" "c.365G>A" "r.(?)" "p.(Cys122Tyr)" ""
"0000819724" "00000666" "70" "969" "1" "969" "1" "c.969+1dup" "r.spl" "p.(?)" ""
"0000819835" "00000666" "70" "529" "0" "533" "0" "c.529_533del" "r.(?)" "p.(Phe177Thrfs*40)" ""
"0000819890" "00000666" "70" "201" "0" "202" "0" "c.201_202del" "r.(?)" "p.(Cys67*)" ""
"0000819891" "00000666" "70" "201" "0" "202" "0" "c.201_202del" "r.(?)" "p.(Cys67*)" ""
"0000819894" "00000666" "70" "769" "-1" "883" "1" "c.(768+1_769-1)_(883+1_884-1)del" "r.spl" "p.(?)" ""
"0000819902" "00000666" "70" "58" "0" "58" "0" "c.58G>T" "r.(?)" "p.(Glu20*)" ""
"0000819903" "00000666" "70" "226" "0" "226" "0" "c.226G>T" "r.(?)" "p.(Asp76Tyr)" ""
"0000821376" "00000666" "70" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000821377" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000821378" "00000666" "70" "338" "0" "338" "0" "c.338C>A" "r.(?)" "p.(Ala113Asp)" ""
"0000821379" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000821380" "00000666" "70" "43" "0" "43" "0" "c.43del" "r.(?)" "p.(Ser15Argfs*31)" ""
"0000822242" "00000666" "70" "884" "-9" "884" "-9" "c.884-9T>A" "r.(=)" "p.(=)" "3i"
"0000823243" "00000666" "50" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" ""
"0000823244" "00000666" "90" "945" "0" "946" "0" "c.945_946insT" "r.(?)" "p.(Asn316*)" ""
"0000824100" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824101" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824103" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824105" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824106" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824107" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824116" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824117" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824118" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824138" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824139" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824141" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824143" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824144" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824145" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824154" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824155" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824156" "00000666" "70" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000824337" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" "2"
"0000824388" "00000666" "90" "934" "0" "934" "0" "c.934C>T" "r.(?)" "p.(Gln312*)" "4"
"0000824720" "00000666" "50" "814" "0" "814" "0" "c.814A>G" "r.(?)" "p.(Met272Val)" ""
"0000824738" "00000666" "50" "448" "0" "448" "0" "c.448T>C" "r.(?)" "p.(Trp150Arg)" ""
"0000825769" "00000666" "70" "947" "0" "947" "0" "c.947dup" "r.(?)" "p.(Asn316Lysfs*13)" "4"
"0000825987" "00000666" "70" "58" "0" "58" "0" "c.58G>T" "r.(?)" "p.(Glu20*)" "1"
"0000826088" "00000666" "70" "22" "0" "22" "0" "c.22A>T" "r.(?)" "p.(Arg8*)" "1"
"0000826089" "00000666" "70" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" "1"
"0000826207" "00000666" "70" "58" "0" "58" "0" "c.58G>T" "r.(?)" "p.(Glu20*)" "1"
"0000827572" "00000666" "90" "103" "-2" "103" "-2" "c.103-2del" "r.spl?" "p.?" "1i"
"0000827573" "00000666" "70" "353" "0" "353" "0" "c.353G>T" "r.(?)" "p.(Arg118Leu)" "2"
"0000827574" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000827575" "00000666" "90" "547" "0" "547" "0" "c.547G>T" "r.(?)" "p.(Glu183*)" "2"
"0000827576" "00000666" "70" "768" "1" "884" "-1" "c.768+1_884-1del" "r.spl?" "p.?" "2i_3i"
"0000828851" "00000666" "70" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000828927" "00000666" "90" "97" "0" "97" "0" "c.97G>T" "r.(?)" "p.(Glu33*)" ""
"0000829798" "00000666" "70" "425" "0" "425" "0" "c.425del" "r.(?)" "p.(Asn142Ilefs*14)" ""
"0000829923" "00000666" "90" "28" "0" "28" "0" "c.28A>T" "r.(?)" "p.(Lys10*)" "1"
"0000842785" "00000666" "70" "103" "-299" "103" "-190" "c.103-299_103-190delinsG" "r.(=)" "p.(=)" "1i"
"0000842786" "00000666" "90" "758" "0" "758" "0" "c.758T>G" "r.(?)" "p.(Leu253Arg)" "2"
"0000842787" "00000666" "90" "758" "0" "758" "0" "c.758T>G" "r.(?)" "p.(Leu253Arg)" "2"
"0000842788" "00000666" "90" "758" "0" "758" "0" "c.758T>G" "r.(?)" "p.(Leu253Arg)" "2"
"0000842789" "00000666" "90" "723" "0" "723" "0" "c.723del" "r.(?)" "p.(Phe241Leufs*13)" "2"
"0000842790" "00000666" "90" "798" "0" "801" "0" "c.798_801del" "r.(?)" "p.(Thr267Argfs*5)" "3"
"0000842791" "00000666" "10" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "2"
"0000842792" "00000666" "10" "597" "0" "597" "0" "c.597T>C" "r.(=)" "p.(=)" "2"
"0000842793" "00000666" "10" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000842794" "00000666" "10" "1012" "0" "1012" "0" "c.1012G>T" "r.(?)" "p.(Asp338Tyr)" "5"
"0000842795" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842796" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842797" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842798" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842799" "00000666" "90" "353" "0" "353" "0" "c.353G>T" "r.(?)" "p.(Arg118Leu)" "2"
"0000842800" "00000666" "90" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" "2"
"0000842801" "00000666" "90" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "3"
"0000842802" "00000666" "90" "305" "0" "305" "0" "c.305dup" "r.(?)" "p.(Arg103Profs*21)" "2"
"0000842803" "00000666" "90" "103" "-2" "103" "-2" "c.103-2A>G" "r.spl?" "p.?" "1i"
"0000842804" "00000666" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Gln134*)" "2"
"0000842805" "00000666" "90" "1073" "-9" "1073" "-9" "c.1073-9T>A" "r.spl?" "p.?" "5"
"0000842806" "00000666" "90" "1073" "-9" "1073" "-9" "c.1073-9T>A" "r.spl?" "p.?" "5"
"0000842807" "00000666" "90" "1073" "-9" "1073" "-9" "c.1073-9T>A" "r.spl?" "p.?" "5"
"0000842808" "00000666" "90" "1073" "-9" "1073" "-9" "c.1073-9T>A" "r.spl?" "p.?" "5"
"0000842809" "00000666" "90" "1073" "-9" "1073" "-9" "c.1073-9T>A" "r.spl?" "p.?" "5"
"0000842810" "00000666" "90" "8" "0" "8" "0" "c.8G>C" "r.(?)" "p.(Cys3Ser)" "1"
"0000842811" "00000666" "90" "76" "0" "77" "0" "c.76_77dup" "r.(?)" "p.(Gln26Hisfs*21)" "1"
"0000842812" "00000666" "90" "102" "1" "102" "1" "c.102+1G>A" "r.spl?" "p.?" "1i"
"0000842813" "00000666" "90" "102" "3" "102" "3" "c.102+3A>G" "r.spl?" "p.?" "1i"
"0000842814" "00000666" "90" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" "2"
"0000842815" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" "2"
"0000842816" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000842817" "00000666" "90" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "2"
"0000842818" "00000666" "90" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000842819" "00000666" "90" "449" "0" "449" "0" "c.449G>A" "r.(?)" "p.(Trp150*)" "2"
"0000842820" "00000666" "90" "515" "0" "515" "0" "c.515dup" "r.(?)" "p.(Ser172Argfs*2)" "2"
"0000842821" "00000666" "90" "673" "0" "673" "0" "c.673dup" "r.(?)" "p.(Arg225Profs*10)" "2"
"0000842822" "00000666" "90" "758" "0" "758" "0" "c.758T>C" "r.(?)" "p.(Leu253Pro)" "2"
"0000842823" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842824" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842825" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000842826" "00000666" "90" "798" "0" "801" "0" "c.798_801delGACA" "r.(?)" "p.(Thr267Argfs*5)" "3"
"0000842827" "00000666" "70" "111" "0" "112" "0" "c.111_112insC" "r.(?)" "p.(Lys38Glnfs*11)" "2"
"0000842828" "00000666" "70" "111" "0" "112" "0" "c.111_112insC" "r.(?)" "p.(Lys38Glnfs*11)" "2"
"0000842829" "00000666" "70" "299" "0" "299" "0" "c.299T>A" "r.(?)" "p.(Val100Glu)" "2"
"0000842830" "00000666" "70" "299" "0" "299" "0" "c.299T>A" "r.(?)" "p.(Val100Glu)" "2"
"0000842831" "00000666" "90" "665" "0" "665" "0" "c.665del" "r.(?)" "p.(Pro222Glnfs*16)" "2"
"0000842832" "00000666" "90" "665" "0" "665" "0" "c.665del" "r.(?)" "p.(Pro222Glnfs*16)" "2"
"0000842833" "00000666" "90" "473" "0" "473" "0" "c.473A>C" "r.(?)" "p.(Gln158Pro)" "2"
"0000842834" "00000666" "90" "473" "0" "473" "0" "c.473A>C" "r.(?)" "p.(Gln158Pro)" "2"
"0000842835" "00000666" "90" "473" "0" "473" "0" "c.473A>C" "r.(?)" "p.(Gln158Pro)" "2"
"0000842836" "00000666" "90" "473" "0" "473" "0" "c.473A>C" "r.(?)" "p.(Gln158Pro)" "2"
"0000842837" "00000666" "90" "473" "0" "473" "0" "c.473A>C" "r.(?)" "p.(Gln158Pro)" "2"
"0000842838" "00000666" "70" "843" "0" "843" "0" "c.843dup" "r.(?)" "p.(Arg282Serfs*6)" "3"
"0000856626" "00000666" "90" "201" "0" "202" "0" "c.201_202del" "r.(?)" "p.(Cys67*)" ""
"0000867378" "00000666" "50" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Asp244Asn)" ""
"0000873419" "00000666" "70" "102" "1" "102" "1" "c.102+1G>A" "r.spl" "p.?" ""
"0000873420" "00000666" "70" "217" "0" "217" "0" "c.217del" "r.(?)" "p.(Tyr73Ilefs*18)" ""
"0000873421" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000873422" "00000666" "70" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" ""
"0000873423" "00000666" "70" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" ""
"0000873424" "00000666" "70" "685" "0" "685" "0" "c.685C>T" "r.(?)" "p.(Gln229*)" ""
"0000873435" "00000666" "70" "102" "1" "102" "1" "c.102+1G>A" "r.spl" "p.?" ""
"0000873436" "00000666" "70" "217" "0" "217" "0" "c.217del" "r.(?)" "p.(Tyr73Ilefs*18)" ""
"0000873437" "00000666" "70" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" ""
"0000873438" "00000666" "70" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Glu138Gly)" ""
"0000873439" "00000666" "70" "685" "0" "685" "0" "c.685C>T" "r.(?)" "p.(Gln229*)" ""
"0000881233" "00000666" "70" "969" "3" "969" "3" "c.969+3A>C" "r.spl" "p.?" ""
"0000896235" "00000666" "50" "298" "0" "298" "0" "c.298G>A" "r.(?)" "p.(Val100Met)" ""
"0000896236" "00000666" "30" "696" "0" "696" "0" "c.696C>T" "r.(?)" "p.(Ser232=)" ""
"0000896583" "00000666" "70" "14" "0" "16" "0" "c.14_16delTCT" "r.(?)" "p.(Phe5del)" ""
"0000896628" "00000666" "90" "97" "0" "97" "0" "c.97G>T" "r.(?)" "p.(Glu33Ter)" ""
"0000905942" "00000666" "70" "700" "0" "700" "0" "c.700G>T" "r.(?)" "p.(Glu234*)" ""
"0000915717" "00000666" "30" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" ""
"0000915901" "00000666" "50" "127" "0" "127" "0" "c.127A>G" "r.(?)" "p.(Ser43Gly)" "2"
"0000915968" "00000666" "90" "873" "0" "873" "0" "c.873del" "r.(?)" "p.(Leu292*)" "3"
"0000916046" "00000666" "70" "687" "0" "688" "0" "c.687_688del" "r.(?)" "p.(Lys230Glufs*4)" "2"
"0000916135" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" "2"
"0000916141" "00000666" "70" "557" "0" "566" "0" "c.557_566del" "r.(?)" "p.(Trp186Phefs*49)" "2"
"0000916354" "00000666" "50" "566" "0" "566" "0" "c.566T>C" "r.(?)" "p.(Leu189Pro)" "2"
"0000916558" "00000666" "70" "391" "0" "391" "0" "c.391dupT" "r.(?)" "p.(Cys131Leufs*8)" "2"
"0000916593" "00000666" "70" "793" "0" "793" "0" "c.793del" "r.(?)" "p.(Val265Phefs*8)" "3"
"0000916613" "00000666" "70" "810" "0" "811" "0" "c.810_811del" "r.(?)" "p.(Ser271Hisfs*4)" "3"
"0000916614" "00000666" "70" "810" "0" "811" "0" "c.810_811del" "r.(?)" "p.(Ser271Hisfs*4)" "3"
"0000916696" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000916708" "00000666" "70" "409" "0" "411" "0" "c.409_411del" "r.(?)" "p.(Ile137del)" "2"
"0000916764" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120*)" "2"
"0000933409" "00000666" "90" "542" "0" "543" "0" "c.542_543del" "r.(?)" "p.(Ser181Trpfs*37)" ""
"0000933413" "00000666" "90" "102" "0" "102" "0" "c.102G>A" "r.(=)" "p.(=)" ""
"0000951761" "00000666" "50" "297" "0" "297" "0" "c.297C>G" "r.(?)" "p.(Ser99Arg)" ""
"0000951762" "00000666" "30" "606" "0" "606" "0" "c.606T>C" "r.(?)" "p.(=)" ""
"0000955405" "00000666" "70" "769" "-419" "883" "4093" "c.769-419_883+4093del" "r.(769_883del)" "p.?" "2i_3i"
"0000958041" "00000666" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000958183" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000958184" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000958797" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000958800" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000958802" "00000666" "70" "769" "-3" "769" "-3" "c.769-3C>A" "r.spl?" "p.?" ""
"0000958808" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0000958812" "00000666" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Ter)" ""
"0000958814" "00000666" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000958815" "00000666" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000958821" "00000666" "90" "838" "0" "838" "0" "c.838del" "r.(?)" "p.(Val280PhefsTer13)" ""
"0000958824" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0000958931" "00000666" "50" "596" "0" "596" "0" "c.596T>C" "r.(?)" "p.(Val199Ala)" ""
"0000958990" "00000666" "50" "566" "0" "566" "0" "c.566T>C" "r.(?)" "p.(Leu189Pro)" ""
"0000958992" "00000666" "50" "969" "3" "969" "3" "c.969+3A>C" "r.spl?" "p.?" ""
"0000959173" "00000666" "50" "58" "0" "58" "0" "c.58G>C" "r.(?)" "p.(Glu20Gln)" ""
"0000971098" "00000666" "50" "341" "0" "341" "0" "c.341G>A" "r.(?)" "p.(Cys114Tyr)" ""
"0000984696" "00000666" "30" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Asp66Asn)" ""
"0001006764" "00000666" "70" "8" "0" "8" "0" "c.8G>C" "r.(?)" "p.(Cys3Ser)" ""
"0001016035" "00000666" "50" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Arg225Trp)" ""
"0001022306" "00000666" "90" "14" "0" "16" "0" "c.14_16del" "r.(?)" "p.(Phe5del)" ""
"0001027502" "00000666" "30" "970" "-20" "970" "-20" "c.970-20T>A" "r.(=)" "p.(=)" ""
"0001058264" "00000666" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" ""
"0001059084" "00000666" "90" "8" "0" "8" "0" "c.8G>C" "r.(?)" "p.(Cys3Ser)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 417
"{{screeningid}}" "{{variantid}}"
"0000000209" "0000001882"
"0000000209" "0000002903"
"0000000209" "0000006684"
"0000000210" "0000008739"
"0000000210" "0000010910"
"0000016561" "0000036429"
"0000032921" "0000060411"
"0000033155" "0000060412"
"0000033159" "0000060413"
"0000033162" "0000060418"
"0000033169" "0000060414"
"0000033173" "0000060415"
"0000033192" "0000060416"
"0000033230" "0000060417"
"0000105509" "0000170950"
"0000105510" "0000170951"
"0000164876" "0000368489"
"0000164877" "0000368490"
"0000164878" "0000368491"
"0000164879" "0000368492"
"0000164880" "0000368493"
"0000164881" "0000368494"
"0000164882" "0000368495"
"0000164883" "0000368496"
"0000164884" "0000368497"
"0000164884" "0000368507"
"0000164885" "0000368498"
"0000164886" "0000368499"
"0000164887" "0000368500"
"0000164888" "0000368501"
"0000164889" "0000368502"
"0000164890" "0000368503"
"0000164891" "0000368504"
"0000164892" "0000368505"
"0000164893" "0000368506"
"0000230744" "0000472362"
"0000234676" "0000477384"
"0000234677" "0000477385"
"0000234678" "0000477386"
"0000234679" "0000477387"
"0000234680" "0000477388"
"0000234681" "0000477389"
"0000234682" "0000477390"
"0000234683" "0000477391"
"0000234684" "0000477392"
"0000234907" "0000477615"
"0000234908" "0000477616"
"0000234909" "0000477617"
"0000241562" "0000487572"
"0000241563" "0000487573"
"0000241564" "0000487574"
"0000309698" "0000684571"
"0000309699" "0000684572"
"0000309802" "0000684675"
"0000310520" "0000685431"
"0000310521" "0000685432"
"0000310522" "0000685433"
"0000310523" "0000685434"
"0000310524" "0000685435"
"0000310817" "0000685841"
"0000310876" "0000686016"
"0000326648" "0000710240"
"0000326676" "0000710268"
"0000326692" "0000710284"
"0000328255" "0000712184"
"0000328256" "0000712185"
"0000328257" "0000712190"
"0000328267" "0000712215"
"0000328614" "0000712572"
"0000328615" "0000712573"
"0000328616" "0000712574"
"0000328617" "0000712575"
"0000328618" "0000712576"
"0000328619" "0000712577"
"0000328620" "0000712578"
"0000328621" "0000712579"
"0000328622" "0000712580"
"0000328623" "0000712581"
"0000328624" "0000712582"
"0000328625" "0000712583"
"0000328626" "0000712584"
"0000328627" "0000712585"
"0000328685" "0000712701"
"0000328686" "0000712702"
"0000328687" "0000712703"
"0000328688" "0000712704"
"0000328689" "0000712705"
"0000328690" "0000712706"
"0000328691" "0000712707"
"0000328692" "0000712708"
"0000328693" "0000712709"
"0000328694" "0000712710"
"0000328695" "0000712711"
"0000328696" "0000712712"
"0000328697" "0000712713"
"0000329204" "0000713327"
"0000329292" "0000713415"
"0000329364" "0000713487"
"0000329369" "0000713492"
"0000329541" "0000713664"
"0000329627" "0000713975"
"0000329628" "0000713976"
"0000329764" "0000714149"
"0000332506" "0000729761"
"0000333440" "0000731086"
"0000333681" "0000731430"
"0000333726" "0000731489"
"0000333727" "0000731490"
"0000333768" "0000731558"
"0000334705" "0000732685"
"0000334706" "0000732686"
"0000334747" "0000732754"
"0000334748" "0000732755"
"0000334749" "0000732756"
"0000334757" "0000732764"
"0000334758" "0000732765"
"0000334759" "0000732766"
"0000334760" "0000732767"
"0000334806" "0000732813"
"0000335665" "0000734359"
"0000335795" "0000734694"
"0000336383" "0000735658"
"0000336384" "0000735659"
"0000336483" "0000735858"
"0000336552" "0000735948"
"0000336620" "0000736065"
"0000336637" "0000736082"
"0000336641" "0000736086"
"0000336650" "0000736095"
"0000336723" "0000736213"
"0000337220" "0000736850"
"0000360008" "0000759650"
"0000360298" "0000760190"
"0000360355" "0000760247"
"0000360386" "0000760278"
"0000360395" "0000760287"
"0000360404" "0000760296"
"0000363421" "0000764059"
"0000363816" "0000764518"
"0000363817" "0000764519"
"0000363818" "0000764520"
"0000363819" "0000764521"
"0000363820" "0000764522"
"0000363821" "0000764523"
"0000363822" "0000764524"
"0000363823" "0000764525"
"0000363824" "0000764526"
"0000363825" "0000764527"
"0000363826" "0000764528"
"0000363827" "0000764529"
"0000363828" "0000764530"
"0000363829" "0000764531"
"0000364697" "0000765572"
"0000364848" "0000765790"
"0000364942" "0000765884"
"0000373306" "0000783278"
"0000373311" "0000783283"
"0000373747" "0000783896"
"0000373916" "0000784229"
"0000373917" "0000784230"
"0000373918" "0000784231"
"0000373919" "0000784232"
"0000374712" "0000785535"
"0000375045" "0000786306"
"0000375094" "0000786361"
"0000375116" "0000786411"
"0000375154" "0000786449"
"0000375170" "0000786465"
"0000376090" "0000787623"
"0000376106" "0000787639"
"0000376636" "0000788529"
"0000376651" "0000788544"
"0000376652" "0000788545"
"0000377437" "0000789767"
"0000377438" "0000789768"
"0000377439" "0000789769"
"0000377440" "0000789770"
"0000377441" "0000789771"
"0000377441" "0000789772"
"0000377882" "0000790354"
"0000377883" "0000790355"
"0000377884" "0000790356"
"0000377885" "0000790357"
"0000377886" "0000790358"
"0000377887" "0000790359"
"0000377888" "0000790360"
"0000377889" "0000790361"
"0000377890" "0000790362"
"0000377891" "0000790363"
"0000377892" "0000790364"
"0000377893" "0000790365"
"0000377955" "0000790466"
"0000377958" "0000790479"
"0000377973" "0000790543"
"0000377990" "0000790440"
"0000378020" "0000790680"
"0000378196" "0000790881"
"0000378197" "0000790882"
"0000378469" "0000791224"
"0000378702" "0000791551"
"0000378703" "0000791552"
"0000378730" "0000791583"
"0000380623" "0000793775"
"0000380624" "0000793776"
"0000380744" "0000793930"
"0000380846" "0000794057"
"0000381003" "0000794267"
"0000381081" "0000794379"
"0000381432" "0000794892"
"0000381977" "0000795609"
"0000381978" "0000795610"
"0000382157" "0000795870"
"0000382158" "0000795871"
"0000382159" "0000795872"
"0000382160" "0000795873"
"0000382187" "0000795900"
"0000382188" "0000795901"
"0000382215" "0000795931"
"0000382218" "0000795934"
"0000382853" "0000796756"
"0000382854" "0000796758"
"0000382854" "0000796759"
"0000382863" "0000796784"
"0000383145" "0000797137"
"0000383146" "0000797138"
"0000383147" "0000797139"
"0000383172" "0000797195"
"0000383629" "0000797812"
"0000383630" "0000797813"
"0000383631" "0000797815"
"0000383634" "0000797819"
"0000383635" "0000797820"
"0000383636" "0000797821"
"0000383637" "0000797822"
"0000383996" "0000798408"
"0000383997" "0000798409"
"0000383998" "0000798410"
"0000384728" "0000811496"
"0000385001" "0000811842"
"0000385009" "0000811892"
"0000385010" "0000811893"
"0000385063" "0000811930"
"0000386257" "0000813664"
"0000386263" "0000813670"
"0000386312" "0000813719"
"0000386650" "0000814288"
"0000386840" "0000814605"
"0000386848" "0000814606"
"0000386966" "0000814789"
"0000386967" "0000814790"
"0000387929" "0000816087"
"0000387998" "0000816156"
"0000388035" "0000816193"
"0000388612" "0000817310"
"0000389502" "0000818588"
"0000390075" "0000819420"
"0000390300" "0000819645"
"0000390319" "0000819664"
"0000390328" "0000819673"
"0000390329" "0000819674"
"0000390336" "0000819681"
"0000390337" "0000819682"
"0000390379" "0000819724"
"0000390490" "0000819835"
"0000390545" "0000819890"
"0000390546" "0000819891"
"0000390549" "0000819894"
"0000390557" "0000819902"
"0000390558" "0000819903"
"0000391626" "0000821376"
"0000391627" "0000821377"
"0000391628" "0000821378"
"0000391629" "0000821379"
"0000391630" "0000821380"
"0000392108" "0000822242"
"0000392808" "0000823243"
"0000392809" "0000823244"
"0000393368" "0000824100"
"0000393369" "0000824101"
"0000393370" "0000824118"
"0000393371" "0000824103"
"0000393373" "0000824105"
"0000393374" "0000824106"
"0000393375" "0000824107"
"0000393384" "0000824116"
"0000393385" "0000824117"
"0000393393" "0000824138"
"0000393394" "0000824139"
"0000393395" "0000824156"
"0000393396" "0000824141"
"0000393398" "0000824143"
"0000393399" "0000824144"
"0000393400" "0000824145"
"0000393409" "0000824154"
"0000393410" "0000824155"
"0000393560" "0000824337"
"0000393608" "0000824388"
"0000393898" "0000824720"
"0000393916" "0000824738"
"0000394754" "0000825769"
"0000394903" "0000825987"
"0000394965" "0000826088"
"0000394966" "0000826089"
"0000395042" "0000826207"
"0000396010" "0000827572"
"0000396011" "0000827573"
"0000396012" "0000827574"
"0000396013" "0000827575"
"0000396014" "0000827576"
"0000397105" "0000828851"
"0000397181" "0000828927"
"0000397730" "0000829798"
"0000397859" "0000829923"
"0000406458" "0000842785"
"0000406459" "0000842786"
"0000406460" "0000842787"
"0000406461" "0000842788"
"0000406462" "0000842789"
"0000406463" "0000842790"
"0000406464" "0000842791"
"0000406465" "0000842792"
"0000406466" "0000842793"
"0000406467" "0000842794"
"0000406468" "0000842795"
"0000406469" "0000842796"
"0000406470" "0000842797"
"0000406471" "0000842798"
"0000406472" "0000842799"
"0000406473" "0000842800"
"0000406474" "0000842801"
"0000406475" "0000842802"
"0000406476" "0000842803"
"0000406477" "0000842804"
"0000406478" "0000842805"
"0000406479" "0000842806"
"0000406480" "0000842807"
"0000406481" "0000842808"
"0000406482" "0000842809"
"0000406483" "0000842810"
"0000406484" "0000842811"
"0000406485" "0000842812"
"0000406486" "0000842813"
"0000406487" "0000842814"
"0000406488" "0000842815"
"0000406489" "0000842816"
"0000406490" "0000842817"
"0000406491" "0000842818"
"0000406492" "0000842819"
"0000406493" "0000842820"
"0000406494" "0000842821"
"0000406495" "0000842822"
"0000406496" "0000842823"
"0000406497" "0000842824"
"0000406498" "0000842825"
"0000406499" "0000842826"
"0000406500" "0000842827"
"0000406501" "0000842828"
"0000406502" "0000842829"
"0000406503" "0000842830"
"0000406504" "0000842831"
"0000406505" "0000842832"
"0000406506" "0000842833"
"0000406507" "0000842834"
"0000406508" "0000842835"
"0000406509" "0000842836"
"0000406510" "0000842837"
"0000406511" "0000842838"
"0000415593" "0000873419"
"0000415594" "0000873420"
"0000415595" "0000873421"
"0000415596" "0000873422"
"0000415597" "0000873423"
"0000415598" "0000873424"
"0000415609" "0000873435"
"0000415610" "0000873436"
"0000415611" "0000873437"
"0000415612" "0000873438"
"0000415613" "0000873439"
"0000420874" "0000881233"
"0000421787" "0000896583"
"0000421820" "0000896628"
"0000428251" "0000905942"
"0000430983" "0000915901"
"0000431029" "0000915968"
"0000431088" "0000916046"
"0000431148" "0000916135"
"0000431152" "0000916141"
"0000431282" "0000916354"
"0000431418" "0000916558"
"0000431437" "0000916593"
"0000431449" "0000916613"
"0000431450" "0000916614"
"0000431506" "0000916696"
"0000431515" "0000916708"
"0000431557" "0000916764"
"0000437942" "0000933409"
"0000437947" "0000933413"
"0000446959" "0000955405"
"0000448555" "0000958041"
"0000448697" "0000958183"
"0000448698" "0000958184"
"0000448964" "0000959173"
"0000449030" "0000958797"
"0000449033" "0000958800"
"0000449035" "0000958802"
"0000449041" "0000958808"
"0000449045" "0000958812"
"0000449047" "0000958814"
"0000449048" "0000958815"
"0000449054" "0000958821"
"0000449057" "0000958824"
"0000449164" "0000958931"
"0000449223" "0000958990"
"0000449225" "0000958992"
"0000462755" "0001022306"
"0000470177" "0001058264"
"0000470962" "0001059084"