### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = RPGRIP1)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"RPGRIP1" "retinitis pigmentosa GTPase regulator interacting protein 1" "14" "q11.2" "unknown" "NG_008933.1" "UD_132118797857" "" "http://www.LOVD.nl/RPGRIP1" "" "1" "13436" "57096" "605446" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/RPGRIP1_NM_020366.3_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-02-13 00:00:00" "00006" "2015-02-28 13:10:10" "00006" "2026-02-03 14:10:31"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00018070" "RPGRIP1" "retinitis pigmentosa GTPase regulator interacting protein 1" "001" "NM_020366.3" "" "NP_065099.3" "" "" "" "1" "3946" "3861" "21756136" "21819460" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 11
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00027" "CILD14" "dyskinesia, ciliary, primary, type 14 (CILD-14)" "" "613807" "" "" "" "00008" "2012-08-20 12:24:19" "00006" "2021-12-10 21:51:32"
"00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59"
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25"
"02743" "CORD13" "dystrophy, cone-rod, type 13 (CORD-13)" "" "608194" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03450" "LCA6" "Leber congenital amaurosis, type 6 (LCA-6)" "AR" "613826" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" ""
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39"
"05165" "CCTRCT" "cataract, congenital (CCTRCT)" "" "" "" "" "" "00006" "2016-05-15 20:37:47" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"RPGRIP1" "02743"
"RPGRIP1" "03450"
## Individuals ## Do not remove or alter this header ##
## Count = 478
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00000223" "" "" "" "1" "" "00041" "{PMID:Antony 2013:23255504}" "" "" "" "United States" "" "0" "" "" "" "UNC64"
"00016610" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" ""
"00033156" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" ""
"00033352" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033353" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033354" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033355" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033356" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033357" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033361" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033362" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033363" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" ""
"00033588" "" "" "" "2" "" "00239" "" "family with 2 affecteds" "-" "yes" "India" "" "0" "" "" "" ""
"00033605" "" "" "" "1" "" "00130" "{PMID:Neveling 2013:24123792}" "" "" "" "" "" "0" "" "" "" "Pat1bl"
"00033606" "" "" "" "1" "" "00130" "{PMID:Neveling 2013:24123792}" "confirmed in affected sib" "" "" "" "" "0" "" "" "" ""
"00033607" "" "" "" "1" "" "00130" "{PMID:Neveling 2013:24123792}" "confirmed in affected sib" "" "" "" "" "0" "" "" "" "Pat8bl"
"00033722" "" "" "" "1" "" "00243" "" "" "M" "yes" "India" "" "0" "" "" "India, south" ""
"00033723" "" "" "" "1" "" "00243" "" "" "M" "yes" "India" "" "0" "" "" "India, south" ""
"00033724" "" "" "" "1" "" "00243" "" "" "F" "yes" "India" "" "0" "" "" "India, north" ""
"00033725" "" "" "" "1" "" "00243" "" "" "M" "no" "India" "" "0" "" "" "India, south" ""
"00038056" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" ""
"00038058" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" ""
"00038059" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" ""
"00038076" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" ""
"00100118" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61312"
"00105038" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "" "M" "no" "Spain" "" "0" "" "" "" ""
"00155548" "" "" "" "2" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" ""
"00155549" "" "" "" "3" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" ""
"00155550" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" ""
"00173892" "" "" "" "1" "" "02449" "{PMID:Wang 2014b:25097241}" "" "F" "" "United States" "" "0" "" "" "" "31"
"00240460" "" "" "" "1" "" "03335" "" "" "F" "" "Mexico" "" "0" "" "" "" ""
"00240461" "" "" "" "1" "" "03335" "" "" "F" "" "Mexico" "" "0" "" "" "" ""
"00269583" "" "" "" "1" "" "03508" "" "" "F" "" "Korea" "" "0" "" "" "" ""
"00269584" "" "" "" "1" "" "03508" "" "" "M" "" "Korea" "" "0" "" "" "" ""
"00269585" "" "" "" "1" "" "03508" "" "" "M" "no" "Korea" "" "0" "" "" "" ""
"00269592" "" "" "" "1" "" "03508" "" "" "M" "no" "Korea" "" "0" "" "" "" ""
"00290971" "" "" "" "209" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00290972" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00290973" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00290974" "" "" "" "18" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304420" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304421" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00308399" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC06321"
"00308560" "" "" "" "2" "" "00004" "{PMID:Holtan 2020:31429209}" "2 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308624" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" ""
"00309408" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309409" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309410" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309411" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00309412" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00325456" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "3275"
"00325458" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "single patient" "" "" "Mexico" "" "0" "" "" "" "3292"
"00325473" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3483"
"00325490" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3592"
"00327953" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240213"
"00328173" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G007341"
"00328328" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "W000332"
"00328336" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000370"
"00328496" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15004859"
"00332200" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB307"
"00332210" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB284"
"00332216" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB285"
"00332217" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB124"
"00332353" "" "" "" "2" "" "00000" "{PMID:Thompson 2017:29178642}" "family, 2 affected" "" "" "Australia" "" "0" "" "" "" "Fam479"
"00332354" "" "" "" "2" "" "00000" "{PMID:Thompson 2017:29178642}" "family, 2 affected" "" "" "Australia" "" "0" "" "" "" "Fam1642"
"00332388" "" "" "" "1" "" "00000" "{PMID:Rim 2017:29145603}" "" "M" "" "Korea" "" "0" "" "" "" "Pat9"
"00332389" "" "" "" "1" "" "00000" "{PMID:Rim 2017:29145603}" "" "M" "" "Korea" "" "0" "" "" "" "Pat10"
"00332408" "" "" "" "1" "" "00006" "{PMID:Han 2017:28966547}" "" "" "" "Korea" "" "0" "" "" "" "Pat8"
"00332409" "" "" "" "1" "" "00006" "{PMID:Han 2017:28966547}" "" "" "" "Korea" "" "0" "" "" "" "Pat9"
"00332471" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat41"
"00333357" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat6"
"00333366" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat11"
"00333427" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD15–01"
"00333430" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD13–08"
"00333457" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "RKK_209"
"00333466" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "FBP_353"
"00333478" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "DGB_032"
"00333964" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "426"
"00333965" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "427"
"00335168" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "2533"
"00335239" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/12"
"00335342" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Spain" "" "0" "" "" "" "Pat105"
"00335498" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD002"
"00335593" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "unknown variant 2nd chromosome; not in 60 controls" "" "" "" "" "0" "" "" "" ""
"00335594" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "unknown variant 2nd chromosome; not in 60 controls" "" "" "" "" "0" "" "" "" ""
"00335614" "" "" "" "1" "" "00008" "{PMID:Dryja 2001:11283794}" "" "" "" "" "" "0" "" "" "" ""
"00335615" "" "" "" "1" "" "00008" "{PMID:Dryja 2001:11283794}" "" "" "" "" "" "0" "" "" "" ""
"00335616" "" "" "" "1" "" "00008" "{PMID:Dryja 2001:11283794}" "" "" "" "" "" "0" "" "" "" ""
"00335617" "" "" "" "1" "" "00008" "{PMID:Dryja 2001:11283794}" "" "" "" "" "" "0" "" "" "" ""
"00335618" "" "" "" "1" "" "00008" "{PMID:Dryja 2001:11283794}" "" "" "" "" "" "0" "" "" "" ""
"00335619" "" "" "" "1" "" "00008" "Miller 1988" "" "" "" "" "" "0" "" "" "" ""
"00335620" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" ""
"00335621" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" ""
"00335622" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" ""
"00358913" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents" "" "" "China" "" "0" "" "" "Han" "Fam25"
"00358914" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents/relatives" "" "" "China" "" "0" "" "" "Han" "Fam26"
"00358915" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents/relatives" "" "" "China" "" "0" "" "" "Han" "Fam27"
"00358916" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous mother" "" "" "China" "" "0" "" "" "Han" "Fam28"
"00358930" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27391102}" "" "" "" "Turkey" "" "0" "" "" "" "Case27536"
"00358951" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71927"
"00358954" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71688"
"00358967" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71315"
"00358970" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71161"
"00359046" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12010986"
"00359059" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12009612"
"00359068" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13013813"
"00359071" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13018022"
"00359073" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12015787"
"00359091" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13010086"
"00359095" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13002515"
"00359098" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13002689"
"00359323" "" "" "" "1" "" "00000" "{PMID:Khan 2017:27160483}" "see paper" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "31169"
"00362149" "" "" "" "1" "" "00006" "{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}" "" "" "" "China" "" "0" "" "" "" "QT312"
"00362150" "" "" "" "1" "" "00006" "{PMID:Huang 2016:26992781}" "" "" "" "China" "" "0" "" "" "" "QT1117"
"00362230" "" "" "" "1" "" "04043" "Fadaie 2021, submitted" "" "F" "" "Netherlands" "" "0" "" "" "" "?"
"00362931" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "RCD163"
"00363473" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "59R+5.99"
"00363603" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "09DG01243"
"00363634" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG1615"
"00363643" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG0522"
"00363649" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG1368"
"00363671" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG2349"
"00363712" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG2106"
"00363737" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "13DG1103"
"00372416" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "87"
"00372447" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "103"
"00372448" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "115"
"00372449" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "133"
"00372450" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "153"
"00372451" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "77"
"00372452" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "79"
"00372453" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "93"
"00372454" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "97"
"00372491" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "113"
"00373343" "" "" "" "2" "" "00006" "{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}" "4-generation family, 2 affected brothers, unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "" "FamMA117"
"00373408" "" "" "" "2" "" "00000" "{PMID:Maria 2015:25775262}" "family" "" "yes" "Pakistan" "" "0" "" "" "" "Fam04"
"00373409" "" "" "" "3" "" "00000" "{PMID:Maria 2015:25775262}" "family" "" "yes" "Pakistan" "" "0" "" "" "" "Fam05"
"00373464" "" "" "" "1" "" "00006" "{PMID:Kikuchi 2015:25692141Kikuchi 2015}" "4-generation family, 1 affected" "F" "" "Japan" "" "0" "" "" "" "patient"
"00373892" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-079-194"
"00375413" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#005"
"00375428" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#022"
"00375441" "" "" "" "1" "" "00000" "{PMID:Watson 2014:25133751}" "family" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "MA10"
"00375456" "" "" "" "2" "" "00000" "{PMID:Khan 2014:24997176}" "family, 2 affected" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat1-1"
"00375457" "" "" "00375456" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat1-2"
"00375458" "" "" "" "2" "" "00000" "{PMID:Khan 2014:24997176}" "family, 2 affected" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat2-1"
"00375459" "" "" "00375458" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat2-2"
"00375461" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat4"
"00375464" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat10"
"00375465" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat11"
"00375467" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat13"
"00375468" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat14"
"00375469" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat15"
"00375470" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat16"
"00375472" "" "" "" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat18"
"00375473" "" "" "" "2" "" "00000" "{PMID:Khan 2014:24997176}" "family, 2 affected" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat19-1"
"00375474" "" "" "00375473" "1" "" "00000" "{PMID:Khan 2014:24997176}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "Pat19-2"
"00376285" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" ""
"00376286" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" ""
"00376471" "" "" "" "1" "" "00000" "{PMID:Li-2009:18936139}" "" "" "" "" "" "0" "" "" "Saudi Arabian" ""
"00376472" "" "" "" "1" "" "00000" "{PMID:Li-2009:18936139}" "" "" "" "" "" "0" "" "" "Saudi Arabian" ""
"00376475" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" ""
"00376476" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" ""
"00376477" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" ""
"00376478" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" ""
"00376709" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376710" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376711" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376712" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376713" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376714" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "M" "" "Spain" "" "0" "" "" "Spanish" ""
"00376720" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376721" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376722" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376728" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376729" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376730" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376731" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376732" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "" "" "Spain" "" "0" "" "" "Spanish" ""
"00376753" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "13"
"00376766" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "28"
"00376770" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "34"
"00376789" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "56"
"00376864" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "" "Turkey" "" "0" "" "" "" "Fam12"
"00377029" "" "" "" "1" "" "00000" "{PMID:mckibbin-2010:20065226}" "" "" "" "" "" "0" "" "" "" ""
"00377030" "" "" "" "1" "" "00000" "{PMID:mckibbin-2010:20065226}" "" "" "" "" "" "0" "" "" "" ""
"00377031" "" "" "" "1" "" "00000" "{PMID:mckibbin-2010:20065226}" "" "" "" "" "" "0" "" "" "" ""
"00377032" "" "" "" "1" "" "00000" "{PMID:mckibbin-2010:20065226}" "" "" "" "" "" "0" "" "" "" ""
"00377513" "" "" "" "1" "" "04521" "{PMID:Hosono 2018:29844330}" "proband, family EYE16" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE16"
"00377515" "" "" "" "3" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "proband, family EYE20a" "F" "no" "Japan" "" "0" "" "" "Japanese" "EYE20"
"00377516" "" "" "00377515" "1" "" "04521" "{PMID:Hosono 2018:29844330},Torii 2023, submitted" "brother of EYE20; monozygotic twin of EYE65, family EYE20a" "M" "no" "Japan" "" "0" "" "" "Japan" "EYE64"
"00377517" "" "" "00377515" "1" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "brother of EYE20; monozygotic twin of EYE64, family EYE20a" "M" "no" "Japan" "" "0" "" "" "Japan" "EYE65"
"00377521" "" "" "" "1" "" "02518" "{PMID:Hosono 2018:29844330}" "proband, family EYE55a" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE55"
"00377522" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family EYE63" "F" "no" "Japan" "" "0" "" "" "Asian" "EYE63"
"00377531" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family EYE139" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE139"
"00377532" "" "" "" "1" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "proband, family EYE149" "M" "no" "Japan" "" "0" "" "" "Japanese" "EYE149"
"00377533" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family EYE152" "F" "no" "Japan" "" "0" "" "" "Asian" "EYE152"
"00377535" "" "" "" "1" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "proband, family EYE170" "F" "no" "Japan" "" "0" "" "" "Japanese" "EYE170"
"00377538" "" "" "" "2" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "proband, family JIKEI-122" "F" "no" "Japan" "" "0" "" "" "Japanese" "JU0954"
"00377539" "" "" "00377538" "1" "" "04521" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "relative of JU0954, family JIKEI-122" "M" "no" "Japan" "" "0" "" "" "Japanese" "JU0955"
"00377544" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family S132" "F" "no" "Japan" "" "0" "" "" "Asian" "S132"
"00377881" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" ""
"00377882" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" ""
"00377883" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" ""
"00377892" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" ""
"00377893" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" ""
"00377894" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "novel" "M" "no" "China" "" "0" "" "" "Chinese" ""
"00377910" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" ""
"00377957" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "affected sister also both variants but both come from father, no other variant in lower covered region." "" "" "" "" "0" "" "" "" ""
"00379754" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0099"
"00380318" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" ""
"00381031" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "F" "" "China" "" "0" "" "" "Chinese" ""
"00381032" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "M" "yes" "China" "" "0" "" "" "Chinese" ""
"00381039" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" ""
"00381046" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" ""
"00381047" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" ""
"00381084" "" "" "" "1" "" "00000" "{PMID:Jonsson-2013:23443024}" "" "F" "" "Sweden" "" "0" "" "" "Swedish" ""
"00381151" "" "" "" "1" "" "00008" "{PMID:Verma-2013:24066033}" "" "F" "yes" "India" "" "0" "" "" "South Indian" ""
"00381165" "" "" "" "1" "" "00008" "{PMID:Neveling-2013:24123792}" "" "" "" "" "" "0" "" "" "" ""
"00381171" "" "" "" "1" "" "00008" "{PMID:Neveling-2013:24123792}" "" "" "" "" "" "0" "" "" "" ""
"00381172" "" "" "" "1" "" "00008" "{PMID:Neveling-2013:24123792}" "" "" "" "" "" "0" "" "" "" ""
"00381215" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel LOF mutations" "" "no" "" "" "0" "" "" "" ""
"00381216" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel LOF mutations" "" "no" "" "" "0" "" "" "" ""
"00381615" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "United Arab Emirates" "" "0" "" "" "" ""
"00381626" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" ""
"00381627" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" ""
"00381640" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" ""
"00381646" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" ""
"00381647" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" ""
"00381656" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" ""
"00381658" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" ""
"00381660" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" ""
"00381662" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" ""
"00381889" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "39"
"00381945" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "F" "" "Germany" "" "0" "" "" "" "14"
"00381946" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "15"
"00381947" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "16"
"00381948" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "F" "" "Germany" "" "0" "" "" "" "17"
"00382602" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "465"
"00382802" "" "" "" "1" "" "00000" "{PMID:Song-2011:22025579}" "" "M" "" "" "" "0" "" "" "" ""
"00383386" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31555371}" "Family 2, individual IV-7" "F" "" "China" "" "0" "" "" "" "2_IV-7"
"00383915" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0310"
"00383949" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0881"
"00384043" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1894"
"00384185" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066584"
"00384186" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066866"
"00384187" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066868"
"00384466" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14730"
"00384993" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "10219"
"00384999" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19068"
"00385018" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19310"
"00385027" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19425"
"00385056" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19929"
"00385080" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "67310"
"00385091" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "191060"
"00385612" "" "" "" "1" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "" "" "" "" "0" "" "" "" "59RE"
"00386291" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RP-632"
"00388175" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "" "F" "" "Korea" "" "0" "" "" "" "32"
"00388176" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "individual previously described in PMID:29145603, PMID:28966547 - possible duplicate in the database" "M" "" "Korea" "" "0" "" "" "" "33"
"00388177" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "individual previously described in PMID:29145603, PMID:28966547 - possible duplicate in the database" "M" "" "Korea" "" "0" "" "" "" "34"
"00388184" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "" "M" "" "Korea" "" "0" "" "" "" "41"
"00388487" "" "" "" "1" "" "00000" "{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15004859"
"00389000" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 93, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "284"
"00389101" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 127, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "385"
"00389745" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 572, cone dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1029"
"00389746" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 581, cone dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1030"
"00389747" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 582, cone dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1031"
"00389758" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 611, cone dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1042"
"00389759" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 611, cone dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1043"
"00389760" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 612, cone dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1044"
"00389834" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 763, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1118"
"00390400" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000332"
"00390401" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000370"
"00390727" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F1, patient IV.7" "M" "" "Tunisia" "" "0" "" "" "" "F1_IV.7"
"00390763" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" ""
"00391221" "" "" "" "1" "" "00000" "{PMID:Sato 2020:32736544}" "brother of patient 2" "M" "no" "Japan" "" "0" "" "" "" "1"
"00391222" "" "" "" "1" "" "00000" "{PMID:Sato 2020:32736544}" "sister of patient 1" "F" "no" "Japan" "" "0" "" "" "" "2"
"00391348" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "4"
"00391586" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "white" "85"
"00391700" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "90"
"00391701" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "91"
"00391702" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "91"
"00391703" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "92"
"00391704" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "92"
"00391705" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "93"
"00391706" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "94"
"00391707" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "95"
"00391708" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "96"
"00391709" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "97"
"00391710" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "98"
"00391711" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "99"
"00391712" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "99"
"00391713" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "100"
"00391714" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "101"
"00391715" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "102"
"00391716" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "103"
"00393461" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393558" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393695" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00395568" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-0567"
"00395856" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F212"
"00396214" "" "" "" "1" "" "00000" "{PMID:SkorczykWerner 2020:33308271}" "" "F" "" "" "" "0" "" "" "Polish" ""
"00396215" "" "" "" "1" "" "00000" "{PMID:SkorczykWerner 2020:33308271}" "" "F" "" "" "" "0" "" "" "Polish" ""
"00396229" "" "" "" "1" "" "00000" "{PMID:SkorczykWerner 2020:33308271}" "" "F" "" "" "" "0" "" "" "Polish" ""
"00396472" "" "" "" "1" "" "00000" "{PMID:Dockery 2017:29099798}" "no patient numbers in the paper, consecutive numbers given" "?" "" "Ireland" "" "0" "" "" "" "5"
"00397588" "" "" "" "1" "" "00000" "{PMID:Cideciyan 2007:17554762}" "" "M" "" "(United States)" "" "0" "" "" "" "P9"
"00402002" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United States" "" "0" "" "" "" "237-523"
"00402003" "" "" "" "2" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, affected sister/brother, unaffected parents" "F;M" "" "United States" "" "0" "" "" "" "281-608"
"00402004" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "601-1236"
"00402005" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, 1 affected, unaffected heterozygous carrierfather, non-carrier mother" "M" "" "United States" "" "0" "" "" "" "949-1907"
"00402006" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "827-1591"
"00402007" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "2-generation family, 1 affected, unaffected parents" "" "" "United States" "" "0" "" "" "" "1797-3128"
"00402008" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "" "F" "" "United States" "" "0" "" "" "" "79-194"
"00402009" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "" "F" "" "United States" "" "0" "" "" "" "501-336"
"00402010" "" "" "" "1" "" "00006" "{PMID:Jamshidi 2019:30072743}" "" "F" "" "United States" "" "0" "" "" "" "690-1378"
"00402311" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "F" "" "China" "" "0" "" "" "" "MEP_305"
"00402314" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "M" "" "China" "" "0" "" "" "" "MEP_318"
"00402316" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "F" "" "China" "" "0" "" "" "" "RKK_665"
"00402319" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "1332"
"00402320" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "3443"
"00402321" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF2147"
"00402322" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "3647"
"00402323" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_1990"
"00402324" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_436"
"00402325" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "14132001"
"00402326" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_1536"
"00402327" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_569"
"00402328" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_1447"
"00402329" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "NEI_8"
"00402330" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "4270jyc"
"00402331" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "RKK_78"
"00402332" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_841"
"00402333" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_825"
"00402334" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "207_3"
"00402335" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_168"
"00402336" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "WLJ_029"
"00402337" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "SRF_684"
"00402338" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "518"
"00402339" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "1275"
"00402340" "" "" "" "1" "" "00006" "{PMID:Zou 2021:33907365}" "" "" "" "China" "" "0" "" "" "" "FBP_207"
"00406384" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-039" "?" "" "United States" "" "0" "" "" "" "Ar-39-04"
"00406406" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-848" "?" "" "United States" "" "0" "" "" "" "?"
"00406407" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-021" "?" "" "United States" "" "0" "" "" "" "?"
"00406593" "" "" "" "1" "" "00000" "{PMID:Preising 2007:17525851}" "family 998, individual 1" "?" "" "" "" "0" "" "" "" "998_1"
"00406594" "" "" "" "1" "" "00000" "{PMID:Preising 2007:17525851}" "family 1483, individual 1" "?" "yes" "" "" "0" "" "" "" "1483_1"
"00408144" "" "" "" "1" "" "00000" "{PMID:Dryja 2001:11283794}" "family #9414, proband" "F" "" "United States" "" "0" "" "" "" "048-044"
"00408145" "" "" "" "1" "" "00000" "{PMID:Dryja 2001:11283794}" "family #J061, proband" "M" "yes" "United States" "" "0" "" "" "" "048-079"
"00408146" "" "" "" "1" "" "00000" "{PMID:Dryja 2001:11283794}" "family #J061, proband\'s sister" "F" "yes" "United States" "" "0" "" "" "" "048-079\'s sister"
"00408147" "" "" "" "1" "" "00000" "{PMID:Dryja 2001:11283794}" "family #9449, proband" "M" "" "United States" "" "0" "" "" "" "048-051"
"00408150" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family SED, proband" "M" "yes" "France" "" "0" "" "" "Moroccan" "II:1"
"00408151" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family SED, proband\'s sister" "F" "yes" "France" "" "0" "" "" "Moroccan" "II:2"
"00408152" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family NIL, proband\'s sister" "M" "yes" "France" "" "0" "" "" "" "II:1"
"00408153" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family NIL, proband\'s sister" "F" "" "France" "" "0" "" "" "" "II:2"
"00408154" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family LOB, proband" "M" "" "France" "" "0" "" "" "French, English, German and Bulgarian" "II:1"
"00408155" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family NES, proband" "M" "" "France" "" "0" "" "" "Belgian" "II:2"
"00408156" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family MOU, proband" "M" "yes" "France" "" "0" "" "" "Moroccan" "II:1"
"00408157" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family GRA, proband" "M" "" "France" "" "0" "" "" "French" "II:1"
"00408158" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family HER, proband" "M" "" "France" "" "0" "" "" "French" "II:2"
"00408159" "" "" "" "1" "" "00000" "{PMID:Gerber 2001:11528500}" "Family GUY, proband" "M" "" "France" "" "0" "" "" "French" "III:2"
"00408166" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:9"
"00408167" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:11"
"00408168" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "IV:5"
"00408169" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "IV:7"
"00408170" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "IV:9"
"00408171" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "IV:11"
"00408172" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "IV:13"
"00408173" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 1CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "IV:14"
"00408174" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:2"
"00408175" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:4"
"00408176" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:7"
"00408177" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "III:8"
"00408178" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "III:11"
"00408179" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "III:13"
"00408180" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "M" "yes" "Pakistan" "" "0" "" "" "" "IV:1"
"00408181" "" "" "" "1" "" "00000" "{PMID:Hameed 2003:12920076}" "Family 4CRD" "F" "yes" "Pakistan" "" "0" "" "" "" "IV:3"
"00408182" "" "" "" "1" "" "00000" "{PMID:Roepman 2005:16339905}" "cell line" "" "" "" "" "0" "" "" "" "?"
"00408183" "" "" "" "1" "" "00000" "{PMID:Roepman 2005:16339905}" "cell line" "" "" "" "" "0" "" "" "" "?"
"00408184" "" "" "" "1" "" "00000" "{PMID:Roepman 2005:16339905}" "cell line" "" "" "" "" "0" "" "" "" "?"
"00408185" "" "" "" "1" "" "00000" "{PMID:Roepman 2005:16339905}" "cell line" "" "" "" "" "0" "" "" "" "?"
"00408186" "" "" "" "1" "" "00000" "{PMID:Roepman 2005:16339905}" "cell line" "" "" "" "" "0" "" "" "" "?"
"00408188" "" "" "" "1" "" "00000" "{PMID:Jacobson 2006:17306875}" "" "" "" "" "" "0" "" "" "" "?"
"00408190" "" "" "" "1" "" "00000" "{PMID:Seong 2009:19172513}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00408191" "" "" "" "1" "" "00000" "{PMID:Seong 2009:19172513}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00408192" "" "" "" "1" "" "00000" "{PMID:Seong 2009:19172513}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?"
"00408200" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99034"
"00408201" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99440"
"00408202" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "13718"
"00408203" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "17163"
"00408204" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "17483"
"00408205" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "7191"
"00408206" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "19418"
"00408207" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "8562"
"00408208" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99435"
"00408209" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "10554"
"00408210" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "10653"
"00408211" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "13652"
"00408212" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99168"
"00408213" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "21035"
"00408214" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99192"
"00408215" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99302"
"00408216" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "99242"
"00408217" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "14501"
"00408218" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "19243"
"00408219" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "13747"
"00408220" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "10033"
"00408221" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "10540"
"00408222" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "16886"
"00408223" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "10366"
"00408224" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "11638"
"00408225" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "21614"
"00408226" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "154"
"00408227" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "210"
"00408228" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "58"
"00408229" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "290"
"00408230" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "24"
"00408231" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "47"
"00408232" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "148"
"00408233" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "149"
"00408234" "" "" "" "1" "" "00000" "{PMID:Fernandez-Martinez 2011:21224891}" "" "?" "" "" "" "0" "" "" "" "292"
"00408263" "" "" "" "1" "" "00000" "{PMID:Fakhratova 2013:23278760}" "proband" "F" "yes" "United Arab Emirates" "" "0" "" "" "" "?"
"00408264" "" "" "" "1" "" "00000" "{PMID:Fakhratova 2013:23278760}" "proband\'s sister" "F" "yes" "United Arab Emirates" "" "0" "" "" "" "?"
"00408265" "" "" "" "1" "" "00000" "{PMID:Suzuki 2014:25096270}" "family 1, proband" "M" "yes" "Japan" "" "0" "" "" "" "Case 1"
"00408266" "" "" "" "1" "" "00000" "{PMID:Suzuki 2014:25096270}" "family 1, proband\'s sibling" "M" "yes" "Japan" "" "0" "" "" "" "Case 2"
"00408267" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "family 1, proband" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "1"
"00408268" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "family 1, proband\'s sibling" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "2"
"00408269" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "family 2, proband" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "3"
"00408270" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "family 2, proband\'s sibling" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "4"
"00408271" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "5"
"00408272" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "6"
"00408273" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "7"
"00408274" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "8"
"00408275" "" "" "" "1" "" "00000" "{PMID:Khan 2013:23505306}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "9"
"00408276" "" "" "" "1" "" "00000" "{PMID:Abouzeid 2016:27116508}" "" "F" "yes" "Egypt" "" "0" "" "" "" "?"
"00408277" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28456785}" "" "M" "" "China" "" "0" "" "" "" "65"
"00408278" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28456785}" "" "F" "" "China" "" "0" "" "" "" "24"
"00408279" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28456785}" "" "F" "" "China" "" "0" "" "" "" "30"
"00408283" "" "" "" "1" "" "00000" "{PMID:Imami 2018:29193763}" "proband" "F" "" "Iran" "" "0" "" "" "" "II: 1"
"00408284" "" "" "" "1" "" "00000" "{PMID:Imami 2018:29193763}" "proband\'s brother" "M" "" "Iran" "" "0" "" "" "" "II: 2"
"00408286" "" "" "" "1" "" "00000" "{PMID:Tallapaka 2019:31191208}" "aborted fetus with multiple malformations; parents second cousins with one Leber congenital amaurosis child" "F" "yes" "India" "" "0" "" "" "" "II: 1"
"00408412" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 6, invidivual a" "?" "" "Finland" "" "0" "" "" "" "6a"
"00408413" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 6, invidivual b" "?" "" "Finland" "" "0" "" "" "" "6b"
"00415267" "" "" "" "1" "" "00000" "{PMID:Alfares 2018:30202406}" "" "M" "" "" "" "0" "" "" "" "22"
"00420523" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F212"
"00426942" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 45, individual 54" "F" "" "" "" "0" "" "" "" "45_54"
"00426946" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 50, individual 59" "F" "" "" "" "0" "" "" "" "50_59"
"00429581" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429598" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429692" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429794" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429853" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429946" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429963" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429986" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00430061" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00430128" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00435214" "" "" "" "1" "" "04521" "Torii 2023, submitted" "" "M" "" "Japan" "" "0" "" "" "Japanese" "EYE345"
"00435216" "" "" "" "1" "" "04521" "Torii 2023, submitted" "" "F" "" "Japan" "" "" "" "" "Japanese" "JU1556"
"00441667" "" "" "" "3" "" "04542" "{PMID:Fadaie 2021:34795310}, {PMID:de Bruijn 2023:36524988}" "family, 3 affected" "" "" "Netherlands" "" "0" "" "" "" "Pat22;DNA12-13802"
"00444310" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat77"
"00447201" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "F" "" "Germany" "" "0" "" "" "" "MISC-269"
"00447323" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1277"
"00447533" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "CRD-775"
"00449987" "" "" "" "1" "" "02230" "{PMID:Zeuli 2024:38816995}" "" "M" "" "Italy" "" "0" "" "" "white" "Pt-27"
"00449989" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "3-generation family, 1 affected, unaffected heterozygous parents/relatives" "M" "" "France" "" "0" "" "" "" "LCA215PatIII2"
"00449990" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous parents" "M" "" "France" "" "0" "" "" "" "LCA454PatII1"
"00449991" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous parents" "M" "" "France" "" "0" "" "" "" "MON035PatII2"
"00449992" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous parents" "M" "" "France" "" "0" "" "" "" "LCA426PatII2"
"00449993" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected parents" "M" "" "France" "" "0" "" "" "" "LCA903PatII1"
"00449994" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected parents" "F" "" "France" "" "0" "" "" "" "LCA485PatII1"
"00449995" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous mother" "M" "" "France" "" "0" "" "" "" "LCA657PatII1"
"00449996" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous mother" "F" "" "France" "" "0" "" "" "" "LCA489PatII1"
"00449997" "" "" "" "1" "" "00006" "{PMID:Perrault 2021:33670832}" "2-generation family, 1 affected, unaffected heterozygous father" "F" "" "France" "" "0" "" "" "" "MON017PatII1"
"00450435" "" "" "" "1" "" "04695" "" "" "" "no" "China" "" "0" "" "" "Asian" "patient"
"00451008" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "074651"
"00451179" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071987"
"00451280" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "073560"
"00451291" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "073786"
"00451332" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "075136"
"00461082" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "white" "Pat17"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 477
"{{individualid}}" "{{diseaseid}}"
"00000223" "00027"
"00033156" "04214"
"00033352" "04210"
"00033353" "00198"
"00033354" "00381"
"00033355" "00198"
"00033356" "04210"
"00033357" "04210"
"00033361" "00058"
"00033362" "04210"
"00033363" "04210"
"00033588" "04214"
"00033605" "00058"
"00033606" "04214"
"00033607" "04214"
"00033722" "04210"
"00033723" "04210"
"00033724" "04210"
"00033725" "04210"
"00038056" "04210"
"00038058" "04210"
"00038059" "04210"
"00038076" "04214"
"00100118" "04210"
"00105038" "04210"
"00155548" "04210"
"00155549" "04210"
"00155550" "04214"
"00173892" "00058"
"00240460" "00381"
"00240461" "00381"
"00269583" "04210"
"00269584" "04210"
"00269585" "04210"
"00269592" "04210"
"00290971" "00198"
"00290972" "00198"
"00290973" "00198"
"00290974" "00198"
"00304420" "00198"
"00304421" "00198"
"00308399" "04214"
"00308560" "04214"
"00308624" "04214"
"00309408" "04214"
"00309409" "04214"
"00309410" "04214"
"00309411" "04214"
"00309412" "04214"
"00325456" "04214"
"00325458" "04214"
"00325473" "04214"
"00325490" "04214"
"00327953" "04214"
"00328173" "04214"
"00328328" "04214"
"00328336" "04214"
"00328496" "04214"
"00332200" "04214"
"00332210" "04214"
"00332216" "04214"
"00332217" "04214"
"00332353" "04214"
"00332354" "04214"
"00332388" "04214"
"00332389" "04214"
"00332408" "04214"
"00332409" "04214"
"00332471" "04214"
"00333357" "04214"
"00333366" "04214"
"00333427" "04214"
"00333430" "04214"
"00333457" "04214"
"00333466" "04214"
"00333478" "04214"
"00333964" "04214"
"00333965" "04214"
"00335168" "00198"
"00335239" "04214"
"00335342" "04214"
"00335498" "04214"
"00335593" "04214"
"00335594" "04214"
"00335614" "04214"
"00335615" "04214"
"00335616" "04214"
"00335617" "04214"
"00335618" "04214"
"00335619" "04214"
"00335620" "04214"
"00335621" "04214"
"00335622" "04214"
"00358913" "04214"
"00358914" "04214"
"00358915" "04214"
"00358916" "04214"
"00358930" "04214"
"00358951" "04214"
"00358954" "04214"
"00358967" "04214"
"00358970" "04214"
"00359046" "04214"
"00359059" "04214"
"00359068" "04214"
"00359071" "04214"
"00359073" "04214"
"00359091" "04214"
"00359095" "04214"
"00359098" "04214"
"00359323" "04214"
"00362149" "04214"
"00362150" "04214"
"00362230" "04214"
"00362931" "04214"
"00363473" "04214"
"00363603" "04214"
"00363634" "04214"
"00363643" "04214"
"00363649" "04214"
"00363671" "04214"
"00363712" "04214"
"00363737" "04214"
"00372416" "04214"
"00372447" "04214"
"00372448" "04214"
"00372449" "04214"
"00372450" "04214"
"00372451" "04214"
"00372452" "04214"
"00372453" "04214"
"00372454" "04214"
"00372491" "04214"
"00373343" "04214"
"00373408" "04214"
"00373409" "04214"
"00373464" "04214"
"00373892" "04214"
"00375413" "04214"
"00375428" "04214"
"00375441" "04214"
"00375456" "04214"
"00375457" "04214"
"00375458" "04214"
"00375459" "04214"
"00375461" "04214"
"00375464" "04214"
"00375465" "04214"
"00375467" "04214"
"00375468" "04214"
"00375469" "04214"
"00375470" "04214"
"00375472" "04214"
"00375473" "04214"
"00375474" "04214"
"00376285" "04214"
"00376286" "04214"
"00376471" "04214"
"00376472" "04214"
"00376475" "04214"
"00376476" "04214"
"00376477" "04214"
"00376478" "04214"
"00376709" "04214"
"00376710" "04214"
"00376711" "04214"
"00376712" "04214"
"00376713" "04214"
"00376714" "04214"
"00376720" "04214"
"00376721" "04214"
"00376722" "04214"
"00376728" "04214"
"00376729" "04214"
"00376730" "04214"
"00376731" "04214"
"00376732" "04214"
"00376753" "04214"
"00376766" "04214"
"00376770" "04214"
"00376789" "04214"
"00376864" "04214"
"00377029" "04214"
"00377030" "04214"
"00377031" "04214"
"00377032" "04214"
"00377513" "04214"
"00377515" "03450"
"00377516" "03450"
"00377517" "03450"
"00377521" "04214"
"00377522" "04214"
"00377531" "04214"
"00377532" "03450"
"00377533" "04214"
"00377535" "03450"
"00377538" "03450"
"00377539" "03450"
"00377544" "04214"
"00377881" "04214"
"00377882" "04214"
"00377883" "04214"
"00377892" "04214"
"00377893" "04214"
"00377894" "04214"
"00377910" "04214"
"00377957" "04214"
"00379754" "04210"
"00380318" "04214"
"00381031" "04214"
"00381032" "04214"
"00381039" "04214"
"00381046" "04214"
"00381047" "04214"
"00381084" "04214"
"00381151" "04214"
"00381165" "04214"
"00381171" "04214"
"00381172" "04214"
"00381215" "04214"
"00381216" "04214"
"00381615" "04214"
"00381626" "04214"
"00381627" "04214"
"00381640" "04214"
"00381646" "04214"
"00381647" "04214"
"00381656" "04214"
"00381658" "04214"
"00381660" "04214"
"00381662" "04214"
"00381889" "04214"
"00381945" "04214"
"00381946" "04214"
"00381947" "04214"
"00381948" "04214"
"00382602" "04214"
"00382802" "04214"
"00383386" "05165"
"00383915" "04214"
"00383949" "04214"
"00384043" "04214"
"00384185" "04214"
"00384186" "04214"
"00384187" "04214"
"00384466" "04214"
"00384993" "04214"
"00384999" "04214"
"00385018" "04214"
"00385027" "04214"
"00385056" "04214"
"00385080" "04214"
"00385091" "04214"
"00385612" "04214"
"00386291" "04214"
"00388175" "04214"
"00388176" "04214"
"00388177" "04214"
"00388184" "04214"
"00388487" "04214"
"00389000" "04214"
"00389101" "04214"
"00389745" "04214"
"00389746" "04214"
"00389747" "04214"
"00389758" "04214"
"00389759" "04214"
"00389760" "04214"
"00389834" "04214"
"00390400" "04214"
"00390401" "04214"
"00390727" "04214"
"00390763" "04214"
"00391221" "04214"
"00391222" "04214"
"00391348" "04214"
"00391586" "04214"
"00391700" "04214"
"00391701" "04214"
"00391702" "04214"
"00391703" "04214"
"00391704" "04214"
"00391705" "04214"
"00391706" "04214"
"00391707" "04214"
"00391708" "04214"
"00391709" "04214"
"00391710" "04214"
"00391711" "04214"
"00391712" "04214"
"00391713" "04214"
"00391714" "04214"
"00391715" "04214"
"00391716" "04214"
"00393461" "04214"
"00393558" "04214"
"00393695" "04214"
"00395568" "04214"
"00395856" "04214"
"00396214" "04214"
"00396215" "04214"
"00396229" "04214"
"00396472" "04214"
"00397588" "04214"
"00402002" "04214"
"00402003" "04214"
"00402004" "04214"
"00402005" "04214"
"00402006" "04214"
"00402007" "04214"
"00402008" "04214"
"00402009" "04214"
"00402010" "04214"
"00402311" "04214"
"00402314" "04214"
"00402316" "04214"
"00402319" "04214"
"00402320" "04214"
"00402321" "04214"
"00402322" "04214"
"00402323" "04214"
"00402324" "04214"
"00402325" "04214"
"00402326" "04214"
"00402327" "04214"
"00402328" "04214"
"00402329" "04214"
"00402330" "04214"
"00402331" "04214"
"00402332" "04214"
"00402333" "04214"
"00402334" "04214"
"00402335" "04214"
"00402336" "04214"
"00402337" "04214"
"00402338" "04214"
"00402339" "04214"
"00402340" "04214"
"00406384" "04214"
"00406406" "04214"
"00406407" "04214"
"00406593" "04214"
"00406594" "04214"
"00408144" "04214"
"00408145" "04214"
"00408146" "04214"
"00408147" "04214"
"00408150" "04214"
"00408151" "04214"
"00408152" "04214"
"00408153" "04214"
"00408154" "04214"
"00408155" "04214"
"00408156" "04214"
"00408157" "04214"
"00408158" "04214"
"00408159" "04214"
"00408166" "04214"
"00408167" "04214"
"00408168" "04214"
"00408169" "04214"
"00408170" "04214"
"00408171" "04214"
"00408172" "04214"
"00408173" "04214"
"00408174" "04214"
"00408175" "04214"
"00408176" "04214"
"00408177" "04214"
"00408178" "04214"
"00408179" "04214"
"00408180" "04214"
"00408181" "04214"
"00408182" "04214"
"00408183" "04214"
"00408184" "04214"
"00408185" "04214"
"00408186" "04214"
"00408188" "04214"
"00408190" "04214"
"00408191" "04214"
"00408192" "04214"
"00408200" "04214"
"00408201" "04214"
"00408202" "04214"
"00408203" "04214"
"00408204" "04214"
"00408205" "04214"
"00408206" "04214"
"00408207" "04214"
"00408208" "04214"
"00408209" "04214"
"00408210" "04214"
"00408211" "04214"
"00408212" "04214"
"00408213" "04214"
"00408214" "04214"
"00408215" "04214"
"00408216" "04214"
"00408217" "04214"
"00408218" "04214"
"00408219" "04214"
"00408220" "04214"
"00408221" "04214"
"00408222" "04214"
"00408223" "04214"
"00408224" "04214"
"00408225" "04214"
"00408226" "04214"
"00408227" "04214"
"00408228" "04214"
"00408229" "04214"
"00408230" "04214"
"00408231" "04214"
"00408232" "04214"
"00408233" "04214"
"00408234" "04214"
"00408263" "04214"
"00408264" "04214"
"00408265" "04214"
"00408266" "04214"
"00408267" "04214"
"00408268" "04214"
"00408269" "04214"
"00408270" "04214"
"00408271" "04214"
"00408272" "04214"
"00408273" "04214"
"00408274" "04214"
"00408275" "04214"
"00408276" "04214"
"00408277" "04214"
"00408278" "04214"
"00408279" "04214"
"00408283" "04214"
"00408284" "04214"
"00408286" "04214"
"00408412" "04214"
"00408413" "04214"
"00415267" "04214"
"00420523" "04214"
"00426942" "04214"
"00426946" "04214"
"00429581" "00112"
"00429598" "00112"
"00429692" "04210"
"00429794" "00112"
"00429853" "04210"
"00429946" "04214"
"00429963" "04210"
"00429986" "04210"
"00430061" "04210"
"00430128" "00112"
"00435214" "03450"
"00435216" "03450"
"00441667" "04210"
"00444310" "04214"
"00447201" "00198"
"00447323" "00198"
"00447533" "00198"
"00449987" "04214"
"00449989" "04210"
"00449990" "04210"
"00449991" "04210"
"00449992" "04210"
"00449993" "04210"
"00449994" "04210"
"00449995" "04210"
"00449996" "04210"
"00449997" "04210"
"00450435" "03450"
"00451008" "04249"
"00451179" "04249"
"00451280" "04249"
"00451291" "04249"
"00451332" "04249"
"00461082" "04214"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00027, 00058, 00112, 00198, 00381, 02743, 03450, 04210, 04214, 04249, 05165
## Count = 451
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000026585" "04214" "00033156" "00229" "Unknown" "09y" "obesity, familial hypercholesterolemia, recurrent cystitis (5y), heart murmur" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000026781" "04210" "00033352" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026782" "00198" "00033353" "00039" "Familial, autosomal recessive" "" "Retinitis punctata albescens" "" "" "" "" "" "" "" "" "" "" ""
"0000026783" "00381" "00033354" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026784" "00198" "00033355" "00039" "Familial, autosomal recessive" "" "Rod Dystrophy" "" "" "" "" "" "" "" "" "" "" ""
"0000026785" "04210" "00033356" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026786" "04210" "00033357" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026790" "00058" "00033361" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000026791" "04210" "00033362" "00039" "Familial, autosomal recessive" "" "gliosis" "" "" "" "" "" "" "" "" "" "" ""
"0000026792" "04210" "00033363" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000027017" "04214" "00033588" "00239" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000027034" "00058" "00033605" "00130" "Familial, autosomal recessive" "" "Cone-rod dystrophy with nystagmus" "" "" "" "" "" "" "" "" "" "" ""
"0000027035" "04214" "00033606" "00130" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000027036" "04214" "00033607" "00130" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000027151" "04210" "00033722" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" ""
"0000027152" "04210" "00033723" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" ""
"0000027153" "04210" "00033724" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" ""
"0000027154" "04210" "00033725" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" ""
"0000028599" "04210" "00038056" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" ""
"0000028601" "04210" "00038058" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" ""
"0000028602" "04210" "00038059" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" ""
"0000028619" "04214" "00038076" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000078355" "04210" "00100118" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000082929" "04210" "00105038" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000128048" "04210" "00155548" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000128049" "04210" "00155549" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000128050" "04214" "00155550" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000138745" "00058" "00173892" "02449" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conr-rod dystrophy" ""
"0000233826" "04214" "00308399" "00004" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000233988" "04214" "00308560" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234052" "04214" "00308624" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234728" "04214" "00309408" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" ""
"0000234729" "04214" "00309409" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234730" "04214" "00309410" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234731" "04214" "00309411" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234732" "04214" "00309412" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000243943" "04214" "00325456" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000243945" "04214" "00325458" "00006" "Unknown" "" "syndromic retinal dystrophy" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000243960" "04214" "00325473" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000243977" "04214" "00325490" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000246180" "04214" "00327953" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000246400" "04214" "00328173" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246555" "04214" "00328328" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "multiple phenotypes" ""
"0000246563" "04214" "00328336" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000246722" "04214" "00328496" "00000" "Familial, autosomal recessive" "2y" "retinal dystrophy (HP:0000556)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000250387" "04214" "00332200" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" ""
"0000250397" "04214" "00332210" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250403" "04214" "00332216" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250404" "04214" "00332217" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250539" "04214" "00332353" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250540" "04214" "00332354" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250574" "04214" "00332388" "00000" "Familial, autosomal recessive" "3y9m" "horizontal jerk nystagmus; fundus grossly normal; oculodigital sign; ERG extinguished" "" "" "" "" "" "" "" "" "LCA" "Leber congenital amaurosis" ""
"0000250575" "04214" "00332389" "00000" "Familial, autosomal recessive" "1y6m" "horizontal jerk nystagmus; fundus grossly normal; oculodigital sign; ERG extinguished" "" "" "" "" "" "" "" "" "LCA" "idiopathic infantile nystagmus" ""
"0000250594" "04214" "00332408" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250595" "04214" "00332409" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000250655" "04214" "00332471" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "LCA" ""
"0000251544" "04214" "00333357" "00000" "Familial, X-linked recessive" "39y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251553" "04214" "00333366" "00000" "Unknown" "20y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000251614" "04214" "00333427" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" ""
"0000251617" "04214" "00333430" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "achromatopsia" ""
"0000251642" "04214" "00333457" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000251651" "04214" "00333466" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000251663" "04214" "00333478" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000252149" "04214" "00333964" "00000" "Familial, autosomal recessive" "54y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" ""
"0000252150" "04214" "00333965" "00000" "Familial, autosomal recessive" "26y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" ""
"0000252883" "00198" "00335168" "00000" "Unknown" "" "0y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000252954" "04214" "00335239" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000253056" "04214" "00335342" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000253443" "04214" "00335498" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000253538" "04214" "00335593" "00008" "Isolated (sporadic)" "15y" "" "1y5m" "" "" "" "" "" "" "" "" "isolated retinitis pigmentosa (IRP)" ""
"0000253539" "04214" "00335594" "00008" "Isolated (sporadic)" "32y" "" "<20y" "" "" "" "" "" "" "" "" "isolated retinitis pigmentosa (IRP)" ""
"0000254173" "04214" "00358913" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000254174" "04214" "00358914" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000254175" "04214" "00358915" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000254176" "04214" "00358916" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000254229" "04214" "00358930" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, DD, Leber congenital amaurosis" ""
"0000254249" "04214" "00358951" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "macular dystrophy" ""
"0000254252" "04214" "00358954" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254265" "04214" "00358967" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254268" "04214" "00358970" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000254343" "04214" "00359046" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000254356" "04214" "00359059" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254365" "04214" "00359068" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254368" "04214" "00359071" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254370" "04214" "00359073" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254388" "04214" "00359091" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254392" "04214" "00359095" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254395" "04214" "00359098" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" ""
"0000254619" "04214" "00359323" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000257563" "04214" "00362149" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000257564" "04214" "00362150" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000257644" "04214" "00362230" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000258297" "04214" "00362931" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000258834" "04214" "00363473" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258953" "04214" "00363603" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000258984" "04214" "00363634" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "cone rod dystrophy" ""
"0000258993" "04214" "00363643" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000258999" "04214" "00363649" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000259021" "04214" "00363671" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "cone rod dystrophy" ""
"0000259062" "04214" "00363712" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000259087" "04214" "00363737" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267731" "04214" "00372416" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267762" "04214" "00372447" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267763" "04214" "00372448" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267764" "04214" "00372449" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267765" "04214" "00372450" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267766" "04214" "00372451" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267767" "04214" "00372452" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267768" "04214" "00372453" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267769" "04214" "00372454" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000267806" "04214" "00372491" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000268624" "04214" "00373343" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000268684" "04214" "00373408" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000268685" "04214" "00373409" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000268740" "04214" "00373464" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone dystrophy" ""
"0000269101" "04214" "00373892" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270627" "04214" "00375413" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270642" "04214" "00375428" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000270655" "04214" "00375441" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000270670" "04214" "00375456" "00000" "Familial, autosomal recessive" "10y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270671" "04214" "00375457" "00000" "Familial, autosomal recessive" "5y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270672" "04214" "00375458" "00000" "Familial, autosomal recessive" "10y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270673" "04214" "00375459" "00000" "Familial, autosomal recessive" "7y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270675" "04214" "00375461" "00000" "Familial, autosomal recessive" "7y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270678" "04214" "00375464" "00000" "Familial, autosomal recessive" "4y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270679" "04214" "00375465" "00000" "Familial, autosomal recessive" "6y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270681" "04214" "00375467" "00000" "Familial, autosomal recessive" "3y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270682" "04214" "00375468" "00000" "Familial, autosomal recessive" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270683" "04214" "00375469" "00000" "Familial, autosomal recessive" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270684" "04214" "00375470" "00000" "Familial, autosomal recessive" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270686" "04214" "00375472" "00000" "Familial, autosomal recessive" "7y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270687" "04214" "00375473" "00000" "Familial, autosomal recessive" "2y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000270688" "04214" "00375474" "00000" "Familial, autosomal dominant" "1y" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000271493" "04214" "00376285" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271494" "04214" "00376286" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271678" "04214" "00376471" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271679" "04214" "00376472" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271682" "04214" "00376475" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271683" "04214" "00376476" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271684" "04214" "00376477" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271685" "04214" "00376478" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000271920" "04214" "00376709" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000271921" "04214" "00376710" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000271922" "04214" "00376711" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000271923" "04214" "00376712" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000271924" "04214" "00376713" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000271925" "04214" "00376714" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271931" "04214" "00376720" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271932" "04214" "00376721" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271933" "04214" "00376722" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271939" "04214" "00376728" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271940" "04214" "00376729" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271941" "04214" "00376730" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271942" "04214" "00376731" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271943" "04214" "00376732" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000271964" "04214" "00376753" "00000" "Familial, autosomal recessive" "48y" "" "" "" "" "" "" "" "" "" "" "Decreased peripheral vision, photophobia, difficult light-to-dark adaptation, night blindness" ""
"0000271977" "04214" "00376766" "00000" "Familial, autosomal recessive" "17y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000271981" "04214" "00376770" "00000" "Familial, autosomal recessive" "11y" "" "" "" "" "" "" "" "" "" "" "Peripheral dystrophy" ""
"0000272000" "04214" "00376789" "00000" "Unknown" "38y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000272075" "04214" "00376864" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000272220" "04214" "00377029" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000272221" "04214" "00377030" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000272222" "04214" "00377031" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000272223" "04214" "00377032" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000272663" "04214" "00377513" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "LCA" "retinal disease" ""
"0000272665" "04214" "00377515" "04521" "Familial, autosomal recessive" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "LCA6" "retinal disease" ""
"0000272666" "04214" "00377516" "04521" "Familial, autosomal recessive" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "LCA6" "retinal disease" ""
"0000272667" "04214" "00377517" "04521" "Familial, autosomal recessive" "" "see paper; see paper, Leber congenital amaurosis" "" "" "" "" "" "" "" "" "LCA6" "retinal disease" ""
"0000272671" "04214" "00377521" "04521" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000272672" "04214" "00377522" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000272681" "04214" "00377531" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000272682" "04214" "00377532" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "LCA" "retinal disease" ""
"0000272683" "04214" "00377533" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000272685" "04214" "00377535" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000272688" "04214" "00377538" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000272689" "04214" "00377539" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000272694" "04214" "00377544" "00000" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" ""
"0000273027" "04214" "00377881" "00000" "-" "2y" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273028" "04214" "00377882" "00000" "Isolated (sporadic)" "7m" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273029" "04214" "00377883" "00000" "Isolated (sporadic)" "11m" "" "4m" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273038" "04214" "00377892" "00000" "Isolated (sporadic)" "1y5m" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273039" "04214" "00377893" "00000" "Isolated (sporadic)" "3y7m" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273040" "04214" "00377894" "00000" "Isolated (sporadic)" "28y" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273056" "04214" "00377910" "00000" "Isolated (sporadic)" "1y6m" "poor vision; roving nystagmus" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000273103" "04214" "00377957" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone Distrophy" ""
"0000273608" "04210" "00379754" "03508" "Familial, autosomal recessive" "" "HP:0001133,\tHP:0000639,\tHP:0001483,\tHP:0001141,\tHP:0000510" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274169" "04214" "00380318" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000274882" "04214" "00381031" "00000" "Isolated (sporadic)" "4m" "poor vision, oculodigital sign" "6m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274883" "04214" "00381032" "00000" "Familial, autosomal recessive" "<1y" "poor vision, roving nystagmus" "7y6m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274890" "04214" "00381039" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274897" "04214" "00381046" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274898" "04214" "00381047" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000274935" "04214" "00381084" "00000" "Familial" "43y" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000275002" "04214" "00381151" "00000" "Unknown" "" "" "3y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275016" "04214" "00381165" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy with nystagmus" ""
"0000275022" "04214" "00381171" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000275023" "04214" "00381172" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000275066" "04214" "00381215" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000275067" "04214" "00381216" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000275457" "04214" "00381615" "00000" "Familial, autosomal recessive" "" "" "9y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275468" "04214" "00381626" "00000" "Familial, autosomal recessive" "" "" "6y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275469" "04214" "00381627" "00000" "Isolated (sporadic)" "" "" "26y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" ""
"0000275482" "04214" "00381640" "00000" "Familial, autosomal recessive" "" "" "11y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275488" "04214" "00381646" "00000" "Familial, autosomal recessive" "" "" "1y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275489" "04214" "00381647" "00000" "Familial, autosomal dominant" "" "" "31y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" ""
"0000275498" "04214" "00381656" "00000" "Familial, autosomal recessive" "" "" "6y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275500" "04214" "00381658" "00000" "Familial, autosomal recessive" "" "" "6y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275502" "04214" "00381660" "00000" "Familial, autosomal dominant" "" "" "55y" "" "" "" "" "" "" "" "" "Autosomal dominant RP, adRP" ""
"0000275504" "04214" "00381662" "00000" "Familial, autosomal recessive" "" "" "2y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000275731" "04214" "00381889" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000275787" "04214" "00381945" "00000" "Familial, autosomal recessive" "26y" "BCVA OD-OS:light perception; nystagmus; strabismus" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000275788" "04214" "00381946" "00000" "Familial, autosomal recessive" "36y" "BCVA OD-OS:hand movement; nystagmus; strabismus" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000275789" "04214" "00381947" "00000" "Familial, autosomal recessive" "47y" "BCVA OD-OS:light perception; nystagmus; strabismus; cataract" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000275790" "04214" "00381948" "00000" "Familial, autosomal recessive" "17y" "BCVA OD-OS:1/10-1/10; nystagmus; strabismus" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000276451" "04214" "00382602" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000276658" "04214" "00382802" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000277171" "05165" "00383386" "00000" "Familial, autosomal dominant" "3m" "Not determined Irregular spot-like cataract in the middle of the lens" "" "" "" "" "" "" "" "" "" "congenital cataract" ""
"0000277700" "04214" "00383915" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277734" "04214" "00383949" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277828" "04214" "00384043" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277970" "04214" "00384185" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy, Leber congenital amaurosis" ""
"0000277971" "04214" "00384186" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy, Leber congenital amaurosis" ""
"0000277972" "04214" "00384187" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy, Leber congenital amaurosis" ""
"0000278251" "04214" "00384466" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000278777" "04214" "00384993" "00000" "Familial, autosomal recessive" "4y" "photophobia, nystagmus, best corrected visual acuity right/left eye: NA" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278783" "04214" "00384999" "00000" "Isolated (sporadic)" "16y" "nyctalopia, nystagmus, best corrected visual acuity right/left eye: LP/LP" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278802" "04214" "00385018" "00000" "Isolated (sporadic)" "26y" "no nyctalopia/photophobia, nystagmus, ERG extinguished, best corrected visual acuity right/left eye: HM/HM" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278811" "04214" "00385027" "00000" "Isolated (sporadic)" "24y" "nyctalopia, nystagmus, ERG severely declined, best corrected visual acuity right/left eye: 0.1/0.1" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278840" "04214" "00385056" "00000" "Isolated (sporadic)" "4y" "nyctalopia, nystagmus, oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: HM/HM" "3m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278864" "04214" "00385080" "00000" "Isolated (sporadic)" "2y" "no nyctalopia/photophobia, nystagmus, oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: NA" "6m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000278875" "04214" "00385091" "00000" "Isolated (sporadic)" "5y" "nyctalopia, nystagmus, oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.05/0.05" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000279407" "04214" "00385612" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" ""
"0000280094" "04214" "00386291" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000281768" "04214" "00388175" "00000" "Unknown" "4y4m" "Nystagmus: Infrequent UBJ, best corrected visual acuity right eye/left eye: 0.2/0.2, fundus: Pigmentary retinopathy, ERG: Extinguished" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000281769" "04214" "00388176" "00000" "Unknown" "3y5m" "Nystagmus: 2-3Hz RBJ bilateral symmetric, best corrected visual acuity right eye/left eye: 0.1/HM, fundus: Pigmentary retinopathy at periphery & Marbled fundus, ERG: Extinguished" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000281770" "04214" "00388177" "00000" "Unknown" "1y6m" "Nystagmus: 2-3Hz pendular horizontal and vertical, best corrected visual acuity right eye/left eye: CSM/CSM, fundus: Pigmentary change & Marbled fundus, ERG: Extinguished" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000281777" "04214" "00388184" "00000" "Unknown" "28y10m" "Nystagmus: 4-5Hz RBJ bilateral symmetric, best corrected visual acuity right eye/left eye: 0.1/0.1, fundus: Optic atrophy, ERG: Extinguished" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000282039" "04214" "00388487" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset retinal dystrophy or Leber congenital amaurosis (eoRD/LCA)" ""
"0000282541" "04214" "00389000" "00000" "Familial, autosomal recessive" "30y" "age at genetic diagnosis mentioned" "" "23y" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000282642" "04214" "00389101" "00000" "Familial, autosomal recessive" "18y" "age at genetic diagnosis mentioned" "" "16y" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000283286" "04214" "00389745" "00000" "Familial, autosomal recessive" "24y" "age at genetic diagnosis mentioned" "" "21y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283287" "04214" "00389746" "00000" "Familial, autosomal recessive" "38y" "age at genetic diagnosis mentioned" "" "34y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283288" "04214" "00389747" "00000" "Familial, autosomal recessive" "20y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283299" "04214" "00389758" "00000" "Familial, autosomal recessive" "13y" "age at genetic diagnosis mentioned" "" "10y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283300" "04214" "00389759" "00000" "Familial, autosomal recessive" "21y" "age at genetic diagnosis mentioned" "" "19y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283301" "04214" "00389760" "00000" "Familial, autosomal recessive" "31y" "age at genetic diagnosis mentioned" "" "28y" "" "" "" "" "" "" "cone dystrophy" "" ""
"0000283375" "04214" "00389834" "00000" "Familial, autosomal recessive" "57y" "age at genetic diagnosis mentioned" "" "56y" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000283938" "04214" "00390400" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283939" "04214" "00390401" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000284215" "04214" "00390727" "00000" "Familial, autosomal recessive" "30y" "Visual acuity right eye/left eye: light perception_light perception, vessel attenuation rpe mottling and spicule deposits from the midretina to the periphery, macula preserved, erg: extinct response" "0m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000284251" "04214" "00390763" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000284662" "04214" "00391221" "00000" "Familial, autosomal recessive" "37y" "horizontal nystagmus,photophobia; 1992 best corrected decimal visual acuity (BCVA) was 0.2 (S + 6.5/C-3.5/170deg) right and 0.1 (S + 6.0/C-2.5/10deg) left eye. Fundus examination revealed bisymmetrical inferior focal retinal pigment epithelium (RPE) mottling. bright-flash electroretinogram (ERG): subnormal pattern, 30 Hz flicker ERG: non-recordable in both eyes. at 37 BCVA was 0.09 both eyes" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000284663" "04214" "00391222" "00000" "Familial, autosomal recessive" "34y" "1992 BCVA was 0.05 right and 0.06 left eye, horizontal nystagmus, photophobia. Bright-flash ERG severely attenuated, 30 Hz flicker ERG was non-recordable in both eyes. At 34 years old BCVA was 0.02 right and 0.03 left eye" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" ""
"0000284788" "04214" "00391348" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis 6 (613826)" "Leber congenital amaurosis 6 (613826)" ""
"0000284922" "04214" "00391586" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000285025" "04214" "00391700" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/200;20/200" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285026" "04214" "00391701" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285027" "04214" "00391702" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285028" "04214" "00391703" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285029" "04214" "00391704" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285030" "04214" "00391705" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285031" "04214" "00391706" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285032" "04214" "00391707" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285033" "04214" "00391708" "00000" "Unknown" "" "best corrected visual acuity right/left eye: counting fingers" "4m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285034" "04214" "00391709" "00000" "Unknown" "" "best corrected visual acuity right/left eye: light perception" "4m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285035" "04214" "00391710" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285036" "04214" "00391711" "00000" "Unknown" "" "best corrected visual acuity right/left eye: hand movement" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285037" "04214" "00391712" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285038" "04214" "00391713" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "3m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285039" "04214" "00391714" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/150:20/150" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285040" "04214" "00391715" "00000" "Unknown" "" "best corrected visual acuity right/left eye: light perception" "6m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000285041" "04214" "00391716" "00000" "Unknown" "" "" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000286667" "04214" "00393461" "00000" "Familial, autosomal recessive" "16y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000286764" "04214" "00393558" "00000" "Isolated (sporadic)" "38y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000286901" "04214" "00393695" "00000" "Isolated (sporadic)" "7y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000288766" "04214" "00395568" "00000" "Familial, autosomal recessive" "" "early onset rod-cone dystrophy, abnormality of the optic nerve, exotropia, nystagmus, progressive external ophthalmoplegia, eeg abnormality, periventricular leukomalacia, attention deficit hyperactivity disorder, poor coordination, poor gross motor coordination, firm muscles" "" "" "" "" "" "" "" "" "Early onset retinitis pigmentosa, progressive external ophthalmoplegia, myoptic atrophythic aterations" "" ""
"0000289018" "04214" "00395856" "00000" "Unknown" "37y" "" "36y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000289376" "04214" "00396214" "00000" "Familial, autosomal recessive" "12y" "1 month: nystagmus,the oculo-digitalsign, absent pupillary responses" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000289377" "04214" "00396215" "00000" "Familial, autosomal recessive" "6y" "2 month: nystagmus, sluggish, then absent pupillary responses, no fixation" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000289391" "04214" "00396229" "00000" "Familial, autosomal recessive" "40y" "1 months: nystagmus and photophobia, sluggish pupillary responses" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" ""
"0000289633" "04214" "00396472" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" ""
"0000290712" "04214" "00397588" "00000" "Familial, autosomal recessive" "21y" "best-corrected visua acuity right/left eye: 20/80/20/100, refraction (spherical equivalent: 12.75/13.5, kinetic visual field extent (V-4e; percentage of normal mean of V-4e target; 2 SD below normal equals 90%): o1/o1" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000294765" "04214" "00402002" "00006" "Familial, autosomal recessive" "" "onset early childhood, keratoconus, posterior subcapsular cataract, asteroid hyalosis, reduced color vision" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294766" "04214" "00402003" "00006" "Familial, autosomal recessive" "" "onset early childhood, nystagmus, optic nerve atrophy, reduces color vision" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294767" "04214" "00402004" "00006" "Familial, autosomal recessive" "" "onset infancy, nystagmus, scatter hypopigmented spots in retinal periphery" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294768" "04214" "00402005" "00006" "Familial, autosomal recessive" "" "onset infancy, nystagmus, peripheral atrophy, pigmentary macular changes" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294769" "04214" "00402006" "00006" "Familial, autosomal recessive" "1y6m" "nystagmus, macular atrophy" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294770" "04214" "00402007" "00006" "Familial, autosomal recessive" "15y" "" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294771" "04214" "00402008" "00006" "Familial, autosomal recessive" "" "onset infancy, peripheral pigmentary changes, bull’s eye macular changes" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294772" "04214" "00402009" "00006" "Familial, autosomal recessive" "4m" "nystagmus" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000294773" "04214" "00402010" "00006" "Familial, autosomal recessive" "" "onset infancy, nystagmus" "" "" "" "" "" "" "" "" "" "retinal degeneration" ""
"0000295073" "04214" "00402311" "00006" "Familial, autosomal recessive" "04y" "see paper; ..." "" "" "" "" "" "" "" "" "LCA6" "retinal degeneration" ""
"0000295076" "04214" "00402314" "00006" "Familial, autosomal recessive" "08y" "see paper; ..." "02y" "" "" "" "" "" "" "" "LCA6" "retinal degeneration" ""
"0000295078" "04214" "00402316" "00006" "Familial, autosomal recessive" "44y" "see paper; ..." "" "" "" "" "" "" "" "" "LCA6" "retinal degeneration" ""
"0000295081" "04214" "00402319" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295082" "04214" "00402320" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295083" "04214" "00402321" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295084" "04214" "00402322" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295085" "04214" "00402323" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295086" "04214" "00402324" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295087" "04214" "00402325" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295088" "04214" "00402326" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295089" "04214" "00402327" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295090" "04214" "00402328" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295091" "04214" "00402329" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295092" "04214" "00402330" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295093" "04214" "00402331" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295094" "04214" "00402332" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295095" "04214" "00402333" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295096" "04214" "00402334" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295097" "04214" "00402335" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295098" "04214" "00402336" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295099" "04214" "00402337" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000295100" "04214" "00402338" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295101" "04214" "00402339" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000295102" "04214" "00402340" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000298871" "04214" "00406384" "00000" "Familial, autosomal dominant" "" "best corrected visual acuity: N/A, non-recordable electroretinogram, nystagmus, keratoconus in early teens, hyperopia (+7.50 spherical equivalent), retinitis pigmentosa-like retinal dystrophy" "<3m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000298893" "04214" "00406406" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000298894" "04214" "00406407" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000299068" "04214" "00406593" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "early-onset rod-cone dystrophy" "" ""
"0000299069" "04214" "00406594" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300273" "04214" "00408144" "00000" "Familial, autosomal recessive" "" "nystagmus and vision limited to light perception since early childhood;26y fundus: moderate vascular attenuation and no intraretinal bone-spicule pigmentary deposits" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300274" "04214" "00408145" "00000" "Familial, autosomal recessive" "15y" "poor vision since early childhood; 15y: nystagmus and vision limited to light perception; hyperopia with a spherical equivalent of +2.6 averaged between the two eyes; fundus: vascular attenuation and bone-spicule pigmentary deposits circumferentially in the midperipheral retina both eyes; 15y a nondetectable full-field electroretinogram; 30-Hz white flicker: greatly reduced amplitudes" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300275" "04214" "00408146" "00000" "Familial, autosomal recessive" "2y" "nystagmus; hyperopia, with a spherical equivalent of +6.9 averaged between the two eyes; able to follow objects with her eyes only in a well-illuminated environment; fundi were close to normal" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300276" "04214" "00408147" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300279" "04214" "00408150" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300280" "04214" "00408151" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300281" "04214" "00408152" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300282" "04214" "00408153" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300283" "04214" "00408154" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300284" "04214" "00408155" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300285" "04214" "00408156" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300286" "04214" "00408157" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300287" "04214" "00408158" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300288" "04214" "00408159" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300295" "04214" "00408166" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300296" "04214" "00408167" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300297" "04214" "00408168" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300298" "04214" "00408169" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300299" "04214" "00408170" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300300" "04214" "00408171" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300301" "04214" "00408172" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300302" "04214" "00408173" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300303" "04214" "00408174" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300304" "04214" "00408175" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300305" "04214" "00408176" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300306" "04214" "00408177" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300307" "04214" "00408178" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300308" "04214" "00408179" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300309" "04214" "00408180" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300310" "04214" "00408181" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000300311" "04214" "00408182" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "nephronophthisis or Leber congenital amaurosis" "" ""
"0000300312" "04214" "00408183" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "nephronophthisis or Leber congenital amaurosis" "" ""
"0000300313" "04214" "00408184" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "nephronophthisis or Leber congenital amaurosis" "" ""
"0000300314" "04214" "00408185" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "nephronophthisis or Leber congenital amaurosis" "" ""
"0000300315" "04214" "00408186" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "nephronophthisis or Leber congenital amaurosis" "" ""
"0000300317" "04214" "00408188" "00000" "Familial, autosomal recessive" "19y" "reduced visual acuity, night blindness, peripheral vision loss from childhood; best-corrected visual acuity: 20/100 both eyes (refraction: +2.00-1.00x90); horizontal nystagmus; no corneal or lenticular abnormalities; funduscopy: attenuated retinal vessels, waxy-appearing optic nerve heads, and peripheral pigmentary disturbance without clumps or bone spicule-like changes; kinetic visual field: limited to a central island only; full-field electroretinogram: no detectable responses; normal thickness in the fovea; thinning in the parafoveal and perifoveal areas extending to the vessel arcades; further toward the periphery, retinal thickness again became normal; nerve fiber layer thickness in an annular region surrounding the optic nerve: within normal limits (data not shown). The central retina was examined in detail for laminar structure and visual sensitivity; retinal lamination was present in the patient scan, but the outer nuclear layer appeared thin with eccentricity from the fovea; measured outer nuclear layer thickness declined from normal to unmeasurable in this central retinal region; dark-adapted chromatic sensitivity measurements in the same retinal region: more than 3 log units of rod sensitivity loss eccentric to the fovea; cone sensitivity: subnormal at the foveal locus, markedly reduced outside the fovea; lamination was less distinct beyond the central retina; thinned and nearly bilaminar appearance at more than 3 mm eccentric from the fovea; longitudinal reflectivity profiles at intervals along the scan highlight the change from identifiable lamination in the outer retina to loss thereof, the same pattern in the vertical cross sections, except increased thickness between 4 and 6 mm of eccentricity in the region of the vascular arcades; select longitudinal reflectivity profiles at a superior perifoveal locus (1.7 mm) and at the peripheral edge of the macular region (2.9 mm) were compared between a healthy person and the patient - laminar architecture was discernible at the perifoveal locus in the patient, but the outer nuclear layer was thinned and the outer retinal choroidal complex showed loss of the reflective peak that is thought to originate at or near the junction of photoreceptor inner and outer segments; further eccentric, the patient longitudinal reflectivity profile differed grossly from normal; mainly a hyperreflective inner retinal signal, a deeper hyporeflective retinal signal, and the single-peaked outer retinal choroidal complex" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300320" "04214" "00408190" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300321" "04214" "00408191" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300322" "04214" "00408192" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300330" "04214" "00408200" "00000" "Unknown" "44y" "maximal intraocular pressure (mm Hg) right/left eye: 25/26; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300331" "04214" "00408201" "00000" "Unknown" "60y" "maximal intraocular pressure (mm Hg) right/left eye: 21/21; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300332" "04214" "00408202" "00000" "Unknown" "65y" "maximal intraocular pressure (mm Hg) right/left eye: 30/30; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): IV/V; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300333" "04214" "00408203" "00000" "Unknown" "72y" "maximal intraocular pressure (mm Hg) right/left eye: 40/40; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): IV/IV; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300334" "04214" "00408204" "00000" "Unknown" "73y" "maximal intraocular pressure (mm Hg) right/left eye: 27/27; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): I/III; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300335" "04214" "00408205" "00000" "Unknown" "50y" "maximal intraocular pressure (mm Hg) right/left eye: 26/27; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300336" "04214" "00408206" "00000" "Unknown" "70y" "maximal intraocular pressure (mm Hg) right/left eye: 31/no data; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): III/no data; optic disk area (mm2) right/left eye: 2.6" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300337" "04214" "00408207" "00000" "Unknown" "44y" "maximal intraocular pressure (mm Hg) right/left eye: 21/21; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300338" "04214" "00408208" "00000" "Unknown" "58y" "maximal intraocular pressure (mm Hg) right/left eye: 20/20; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300339" "04214" "00408209" "00000" "Unknown" "63y" "maximal intraocular pressure (mm Hg) right/left eye: 26/26; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300340" "04214" "00408210" "00000" "Unknown" "69y" "maximal intraocular pressure (mm Hg) right/left eye: 21/24; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): III/IV; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300341" "04214" "00408211" "00000" "Unknown" "53y" "maximal intraocular pressure (mm Hg) right/left eye: 26/26; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300342" "04214" "00408212" "00000" "Unknown" "49y" "maximal intraocular pressure (mm Hg) right/left eye: 38/38; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): I/I; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300343" "04214" "00408213" "00000" "Unknown" "25y" "maximal intraocular pressure (mm Hg) right/left eye: 22/36; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): 0/4; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "juvenile open-angle glaucoma" "" ""
"0000300344" "04214" "00408214" "00000" "Unknown" "43y" "maximal intraocular pressure (mm Hg) right/left eye: 24/24; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300345" "04214" "00408215" "00000" "Unknown" "44y" "maximal intraocular pressure (mm Hg) right/left eye: 26/26; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): III/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300346" "04214" "00408216" "00000" "Unknown" "24y" "maximal intraocular pressure (mm Hg) right/left eye: 35/35; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): I/I; optic disk area (mm2) right/left ey" "" "" "" "" "" "" "" "" "juvenile open-angle glaucoma" "" ""
"0000300347" "04214" "00408217" "00000" "Unknown" "68y" "maximal intraocular pressure (mm Hg) right/left eye: 21/21; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/I; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300348" "04214" "00408218" "00000" "Unknown" "81y" "maximal intraocular pressure (mm Hg) right/left eye: no data; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300349" "04214" "00408219" "00000" "Unknown" "69y" "maximal intraocular pressure (mm Hg) right/left eye: 28/28; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): II/II; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300350" "04214" "00408220" "00000" "Unknown" "49y" "maximal intraocular pressure (mm Hg) right/left eye: no data; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300351" "04214" "00408221" "00000" "Unknown" "66y" "maximal intraocular pressure (mm Hg) right/left eye: 20/20; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): no data; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300352" "04214" "00408222" "00000" "Unknown" "67y" "maximal intraocular pressure (mm Hg) right/left eye: no data; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): V/III; optic disk area (mm2) right/left eye: 2" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300353" "04214" "00408223" "00000" "Unknown" "20y" "maximal intraocular pressure (mm Hg) right/left eye: 24/20; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): IV/IV; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "juvenile open-angle glaucoma" "" ""
"0000300354" "04214" "00408224" "00000" "Unknown" "41y" "maximal intraocular pressure (mm Hg) right/left eye: 20/22; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): I/I; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300355" "04214" "00408225" "00000" "Unknown" "53y" "maximal intraocular pressure (mm Hg) right/left eye: 30/32; grade of optic disk atrophy according to Jonas ano data Papastathopoulos (normal 0, moderate cupping I, notching of the neuroretinal rim II/III, temporal neuroretinal rim loss IV, complete atrophy V): I/I; optic disk area (mm2) right/left eye:" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300356" "04214" "00408226" "00000" "Unknown" "50y" "maximal intraocular pressure (mm Hg) right/left eye: 10/10; visual field (Aulhorn): 0/0; optic disk area (mm2) right/left eye: 2.4/2.4" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300357" "04214" "00408227" "00000" "Unknown" "65y" "maximal intraocular pressure (mm Hg) right/left eye: 17/16; visual field (Aulhorn): 0/I; optic disk area (mm2) right/left eye: no data" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300358" "04214" "00408228" "00000" "Unknown" "59y" "maximal intraocular pressure (mm Hg) right/left eye: 26/26; visual field (Aulhorn): II/0; optic disk area (mm2) right/left eye: no data" "" "" "" "" "" "" "" "" "primary open-angle glaucoma" "" ""
"0000300359" "04214" "00408229" "00000" "Unknown" "29y" "maximal intraocular pressure (mm Hg) right/left eye: 23/23; visual field (Aulhorn): I/0; optic disk area (mm2) right/left eye: 0.7/0.7" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300360" "04214" "00408230" "00000" "Unknown" "78y" "maximal intraocular pressure (mm Hg) right/left eye: 19/18; visual field (Aulhorn): I/I; optic disk area (mm2) right/left eye: 0.7/0.7" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300361" "04214" "00408231" "00000" "Unknown" "67y" "maximal intraocular pressure (mm Hg) right/left eye: 18/19; visual field (Aulhorn): III/0; optic disk area (mm2) right/left eye: 2.4/2.1" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300362" "04214" "00408232" "00000" "Unknown" "88y" "maximal intraocular pressure (mm Hg) right/left eye: 15/16; visual field (Aulhorn): no data; optic disk area (mm2) right/left eye: 1.9/1.7" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300363" "04214" "00408233" "00000" "Unknown" "83y" "maximal intraocular pressure (mm Hg) right/left eye: 20/18; visual field (Aulhorn): I/II; optic disk area (mm2) right/left eye: 2.6/2.6" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300364" "04214" "00408234" "00000" "Unknown" "37y" "maximal intraocular pressure (mm Hg) right/left eye: 16/16; visual field (Aulhorn): no data; optic disk area (mm2) right/left eye: 0.5/0.3" "" "" "" "" "" "" "" "" "normal tension glaucoma" "" ""
"0000300391" "04214" "00408263" "00000" "Familial, autosomal recessive" "10y" "marked photophobia, horizontal pendular nystagmus, light perception vision, sluggish pupillary reaction, oculo-digital behavior; anterior segment: normal; ophthalmoscopy: irregular shaped, yellowish white small lesions in the mid-periphery temporally at the level of the retinal pigment epithelium spearing the maculae and similar ones nasally occupying the posterior pole and extending into the mid-periphery; the latter were not noticeable two years prior; mild pallor of the optic nerve heads, mild narrowing of the retinal arterioles, and dull macular reflexes; cycloplegic retinoscopy: hypermetropia with astigmatism of +2.50/+2.75 90 right eye and +2.00/+3.00 100 left eye; electroretinogram: flat; optical coherence tomography: normal thickness in the fovea, thinning in the parafoveal area, and thickness that becomes normal again toward the retinal periphery; the child is attending a special school and learning Braille" "6m" "" "very little visual responses, nystagmus, photophobia" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300392" "04214" "00408264" "00000" "Familial, autosomal recessive" "8y" "best-corrected visual acuity right/left eye: 0.3 / 0.2; refractive error: +4.50/+1.50 90 right eye,+4.50/ +1.50 80 left eye; tinted lenses usage due to photophobia; anterior segment: normal; ophthalmoscopy: fine pigment disturbance in the posterior pole, with mild pallor of optic nerve heads and mild arteriolar attenuation; electroretinogram: flat photopic conditions; optical coherence tomography: normal" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300393" "04214" "00408265" "00000" "Familial, autosomal recessive" "11y" "4y: pendular eccentric nystagmus; slit-lamp biomicroscopy: normal; no abnormal findings on fundus photographs; best-corrected visual acuity: 0.06 (uncorrected) right eye and 0.06 (+3.50/-4.50/ 175 deg) left eye; refraction: S: -0.25D C: -6.25D Ax: 6 deg right eye, S: +3.5 C: -4.75 Ax: 174 deg left eye; 9y: Goldmann perimetry: low sensitivity within the III4e and V4e isopters both eyes; 5y: full field electroretinograms after 20 min of dark adaptation amplitudes of a-waves: right eye: 220 lV, left eye: 176 lV, (normal control: 415.55 ± 68.18 lV); b-waves (right eye: 272 lV, left eye: 232 lV, normal control 516.62 ± 88.32 lV); light-adapted electroretinogram (30 Hz flicker): not detectable; 11y: spectral-domain optical coherence tomography: thinning of the outer nuclear layer (22 lm,) and discontinuous inner segment/outer segment line; a remarkable change of retinal pigment epithelium not detectable; 11y: day blindness, but no night blindnes" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300394" "04214" "00408266" "00000" "Familial, autosomal recessive" "7y" "11m: nystagmus and visual impairment since 6 months after birth; eyes orthophoric in the primary position; pendular eccentric nystagmus; 2y: slit-lamp biomicroscopy: normal; no abnormal findings on fundus photographs; visual acuity: 2.4 cpd/55 cm both eyes measured with Teller Acuity Cards; . refraction: S: +5.25 C: -2.75 Ax: 17 deg right eye, S: +4.75 C: -1.75 Ax: 178deg left eye; 3y: Goldmann perimetry: low sensitivity within the III4e and V4e isopters both eyes" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300395" "04214" "00408267" "00000" "Familial, autosomal recessive" "7y" "fixation: poor; oculodigital reflex: no; eye movements: nystagmus; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre): 3." "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300396" "04214" "00408268" "00000" "Familial, autosomal recessive" "4y" "fixation: poor; oculodigital reflex: no; eye movements: nystagmus; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre):" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300397" "04214" "00408269" "00000" "Familial, autosomal recessive" "5y" "fixation: none; oculodigital reflex: yes; eye movements: wandering; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre): 3; other" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300398" "04214" "00408270" "00000" "Familial, autosomal recessive" "2y" "fixation: none; oculodigital reflex: yes; eye movements: wandering; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre):" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300399" "04214" "00408271" "00000" "Familial, autosomal recessive" "6y" "fixation: poor; oculodigital reflex: no; eye movements: nystagmus; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre): 7; other" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300400" "04214" "00408272" "00000" "Familial, autosomal recessive" "3y" "fixation: none; oculodigital reflex: yes; eye movements: wandering; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre): 8; other" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300401" "04214" "00408273" "00000" "Familial, autosomal recessive" "3y" "fixation: poor; oculodigital reflex: yes; eye movements: nystagmus; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre): 7; other" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300402" "04214" "00408274" "00000" "Familial, autosomal recessive" "2y" "fixation: none; oculodigital reflex: yes; eye movements: wandering; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre):" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300403" "04214" "00408275" "00000" "Familial, autosomal recessive" "2y" "fixation: none; oculodigital reflex: yes; eye movements: wandering; cycloplaegic retinoscopy spherical equivalent (astigmatism: ≤1.5 dioptre):" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300404" "04214" "00408276" "00000" "Familial, autosomal recessive" "4y" "severe visual impairment of their child during infancy; retardation of the neuropsychological development; brain computer tomography: mild cortical atrophy; ophthalmic examination: no fixation, visual acuity could not be measured; fundus: disc pallor, moderately attenuated vessels; fundography and fluorescein angiography: disc pallor, attenuated retinal vessels, attenuated macular reflex and pigment epithelium mottling in the mid-periphery; electroretinogram: photopic, flickers and scotopic recordings unresponsive; visual evoked potentials: marked dysfunction" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300405" "04214" "00408277" "00000" "Familial, autosomal recessive" "30y" "early-onset bilateral blurred vision in childhood (visual acuity: 20/25), nystagmus and night blindness ~ 23y; gradually decreasing vision and loss of peripheral visual fields; 30y - best-corrected visual acuity and refraction right; left eye: 20/133, -2.25; 20/200, -2.00. fundus: waxy disc, obviously attenuated retinal vesels; no significant pigmentary changes of salt and pepper or bone corpuscle type in the left eye; a few patchy pigmentary changes inferior in the periphery retina; center 30deg visual field examination: tubular vision with little center visual island left; time-dominant optical coherence tomography: significant thinner outer retina, especially in the left eye; fundus fluorescence angiography: significant delay in the arm-retina circulation time from 10~15sec to 17sec of the left eye, which exhibited considerable attenuation of the retinal arterioles. Absent peripheral background fluorescence - choriocapillaris atrophied; patchy blocked fluorescence in the corresponding pigmentary area in the inferior periphery retina of the right eye; normal structure of macular arch absent, full-field electroretinography: no detectable rod responses to single flashes of blue light and cone responses to the 30 Hz flicker that were reduced 99% and delayed" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000300406" "04214" "00408278" "00000" "Familial, autosomal recessive" "22y" "progressive vision weakness for 20+ years; 8m: nystagmus; gradual loss of visual acuity and night blindness; in the last 6 years, visual field showed losses of peripheral vision, 21y tunnel vision; best-corrected visual acuity: 12/400 both eyes; fundus: attenuated retina vascular with absent pigmentary changes; electroretinogram: extinguished waveform," "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000300407" "04214" "00408279" "00000" "Familial, autosomal recessive" "36y" "severe visual impairment and nystagmus; 36y: best-corrected visual acuity: hand motion; fundus: narrowed arterioles and tortuous veins; bone corpuscle types pigmentary in the periphery retina; scotopic electroretinogram (rod response) after 30min dark adaptation: extinguished; only three waves of oscillatory potential electroretinogram were recorded, their amplitudes were severe declined; cone system affected with slightly delayed b-wave implicit time; absence of normal electroretinogram response to a 30Hz flickering light; fundus fluorescence angiography: the edges of optic disks were vague, illumination of periphery scattered transmitted fluorescences was gradually increasing, patchy blocked fluorescence existed in the periphery area, vessels obstruction induced massive periphery nonperfusion area" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300410" "04214" "00408283" "00000" "Familial, autosomal recessive" "14y" "posterior subcapsular cataract; typical macular atrophy and high myopia, tunnel vision, decreased night vision and loss of peripheral vision; night blindness, decreased central vision, visual acuity and especially the presence of fundus flecks in the posterior pole of the retina; fundus autofluorescence: \'salt and pepper\' pigment mottling pattern, severe retinal pigment epithelium atrophic changes, replacement of normal darkened colour with a central reddish colour, and close mottling and transparency of the macula; dark choroid with staining of white fundus flecks confirmed by optical coherence tomography and electroretinography: loss of the outer retinal architecture, foveal atrophy and loss of normal foveal configuration of the left eye, which was extremely apparent in the macula; abnormality in the retinal layers with cube volume of 8.9 mm3 and cube average thickness of 248 lm (age-matched control 9.5 mm3 and 264 lm)" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300411" "04214" "00408284" "00000" "Familial, autosomal recessive" "" "tunnel vision, decreased night vision and loss of peripheral vision; best-corrected visual acuities of the left and right eyes of both siblings ranged between 20/100 and 20/30, respectively" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300413" "04214" "00408286" "00000" "Familial, autosomal recessive" "0d" "fetus from terminated pregnancy: autopsy: externally, midline depression in the cranium extending onto the forehead, acircular defect in the occipital region of the cranium; significant hypertelorism; the nose well formed, both lateral maxillary processes not fused; nasal process not well developed, resulting in a large median upperlip cleft; cleft palate and micrognathia abdomen distended, anal opening could not be visualized; all limbs: postaxial polydactyly, both lower limbs were internally angulated in addition to bilateral congenital talipes equinovarus; enlarged and polycystic kidneys; friable liver; thin sigmoid colon" "" "" "" "" "" "" "" "" "Meckel-Gruber syndrome and Leber congenital amaurosis" "" ""
"0000300528" "04214" "00408412" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000300529" "04214" "00408413" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" ""
"0000307065" "04214" "00415267" "00000" "Familial, autosomal recessive" "" "OMIM: 613826; poor vision and dysmorphic features" "" "" "" "" "" "" "" "" "Leber congential amaurosis-6" "" ""
"0000311771" "04214" "00420523" "00000" "Familial, autosomal recessive" "37y" "" "36y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" ""
"0000318080" "04214" "00426942" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "rod-cone dystrophy" ""
"0000318084" "04214" "00426946" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "Stargardt disease" ""
"0000320453" "00112" "00429581" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320470" "00112" "00429598" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320564" "04210" "00429692" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320666" "00112" "00429794" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320725" "04210" "00429853" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320818" "04214" "00429946" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320835" "04210" "00429963" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320858" "04210" "00429986" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320933" "04210" "00430061" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000321000" "00112" "00430128" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000325414" "03450" "00435214" "04521" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000325416" "03450" "00435216" "04521" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000331082" "04210" "00441667" "04542" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000333563" "04214" "00444310" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis," ""
"0000336400" "00198" "00447201" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "eye diseaes" ""
"0000336522" "00198" "00447323" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" ""
"0000336732" "00198" "00447533" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000339047" "04214" "00449987" "02230" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "LCA6" "retinal disease" ""
"0000339049" "04210" "00449989" "00006" "Familial, autosomal recessive" "27y" "nystagmus; oculo-digitals signs; no photophobia; refraction +2.5LRE (27y); visual acuity reduced to light perception; fundus salt and pepper aspect; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339050" "04210" "00449990" "00006" "Familial, autosomal recessive" "2y" "nystagmus; oculo-digitals signs; no photophobia; refraction +7.5LRE (2y); visual acuity reduced to light perception; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339051" "04210" "00449991" "00006" "Familial, autosomal recessive" "6m" "nystagmus; no oculo-digitals signs; no photophobia; refraction +6.25RE, refraction +4.75LE (0.5y); visual acuity reduced to hand movement; fundus reduced calibers vessels; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339052" "04210" "00449992" "00006" "Familial, autosomal recessive" "6y" "nystagmus; oculo-digitals signs; photophobia; refraction +4LRE (6y); visual acuity reduced to light perception; fundus salt and pepper aspect; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339053" "04210" "00449993" "00006" "Familial, autosomal recessive" "39y" "nystagmus; oculo-digitals signs; no photophobia; refraction +1LRE (39y); visual acuity reduced to light perception; fundus reduced calibers vessels, salt and pepper aspect; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339054" "04210" "00449994" "00006" "Familial, autosomal recessive" "" "ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "LCA6" "Leber congenital amaurosis" ""
"0000339055" "04210" "00449995" "00006" "Unknown" "" "nystagmus; oculo-digitals signs; visual acuity 20/500 LRE ; fundus reduced calibers vessels; ERG undetectable; transmission of hearing loss and mild intellectual deficiency" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000339056" "04210" "00449996" "00006" "Unknown" "14y" "nystagmus; oculo-digitals signs; no photophobia; refraction +10LRE (14y); visual acuity 20/125LRE; fundus salt and pepper aspect; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000339057" "04210" "00449997" "00006" "Unknown" "3y" "nystagmus; oculo-digitals signs; photophobia; refraction +4LRE (3y); 20/50LE20/40RE; fundus salt and pepper aspect; ERG undetectable; no extraocular features" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000339496" "03450" "00450435" "04695" "Familial, autosomal recessive" "" "nystagmus" "" "08y" "" "" "" "" "" "" "LCA6" "" ""
"0000340063" "04249" "00451008" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000348582" "04214" "00461082" "00006" "Familial, autosomal recessive" "" "" "4y" "" "" "" "" "" "" "" "" "retinitis punctata albescens" ""
## Screenings ## Do not remove or alter this header ##
## Count = 480
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000000226" "00000223" "1" "00041" "00041" "2012-10-28 22:30:45" "" "" "SEQ" "DNA" "" ""
"0000016563" "00016610" "1" "00552" "00552" "2014-05-23 13:38:12" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033224" "00033156" "1" "00229" "00229" "2012-02-04 14:28:42" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" ""
"0000033420" "00033352" "1" "00039" "00039" "2012-09-18 14:09:52" "" "" "SEQ" "DNA" "" ""
"0000033421" "00033353" "1" "00039" "00039" "2012-09-18 14:12:07" "" "" "SEQ" "DNA" "" ""
"0000033422" "00033354" "1" "00039" "00039" "2012-09-18 14:15:36" "" "" "SEQ" "DNA" "" ""
"0000033423" "00033355" "1" "00039" "00039" "2012-09-19 08:59:08" "" "" "SEQ" "DNA" "" ""
"0000033424" "00033356" "1" "00039" "00039" "2012-09-19 09:01:23" "" "" "SEQ" "DNA" "" ""
"0000033425" "00033357" "1" "00039" "00039" "2012-09-19 09:03:54" "" "" "SEQ" "DNA" "" ""
"0000033429" "00033361" "1" "00039" "00039" "2012-09-19 09:19:44" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033430" "00033362" "1" "00039" "00039" "2012-09-19 09:22:00" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033431" "00033363" "1" "00039" "00039" "2012-09-19 09:24:36" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033656" "00033588" "1" "00239" "00239" "2013-01-10 11:00:38" "00006" "2013-01-13 11:34:44" "SEQ" "DNA" "" ""
"0000033673" "00033605" "1" "00130" "00130" "2013-10-02 09:46:06" "" "" "SEQ" "DNA" "" ""
"0000033674" "00033606" "1" "00130" "00130" "2013-10-02 10:09:57" "" "" "SEQ" "DNA" "" ""
"0000033675" "00033607" "1" "00130" "00130" "2013-10-02 10:13:39" "" "" "SEQ" "DNA" "" ""
"0000033790" "00033722" "1" "00243" "00243" "2015-02-24 10:12:02" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033791" "00033723" "1" "00243" "00243" "2015-02-24 10:25:32" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033792" "00033724" "1" "00243" "00243" "2015-02-24 10:35:24" "" "" "SEQ-NG-I" "DNA" "" ""
"0000033793" "00033725" "1" "00243" "00243" "2015-02-24 10:50:35" "" "" "SEQ-NG-I" "DNA" "" ""
"0000038287" "00038056" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" ""
"0000038289" "00038058" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" ""
"0000038290" "00038059" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" ""
"0000038307" "00038076" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" ""
"0000100522" "00100118" "1" "01769" "01769" "2017-01-30 21:18:09" "" "" "SEQ" "DNA" "WBC" ""
"0000105511" "00105038" "1" "01244" "01244" "2017-06-15 16:35:51" "" "" "SEQ-NG-I" "DNA" "Whole blood" ""
"0000156413" "00155548" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000156414" "00155549" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000156415" "00155550" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000174782" "00173892" "1" "02449" "02449" "2018-04-11 18:11:48" "" "" "SEQ" "DNA" "" ""
"0000241570" "00240460" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000241571" "00240461" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000270740" "00269583" "1" "03508" "03508" "2019-12-01 06:47:50" "" "" "SEQ-NG" "DNA" "blood" "Targeted gene panel"
"0000270741" "00269584" "1" "03508" "03508" "2019-12-01 06:50:23" "" "" "SEQ-NG" "DNA" "blood" "Targeted gene panel"
"0000270742" "00269585" "1" "03508" "03508" "2019-12-01 07:13:17" "" "" "SEQ-NG" "DNA" "blood" "Targeted gene panel"
"0000270749" "00269592" "1" "03508" "03508" "2019-12-01 08:11:41" "" "" "SEQ-NG" "DNA" "blood" "Targeted gene panel"
"0000292139" "00290971" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292140" "00290972" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292141" "00290973" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292142" "00290974" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305549" "00304420" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305550" "00304421" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000309543" "00308399" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel"
"0000309705" "00308560" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309769" "00308624" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000310553" "00309408" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310554" "00309409" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310555" "00309410" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310556" "00309411" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310557" "00309412" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000326667" "00325456" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000326669" "00325458" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000326684" "00325473" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000326701" "00325490" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000329168" "00327953" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES"
"0000329388" "00328173" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329543" "00328328" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329551" "00328336" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329711" "00328496" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000333420" "00332200" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333430" "00332210" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333436" "00332216" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333437" "00332217" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333576" "00332353" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" ""
"0000333577" "00332354" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" ""
"0000333612" "00332388" "1" "00000" "00006" "2021-02-18 13:23:10" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000333613" "00332389" "1" "00000" "00006" "2021-02-18 13:23:10" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000333632" "00332408" "1" "00006" "00006" "2021-02-18 13:32:40" "" "" "SEQ;SEQ-NG" "DNA" "" "4813 clinical gene panel"
"0000333633" "00332409" "1" "00006" "00006" "2021-02-18 13:34:39" "" "" "SEQ;SEQ-NG" "DNA" "" "4813 clinical gene panel"
"0000333695" "00332471" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel"
"0000334582" "00333357" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel"
"0000334591" "00333366" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel"
"0000334652" "00333427" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel"
"0000334655" "00333430" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel"
"0000334682" "00333457" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334691" "00333466" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334703" "00333478" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000335190" "00333964" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335191" "00333965" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000336397" "00335168" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336468" "00335239" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel"
"0000336571" "00335342" "1" "02485" "00006" "2021-03-04 17:06:33" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000336727" "00335498" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel"
"0000336821" "00335593" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "blood" ""
"0000336822" "00335594" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "blood" ""
"0000336842" "00335614" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336843" "00335615" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336844" "00335616" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336845" "00335617" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336846" "00335618" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336847" "00335619" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336848" "00335620" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336849" "00335621" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000336850" "00335622" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" ""
"0000360146" "00358913" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000360147" "00358914" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000360148" "00358915" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000360149" "00358916" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000360163" "00358930" "1" "00000" "00006" "2021-03-17 15:00:07" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360188" "00358951" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360191" "00358954" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360204" "00358967" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360207" "00358970" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360284" "00359046" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360297" "00359059" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360306" "00359068" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360309" "00359071" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360311" "00359073" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360329" "00359091" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360333" "00359095" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360336" "00359098" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360564" "00359323" "1" "00000" "00006" "2021-03-19 13:20:32" "" "" "SEQ-NG" "DNA" "" "105-gene panel"
"0000363378" "00362149" "1" "00006" "00006" "2021-04-15 14:35:20" "" "" "SEQ-NG" "DNA" "" "WES"
"0000363379" "00362150" "1" "00006" "00006" "2021-04-15 14:35:20" "" "" "SEQ-NG" "DNA" "" "WES"
"0000363459" "00362230" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" ""
"0000364159" "00362931" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364701" "00363473" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel"
"0000364831" "00363603" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364862" "00363634" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364871" "00363643" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364877" "00363649" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364899" "00363671" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364940" "00363712" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364965" "00363737" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373649" "00372416" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373680" "00372447" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373681" "00372448" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373682" "00372449" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373683" "00372450" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373684" "00372451" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373685" "00372452" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373686" "00372453" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373687" "00372454" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000373724" "00372491" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374578" "00373343" "1" "00006" "00006" "2021-05-13 20:27:51" "" "" "arraySNP;SEQ" "DNA" "" ""
"0000374643" "00373408" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "arraySNP;SEQ" "DNA" "" ""
"0000374644" "00373409" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "arraySNP;SEQ" "DNA" "" ""
"0000374699" "00373464" "1" "00006" "00006" "2021-05-14 15:56:17" "" "" "SEQ;SEQ-NG" "DNA" "" "123-gene panel"
"0000375124" "00373892" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000376610" "00375413" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES"
"0000376625" "00375428" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES"
"0000376638" "00375441" "1" "00000" "00006" "2021-06-04 11:16:10" "" "" "SEQ-NG" "DNA" "" "162-gene panel"
"0000376653" "00375456" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376654" "00375457" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376655" "00375458" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376656" "00375459" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376658" "00375461" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376661" "00375464" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376662" "00375465" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376664" "00375467" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376665" "00375468" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376666" "00375469" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376667" "00375470" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376669" "00375472" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376670" "00375473" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000376671" "00375474" "1" "00000" "00006" "2021-06-04 12:05:48" "" "" "SEQ-NG" "DNA" "" "14-gene panel"
"0000377481" "00376285" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" ""
"0000377482" "00376286" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" ""
"0000377676" "00376471" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000377677" "00376472" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000377680" "00376475" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" ""
"0000377681" "00376476" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" ""
"0000377682" "00376477" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" ""
"0000377683" "00376478" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" ""
"0000377915" "00376709" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377916" "00376710" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377917" "00376711" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377918" "00376712" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377919" "00376713" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377920" "00376714" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377926" "00376720" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377927" "00376721" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377928" "00376722" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377934" "00376728" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377935" "00376729" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377936" "00376730" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377937" "00376731" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377938" "00376732" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" ""
"0000377959" "00376753" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377972" "00376766" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377976" "00376770" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000377995" "00376789" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000378069" "00376864" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES"
"0000378234" "00377029" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "blood" ""
"0000378235" "00377030" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "blood" ""
"0000378236" "00377031" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "blood" ""
"0000378237" "00377032" "1" "00000" "00008" "2021-06-29 06:08:50" "" "" "SEQ" "DNA" "blood" ""
"0000378716" "00377513" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-13 22:59:17" "MLPA;SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis, multiplex ligation-dependent probe amplification analysis"
"0000378718" "00377515" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-12 14:28:07" "SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing"
"0000378719" "00377516" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-12 14:32:49" "SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing"
"0000378720" "00377517" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-12 14:31:43" "SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing"
"0000378724" "00377521" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-13 22:49:27" "SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing"
"0000378725" "00377522" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ;MLPA" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencingmultiplex ligation-dependent probe amplification analysis"
"0000378734" "00377531" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing"
"0000378735" "00377532" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-13 22:57:42" "SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing"
"0000378736" "00377533" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ;MLPA" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis, multiplex ligation-dependent probe amplification analysis"
"0000378738" "00377535" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-12 14:41:13" "MLPA;SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis, multiplex ligation-dependent probe amplification analysis"
"0000378741" "00377538" "1" "04521" "03840" "2021-07-22 15:35:32" "04521" "2023-06-13 04:35:43" "MLPA;SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencingmultiplex ligation-dependent probe amplification analysis,WGS"
"0000378742" "00377539" "1" "04521" "03840" "2021-07-22 15:35:32" "04521" "2023-06-13 04:49:40" "MLPA;SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis, multiplex ligation-dependent probe amplification analysis, WGS"
"0000378747" "00377544" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing"
"0000379085" "00377881" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379086" "00377882" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379087" "00377883" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379096" "00377892" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379097" "00377893" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379098" "00377894" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379114" "00377910" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" ""
"0000379161" "00377957" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" ""
"0000380955" "00379754" "1" "03508" "03508" "2021-08-09 04:35:07" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381430" "00379754" "1" "03508" "03508" "2021-08-13 05:10:59" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381532" "00380318" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "exome sequencing"
"0000382245" "00381031" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" ""
"0000382246" "00381032" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" ""
"0000382253" "00381039" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" ""
"0000382260" "00381046" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" ""
"0000382261" "00381047" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" ""
"0000382298" "00381084" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySNP;SEQ;PCR" "DNA" "blood" ""
"0000382366" "00381151" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ" "DNA" "blood" "Asper chip analysis"
"0000382380" "00381165" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "Exome Sequencing"
"0000382386" "00381171" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "Exome Sequencing"
"0000382387" "00381172" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "Exome Sequencing"
"0000382430" "00381215" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382431" "00381216" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382831" "00381615" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382842" "00381626" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382843" "00381627" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382856" "00381640" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382862" "00381646" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382863" "00381647" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382872" "00381656" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382874" "00381658" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382876" "00381660" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000382878" "00381662" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" ""
"0000383105" "00381889" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383161" "00381945" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000383162" "00381946" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000383163" "00381947" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000383164" "00381948" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel"
"0000383816" "00382602" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000384018" "00382802" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "arraySEQ;PCR" "DNA" "blood" ""
"0000384611" "00383386" "1" "00000" "03840" "2021-09-29 09:56:40" "" "" "SEQ-NG" "DNA" "blood" "eye disease enrichment panel, see paper"
"0000385140" "00383915" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385174" "00383949" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" ""
"0000385268" "00384043" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385410" "00384185" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385411" "00384186" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385412" "00384187" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385691" "00384466" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000386222" "00384993" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386228" "00384999" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386247" "00385018" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386256" "00385027" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386285" "00385056" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386309" "00385080" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386320" "00385091" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386841" "00385612" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip"
"0000387520" "00386291" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000389414" "00388175" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing"
"0000389415" "00388176" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing"
"0000389416" "00388177" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing"
"0000389423" "00388184" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing"
"0000389728" "00388487" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing"
"0000390243" "00389000" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper"
"0000390344" "00389101" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390988" "00389745" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper"
"0000390989" "00389746" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper"
"0000390990" "00389747" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper"
"0000391001" "00389758" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000391002" "00389759" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000391003" "00389760" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000391077" "00389834" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper"
"0000391641" "00390400" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391642" "00390401" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391968" "00390727" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing"
"0000392004" "00390763" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" ""
"0000392463" "00391221" "1" "00000" "03840" "2021-11-14 11:38:34" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing"
"0000392464" "00391222" "1" "00000" "03840" "2021-11-14 11:38:34" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing"
"0000392590" "00391348" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing"
"0000392828" "00391586" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392941" "00391700" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392942" "00391701" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392943" "00391702" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392944" "00391703" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392945" "00391704" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392946" "00391705" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392947" "00391706" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392948" "00391707" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392949" "00391708" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392950" "00391709" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392951" "00391710" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392952" "00391711" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392953" "00391712" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392954" "00391713" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392955" "00391714" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392956" "00391715" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000392957" "00391716" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien"
"0000394709" "00393461" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394806" "00393558" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394943" "00393695" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000396806" "00395568" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing"
"0000397095" "00395856" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes"
"0000397455" "00396214" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "arraySNP;SEQ-NG" "DNA" "" ""
"0000397456" "00396215" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG" "DNA" "" ""
"0000397470" "00396229" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "arraySNP;SEQ-NG" "DNA" "" ""
"0000397715" "00396472" "1" "00000" "03840" "2021-12-16 12:35:05" "" "" "SEQ-NG-I" "DNA" "blood" "panel of 254 genes implicated in retinopathies"
"0000398827" "00397588" "1" "00000" "03840" "2021-12-26 19:07:26" "" "" "SEQ" "DNA" "blood" ""
"0000403243" "00402002" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403244" "00402003" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403245" "00402004" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" ""
"0000403246" "00402005" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" ""
"0000403247" "00402006" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" ""
"0000403248" "00402007" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403249" "00402008" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403250" "00402009" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403251" "00402010" "1" "00006" "00006" "2022-02-03 21:20:11" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403552" "00402311" "1" "00006" "00006" "2022-02-04 15:40:56" "" "" "SEQ" "DNA" "" ""
"0000403555" "00402314" "1" "00006" "00006" "2022-02-04 15:57:31" "" "" "SEQ" "DNA" "" ""
"0000403557" "00402316" "1" "00006" "00006" "2022-02-04 16:16:15" "" "" "SEQ" "DNA" "" ""
"0000403560" "00402319" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403561" "00402320" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403562" "00402321" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403563" "00402322" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403564" "00402323" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403565" "00402324" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403566" "00402325" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403567" "00402326" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403568" "00402327" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403569" "00402328" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403570" "00402329" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403571" "00402330" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403572" "00402331" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403573" "00402332" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403574" "00402333" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403575" "00402334" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403576" "00402335" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403577" "00402336" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403578" "00402337" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403579" "00402338" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403580" "00402339" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000403581" "00402340" "1" "00006" "00006" "2022-02-04 18:02:19" "" "" "SEQ" "DNA" "" ""
"0000407626" "00406384" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" ""
"0000407648" "00406406" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" ""
"0000407649" "00406407" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" ""
"0000407836" "00406593" "1" "00000" "03840" "2022-04-01 15:23:22" "" "" "SSCA;SEQ" "DNA" "blood" ""
"0000407837" "00406594" "1" "00000" "03840" "2022-04-01 15:23:22" "" "" "SSCA;SEQ" "DNA" "blood" ""
"0000409399" "00408144" "1" "00000" "03840" "2022-04-14 18:55:23" "" "" "SEQ" "DNA" "" ""
"0000409400" "00408145" "1" "00000" "03840" "2022-04-14 18:55:23" "" "" "SEQ" "DNA" "" ""
"0000409401" "00408146" "1" "00000" "03840" "2022-04-14 18:55:23" "" "" "SEQ" "DNA" "" ""
"0000409402" "00408147" "1" "00000" "03840" "2022-04-14 18:55:23" "" "" "SEQ" "DNA" "" ""
"0000409405" "00408150" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409406" "00408151" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409407" "00408152" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409408" "00408153" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409409" "00408154" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409410" "00408155" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409411" "00408156" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409412" "00408157" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409413" "00408158" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409414" "00408159" "1" "00000" "03840" "2022-04-14 20:25:47" "" "" "SEQ" "DNA" "" ""
"0000409421" "00408166" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409422" "00408167" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409423" "00408168" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409424" "00408169" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409425" "00408170" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409426" "00408171" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409427" "00408172" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409428" "00408173" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409429" "00408174" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409430" "00408175" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409431" "00408176" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409432" "00408177" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409433" "00408178" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409434" "00408179" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409435" "00408180" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409436" "00408181" "1" "00000" "03840" "2022-04-15 07:36:10" "" "" "STR;DHPLC;SEQ" "DNA" "" ""
"0000409437" "00408182" "1" "00000" "03840" "2022-04-15 14:20:58" "" "" "?" "DNA" "" ""
"0000409438" "00408183" "1" "00000" "03840" "2022-04-15 14:20:58" "" "" "?" "DNA" "" ""
"0000409439" "00408184" "1" "00000" "03840" "2022-04-15 14:20:58" "" "" "?" "DNA" "" ""
"0000409440" "00408185" "1" "00000" "03840" "2022-04-15 14:20:58" "" "" "?" "DNA" "" ""
"0000409441" "00408186" "1" "00000" "03840" "2022-04-15 14:20:58" "" "" "?" "DNA" "" ""
"0000409443" "00408188" "1" "00000" "03840" "2022-04-15 16:06:52" "" "" "SSCA;SEQ" "DNA" "" ""
"0000409445" "00408190" "1" "00000" "03840" "2022-04-17 15:26:28" "" "" "SEQ" "DNA" "" ""
"0000409446" "00408191" "1" "00000" "03840" "2022-04-17 15:26:28" "" "" "SEQ" "DNA" "" ""
"0000409447" "00408192" "1" "00000" "03840" "2022-04-17 15:26:28" "" "" "SEQ" "DNA" "" ""
"0000409455" "00408200" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409456" "00408201" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409457" "00408202" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409458" "00408203" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409459" "00408204" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409460" "00408205" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409461" "00408206" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409462" "00408207" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409463" "00408208" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409464" "00408209" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409465" "00408210" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409466" "00408211" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409467" "00408212" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409468" "00408213" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409469" "00408214" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409470" "00408215" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409471" "00408216" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409472" "00408217" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409473" "00408218" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409474" "00408219" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409475" "00408220" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409476" "00408221" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409477" "00408222" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409478" "00408223" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409479" "00408224" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409480" "00408225" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409481" "00408226" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409482" "00408227" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409483" "00408228" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409484" "00408229" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409485" "00408230" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409486" "00408231" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409487" "00408232" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409488" "00408233" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409489" "00408234" "1" "00000" "03840" "2022-04-17 20:11:19" "" "" "SEQ" "DNA" "" ""
"0000409518" "00408263" "1" "00000" "03840" "2022-04-18 13:31:15" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000409519" "00408264" "1" "00000" "03840" "2022-04-18 13:31:15" "" "" "SEQ-NG;SEQ" "DNA" "" ""
"0000409520" "00408265" "1" "00000" "03840" "2022-04-18 15:33:55" "" "" "SEQ" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409521" "00408266" "1" "00000" "03840" "2022-04-18 15:33:55" "" "" "SEQ" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409522" "00408267" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409523" "00408268" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409524" "00408269" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409525" "00408270" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409526" "00408271" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409527" "00408272" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409528" "00408273" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409529" "00408274" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409530" "00408275" "1" "00000" "03840" "2022-04-18 15:37:13" "" "" "?" "DNA" "" "retrospective study, homozygosity-mapping guided candidate gene analysis or next-generation sequencing of a panel of candidate genes"
"0000409531" "00408276" "1" "00000" "03840" "2022-04-18 20:30:55" "" "" "SEQ-NG;SEQ" "DNA" "" "IROme, an in-house-designed enrichment system for retinal dystrophy genes"
"0000409533" "00408277" "1" "00000" "03840" "2022-04-19 16:11:05" "" "" "SEQ-NG;SEQ" "DNA" "" "Targeted next generation sequencing"
"0000409534" "00408278" "1" "00000" "03840" "2022-04-19 16:11:05" "" "" "SEQ-NG;SEQ" "DNA" "" "Targeted next generation sequencing"
"0000409535" "00408279" "1" "00000" "03840" "2022-04-19 16:11:05" "" "" "SEQ-NG;SEQ" "DNA" "" "Targeted next generation sequencing"
"0000409538" "00408283" "1" "00000" "03840" "2022-04-19 17:18:15" "" "" "SEQ-NG;SEQ" "DNA" "" "Targeted next generation sequencing"
"0000409539" "00408284" "1" "00000" "03840" "2022-04-19 17:18:15" "" "" "SEQ-NG;SEQ" "DNA" "" "Targeted next generation sequencing"
"0000409542" "00408286" "1" "00000" "03840" "2022-04-19 20:05:20" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing"
"0000409669" "00408412" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409670" "00408413" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel"
"0000416549" "00415267" "1" "00000" "03840" "2022-08-10 20:39:58" "" "" "SEQ-NG" "DNA" "" "exome sequencing done at a commercial CAPaccredited laboratory"
"0000421832" "00420523" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes"
"0000428262" "00426942" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing"
"0000428266" "00426946" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing"
"0000430994" "00429581" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431011" "00429598" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431105" "00429692" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431207" "00429794" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431266" "00429853" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431359" "00429946" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431376" "00429963" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431399" "00429986" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431474" "00430061" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431541" "00430128" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000436689" "00435214" "1" "04521" "04521" "2023-06-12 11:34:14" "" "" "SEQ-NG" "DNA" "Blood" "WGS"
"0000436691" "00377535" "1" "04521" "04521" "2023-06-13 03:07:56" "" "" "SEQ-NG" "DNA" "Blood" "WGS"
"0000436692" "00435216" "1" "04521" "04521" "2023-06-13 04:01:05" "" "" "SEQ-NG" "DNA" "Blood" "WGS"
"0000443153" "00441667" "1" "04542" "00008" "2023-11-09 09:55:44" "" "" "SEQ-NG" "DNA" "blood" "Published as WGS"
"0000445884" "00444310" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000448778" "00447201" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448900" "00447323" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000449110" "00447533" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000451583" "00449987" "1" "02230" "00006" "2024-05-24 14:55:58" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WGS"
"0000451585" "00449989" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451586" "00449990" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451587" "00449991" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451588" "00449992" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451589" "00449993" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451590" "00449994" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "55-gene panel, RPGRIP1"
"0000451591" "00449995" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "SEQ;SEQ-NG" "DNA" "" "55-gene panel, RPGRIP1"
"0000451592" "00449996" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "SEQ;SEQ-NG" "DNA" "" "55-gene panel, RPGRIP1"
"0000451593" "00449997" "1" "00006" "00006" "2024-05-24 15:53:04" "" "" "SEQ;SEQ-NG" "DNA" "" "55-gene panel, RPGRIP1"
"0000452032" "00450435" "1" "04695" "04695" "2024-05-27 05:29:09" "" "" "SEQ-NG" "DNA" "" ""
"0000452606" "00451008" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452778" "00451179" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452879" "00451280" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452890" "00451291" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452931" "00451332" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000462714" "00461082" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 502
"{{screeningid}}" "{{geneid}}"
"0000000226" "CCDC39"
"0000033224" "ARL6"
"0000033224" "IMPDH1"
"0000033224" "RPGRIP1"
"0000033420" "RPGRIP1"
"0000033421" "RPGRIP1"
"0000033422" "RPGRIP1"
"0000033423" "RPGRIP1"
"0000033424" "RPGRIP1"
"0000033425" "RPGRIP1"
"0000033429" "RPGRIP1"
"0000033430" "RPGRIP1"
"0000033431" "RPGRIP1"
"0000033656" "RPGRIP1"
"0000033673" "RPGRIP1"
"0000033674" "RPGRIP1"
"0000033675" "RPGRIP1"
"0000033790" "RPGRIP1"
"0000033791" "RPGRIP1"
"0000033792" "RPGRIP1"
"0000033793" "RPGRIP1"
"0000038287" "CRB1"
"0000038289" "CRB1"
"0000038290" "CRB1"
"0000038307" "CRB1"
"0000100522" "RPGRIP1"
"0000156413" "RPGRIP1"
"0000156414" "RPGRIP1"
"0000156415" "RPGRIP1"
"0000174782" "MERTK"
"0000241570" "RPGRIP1"
"0000241571" "RPGRIP1"
"0000309543" "RPGRIP1"
"0000309705" "RPGRIP1"
"0000309769" "RPGRIP1"
"0000310553" "RPGRIP1"
"0000310554" "RPGRIP1"
"0000310555" "RPGRIP1"
"0000310556" "RPGRIP1"
"0000310557" "RPGRIP1"
"0000326667" "RPGRIP1"
"0000326669" "RPGRIP1"
"0000326684" "RPGRIP1"
"0000326701" "RPGRIP1"
"0000329168" "RPGRIP1"
"0000329388" "RPGRIP1"
"0000329543" "RPGRIP1"
"0000329551" "RPGRIP1"
"0000329711" "RPGRIP1"
"0000333576" "RPGRIP1"
"0000333577" "RPGRIP1"
"0000333612" "RPGRIP1"
"0000333613" "RPGRIP1"
"0000333632" "RPGRIP1"
"0000333633" "RPGRIP1"
"0000333695" "RPGRIP1"
"0000334582" "RPGR"
"0000334682" "RPGRIP1"
"0000334691" "RPGRIP1"
"0000334703" "RPGRIP1"
"0000335190" "RPGRIP1"
"0000335191" "RPGRIP1"
"0000336397" "RPGRIP1"
"0000336468" "RPGRIP1"
"0000336571" "RPGRIP1"
"0000336727" "RPGRIP1"
"0000336821" "RPGRIP1"
"0000336822" "RPGRIP1"
"0000336842" "RPGRIP1"
"0000336843" "RPGRIP1"
"0000336844" "RPGRIP1"
"0000336845" "RPGRIP1"
"0000336846" "RPGRIP1"
"0000336847" "RPGRIP1"
"0000336848" "RPGRIP1"
"0000336849" "RPGRIP1"
"0000336850" "RPGRIP1"
"0000360146" "RPGRIP1"
"0000360147" "RPGRIP1"
"0000360148" "RPGRIP1"
"0000360149" "RPGRIP1"
"0000360163" "RPGRIP1"
"0000360564" "RPGRIP1"
"0000363378" "RPGRIP1"
"0000363379" "RPGRIP1"
"0000363459" "RPGRIP1"
"0000364159" "RPGRIP1"
"0000364701" "RPGRIP1"
"0000364831" "RPGRIP1"
"0000364862" "RPGRIP1"
"0000364871" "RPGRIP1"
"0000364877" "RPGRIP1"
"0000364899" "RPGRIP1"
"0000364940" "RPGRIP1"
"0000364965" "RPGRIP1"
"0000373649" "RPGRIP1"
"0000373680" "RPGRIP1"
"0000373681" "RPGRIP1"
"0000373682" "RPGRIP1"
"0000373683" "RPGRIP1"
"0000373684" "RPGRIP1"
"0000373685" "RPGRIP1"
"0000373686" "RPGRIP1"
"0000373687" "RPGRIP1"
"0000373724" "RPGRIP1"
"0000374578" "RPGRIP1"
"0000374643" "RPGRIP1"
"0000374644" "RPGRIP1"
"0000374699" "RP1L1"
"0000375124" "RPGRIP1"
"0000376638" "RPGRIP1"
"0000376653" "RPGRIP1"
"0000376654" "RPGRIP1"
"0000376655" "RPGRIP1"
"0000376656" "RPGRIP1"
"0000376658" "RPGRIP1"
"0000376661" "RPGRIP1"
"0000376662" "RPGRIP1"
"0000376664" "RPGRIP1"
"0000376665" "RPGRIP1"
"0000376666" "RPGRIP1"
"0000376667" "RPGRIP1"
"0000376669" "RPGRIP1"
"0000376670" "RPGRIP1"
"0000376671" "RPGRIP1"
"0000377481" "RPGRIP1"
"0000377482" "RPGRIP1"
"0000377676" "RPGRIP1"
"0000377677" "RPGRIP1"
"0000377680" "RPGRIP1"
"0000377681" "RPGRIP1"
"0000377682" "RPGRIP1"
"0000377683" "RPGRIP1"
"0000377915" "AIPL1"
"0000377915" "CRB1"
"0000377915" "CRX"
"0000377915" "GUCY2D"
"0000377915" "LRAT"
"0000377915" "MERTK"
"0000377915" "RPE65"
"0000377915" "RPGRIP1"
"0000377916" "AIPL1"
"0000377916" "CRB1"
"0000377916" "CRX"
"0000377916" "GUCY2D"
"0000377916" "LRAT"
"0000377916" "MERTK"
"0000377916" "RPE65"
"0000377916" "RPGRIP1"
"0000377917" "AIPL1"
"0000377917" "CRB1"
"0000377917" "CRX"
"0000377917" "GUCY2D"
"0000377917" "LRAT"
"0000377917" "MERTK"
"0000377917" "RPE65"
"0000377917" "RPGRIP1"
"0000377918" "AIPL1"
"0000377918" "CRB1"
"0000377918" "CRX"
"0000377918" "GUCY2D"
"0000377918" "LRAT"
"0000377918" "MERTK"
"0000377918" "RPE65"
"0000377918" "RPGRIP1"
"0000377919" "AIPL1"
"0000377919" "CRB1"
"0000377919" "CRX"
"0000377919" "GUCY2D"
"0000377919" "LRAT"
"0000377919" "MERTK"
"0000377919" "RPE65"
"0000377919" "RPGRIP1"
"0000377920" "AIPL1"
"0000377920" "CRB1"
"0000377920" "CRX"
"0000377920" "GUCY2D"
"0000377920" "LRAT"
"0000377920" "MERTK"
"0000377920" "RPE65"
"0000377920" "RPGRIP1"
"0000377926" "AIPL1"
"0000377926" "CRB1"
"0000377926" "CRX"
"0000377926" "GUCY2D"
"0000377926" "LRAT"
"0000377926" "MERTK"
"0000377926" "RPE65"
"0000377926" "RPGRIP1"
"0000377927" "AIPL1"
"0000377927" "CRB1"
"0000377927" "CRX"
"0000377927" "GUCY2D"
"0000377927" "LRAT"
"0000377927" "MERTK"
"0000377927" "RPE65"
"0000377927" "RPGRIP1"
"0000377928" "AIPL1"
"0000377928" "CRB1"
"0000377928" "CRX"
"0000377928" "GUCY2D"
"0000377928" "LRAT"
"0000377928" "MERTK"
"0000377928" "RPE65"
"0000377928" "RPGRIP1"
"0000377934" "AIPL1"
"0000377934" "CRB1"
"0000377934" "CRX"
"0000377934" "GUCY2D"
"0000377934" "LRAT"
"0000377934" "MERTK"
"0000377934" "RPE65"
"0000377934" "RPGRIP1"
"0000377935" "AIPL1"
"0000377935" "CRB1"
"0000377935" "CRX"
"0000377935" "GUCY2D"
"0000377935" "LRAT"
"0000377935" "MERTK"
"0000377935" "RPE65"
"0000377935" "RPGRIP1"
"0000377936" "AIPL1"
"0000377936" "CRB1"
"0000377936" "CRX"
"0000377936" "GUCY2D"
"0000377936" "LRAT"
"0000377936" "MERTK"
"0000377936" "RPE65"
"0000377936" "RPGRIP1"
"0000377937" "AIPL1"
"0000377937" "CRB1"
"0000377937" "CRX"
"0000377937" "GUCY2D"
"0000377937" "LRAT"
"0000377937" "MERTK"
"0000377937" "RPE65"
"0000377937" "RPGRIP1"
"0000377938" "AIPL1"
"0000377938" "CRB1"
"0000377938" "CRX"
"0000377938" "GUCY2D"
"0000377938" "LRAT"
"0000377938" "MERTK"
"0000377938" "RPE65"
"0000377938" "RPGRIP1"
"0000378234" "RPGRIP1"
"0000378235" "RPGRIP1"
"0000378236" "RPGRIP1"
"0000378237" "RPGRIP1"
"0000378720" "A2MP1"
"0000379085" "RPGRIP1"
"0000379086" "RPGRIP1"
"0000379087" "RPGRIP1"
"0000379096" "RPGRIP1"
"0000379097" "RPGRIP1"
"0000379098" "RPGRIP1"
"0000379114" "RPGRIP1"
"0000379161" "DFNB31"
"0000381532" "RPGRIP1"
"0000382245" "RPGRIP1"
"0000382246" "RPGRIP1"
"0000382253" "C2orf71"
"0000382260" "TOPORS"
"0000382261" "USH2A"
"0000382298" "AIPL1"
"0000382366" "RPE65"
"0000382366" "RPGRIP1"
"0000382380" "RPGRIP1"
"0000382386" "RPGRIP1"
"0000382387" "RPGRIP1"
"0000382430" "RPGRIP1"
"0000382431" "RPGRIP1"
"0000382831" "RPGRIP1"
"0000382842" "RPGRIP1"
"0000382843" "PROM1"
"0000382856" "RPGRIP1"
"0000382862" "RPGRIP1"
"0000382863" "ROM1"
"0000382872" "RPGRIP1"
"0000382874" "RPGRIP1"
"0000382876" "ABCA4"
"0000382878" "RPGRIP1"
"0000383105" "RPGRIP1"
"0000383816" "RPGRIP1"
"0000384018" "RPGRIP1"
"0000384611" "RPGRIP1"
"0000385140" "PDE6A"
"0000385174" "PDE6A"
"0000385268" "RPGRIP1"
"0000385410" "RPGRIP1"
"0000385411" "RPGRIP1"
"0000385412" "RPGRIP1"
"0000385691" "RPGRIP1"
"0000386222" "RPGRIP1"
"0000386228" "RPGRIP1"
"0000386247" "RPGRIP1"
"0000386256" "RPGRIP1"
"0000386285" "RPGRIP1"
"0000386309" "RPGRIP1"
"0000386320" "RPGRIP1"
"0000386841" "RPGRIP1"
"0000387520" "CNGB3"
"0000389414" "RPGRIP1"
"0000389415" "RPGRIP1"
"0000389416" "RPGRIP1"
"0000389423" "RPGRIP1"
"0000389728" "RPGRIP1"
"0000390243" "RPGRIP1"
"0000390344" "RPGRIP1"
"0000390988" "RPGRIP1"
"0000390989" "RPGRIP1"
"0000390990" "RPGRIP1"
"0000391001" "RPGRIP1"
"0000391002" "RPGRIP1"
"0000391003" "RPGRIP1"
"0000391077" "RPGRIP1"
"0000391641" "RPGRIP1"
"0000391642" "RPGRIP1"
"0000391968" "RPGRIP1"
"0000392004" "RPGRIP1"
"0000392463" "RPGRIP1"
"0000392464" "RPGRIP1"
"0000392590" "RPGRIP1"
"0000392828" "RPGRIP1"
"0000392941" "RPGRIP1"
"0000392942" "RPGRIP1"
"0000392943" "RPGRIP1"
"0000392944" "RPGRIP1"
"0000392945" "RPGRIP1"
"0000392946" "RPGRIP1"
"0000392947" "RPGRIP1"
"0000392948" "RPGRIP1"
"0000392949" "RPGRIP1"
"0000392950" "RPGRIP1"
"0000392951" "RPGRIP1"
"0000392952" "RPGRIP1"
"0000392953" "RPGRIP1"
"0000392954" "RPGRIP1"
"0000392955" "RPGRIP1"
"0000392956" "RPGRIP1"
"0000392957" "RPGRIP1"
"0000394709" "RPGRIP1"
"0000394806" "RPGRIP1"
"0000394943" "RPGRIP1"
"0000396806" "RPGRIP1"
"0000397095" "RPGRIP1"
"0000397455" "RPGRIP1"
"0000397456" "GUCY2D"
"0000397470" "RPGRIP1"
"0000397715" "RPGRIP1"
"0000398827" "RPGRIP1"
"0000403552" "RPGRIP1"
"0000403555" "RPGRIP1"
"0000403557" "RPGRIP1"
"0000403560" "RPGRIP1"
"0000403561" "RPGRIP1"
"0000403562" "RPGRIP1"
"0000403563" "RPGRIP1"
"0000403564" "RPGRIP1"
"0000403565" "RPGRIP1"
"0000403566" "RPGRIP1"
"0000403567" "RPGRIP1"
"0000403568" "RPGRIP1"
"0000403569" "RPGRIP1"
"0000403570" "RPGRIP1"
"0000403571" "RPGRIP1"
"0000403572" "RPGRIP1"
"0000403573" "RPGRIP1"
"0000403574" "RPGRIP1"
"0000403575" "RPGRIP1"
"0000403576" "RPGRIP1"
"0000403577" "RPGRIP1"
"0000403578" "RPGRIP1"
"0000403579" "RPGRIP1"
"0000403580" "RPGRIP1"
"0000403581" "RPGRIP1"
"0000407626" "GUCY2D"
"0000407648" "RPGRIP1"
"0000407649" "RPGRIP1"
"0000407836" "RPGRIP1"
"0000407837" "RPGRIP1"
"0000409399" "RPGRIP1"
"0000409400" "RPGRIP1"
"0000409401" "RPGRIP1"
"0000409402" "RPGRIP1"
"0000409405" "RPGRIP1"
"0000409406" "RPGRIP1"
"0000409407" "RPGRIP1"
"0000409408" "RPGRIP1"
"0000409409" "RPGRIP1"
"0000409410" "RPGRIP1"
"0000409411" "RPGRIP1"
"0000409412" "RPGRIP1"
"0000409413" "RPGRIP1"
"0000409414" "RPGRIP1"
"0000409421" "RPGRIP1"
"0000409422" "RPGRIP1"
"0000409423" "RPGRIP1"
"0000409424" "RPGRIP1"
"0000409425" "RPGRIP1"
"0000409426" "RPGRIP1"
"0000409427" "RPGRIP1"
"0000409428" "RPGRIP1"
"0000409429" "RPGRIP1"
"0000409430" "RPGRIP1"
"0000409431" "RPGRIP1"
"0000409432" "RPGRIP1"
"0000409433" "RPGRIP1"
"0000409434" "RPGRIP1"
"0000409435" "RPGRIP1"
"0000409436" "RPGRIP1"
"0000409437" "RPGRIP1"
"0000409438" "RPGRIP1"
"0000409439" "RPGRIP1"
"0000409440" "RPGRIP1"
"0000409441" "RPGRIP1"
"0000409443" "RPGRIP1"
"0000409445" "RPGRIP1"
"0000409446" "RPGRIP1"
"0000409447" "RPGRIP1"
"0000409455" "RPGRIP1"
"0000409456" "RPGRIP1"
"0000409457" "RPGRIP1"
"0000409458" "RPGRIP1"
"0000409459" "RPGRIP1"
"0000409460" "RPGRIP1"
"0000409461" "RPGRIP1"
"0000409462" "RPGRIP1"
"0000409463" "RPGRIP1"
"0000409464" "RPGRIP1"
"0000409465" "RPGRIP1"
"0000409466" "RPGRIP1"
"0000409467" "RPGRIP1"
"0000409468" "RPGRIP1"
"0000409469" "RPGRIP1"
"0000409470" "RPGRIP1"
"0000409471" "RPGRIP1"
"0000409472" "RPGRIP1"
"0000409473" "RPGRIP1"
"0000409474" "RPGRIP1"
"0000409475" "RPGRIP1"
"0000409476" "RPGRIP1"
"0000409477" "RPGRIP1"
"0000409478" "RPGRIP1"
"0000409479" "RPGRIP1"
"0000409480" "RPGRIP1"
"0000409481" "RPGRIP1"
"0000409482" "RPGRIP1"
"0000409483" "RPGRIP1"
"0000409484" "RPGRIP1"
"0000409485" "RPGRIP1"
"0000409486" "RPGRIP1"
"0000409487" "RPGRIP1"
"0000409488" "RPGRIP1"
"0000409489" "RPGRIP1"
"0000409518" "RPGRIP1"
"0000409519" "RPGRIP1"
"0000409520" "RPGRIP1"
"0000409521" "RPGRIP1"
"0000409522" "RPGRIP1"
"0000409523" "RPGRIP1"
"0000409524" "RPGRIP1"
"0000409525" "RPGRIP1"
"0000409526" "RPGRIP1"
"0000409527" "RPGRIP1"
"0000409528" "RPGRIP1"
"0000409529" "RPGRIP1"
"0000409530" "RPGRIP1"
"0000409531" "RPGRIP1"
"0000409533" "RPGRIP1"
"0000409534" "RPGRIP1"
"0000409535" "RPGRIP1"
"0000409538" "RPGRIP1"
"0000409539" "RPGRIP1"
"0000409542" "RPGRIP1"
"0000409669" "RPGRIP1"
"0000409670" "RPGRIP1"
"0000416549" "RPGRIP1"
"0000421832" "RPGRIP1"
"0000428262" "IMPDH1"
"0000428266" "ABCA4"
"0000430994" "RPGRIP1"
"0000431011" "RPGRIP1"
"0000431105" "RPGRIP1"
"0000431207" "RPGRIP1"
"0000431266" "RPGRIP1"
"0000431359" "RPGRIP1"
"0000431376" "RPGRIP1"
"0000431399" "RPGRIP1"
"0000431474" "RPGRIP1"
"0000431541" "RPGRIP1"
"0000443153" "RPGRIP1"
"0000451585" "RPGRIP1"
"0000451586" "RPGRIP1"
"0000451587" "RPGRIP1"
"0000451588" "RPGRIP1"
"0000451589" "RPGRIP1"
"0000451590" "RPGRIP1"
"0000451591" "RPGRIP1"
"0000451592" "RPGRIP1"
"0000451593" "RPGRIP1"
"0000452032" "RPGRIP1"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 751
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000036431" "3" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00552" "RPGRIP1_000002" "g.21813304C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "likely pathogenic" ""
"0000060449" "1" "10" "14" "21770730" "21770730" "subst" "0.503623" "00229" "RPGRIP1_000001" "g.21770730A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign" "Germline" "no" "" "0" "" "" "g.21302571A>G" "" "benign" ""
"0000060450" "1" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060451" "2" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060452" "1" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060453" "2" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060454" "1" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060455" "2" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00039" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000060456" "1" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00130" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "likely pathogenic" ""
"0000060457" "1" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00130" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "likely pathogenic" ""
"0000060458" "1" "90" "14" "21762904" "21762904" "subst" "1.21912E-5" "00039" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21294745C>T" "" "pathogenic" ""
"0000060459" "2" "90" "14" "21762904" "21762904" "subst" "1.21912E-5" "00039" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21294745C>T" "" "pathogenic" ""
"0000060460" "1" "90" "14" "21793411" "21793411" "subst" "1.64522E-5" "00039" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "pathogenic" ""
"0000060461" "2" "90" "14" "21793411" "21793411" "subst" "1.64522E-5" "00039" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "pathogenic" ""
"0000060462" "1" "90" "14" "21793411" "21793411" "subst" "1.64522E-5" "00039" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "pathogenic" ""
"0000060463" "2" "90" "14" "21793411" "21793411" "subst" "1.64522E-5" "00039" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "pathogenic" ""
"0000060464" "1" "90" "14" "21802855" "21802855" "subst" "0" "00039" "RPGRIP1_000005" "g.21802855T>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21334696T>A" "" "pathogenic" ""
"0000060465" "2" "90" "14" "21802855" "21802855" "subst" "0" "00039" "RPGRIP1_000005" "g.21802855T>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21334696T>A" "" "pathogenic" ""
"0000060466" "1" "90" "14" "21780621" "21780621" "del" "0" "00039" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "pathogenic" ""
"0000060467" "2" "90" "14" "21780621" "21780621" "del" "0" "00039" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "pathogenic" ""
"0000060468" "1" "90" "14" "21780621" "21780621" "del" "0" "00039" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "pathogenic" ""
"0000060469" "2" "90" "14" "21780621" "21780621" "del" "0" "00039" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "pathogenic" ""
"0000060470" "10" "90" "14" "21794020" "21794020" "subst" "2.04252E-5" "00239" "RPGRIP1_000007" "g.21794020G>A" "" "" "" "" "not in 200 controls" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "pathogenic" ""
"0000060471" "20" "90" "14" "21794020" "21794020" "subst" "2.04252E-5" "00239" "RPGRIP1_000007" "g.21794020G>A" "" "" "" "" "not in 200 controls" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "pathogenic" ""
"0000060472" "2" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00130" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "likely pathogenic" ""
"0000060473" "2" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00130" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "likely pathogenic" ""
"0000060474" "10" "50" "14" "21795863" "21795864" "ins" "0" "00130" "RPGRIP1_000008" "g.21795863_21795864insGGTA" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.21327704_21327705insGGTA" "" "VUS" ""
"0000060475" "20" "50" "14" "21795863" "21795864" "ins" "0" "00130" "RPGRIP1_000008" "g.21795863_21795864insGGTA" "" "{PMID:Neveling 2013:24123792}" "" "" "" "Unknown" "" "" "0" "" "" "g.21327704_21327705insGGTA" "" "VUS" ""
"0000060476" "3" "70" "14" "21811289" "21811289" "del" "0" "00243" "RPGRIP1_000009" "g.21811289del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21343130del" "" "likely pathogenic" ""
"0000060479" "3" "70" "14" "21793055" "21793055" "subst" "0" "00243" "RPGRIP1_000010" "g.21793055C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21324896C>T" "" "likely pathogenic" ""
"0000060481" "3" "70" "14" "21793055" "21793055" "subst" "0" "00243" "RPGRIP1_000010" "g.21793055C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21324896C>T" "" "likely pathogenic" ""
"0000060482" "10" "70" "14" "21819302" "21819302" "subst" "0" "00243" "RPGRIP1_000011" "g.21819302T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351143T>C" "" "likely pathogenic" ""
"0000060483" "20" "70" "14" "21819302" "21819302" "subst" "0" "00243" "RPGRIP1_000011" "g.21819302T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21351143T>C" "" "likely pathogenic" ""
"0000162821" "3" "90" "14" "21779984" "21779984" "del" "0" "01769" "RPGRIP1_000012" "g.21779984del" "" "{PMID:Li 2017:28418496}" "" "931delA" "" "Germline" "yes" "" "0" "" "" "g.21311825del" "" "pathogenic" ""
"0000170952" "0" "90" "14" "21775984" "21775985" "del" "0" "01244" "RPGRIP1_000013" "g.21775984_21775985del" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "" "" "0" "" "" "g.21307825_21307826del" "" "pathogenic" ""
"0000170953" "0" "70" "14" "21793565" "21793565" "del" "0" "01244" "RPGRIP1_000014" "g.21793565del" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "" "" "0" "" "" "g.21325406del" "" "likely pathogenic" ""
"0000247205" "0" "10" "14" "21811196" "21811196" "subst" "0.00828142" "02330" "RPGRIP1_000068" "g.21811196A>G" "" "" "" "RPGRIP1(NM_020366.3):c.3341A>G (p.D1114G), RPGRIP1(NM_020366.4):c.3341A>G (p.D1114G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21343037A>G" "" "benign" ""
"0000247257" "0" "10" "14" "21793064" "21793064" "subst" "0" "02330" "RPGRIP1_000047" "g.21793064A>T" "" "" "" "RPGRIP1(NM_020366.4):c.2050A>T (p.M684L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324905A>T" "" "benign" ""
"0000247262" "0" "10" "14" "21778769" "21778769" "subst" "0.00488946" "02330" "RPGRIP1_000031" "g.21778769A>G" "" "" "" "RPGRIP1(NM_020366.4):c.930+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21310610A>G" "" "benign" ""
"0000247277" "0" "30" "14" "21775897" "21775897" "subst" "0.000146629" "02330" "RPGRIP1_000027" "g.21775897A>G" "" "" "" "RPGRIP1(NM_020366.3):c.808A>G (p.I270V), RPGRIP1(NM_020366.4):c.808A>G (p.I270V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21307738A>G" "" "likely benign" ""
"0000247278" "0" "30" "14" "21775949" "21775949" "subst" "0" "02330" "RPGRIP1_000028" "g.21775949A>G" "" "" "" "RPGRIP1(NM_020366.4):c.860A>G (p.N287S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21307790A>G" "" "likely benign" ""
"0000247279" "0" "30" "14" "21813290" "21813290" "subst" "4.06322E-6" "02330" "RPGRIP1_000025" "g.21813290A>G" "" "" "" "RPGRIP1(NM_020366.4):c.3551A>G (p.Q1184R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21345131A>G" "" "likely benign" ""
"0000247989" "0" "10" "14" "21770730" "21770730" "subst" "0.503623" "02325" "RPGRIP1_000001" "g.21770730A>G" "" "" "" "RPGRIP1(NM_020366.3):c.574A>G (p.K192E), RPGRIP1(NM_020366.4):c.574A>G (p.K192E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302571A>G" "" "benign" ""
"0000250668" "0" "10" "14" "21811196" "21811196" "subst" "0.00828142" "02326" "RPGRIP1_000068" "g.21811196A>G" "" "" "" "RPGRIP1(NM_020366.3):c.3341A>G (p.D1114G), RPGRIP1(NM_020366.4):c.3341A>G (p.D1114G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21343037A>G" "" "benign" ""
"0000253020" "0" "10" "14" "21811196" "21811196" "subst" "0.00828142" "01943" "RPGRIP1_000068" "g.21811196A>G" "" "" "" "RPGRIP1(NM_020366.3):c.3341A>G (p.D1114G), RPGRIP1(NM_020366.4):c.3341A>G (p.D1114G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21343037A>G" "" "benign" ""
"0000253250" "0" "10" "14" "21770730" "21770730" "subst" "0.503623" "01943" "RPGRIP1_000001" "g.21770730A>G" "" "" "" "RPGRIP1(NM_020366.3):c.574A>G (p.K192E), RPGRIP1(NM_020366.4):c.574A>G (p.K192E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302571A>G" "" "benign" ""
"0000253475" "0" "10" "14" "21770681" "21770681" "subst" "0.156312" "01943" "RPGRIP1_000022" "g.21770681A>G" "" "" "" "RPGRIP1(NM_020366.3):c.525A>G (p.P175=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302522A>G" "" "benign" ""
"0000255912" "0" "50" "14" "21770719" "21770719" "subst" "0" "01943" "RPGRIP1_000024" "g.21770719A>C" "" "" "" "RPGRIP1(NM_020366.3):c.563A>C (p.E188A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302560A>C" "" "VUS" ""
"0000295015" "0" "10" "14" "21788158" "21788158" "subst" "0.000299892" "02330" "RPGRIP1_000036" "g.21788158T>G" "" "" "" "RPGRIP1(NM_020366.4):c.1307-18T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21319999T>G" "" "benign" ""
"0000295016" "0" "10" "14" "21790040" "21790040" "subst" "0.201288" "02330" "RPGRIP1_000038" "g.21790040G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1639G>T (p.A547S), RPGRIP1(NM_020366.4):c.1639G>T (p.A547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000295017" "0" "30" "14" "21790154" "21790154" "subst" "0.00167535" "02330" "RPGRIP1_000039" "g.21790154C>T" "" "" "" "RPGRIP1(NM_020366.3):c.1753C>T (p.(Pro585Ser)), RPGRIP1(NM_020366.4):c.1753C>T (p.P585S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321995C>T" "" "likely benign" ""
"0000295018" "0" "30" "14" "21792810" "21792810" "subst" "0.000130043" "02330" "RPGRIP1_000042" "g.21792810C>T" "" "" "" "RPGRIP1(NM_020366.4):c.1796C>T (p.P599L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324651C>T" "" "likely benign" ""
"0000295019" "0" "30" "14" "21792934" "21792934" "subst" "0.000292391" "02330" "RPGRIP1_000044" "g.21792934C>T" "" "" "" "RPGRIP1(NM_020366.4):c.1920C>T (p.A640=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324775C>T" "" "likely benign" ""
"0000295020" "0" "70" "14" "21792962" "21792962" "subst" "0" "02330" "RPGRIP1_000046" "g.21792962C>T" "" "" "" "RPGRIP1(NM_020366.4):c.1948C>T (p.P650S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324803C>T" "" "likely pathogenic" ""
"0000295021" "0" "10" "14" "21762981" "21762981" "subst" "0" "02330" "RPGRIP1_000018" "g.21762981C>G" "" "" "" "RPGRIP1(NM_020366.4):c.218+13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21294822C>G" "" "benign" ""
"0000295022" "0" "10" "14" "21793467" "21793467" "subst" "0.00151197" "02330" "RPGRIP1_000052" "g.21793467G>A" "" "" "" "RPGRIP1(NM_020366.4):c.2292G>A (p.A764=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325308G>A" "" "benign" ""
"0000295023" "0" "10" "14" "21794019" "21794019" "subst" "1.6349E-5" "02330" "RPGRIP1_000053" "g.21794019C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2397C>T (p.N799=), RPGRIP1(NM_020366.4):c.2397C>T (p.N799=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325860C>T" "" "benign" ""
"0000295024" "0" "10" "14" "21794214" "21794214" "subst" "0.000211257" "02330" "RPGRIP1_000058" "g.21794214T>C" "" "" "" "RPGRIP1(NM_020366.4):c.2592T>C (p.Y864=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21326055T>C" "" "benign" ""
"0000295025" "0" "30" "14" "21794221" "21794221" "subst" "0.00048359" "02330" "RPGRIP1_000059" "g.21794221C>T" "" "" "" "RPGRIP1(NM_020366.4):c.2599C>T (p.R867W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21326062C>T" "" "likely benign" ""
"0000295026" "0" "10" "14" "21795949" "21795949" "subst" "0.00120339" "02330" "RPGRIP1_000062" "g.21795949G>C" "" "" "" "RPGRIP1(NM_020366.4):c.2878G>C (p.A960P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21327790G>C" "" "benign" ""
"0000295027" "0" "30" "14" "21796744" "21796744" "subst" "2.43738E-5" "02330" "RPGRIP1_000064" "g.21796744G>A" "" "" "" "RPGRIP1(NM_020366.4):c.3057G>A (p.M1019I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21328585G>A" "" "likely benign" ""
"0000295028" "0" "10" "14" "21798479" "21798479" "subst" "0.00047915" "02330" "RPGRIP1_000066" "g.21798479C>T" "" "" "" "RPGRIP1(NM_020366.3):c.3171C>T (p.H1057=), RPGRIP1(NM_020366.4):c.3171C>T (p.H1057=, p.(His1057=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21330320C>T" "" "benign" ""
"0000295029" "0" "30" "14" "21798486" "21798486" "subst" "0" "02330" "RPGRIP1_000067" "g.21798486G>A" "" "" "" "RPGRIP1(NM_020366.4):c.3178G>A (p.E1060K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21330327G>A" "" "likely benign" ""
"0000295030" "0" "10" "14" "21811302" "21811302" "subst" "0.00150429" "02330" "RPGRIP1_000069" "g.21811302C>T" "" "" "" "RPGRIP1(NM_020366.4):c.3447C>T (p.Y1149=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21343143C>T" "" "benign" ""
"0000295031" "0" "30" "14" "21769282" "21769282" "subst" "7.15499E-5" "02330" "RPGRIP1_000020" "g.21769282G>C" "" "" "" "RPGRIP1(NM_020366.4):c.376G>C (p.G126R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21301123G>C" "" "likely benign" ""
"0000295032" "0" "10" "14" "21769356" "21769356" "subst" "0.00302545" "02330" "RPGRIP1_000021" "g.21769356C>G" "" "" "" "RPGRIP1(NM_020366.3):c.450C>G (p.L150=), RPGRIP1(NM_020366.4):c.450C>G (p.L150=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21301197C>G" "" "benign" ""
"0000295033" "0" "10" "14" "21776010" "21776012" "del" "0" "02330" "RPGRIP1_000029" "g.21776010_21776012del" "" "" "" "RPGRIP1(NM_020366.4):c.906+15_906+17delTCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21307851_21307853del" "" "benign" ""
"0000295034" "0" "10" "14" "21762845" "21762845" "subst" "0.00126206" "02330" "RPGRIP1_000017" "g.21762845T>A" "" "" "" "RPGRIP1(NM_020366.3):c.95T>A (p.M32K), RPGRIP1(NM_020366.4):c.95T>A (p.M32K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21294686T>A" "" "benign" ""
"0000297735" "0" "10" "14" "21785790" "21785790" "subst" "0" "02325" "RPGRIP1_000033" "g.21785790G>A" "" "" "" "RPGRIP1(NM_020366.4):c.1152-65G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21317631G>A" "" "benign" ""
"0000297736" "0" "10" "14" "21790040" "21790040" "subst" "0.201288" "02325" "RPGRIP1_000038" "g.21790040G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1639G>T (p.A547S), RPGRIP1(NM_020366.4):c.1639G>T (p.A547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000297737" "0" "10" "14" "21796784" "21796784" "subst" "0.331661" "02325" "RPGRIP1_000065" "g.21796784G>C" "" "" "" "RPGRIP1(NM_020366.3):c.3097G>C (p.E1033Q), RPGRIP1(NM_020366.4):c.3097G>C (p.E1033Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21328625G>C" "" "benign" ""
"0000297738" "0" "10" "14" "21778727" "21778729" "del" "0" "02325" "RPGRIP1_000030" "g.21778727_21778729del" "" "" "" "RPGRIP1(NM_020366.3):c.907-16_907-14delAAT, RPGRIP1(NM_020366.4):c.907-16_907-14delAAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21310568_21310570del" "" "benign" ""
"0000301490" "0" "10" "14" "21790040" "21790040" "subst" "0.201288" "02326" "RPGRIP1_000038" "g.21790040G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1639G>T (p.A547S), RPGRIP1(NM_020366.4):c.1639G>T (p.A547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000301491" "0" "10" "14" "21794039" "21794039" "subst" "0.00239389" "02326" "RPGRIP1_000054" "g.21794039C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2417C>T (p.T806I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325880C>T" "" "benign" ""
"0000307327" "0" "50" "14" "21785876" "21785876" "subst" "1.47166E-5" "01943" "RPGRIP1_000034" "g.21785876C>G" "" "" "" "RPGRIP1(NM_020366.3):c.1173C>G (p.S391R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21317717C>G" "" "VUS" ""
"0000307328" "0" "30" "14" "21785900" "21785900" "subst" "0.00081791" "01943" "RPGRIP1_000035" "g.21785900C>T" "" "" "" "RPGRIP1(NM_020366.3):c.1197C>T (p.N399=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21317741C>T" "" "likely benign" ""
"0000307329" "0" "10" "14" "21790040" "21790040" "subst" "0.201288" "01943" "RPGRIP1_000038" "g.21790040G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1639G>T (p.A547S), RPGRIP1(NM_020366.4):c.1639G>T (p.A547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000307330" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "01943" "RPGRIP1_000040" "g.21792781G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1767G>T (p.Q589H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000307331" "0" "10" "14" "21792811" "21792811" "subst" "0.207374" "01943" "RPGRIP1_000043" "g.21792811G>A" "" "" "" "RPGRIP1(NM_020366.3):c.1797G>A (p.P599=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324652G>A" "" "benign" ""
"0000307332" "0" "50" "14" "21792951" "21792951" "subst" "4.06128E-6" "01943" "RPGRIP1_000045" "g.21792951G>A" "" "" "" "RPGRIP1(NM_020366.3):c.1937G>A (p.G646E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324792G>A" "" "VUS" ""
"0000307333" "0" "30" "14" "21793114" "21793114" "subst" "0.000515904" "01943" "RPGRIP1_000048" "g.21793114G>T" "" "" "" "RPGRIP1(NM_020366.3):c.2100G>T (p.R700=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324955G>T" "" "likely benign" ""
"0000307334" "0" "10" "14" "21793236" "21793236" "subst" "0.191772" "01943" "RPGRIP1_000049" "g.21793236G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2215+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325077G>A" "" "benign" ""
"0000307335" "0" "50" "14" "21793466" "21793466" "subst" "2.49582E-5" "01943" "RPGRIP1_000051" "g.21793466C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2291C>T (p.A764V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325307C>T" "" "VUS" ""
"0000307336" "0" "30" "14" "21794177" "21794177" "subst" "0.000828541" "01943" "RPGRIP1_000057" "g.21794177G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2555G>A (p.R852Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21326018G>A" "" "likely benign" ""
"0000307337" "0" "10" "14" "21795769" "21795769" "subst" "0.000235734" "01943" "RPGRIP1_000060" "g.21795769G>T" "" "" "" "RPGRIP1(NM_020366.3):c.2711-13G>T, RPGRIP1(NM_020366.4):c.2711-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21327610G>T" "" "benign" ""
"0000307338" "0" "10" "14" "21769193" "21769193" "subst" "0.0704754" "01943" "RPGRIP1_000019" "g.21769193C>A" "" "" "" "RPGRIP1(NM_020366.3):c.287C>A (p.P96Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21301034C>A" "" "benign" ""
"0000307339" "0" "10" "14" "21796784" "21796784" "subst" "0.331661" "01943" "RPGRIP1_000065" "g.21796784G>C" "" "" "" "RPGRIP1(NM_020366.3):c.3097G>C (p.E1033Q), RPGRIP1(NM_020366.4):c.3097G>C (p.E1033Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21328625G>C" "" "benign" ""
"0000307340" "0" "30" "14" "21798479" "21798479" "subst" "0.00047915" "01943" "RPGRIP1_000066" "g.21798479C>T" "" "" "" "RPGRIP1(NM_020366.3):c.3171C>T (p.H1057=), RPGRIP1(NM_020366.4):c.3171C>T (p.H1057=, p.(His1057=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21330320C>T" "" "likely benign" ""
"0000307341" "0" "30" "14" "21813285" "21813285" "subst" "0.0168479" "01943" "RPGRIP1_000070" "g.21813285C>T" "" "" "" "RPGRIP1(NM_020366.3):c.3546C>T (p.D1182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21345126C>T" "" "likely benign" ""
"0000307342" "0" "90" "14" "21770691" "21770691" "del" "0" "01943" "RPGRIP1_000023" "g.21770691del" "" "" "" "RPGRIP1(NM_020366.3):c.535delG (p.E179Sfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302532del" "" "pathogenic" ""
"0000307344" "0" "50" "14" "21762836" "21762836" "subst" "0" "01943" "RPGRIP1_000016" "g.21762836G>T" "" "" "" "RPGRIP1(NM_020366.3):c.86G>T (p.G29V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21294677G>T" "" "VUS" ""
"0000307345" "0" "30" "14" "21762845" "21762845" "subst" "0.00126206" "01943" "RPGRIP1_000017" "g.21762845T>A" "" "" "" "RPGRIP1(NM_020366.3):c.95T>A (p.M32K), RPGRIP1(NM_020366.4):c.95T>A (p.M32K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21294686T>A" "" "likely benign" ""
"0000337509" "0" "10" "14" "21793236" "21793236" "subst" "0.191772" "02327" "RPGRIP1_000049" "g.21793236G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2215+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325077G>A" "" "benign" ""
"0000339668" "0" "10" "14" "21792811" "21792811" "subst" "0.207374" "02327" "RPGRIP1_000043" "g.21792811G>A" "" "" "" "RPGRIP1(NM_020366.3):c.1797G>A (p.P599=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324652G>A" "" "benign" ""
"0000341495" "0" "10" "14" "21790040" "21790040" "subst" "0.201288" "02327" "RPGRIP1_000038" "g.21790040G>T" "" "" "" "RPGRIP1(NM_020366.3):c.1639G>T (p.A547S), RPGRIP1(NM_020366.4):c.1639G>T (p.A547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000341774" "0" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "02327" "RPGRIP1_000002" "g.21813304C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000342477" "0" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "02327" "RPGRIP1_000026" "g.21771701C>T" "" "" "" "RPGRIP1(NM_020366.4):c.799C>T (p.(Arg267*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21303542C>T" "" "pathogenic" ""
"0000343155" "0" "10" "14" "21792807" "21792807" "subst" "0.00354431" "02327" "RPGRIP1_000041" "g.21792807G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324648G>A" "" "benign" ""
"0000343393" "0" "90" "14" "21794062" "21794062" "subst" "8.13703E-6" "02327" "RPGRIP1_000055" "g.21794062C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2440C>T (p.R814*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21325903C>T" "" "pathogenic" ""
"0000343424" "0" "90" "14" "21794176" "21794176" "subst" "4.06131E-6" "02327" "RPGRIP1_000056" "g.21794176C>T" "" "" "" "RPGRIP1(NM_020366.4):c.2554C>T (p.R852*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21326017C>T" "" "pathogenic" ""
"0000347461" "0" "10" "14" "21770730" "21770730" "subst" "0.503623" "02327" "RPGRIP1_000001" "g.21770730A>G" "" "" "" "RPGRIP1(NM_020366.3):c.574A>G (p.K192E), RPGRIP1(NM_020366.4):c.574A>G (p.K192E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21302571A>G" "" "benign" ""
"0000348538" "0" "70" "14" "21792962" "21792962" "subst" "0" "02327" "RPGRIP1_000046" "g.21792962C>T" "" "" "" "RPGRIP1(NM_020366.4):c.1948C>T (p.P650S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21324803C>T" "" "likely pathogenic" ""
"0000348618" "0" "90" "14" "21795863" "21795864" "ins" "0" "02327" "RPGRIP1_000008" "g.21795863_21795864insGGTA" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21327704_21327705insGGTA" "" "pathogenic" ""
"0000349898" "0" "50" "14" "21816396" "21816396" "subst" "1.84415E-5" "02327" "RPGRIP1_000071" "g.21816396A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21348237A>G" "" "VUS" ""
"0000358335" "3" "90" "14" "21790016" "21790025" "del" "0" "01243" "RPGRIP1_000037" "g.21790016_21790025del" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.21321857_21321866del" "" "pathogenic" ""
"0000358336" "3" "70" "14" "21793424" "21793424" "subst" "0" "01243" "RPGRIP1_000050" "g.21793424A>G" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.21325265A>G" "" "likely pathogenic" ""
"0000358337" "3" "90" "14" "21796661" "21796661" "del" "0" "01243" "RPGRIP1_000063" "g.21796661del" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.21328502del" "" "pathogenic" ""
"0000487580" "3" "90" "14" "21790025" "21790025" "del" "0" "03335" "RPGRIP1_000073" "g.21790025del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21321866del" "" "pathogenic (recessive)" ""
"0000487581" "3" "90" "14" "21780630" "21780630" "del" "0" "03335" "RPGRIP1_000072" "g.21780630del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.21312471del" "" "pathogenic (recessive)" ""
"0000551496" "0" "90" "14" "21762926" "21762926" "del" "0" "02330" "RPGRIP1_000074" "g.21762926del" "" "" "" "RPGRIP1(NM_020366.4):c.176delT (p.L59Wfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21294767del" "" "pathogenic" ""
"0000551497" "0" "50" "14" "21769259" "21769259" "subst" "1.71076E-5" "02330" "RPGRIP1_000075" "g.21769259G>A" "" "" "" "RPGRIP1(NM_020366.4):c.353G>A (p.R118H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21301100G>A" "" "VUS" ""
"0000551498" "0" "10" "14" "21769356" "21769356" "subst" "0.00302545" "01943" "RPGRIP1_000021" "g.21769356C>G" "" "" "" "RPGRIP1(NM_020366.3):c.450C>G (p.L150=), RPGRIP1(NM_020366.4):c.450C>G (p.L150=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21301197C>G" "" "benign" ""
"0000551499" "0" "10" "14" "21770644" "21770644" "subst" "0.000164988" "02330" "RPGRIP1_000076" "g.21770644T>C" "" "" "" "RPGRIP1(NM_020366.3):c.491-3T>C, RPGRIP1(NM_020366.4):c.491-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21302485T>C" "" "benign" ""
"0000551500" "0" "30" "14" "21770644" "21770644" "subst" "0.000164988" "01943" "RPGRIP1_000076" "g.21770644T>C" "" "" "" "RPGRIP1(NM_020366.3):c.491-3T>C, RPGRIP1(NM_020366.4):c.491-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21302485T>C" "" "likely benign" ""
"0000551501" "0" "30" "14" "21771685" "21771685" "subst" "4.06762E-6" "02330" "RPGRIP1_000077" "g.21771685G>A" "" "" "" "RPGRIP1(NM_020366.4):c.783G>A (p.Q261=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21303526G>A" "" "likely benign" ""
"0000551502" "0" "50" "14" "21775897" "21775897" "subst" "0.000146629" "01943" "RPGRIP1_000027" "g.21775897A>G" "" "" "" "RPGRIP1(NM_020366.3):c.808A>G (p.I270V), RPGRIP1(NM_020366.4):c.808A>G (p.I270V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21307738A>G" "" "VUS" ""
"0000551503" "0" "90" "14" "21775990" "21775990" "subst" "0" "02330" "RPGRIP1_000078" "g.21775990C>T" "" "" "" "RPGRIP1(NM_020366.4):c.901C>T (p.Q301*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21307831C>T" "" "pathogenic" ""
"0000551504" "0" "10" "14" "21778727" "21778729" "del" "0" "02326" "RPGRIP1_000030" "g.21778727_21778729del" "" "" "" "RPGRIP1(NM_020366.3):c.907-16_907-14delAAT, RPGRIP1(NM_020366.4):c.907-16_907-14delAAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21310568_21310570del" "" "benign" ""
"0000551505" "0" "50" "14" "21785939" "21785939" "subst" "5.76037E-5" "02330" "RPGRIP1_000079" "g.21785939G>A" "" "" "" "RPGRIP1(NM_020366.3):c.1236G>A (p.Q412=), RPGRIP1(NM_020366.4):c.1236G>A (p.Q412=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21317780G>A" "" "VUS" ""
"0000551506" "0" "30" "14" "21786013" "21786013" "subst" "0" "02330" "RPGRIP1_000080" "g.21786013G>T" "" "" "" "RPGRIP1(NM_020366.4):c.1306+4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21317854G>T" "" "likely benign" ""
"0000551507" "0" "30" "14" "21790154" "21790154" "subst" "0.00167535" "01804" "RPGRIP1_000039" "g.21790154C>T" "" "" "" "RPGRIP1(NM_020366.3):c.1753C>T (p.(Pro585Ser)), RPGRIP1(NM_020366.4):c.1753C>T (p.P585S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21321995C>T" "" "likely benign" ""
"0000551509" "0" "10" "14" "21793398" "21793398" "subst" "1.24771E-5" "02330" "RPGRIP1_000082" "g.21793398T>C" "" "" "" "RPGRIP1(NM_020366.4):c.2223T>C (p.G741=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325239T>C" "" "benign" ""
"0000551510" "0" "30" "14" "21793439" "21793439" "subst" "3.26395E-5" "01804" "RPGRIP1_000083" "g.21793439G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2264G>A (p.(Arg755His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325280G>A" "" "likely benign" ""
"0000551511" "0" "30" "14" "21793459" "21793459" "subst" "0.00329785" "02330" "RPGRIP1_000084" "g.21793459C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2284C>T (p.L762=), RPGRIP1(NM_020366.4):c.2284C>T (p.L762=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325300C>T" "" "likely benign" ""
"0000551512" "0" "30" "14" "21793459" "21793459" "subst" "0.00329785" "01943" "RPGRIP1_000084" "g.21793459C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2284C>T (p.L762=), RPGRIP1(NM_020366.4):c.2284C>T (p.L762=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325300C>T" "" "likely benign" ""
"0000551513" "0" "30" "14" "21793459" "21793459" "subst" "0.00329785" "02326" "RPGRIP1_000084" "g.21793459C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2284C>T (p.L762=), RPGRIP1(NM_020366.4):c.2284C>T (p.L762=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325300C>T" "" "likely benign" ""
"0000551514" "0" "50" "14" "21794057" "21794057" "subst" "0.00102556" "02330" "RPGRIP1_000085" "g.21794057G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2435G>A (p.R812Q), RPGRIP1(NM_020366.4):c.2435G>A (p.R812Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325898G>A" "" "VUS" ""
"0000551515" "0" "70" "14" "21794057" "21794057" "subst" "0.00102556" "01943" "RPGRIP1_000085" "g.21794057G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2435G>A (p.R812Q), RPGRIP1(NM_020366.4):c.2435G>A (p.R812Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325898G>A" "" "likely pathogenic" ""
"0000551516" "0" "90" "14" "21794062" "21794062" "subst" "8.13703E-6" "01943" "RPGRIP1_000055" "g.21794062C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2440C>T (p.R814*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325903C>T" "" "pathogenic" ""
"0000551517" "0" "90" "14" "21794176" "21794176" "subst" "4.06131E-6" "02330" "RPGRIP1_000056" "g.21794176C>T" "" "" "" "RPGRIP1(NM_020366.4):c.2554C>T (p.R852*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21326017C>T" "" "pathogenic" ""
"0000551518" "0" "30" "14" "21794222" "21794222" "subst" "7.72207E-5" "01804" "RPGRIP1_000086" "g.21794222G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2600G>A (p.(Arg867Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21326063G>A" "" "likely benign" ""
"0000551519" "0" "50" "14" "21802832" "21802833" "ins" "5.38481E-5" "01943" "RPGRIP1_000087" "g.21802832_21802833insAAATA" "" "" "" "RPGRIP1(NM_020366.3):c.3307_3308insAAATA (p.V1103Efs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21334673_21334674insAAATA" "" "VUS" ""
"0000551520" "0" "30" "14" "21802834" "21802835" "del" "5.39093E-5" "01943" "RPGRIP1_000088" "g.21802834_21802835del" "" "" "" "RPGRIP1(NM_020366.3):c.3309_3310delGC (p.P1104Tfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21334675_21334676del" "" "likely benign" ""
"0000551521" "0" "50" "14" "21811213" "21811213" "subst" "0.00040791" "02330" "RPGRIP1_000089" "g.21811213A>G" "" "" "" "RPGRIP1(NM_020366.3):c.3358A>G (p.I1120V), RPGRIP1(NM_020366.4):c.3358A>G (p.I1120V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21343054A>G" "" "VUS" ""
"0000551522" "0" "10" "14" "21811338" "21811338" "subst" "4.07302E-6" "02330" "RPGRIP1_000090" "g.21811338C>T" "" "" "" "RPGRIP1(NM_020366.4):c.3483C>T (p.S1161=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21343179C>T" "" "benign" ""
"0000551523" "0" "30" "14" "21820890" "21820890" "subst" "1.63531E-5" "01804" "SUPT16H_000031" "g.21820890C>T" "" "" "" "SUPT16H(NM_007192.3):c.3086G>A (p.(Arg1029His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.21352731C>T" "" "likely benign" ""
"0000604552" "3" "70" "14" "21813304" "21813310" "del" "0" "03508" "RPGRIP1_000093" "g.21813304_21813310del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" ""
"0000604553" "11" "70" "14" "21793477" "21793477" "subst" "2.56432E-5" "03508" "RPGRIP1_000092" "g.21793477C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.21325318C>T" "" "pathogenic (recessive)" ""
"0000604554" "21" "70" "14" "21813304" "21813310" "del" "0" "03508" "RPGRIP1_000093" "g.21813304_21813310del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" ""
"0000604555" "3" "70" "14" "21813304" "21813310" "del" "0" "03508" "RPGRIP1_000093" "g.21813304_21813310del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" ""
"0000604570" "0" "70" "14" "21793093" "21793093" "subst" "0" "03508" "RPGRIP1_000094" "g.21793093C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.21324934C>G" "" "pathogenic (recessive)" ""
"0000604571" "0" "70" "14" "21793226" "21793250" "del" "0" "03508" "RPGRIP1_000095" "g.21793226_21793250del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.21325067_21325091del" "" "pathogenic (recessive)" ""
"0000614762" "0" "10" "14" "21762903" "21762903" "subst" "2.03136E-5" "02330" "RPGRIP1_000096" "g.21762903T>C" "" "" "" "RPGRIP1(NM_020366.4):c.153T>C (p.F51=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21294744T>C" "" "benign" ""
"0000614763" "0" "30" "14" "21771577" "21771577" "subst" "4.06402E-6" "01943" "RPGRIP1_000097" "g.21771577C>T" "" "" "" "RPGRIP1(NM_020366.3):c.675C>T (p.H225=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21303418C>T" "" "likely benign" ""
"0000614764" "0" "30" "14" "21780642" "21780642" "subst" "0" "01943" "RPGRIP1_000098" "g.21780642C>A" "" "" "" "RPGRIP1(NM_020366.3):c.1128C>A (p.D376E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21312483C>A" "" "likely benign" ""
"0000614765" "0" "50" "14" "21794102" "21794102" "subst" "6.09419E-5" "01943" "RPGRIP1_000099" "g.21794102G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2480G>A (p.R827H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21325943G>A" "" "VUS" ""
"0000614766" "0" "30" "14" "21795769" "21795769" "subst" "0.000235734" "02330" "RPGRIP1_000060" "g.21795769G>T" "" "" "" "RPGRIP1(NM_020366.3):c.2711-13G>T, RPGRIP1(NM_020366.4):c.2711-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21327610G>T" "" "likely benign" ""
"0000614767" "0" "30" "14" "21795949" "21795949" "subst" "8.59564E-6" "01943" "RPGRIP1_000100" "g.21795949G>T" "" "" "" "RPGRIP1(NM_020366.3):c.2878G>T (p.A960S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21327790G>T" "" "likely benign" ""
"0000648828" "1" "30" "14" "21769193" "21769193" "subst" "0.0704754" "03575" "RPGRIP1_000019" "g.21769193C>A" "209/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "209 heterozygous; {DB:CLININrs1040904}" "Germline" "" "rs1040904" "0" "" "" "g.21301034C>A" "" "likely benign" ""
"0000648829" "1" "30" "14" "21792781" "21792781" "subst" "0.00284494" "03575" "RPGRIP1_000040" "g.21792781G>T" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs34067949}" "Germline" "" "rs34067949" "0" "" "" "g.21324622G>T" "" "likely benign" ""
"0000648830" "1" "50" "14" "21793089" "21793089" "subst" "3.65512E-5" "03575" "RPGRIP1_000101" "g.21793089A>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs200401966}" "Germline" "" "rs200401966" "0" "" "" "g.21324930A>G" "" "VUS" ""
"0000648831" "1" "50" "14" "21813285" "21813285" "subst" "0.0168479" "03575" "RPGRIP1_000070" "g.21813285C>T" "18/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 18 heterozygous; {DB:CLININrs34116882}" "Germline" "" "rs34116882" "0" "" "" "g.21345126C>T" "" "VUS" ""
"0000657368" "0" "50" "14" "21794213" "21794213" "subst" "0" "02327" "RPGRIP1_000102" "g.21794213A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.21326054A>G" "" "VUS" ""
"0000669237" "3" "30" "14" "21769193" "21769193" "subst" "0.0704754" "03575" "RPGRIP1_000019" "g.21769193C>A" "5/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 homozygous; {DB:CLININrs1040904}" "Germline" "" "rs1040904" "0" "" "" "g.21301034C>A" "" "likely benign" ""
"0000669238" "3" "50" "14" "21813285" "21813285" "subst" "0.0168479" "03575" "RPGRIP1_000070" "g.21813285C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 homozygous; {DB:CLININrs34116882}" "Germline" "" "rs34116882" "0" "" "" "g.21345126C>T" "" "VUS" ""
"0000679897" "0" "90" "14" "21780621" "21780621" "del" "0" "02330" "RPGRIP1_000006" "g.21780621del" "" "" "" "RPGRIP1(NM_020366.4):c.1107delA (p.E370Nfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000679898" "0" "50" "14" "21793041" "21793041" "subst" "0" "01804" "RPGRIP1_000103" "g.21793041A>G" "" "" "" "RPGRIP1(NM_020366.3):c.2027A>G (p.(Tyr676Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000679899" "0" "90" "14" "21793197" "21793198" "del" "0" "02330" "RPGRIP1_000104" "g.21793197_21793198del" "" "" "" "RPGRIP1(NM_020366.4):c.2183_2184delTG (p.V728Gfs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000679900" "0" "30" "14" "21794172" "21794172" "subst" "0.000393931" "01943" "RPGRIP1_000105" "g.21794172G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2550G>A (p.Q850=), RPGRIP1(NM_020366.4):c.2550G>A (p.Q850=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000679901" "0" "50" "14" "21802823" "21802823" "subst" "0" "01943" "RPGRIP1_000106" "g.21802823G>T" "" "" "" "RPGRIP1(NM_020366.3):c.3298G>T (p.D1100Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000684408" "3" "70" "14" "21793035" "21793035" "subst" "4.06111E-6" "00004" "RPGRIP1_000108" "g.21793035C>A" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324876C>A" "" "likely pathogenic (recessive)" ""
"0000684578" "1" "70" "14" "21771575" "21771575" "del" "0" "00004" "RPGRIP1_000107" "g.21771575del" "2/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.21303416del" "" "likely pathogenic" ""
"0000684642" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00004" "RPGRIP1_000038" "g.21790040G>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.21321881G>T" "" "likely pathogenic (recessive)" ""
"0000685464" "0" "90" "14" "21790016" "21790025" "del" "0" "00004" "RPGRIP1_000037" "g.21790016_21790025del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685465" "0" "70" "14" "21793424" "21793424" "subst" "0" "00004" "RPGRIP1_000050" "g.21793424A>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000685466" "0" "90" "14" "21796622" "21796622" "subst" "0" "00004" "RPGRIP1_000109" "g.21796622C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685467" "0" "90" "14" "21796661" "21796661" "del" "0" "00004" "RPGRIP1_000063" "g.21796661del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685468" "0" "90" "14" "21816376" "21816379" "del" "0" "00004" "RPGRIP1_000110" "g.21816376_21816379del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000691605" "0" "90" "14" "21788223" "21788223" "del" "0" "01943" "RPGRIP1_000111" "g.21788223del" "" "" "" "RPGRIP1(NM_020366.3):c.1354delC (p.H452Ifs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000691606" "0" "50" "14" "21816392" "21816392" "subst" "0" "01943" "RPGRIP1_000112" "g.21816392G>C" "" "" "" "RPGRIP1(NM_020366.3):c.3679G>C (p.G1227R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000710259" "3" "90" "14" "21762904" "21762904" "subst" "1.21912E-5" "00006" "RPGRIP1_000003" "g.21762904C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.21294745C>T" "" "pathogenic" ""
"0000710261" "1" "90" "14" "21795846" "21795846" "subst" "8.12308E-6" "00006" "RPGRIP1_000113" "g.21795846G>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.21327687G>A" "" "pathogenic" ""
"0000710276" "3" "90" "14" "21790025" "21790025" "del" "0" "00006" "RPGRIP1_000073" "g.21790025del" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "1624delG" "ACMG PVS1, PM2, PP4" "Germline" "" "" "0" "" "" "g.21321866del" "" "pathogenic" "ACMG"
"0000710293" "3" "90" "14" "21780630" "21780630" "del" "0" "00006" "RPGRIP1_000072" "g.21780630del" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "1116delA" "ACMG PVS1, PM2, PP4" "Germline" "" "" "0" "" "" "g.21312471del" "" "pathogenic" "ACMG"
"0000713291" "0" "90" "14" "21796628" "21796628" "subst" "4.06352E-6" "00000" "RPGRIP1_000116" "g.21796628C>T" "" "{PMID:Carss 2017:28041643}" "" "14:21796628C>T ENST00000400017.2:c.2941C>T (Arg981Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713511" "3" "90" "14" "21795960" "21795960" "del" "0" "00000" "RPGRIP1_000115" "g.21795960del" "" "{PMID:Carss 2017:28041643}" "" "14:21795959CT>C ENST00000400017.2:c.2890delT (Ser964ProfsTer37)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713666" "3" "90" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Carss 2017:28041643}" "" "14:21794020G>A ENST00000400017.2:c.2398G>A (Glu800Lys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713674" "0" "90" "14" "21780627" "21780627" "del" "8.18806E-6" "00000" "RPGRIP1_000114" "g.21780627del" "" "{PMID:Carss 2017:28041643}" "" "14:21780626GA>G ENST00000400017.2:c.1116delA (Lys372AsnfsTer3)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713701" "0" "90" "14" "21798428" "21798428" "subst" "0" "00000" "RPGRIP1_000118" "g.21798428G>A" "" "{PMID:Carss 2017:28041643}" "" "14:21798428G>A ENST00000400017.2:c.3120G>A (Trp1040Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000714068" "2" "70" "14" "21798407" "21798547" "del" "0" "00000" "RPGRIP1_000117" "g.(21796787_21798407)_(21798547_21802813)del" "" "{PMID:Taylor 2017:28341476}" "" "ex19 deletion" "" "Germline" "" "" "0" "" "" "g.(21328628_21330248)_(21330388_21334654)del" "" "likely pathogenic (recessive)" ""
"0000714103" "1" "70" "14" "21793093" "21793093" "subst" "0" "00000" "RPGRIP1_000094" "g.21793093C>G" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.21324934C>G" "" "likely pathogenic (recessive)" ""
"0000724665" "0" "50" "14" "21762974" "21762974" "subst" "0.000143776" "01943" "RPGRIP1_000119" "g.21762974T>C" "" "" "" "RPGRIP1(NM_020366.3):c.218+6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000724666" "0" "30" "14" "21769278" "21769278" "subst" "0" "01943" "RPGRIP1_000120" "g.21769278G>A" "" "" "" "RPGRIP1(NM_020366.3):c.372G>A (p.L124=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724667" "0" "30" "14" "21769359" "21769359" "subst" "0" "01943" "RPGRIP1_000121" "g.21769359C>T" "" "" "" "RPGRIP1(NM_020366.3):c.453C>T (p.H151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724668" "0" "30" "14" "21793506" "21793506" "subst" "0" "01943" "RPGRIP1_000122" "g.21793506C>A" "" "" "" "RPGRIP1(NM_020366.3):c.2331C>A (p.T777=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724669" "0" "30" "14" "21794019" "21794019" "subst" "1.6349E-5" "01943" "RPGRIP1_000053" "g.21794019C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2397C>T (p.N799=), RPGRIP1(NM_020366.4):c.2397C>T (p.N799=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724670" "0" "50" "14" "21794239" "21794239" "subst" "2.4424E-5" "01943" "RPGRIP1_000123" "g.21794239C>G" "" "" "" "RPGRIP1(NM_020366.3):c.2617C>G (p.H873D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000724671" "0" "50" "14" "21811213" "21811213" "subst" "0.00040791" "01943" "RPGRIP1_000089" "g.21811213A>G" "" "" "" "RPGRIP1(NM_020366.3):c.3358A>G (p.I1120V), RPGRIP1(NM_020366.4):c.3358A>G (p.I1120V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000731011" "1" "70" "14" "21771669" "21771669" "subst" "0" "00000" "RPGRIP1_000128" "g.21771669C>G" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "" "0" "" "" "g.21303510C>G" "" "likely pathogenic (recessive)" ""
"0000731012" "3" "70" "14" "21785883" "21785883" "subst" "0" "00000" "RPGRIP1_000130" "g.21785883C>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "" "0" "" "" "g.21317724C>T" "" "likely pathogenic (recessive)" ""
"0000731055" "0" "50" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs10151259" "0" "" "" "g.21321881G>T" "" "VUS" ""
"0000731074" "0" "50" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs17103671" "0" "" "" "g.21343037A>G" "" "VUS" ""
"0000731083" "2" "70" "14" "21780601" "21780604" "del" "0" "00000" "RPGRIP1_000129" "g.21780601_21780604del" "" "{PMID:Bryant 2018:29343940}" "" "1084_1087del" "" "Germline" "" "" "0" "" "" "g.21312442_21312445del" "" "likely pathogenic (recessive)" ""
"0000731252" "21" "70" "14" "21785922" "21785922" "subst" "0" "00000" "RPGRIP1_000125" "g.21785922C>T" "" "{PMID:Thompson 2017:29178642}" "" "[1219C>T;1763-8C>G]" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000731253" "21" "70" "14" "21796622" "21796622" "subst" "0" "00000" "RPGRIP1_000109" "g.21796622C>T" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.21328463C>T" "" "likely pathogenic (recessive)" ""
"0000731277" "11" "70" "14" "21798377" "21798551" "del" "0" "00000" "RPGRIP1_000124" "g.(21798302_21798377)_(21798551_21799045)del" "" "{PMID:Thompson 2017:29178642}" "" "del ex19" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000731278" "11" "70" "14" "21788316" "21788316" "subst" "0" "00000" "RPGRIP1_000131" "g.21788316C>T" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.21320157C>T" "" "likely pathogenic (recessive)" ""
"0000731294" "21" "50" "14" "21792769" "21792769" "subst" "4.09695E-6" "00000" "RPGRIP1_000126" "g.21792769C>G" "" "{PMID:Thompson 2017:29178642}" "" "1219C>T;1763-8C>G" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000731314" "11" "70" "14" "21793477" "21793477" "subst" "2.56432E-5" "00000" "RPGRIP1_000092" "g.21793477C>T" "" "{PMID:Rim 2017:29145603}" "" "" "" "Germline" "" "" "0" "" "" "g.21325318C>T" "" "likely pathogenic (recessive)" ""
"0000731315" "3" "70" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Rim 2017:29145603}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145_21345151del" "" "likely pathogenic (recessive)" ""
"0000731340" "21" "70" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Rim 2017:29145603}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145_21345151del" "" "likely pathogenic (recessive)" ""
"0000731347" "1" "70" "14" "21813304" "21813310" "del" "0" "00006" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Han 2017:28966547}" "" "c.3565_3571delCGAAGGC" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000731348" "1" "70" "14" "21793093" "21793093" "subst" "0" "00006" "RPGRIP1_000094" "g.21793093C>G" "" "{PMID:Han 2017:28966547}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000731349" "2" "70" "14" "21793223" "21793247" "del" "0" "00006" "RPGRIP1_000095" "g.21793223_21793247del" "" "{PMID:Han 2017:28966547}" "" "2209_2215+18del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000731444" "1" "70" "14" "21762833" "21762833" "subst" "0" "00000" "RPGRIP1_000127" "g.21762833T>G" "" "{PMID:DiIorio 2017:29053603}" "" "" "" "Germline" "" "" "0" "" "" "g.21294674T>G" "" "likely pathogenic (recessive)" ""
"0000731459" "2" "70" "14" "21793402" "21793403" "del" "0" "00000" "RPGRIP1_000132" "g.21793402_21793403del" "" "{PMID:DiIorio 2017:29053603}" "" "c.2225_2226del" "" "Germline" "" "" "0" "" "" "g.21325243_21325244del" "" "likely pathogenic (recessive)" ""
"0000732476" "0" "50" "14" "21811257" "21811259" "del" "0.000158473" "00000" "RPGRIP1_000140" "g.21811257_21811259del" "" "{PMID:Costa 2017:28912962}" "" "3402_3404delGTC" "" "Germline" "" "" "0" "" "" "g.21343098_21343100del" "" "VUS" ""
"0000732520" "0" "90" "14" "21769162" "21769162" "subst" "0.00182904" "00000" "RPGRIP1_000133" "g.21769162C>T" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.21301003C>T" "" "pathogenic" ""
"0000732606" "0" "50" "14" "21790154" "21790154" "subst" "0.00167535" "00000" "RPGRIP1_000039" "g.21790154C>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.21321995C>T" "" "VUS" ""
"0000732627" "0" "90" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "rs34067949" "0" "" "" "g.21324622G>T" "" "pathogenic" ""
"0000732662" "3" "70" "14" "21802869" "21802869" "subst" "0" "00000" "RPGRIP1_000139" "g.21802869G>A" "" "{PMID:Soens 2017:28714225}" "" "" "effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.21334710G>A" "" "likely pathogenic" ""
"0000732671" "1" "70" "14" "21789561" "21789561" "subst" "0" "00000" "RPGRIP1_000136" "g.21789561G>A" "" "{PMID:Soens 2017:28714225}" "" "" "effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.21321402G>A" "" "likely pathogenic" ""
"0000732683" "1" "70" "14" "21770720" "21770720" "subst" "0" "00000" "RPGRIP1_000134" "g.21770720A>G" "" "{PMID:Soens 2017:28714225}" "" "" "effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.21302561A>G" "" "likely pathogenic" ""
"0000732692" "2" "70" "14" "21795789" "21795789" "dup" "0" "00000" "RPGRIP1_000061" "g.21795789dup" "" "{PMID:Soens 2017:28714225}" "" "2714_2715insT" "" "Germline" "" "" "0" "" "" "g.21327630dup" "" "likely pathogenic" ""
"0000732702" "2" "70" "14" "21795830" "21795831" "ins" "0" "00000" "RPGRIP1_000138" "g.21795830_21795831insT" "" "{PMID:Soens 2017:28714225}" "" "" "" "Germline" "" "" "0" "" "" "g.21327671_21327672insT" "" "likely pathogenic" ""
"0000733199" "3" "70" "14" "21790016" "21790025" "del" "0" "00000" "RPGRIP1_000037" "g.21790016_21790025del" "" "{PMID:Stone 2017:28559085}" "" "1614_1623delGGAACTGGAG" "" "Germline" "" "" "0" "" "" "g.21321857_21321866del" "" "likely pathogenic" ""
"0000733200" "1" "70" "14" "21792906" "21792906" "subst" "1.21831E-5" "00000" "RPGRIP1_000137" "g.21792906A>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.21324747A>G" "" "likely pathogenic" ""
"0000733630" "2" "70" "14" "21771613" "21771613" "del" "0" "00000" "RPGRIP1_000135" "g.21771613del" "" "{PMID:Stone 2017:28559085}" "" "711delA" "" "Germline" "" "" "0" "" "" "g.21303454del" "" "likely pathogenic" ""
"0000735672" "0" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "00000" "RPGRIP1_000026" "g.21771701C>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.21303542C>T" "" "pathogenic" ""
"0000735770" "0" "90" "14" "21795789" "21795789" "dup" "0" "00000" "RPGRIP1_000061" "g.21795789dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.21327630dup" "" "pathogenic" ""
"0000735843" "1" "70" "14" "21775984" "21775985" "del" "0" "00000" "RPGRIP1_000013" "g.21775984_21775985del" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.21307825_21307826del" "" "likely pathogenic" ""
"0000735863" "2" "70" "14" "21793565" "21793565" "del" "0" "00000" "RPGRIP1_000014" "g.21793565del" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.21325406del" "" "likely pathogenic" ""
"0000735996" "1" "70" "14" "21785923" "21785923" "dup" "0" "02485" "RPGRIP1_000143" "g.21785923dup" "" "{PMID:Bravo-Gil 2017:28157192}" "" "c.1220dupA" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.21317764dup" "" "likely pathogenic" ""
"0000736217" "1" "90" "14" "21793402" "21793403" "del" "0" "00000" "RPGRIP1_000132" "g.21793402_21793403del" "" "{PMID:Bernardis 2016:28127548}" "" "c.2225_2226delGA" "" "Germline" "" "" "0" "" "" "g.21325243_21325244del" "" "pathogenic" ""
"0000736261" "2" "90" "14" "21795867" "21795867" "dup" "0" "00000" "RPGRIP1_000144" "g.21795867dup" "" "{PMID:Bernardis 2016:28127548}" "" "c.2795_2796insT" "" "Germline" "" "" "0" "" "" "g.21327708dup" "" "pathogenic" ""
"0000736357" "1" "70" "14" "21790015" "21790024" "del" "2.4874E-5" "00008" "RPGRIP1_000037" "g.21790015_21790024del" "" "{PMID:Booij 2005:16272259}" "" "Glu538Glufs2" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000736358" "1" "70" "14" "21811196" "21811196" "subst" "0.00828142" "00008" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Booij 2005:16272259}" "" "Asp1114Gly" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000736378" "1" "10" "14" "21770681" "21770681" "subst" "0.156312" "00008" "RPGRIP1_000022" "g.21770681A>G" "" "{PMID:Dryja 2001:11283794}; {PMID:Booij 2005:16272259}" "" "525A>G" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736379" "1" "10" "14" "21770730" "21770730" "subst" "0.503623" "00008" "RPGRIP1_000001" "g.21770730A>G" "" "{PMID:Dryja 2001:11283794}; {PMID:Booij 2005:16272259}" "" "574A>G" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736380" "1" "10" "14" "21792811" "21792811" "subst" "0.207374" "00008" "RPGRIP1_000043" "g.21792811G>A" "" "{PMID:Dryja 2001:11283794}; {PMID:Booij 2005:16272259}" "" "1797G>A" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736381" "1" "10" "14" "21796784" "21796784" "subst" "0.331661" "00008" "RPGRIP1_000065" "g.21796784G>C" "" "{PMID:Dryja 2001:11283794}; {PMID:Booij 2005:16272259}" "" "3097G>C" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736382" "1" "10" "14" "21813285" "21813285" "subst" "0.0168479" "00008" "RPGRIP1_000070" "g.21813285C>T" "" "{PMID:Dryja 2001:11283794}; {PMID:Booij 2005:16272259}" "" "3546C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736383" "1" "10" "14" "21793467" "21793467" "subst" "0.00151197" "00008" "RPGRIP1_000052" "g.21793467G>A" "" "Miller 1988; {PMID:Booij 2005:16272259}" "" "2292G>A" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736384" "1" "10" "14" "21769192" "21769193" "ins" "0" "00008" "RPGRIP1_000141" "g.21769192_21769193insATA" "" "{PMID:Booij 2005:16272259}" "" "IVS6-16-15insATA" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736385" "1" "10" "14" "21778589" "21778590" "del" "0" "00008" "RPGRIP1_000142" "g.21778589_21778590del" "" "{PMID:Booij 2005:16272259}" "" "IVS6-153_-154delGG" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000736386" "1" "10" "14" "21790040" "21790040" "subst" "0.201288" "00008" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Booij 2005:16272259}" "" "1639G>T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000759844" "1" "70" "14" "21785913" "21785913" "subst" "0" "00000" "RPGRIP1_000146" "g.21785913G>T" "" "{PMID:Wang 2016:27422788}" "" "c.G1210T p.E404X" "" "Germline" "" "" "0" "" "" "g.21317754G>T" "" "likely pathogenic" ""
"0000759845" "3" "70" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Wang 2016:27422788}" "" "c.534delG p.K178fs" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "likely pathogenic" ""
"0000759846" "3" "70" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Wang 2016:27422788}" "" "c.534delG p.K178fs" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "likely pathogenic" ""
"0000759847" "1" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Wang 2016:27422788}" "" "c.G2398A p.E800K" "" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "likely pathogenic" ""
"0000759876" "2" "70" "14" "21780016" "21780019" "dup" "0" "00000" "RPGRIP1_000145" "g.21780016_21780019dup" "" "{PMID:Wang 2016:27422788}" "" "c.961_962insCCCT p.A321fs" "" "Germline" "" "" "0" "" "" "g.21311857_21311860dup" "" "likely pathogenic" ""
"0000759877" "2" "70" "14" "21793072" "21793072" "dup" "0" "00000" "RPGRIP1_000151" "g.21793072dup" "" "{PMID:Wang 2016:27422788}" "" "c.2058dupA p.T686fs" "" "Germline" "" "" "0" "" "" "g.21324913dup" "" "likely pathogenic" ""
"0000759890" "3" "70" "14" "21795961" "21795961" "del" "0" "00000" "RPGRIP1_000155" "g.21795961del" "" "{PMID:Tiwari 2016:27391102}" "" "" "" "Germline" "" "" "0" "" "" "g.21327802del" "" "likely pathogenic (recessive)" ""
"0000759987" "0" "50" "14" "21793080" "21793080" "subst" "0" "00000" "RPGRIP1_000152" "g.21793080T>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.21324921T>C" "" "VUS" ""
"0000759994" "0" "50" "14" "21811213" "21811213" "subst" "0.00040791" "00000" "RPGRIP1_000089" "g.21811213A>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.21343054A>G" "" "VUS" ""
"0000760043" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000760055" "0" "50" "14" "21793031" "21793031" "subst" "0" "00000" "RPGRIP1_000150" "g.21793031C>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.21324872C>T" "" "VUS" ""
"0000760176" "3" "50" "14" "21794230" "21794231" "ins" "0" "00000" "RPGRIP1_000154" "g.21794230_21794231insA" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21326071_21326072insA" "" "VUS" ""
"0000760189" "3" "70" "14" "21816333" "21816333" "subst" "0" "00000" "RPGRIP1_000156" "g.21816333T>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21348174T>G" "" "likely pathogenic" ""
"0000760198" "3" "50" "14" "21793021" "21793021" "del" "0" "00000" "RPGRIP1_000149" "g.21793021del" "" "{PMID:Ellingford 2016:27208204}" "" "2007delT" "" "Germline" "" "" "0" "" "" "g.21324862del" "" "VUS" ""
"0000760201" "3" "70" "14" "21792906" "21792906" "subst" "1.21831E-5" "00000" "RPGRIP1_000137" "g.21792906A>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21324747A>G" "" "likely pathogenic" ""
"0000760203" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Ellingford 2016:27208204}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000760221" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Ellingford 2016:27208204}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000760225" "3" "50" "14" "21786006" "21786006" "subst" "0" "00000" "RPGRIP1_000147" "g.21786006A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21317847A>T" "" "VUS" ""
"0000760228" "0" "50" "14" "21788314" "21788314" "subst" "0" "00000" "RPGRIP1_000148" "g.21788314T>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21320155T>A" "" "VUS" ""
"0000760458" "0" "50" "14" "21793489" "21793489" "subst" "1.31708E-5" "00000" "RPGRIP1_000153" "g.21793489C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.21325330C>T" "" "VUS" ""
"0000760596" "3" "90" "14" "21794230" "21794231" "ins" "0" "00000" "RPGRIP1_000154" "g.21794230_21794231insA" "" "{PMID:Khan 2017:27160483}" "" "" "" "Germline" "" "" "0" "" "" "g.21326071_21326072insA" "" "pathogenic" ""
"0000763955" "1" "70" "14" "21771701" "21771701" "subst" "4.07319E-6" "00006" "RPGRIP1_000026" "g.21771701C>T" "" "{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.21303542C>T" "" "likely pathogenic (recessive)" ""
"0000763956" "1" "70" "14" "21770691" "21770691" "del" "0" "00006" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "likely pathogenic (recessive)" ""
"0000764020" "2" "70" "14" "21794214" "21794214" "subst" "0" "00006" "RPGRIP1_000158" "g.21794214T>G" "" "{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.21326055T>G" "" "likely pathogenic (recessive)" ""
"0000764021" "2" "70" "14" "21792775" "21792775" "subst" "8.17608E-6" "00006" "RPGRIP1_000157" "g.21792775A>G" "" "{PMID:Huang 2016:26992781}" "" "" "" "Germline" "" "" "0" "" "" "g.21324616A>G" "" "likely pathogenic (recessive)" ""
"0000764114" "3" "90" "14" "21799664" "21803187" "del" "0" "04043" "RPGRIP1_000159" "g.21799664_21803187del" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.21331505_21335028del" "" "pathogenic (recessive)" ""
"0000764921" "1" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Weisschuh 2016:26766544}" "" "630del (H198Tfs*50)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000764941" "2" "70" "14" "21795867" "21795867" "dup" "0" "00000" "RPGRIP1_000144" "g.21795867dup" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.21327708dup" "" "likely pathogenic (recessive)" ""
"0000765576" "1" "90" "14" "21790154" "21790154" "subst" "0.00167535" "00000" "RPGRIP1_000039" "g.21790154C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.21321995C>T" "" "pathogenic" ""
"0000765603" "0" "90" "14" "21793477" "21793477" "subst" "2.56432E-5" "00000" "RPGRIP1_000092" "g.21793477C>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.21325318C>T" "" "pathogenic" ""
"0000765604" "0" "90" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Ge 2015:26667666}" "" "RPGRIP1:973T>C (Phe325Leu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000765773" "0" "70" "14" "21795947" "21795947" "del" "0" "00000" "RPGRIP1_000161" "g.21795947del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21327788del" "" "likely pathogenic" ""
"0000765804" "0" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "likely pathogenic" ""
"0000765813" "0" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000765819" "0" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic" ""
"0000765841" "0" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "likely pathogenic" ""
"0000765882" "0" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic" ""
"0000765907" "0" "70" "14" "21769393" "21769393" "del" "0" "00000" "RPGRIP1_000160" "g.21769393del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.21301234del" "" "likely pathogenic" ""
"0000783797" "3" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Wang 2015:26047050}" "" "534delG" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "pathogenic" ""
"0000783828" "1" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Wang 2015:26047050}" "" "534delG" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "pathogenic" ""
"0000783829" "1" "90" "14" "21785937" "21785937" "subst" "0" "00000" "RPGRIP1_000165" "g.21785937C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21317778C>T" "" "pathogenic" ""
"0000783830" "1" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Wang 2015:26047050}" "" "3560_3566del" "" "Germline" "" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic" ""
"0000783831" "1" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Wang 2015:26047050}" "" "534delG" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "pathogenic" ""
"0000783832" "1" "90" "14" "21769397" "21769397" "subst" "0" "00000" "RPGRIP1_000163" "g.21769397G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21301238G>T" "" "pathogenic" ""
"0000783833" "1" "90" "14" "21769397" "21769397" "subst" "0" "00000" "RPGRIP1_000163" "g.21769397G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21301238G>T" "" "pathogenic" ""
"0000783834" "1" "90" "14" "21769273" "21769273" "subst" "0" "00000" "RPGRIP1_000162" "g.21769273C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21301114C>T" "" "pathogenic" ""
"0000783835" "1" "90" "14" "21794214" "21794214" "subst" "0" "00000" "RPGRIP1_000158" "g.21794214T>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21326055T>G" "" "pathogenic" ""
"0000783872" "2" "50" "14" "21793072" "21793072" "dup" "0" "00000" "RPGRIP1_000151" "g.21793072dup" "" "{PMID:Wang 2015:26047050}" "" "2057_2058insA" "" "Germline" "" "" "0" "" "" "g.21324913dup" "" "VUS" ""
"0000783925" "2" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000783926" "2" "90" "14" "21793027" "21793027" "dup" "0" "00000" "RPGRIP1_000166" "g.21793027dup" "" "{PMID:Wang 2015:26047050}" "" "2009_2010insG" "" "Germline" "" "" "0" "" "" "g.21324868dup" "" "pathogenic" ""
"0000783927" "2" "90" "14" "21813357" "21813357" "subst" "0" "00000" "RPGRIP1_000167" "g.21813357G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21345198G>A" "" "pathogenic" ""
"0000783928" "2" "90" "14" "21785928" "21785928" "subst" "0" "00000" "RPGRIP1_000164" "g.21785928C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21317769C>T" "" "pathogenic" ""
"0000783929" "2" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Wang 2015:26047050}" "" "3560_3566del" "" "Germline" "" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic" ""
"0000783930" "2" "90" "14" "21794176" "21794176" "subst" "4.06131E-6" "00000" "RPGRIP1_000056" "g.21794176C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21326017C>T" "" "pathogenic" ""
"0000783931" "2" "90" "14" "21816330" "21816334" "del" "0" "00000" "RPGRIP1_000168" "g.21816330_21816334del" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21348171_21348175del" "" "pathogenic" ""
"0000783932" "2" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "00000" "RPGRIP1_000026" "g.21771701C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.21303542C>T" "" "pathogenic" ""
"0000783964" "1" "50" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Wang 2015:26047050}" "" "G2398G>A" "" "Germline" "" "" "0" "" "" "g.21325861G>A" "" "VUS" ""
"0000785369" "3" "90" "14" "21794278" "21794278" "subst" "0" "00006" "RPGRIP1_000169" "g.21794278C>T" "" "{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000785456" "3" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Maria 2015:25775262}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic (recessive)" ""
"0000785457" "3" "90" "14" "21778767" "21778767" "subst" "0" "00000" "RPGRIP1_000171" "g.21778767G>A" "" "{PMID:Maria 2015:25775262}" "" "" "" "Germline" "" "" "0" "" "" "g.21310608G>A" "" "pathogenic (recessive)" ""
"0000785521" "1" "50" "14" "21816347" "21816347" "subst" "0" "00006" "RPGRIP1_000170" "g.21816347G>A" "" "{PMID:Kikuchi 2015:25692141}" "" "" "" "Germline" "no" "" "0" "" "" "" "" "VUS" ""
"0000786419" "3" "90" "14" "21819307" "21819308" "ins" "4.09085E-6" "00000" "RPGRIP1_000172" "g.21819307_21819308insGAAA" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "" "" "0" "" "" "g.21351148_21351149insGAAA" "" "pathogenic (recessive)" ""
"0000788385" "0" "50" "14" "21785998" "21785998" "subst" "0.000205726" "00000" "RPGRIP1_000173" "g.21785998C>T" "" "{PMID:Katagiri 2014:25268133}" "" "C1295T" "" "Germline" "" "rs190985984" "0" "" "" "g.21317839C>T" "" "VUS" ""
"0000788470" "0" "50" "14" "21813310" "21813310" "subst" "0.00067466" "00000" "RPGRIP1_000175" "g.21813310C>T" "" "{PMID:Katagiri 2014:25268133}" "" "C3571T" "" "Germline" "" "rs188660364" "0" "" "" "g.21345151C>T" "" "VUS" ""
"0000788531" "3" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Watson 2014:25133751}" "" "" "" "Germline" "" "" "0" "" "" "g.21345145C>T" "" "pathogenic" ""
"0000788546" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788547" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788548" "3" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Khan 2014:24997176}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic (recessive)" ""
"0000788549" "3" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Khan 2014:24997176}" "" "" "" "Germline" "" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic (recessive)" ""
"0000788551" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788554" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788555" "3" "70" "14" "21794284" "21794284" "subst" "1.68029E-5" "00000" "RPGRIP1_000174" "g.21794284C>T" "" "{PMID:Khan 2014:24997176}" "" "" "" "Germline" "" "" "0" "" "" "g.21326125C>T" "" "likely pathogenic (recessive)" ""
"0000788557" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788558" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788559" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788560" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788562" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788563" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000788564" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2014:24997176}" "" "1107delA" "" "Germline" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic (recessive)" ""
"0000789835" "0" "70" "14" "21788314" "21788314" "subst" "0" "00000" "RPGRIP1_000148" "g.21788314T>A" "" "{PMID:Avela 2019:31087526}" "" "c.1445T>A" "Check also: Ellingford 2016" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000789836" "0" "70" "14" "21793489" "21793489" "subst" "1.31708E-5" "00000" "RPGRIP1_000153" "g.21793489C>T" "" "{PMID:Avela 2019:31087526}" "" "c.2314C>T" "Check also: Ellingford 2016" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000789837" "0" "70" "14" "21788314" "21788314" "subst" "0" "00000" "RPGRIP1_000148" "g.21788314T>A" "" "{PMID:Avela 2019:31087526}" "" "c.1445T>A" "Check also: Ellingford 2016" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000789838" "0" "70" "14" "21793489" "21793489" "subst" "1.31708E-5" "00000" "RPGRIP1_000153" "g.21793489C>T" "" "{PMID:Avela 2019:31087526}" "" "c.2314C>T" "Check also: Ellingford 2016" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790090" "0" "10" "14" "21770716" "21770716" "subst" "0" "00000" "RPGRIP1_000177" "g.21770716G>T" "" "{PMID:Li-2009:18936139}" "" "560G?T" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000790091" "0" "10" "14" "21780085" "21780085" "subst" "0" "00000" "SERPINA1_000009" "g.21780085G>C" "" "{PMID:Li-2009:18936139}" "" "1033G?C" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000790094" "0" "50" "14" "21785998" "21785998" "subst" "0.000205726" "00000" "RPGRIP1_000173" "g.21785998C>T" "" "{PMID:Seong-2008:18682808}" "" "c.1295C>T(S432F)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790095" "0" "50" "14" "21792816" "21792816" "subst" "2.03123E-5" "00000" "RPGRIP1_000178" "g.21792816C>G" "" "{PMID:Seong-2008:18682808}" "" "c.1802C>G (S601W)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790096" "0" "90" "14" "21792906" "21792906" "subst" "4.06105E-6" "00000" "RPGRIP1_000179" "g.21792906A>T" "" "{PMID:Seong-2008:18682808}" "" "c.1892A>T (H631P)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000790097" "0" "90" "14" "21813299" "21813305" "del" "0" "00000" "RPGRIP1_000093" "g.21813299_21813305delAAGGCCG" "" "{PMID:Seong-2008:18682808}" "" "c.3560_3566delAAGGCCG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000790098" "0" "50" "14" "21798478" "21798478" "subst" "0.000145295" "00000" "RPGRIP1_000182" "g.21798478A>T" "" "{PMID:Seong-2008:18682808}" "" "c.3170A>T (H1057L)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790313" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.1767G>T (p.Gln589His)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790314" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.1767G>T (p.Gln589His)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790315" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.1767G>T (p.Gln589His)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790318" "0" "50" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790319" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.1767G>T (p.Gln589His)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790320" "0" "50" "14" "21794039" "21794039" "subst" "0.00239389" "00000" "RPGRIP1_000054" "g.21794039C>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.2417C>T (p.Thr806Ile)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790321" "0" "50" "14" "21794057" "21794057" "subst" "0.00102556" "00000" "RPGRIP1_000085" "g.21794057G>A" "" "{PMID:Vallespin 2007:18055816}" "" "c.2435G>A (p.Arg812Gln)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790322" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790323" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790325" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790331" "0" "50" "14" "21794039" "21794039" "subst" "0.00239389" "00000" "RPGRIP1_000054" "g.21794039C>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.2417C>T (p.Thr806Ile)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790332" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790333" "0" "50" "14" "21811213" "21811213" "subst" "0.00040791" "00000" "RPGRIP1_000089" "g.21811213A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3358A>G (p.Ile1120Leu)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790339" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Vallespin 2007:18055816}" "" "c.1767G>T (p.Gln589His)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790340" "0" "50" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Vallespin 2007:18055816}" "" "c.2555G>A (p.Arg852Gln)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000790341" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790342" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790343" "0" "30" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Vallespin 2007:18055816}" "" "c.3341A>G (p.Asp1114Gly*)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000790480" "0" "50" "14" "21769226" "21769228" "del" "0" "00000" "RPGRIP1_000176" "g.21769226_21769228del" "" "{PMID:Wang 2014:25097241}" "" "c.320_322delCGG" "" "Germline" "" "" "0" "" "" "g.21301067_21301069del" "" "VUS" ""
"0000790503" "0" "50" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs10151259" "0" "" "" "g.21321881G>T" "" "VUS" ""
"0000790536" "0" "50" "14" "21811213" "21811213" "subst" "0.00040791" "00000" "RPGRIP1_000089" "g.21811213A>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs137853911" "0" "" "" "g.21343054A>G" "" "VUS" ""
"0000790558" "0" "50" "14" "21794156" "21794156" "subst" "0" "00000" "RPGRIP1_000180" "g.21794156C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.21325997C>T" "" "VUS" ""
"0000790559" "0" "50" "14" "21794176" "21794176" "subst" "4.06131E-6" "00000" "RPGRIP1_000056" "g.21794176C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.21326017C>T" "" "VUS" ""
"0000790623" "0" "50" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs10151259" "0" "" "" "g.21321881G>T" "" "VUS" ""
"0000790656" "0" "50" "14" "21819257" "21819257" "subst" "0.00155576" "00000" "RPGRIP1_000183" "g.21819257C>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.21351098C>A" "" "VUS" ""
"0000790738" "3" "70" "14" "21795829" "21795829" "subst" "0" "00000" "RPGRIP1_000181" "g.21795829C>T" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.21327670C>T" "" "likely pathogenic" ""
"0000790929" "3" "70" "14" "21770744" "21770744" "subst" "0" "00000" "RPGRIP1_000184" "g.21770744G>C" "" "{PMID:mckibbin-2010:20065226}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790930" "3" "70" "14" "21816333" "21816333" "subst" "0" "00000" "RPGRIP1_000156" "g.21816333T>G" "" "{PMID:mckibbin-2010:20065226}" "" "c.3620T>G (p.Leu1207X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790931" "3" "70" "14" "21785883" "21785883" "subst" "0" "00000" "RPGRIP1_000130" "g.21785883C>T" "" "{PMID:mckibbin-2010:20065226}" "" "c.1180C>T (p.Gln394X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790932" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:mckibbin-2010:20065226}" "" "c.2480 G>T (p.Arg827Leu)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000791571" "3" "90" "14" "21813304" "21813310" "del" "0" "04521" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.3565_3571del" "homozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic" "ACMG"
"0000791572" "3" "90" "14" "21813304" "21813310" "del" "0" "04521" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.3565_3571del" "homozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000791573" "3" "90" "14" "21813304" "21813310" "del" "0" "04521" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.3565_3571del" "homozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000791577" "11" "90" "14" "21788337" "21788337" "subst" "0" "04521" "RPGRIP1_000186" "g.21788337G>T" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.1467+1G>T" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21320178G>T" "" "pathogenic (recessive)" "ACMG"
"0000791578" "0" "50" "14" "21792816" "21792816" "subst" "2.03123E-5" "00000" "RPGRIP1_000178" "g.21792816C>G" "" "{PMID:Hosono 2018:29844330}" "" "c.1802C>G" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "rs3748360" "0" "" "" "g.21324657C>G" "" "VUS" "ACMG"
"0000791588" "11" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "04521" "RPGRIP1_000026" "g.21771701C>T" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.799C>T" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21303542C>T" "" "pathogenic (recessive)" "ACMG"
"0000791589" "0" "90" "14" "21794176" "21794176" "subst" "4.06131E-6" "00000" "RPGRIP1_000056" "g.21794176C>T" "" "{PMID:Hosono 2018:29844330}" "" "c.2554C>T" "single heterozygous variant in a recessive gene" "Germline" "no" "" "0" "" "" "g.21326017C>T" "" "pathogenic" "ACMG"
"0000791591" "11" "90" "14" "21813304" "21813310" "del" "0" "04521" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.3565_3571del" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic" "ACMG"
"0000791594" "11" "90" "14" "21794706" "21796044" "del" "0" "04521" "RPGRIP1_000188" "g.21794706_21796044del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.2710+374_2895+74del" "published as c.2710+374_2895+74del, correct is c.2710+374_2895+78del" "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "pathogenic" "ACMG"
"0000791595" "11" "90" "14" "21794706" "21796044" "del" "0" "04521" "RPGRIP1_000188" "g.21794706_21796044del" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.2710+374_2895+74del" "compound heterozygous\r\nIt was published as \"c.2710+374_2895+74del\", but \"c.2710+374_2895+78del\" is correct." "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "pathogenic" "ACMG"
"0000791602" "0" "90" "14" "21794706" "21796044" "del" "0" "04521" "RPGRIP1_000188" "g.21794706_21796044del" "" "{PMID:Hosono 2018:29844330}" "" "c.2710+374_2895+74del" "published as c.2710+374_2895+74del, correct is c.2710+374_2895+78del\r\nsingle heterozygous variant, probably not causative in the patient" "Germline" "no" "" "0" "" "" "g.21326547_21327885del" "" "pathogenic" "ACMG"
"0000791607" "21" "90" "14" "21794706" "21796044" "del" "0" "04521" "RPGRIP1_000188" "g.21794706_21796044del" "" "{PMID:Hosono 2018:29844330}, Torii 2023 submitted" "" "c.2710+374_2895+74del" "compound heterozygous, causative variant\r\npublished as c.2710+374_2895+74del\", correct is c.2710+374_2895+78del" "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "pathogenic (recessive)" "ACMG"
"0000791621" "0" "50" "14" "21819349" "21819351" "del" "0" "00000" "RPGRIP1_000189" "g.21819349_21819351del" "" "{PMID:Hosono 2018:29844330}" "" "c.3835_3837del" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "rs281865293" "0" "" "" "g.21351190_21351192del" "" "VUS" "ACMG"
"0000791623" "21" "90" "14" "21790088" "21790088" "subst" "0" "04521" "RPGRIP1_000187" "g.21790088C>T" "" "{PMID:Hosono 2018:29844330}, Torii 2023, submitted" "" "c.1687C>T" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.21321929C>T" "" "pathogenic (recessive)" "ACMG"
"0000791635" "0" "50" "14" "21792816" "21792816" "subst" "2.03123E-5" "00000" "RPGRIP1_000178" "g.21792816C>G" "" "{PMID:Hosono 2018:29844330}" "" "c.1802C>G" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "rs3748360" "0" "" "" "g.21324657C>G" "" "VUS" "ACMG"
"0000792148" "0" "90" "14" "21769264" "21769264" "subst" "0" "00000" "RPGRIP1_000191" "g.21769264C>T" "3/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "358C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792149" "0" "90" "14" "21816462" "21816462" "subst" "0" "00000" "RPGRIP1_000196" "g.21816462C>A" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "3748+1C>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792150" "0" "90" "14" "21769264" "21769264" "subst" "0" "00000" "RPGRIP1_000191" "g.21769264C>T" "3/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "358C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792151" "0" "90" "14" "21769148" "21769148" "subst" "0" "00000" "RPGRIP1_000190" "g.21769148T>A" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "242T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792152" "0" "90" "14" "21789416" "21789416" "subst" "3.68179E-5" "00000" "RPGRIP1_000193" "g.21789416A>G" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "1468-2A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792153" "0" "90" "14" "21793436" "21793436" "del" "0" "00000" "RPGRIP1_000194" "g.21793436delT" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "2261delT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792166" "0" "90" "14" "21769264" "21769264" "subst" "0" "00000" "RPGRIP1_000191" "g.21769264C>T" "3/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "358C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792167" "0" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "00000" "RPGRIP1_000026" "g.21771701C>T" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "799C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000792168" "0" "50" "14" "21811243" "21811243" "subst" "0" "00000" "RPGRIP1_000195" "g.21811243G>C" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "3388G>C" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000792193" "3" "10" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000192" "g.21770691del" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "535delG" "" "Germline" "" "" "0" "" "" "g.21302532del" "" "benign" ""
"0000792274" "0" "90" "14" "21794039" "21794039" "subst" "0.00239389" "00000" "RPGRIP1_000054" "g.21794039C>T" "" "{PMID:_Audo-2012:22277662}" "" "c.2417C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000794202" "0" "70" "14" "21789794" "21789794" "subst" "0" "03508" "RPGRIP1_000198" "g.21789794G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG"
"0000794891" "0" "70" "14" "21782343" "21801807" "dup" "0" "03508" "RPGRIP1_000197" "g.21782343_21801807dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.21314184_21333648dup" "" "VUS" "ACMG"
"0000794993" "3" "50" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.1107del" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000795970" "3" "70" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000192" "g.21770691delG" "0/384 controls" "{PMID:Chen-2013:23661368}" "" "c.[535delG];[535delG]" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000795971" "3" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "0/384 controls" "{PMID:Chen-2013:23661368}" "" "c.[2236G>A];[2236G>A]" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000795984" "0" "50" "14" "21788338" "21788338" "subst" "0" "00000" "RPGRIP1_000201" "g.21788338T>C" "" "{PMID:Chen-2013:23661368}" "" "c.1467+2T>C" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000795986" "0" "30" "14" "21788338" "21788338" "subst" "0" "00000" "RPGRIP1_000201" "g.21788338T>C" "" "{PMID:Chen-2013:23661368}" "" "c.1467+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" ""
"0000796000" "0" "30" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000192" "g.21770691delG" "" "{PMID:Chen-2013:23661368}" "" "c.535delG" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" ""
"0000796002" "0" "30" "14" "21793520" "21793520" "subst" "0" "00000" "RPGRIP1_000202" "g.21793520G>A" "" "{PMID:Chen-2013:23661368}" "" "c.2345G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" ""
"0000796050" "0" "90" "14" "21770730" "21770730" "subst" "0.503623" "00000" "RPGRIP1_000001" "g.21770730A>G" "" "{PMID:Jonsson-2013:23443024}" "" "c.574A>G" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" ""
"0000796051" "0" "90" "14" "21778726" "21778728" "del" "0" "00000" "RPGRIP1_000199" "g.21778726_21778728delTAA" "" "{PMID:Jonsson-2013:23443024}" "" "c.907-17_907-15delTAA" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" ""
"0000796144" "3" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Verma-2013:24066033}" "" "c.3565C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796166" "3" "70" "14" "21795863" "21795864" "ins" "0" "00000" "RPGRIP1_000008" "g.21795863_21795864insGGTA" "" "{PMID:Neveling-2013:24123792}" "" "c.2792_2793insGGTA" "-" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796175" "0" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Neveling-2013:24123792}" "" "c.3565C>T" "confirmed in affected sib" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796176" "0" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Neveling-2013:24123792}" "" "c.2398G>A" "confirmed in affected sib" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796177" "0" "70" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Neveling-2013:24123792}" "" "c.3565C>T" "confirmed in affected sib" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796178" "0" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Neveling-2013:24123792}" "" "c.2398G>A" "confirmed in affected sib" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000796243" "0" "90" "14" "21780603" "21780604" "dup" "0" "00000" "RPGRIP1_000200" "g.21780603_21780604dup" "" "{PMID:Wang-2013:23847139}" "" "c.1083_1084insGA" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796244" "0" "90" "14" "21819262" "21819262" "subst" "4.24308E-6" "00000" "RPGRIP1_000203" "g.21819262G>T" "" "{PMID:Wang-2013:23847139}" "" "c.3749-1G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796245" "0" "90" "14" "21780603" "21780604" "dup" "0" "00000" "RPGRIP1_000200" "g.21780603_21780604dup" "" "{PMID:Wang-2013:23847139}" "" "c.1083_1084insGA" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796246" "0" "90" "14" "21819262" "21819262" "subst" "4.24308E-6" "00000" "RPGRIP1_000203" "g.21819262G>T" "" "{PMID:Wang-2013:23847139}" "" "c.3749-1G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796710" "3" "90" "14" "21794230" "21794231" "ins" "0" "00000" "RPGRIP1_000154" "g.21794230_21794231insA" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2608_2609insA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796731" "3" "90" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1107delA" "" "Germline" "" "rs61751266" "0" "" "" "" "" "pathogenic" ""
"0000796737" "0" "70" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1767G>T" "" "Germline" "" "rs34067949" "0" "" "" "" "" "likely pathogenic" ""
"0000796765" "3" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.3565C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796777" "3" "90" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1107delA" "" "Germline" "" "rs61751266" "0" "" "" "" "" "pathogenic" ""
"0000796785" "0" "70" "14" "21794132" "21794132" "subst" "4.46759E-5" "00000" "RPGRIP1_000204" "g.21794132C>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2510C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796808" "3" "90" "14" "21794284" "21794284" "subst" "1.68029E-5" "00000" "RPGRIP1_000174" "g.21794284C>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2662C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796814" "3" "90" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1107delA" "" "Germline" "" "rs61751266" "0" "" "" "" "" "pathogenic" ""
"0000796820" "0" "70" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2555G>A" "" "Germline" "" "rs181758389" "0" "" "" "" "" "likely pathogenic" ""
"0000796822" "3" "90" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1107delA" "" "Germline" "" "rs61751266" "0" "" "" "" "" "pathogenic" ""
"0000797097" "3" "50" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "deletion of exon 19" "Homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "VUS" "ACMG"
"0000797184" "3" "70" "14" "21794062" "21794062" "subst" "8.13703E-6" "00000" "RPGRIP1_000055" "g.21794062C>T" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2440C>T/p.R814*, allele 2: c.2440C>T/p.R814*" "homozygous" "Germline" "?" "" "0" "" "" "g.21325903C>T" "" "likely pathogenic" "ACMG"
"0000797185" "0" "70" "14" "21786006" "21786006" "subst" "0" "00000" "RPGRIP1_000147" "g.21786006A>T" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.1303A>T/p.K435*, allele 2: c.801-25_c.843del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21317847A>T" "" "likely pathogenic" "ACMG"
"0000797186" "3" "70" "14" "21796628" "21796628" "subst" "4.06352E-6" "00000" "RPGRIP1_000116" "g.21796628C>T" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2941C>T/p.R981*, allele 2: c.2941C>T/p.R981*" "homozygous" "Germline" "?" "" "0" "" "" "g.21328469C>T" "" "likely pathogenic" "ACMG"
"0000797187" "0" "70" "14" "21771703" "21771703" "subst" "1.22233E-5" "00000" "RPGRIP1_000206" "g.21771703G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.800+1G>A/p.?, allele 2: c.2718dup/p.N907*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21303544G>A" "" "likely pathogenic" "ACMG"
"0000797207" "0" "70" "14" "21775865" "21775932" "del" "0" "00000" "RPGRIP1_000207" "g.21775865_21775932del" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.1303A>T/p.K435*, allele 2: c.801-25_c.843del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21307706_21307773del" "" "likely pathogenic" "ACMG"
"0000797208" "0" "70" "14" "21795789" "21795789" "dup" "0" "00000" "RPGRIP1_000061" "g.21795789dup" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.800+1G>A/p.?, allele 2: c.2718dup/p.N907*" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21327630dup" "" "likely pathogenic" "ACMG"
"0000798081" "0" "90" "14" "21762944" "21762944" "subst" "0" "00000" "RPGRIP1_000205" "g.21762944G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RPGRIP1 c.194G>A, p.(Trp65*), MAKBBS10 c.1367_1368insT, p.(Lys456Asnfs*12), c.271dup, p.(Cys91Leufs*5)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.21294785G>A" "" "pathogenic" "ACMG"
"0000798443" "0" "70" "14" "21811213" "21811213" "subst" "0.00040791" "00000" "RPGRIP1_000089" "g.21811213A>G" "" "{PMID:Song-2011:22025579}" "" "c.3358A>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000806290" "0" "10" "14" "21769162" "21769162" "subst" "0.00182904" "02330" "RPGRIP1_000133" "g.21769162C>T" "" "" "" "RPGRIP1(NM_020366.4):c.256C>T (p.R86W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000806291" "0" "30" "14" "21785939" "21785939" "subst" "5.76037E-5" "01943" "RPGRIP1_000079" "g.21785939G>A" "" "" "" "RPGRIP1(NM_020366.3):c.1236G>A (p.Q412=), RPGRIP1(NM_020366.4):c.1236G>A (p.Q412=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000806292" "0" "50" "14" "21793460" "21793460" "subst" "8.2528E-6" "01943" "RPGRIP1_000208" "g.21793460T>C" "" "" "" "RPGRIP1(NM_020366.3):c.2285T>C (p.L762P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000806293" "0" "30" "14" "21796793" "21796793" "subst" "0" "01943" "RPGRIP1_000209" "g.21796793C>T" "" "" "" "RPGRIP1(NM_020366.3):c.3099+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000811356" "0" "30" "14" "21794291" "21794291" "subst" "0.000110395" "00000" "RPGRIP1_000212" "g.21794291G>A" "" "{PMID:Wang 2019:31555371}" "" "c.2669G>A, p.R890Q" "" "Germline" "?" "" "0" "" "" "g.21326132G>A" "" "likely benign" ""
"0000812021" "0" "70" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Martin Merida 2019:30902645}" "" "PDE6A Ex.4 c.784G>A p.(Ala262Thr), Ex.4 c.784G>A p.(Ala262Thr), RPGRIP1: p.(Asp1114Gly) Ex.21 c.3341A>G" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21343037A>G" "" "likely pathogenic" ""
"0000812073" "0" "70" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "PDE6A Ex.1 c.305G>A p.(Arg102His), Ex.1 c.305G>A p.(Arg102His), RPGRIP1: Ex.14 c.1767G>T p.(Gln589His)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21324622G>T" "" "likely pathogenic" ""
"0000812229" "3" "70" "14" "21819262" "21819262" "subst" "4.24308E-6" "00000" "RPGRIP1_000203" "g.21819262G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "RPGRIP1 IVS23 c.3749-1G>T p.(?), IVS23 c.3749-1G>T p.(?)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21351103G>T" "" "likely pathogenic" ""
"0000812456" "3" "70" "14" "21786009" "21786009" "subst" "0" "00000" "RPGRIP1_000211" "g.21786009G>T" "" "{PMID:Tayebi 2019:30820146}" "" "c.1306G>T, p.(Ala436Ser)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.21317850G>T" "" "likely pathogenic" ""
"0000812457" "3" "70" "14" "21786009" "21786009" "subst" "0" "00000" "RPGRIP1_000211" "g.21786009G>T" "" "{PMID:Tayebi 2019:30820146}" "" "c.1306G>T, p.(Ala436Ser)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.21317850G>T" "" "likely pathogenic" ""
"0000812458" "3" "70" "14" "21786009" "21786009" "subst" "0" "00000" "RPGRIP1_000211" "g.21786009G>T" "" "{PMID:Tayebi 2019:30820146}" "" "c.1306G>T, p.(Ala436Ser)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.21317850G>T" "" "likely pathogenic" ""
"0000812796" "0" "90" "14" "21795968" "21795968" "subst" "0" "00000" "RPGRIP1_000213" "g.21795968T>C" "" "{PMID:Wang 2019:31106028}" "" "c.2895+2T>C, p.?" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21327809T>C" "" "pathogenic" ""
"0000812797" "0" "70" "14" "21780625" "21780625" "subst" "2.45624E-5" "00000" "RPGRIP1_000210" "g.21780625C>T" "" "{PMID:Wang 2019:31106028}" "" "c.1111C>T, p.(Arg371*)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21312466C>T" "" "likely pathogenic" ""
"0000813629" "1" "90" "14" "21762904" "21762904" "subst" "1.21912E-5" "00000" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.6807C>T, c.154C>T, p.R52X" "" "Germline" "yes" "" "0" "" "" "g.21294745C>T" "" "pathogenic" "ACMG"
"0000813635" "0" "90" "14" "21769273" "21769273" "subst" "0" "00000" "RPGRIP1_000162" "g.21769273C>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.13176C>T, c.367C>T, p.R123X" "single heterozygous" "Unknown" "?" "" "0" "" "" "g.21301114C>T" "" "pathogenic" "ACMG"
"0000813654" "1" "90" "14" "21762904" "21762904" "subst" "1.21912E-5" "00000" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.6807C>T, c.154C>T, p.R52X" "" "Germline" "yes" "" "0" "" "" "g.21294745C>T" "" "pathogenic" "ACMG"
"0000813663" "3" "90" "14" "21795968" "21795968" "subst" "0" "00000" "RPGRIP1_000213" "g.21795968T>C" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.39871T>C, c.2895+2T>C" "" "Germline" "yes" "" "0" "" "" "g.21327809T>C" "" "pathogenic" "ACMG"
"0000813692" "1" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.14594delG, c.535delG, p.E179Sfs11" "" "Germline" "yes" "" "0" "" "" "g.21302532del" "" "pathogenic" "ACMG"
"0000813716" "1" "90" "14" "21780625" "21780625" "subst" "2.45624E-5" "00000" "RPGRIP1_000210" "g.21780625C>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.24528C>T, c.1111C>T, p.R371X" "" "Germline" "yes" "" "0" "" "" "g.21312466C>T" "" "pathogenic" "ACMG"
"0000813727" "1" "90" "14" "21789416" "21789416" "subst" "3.68179E-5" "00000" "RPGRIP1_000193" "g.21789416A>G" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.33319A>G, c.1468-2A>G" "" "Germline" "yes" "" "0" "" "" "g.21321257A>G" "" "pathogenic" "ACMG"
"0000813735" "2" "70" "14" "21816398" "21816398" "subst" "0" "00000" "RPGRIP1_000215" "g.21816398G>C" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.60301G>C, c.3685G>C, p.A1229P" "" "Germline" "yes" "" "0" "" "" "g.21348239G>C" "" "likely pathogenic" "ACMG"
"0000813749" "2" "90" "14" "21813304" "21813304" "subst" "2.03194E-5" "00000" "RPGRIP1_000002" "g.21813304C>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.57207C>T, c.3565C>T, p.R1189X" "" "Germline" "yes" "" "0" "" "" "g.21345145C>T" "" "pathogenic" "ACMG"
"0000813768" "2" "90" "14" "21802850" "21802850" "subst" "0" "00000" "RPGRIP1_000214" "g.21802850A>T" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.46753A>T, c.3325A>T, p.K1109X" "" "Germline" "yes" "" "0" "" "" "g.21334691A>T" "" "pathogenic" "ACMG"
"0000813782" "2" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.14594delG, c.535delG, p.E179Sfs11" "" "Germline" "yes" "" "0" "" "" "g.21302532del" "" "pathogenic" "ACMG"
"0000813788" "2" "90" "14" "21770691" "21770691" "del" "0" "00000" "RPGRIP1_000023" "g.21770691del" "" "{PMID:Xu 2020:31630094}" "" "RPGRIP1 NM_020366: g.14594delG, c.535delG, p.E179Sfs11" "" "Germline" "yes" "" "0" "" "" "g.21302532del" "" "pathogenic" "ACMG"
"0000814607" "0" "70" "14" "21775984" "21775985" "del" "0" "00000" "RPGRIP1_000013" "g.21775984_21775985del" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.895_896del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814608" "0" "50" "14" "21793565" "21793565" "del" "0" "00000" "RPGRIP1_000014" "g.21793565del" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.2367+23del" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000815625" "0" "50" "14" "21778769" "21778769" "subst" "0.00488946" "00000" "RPGRIP1_000031" "g.21778769A>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "RPGRIP1:NM_020366 c.930+3A>G, p.?" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.21310610A>G" "" "VUS" "ACMG"
"0000818458" "3" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Surl 2020:32165824}" "" "c.3565_3571del:p.(Arg1189Glyfs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000818459" "3" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Surl 2020:32165824}" "" "c.3565_3571del:p.(Arg1189Glyfs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000818460" "11" "90" "14" "21793477" "21793477" "subst" "2.56432E-5" "00000" "RPGRIP1_000092" "g.21793477C>T" "" "{PMID:Surl 2020:32165824}" "" "c.2302C>T:p.(Arg768*)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21325318C>T" "" "pathogenic (recessive)" "ACMG"
"0000818461" "21" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Surl 2020:32165824}" "" "c.3565_3571del:p.(Arg1189Glyfs*7)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000818462" "3" "90" "14" "21813304" "21813310" "del" "0" "00000" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Surl 2020:32165824}" "" "c.3565_3571del:p.(Arg1189Glyfs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic (recessive)" "ACMG"
"0000818478" "21" "90" "14" "21793093" "21793093" "subst" "0" "00000" "RPGRIP1_000094" "g.21793093C>G" "" "{PMID:Surl 2020:32165824}" "" "c.2079C>G:p.(Tyr693*)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21324934C>G" "" "pathogenic (recessive)" "ACMG"
"0000818479" "21" "90" "14" "21793226" "21793250" "del" "0" "00000" "RPGRIP1_000095" "g.21793226_21793250del" "" "{PMID:Surl 2020:32165824}" "" "c.2212_2215+21del:p.?" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.21325067_21325091del" "" "pathogenic (recessive)" "ACMG"
"0000818960" "2" "70" "14" "21798407" "21798547" "del" "0" "00000" "RPGRIP1_000216" "g.(21796787_21798407)_(21798547_21802763)del" "" "{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}" "" "del ex19" "" "Germline" "yes" "" "0" "" "" "g.(21328628_21330248)_(21330388_21334604)del" "" "likely pathogenic" ""
"0000818961" "1" "70" "14" "21793093" "21793093" "subst" "0" "00000" "RPGRIP1_000094" "g.21793093C>G" "" "{PMID:Ellingsford 2018:29074561}" "" "c.2079C>G p.(Tyr693Ter)" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000819588" "1" "70" "14" "21793035" "21793035" "subst" "4.06111E-6" "00000" "RPGRIP1_000108" "g.21793035C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2021C>A/p.P674H, variant 2: c.2021C>A/p.P674H" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.21324876C>A" "" "likely pathogenic" ""
"0000819689" "1" "70" "14" "21771703" "21771703" "subst" "1.22233E-5" "00000" "RPGRIP1_000206" "g.21771703G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.800+1G>A/p.?, variant 2: c.2718dup/p.N907*" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21303544G>A" "" "likely pathogenic" ""
"0000820333" "1" "70" "14" "21794284" "21794284" "subst" "1.68029E-5" "00000" "RPGRIP1_000174" "g.21794284C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2662C>T/p.R888*, variant 2: c.2662C>T/p.R888*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.21326125C>T" "" "likely pathogenic" ""
"0000820334" "1" "70" "14" "21794054" "21794054" "subst" "0" "00000" "RPGRIP1_000221" "g.21794054T>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2432T>A/p.L811H, variant 2 :Deletion exon 21" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.21325895T>A" "" "likely pathogenic" ""
"0000820335" "1" "70" "14" "21794284" "21794284" "subst" "1.68029E-5" "00000" "RPGRIP1_000174" "g.21794284C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2662C>T/p.R888* , variant 2: c.268G>A/p.V90I" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.21326125C>T" "" "likely pathogenic" ""
"0000820346" "1" "70" "14" "21780625" "21780625" "subst" "2.45624E-5" "00000" "RPGRIP1_000210" "g.21780625C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.1111C>T/p.R371*, variant 2: c.2367+23del/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21312466C>T" "" "likely pathogenic" ""
"0000820347" "1" "70" "14" "21780625" "21780625" "subst" "2.45624E-5" "00000" "RPGRIP1_000210" "g.21780625C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.1111C>T/p.R371*, variant 2: c.2367+23del/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21312466C>T" "" "likely pathogenic" ""
"0000820348" "1" "70" "14" "21789561" "21789561" "subst" "0" "00000" "RPGRIP1_000136" "g.21789561G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.1611G>A/p.?, variant 2: c.1611G>A/p.?" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.21321402G>A" "" "likely pathogenic" ""
"0000820422" "1" "70" "14" "21775997" "21775997" "subst" "0" "00000" "RPGRIP1_000218" "g.21775997T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.906+2T>G/p.? , variant 2: c.1612-3C>A/p.?" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.21307838T>G" "" "likely pathogenic" ""
"0000820699" "1" "70" "14" "21795789" "21795789" "dup" "0" "00000" "RPGRIP1_000061" "g.21795789dup" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.800+1G>A/p.?, variant 2: c.2718dup/p.N907*" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21327630dup" "" "likely pathogenic" ""
"0000820865" "1" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2432T>A/p.L811H, variant 2 :Deletion exon 21" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000820866" "1" "70" "14" "21769174" "21769174" "subst" "0" "00000" "RPGRIP1_000217" "g.21769174G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.2662C>T/p.R888* , variant 2: c.268G>A/p.V90I" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.21301015G>A" "" "likely pathogenic" ""
"0000820873" "1" "70" "14" "21793565" "21793565" "del" "0" "00000" "RPGRIP1_000014" "g.21793565del" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.1111C>T/p.R371*, variant 2: c.2367+23del/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21325406del" "" "likely pathogenic" ""
"0000820874" "1" "70" "14" "21793565" "21793565" "del" "0" "00000" "RPGRIP1_000014" "g.21793565del" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.1111C>T/p.R371*, variant 2: c.2367+23del/p.?" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21325406del" "" "likely pathogenic" ""
"0000820910" "1" "70" "14" "21790010" "21790010" "subst" "0" "00000" "RPGRIP1_000219" "g.21790010C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RPGRIP1, variant 1: c.906+2T>G/p.? , variant 2: c.1612-3C>A/p.?" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.21321851C>A" "" "likely pathogenic" ""
"0000821391" "3" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "00000" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Turro 2020:32581362}" "" "RPGRIP1 c.2398G>A, p.Glu800Lys" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21325861G>A" "" "likely pathogenic" ""
"0000821392" "0" "70" "14" "21780630" "21780630" "del" "0" "00000" "RPGRIP1_000072" "g.21780630del" "" "{PMID:Turro 2020:32581362}" "" "RPGRIP1 c.1116delA, p.Lys372AsnfsTer3" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21312471del" "" "likely pathogenic" ""
"0000821602" "0" "70" "14" "21784106" "21791536" "del" "0" "00000" "SERPINA1_000009" "g.21784106_21791536del" "" "{PMID:Turro 2020:32581362}" "" "chr14:g.21784106_21791536del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" ""
"0000822041" "3" "70" "14" "21798421" "21798422" "del" "0" "00000" "RPGRIP1_000222" "g.21798421_21798422del" "" "{PMID:Habibi 2020:32641690}" "" "RPGRIP1 c.[3113-3114delCT];[3113-3114delCT], p.[T1038Rfs*8]; T1038Rfs*8]" "homozygous" "Germline" "?" "" "0" "" "" "g.21330262_21330263del" "" "likely pathogenic" ""
"0000822123" "0" "70" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Booij-2011:20801516}" "" "c.3341A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000822762" "3" "70" "14" "21793469" "21793470" "delins" "0" "00000" "RPGRIP1_000220" "g.21793469_21793470delinsAA" "" "{PMID:Sato 2020:32736544}" "" "NM_020366: exon15:c.G2294A and c.C2295A, p.C765X)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325310_21325311delinsAA" "" "likely pathogenic" ""
"0000822763" "3" "70" "14" "21793469" "21793470" "delins" "0" "00000" "RPGRIP1_000220" "g.21793469_21793470delinsAA" "" "{PMID:Sato 2020:32736544}" "" "NM_020366: exon15:c.G2294A and c.C2295A, p.C765X)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325310_21325311delinsAA" "" "likely pathogenic" ""
"0000822933" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Méjécase 2020:32783370}" "" "RPGRIP1 c.1107del p.(Glu370Asnfs *5)" "homozygous" "Unknown" "?" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000823263" "21" "90" "14" "21771613" "21771613" "del" "0" "00000" "RPGRIP1_000135" "g.21771613del" "" "{PMID:Hull 2020:32856788}" "" "RPGRIP1 nucleotide 1, protein 1:c.711delA(maternal), p.Lys239Serfs*36 nucleotide 2, protein 2:c.832delC (paternal), p.Arg278Aspfs*15" "heterozygous, ACMG classified, novel (Table 2)" "Germline" "?" "" "0" "" "" "g.21303454del" "" "pathogenic" "ACMG"
"0000823291" "11" "90" "14" "21775921" "21775921" "del" "0" "00000" "RPGRIP1_000224" "g.21775921del" "" "{PMID:Hull 2020:32856788}" "" "RPGRIP1 nucleotide 1, protein 1:c.711delA(maternal), p.Lys239Serfs*36 nucleotide 2, protein 2:c.832delC (paternal), p.Arg278Aspfs*15" "heterozygous, ACMG classified, novel (Table 2)" "Germline" "?" "" "0" "" "" "g.21307762del" "" "pathogenic" "ACMG"
"0000823410" "0" "70" "14" "21795830" "21795831" "ins" "0" "00000" "RPGRIP1_000138" "g.21795830_21795831insT" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2759 2760insT; p.GIn920HisfsTer14" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21327671_21327672insT" "" "likely pathogenic" "ACMG"
"0000823411" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823412" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823413" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823414" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823415" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823416" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823417" "0" "50" "14" "21793026" "21793026" "subst" "4.06141E-6" "00000" "RPGRIP1_000225" "g.21793026G>A" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2012G>A p.GIy671GIu" "homozygous" "Unknown" "?" "" "0" "" "" "g.21324867G>A" "" "VUS" "ACMG"
"0000823418" "0" "70" "14" "21795830" "21795831" "ins" "0" "00000" "RPGRIP1_000138" "g.21795830_21795831insT" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2759_2760insT; p.GIn920HisfsTer14" "homozygous" "Unknown" "?" "" "0" "" "" "g.21327671_21327672insT" "" "likely pathogenic" "ACMG"
"0000823419" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823420" "0" "70" "14" "21795830" "21795831" "ins" "0" "00000" "RPGRIP1_000138" "g.21795830_21795831insT" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2759 2760insT; p.GIn920HisfsTer14" "homozygous" "Unknown" "?" "" "0" "" "" "g.21327671_21327672insT" "" "likely pathogenic" "ACMG"
"0000823421" "0" "70" "14" "21796628" "21796628" "subst" "4.06352E-6" "00000" "RPGRIP1_000116" "g.21796628C>T" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2941C>T; p.Arg981Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.21328469C>T" "" "likely pathogenic" "ACMG"
"0000823422" "0" "70" "14" "21796628" "21796628" "subst" "4.06352E-6" "00000" "RPGRIP1_000116" "g.21796628C>T" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2941C>T; p.Arg981Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.21328469C>T" "" "likely pathogenic" "ACMG"
"0000823423" "0" "70" "14" "21795830" "21795831" "ins" "0" "00000" "RPGRIP1_000138" "g.21795830_21795831insT" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2759 2760insT; p.GIn920HisfsTer14" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21327671_21327672insT" "" "likely pathogenic" "ACMG"
"0000823424" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.?" "heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823425" "0" "90" "14" "21771703" "21771703" "subst" "1.22233E-5" "00000" "RPGRIP1_000206" "g.21771703G>A" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.800+1G>A; p.?" "homozygous" "Unknown" "?" "" "0" "" "" "g.21303544G>A" "" "pathogenic" "ACMG"
"0000823426" "0" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 Exon 10-18 deletion; p.*" "homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000823525" "0" "50" "14" "21789561" "21789561" "subst" "0" "00000" "RPGRIP1_000136" "g.21789561G>A" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.1611G>A; p.GIn537=" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21321402G>A" "" "VUS" "ACMG"
"0000823527" "0" "50" "14" "21771702" "21771702" "subst" "2.03731E-5" "00000" "RPGRIP1_000223" "g.21771702G>A" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.800G>A; p.Arg267GIn" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21303543G>A" "" "VUS" "ACMG"
"0000823530" "0" "50" "14" "21793026" "21793026" "subst" "4.06141E-6" "00000" "RPGRIP1_000225" "g.21793026G>A" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2012G>A p.GIy671GIu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324867G>A" "" "VUS" "ACMG"
"0000823532" "0" "50" "14" "21794090" "21794090" "subst" "0" "00000" "RPGRIP1_000226" "g.21794090A>G" "" "{PMID:Sallum 2020:32865313}" "" "RPGRIP1 c.2468A>G; p.Tyr823Cys" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325931A>G" "" "VUS" "ACMG"
"0000825696" "0" "70" "14" "21798549" "21798549" "subst" "5.92256E-6" "00000" "RPGRIP1_000229" "g.21798549A>G" "" "{PMID:Liu-2020:33090715}" "" "c.3238+3A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825697" "0" "70" "14" "21762904" "21762904" "subst" "1.21912E-5" "00000" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Liu-2020:33090715}" "" "c.154C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825842" "0" "70" "14" "21762904" "21762904" "subst" "1.21912E-5" "00000" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Liu-2020:33090715}" "" "c.154C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000825843" "0" "70" "14" "21785962" "21785962" "subst" "0" "00000" "RPGRIP1_000227" "g.21785962C>T" "" "{PMID:Liu-2020:33090715}" "" "c.1259C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826051" "0" "70" "14" "21793035" "21793035" "subst" "4.06111E-6" "00000" "RPGRIP1_000108" "g.21793035C>A" "" "{PMID:Liu-2020:33090715}" "" "c.2021C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000826052" "0" "70" "14" "21793997" "21794026" "del" "0" "00000" "RPGRIP1_000228" "g.21793997_21794026del" "" "{PMID:Liu-2020:33090715}" "" "c.2374_2403del30bp" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000828485" "3" "90" "14" "21796622" "21796622" "subst" "0" "00000" "RPGRIP1_000109" "g.21796622C>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "RPGRIP1, c.2935C>T, p.Gln979*, homozygous" "" "Unknown" "?" "" "0" "" "" "g.21328463C>T" "" "pathogenic" "ACMG"
"0000828841" "0" "50" "14" "21793098" "21793098" "subst" "4.87397E-5" "00000" "RPGRIP1_000230" "g.21793098A>G" "" "{PMID:Chen 2021:43360855}" "" "RPGRIP1 c.[2084A>G];[?], V1: c.2084A>G, (p.Gln695Arg)" "single heterozygous variant in a recessive disease: a variant on the other allele is expected but not yet identified" "Unknown" "?" "" "0" "" "" "g.21324939A>G" "" "VUS" "ACMG"
"0000829448" "0" "70" "14" "21788283" "21788283" "subst" "0" "00000" "RPGRIP1_000233" "g.21788283C>T" "" "{PMID:SkorczykWerner-2020:33308271}" "" "c.1414C>T (p.(Gln472*))" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000829465" "3" "70" "14" "21785919" "21785919" "del" "0" "00000" "RPGRIP1_000232" "g.21785919del" "" "{PMID:SkorczykWerner-2020:33308271}" "" "c.1216del (p.(Leu406Tyrfs*36))" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000829466" "0" "70" "14" "21780662" "21780665" "del" "0" "00000" "RPGRIP1_000231" "g.21780662_21780665del" "" "{PMID:SkorczykWerner-2020:33308271}" "" "c.1148_1151del (p.(Glu383Alafs*19))" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000829783" "3" "70" "14" "21796586" "21796586" "subst" "0" "00000" "RPGRIP1_000234" "g.21796586C>T" "" "{PMID:Dockery 2017:29099798}" "" "RPGRIP1 c.2899C>T, p.Gln967 *" "only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees," "Germline" "yes" "" "0" "" "" "g.21328427C>T" "" "likely pathogenic" ""
"0000831089" "3" "70" "14" "21816345" "21816345" "subst" "0" "00000" "RPGRIP1_000235" "g.21816345T>A" "" "{PMID:Cideciyan 2007:17554762}" "" "RPGRIP1 c.3632T>A, p.V121E" "" "Germline" "?" "" "0" "" "" "g.21348186T>A" "" "likely pathogenic" ""
"0000838404" "11" "90" "14" "21819307" "21819308" "ins" "4.09085E-6" "00006" "RPGRIP1_000172" "g.21819307_21819308insGAAA" "" "{PMID:Jamshidi 2019:30072743}" "" "3793_3794insGAAA" "" "Germline" "" "" "0" "" "" "g.21351148_21351149insGAAA" "" "pathogenic (recessive)" ""
"0000838405" "1" "90" "14" "21790016" "21790025" "del" "0" "00006" "RPGRIP1_000037" "g.21790016_21790025del" "" "{PMID:Jamshidi 2019:30072743}" "" "1615_1624del10" "" "Germline" "" "" "0" "" "" "g.21321857_21321866del" "" "pathogenic (recessive)" ""
"0000838406" "11" "90" "14" "21798547" "21798547" "subst" "0" "00006" "RPGRIP1_000238" "g.21798547G>A" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000838407" "20" "90" "14" "21816330" "21816334" "del" "0" "00006" "RPGRIP1_000168" "g.21816330_21816334del" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "De novo" "" "" "0" "" "" "g.21348171_21348175del" "" "pathogenic (recessive)" ""
"0000838408" "21" "90" "14" "21775984" "21775985" "del" "0" "00006" "RPGRIP1_000237" "g.21775984_21775985delGA" "" "{PMID:Jamshidi 2019:30072743}" "" "895_896delGA" "" "Germline" "" "" "0" "" "" "g.21307825_21307826del" "" "pathogenic (recessive)" ""
"0000838409" "1" "90" "14" "21793477" "21793477" "subst" "2.56432E-5" "00006" "RPGRIP1_000092" "g.21793477C>T" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.21325318C>T" "" "pathogenic (recessive)" ""
"0000838410" "3" "90" "14" "21819307" "21819308" "ins" "4.09085E-6" "00006" "RPGRIP1_000172" "g.21819307_21819308insGAAA" "" "{PMID:Jamshidi 2019:30072743}" "" "3793_3794insGAAA" "" "Germline" "" "" "0" "" "" "g.21351148_21351149insGAAA" "" "pathogenic (recessive)" ""
"0000838411" "1" "90" "14" "21793477" "21793477" "subst" "2.56432E-5" "00006" "RPGRIP1_000092" "g.21793477C>T" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000838412" "1" "90" "14" "21780601" "21780604" "del" "0" "00006" "RPGRIP1_000129" "g.21780601_21780604del" "" "{PMID:Jamshidi 2019:30072743}" "" "1084_1087del" "" "Germline" "" "" "0" "" "" "g.21312442_21312445del" "" "pathogenic (recessive)" ""
"0000838413" "21" "90" "14" "21754236" "21763568" "del" "0" "00006" "RPGRIP1_000236" "g.(21754036_21754236)_(21763568_21763768)del" "" "{PMID:Jamshidi 2019:30072743}" "" "dup ex1-2" "deleterious duplication 2kb 5\' of exon 1 to 0.7kb in intron 2" "Germline" "" "" "0" "" "" "g.(21285877_21286077)_(21295409_21295609)del" "" "pathogenic (recessive)" ""
"0000838414" "2" "90" "14" "21765531" "21765532" "ins" "0" "00006" "RPGRIP1_000241" "g.21765531_21765532ins[21758159_21765383;21765519_21765531]" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.21297372_21297373ins[21290000_21297224;21297360_21297372]" "" "pathogenic (recessive)" ""
"0000838415" "2" "90" "14" "21789588" "21789588" "subst" "0" "00006" "RPGRIP1_000239" "g.21789588G>A" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.21321429G>A" "" "pathogenic (recessive)" ""
"0000838416" "11" "90" "14" "21789155" "21789155" "subst" "0" "00006" "RPGRIP1_000240" "g.21789155G>C" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.21320996G>C" "" "pathogenic (recessive)" ""
"0000838417" "11" "90" "14" "21793565" "21793565" "del" "0" "00006" "RPGRIP1_000014" "g.21793565del" "" "{PMID:Jamshidi 2019:30072743}" "" "2367+23delG" "" "Germline" "" "" "0" "" "" "g.21325406del" "" "pathogenic (recessive)" ""
"0000838418" "2" "90" "14" "21798407" "21798547" "del" "0" "00006" "RPGRIP1_000216" "g.(21796787_21798407)_(21798547_21802763)del" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.(21328628_21330248)_(21330388_21334604)del" "" "pathogenic (recessive)" ""
"0000838420" "2" "90" "14" "21771613" "21771613" "del" "0" "00006" "RPGRIP1_000135" "g.21771613del" "" "{PMID:Jamshidi 2019:30072743}" "" "711_711del1" "" "Germline" "" "" "0" "" "" "g.21303454del" "" "pathogenic (recessive)" ""
"0000838421" "2" "90" "14" "21771669" "21771669" "subst" "0" "00006" "RPGRIP1_000128" "g.21771669C>G" "" "{PMID:Jamshidi 2019:30072743}" "" "" "" "Germline" "" "" "0" "" "" "g.21303510C>G" "" "pathogenic (recessive)" ""
"0000838985" "1" "90" "14" "21819307" "21819308" "ins" "4.09085E-6" "00006" "RPGRIP1_000172" "g.21819307_21819308insGAAA" "" "{PMID:Zou 2021:33907365}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000838989" "2" "90" "14" "21794565" "21794565" "subst" "0" "00006" "RPGRIP1_000242" "g.21794565G>A" "" "{PMID:Zou 2021:33907365}" "" "" "effect on splicing predicted from in vitro expression HEK293 cells mini gene splicing assay (nt numbering paper incorrect)" "Germline" "" "" "0" "" "" "g.21326406G>A" "" "pathogenic (recessive)" ""
"0000838990" "1" "90" "14" "21779986" "21779986" "dup" "0" "00006" "RPGRIP1_000243" "g.21779986dup" "" "{PMID:Zou 2021:33907365}" "" "934dupC" "" "Germline" "" "" "0" "" "" "g.21311827dup" "" "pathogenic (recessive)" ""
"0000838991" "2" "90" "14" "21789155" "21789155" "subst" "0" "00006" "RPGRIP1_000240" "g.21789155G>C" "" "{PMID:Zou 2021:33907365}" "" "" "effect on splicing predicted from in vitro expression HEK293 cells mini gene splicing assay (nt numbering incorrect)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000838992" "1" "90" "14" "21794249" "21794249" "subst" "0" "00006" "RPGRIP1_000244" "g.21794249A>G" "" "{PMID:Zou 2021:33907365}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000838994" "2" "90" "14" "21809981" "21812868" "del" "0" "00006" "RPGRIP1_000245" "g.21809981_21812868del" "" "{PMID:Zou 2021:33907365}" "" "" "variant description corrected after contact with the authors" "Germline" "" "" "0" "" "" "g.21341822_21344709del" "" "pathogenic (recessive)" ""
"0000838997" "1" "70" "14" "21793031" "21793031" "subst" "0" "00006" "RPGRIP1_000150" "g.21793031C>T" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324872C>T" "" "likely pathogenic" ""
"0000838998" "1" "70" "14" "21794249" "21794249" "subst" "0" "00006" "RPGRIP1_000244" "g.21794249A>G" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21326090A>G" "" "likely pathogenic" ""
"0000838999" "1" "70" "14" "21771677" "21771677" "subst" "0" "00006" "RPGRIP1_000249" "g.21771677T>C" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21303518T>C" "" "likely pathogenic" ""
"0000839000" "1" "70" "14" "21794056" "21794056" "subst" "2.4421E-5" "00006" "RPGRIP1_000255" "g.21794056C>T" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21325897C>T" "" "likely pathogenic" ""
"0000839001" "1" "70" "14" "21769322" "21769322" "subst" "0" "00006" "RPGRIP1_000247" "g.21769322C>T" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21301163C>T" "" "likely pathogenic" ""
"0000839002" "1" "70" "14" "21769379" "21769379" "subst" "5.12689E-6" "00006" "RPGRIP1_000248" "g.21769379C>T" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21301220C>T" "" "likely pathogenic" ""
"0000839003" "1" "70" "14" "21780067" "21780067" "subst" "8.17054E-6" "00006" "RPGRIP1_000250" "g.21780067A>G" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21311908A>G" "" "likely pathogenic" ""
"0000839004" "1" "70" "14" "21792876" "21792876" "subst" "0" "00006" "RPGRIP1_000252" "g.21792876T>C" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324717T>C" "" "likely pathogenic" ""
"0000839005" "1" "70" "14" "21793146" "21793146" "subst" "0" "00006" "RPGRIP1_000254" "g.21793146A>G" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324987A>G" "" "likely pathogenic" ""
"0000839015" "1" "70" "14" "21785868" "21785868" "dup" "0" "00006" "RPGRIP1_000251" "g.21785868dup" "" "{PMID:Zou 2021:33907365}" "" "c.1165dupA" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21317709dup" "" "likely pathogenic" ""
"0000839016" "1" "70" "14" "21762835" "21762835" "subst" "8.14425E-6" "00006" "RPGRIP1_000246" "g.21762835G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21294676G>A" "" "likely pathogenic" ""
"0000839017" "1" "70" "14" "21762835" "21762835" "subst" "8.14425E-6" "00006" "RPGRIP1_000246" "g.21762835G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21294676G>A" "" "likely pathogenic" ""
"0000839018" "1" "70" "14" "21792775" "21792775" "subst" "8.17608E-6" "00006" "RPGRIP1_000157" "g.21792775A>G" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324616A>G" "" "likely pathogenic" ""
"0000839019" "1" "70" "14" "21793466" "21793466" "subst" "2.49582E-5" "00006" "RPGRIP1_000051" "g.21793466C>T" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21325307C>T" "" "likely pathogenic" ""
"0000839020" "1" "70" "14" "21794102" "21794102" "subst" "6.09419E-5" "00006" "RPGRIP1_000099" "g.21794102G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21325943G>A" "" "likely pathogenic" ""
"0000839021" "1" "70" "14" "21794222" "21794222" "subst" "7.72207E-5" "00006" "RPGRIP1_000086" "g.21794222G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21326063G>A" "" "likely pathogenic" ""
"0000839022" "1" "70" "14" "21794254" "21794254" "subst" "1.63006E-5" "00006" "RPGRIP1_000256" "g.21794254G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21326095G>A" "" "likely pathogenic" ""
"0000839023" "1" "70" "14" "21796652" "21796652" "subst" "2.84486E-5" "00006" "RPGRIP1_000257" "g.21796652G>A" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21328493G>A" "" "likely pathogenic" ""
"0000839024" "1" "70" "14" "21802767" "21802767" "subst" "0" "00006" "RPGRIP1_000258" "g.21802767A>G" "" "{PMID:Zou 2021:33907365}" "" "" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21334608A>G" "" "likely pathogenic" ""
"0000839025" "1" "70" "14" "21780621" "21780621" "del" "0" "00006" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Zou 2021:33907365}" "" "c.1107delA" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000839026" "1" "70" "14" "21792965" "21792965" "del" "0" "00006" "RPGRIP1_000253" "g.21792965del" "" "{PMID:Zou 2021:33907365}" "" "c.1951delA" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21324806del" "" "likely pathogenic" ""
"0000839027" "1" "70" "14" "21771575" "21771575" "del" "0" "00006" "RPGRIP1_000107" "g.21771575del" "" "{PMID:Zou 2021:33907365}" "" "c.673delC" "no variant 2nd chromosome" "Germline/De novo (untested)" "" "" "0" "" "" "g.21303416del" "" "likely pathogenic" ""
"0000844304" "0" "70" "14" "21790154" "21790154" "subst" "0.00167535" "00000" "RPGRIP1_000039" "g.21790154C>T" "" "{PMID:Wiszniewski 2011:21153841}" "" "RPGRIP1 c.1753C>T, p.P585S" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21321995C>T" "" "likely pathogenic" ""
"0000844336" "0" "70" "14" "21793543" "21793543" "subst" "0" "00000" "RPGRIP1_000260" "g.21793543G>A" "" "{PMID:Wiszniewski 2011:21153841}" "" "RPGRIP1 c.2367+1G>A, Splice" "homozygous" "Unknown" "?" "" "0" "" "" "g.21325384G>A" "" "likely pathogenic" ""
"0000844337" "0" "50" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Wiszniewski 2011:21153841}" "" "RPGRIP1 c.3341A>G, p.D1114G" "single allele in a recessive disease; heterozygous" "Unknown" "?" "" "0" "" "" "g.21343037A>G" "" "VUS" ""
"0000844632" "0" "70" "14" "21792998" "21792998" "subst" "0" "00000" "RPGRIP1_000259" "g.21792998G>A" "" "{PMID:Preising 2007:17525851}" "" "RPGRIP p.E662 K (c.1986G>A)" "typing error in annotation: p.E662K is caused by c.1120del and not c.1160del; heterozygous" "Germline" "yes" "" "0" "" "" "g.21324839G>A" "" "likely pathogenic" ""
"0000844633" "3" "70" "14" "21816416" "21816416" "subst" "0" "00000" "RPGRIP1_000262" "g.21816416C>T" "" "{PMID:Preising 2007:17525851}" "" "RPGRIP1 p.Q1253X (c.3703C>T)" "error in annotation: should be p.Q1235X and not p.Q1253X, homozygous" "Germline" "yes" "" "0" "" "" "g.21348257C>T" "" "likely pathogenic" ""
"0000844646" "0" "70" "14" "21794290" "21794290" "subst" "8.47436E-6" "00000" "RPGRIP1_000261" "g.21794290C>T" "" "{PMID:Preising 2007:17525851}" "" "RPGRIP p.R890X (c. 2668C>T)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21326131C>T" "" "likely pathogenic" ""
"0000846561" "11" "70" "14" "21813348" "21813348" "del" "0" "00000" "RPGRIP1_000280" "g.21813348del" "" "{PMID:Dryja 2001:11283794}" "" "RPGRIP1 Asp1176(1-bp del)" "no nucleotide annotation, extrapolated from sequence; heterozygous" "Germline" "yes" "" "0" "" "" "g.21345189del" "" "likely pathogenic" ""
"0000846562" "3" "70" "14" "21795831" "21795831" "dup" "0" "00000" "RPGRIP1_000279" "g.21795831dup" "" "{PMID:Dryja 2001:11283794}" "" "RPGRIP1 Gln893(1-bp ins)" "no nucleotide annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21327672dup" "" "likely pathogenic" ""
"0000846563" "3" "70" "14" "21795831" "21795831" "dup" "0" "00000" "RPGRIP1_000279" "g.21795831dup" "" "{PMID:Dryja 2001:11283794}" "" "RPGRIP1 Gln893(1-bp ins)" "no nucleotide annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21327672dup" "" "likely pathogenic" ""
"0000846564" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Dryja 2001:11283794}" "" "RPGRIP1 Lys342(1-bp del)" "no nucleotide annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846565" "21" "70" "14" "21762944" "21762944" "subst" "0" "00000" "RPGRIP1_000205" "g.21762944G>A" "" "{PMID:Dryja 2001:11283794}" "" "RPGRIP1 Trp65Ter" "no nucleotide annotation, extrapolated from sequence; heterozygous" "Germline" "yes" "" "0" "" "" "g.21294785G>A" "" "likely pathogenic" ""
"0000846569" "3" "70" "14" "21793412" "21793412" "subst" "0" "00000" "RPGRIP1_000273" "g.21793412G>A" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 G2237A (G746E)" "obsolete annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21325253G>A" "" "likely pathogenic" ""
"0000846570" "3" "70" "14" "21793412" "21793412" "subst" "0" "00000" "RPGRIP1_000273" "g.21793412G>A" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 G2237A (G746E)" "obsolete annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21325253G>A" "" "likely pathogenic" ""
"0000846571" "3" "70" "14" "21770667" "21770667" "del" "0" "00000" "RPGRIP1_000264" "g.21770667del" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 delT511" "obsolete annotation, extrapolated from sequence; homozygous" "Germline" "yes" "" "0" "" "" "g.21302508del" "" "likely pathogenic" ""
"0000846572" "3" "70" "14" "21770667" "21770667" "del" "0" "00000" "RPGRIP1_000264" "g.21770667del" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 delT511" "obsolete annotation, extrapolated from sequence; heterozygous" "Germline" "yes" "" "0" "" "" "g.21302508del" "" "likely pathogenic" ""
"0000846573" "21" "70" "14" "21794189" "21794190" "dup" "0" "00000" "RPGRIP1_000277" "g.21794189_21794190dup" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 2566+2 insTT" "obsolete annotation, from the sequence in publication it is actually c.2567_2568dup, p.(Val857Leufs*2); heterozygous" "Germline" "yes" "" "0" "" "" "g.21326030_21326031dup" "" "likely pathogenic" ""
"0000846574" "11" "70" "14" "21794290" "21794290" "subst" "8.47436E-6" "00000" "RPGRIP1_000261" "g.21794290C>T" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 C2668T (R890X)" "obsolete annotation, extrapolated from sequence; heterozygous" "Germline" "yes" "" "0" "" "" "g.21326131C>T" "" "likely pathogenic" ""
"0000846575" "3" "10" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 A3341G (D1114G)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21343037A>G" "" "benign" ""
"0000846576" "11" "50" "14" "21789475" "21789475" "subst" "0" "00000" "RPGRIP1_000269" "g.21789475C>T" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 C1525T (Q509X)" "single heterozygous, no other allele found, unsure pathogenicity" "Germline" "?" "" "0" "" "" "g.21321316C>T" "" "VUS" ""
"0000846577" "21" "50" "14" "21789452" "21789455" "dup" "0" "00000" "RPGRIP1_000268" "g.21789452_21789455dup" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 1501+4 insTGTC" "single heterozygous, no other allele found, unsure pathogenicity" "Germline" "?" "" "0" "" "" "g.21321293_21321296dup" "" "VUS" ""
"0000846578" "11" "50" "14" "21819349" "21819351" "del" "0" "00000" "RPGRIP1_000189" "g.21819349_21819351del" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 del nt 3835-3837 (del E1279)" "single heterozygous, no other allele found, unsure pathogenicity, affected cousin wild type" "Germline" "no" "" "0" "" "" "g.21351190_21351192del" "" "VUS" ""
"0000846579" "11" "70" "14" "21816342" "21816343" "ins" "0" "00000" "RPGRIP1_000281" "g.21816342_21816343insG" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 ins 3629+1G" "obsolete annotation, from the sequence in publication it is actually c.3629_3630insG, p.(Val1211Serfs*4); heterozygous" "Germline" "yes" "" "0" "" "" "g.21348183_21348184insG" "" "likely pathogenic" ""
"0000846580" "21" "10" "14" "21811196" "21811196" "subst" "0.00828142" "00000" "RPGRIP1_000068" "g.21811196A>G" "" "{PMID:Gerber 2001:11528500}" "" "RPGRIP1 A3341G (D1114G)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; heterozygous" "Germline" "yes" "" "0" "" "" "g.21343037A>G" "" "benign" ""
"0000846588" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846589" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846590" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846591" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846592" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846593" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846594" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846595" "3" "70" "14" "21794102" "21794102" "subst" "0" "00000" "RPGRIP1_000185" "g.21794102G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.2480G>T, p.(Arg827Leu)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325943G>T" "" "likely pathogenic" ""
"0000846596" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846597" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846598" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846599" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846600" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846601" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846602" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846603" "3" "10" "14" "21790040" "21790040" "subst" "0.201288" "00000" "RPGRIP1_000038" "g.21790040G>T" "" "{PMID:Hameed 2003:12920076}" "" "RPGRIP1 c.1639G>T, p.(Ala547Ser)" "considered likely pathogenic at first, but later found to be at great frequencies in other populactions; homozygous" "Germline" "yes" "" "0" "" "" "g.21321881G>T" "" "benign" ""
"0000846605" "3" "90" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Roepman 2005:16339905}" "" "RPGRIP1 p.D876G" "this variant severely disrupted the interaction with nephrocystin-4" "In vitro (cloned)" "" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000846606" "3" "90" "15" "0" "0" "" "0" "00000" "IGF1R_000000" "g.?" "" "{PMID:Roepman 2005:16339905}" "" "RPGRIP1 p.R890X" "this variant severely disrupted the interaction with nephrocystin-4" "In vitro (cloned)" "" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000846607" "3" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Roepman 2005:16339905}" "" "RPGRIP1 p.G746E" "this variant severely disrupted the interaction with nephrocystin-4" "In vitro (cloned)" "" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000846608" "3" "90" "17" "0" "0" "" "0" "00000" "MYH2_000008" "g.?" "" "{PMID:Roepman 2005:16339905}" "" "RPGRIP1 p.V857fs" "this variant severely disrupted the interaction with nephrocystin-4" "In vitro (cloned)" "" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000846609" "3" "90" "18" "0" "0" "" "0" "00000" "SMCHD1_000000" "g.?" "" "{PMID:Roepman 2005:16339905}" "" "RPGRIP1 p.R852Q" "this variant severely disrupted the interaction with nephrocystin-4" "In vitro (cloned)" "" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000846612" "3" "70" "14" "21816345" "21816345" "subst" "0" "00000" "RPGRIP1_000235" "g.21816345T>A" "" "{PMID:Jacobson 2006:17306875}" "" "RPGRIP1 Val1211Glu" "no nucleotide annotation, extrapolated from protein and databases; homozygous" "Germline" "yes" "" "0" "" "" "g.21348186T>A" "" "likely pathogenic" ""
"0000846615" "0" "50" "14" "21785998" "21785998" "subst" "0.000205726" "00000" "RPGRIP1_000173" "g.21785998C>T" "" "{PMID:Seong 2009:19172513}" "" "RPGRIP1 c.1295C>T (p.S432F)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21317839C>T" "" "VUS" ""
"0000846616" "0" "50" "14" "21792816" "21792816" "subst" "2.03123E-5" "00000" "RPGRIP1_000178" "g.21792816C>G" "" "{PMID:Seong 2009:19172513}" "" "RPGRIP1 c.1802C>G (p.S601W)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324657C>G" "" "VUS" ""
"0000846617" "0" "50" "14" "21798478" "21798478" "subst" "0.000145295" "00000" "RPGRIP1_000182" "g.21798478A>T" "" "{PMID:Seong 2009:19172513}" "" "RPGRIP1 .3170A>T (p.H1057L)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21330319A>T" "" "VUS" ""
"0000846625" "0" "50" "14" "21762845" "21762845" "subst" "0.00126206" "00000" "RPGRIP1_000017" "g.21762845T>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.95T>A, M32L" "error in annotation, M32L is actually caused by c.95A>T and not c.95T>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21294686T>A" "" "VUS" ""
"0000846626" "0" "50" "14" "21762845" "21762845" "subst" "0.00126206" "00000" "RPGRIP1_000017" "g.21762845T>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.95T>A, M32L" "error in annotation, M32L is actually caused by c.95A>T and not c.95T>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21294686T>A" "" "VUS" ""
"0000846627" "0" "50" "14" "21762845" "21762845" "subst" "0.00126206" "00000" "RPGRIP1_000017" "g.21762845T>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.95T>A, M32L" "error in annotation, M32L is actually caused by c.95A>T and not c.95T>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21294686T>A" "" "VUS" ""
"0000846628" "0" "50" "14" "21762845" "21762845" "subst" "0.00126206" "00000" "RPGRIP1_000017" "g.21762845T>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.95T>A, M32L" "error in annotation, M32L is actually caused by c.95A>T and not c.95T>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21294686T>A" "" "VUS" ""
"0000846629" "0" "50" "14" "21762845" "21762845" "subst" "0.00126206" "00000" "RPGRIP1_000017" "g.21762845T>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.95T>A, M32L" "error in annotation, M32L is actually caused by c.95A>T and not c.95T>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21294686T>A" "" "VUS" ""
"0000846630" "0" "50" "14" "21769309" "21769309" "subst" "0" "00000" "RPGRIP1_000263" "g.21769309A>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.403A>G, S135R" "error in annotation, S135R is not caused by c.403A>G, it causes S135G; S135R is caused by either c.403A>C or c.405C>G or c.405C>A; heterozygous" "Unknown" "?" "" "0" "" "" "g.21301150A>G" "" "VUS" ""
"0000846631" "0" "50" "14" "21780005" "21780005" "subst" "8.35862E-6" "00000" "RPGRIP1_000265" "g.21780005C>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.953C>T, A318V" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21311846C>T" "" "VUS" ""
"0000846632" "0" "50" "14" "21780602" "21780602" "subst" "0" "00000" "RPGRIP1_000266" "g.21780602G>C" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1088G>C, R363T" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21312443G>C" "" "VUS" ""
"0000846633" "0" "50" "14" "21788184" "21788184" "subst" "0" "00000" "RPGRIP1_000267" "g.21788184G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1315G>T, E439X" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21320025G>T" "" "VUS" ""
"0000846634" "0" "50" "14" "21790154" "21790154" "subst" "0.00167535" "00000" "RPGRIP1_000039" "g.21790154C>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1753C>T, P585S" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21321995C>T" "" "VUS" ""
"0000846635" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1767G>T, Q589H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000846636" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1767G>T, Q589H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000846637" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1767G>T, Q589H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000846638" "0" "50" "14" "21792781" "21792781" "subst" "0.00284494" "00000" "RPGRIP1_000040" "g.21792781G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1767G>T, Q589H" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324622G>T" "" "VUS" ""
"0000846639" "0" "50" "14" "21792807" "21792807" "subst" "0.00354431" "00000" "RPGRIP1_000041" "g.21792807G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1793G>A, R598Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324648G>A" "" "VUS" ""
"0000846640" "0" "50" "14" "21792807" "21792807" "subst" "0.00354431" "00000" "RPGRIP1_000041" "g.21792807G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1793G>A, R598Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324648G>A" "" "VUS" ""
"0000846641" "0" "50" "14" "21792807" "21792807" "subst" "0.00354431" "00000" "RPGRIP1_000041" "g.21792807G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1793G>A, R598Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324648G>A" "" "VUS" ""
"0000846642" "0" "50" "14" "21792918" "21792918" "subst" "0.0001665" "00000" "RPGRIP1_000271" "g.21792918C>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1904C>G, A635G" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324759C>G" "" "VUS" ""
"0000846643" "0" "50" "14" "21792918" "21792918" "subst" "0.0001665" "00000" "RPGRIP1_000271" "g.21792918C>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1904C>G, A635G" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324759C>G" "" "VUS" ""
"0000846644" "0" "50" "14" "21793466" "21793466" "subst" "2.49582E-5" "00000" "RPGRIP1_000051" "g.21793466C>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2291C>T, A764V" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325307C>T" "" "VUS" ""
"0000846645" "0" "50" "14" "21794039" "21794039" "subst" "0.00239389" "00000" "RPGRIP1_000054" "g.21794039C>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2417C>T, T806I" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325880C>T" "" "VUS" ""
"0000846646" "0" "50" "14" "21794057" "21794057" "subst" "0.00102556" "00000" "RPGRIP1_000085" "g.21794057G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2435G>A, R812H" "error in annotation, R812H is not caused by c.2435G>A; c.2435G>A causes R812Q; heterozygous" "Unknown" "?" "" "0" "" "" "g.21325898G>A" "" "VUS" ""
"0000846647" "0" "50" "14" "21794132" "21794132" "subst" "4.46759E-5" "00000" "RPGRIP1_000204" "g.21794132C>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2510C>G, A837G" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325973C>G" "" "VUS" ""
"0000846648" "0" "50" "14" "21794132" "21794132" "subst" "4.46759E-5" "00000" "RPGRIP1_000204" "g.21794132C>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2510C>G, A837G" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325973C>G" "" "VUS" ""
"0000846649" "0" "50" "14" "21794134" "21794134" "subst" "7.31077E-5" "00000" "RPGRIP1_000275" "g.21794134A>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2512A>G, I838V" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325975A>G" "" "VUS" ""
"0000846650" "0" "50" "14" "21794134" "21794134" "subst" "7.31077E-5" "00000" "RPGRIP1_000275" "g.21794134A>G" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2512A>G, I838V" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325975A>G" "" "VUS" ""
"0000846651" "0" "50" "14" "21792822" "21792822" "subst" "0" "00000" "RPGRIP1_000270" "g.21792822G>C" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1808G>C, C603S" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324663G>C" "" "VUS" ""
"0000846652" "0" "50" "14" "21792927" "21792927" "subst" "1.21828E-5" "00000" "RPGRIP1_000272" "g.21792927C>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.1913C>T, T638I" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21324768C>T" "" "VUS" ""
"0000846653" "0" "50" "14" "21794063" "21794063" "subst" "8.13623E-6" "00000" "RPGRIP1_000274" "g.21794063G>T" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2441G>T, R814L" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325904G>T" "" "VUS" ""
"0000846654" "0" "50" "14" "21794143" "21794143" "subst" "0" "00000" "RPGRIP1_000276" "g.21794143G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2521G>A, A841T" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21325984G>A" "" "VUS" ""
"0000846655" "0" "50" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2555G>A, R852Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21326018G>A" "" "VUS" ""
"0000846656" "0" "50" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2555G>A, R852Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21326018G>A" "" "VUS" ""
"0000846657" "0" "50" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2555G>A, R852Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21326018G>A" "" "VUS" ""
"0000846658" "0" "50" "14" "21794177" "21794177" "subst" "0.000828541" "00000" "RPGRIP1_000057" "g.21794177G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2555G>A, R852Q" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21326018G>A" "" "VUS" ""
"0000846659" "0" "50" "14" "21794270" "21794270" "subst" "0" "00000" "RPGRIP1_000278" "g.21794270G>A" "" "{PMID:Fernandez-Martinez 2011:21224891}" "" "RPGRIP1 c.2648G>A, G883D" "heterozygous" "Unknown" "?" "" "0" "" "" "g.21326111G>A" "" "VUS" ""
"0000846697" "3" "70" "14" "21794230" "21794231" "ins" "0" "00000" "RPGRIP1_000154" "g.21794230_21794231insA" "" "{PMID:Fakhratova 2013:23278760}" "" "RPGRIP1 c.2608_2609insA, p.(Leu870TyrfsX7)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21326071_21326072insA" "" "likely pathogenic" ""
"0000846698" "3" "70" "14" "21794230" "21794231" "ins" "0" "00000" "RPGRIP1_000154" "g.21794230_21794231insA" "" "{PMID:Fakhratova 2013:23278760}" "" "RPGRIP1 c.2608_2609insA, p.(Leu870TyrfsX7)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21326071_21326072insA" "" "likely pathogenic" ""
"0000846699" "3" "70" "14" "21794706" "21796044" "del" "0" "00000" "RPGRIP1_000285" "g.21794706_21796044del" "" "{PMID:Suzuki 2014:25096270}" "" "RPGRIP1 c.2710+372_2895+76del1339" "3\' rule sgifts it to c.2710+374_2895+78del; homozygous" "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "likely pathogenic" ""
"0000846700" "3" "70" "14" "21794706" "21796044" "del" "0" "00000" "RPGRIP1_000285" "g.21794706_21796044del" "" "{PMID:Suzuki 2014:25096270}" "" "RPGRIP1 c.2710+372_2895+76del1339" "3\' rule sgifts it to c.2710+374_2895+78del; homozygous" "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "likely pathogenic" ""
"0000846701" "3" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.2236G>A, p.(Gly746Arg)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic" ""
"0000846702" "3" "70" "14" "21793411" "21793411" "subst" "1.64522E-5" "00000" "RPGRIP1_000004" "g.21793411G>A" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.2236G>A, p.(Gly746Arg)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21325252G>A" "" "likely pathogenic" ""
"0000846703" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.1107delA, p.(Glu370Asnfs*5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846704" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.1107delA, p.(Glu370Asnfs*5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846705" "3" "70" "14" "21794284" "21794284" "subst" "1.68029E-5" "00000" "RPGRIP1_000174" "g.21794284C>T" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.2662C>T, p.(Arg888X)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21326125C>T" "" "likely pathogenic" ""
"0000846706" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.1107delA, p.(Glu370Asnfs*5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846707" "3" "70" "14" "21802855" "21802855" "subst" "0" "00000" "RPGRIP1_000005" "g.21802855T>A" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.3330T>A, p.(Tyr1110*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21334696T>A" "" "likely pathogenic" ""
"0000846708" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.1107delA, p.(Glu370Asnfs*5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846709" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "" "{PMID:Khan 2013:23505306}" "" "RPGRIP1 c.1107delA, p.(Glu370Asnfs*5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.21312462del" "" "likely pathogenic" ""
"0000846710" "3" "70" "14" "21769326" "21769326" "del" "0" "00000" "RPGRIP1_000282" "g.21769326del" "" "{PMID:Abouzeid 2016:27116508}" "" "RPGRIP1 c.[420delG]" "homozygous" "Germline" "yes" "" "0" "" "" "g.21301167del" "" "likely pathogenic" ""
"0000846712" "3" "70" "14" "21789416" "21789416" "subst" "3.68179E-5" "00000" "RPGRIP1_000193" "g.21789416A>G" "" "{PMID:Huang 2017:28456785}" "" "RPGRIP1 c.1468-2A>G , Exon12 del" "homozygous" "Germline" "yes" "" "0" "" "" "g.21321257A>G" "" "likely pathogenic" ""
"0000846713" "2" "70" "14" "21793034" "21793034" "subst" "0" "00000" "RPGRIP1_000284" "g.21793034C>T" "" "{PMID:Huang 2017:28456785}" "" "RPGRIP1 c.2020C>T , p.Pro674Ser" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21324875C>T" "" "likely pathogenic" ""
"0000846714" "3" "70" "14" "0" "0" "" "0" "00000" "SERPINA1_000009" "g.?" "" "{PMID:Huang 2017:28456785}" "" "RPGRIP1 ex1-22del" "deletion exons 1-22, no breakpoints known; homozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000846715" "1" "70" "14" "21762904" "21762904" "subst" "1.21912E-5" "00000" "RPGRIP1_000003" "g.21762904C>T" "" "{PMID:Huang 2017:28456785}" "" "RPGRIP1 c.154C>T, p.Arg52*" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.21294745C>T" "" "likely pathogenic" ""
"0000846718" "3" "70" "14" "21795961" "21795961" "del" "0" "00000" "RPGRIP1_000155" "g.21795961del" "" "{PMID:Imami 2018:29193763}" "" "RPGRIP1 c.2889delT (p.P963 fs)" "3\' rule shifts it to c.2890del, first affected amino acid rule shifts it to p.S964Pfs*37; homozygous" "Germline" "yes" "" "0" "" "" "g.21327802del" "" "likely pathogenic" ""
"0000846719" "3" "70" "14" "21795961" "21795961" "del" "0" "00000" "RPGRIP1_000155" "g.21795961del" "" "{PMID:Imami 2018:29193763}" "" "RPGRIP1 c.2889delT (p.P963 fs)" "3\' rule shifts it to c.2890del, first affected amino acid rule shifts it to p.S964Pfs*37; homozygous" "Germline" "yes" "" "0" "" "" "g.21327802del" "" "likely pathogenic" ""
"0000846722" "3" "90" "14" "21775992" "21776012" "del" "0" "00000" "RPGRIP1_000283" "g.21775992_21776012del" "" "{PMID:Tallapaka 2019:31191208}" "" "RPGRIP1 c.900_906+14delTCAAGAGGTGAGTTGCCATCA" "double homozygous" "Germline" "yes" "" "0" "" "" "g.21307833_21307853del" "" "pathogenic" ""
"0000846873" "1" "70" "14" "21788314" "21788314" "subst" "0" "00000" "RPGRIP1_000148" "g.21788314T>A" "" "{PMID:Avela 2019:31087526}" "" "RPGRIP1 c.1445T>A , p.(Leu482Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21320155T>A" "" "likely pathogenic" ""
"0000846874" "1" "70" "14" "21788314" "21788314" "subst" "0" "00000" "RPGRIP1_000148" "g.21788314T>A" "" "{PMID:Avela 2019:31087526}" "" "RPGRIP1 c.1445T>A , p.(Leu482Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21320155T>A" "" "likely pathogenic" ""
"0000846925" "2" "70" "14" "21793489" "21793489" "subst" "1.31708E-5" "00000" "RPGRIP1_000153" "g.21793489C>T" "" "{PMID:Avela 2019:31087526}" "" "RPGRIP1 c.2314C>T, p.(Gln772Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21325330C>T" "" "likely pathogenic" ""
"0000846926" "2" "70" "14" "21793489" "21793489" "subst" "1.31708E-5" "00000" "RPGRIP1_000153" "g.21793489C>T" "" "{PMID:Avela 2019:31087526}" "" "RPGRIP1 c.2314C>T, p.(Gln772Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.21325330C>T" "" "likely pathogenic" ""
"0000853733" "0" "30" "14" "21756185" "21756185" "subst" "0.000511775" "02330" "RPGRIP1_000286" "g.21756185T>C" "" "" "" "RPGRIP1(NM_020366.4):c.50T>C (p.I17T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000853734" "0" "30" "14" "21762845" "21762845" "subst" "0.00126206" "02326" "RPGRIP1_000017" "g.21762845T>A" "" "" "" "RPGRIP1(NM_020366.3):c.95T>A (p.M32K), RPGRIP1(NM_020366.4):c.95T>A (p.M32K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000863486" "0" "30" "14" "21778770" "21778773" "del" "0" "02326" "RPGRIP1_000287" "g.21778770_21778773del" "" "" "" "RPGRIP1(NM_020366.3):c.930+4_930+7delCTTA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000863487" "0" "30" "14" "21793114" "21793114" "subst" "0.000515904" "02326" "RPGRIP1_000048" "g.21793114G>T" "" "" "" "RPGRIP1(NM_020366.3):c.2100G>T (p.R700=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000863488" "0" "30" "14" "21794112" "21794112" "subst" "2.03107E-5" "01943" "RPGRIP1_000288" "g.21794112C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2490C>T (p.T830=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000874677" "3" "70" "14" "21780621" "21780621" "del" "0" "00000" "RPGRIP1_000006" "g.21780621del" "frequency in 1500 in-house samples: 0" "{PMID:Alfares 2018:30202406}" "" "RPGRIP1,NM_020366.3,c.1107del, p.Glu370Asnfs*5" "homozygous" "Unknown" "?" "" "0" "" "" "g.21312462del" "" "likely pathogenic" "ACMG"
"0000891675" "0" "50" "14" "21793565" "21793565" "del" "0" "02330" "RPGRIP1_000014" "g.21793565del" "" "" "" "RPGRIP1(NM_020366.4):c.2367+23delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000891676" "0" "30" "14" "21802750" "21802750" "subst" "0.0012692" "02330" "RPGRIP1_000289" "g.21802750C>T" "" "" "" "RPGRIP1(NM_020366.4):c.3239-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000896642" "0" "50" "14" "21793098" "21793098" "subst" "4.87397E-5" "00000" "RPGRIP1_000230" "g.21793098A>G" "Taiwan Biobank: 0.000989; GnomAD_exome_East: 0.000723; GnomAD_All: 0.0000522" "{PMID:Chen 2021:33608557}" "" "RPGRIP1 c.[2084A>G];[?]; p.(Gln695Arg)" "heterozygous; single variant in a recessive gene, no second allele found" "Germline" "yes" "" "0" "" "" "g.21324939A>G" "" "VUS" ""
"0000905964" "0" "50" "14" "21813309" "21813309" "subst" "5.28314E-5" "00000" "RPGRIP1_000290" "g.21813309G>T" "" "{PMID:Zhu 2022:35456422}" "" "RPGRIP1 c.3570G>T, p.(Arg1190Ser)" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21345150G>T" "" "VUS" "ACMG"
"0000905983" "0" "70" "14" "21775921" "21775921" "del" "0" "00000" "RPGRIP1_000224" "g.21775921del" "" "{PMID:Zhu 2022:35456422}" "" "RPGRIP1 c.832del, p.(Arg278Aspfs*15)" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.21307762del" "" "likely pathogenic" "ACMG"
"0000914147" "0" "90" "14" "21793477" "21793477" "subst" "2.56432E-5" "02327" "RPGRIP1_000092" "g.21793477C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000914148" "0" "30" "14" "21793998" "21793998" "subst" "0.000472275" "02330" "RPGRIP1_000296" "g.21793998G>A" "" "" "" "RPGRIP1(NM_020366.4):c.2376G>A (p.S792=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000914149" "0" "30" "14" "21794172" "21794172" "subst" "0.000393931" "02330" "RPGRIP1_000105" "g.21794172G>A" "" "" "" "RPGRIP1(NM_020366.3):c.2550G>A (p.Q850=), RPGRIP1(NM_020366.4):c.2550G>A (p.Q850=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000915917" "1" "70" "14" "21788227" "21788245" "del" "0" "04436" "RPGRIP1_000294" "g.21788227_21788245del" "" "{PMID:Panneman 2023:36819107}" "" "c.1358_1376del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000915918" "2" "90" "14" "0" "0" "" "0" "04436" "SERPINA1_000009" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(2367+1_2368-1)_(2710+1_2711-1)del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000915940" "3" "70" "14" "0" "0" "" "0" "04436" "SERPINA1_000009" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(2367+1_2368-1)_(2710+1_2711-1)del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916071" "3" "70" "14" "21769336" "21769336" "subst" "0" "04436" "RPGRIP1_000292" "g.21769336C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.430C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916231" "1" "90" "14" "21796628" "21796628" "subst" "4.06352E-6" "04436" "RPGRIP1_000116" "g.21796628C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2941C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916232" "2" "70" "14" "0" "0" "" "0" "04436" "SERPINA1_000009" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(3099+1_3100-1)_(3238+1_3239-1)del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916328" "1" "90" "14" "21795967" "21795967" "subst" "8.91075E-6" "04436" "RPGRIP1_000297" "g.21795967G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2895+1G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916329" "2" "50" "14" "21811229" "21811229" "subst" "0" "04436" "RPGRIP1_000298" "g.21811229T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.3374T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916470" "3" "90" "14" "21794020" "21794020" "subst" "2.04252E-5" "04436" "RPGRIP1_000007" "g.21794020G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2398G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916496" "1" "90" "14" "21771703" "21771703" "subst" "1.22233E-5" "04436" "RPGRIP1_000206" "g.21771703G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.800+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916497" "2" "90" "14" "21795967" "21795967" "subst" "8.91075E-6" "04436" "RPGRIP1_000297" "g.21795967G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2895+1G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916528" "3" "70" "14" "21792785" "21792786" "ins" "0" "04436" "RPGRIP1_000295" "g.21792785_21792786insGAAA" "" "{PMID:Panneman 2023:36819107}" "" "c.1771_1772insGAAA" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916649" "3" "50" "14" "21770636" "21770636" "subst" "0" "04436" "RPGRIP1_000293" "g.21770636T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.491-11T>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916746" "3" "70" "14" "21762970" "21762970" "subst" "0" "04436" "RPGRIP1_000291" "g.21762970T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.218+2T>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000927802" "21" "90" "14" "21788232" "21788232" "del" "0" "04521" "RPGRIP1_000300" "g.21788232del" "" "Torii 2023, submitted" "" "" "" "Germline" "yes" "" "0" "" "" "g.21320073del" "" "pathogenic (recessive)" "ACMG"
"0000927803" "11" "90" "14" "21775960" "21775961" "ins" "0" "04521" "RPGRIP1_000299" "g.21775960_21775961ins[N[(300_400)];21775943_21775960]" "" "Torii 2023, submitted" "" "" "AluY insertion with an 18-bp target site duplication" "Germline" "yes" "" "0" "" "" "g.21307801_21307802ins[N[(300_400)];21307784_21307801]" "" "pathogenic (recessive)" "ACMG"
"0000927805" "21" "90" "14" "21744993" "21749459" "del" "0" "04521" "RPGRIP1_000303" "g.21744993_21749459del" "" "Torii 2023, submitted" "" "" "microdeletion involving exon 1 of RPGRIP1 (NM_020366.4)." "Germline" "" "" "0" "" "" "g.21276834_21281300del" "" "pathogenic (recessive)" ""
"0000927806" "11" "90" "14" "21794706" "21796044" "del" "0" "04521" "RPGRIP1_000188" "g.21794706_21796044del" "" "Torii 2023, submitted" "" "" "microdeletion involving exon 18" "Germline" "yes" "" "0" "" "" "g.21326547_21327885del" "" "VUS" ""
"0000927807" "21" "90" "14" "21745430" "21765363" "delins" "0" "04521" "RPGRIP1_000302" "g.21745430_21765363delinsN[330]" "" "Torii 2023, submitted" "" "" "microdeletion involving exon 1 to 3" "Germline" "yes" "" "0" "" "" "g.21277271_21297204delinsN[330]" "" "pathogenic (recessive)" ""
"0000927808" "21" "90" "14" "21744306" "21748424" "del" "0" "04521" "RPGRIP1_000303" "g.21744306_21748424del" "" "Torii 2023, submitted" "" "" "microdeletion involving exon 1 of RPGRIP1 (NM_020366.4)" "Germline" "yes" "" "0" "" "" "g.21276147_21280265del" "" "likely pathogenic (recessive)" ""
"0000927809" "21" "90" "14" "21744306" "21748424" "del" "0" "04521" "RPGRIP1_000303" "g.21744306_21748424del" "" "Torii 2023, submitted" "" "" "microdeletion involving exon 1 of RPGRIP1 (NM_020366.4)" "Germline" "yes" "" "0" "" "" "g.21276147_21280265del" "" "likely pathogenic (recessive)" ""
"0000930269" "0" "70" "14" "21794020" "21794020" "subst" "2.04252E-5" "02330" "RPGRIP1_000007" "g.21794020G>A" "" "" "" "RPGRIP1(NM_020366.4):c.2398G>A (p.E800K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000930270" "0" "30" "14" "21794112" "21794112" "subst" "2.03107E-5" "02326" "RPGRIP1_000288" "g.21794112C>T" "" "" "" "RPGRIP1(NM_020366.3):c.2490C>T (p.T830=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000930271" "0" "30" "14" "21820878" "21820878" "subst" "0.0012335" "02325" "SUPT16H_000030" "g.21820878C>T" "" "" "" "SUPT16H(NM_007192.4):c.3098G>A (p.R1033H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" ""
"0000944541" "3" "70" "14" "21799664" "21803187" "del" "0" "04542" "RPGRIP1_000159" "g.21799664_21803187del" "" "{PMID:Fadaie 2021:34795310}, {PMID:de Bruijn 2023:36524988}" "" "" "" "Germline" "yes" "" "0" "" "" "g.21331505_21335028del" "" "likely pathogenic (recessive)" "ACMG"
"0000954069" "3" "90" "14" "21813304" "21813310" "del" "0" "00006" "RPGRIP1_000093" "g.21813304_21813310del" "" "{PMID:Moon 2021:35052368}" "" "3565_3571delCGAAGGC" "" "Germline" "" "" "0" "" "" "g.21345145_21345151del" "" "pathogenic" ""
"0000958386" "0" "70" "14" "21793565" "21793565" "del" "0" "00006" "RPGRIP1_000014" "g.21793565del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG, BP7" "Germline" "" "" "0" "" "" "g.21325406del" "" "likely pathogenic (recessive)" "ACMG"
"0000958586" "0" "90" "14" "21771703" "21771703" "subst" "1.22233E-5" "00006" "RPGRIP1_000206" "g.21771703G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.21303544G>A" "" "pathogenic (recessive)" "ACMG"
"0000958666" "0" "70" "14" "21810123" "21813018" "del" "0" "00006" "RPGRIP1_000306" "g.21810123_21813018del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.21341964_21344859del" "" "likely pathogenic (recessive)" "ACMG"
"0000958667" "0" "50" "14" "21769174" "21769174" "subst" "0" "00006" "RPGRIP1_000217" "g.21769174G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5, BP4" "Germline" "" "" "0" "" "" "g.21301015G>A" "" "VUS" "ACMG"
"0000958877" "0" "70" "14" "21769237" "21769237" "subst" "0" "00006" "RPGRIP1_000304" "g.21769237C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.21301078C>T" "" "likely pathogenic (recessive)" "ACMG"
"0000959317" "0" "50" "14" "21793234" "21793234" "subst" "0" "00006" "RPGRIP1_000305" "g.21793234G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2" "Germline" "" "" "0" "" "" "g.21325075G>A" "" "VUS" "ACMG"
"0000967431" "0" "30" "14" "21780583" "21780583" "subst" "0.000112451" "02330" "RPGRIP1_000307" "g.21780583C>A" "" "" "" "RPGRIP1(NM_020366.4):c.1078-9C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000967432" "0" "30" "14" "21788303" "21788303" "subst" "2.43728E-5" "02330" "RPGRIP1_000308" "g.21788303C>T" "" "" "" "RPGRIP1(NM_020366.4):c.1434C>T (p.H478=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000980804" "0" "30" "14" "21798479" "21798479" "subst" "0.00047915" "01804" "RPGRIP1_000066" "g.21798479C>T" "" "" "" "RPGRIP1(NM_020366.3):c.3171C>T (p.H1057=), RPGRIP1(NM_020366.4):c.3171C>T (p.H1057=, p.(His1057=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000985488" "0" "90" "14" "21775921" "21775921" "subst" "0" "02230" "RPGRIP1_000309" "g.21775921C>T" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.21307762C>T" "" "pathogenic (recessive)" ""
"0000985496" "0" "90" "14" "21789290" "21789290" "subst" "0" "02230" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985498" "21" "90" "14" "21789452" "21789455" "dup" "0" "00006" "RPGRIP1_000268" "g.21789452_21789455dup" "" "{PMID:Perrault 2021:33670832}" "" "1502-1505insTGTC" "" "Germline" "" "" "0" "" "" "g.21321293_21321296dup" "" "pathogenic (recessive)" ""
"0000985499" "21" "90" "14" "21789475" "21789475" "subst" "0" "00006" "RPGRIP1_000269" "g.21789475C>T" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs61751267" "0" "" "" "g.21321316C>T" "" "pathogenic (recessive)" ""
"0000985500" "11" "90" "14" "21795967" "21795967" "subst" "8.91075E-6" "00006" "RPGRIP1_000297" "g.21795967G>T" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs748072501" "0" "" "" "g.21327808G>T" "" "pathogenic (recessive)" ""
"0000985501" "3" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985502" "3" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985503" "1" "90" "14" "21778843" "21778843" "subst" "0" "00006" "RPGRIP1_000310" "g.21778843A>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "" "0" "" "" "g.21310684A>G" "" "pathogenic (recessive)" ""
"0000985504" "21" "90" "14" "21794059" "21794059" "del" "0" "00006" "RPGRIP1_000312" "g.21794059del" "" "{PMID:Perrault 2021:33670832}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.21325900del" "" "pathogenic (recessive)" ""
"0000985505" "21" "90" "14" "21798547" "21798547" "subst" "0" "00006" "RPGRIP1_000238" "g.21798547G>A" "" "{PMID:Perrault 2021:33670832}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.21330388G>A" "" "pathogenic (recessive)" ""
"0000985506" "11" "90" "14" "21795967" "21795967" "subst" "8.91075E-6" "00006" "RPGRIP1_000297" "g.21795967G>T" "" "{PMID:Perrault 2021:33670832}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.21327808G>T" "" "pathogenic (recessive)" ""
"0000985507" "11" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985508" "11" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985509" "21" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985510" "2" "90" "14" "21789290" "21789290" "subst" "0" "00006" "RPGRIP1_000311" "g.21789290T>G" "" "{PMID:Perrault 2021:33670832}" "" "" "" "Germline" "" "rs1245948143" "0" "" "" "g.21321131T>G" "" "pathogenic (recessive)" ""
"0000985980" "11" "70" "14" "21770745" "21770745" "subst" "0" "04695" "RPGRIP1_000313" "g.21770745T>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.21302586T>G" "" "likely pathogenic" "ACMG"
"0000985981" "21" "90" "14" "21789587" "21789587" "subst" "0" "04695" "RPGRIP1_000314" "g.21789587G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.21321428G>A" "" "likely pathogenic" "ACMG"
"0000986589" "1" "50" "14" "21792959" "21792959" "subst" "4.06138E-6" "04405" "RPGRIP1_000317" "g.21792959C>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.21324800C>A" "" "VUS" "ACMG"
"0000986960" "2" "50" "14" "21794287" "21794287" "subst" "8.04117E-5" "04405" "RPGRIP1_000318" "g.21794287G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.21326128G>A" "" "VUS" "ACMG"
"0000987235" "0" "70" "14" "21816333" "21816333" "subst" "0" "00006" "RPGRIP1_000156" "g.21816333T>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.21348174T>G" "" "likely pathogenic" "ACMG"
"0000987276" "0" "90" "14" "21790016" "21790025" "del" "0" "00006" "RPGRIP1_000037" "g.21790016_21790025del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.21321857_21321866del" "" "pathogenic" "ACMG"
"0000987325" "0" "70" "14" "21788175" "21788337" "del" "0" "00006" "RPGRIP1_000316" "g.(21786010_21788175)_(21788337_21789417)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000987336" "0" "70" "14" "21771533" "21771533" "del" "0" "00006" "RPGRIP1_000315" "g.21771533del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.21303374del" "" "likely pathogenic" "ACMG"
"0001000837" "0" "30" "14" "21820891" "21820891" "subst" "1.22673E-5" "01804" "SUPT16H_000032" "g.21820891G>A" "" "" "" "SUPT16H(NM_007192.3):c.3085C>T (p.(Arg1029Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" ""
"0001000838" "0" "50" "14" "21822563" "21822563" "subst" "0" "01804" "SUPT16H_000033" "g.21822563C>T" "" "" "" "SUPT16H(NM_007192.3):c.2790+7G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" ""
"0001022265" "3" "90" "14" "21796622" "21796622" "subst" "0" "00006" "RPGRIP1_000109" "g.21796622C>T" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs1371805993" "0" "" "" "g.21328463C>T" "" "pathogenic" ""
"0001039856" "0" "90" "14" "21771701" "21771701" "subst" "4.07319E-6" "01804" "RPGRIP1_000026" "g.21771701C>T" "" "" "" "RPGRIP1(NM_020366.4):c.799C>T (p.(Arg267*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0001039857" "0" "50" "14" "21793077" "21793077" "subst" "0.000251801" "01804" "RPGRIP1_000321" "g.21793077C>T" "" "" "" "RPGRIP1(NM_020366.4):c.2063C>T (p.(Ser688Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001054751" "0" "50" "14" "21762866" "21762866" "subst" "2.43698E-5" "01804" "RPGRIP1_000322" "g.21762866G>A" "" "" "" "RPGRIP1(NM_020366.4):c.116G>A (p.(Ser39Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001054752" "0" "50" "14" "21762877" "21762877" "subst" "8.12387E-5" "01804" "RPGRIP1_000323" "g.21762877C>T" "" "" "" "RPGRIP1(NM_020366.4):c.127C>T (p.(Arg43Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001054753" "0" "30" "14" "21786012" "21786012" "subst" "5.2319E-5" "01804" "RPGRIP1_000324" "g.21786012A>G" "" "" "" "RPGRIP1(NM_020366.4):c.1306+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes RPGRIP1
## Count = 751
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000036431" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060449" "00018070" "10" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" "4"
"0000060450" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060451" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060452" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060453" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060454" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060455" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060456" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060457" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000060458" "00018070" "90" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" "2"
"0000060459" "00018070" "90" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" "2"
"0000060460" "00018070" "90" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "15"
"0000060461" "00018070" "90" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "15"
"0000060462" "00018070" "90" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "15"
"0000060463" "00018070" "90" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "15"
"0000060464" "00018070" "90" "3330" "0" "3330" "0" "c.3330T>A" "r.(?)" "p.(Tyr1110*)" "20"
"0000060465" "00018070" "90" "3330" "0" "3330" "0" "c.3330T>A" "r.(?)" "p.(Tyr1110*)" "20"
"0000060466" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000060467" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000060468" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000060469" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000060470" "00018070" "90" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000060471" "00018070" "90" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000060472" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000060473" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000060474" "00018070" "50" "2792" "0" "2793" "0" "c.2792_2793insGGTA" "r.(?)" "p.(Pro932Valfs*3)" "17"
"0000060475" "00018070" "50" "2792" "0" "2793" "0" "c.2792_2793insGGTA" "r.(?)" "p.(Pro932Valfs*3)" "17"
"0000060476" "00018070" "70" "3434" "0" "3434" "0" "c.3434del" "r.(?)" "p.(Glu1145Glyfs*18)" "21"
"0000060479" "00018070" "70" "2041" "0" "2041" "0" "c.2041C>T" "r.(?)" "p.(Gln681*)" "14"
"0000060481" "00018070" "70" "2041" "0" "2041" "0" "c.2041C>T" "r.(?)" "p.(Gln681*)" "14"
"0000060482" "00018070" "70" "3788" "0" "3788" "0" "c.3788T>C" "r.(?)" "p.(Leu1263Pro)" "24"
"0000060483" "00018070" "70" "3788" "0" "3788" "0" "c.3788T>C" "r.(?)" "p.(Leu1263Pro)" "24"
"0000162821" "00018070" "90" "932" "0" "932" "0" "c.932del" "r.(?)" "p.(Asn311Ilefs*5)" "8"
"0000170952" "00018070" "90" "895" "0" "896" "0" "c.895_896del" "r.(?)" "p.(Glu299Serfs*21)" "6"
"0000170953" "00018070" "70" "2367" "23" "2367" "23" "c.2367+23del" "r.(?)" "p.(=)" "15i"
"0000247205" "00018070" "10" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000247257" "00018070" "10" "2050" "0" "2050" "0" "c.2050A>T" "r.(?)" "p.(Met684Leu)" ""
"0000247262" "00018070" "10" "930" "3" "930" "3" "c.930+3A>G" "r.spl?" "p.?" ""
"0000247277" "00018070" "30" "808" "0" "808" "0" "c.808A>G" "r.(?)" "p.(Ile270Val)" ""
"0000247278" "00018070" "30" "860" "0" "860" "0" "c.860A>G" "r.(?)" "p.(Asn287Ser)" ""
"0000247279" "00018070" "30" "3551" "0" "3551" "0" "c.3551A>G" "r.(?)" "p.(Gln1184Arg)" ""
"0000247989" "00018070" "10" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" ""
"0000250668" "00018070" "10" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000253020" "00018070" "10" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000253250" "00018070" "10" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" ""
"0000253475" "00018070" "10" "525" "0" "525" "0" "c.525A>G" "r.(?)" "p.(Pro175=)" ""
"0000255912" "00018070" "50" "563" "0" "563" "0" "c.563A>C" "r.(?)" "p.(Glu188Ala)" ""
"0000295015" "00018070" "10" "1307" "-18" "1307" "-18" "c.1307-18T>G" "r.(=)" "p.(=)" ""
"0000295016" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000295017" "00018070" "30" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000295018" "00018070" "30" "1796" "0" "1796" "0" "c.1796C>T" "r.(?)" "p.(Pro599Leu)" ""
"0000295019" "00018070" "30" "1920" "0" "1920" "0" "c.1920C>T" "r.(?)" "p.(Ala640=)" ""
"0000295020" "00018070" "70" "1948" "0" "1948" "0" "c.1948C>T" "r.(?)" "p.(Pro650Ser)" ""
"0000295021" "00018070" "10" "218" "13" "218" "13" "c.218+13C>G" "r.(=)" "p.(=)" ""
"0000295022" "00018070" "10" "2292" "0" "2292" "0" "c.2292G>A" "r.(?)" "p.(Ala764=)" ""
"0000295023" "00018070" "10" "2397" "0" "2397" "0" "c.2397C>T" "r.(?)" "p.(Asn799=)" ""
"0000295024" "00018070" "10" "2592" "0" "2592" "0" "c.2592T>C" "r.(?)" "p.(Tyr864=)" ""
"0000295025" "00018070" "30" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" ""
"0000295026" "00018070" "10" "2878" "0" "2878" "0" "c.2878G>C" "r.(?)" "p.(Ala960Pro)" ""
"0000295027" "00018070" "30" "3057" "0" "3057" "0" "c.3057G>A" "r.(?)" "p.(Met1019Ile)" ""
"0000295028" "00018070" "10" "3171" "0" "3171" "0" "c.3171C>T" "r.(?)" "p.(His1057=)" ""
"0000295029" "00018070" "30" "3178" "0" "3178" "0" "c.3178G>A" "r.(?)" "p.(Glu1060Lys)" ""
"0000295030" "00018070" "10" "3447" "0" "3447" "0" "c.3447C>T" "r.(?)" "p.(Tyr1149=)" ""
"0000295031" "00018070" "30" "376" "0" "376" "0" "c.376G>C" "r.(?)" "p.(Gly126Arg)" ""
"0000295032" "00018070" "10" "450" "0" "450" "0" "c.450C>G" "r.(?)" "p.(Leu150=)" ""
"0000295033" "00018070" "10" "906" "15" "906" "17" "c.906+15_906+17del" "r.(=)" "p.(=)" ""
"0000295034" "00018070" "10" "95" "0" "95" "0" "c.95T>A" "r.(?)" "p.(Met32Lys)" ""
"0000297735" "00018070" "10" "1152" "-65" "1152" "-65" "c.1152-65G>A" "r.(=)" "p.(=)" ""
"0000297736" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000297737" "00018070" "10" "3097" "0" "3097" "0" "c.3097G>C" "r.(?)" "p.(Glu1033Gln)" ""
"0000297738" "00018070" "10" "907" "-16" "907" "-14" "c.907-16_907-14del" "r.(=)" "p.(=)" ""
"0000301490" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000301491" "00018070" "10" "2417" "0" "2417" "0" "c.2417C>T" "r.(?)" "p.(Thr806Ile)" ""
"0000307327" "00018070" "50" "1173" "0" "1173" "0" "c.1173C>G" "r.(?)" "p.(Ser391Arg)" ""
"0000307328" "00018070" "30" "1197" "0" "1197" "0" "c.1197C>T" "r.(?)" "p.(Asn399=)" ""
"0000307329" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000307330" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000307331" "00018070" "10" "1797" "0" "1797" "0" "c.1797G>A" "r.(?)" "p.(Pro599=)" ""
"0000307332" "00018070" "50" "1937" "0" "1937" "0" "c.1937G>A" "r.(?)" "p.(Gly646Glu)" ""
"0000307333" "00018070" "30" "2100" "0" "2100" "0" "c.2100G>T" "r.(?)" "p.(Arg700=)" ""
"0000307334" "00018070" "10" "2215" "7" "2215" "7" "c.2215+7G>A" "r.(=)" "p.(=)" ""
"0000307335" "00018070" "50" "2291" "0" "2291" "0" "c.2291C>T" "r.(?)" "p.(Ala764Val)" ""
"0000307336" "00018070" "30" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" ""
"0000307337" "00018070" "10" "2711" "-13" "2711" "-13" "c.2711-13G>T" "r.(=)" "p.(=)" ""
"0000307338" "00018070" "10" "287" "0" "287" "0" "c.287C>A" "r.(?)" "p.(Pro96Gln)" ""
"0000307339" "00018070" "10" "3097" "0" "3097" "0" "c.3097G>C" "r.(?)" "p.(Glu1033Gln)" ""
"0000307340" "00018070" "30" "3171" "0" "3171" "0" "c.3171C>T" "r.(?)" "p.(His1057=)" ""
"0000307341" "00018070" "30" "3546" "0" "3546" "0" "c.3546C>T" "r.(?)" "p.(Asp1182=)" ""
"0000307342" "00018070" "90" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000307344" "00018070" "50" "86" "0" "86" "0" "c.86G>T" "r.(?)" "p.(Gly29Val)" ""
"0000307345" "00018070" "30" "95" "0" "95" "0" "c.95T>A" "r.(?)" "p.(Met32Lys)" ""
"0000337509" "00018070" "10" "2215" "7" "2215" "7" "c.2215+7G>A" "r.(=)" "p.(=)" ""
"0000339668" "00018070" "10" "1797" "0" "1797" "0" "c.1797G>A" "r.(?)" "p.(Pro599=)" ""
"0000341495" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000341774" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000342477" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Ter)" ""
"0000343155" "00018070" "10" "1793" "0" "1793" "0" "c.1793G>A" "r.(?)" "p.(Arg598Gln)" ""
"0000343393" "00018070" "90" "2440" "0" "2440" "0" "c.2440C>T" "r.(?)" "p.(Arg814Ter)" ""
"0000343424" "00018070" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Ter)" ""
"0000347461" "00018070" "10" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" ""
"0000348538" "00018070" "70" "1948" "0" "1948" "0" "c.1948C>T" "r.(?)" "p.(Pro650Ser)" ""
"0000348618" "00018070" "90" "2792" "0" "2793" "0" "c.2792_2793insGGTA" "r.(?)" "p.(Pro932ValfsTer3)" ""
"0000349898" "00018070" "50" "3683" "0" "3683" "0" "c.3683A>G" "r.(?)" "p.(Tyr1228Cys)" ""
"0000358335" "00018070" "90" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539Glnfs*2)" "13"
"0000358336" "00018070" "70" "2249" "0" "2249" "0" "c.2249A>G" "r.(?)" "p.(Tyr750Cys)" "15"
"0000358337" "00018070" "90" "2974" "0" "2974" "0" "c.2974del" "r.(?)" "p.(Arg992Glufs*9)" "18"
"0000487580" "00018070" "90" "1624" "0" "1624" "0" "c.1624del" "r.(?)" "p.(Ala542Glnfs*2)" "13"
"0000487581" "00018070" "90" "1116" "0" "1116" "0" "c.1116del" "r.(?)" "p.(Lys372Asnfs*3)" "9"
"0000551496" "00018070" "90" "176" "0" "176" "0" "c.176del" "r.(?)" "p.(Leu59TrpfsTer2)" ""
"0000551497" "00018070" "50" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" ""
"0000551498" "00018070" "10" "450" "0" "450" "0" "c.450C>G" "r.(?)" "p.(Leu150=)" ""
"0000551499" "00018070" "10" "491" "-3" "491" "-3" "c.491-3T>C" "r.spl?" "p.?" ""
"0000551500" "00018070" "30" "491" "-3" "491" "-3" "c.491-3T>C" "r.spl?" "p.?" ""
"0000551501" "00018070" "30" "783" "0" "783" "0" "c.783G>A" "r.(?)" "p.(Gln261=)" ""
"0000551502" "00018070" "50" "808" "0" "808" "0" "c.808A>G" "r.(?)" "p.(Ile270Val)" ""
"0000551503" "00018070" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" ""
"0000551504" "00018070" "10" "907" "-16" "907" "-14" "c.907-16_907-14del" "r.(=)" "p.(=)" ""
"0000551505" "00018070" "50" "1236" "0" "1236" "0" "c.1236G>A" "r.(?)" "p.(Gln412=)" ""
"0000551506" "00018070" "30" "1306" "4" "1306" "4" "c.1306+4G>T" "r.spl?" "p.?" ""
"0000551507" "00018070" "30" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000551509" "00018070" "10" "2223" "0" "2223" "0" "c.2223T>C" "r.(?)" "p.(Gly741=)" ""
"0000551510" "00018070" "30" "2264" "0" "2264" "0" "c.2264G>A" "r.(?)" "p.(Arg755His)" ""
"0000551511" "00018070" "30" "2284" "0" "2284" "0" "c.2284C>T" "r.(?)" "p.(Leu762=)" ""
"0000551512" "00018070" "30" "2284" "0" "2284" "0" "c.2284C>T" "r.(?)" "p.(Leu762=)" ""
"0000551513" "00018070" "30" "2284" "0" "2284" "0" "c.2284C>T" "r.(?)" "p.(Leu762=)" ""
"0000551514" "00018070" "50" "2435" "0" "2435" "0" "c.2435G>A" "r.(?)" "p.(Arg812Gln)" ""
"0000551515" "00018070" "70" "2435" "0" "2435" "0" "c.2435G>A" "r.(?)" "p.(Arg812Gln)" ""
"0000551516" "00018070" "90" "2440" "0" "2440" "0" "c.2440C>T" "r.(?)" "p.(Arg814Ter)" ""
"0000551517" "00018070" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Ter)" ""
"0000551518" "00018070" "30" "2600" "0" "2600" "0" "c.2600G>A" "r.(?)" "p.(Arg867Gln)" ""
"0000551519" "00018070" "50" "3307" "0" "3308" "0" "c.3307_3308insAAATA" "r.(?)" "p.(Val1103GlufsTer33)" ""
"0000551520" "00018070" "30" "3309" "0" "3310" "0" "c.3309_3310del" "r.(?)" "p.(Pro1104ThrfsTer8)" ""
"0000551521" "00018070" "50" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" ""
"0000551522" "00018070" "10" "3483" "0" "3483" "0" "c.3483C>T" "r.(?)" "p.(Ser1161=)" ""
"0000551523" "00018070" "30" "5376" "0" "5376" "0" "c.*1515C>T" "r.(=)" "p.(=)" ""
"0000604552" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" "22"
"0000604553" "00018070" "70" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" "15"
"0000604554" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" "22/24"
"0000604555" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" "22"
"0000604570" "00018070" "70" "2079" "0" "2079" "0" "c.2079C>G" "r.(?)" "p.(Tyr693*)" "14"
"0000604571" "00018070" "70" "2212" "0" "2215" "21" "c.2212_2215+21del" "r.spl?" "p.?" "14_14i"
"0000614762" "00018070" "10" "153" "0" "153" "0" "c.153T>C" "r.(?)" "p.(Phe51=)" ""
"0000614763" "00018070" "30" "675" "0" "675" "0" "c.675C>T" "r.(?)" "p.(His225=)" ""
"0000614764" "00018070" "30" "1128" "0" "1128" "0" "c.1128C>A" "r.(?)" "p.(Asp376Glu)" ""
"0000614765" "00018070" "50" "2480" "0" "2480" "0" "c.2480G>A" "r.(?)" "p.(Arg827His)" ""
"0000614766" "00018070" "30" "2711" "-13" "2711" "-13" "c.2711-13G>T" "r.(=)" "p.(=)" ""
"0000614767" "00018070" "30" "2878" "0" "2878" "0" "c.2878G>T" "r.(?)" "p.(Ala960Ser)" ""
"0000648828" "00018070" "30" "287" "0" "287" "0" "c.287C>A" "r.(?)" "p.(Pro96Gln)" ""
"0000648829" "00018070" "30" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000648830" "00018070" "50" "2075" "0" "2075" "0" "c.2075A>G" "r.(?)" "p.(His692Arg)" ""
"0000648831" "00018070" "50" "3546" "0" "3546" "0" "c.3546C>T" "r.(=)" "p.(=)" ""
"0000657368" "00018070" "50" "2591" "0" "2591" "0" "c.2591A>G" "r.(?)" "p.(Tyr864Cys)" ""
"0000669237" "00018070" "30" "287" "0" "287" "0" "c.287C>A" "r.(?)" "p.(Pro96Gln)" ""
"0000669238" "00018070" "50" "3546" "0" "3546" "0" "c.3546C>T" "r.(=)" "p.(=)" ""
"0000679897" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000679898" "00018070" "50" "2027" "0" "2027" "0" "c.2027A>G" "r.(?)" "p.(Tyr676Cys)" ""
"0000679899" "00018070" "90" "2183" "0" "2184" "0" "c.2183_2184del" "r.(?)" "p.(Val728GlyfsTer39)" ""
"0000679900" "00018070" "30" "2550" "0" "2550" "0" "c.2550G>A" "r.(?)" "p.(Gln850=)" ""
"0000679901" "00018070" "50" "3298" "0" "3298" "0" "c.3298G>T" "r.(?)" "p.(Asp1100Tyr)" ""
"0000684408" "00018070" "70" "2021" "0" "2021" "0" "c.2021C>A" "r.(?)" "p.(Pro674His)" "14"
"0000684578" "00018070" "70" "673" "0" "673" "0" "c.673del" "r.(?)" "p.(His225Thrfs*50)" ""
"0000684642" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000685464" "00018070" "90" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539Glnfs*2)" ""
"0000685465" "00018070" "70" "2249" "0" "2249" "0" "c.2249A>G" "r.(?)" "p.(Tyr750Cys)" ""
"0000685466" "00018070" "90" "2935" "0" "2935" "0" "c.2935C>T" "r.(?)" "p.(Gln979*)" ""
"0000685467" "00018070" "90" "2974" "0" "2974" "0" "c.2974del" "r.(?)" "p.(Arg992Glufs*9)" ""
"0000685468" "00018070" "90" "3663" "0" "3666" "0" "c.3663_3666del" "r.(?)" "p.(Lys1221Asnfs*23)" ""
"0000691605" "00018070" "90" "1354" "0" "1354" "0" "c.1354del" "r.(?)" "p.(His452IlefsTer5)" ""
"0000691606" "00018070" "50" "3679" "0" "3679" "0" "c.3679G>C" "r.(?)" "p.(Gly1227Arg)" ""
"0000710259" "00018070" "90" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" ""
"0000710261" "00018070" "90" "2775" "0" "2775" "0" "c.2775G>A" "r.(?)" "p.(Trp925*)" ""
"0000710276" "00018070" "90" "1624" "0" "1624" "0" "c.1624del" "r.(?)" "p.(Ala542Glnfs*2)" ""
"0000710293" "00018070" "90" "1116" "0" "1116" "0" "c.1116del" "r.(?)" "p.(Lys372Asnfs*3)" ""
"0000713291" "00018070" "90" "2941" "0" "2941" "0" "c.2941C>T" "r.(?)" "p.(Arg981*)" ""
"0000713511" "00018070" "90" "2889" "0" "2889" "0" "c.2889del" "r.(?)" "p.(Ser964Profs*37)" ""
"0000713666" "00018070" "90" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" ""
"0000713674" "00018070" "90" "1113" "0" "1113" "0" "c.1113del" "r.(?)" "p.(Lys372Asnfs*3)" ""
"0000713701" "00018070" "90" "3120" "0" "3120" "0" "c.3120G>A" "r.(?)" "p.(Trp1040*)" ""
"0000714068" "00018070" "70" "3100" "-1" "3238" "1" "c.(3099+1_3100-1)_(3238+1_3289)del" "r.?" "p.?" ""
"0000714103" "00018070" "70" "2079" "0" "2079" "0" "c.2079C>G" "r.(?)" "p.(Tyr693*)" ""
"0000724665" "00018070" "50" "218" "6" "218" "6" "c.218+6T>C" "r.(=)" "p.(=)" ""
"0000724666" "00018070" "30" "372" "0" "372" "0" "c.372G>A" "r.(?)" "p.(Leu124=)" ""
"0000724667" "00018070" "30" "453" "0" "453" "0" "c.453C>T" "r.(?)" "p.(His151=)" ""
"0000724668" "00018070" "30" "2331" "0" "2331" "0" "c.2331C>A" "r.(?)" "p.(Thr777=)" ""
"0000724669" "00018070" "30" "2397" "0" "2397" "0" "c.2397C>T" "r.(?)" "p.(Asn799=)" ""
"0000724670" "00018070" "50" "2617" "0" "2617" "0" "c.2617C>G" "r.(?)" "p.(His873Asp)" ""
"0000724671" "00018070" "50" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" ""
"0000731011" "00018070" "70" "767" "0" "767" "0" "c.767C>G" "r.(?)" "p.(Ser256*)" ""
"0000731012" "00018070" "70" "1180" "0" "1180" "0" "c.1180C>T" "r.(?)" "p.(Gln394*)" ""
"0000731055" "00018070" "50" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000731074" "00018070" "50" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000731083" "00018070" "70" "1087" "0" "1090" "0" "c.1087_1090del" "r.(?)" "p.(Arg363Leufs*11)" ""
"0000731252" "00018070" "70" "1219" "0" "1219" "0" "c.1219C>T" "r.(?)" "p.(Gln407*)" ""
"0000731253" "00018070" "70" "2935" "0" "2935" "0" "c.2935C>T" "r.(?)" "p.(Gln979*)" ""
"0000731277" "00018070" "70" "3100" "-31" "3238" "5" "c.(3100-106_3100-31)_(3238+5_3238+499)del" "r.?" "p.?" "18i_19i"
"0000731278" "00018070" "70" "1447" "0" "1447" "0" "c.1447C>T" "r.(?)" "p.(Gln483*)" ""
"0000731294" "00018070" "50" "1763" "-8" "1763" "-8" "c.1763-8C>G" "r.(?)" "p.(=)" ""
"0000731314" "00018070" "70" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000731315" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000731340" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000731347" "00018070" "70" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000731348" "00018070" "70" "2079" "0" "2079" "0" "c.2079C>G" "r.(?)" "p.(Tyr693*)" ""
"0000731349" "00018070" "70" "2212" "0" "2215" "21" "c.2212_2215+21del" "r.spl" "p.?" "14i"
"0000731444" "00018070" "70" "86" "-3" "86" "-3" "c.86-3T>G" "r.spl" "p.?" ""
"0000731459" "00018070" "70" "2227" "0" "2228" "0" "c.2227_2228del" "r.(?)" "p.(Glu743Argfs*24)" ""
"0000732476" "00018070" "50" "3402" "0" "3404" "0" "c.3402_3404delGTC" "r.(?)" "p.(Met1134_Ser1135delinsIle)" ""
"0000732520" "00018070" "90" "256" "0" "256" "0" "c.256C>T" "r.(?)" "p.(Arg86Trp)" ""
"0000732606" "00018070" "50" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000732627" "00018070" "90" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000732662" "00018070" "70" "3339" "5" "3339" "5" "c.3339+5G>A" "r.(del-exon)" "p.?" ""
"0000732671" "00018070" "70" "1611" "0" "1611" "0" "c.1611G>A" "r.ins,del,del" "p.?" ""
"0000732683" "00018070" "70" "564" "0" "564" "0" "c.564A>G" "r.[(565_587del,491_587del)]" "p.?" ""
"0000732692" "00018070" "70" "2718" "0" "2718" "0" "c.2718dupT" "r.(?)" "p.(Asn907*)" ""
"0000732702" "00018070" "70" "2759" "0" "2760" "0" "c.2759_2760insT" "r.(?)" "p.(Gln920Hisfs*14)" ""
"0000733199" "00018070" "70" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539Glnfs*2)" ""
"0000733200" "00018070" "70" "1892" "0" "1892" "0" "c.1892A>G" "r.(?)" "p.(His631Arg)" ""
"0000733630" "00018070" "70" "711" "0" "711" "0" "c.711del" "r.(?)" "p.(Lys239Serfs*36)" ""
"0000735672" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267*)" ""
"0000735770" "00018070" "90" "2718" "0" "2718" "0" "c.2718dup" "r.(?)" "p.(Asn907*)" ""
"0000735843" "00018070" "70" "895" "0" "896" "0" "c.895_896del" "r.(?)" "p.(Glu299SerfsTer21)" ""
"0000735863" "00018070" "70" "2367" "23" "2367" "23" "c.2367+23del" "r.spl" "p.?" ""
"0000735996" "00018070" "70" "1220" "0" "1220" "0" "c.1220dup" "r.(?)" "p.(Gln408AlafsTer13)" "10"
"0000736217" "00018070" "90" "2225" "0" "2226" "0" "c.2225_2226delGA" "r.(?)" "p.(Glu743Argfs*24)" "15"
"0000736261" "00018070" "90" "2795" "0" "2796" "0" "c.2795_2796insT" "r.(?)" "p.(Glu933*)" "17"
"0000736357" "00018070" "70" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539Glnfs*2)" "13"
"0000736358" "00018070" "70" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000736378" "00018070" "10" "525" "0" "525" "0" "c.525A>G" "r.(=)" "p.(=)" "4"
"0000736379" "00018070" "10" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" "4"
"0000736380" "00018070" "10" "1797" "0" "1797" "0" "c.1797G>A" "r.(=)" "p.(=)" "14"
"0000736381" "00018070" "10" "3097" "0" "3097" "0" "c.3097G>C" "r.(?)" "p.(Glu1033Gln)" "18"
"0000736382" "00018070" "10" "3546" "0" "3546" "0" "c.3546C>T" "r.(=)" "p.(=)" "22"
"0000736383" "00018070" "10" "2292" "0" "2292" "0" "c.2292G>A" "r.(=)" "p.(=)" "15"
"0000736384" "00018070" "10" "286" "0" "287" "0" "c.286_287insATA" "r.(?)" "p.(Pro96delinsHisThr)" "3"
"0000736385" "00018070" "10" "907" "-154" "907" "-153" "c.907-154_907-153del" "r.(=)" "p.(=)" "6i"
"0000736386" "00018070" "10" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" "13"
"0000759844" "00018070" "70" "1210" "0" "1210" "0" "c.1210G>T" "r.(?)" "p.(Glu404Ter)" ""
"0000759845" "00018070" "70" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000759846" "00018070" "70" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000759847" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" ""
"0000759876" "00018070" "70" "964" "0" "967" "0" "c.964_967dup" "r.(?)" "p.(Leu323ProfsTer7)" ""
"0000759877" "00018070" "70" "2058" "0" "2058" "0" "c.2058dup" "r.(?)" "p.(Asp687ArgfsTer16)" ""
"0000759890" "00018070" "70" "2890" "0" "2890" "0" "c.2890del" "r.(?)" "p.(Ser964ProfsTer37)" ""
"0000759987" "00018070" "50" "2066" "0" "2066" "0" "c.2066T>C" "r.(?)" "p.(Leu689Pro)" ""
"0000759994" "00018070" "50" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" ""
"0000760043" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000760055" "00018070" "50" "2017" "0" "2017" "0" "c.2017C>T" "r.(?)" "p.(Gln673*)" ""
"0000760176" "00018070" "50" "2608" "0" "2609" "0" "c.2608_2609insA" "r.(?)" "p.(Leu870Tyrfs*7)" ""
"0000760189" "00018070" "70" "3620" "0" "3620" "0" "c.3620T>G" "r.(?)" "p.(Leu1207*)" ""
"0000760198" "00018070" "50" "2007" "0" "2007" "0" "c.2007del" "r.(?)" "p.(Val670Trpfs*14)" ""
"0000760201" "00018070" "70" "1892" "0" "1892" "0" "c.1892A>G" "r.(?)" "p.(His631Arg)" ""
"0000760203" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000760221" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000760225" "00018070" "50" "1303" "0" "1303" "0" "c.1303A>T" "r.(?)" "p.(Lys435*)" ""
"0000760228" "00018070" "50" "1445" "0" "1445" "0" "c.1445T>A" "r.(?)" "p.(Leu482*)" ""
"0000760458" "00018070" "50" "2314" "0" "2314" "0" "c.2314C>T" "r.(?)" "p.(Gln772*)" ""
"0000760596" "00018070" "90" "2608" "0" "2609" "0" "c.2608_2609insA" "r.(?)" "p.(Leu870TyrfsTer7)" ""
"0000763955" "00018070" "70" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Ter)" ""
"0000763956" "00018070" "70" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000764020" "00018070" "70" "2592" "0" "2592" "0" "c.2592T>G" "r.(?)" "p.(Tyr864Ter)" ""
"0000764021" "00018070" "70" "1763" "-2" "1763" "-2" "c.1763-2A>G" "r.spl" "p.?" ""
"0000764114" "00018070" "90" "3238" "1118" "3339" "323" "c.3238+1118_3339+323del" "r.3239_3339del" "p.(Asp1080Glyfs*6)" "20"
"0000764921" "00018070" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000764941" "00018070" "70" "2796" "0" "2796" "0" "c.2796dup" "r.(?)" "p.(Glu933Ter)" ""
"0000765576" "00018070" "90" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000765603" "00018070" "90" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000765604" "00018070" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000765773" "00018070" "70" "2876" "0" "2876" "0" "c.2876del" "r.(?)" "p.(Lys959ArgfsTer42)" ""
"0000765804" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000765813" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000765819" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000765841" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000765882" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000765907" "00018070" "70" "487" "0" "487" "0" "c.487del" "r.(?)" "p.(Arg163GlyfsTer7)" ""
"0000783797" "00018070" "90" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000783828" "00018070" "90" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000783829" "00018070" "90" "1234" "0" "1234" "0" "c.1234C>T" "r.(?)" "p.(Gln412Ter)" ""
"0000783830" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" ""
"0000783831" "00018070" "90" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179SerfsTer11)" ""
"0000783832" "00018070" "90" "490" "1" "490" "1" "c.490+1G>T" "r.spl" "p.?" ""
"0000783833" "00018070" "90" "490" "1" "490" "1" "c.490+1G>T" "r.spl" "p.?" ""
"0000783834" "00018070" "90" "367" "0" "367" "0" "c.367C>T" "r.(?)" "p.(Arg123Ter)" ""
"0000783835" "00018070" "90" "2592" "0" "2592" "0" "c.2592T>G" "r.(?)" "p.(Tyr864Ter)" ""
"0000783872" "00018070" "50" "2058" "0" "2058" "0" "c.2058dup" "r.(?)" "p.(Asp687ArgfsTer16)" ""
"0000783925" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000783926" "00018070" "90" "2013" "0" "2013" "0" "c.2013dup" "r.(?)" "p.(Pro672AlafsTer6)" ""
"0000783927" "00018070" "90" "3617" "1" "3617" "1" "c.3617+1G>A" "r.spl" "p.?" ""
"0000783928" "00018070" "90" "1225" "0" "1225" "0" "c.1225C>T" "r.(?)" "p.(Gln409Ter)" ""
"0000783929" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" ""
"0000783930" "00018070" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Ter)" ""
"0000783931" "00018070" "90" "3618" "-5" "3618" "-1" "c.3618-5_3618-1del" "r.spl" "p.?" ""
"0000783932" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Ter)" ""
"0000783964" "00018070" "50" "" "0" "" "0" "c.G2398G>A" "r.(?)" "p.(Glu800Lys)" ""
"0000785369" "00018070" "90" "2656" "0" "2656" "0" "c.2656C>T" "r.(?)" "p.(Leu886Phe)" ""
"0000785456" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000785457" "00018070" "90" "930" "1" "930" "1" "c.930+1G>A" "r.spl" "p.?" ""
"0000785521" "00018070" "50" "3634" "0" "3634" "0" "c.3634G>A" "r.(?)" "p.(Val1212Ile)" ""
"0000786419" "00018070" "90" "3793" "0" "3794" "0" "c.3793_3794insGAAA" "r.(?)" "p.(Val1265GlyfsTer19)" ""
"0000788385" "00018070" "50" "1295" "0" "1295" "0" "c.1295C>T" "r.(?)" "p.(Ser432Phe)" "10"
"0000788470" "00018070" "50" "3571" "0" "3571" "0" "c.3571C>T" "r.(?)" "p.(Arg1191Trp)" "22"
"0000788531" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Ter)" ""
"0000788546" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788547" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788548" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000788549" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000788551" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788554" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788555" "00018070" "70" "2662" "0" "2662" "0" "c.2662C>T" "r.(?)" "p.(Arg888Ter)" ""
"0000788557" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788558" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788559" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788560" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788562" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788563" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000788564" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" ""
"0000789835" "00018070" "70" "1445" "0" "1445" "0" "c.1445T>A" "r.(?)" "p.(Leu482*)" "11"
"0000789836" "00018070" "70" "2314" "0" "2314" "0" "c.2314C>T" "r.(?)" "p.(Gln772*)" "15"
"0000789837" "00018070" "70" "1445" "0" "1445" "0" "c.1445T>A" "r.(?)" "p.(Leu482*)" "11"
"0000789838" "00018070" "70" "2314" "0" "2314" "0" "c.2314C>T" "r.(?)" "p.(Gln772*)" "15"
"0000790090" "00018070" "10" "560" "0" "560" "0" "c.560G>T" "r.(?)" "p.(Gly187Val)" "4"
"0000790091" "00018070" "10" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "8"
"0000790094" "00018070" "50" "1295" "0" "1295" "0" "c.1295C>T" "r.(?)" "p.(Ser432Phe)" "10"
"0000790095" "00018070" "50" "1802" "0" "1802" "0" "c.1802C>G" "r.(?)" "p.(Ser601Trp)" "14"
"0000790096" "00018070" "90" "1892" "0" "1892" "0" "c.1892A>T" "r.(?)" "p.(His631Leu)" "14"
"0000790097" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" "22"
"0000790098" "00018070" "50" "3170" "0" "3170" "0" "c.3170A>T" "r.(?)" "p.(His1057Leu)" "19"
"0000790313" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000790314" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000790315" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000790318" "00018070" "50" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790319" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000790320" "00018070" "50" "2417" "0" "2417" "0" "c.2417C>T" "r.(?)" "p.(Thr806Ile)" "16"
"0000790321" "00018070" "50" "2435" "0" "2435" "0" "c.2435G>A" "r.(?)" "p.(Arg812Gln)" "16"
"0000790322" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790323" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790325" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790331" "00018070" "50" "2417" "0" "2417" "0" "c.2417C>T" "r.(?)" "p.(Thr806Ile)" "16"
"0000790332" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790333" "00018070" "50" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" "21"
"0000790339" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000790340" "00018070" "50" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" "16"
"0000790341" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790342" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790343" "00018070" "30" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000790480" "00018070" "50" "320" "0" "322" "0" "c.320_322del" "r.(?)" "p.(Ala107del)" ""
"0000790503" "00018070" "50" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000790536" "00018070" "50" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" ""
"0000790558" "00018070" "50" "2534" "0" "2534" "0" "c.2534C>T" "r.(?)" "p.(Pro845Leu)" ""
"0000790559" "00018070" "50" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Ter)" ""
"0000790623" "00018070" "50" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000790656" "00018070" "50" "3749" "-6" "3749" "-6" "c.3749-6C>A" "r.spl?" "p.?" ""
"0000790738" "00018070" "70" "2758" "0" "2758" "0" "c.2758C>T" "r.(?)" "p.(Gln920Ter)" ""
"0000790929" "00018070" "70" "587" "1" "587" "1" "c.587+1G>C" "r.spl?" "p.?" "4i"
"0000790930" "00018070" "70" "3620" "0" "3620" "0" "c.3620T>G" "r.(?)" "p.(Leu1207*)" "23"
"0000790931" "00018070" "70" "1180" "0" "1180" "0" "c.1180C>T" "r.(?)" "p.(Gln394*)" "10"
"0000790932" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" "16"
"0000791571" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" "22"
"0000791572" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" "22"
"0000791573" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" "22"
"0000791577" "00018070" "90" "1467" "1" "1467" "1" "c.1467+1G>T" "r.(?)" "p.(?)" "11i"
"0000791578" "00018070" "50" "1802" "0" "1802" "0" "c.1802C>G" "r.(?)" "p.(Ser601Trp)" "14"
"0000791588" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Ter)" "5"
"0000791589" "00018070" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Arg852Ter)" "16"
"0000791591" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" "22"
"0000791594" "00018070" "90" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.?" "p.?" "16i_17i"
"0000791595" "00018070" "90" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.(?)" "p.(?)" "16i_17"
"0000791602" "00018070" "90" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.?" "p.?" "16i_17i"
"0000791607" "00018070" "90" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.?" "p.?" "16i_17i"
"0000791621" "00018070" "50" "3835" "0" "3837" "0" "c.3835_3837del" "r.(?)" "p.(Glu1279del)" "24"
"0000791623" "00018070" "90" "1687" "0" "1687" "0" "c.1687C>T" "r.(?)" "p.(Arg563Ter)" "13"
"0000791635" "00018070" "50" "1802" "0" "1802" "0" "c.1802C>G" "r.(?)" "p.(Ser601Trp)" "14"
"0000792148" "00018070" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Gln120*)" "3"
"0000792149" "00018070" "90" "3748" "1" "3748" "1" "c.3748+1C>A" "r.spl?" "p.?" "23i"
"0000792150" "00018070" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Gln120*)" "3"
"0000792151" "00018070" "90" "242" "0" "242" "0" "c.242T>A" "r.(?)" "p.(Leu81*)" "3"
"0000792152" "00018070" "90" "1468" "-2" "1468" "-2" "c.1468-2A>G" "r.spl?" "p.?" "11i"
"0000792153" "00018070" "90" "2261" "0" "2261" "0" "c.2261delT" "r.(?)" "p.(Leu754Argfs*5)" "15"
"0000792166" "00018070" "90" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Gln120*)" "3"
"0000792167" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267*)" "5"
"0000792168" "00018070" "50" "3388" "0" "3388" "0" "c.3388G>C" "r.(?)" "p.(Glu1130Gln)" "21"
"0000792193" "00018070" "10" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179Serfs*11)" "4"
"0000792274" "00018070" "90" "2417" "0" "2417" "0" "c.2417C>T" "r.(?)" "p.(Thr806Ile)" "16"
"0000794202" "00018070" "70" "1612" "-219" "1612" "-219" "c.1612-219G>T" "r.(=)" "p.(=)" ""
"0000794891" "00018070" "70" "1151" "1678" "3239" "-957" "c.1151+1678_3239-957dup" "r.?" "p.?" ""
"0000794993" "00018070" "50" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000795970" "00018070" "70" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179Serfs*11)" "4"
"0000795971" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "15"
"0000795984" "00018070" "50" "1467" "2" "1467" "2" "c.1467+2T>C" "r.spl?" "p.?" "11i"
"0000795986" "00018070" "30" "1467" "2" "1467" "2" "c.1467+2T>C" "r.spl?" "p.?" "11i"
"0000796000" "00018070" "30" "535" "0" "535" "0" "c.535del" "r.(?)" "p.(Glu179Serfs*11)" "4"
"0000796002" "00018070" "30" "2345" "0" "2345" "0" "c.2345G>A" "r.(?)" "p.(Gly782Asp)" "15"
"0000796050" "00018070" "90" "574" "0" "574" "0" "c.574A>G" "r.(?)" "p.(Lys192Glu)" "4"
"0000796051" "00018070" "90" "907" "-17" "907" "-15" "c.907-17_907-15delTAA" "r.(=)" "p.(=)" "6i"
"0000796144" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000796166" "00018070" "70" "2792" "0" "2793" "0" "c.2792_2793insGGTA" "r.(?)" "p.(Pro932Valfs*3)" "17"
"0000796175" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000796176" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000796177" "00018070" "70" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000796178" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000796243" "00018070" "90" "1089" "0" "1090" "0" "c.1089_1090dup" "r.(?)" "p.(Val364Glufs*12)" "9"
"0000796244" "00018070" "90" "3749" "-1" "3749" "-1" "c.3749-1G>T" "r.spl?" "p.?" "23i"
"0000796245" "00018070" "90" "1089" "0" "1090" "0" "c.1089_1090dup" "r.(?)" "p.(Val364Glufs*12)" "9"
"0000796246" "00018070" "90" "3749" "-1" "3749" "-1" "c.3749-1G>T" "r.spl?" "p.?" "23i"
"0000796710" "00018070" "90" "2608" "0" "2609" "0" "c.2608_2609insA" "r.(?)" "p.(Leu870Tyrfs*7)" "16"
"0000796731" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000796737" "00018070" "70" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000796765" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" "22"
"0000796777" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000796785" "00018070" "70" "2510" "0" "2510" "0" "c.2510C>G" "r.(?)" "p.(Ala837Gly)" "16"
"0000796808" "00018070" "90" "2662" "0" "2662" "0" "c.2662C>T" "r.(?)" "p.(Arg888*)" "16"
"0000796814" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000796820" "00018070" "70" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" "16"
"0000796822" "00018070" "90" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" "9"
"0000797097" "00018070" "50" "2896" "-1" "3099" "1" "c.(2895+1_2896-1)_(3099+1_3100-1)del" "r.(?)" "p.(?)" "19"
"0000797184" "00018070" "70" "2440" "0" "2440" "0" "c.2440C>T" "r.(?)" "p.(Arg814*)" ""
"0000797185" "00018070" "70" "1303" "0" "1303" "0" "c.1303A>T" "r.(?)" "p.(Lys435*)" ""
"0000797186" "00018070" "70" "2941" "0" "2941" "0" "c.2941C>T" "r.(?)" "p.(Arg981*)" ""
"0000797187" "00018070" "70" "800" "1" "800" "1" "c.800+1G>A" "r.spl" "p.(?)" ""
"0000797207" "00018070" "70" "801" "-25" "843" "0" "c.801-25_843del" "r.spl" "p.(?)" ""
"0000797208" "00018070" "70" "2718" "0" "2718" "0" "c.2718dup" "r.(?)" "p.(Asn907*)" ""
"0000798081" "00018070" "90" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Trp65*)" ""
"0000798443" "00018070" "70" "3358" "0" "3358" "0" "c.3358A>G" "r.(?)" "p.(Ile1120Val)" "21"
"0000806290" "00018070" "10" "256" "0" "256" "0" "c.256C>T" "r.(?)" "p.(Arg86Trp)" ""
"0000806291" "00018070" "30" "1236" "0" "1236" "0" "c.1236G>A" "r.(?)" "p.(Gln412=)" ""
"0000806292" "00018070" "50" "2285" "0" "2285" "0" "c.2285T>C" "r.(?)" "p.(Leu762Pro)" ""
"0000806293" "00018070" "30" "3099" "7" "3099" "7" "c.3099+7C>T" "r.(=)" "p.(=)" ""
"0000811356" "00018070" "30" "2669" "0" "2669" "0" "c.2669G>A" "r.(?)" "p.(Arg890Gln)" ""
"0000812021" "00018070" "70" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000812073" "00018070" "70" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" "14"
"0000812229" "00018070" "70" "3749" "-1" "3749" "-1" "c.3749-1G>T" "r.(?)" "p.(?)" "23i"
"0000812456" "00018070" "70" "1306" "0" "1306" "0" "c.1306G>T" "r.(?)" "p.(Ala436Ser)" "10"
"0000812457" "00018070" "70" "1306" "0" "1306" "0" "c.1306G>T" "r.(?)" "p.(Ala436Ser)" "10"
"0000812458" "00018070" "70" "1306" "0" "1306" "0" "c.1306G>T" "r.(?)" "p.(Ala436Ser)" "10"
"0000812796" "00018070" "90" "2895" "2" "2895" "2" "c.2895+2T>C" "r.spl" "p.(?)" ""
"0000812797" "00018070" "70" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Arg371*)" ""
"0000813629" "00018070" "90" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" ""
"0000813635" "00018070" "90" "367" "0" "367" "0" "c.367C>T" "r.(?)" "p.(Arg123*)" ""
"0000813654" "00018070" "90" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" ""
"0000813663" "00018070" "90" "2895" "2" "2895" "2" "c.2895+2T>C" "r.spl" "p.(?)" ""
"0000813692" "00018070" "90" "535" "0" "535" "0" "c.535delG" "r.(?)" "p.(Glu179Serfs*11)" ""
"0000813716" "00018070" "90" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Arg371*)" ""
"0000813727" "00018070" "90" "1468" "-2" "1468" "-2" "c.1468-2A>G" "r.spl" "p.(?)" ""
"0000813735" "00018070" "70" "3685" "0" "3685" "0" "c.3685G>C" "r.(?)" "p.(Ala1229Pro)" ""
"0000813749" "00018070" "90" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189*)" ""
"0000813768" "00018070" "90" "3325" "0" "3325" "0" "c.3325A>T" "r.(?)" "p.(Lys1109*)" ""
"0000813782" "00018070" "90" "535" "0" "535" "0" "c.535delG" "r.(?)" "p.(Glu179Serfs*11)" ""
"0000813788" "00018070" "90" "535" "0" "535" "0" "c.535delG" "r.(?)" "p.(Glu179Serfs*11)" ""
"0000814607" "00018070" "70" "895" "0" "896" "0" "c.895_896del" "r.(?)" "p.(Glu299Serfs*21)" "6"
"0000814608" "00018070" "50" "2367" "23" "2367" "23" "c.2367+23del" "r.(=)" "p.(=)" "15i"
"0000815625" "00018070" "50" "930" "3" "930" "3" "c.930+3A>G" "r.spl?" "p.(?)" ""
"0000818458" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000818459" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000818460" "00018070" "90" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000818461" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000818462" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189Glyfs*7)" ""
"0000818478" "00018070" "90" "2079" "0" "2079" "0" "c.2079C>G" "r.(?)" "p.(Tyr693*)" ""
"0000818479" "00018070" "90" "2212" "0" "2215" "21" "c.2212_2215+21del" "r.spl" "p.(?)" ""
"0000818960" "00018070" "70" "3100" "-1" "3238" "1" "c.(3099+1_3100-1)_(3238+1_3239-1)del" "r.spl?" "p.?" "18i_19i"
"0000818961" "00018070" "70" "2079" "0" "2079" "0" "c.2079C>G" "r.(?)" "p.(Tyr693*)" "14"
"0000819588" "00018070" "70" "2021" "0" "2021" "0" "c.2021C>A" "r.(?)" "p.(Pro674His)" ""
"0000819689" "00018070" "70" "800" "1" "800" "1" "c.800+1G>A" "r.spl" "p.(?)" ""
"0000820333" "00018070" "70" "2662" "0" "2662" "0" "c.2662C>T" "r.(?)" "p.(Arg888*)" ""
"0000820334" "00018070" "70" "2432" "0" "2432" "0" "c.2432T>A" "r.(?)" "p.(Leu811His)" ""
"0000820335" "00018070" "70" "2662" "0" "2662" "0" "c.2662C>T" "r.(?)" "p.(Arg888*)" ""
"0000820346" "00018070" "70" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Arg371*)" ""
"0000820347" "00018070" "70" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Arg371*)" ""
"0000820348" "00018070" "70" "1611" "0" "1611" "0" "c.1611G>A" "r.(?)" "p.(Gln537=)" ""
"0000820422" "00018070" "70" "906" "2" "906" "2" "c.906+2T>G" "r.spl" "p.(?)" ""
"0000820699" "00018070" "70" "2718" "0" "2718" "0" "c.2718dup" "r.(?)" "p.(Asn907*)" ""
"0000820865" "00018070" "70" "3239" "-1" "3339" "1" "c.(3238+1_3239-1)_(3339+1_3340-1)del" "r.spl" "p.(?)" ""
"0000820866" "00018070" "70" "268" "0" "268" "0" "c.268G>A" "r.(?)" "p.(Val90Ile)" ""
"0000820873" "00018070" "70" "2367" "23" "2367" "23" "c.2367+23del" "r.spl" "p.(?)" ""
"0000820874" "00018070" "70" "2367" "23" "2367" "23" "c.2367+23del" "r.spl" "p.(?)" ""
"0000820910" "00018070" "70" "1612" "-3" "1612" "-3" "c.1612-3C>A" "r.spl?" "p.(?)" ""
"0000821391" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" ""
"0000821392" "00018070" "70" "1116" "0" "1116" "0" "c.1116del" "r.(?)" "p.(Lys372Asnfs*3)" ""
"0000821602" "00018070" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000822041" "00018070" "70" "3113" "0" "3114" "0" "c.3113_3114del" "r.(?)" "p.(Thr1038Argfs*8)" ""
"0000822123" "00018070" "70" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" "21"
"0000822762" "00018070" "70" "2294" "0" "2295" "0" "c.2294_2295delinsAA" "r.(?)" "p.(Cys765*)" ""
"0000822763" "00018070" "70" "2294" "0" "2295" "0" "c.2294_2295delinsAA" "r.(?)" "p.(Cys765*)" ""
"0000822933" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000823263" "00018070" "90" "711" "0" "711" "0" "c.711delA" "r.(?)" "p.(Lys239Serfs*36)" ""
"0000823291" "00018070" "90" "832" "0" "832" "0" "c.832del" "r.(?)" "p.(Arg278Aspfs*15)" ""
"0000823410" "00018070" "70" "2759" "0" "2760" "0" "c.2759_2760insT" "r.(?)" "p.(Gln920Hisfs*14)" ""
"0000823411" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823412" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823413" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823414" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823415" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823416" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823417" "00018070" "50" "2012" "0" "2012" "0" "c.2012G>A" "r.(?)" "p.(Gly671Glu)" ""
"0000823418" "00018070" "70" "2759" "0" "2760" "0" "c.2759_2760insT" "r.(?)" "p.(Gln920Hisfs*14)" ""
"0000823419" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823420" "00018070" "70" "2759" "0" "2760" "0" "c.2759_2760insT" "r.(?)" "p.(Gln920Hisfs*14)" ""
"0000823421" "00018070" "70" "2941" "0" "2941" "0" "c.2941C>T" "r.(?)" "p.(Arg981*)" ""
"0000823422" "00018070" "70" "2941" "0" "2941" "0" "c.2941C>T" "r.(?)" "p.(Arg981*)" ""
"0000823423" "00018070" "70" "2759" "0" "2760" "0" "c.2759_2760insT" "r.(?)" "p.(Gln920Hisfs*14)" ""
"0000823424" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823425" "00018070" "90" "800" "1" "800" "1" "c.800+1G>A" "r.spl" "p.(?)" ""
"0000823426" "00018070" "70" "1078" "-1" "2895" "1" "c.(1077+1_1078-1)_(2895+1_2896-1)del" "r.spl" "p.(?)" "_10_18_"
"0000823525" "00018070" "50" "1611" "0" "1611" "0" "c.1611G>A" "r.spl?" "p.(Gln537=)" ""
"0000823527" "00018070" "50" "800" "0" "800" "0" "c.800G>A" "r.(?)" "p.(Arg267Gln)" ""
"0000823530" "00018070" "50" "2012" "0" "2012" "0" "c.2012G>A" "r.(?)" "p.(Gly671Glu)" ""
"0000823532" "00018070" "50" "2468" "0" "2468" "0" "c.2468A>G" "r.(?)" "p.(Tyr823Cys)" ""
"0000825696" "00018070" "70" "3238" "3" "3238" "3" "c.3238+3A>G" "r.spl?" "p.?" "19i"
"0000825697" "00018070" "70" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" "2"
"0000825842" "00018070" "70" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.(Arg52*)" "2"
"0000825843" "00018070" "70" "1259" "0" "1259" "0" "c.1259C>T" "r.(?)" "p.?" "10"
"0000826051" "00018070" "70" "2021" "0" "2021" "0" "c.2021C>A" "r.(?)" "p.(Pro674His)" "14"
"0000826052" "00018070" "70" "2375" "0" "2404" "0" "c.2375_2404del" "r.(?)" "p.(Ser792_Leu801del)" "16"
"0000828485" "00018070" "90" "2935" "0" "2935" "0" "c.2935C>T" "r.(?)" "p.(Gln979*)" ""
"0000828841" "00018070" "50" "2084" "0" "2084" "0" "c.2084A>G" "r.(?)" "p.(Gln695Arg)" ""
"0000829448" "00018070" "70" "1414" "0" "1414" "0" "c.1414C>T" "r.(?)" "p.(Gln472*)" "11"
"0000829465" "00018070" "70" "1216" "0" "1216" "0" "c.1216del" "r.(?)" "p.(Leu406Tyrfs*36)" "10"
"0000829466" "00018070" "70" "1148" "0" "1151" "0" "c.1148_1151del" "r.(?)" "p.(Glu383Alafs*19)" "9"
"0000829783" "00018070" "70" "2899" "0" "2899" "0" "c.2899C>T" "r.(?)" "p.(Gln967*)" ""
"0000831089" "00018070" "70" "3632" "0" "3632" "0" "c.3632T>A" "r.(?)" "p.(Val1211Glu)" ""
"0000838404" "00018070" "90" "3793" "0" "3794" "0" "c.3793_3794insGAAA" "r.(?)" "p.(Val1265Glyfs*19)" ""
"0000838405" "00018070" "90" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539Glnfs*2)" ""
"0000838406" "00018070" "90" "3238" "1" "3238" "1" "c.3238+1G>A" "r.spl" "p.?" "19i"
"0000838407" "00018070" "90" "3618" "-1" "3621" "0" "c.3618-1_3621del" "r.spl" "p.?" "22i_23"
"0000838408" "00018070" "90" "895" "0" "896" "0" "c.895_896delGA" "r.(?)" "p.(Glu299Serfs*21)" ""
"0000838409" "00018070" "90" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000838410" "00018070" "90" "3793" "0" "3794" "0" "c.3793_3794insGAAA" "r.(?)" "p.(Val1265Glyfs*19)" ""
"0000838411" "00018070" "90" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000838412" "00018070" "90" "1087" "0" "1090" "0" "c.1087_1090del" "r.(?)" "p.(Arg363Leufs*11)" ""
"0000838413" "00018070" "90" "0" "0" "0" "0" "c.-1_(218+600_218+800){2}" "r.?" "p.?" "_1_2i"
"0000838414" "00018070" "90" "218" "2563" "218" "2564" "c.218+2563_218+2564ins[85+1939_218+2415;218+2551_218+2563]" "r.?" "p.?" "1i_2i"
"0000838415" "00018070" "90" "1611" "27" "1611" "27" "c.1611+27G>A" "r.1611_1612ins[1611+1_1611+26;a;1611+28_1611+104]" "p.Glu538fs" "12i"
"0000838416" "00018070" "90" "1468" "-263" "1468" "-263" "c.1468-263G>C" "r.[1467_1468ins1468-250_1468-133,1467_1468ins1468-250_1468-1]" "p.Pro490fs" "11i"
"0000838417" "00018070" "90" "2367" "23" "2367" "23" "c.2367+23del" "r.[2367_2368ins2367+1_2368-1,=]" "p.[Phe790fs,=]" "15i"
"0000838418" "00018070" "90" "3100" "-1" "3238" "1" "c.(3099+1_3100-1)_(3238+1_3239-1)del" "r.?" "p.?" "18i_19i"
"0000838420" "00018070" "90" "711" "0" "711" "0" "c.711del" "r.(?)" "p.(Lys239Serfs*36)" ""
"0000838421" "00018070" "90" "767" "0" "767" "0" "c.767C>G" "r.(?)" "p.(Ser256*)" ""
"0000838985" "00018070" "90" "3793" "0" "3794" "0" "c.3793_3794insGAAA" "r.(?)" "p.(Val1265Glyfs*19)" ""
"0000838989" "00018070" "90" "2710" "233" "2710" "233" "c.2710+233G>A" "r.(2710_2711ins2710+95_2710+229del)" "p.(Gly904fs)" "16i"
"0000838990" "00018070" "90" "934" "0" "934" "0" "c.934dup" "r.(?)" "p.(Gln312Profs*9)" ""
"0000838991" "00018070" "90" "1468" "-263" "1468" "-263" "c.1468-263G>C" "r.(1467_1468ins1468-250_1468-133)" "p.(Pro490fs)" "11i"
"0000838992" "00018070" "90" "2627" "0" "2627" "0" "c.2627A>G" "r.(?)" "p.(Asp876Gly)" ""
"0000838994" "00018070" "90" "3340" "-1214" "3533" "-404" "c.3340-1214_3533-404del" "r.(?)" "p.(Asp1114*)" "20i_21i"
"0000838997" "00018070" "70" "2017" "0" "2017" "0" "c.2017C>T" "r.(?)" "p.(Gln673Ter)" "14"
"0000838998" "00018070" "70" "2627" "0" "2627" "0" "c.2627A>G" "r.(?)" "p.(Asp876Gly)" "16"
"0000838999" "00018070" "70" "775" "0" "775" "0" "c.775T>C" "r.(?)" "p.(Cys259Arg)" "5"
"0000839000" "00018070" "70" "2434" "0" "2434" "0" "c.2434C>T" "r.(?)" "p.(Arg812Trp)" "16"
"0000839001" "00018070" "70" "416" "0" "416" "0" "c.416C>T" "r.(?)" "p.(Ala139Val)" "3"
"0000839002" "00018070" "70" "473" "0" "473" "0" "c.473C>T" "r.(?)" "p.(Pro158Leu)" "3"
"0000839003" "00018070" "70" "1015" "0" "1015" "0" "c.1015A>G" "r.(?)" "p.(Lys339Glu)" "8"
"0000839004" "00018070" "70" "1862" "0" "1862" "0" "c.1862T>C" "r.(?)" "p.(Leu621Pro)" "14"
"0000839005" "00018070" "70" "2132" "0" "2132" "0" "c.2132A>G" "r.(?)" "p.(His711Arg)" "14"
"0000839015" "00018070" "70" "1165" "0" "1165" "0" "c.1165dup" "r.(?)" "p.(Ser389LysfsTer2)" "10"
"0000839016" "00018070" "70" "86" "-1" "86" "-1" "c.86-1G>A" "r.spl" "p.?" "1i"
"0000839017" "00018070" "70" "86" "-1" "86" "-1" "c.86-1G>A" "r.spl" "p.?" "1i"
"0000839018" "00018070" "70" "1763" "-2" "1763" "-2" "c.1763-2A>G" "r.spl" "p.?" "13i"
"0000839019" "00018070" "70" "2291" "0" "2291" "0" "c.2291C>T" "r.(?)" "p.(Ala764Val)" "15"
"0000839020" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>A" "r.(?)" "p.(Arg827His)" "16"
"0000839021" "00018070" "70" "2600" "0" "2600" "0" "c.2600G>A" "r.(?)" "p.(Arg867Gln)" "16"
"0000839022" "00018070" "70" "2632" "0" "2632" "0" "c.2632G>A" "r.(?)" "p.(Glu878Lys)" "16"
"0000839023" "00018070" "70" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "18"
"0000839024" "00018070" "70" "3242" "0" "3242" "0" "c.3242A>G" "r.(?)" "p.(Lys1081Arg)" "20"
"0000839025" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370AsnfsTer5)" "9"
"0000839026" "00018070" "70" "1951" "0" "1951" "0" "c.1951del" "r.(?)" "p.(Thr651ProfsTer33)" "14"
"0000839027" "00018070" "70" "673" "0" "673" "0" "c.673del" "r.(?)" "p.(His225ThrfsTer50)" "5"
"0000844304" "00018070" "70" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000844336" "00018070" "70" "2367" "1" "2367" "1" "c.2367+1G>A" "r.spl" "p.(?)" ""
"0000844337" "00018070" "50" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000844632" "00018070" "70" "1984" "0" "1984" "0" "c.1984G>A" "r.(?)" "p.(Glu662Lys)" ""
"0000844633" "00018070" "70" "3703" "0" "3703" "0" "c.3703C>T" "r.(?)" "p.(Gln1235Ter)" ""
"0000844646" "00018070" "70" "2668" "0" "2668" "0" "c.2668C>T" "r.(?)" "p.(Arg890Ter)" ""
"0000846561" "00018070" "70" "3609" "0" "3609" "0" "c.3609del" "r.(?)" "p.(Gln1204Lysfs*4)" ""
"0000846562" "00018070" "70" "2760" "0" "2760" "0" "c.2760dup" "r.(?)" "p.(Val921Serfs*13)" ""
"0000846563" "00018070" "70" "2760" "0" "2760" "0" "c.2760dup" "r.(?)" "p.(Val921Serfs*13)" ""
"0000846564" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846565" "00018070" "70" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Trp65*)" ""
"0000846569" "00018070" "70" "2237" "0" "2237" "0" "c.2237G>A" "r.(?)" "p.(Gly746Glu)" ""
"0000846570" "00018070" "70" "2237" "0" "2237" "0" "c.2237G>A" "r.(?)" "p.(Gly746Glu)" ""
"0000846571" "00018070" "70" "511" "0" "511" "0" "c.511del" "r.(?)" "p.(Tyr171Thrfs*19)" ""
"0000846572" "00018070" "70" "511" "0" "511" "0" "c.511del" "r.(?)" "p.(Tyr171Thrfs*19)" ""
"0000846573" "00018070" "70" "2567" "0" "2568" "0" "c.2567_2568dup" "r.(?)" "p.(Val857Leufs*2)" ""
"0000846574" "00018070" "70" "2668" "0" "2668" "0" "c.2668C>T" "r.(?)" "p.(Arg890*)" ""
"0000846575" "00018070" "10" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000846576" "00018070" "50" "1525" "0" "1525" "0" "c.1525C>T" "r.(?)" "p.(Gln509*)" ""
"0000846577" "00018070" "50" "1502" "0" "1505" "0" "c.1502_1505dup" "r.(?)" "p.(Gln503Valfs*6)" ""
"0000846578" "00018070" "50" "3835" "0" "3837" "0" "c.3835_3837del" "r.(?)" "p.(Glu1279del)" ""
"0000846579" "00018070" "70" "3629" "0" "3630" "0" "c.3629_3630insG" "r.(?)" "p.(Val1211Serfs*4)" ""
"0000846580" "00018070" "10" "3341" "0" "3341" "0" "c.3341A>G" "r.(?)" "p.(Asp1114Gly)" ""
"0000846588" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846589" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846590" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846591" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846592" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846593" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846594" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846595" "00018070" "70" "2480" "0" "2480" "0" "c.2480G>T" "r.(?)" "p.(Arg827Leu)" ""
"0000846596" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846597" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846598" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846599" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846600" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846601" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846602" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846603" "00018070" "70" "1639" "0" "1639" "0" "c.1639G>T" "r.(?)" "p.(Ala547Ser)" ""
"0000846605" "00018070" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.D876G" ""
"0000846606" "00018070" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.R890X" ""
"0000846607" "00018070" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.G746E" ""
"0000846608" "00018070" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.V857fs" ""
"0000846609" "00018070" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.R852Q" ""
"0000846612" "00018070" "70" "3632" "0" "3632" "0" "c.3632T>A" "r.(?)" "p.(Val1211Glu)" ""
"0000846615" "00018070" "50" "1295" "0" "1295" "0" "c.1295C>T" "r.(?)" "p.(Ser432Phe)" ""
"0000846616" "00018070" "50" "1802" "0" "1802" "0" "c.1802C>G" "r.(?)" "p.(Ser601Trp)" ""
"0000846617" "00018070" "50" "3170" "0" "3170" "0" "c.3170A>T" "r.(?)" "p.(His1057Leu)" ""
"0000846625" "00018070" "50" "95" "0" "95" "0" "c.95A>T" "r.(?)" "p.(Met32Leu)" ""
"0000846626" "00018070" "50" "95" "0" "95" "0" "c.95A>T" "r.(?)" "p.(Met32Leu)" ""
"0000846627" "00018070" "50" "95" "0" "95" "0" "c.95A>T" "r.(?)" "p.(Met32Leu)" ""
"0000846628" "00018070" "50" "95" "0" "95" "0" "c.95A>T" "r.(?)" "p.(Met32Leu)" ""
"0000846629" "00018070" "50" "95" "0" "95" "0" "c.95A>T" "r.(?)" "p.(Met32Leu)" ""
"0000846630" "00018070" "50" "403" "0" "403" "0" "c.403A>C" "r.(?)" "p.(Ser135Arg)" ""
"0000846631" "00018070" "50" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Ala318Val)" ""
"0000846632" "00018070" "50" "1088" "0" "1088" "0" "c.1088G>C" "r.(?)" "p.(Arg363Thr)" ""
"0000846633" "00018070" "50" "1315" "0" "1315" "0" "c.1315G>T" "r.(?)" "p.(Glu439Ter)" ""
"0000846634" "00018070" "50" "1753" "0" "1753" "0" "c.1753C>T" "r.(?)" "p.(Pro585Ser)" ""
"0000846635" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000846636" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000846637" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000846638" "00018070" "50" "1767" "0" "1767" "0" "c.1767G>T" "r.(?)" "p.(Gln589His)" ""
"0000846639" "00018070" "50" "1793" "0" "1793" "0" "c.1793G>A" "r.(?)" "p.(Arg598Gln)" ""
"0000846640" "00018070" "50" "1793" "0" "1793" "0" "c.1793G>A" "r.(?)" "p.(Arg598Gln)" ""
"0000846641" "00018070" "50" "1793" "0" "1793" "0" "c.1793G>A" "r.(?)" "p.(Arg598Gln)" ""
"0000846642" "00018070" "50" "1904" "0" "1904" "0" "c.1904C>G" "r.(?)" "p.(Ala635Gly)" ""
"0000846643" "00018070" "50" "1904" "0" "1904" "0" "c.1904C>G" "r.(?)" "p.(Ala635Gly)" ""
"0000846644" "00018070" "50" "2291" "0" "2291" "0" "c.2291C>T" "r.(?)" "p.(Ala764Val)" ""
"0000846645" "00018070" "50" "2417" "0" "2417" "0" "c.2417C>T" "r.(?)" "p.(Thr806Ile)" ""
"0000846646" "00018070" "50" "2435" "0" "2435" "0" "c.2435G>A" "r.(?)" "p.(Arg812Gln)" ""
"0000846647" "00018070" "50" "2510" "0" "2510" "0" "c.2510C>G" "r.(?)" "p.(Ala837Gly)" ""
"0000846648" "00018070" "50" "2510" "0" "2510" "0" "c.2510C>G" "r.(?)" "p.(Ala837Gly)" ""
"0000846649" "00018070" "50" "2512" "0" "2512" "0" "c.2512A>G" "r.(?)" "p.(Ile838Val)" ""
"0000846650" "00018070" "50" "2512" "0" "2512" "0" "c.2512A>G" "r.(?)" "p.(Ile838Val)" ""
"0000846651" "00018070" "50" "1808" "0" "1808" "0" "c.1808G>C" "r.(?)" "p.(Cys603Ser)" ""
"0000846652" "00018070" "50" "1913" "0" "1913" "0" "c.1913C>T" "r.(?)" "p.(Thr638Ile)" ""
"0000846653" "00018070" "50" "2441" "0" "2441" "0" "c.2441G>T" "r.(?)" "p.(Arg814Leu)" ""
"0000846654" "00018070" "50" "2521" "0" "2521" "0" "c.2521G>A" "r.(?)" "p.(Ala841Thr)" ""
"0000846655" "00018070" "50" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" ""
"0000846656" "00018070" "50" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" ""
"0000846657" "00018070" "50" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" ""
"0000846658" "00018070" "50" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" ""
"0000846659" "00018070" "50" "2648" "0" "2648" "0" "c.2648G>A" "r.(?)" "p.(Gly883Asp)" ""
"0000846697" "00018070" "70" "2608" "0" "2609" "0" "c.2608_2609insA" "r.(?)" "p.(Leu870Tyrfs*7)" ""
"0000846698" "00018070" "70" "2608" "0" "2609" "0" "c.2608_2609insA" "r.(?)" "p.(Leu870Tyrfs*7)" ""
"0000846699" "00018070" "70" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.(?)" "p.(?)" "16i_17i"
"0000846700" "00018070" "70" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.(?)" "p.(?)" "16i_17i"
"0000846701" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000846702" "00018070" "70" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" ""
"0000846703" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846704" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846705" "00018070" "70" "2662" "0" "2662" "0" "c.2662C>T" "r.(?)" "p.(Arg888*)" ""
"0000846706" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846707" "00018070" "70" "3330" "0" "3330" "0" "c.3330T>A" "r.(?)" "p.(Tyr1110*)" ""
"0000846708" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846709" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000846710" "00018070" "70" "420" "0" "420" "0" "c.420del" "r.(?)" "p.(Gln140Hisfs*30)" ""
"0000846712" "00018070" "70" "1468" "-2" "1468" "-2" "c.1468-2A>G" "r.spl" "Exon12 del" "11i"
"0000846713" "00018070" "70" "2020" "0" "2020" "0" "c.2020C>T" "r.(?)" "p.Pro674Ser" "14"
"0000846714" "00018070" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "_1_22_"
"0000846715" "00018070" "70" "154" "0" "154" "0" "c.154C>T" "r.(?)" "p.Arg52*" "2"
"0000846718" "00018070" "70" "2890" "0" "2890" "0" "c.2890del" "r.spl" "p.(Ser964Profs*37)" "11i"
"0000846719" "00018070" "70" "2890" "0" "2890" "0" "c.2890del" "r.spl" "p.(Ser964Profs*37)" "11i"
"0000846722" "00018070" "90" "903" "0" "906" "17" "c.903_906+17del" "r.spl" "p.(Glu302Hisfs*13)" "11i"
"0000846873" "00018070" "70" "1445" "0" "1445" "0" "c.1445T>A" "r.(?)" "p.(Leu482*)" ""
"0000846874" "00018070" "70" "1445" "0" "1445" "0" "c.1445T>A" "r.(?)" "p.(Leu482*)" ""
"0000846925" "00018070" "70" "2314" "0" "2314" "0" "c.2314C>T" "r.(?)" "p.(Gln772*)" ""
"0000846926" "00018070" "70" "2314" "0" "2314" "0" "c.2314C>T" "r.(?)" "p.(Gln772*)" ""
"0000853733" "00018070" "30" "50" "0" "50" "0" "c.50T>C" "r.(?)" "p.(Ile17Thr)" ""
"0000853734" "00018070" "30" "95" "0" "95" "0" "c.95T>A" "r.(?)" "p.(Met32Lys)" ""
"0000863486" "00018070" "30" "930" "4" "930" "7" "c.930+4_930+7del" "r.spl?" "p.?" ""
"0000863487" "00018070" "30" "2100" "0" "2100" "0" "c.2100G>T" "r.(?)" "p.(Arg700=)" ""
"0000863488" "00018070" "30" "2490" "0" "2490" "0" "c.2490C>T" "r.(?)" "p.(Thr830=)" ""
"0000874677" "00018070" "70" "1107" "0" "1107" "0" "c.1107del" "r.(?)" "p.(Glu370Asnfs*5)" ""
"0000891675" "00018070" "50" "2367" "23" "2367" "23" "c.2367+23del" "r.(=)" "p.(=)" ""
"0000891676" "00018070" "30" "3239" "-14" "3239" "-14" "c.3239-14C>T" "r.(=)" "p.(=)" ""
"0000896642" "00018070" "50" "2084" "0" "2084" "0" "c.2084A>G" "r.(?)" "p.(Gln695Arg)" ""
"0000905964" "00018070" "50" "3570" "0" "3570" "0" "c.3570G>T" "r.(?)" "p.(Arg1190Ser)" ""
"0000905983" "00018070" "70" "832" "0" "832" "0" "c.832del" "r.(?)" "p.(Arg278Aspfs*15)" ""
"0000914147" "00018070" "90" "2302" "0" "2302" "0" "c.2302C>T" "r.(?)" "p.(Arg768*)" ""
"0000914148" "00018070" "30" "2376" "0" "2376" "0" "c.2376G>A" "r.(?)" "p.(Ser792=)" ""
"0000914149" "00018070" "30" "2550" "0" "2550" "0" "c.2550G>A" "r.(?)" "p.(Gln850=)" ""
"0000915917" "00018070" "70" "1358" "0" "1376" "0" "c.1358_1376del" "r.(?)" "p.(Lys453Thrfs*47)" "11"
"0000915918" "00018070" "90" "2368" "-1" "2710" "1" "c.(2367+1_2368-1)_(2710+1_2711-1)del" "r.?" "p.(Phe790Valfs*33)" ""
"0000915940" "00018070" "70" "2368" "-1" "2710" "1" "c.(2367+1_2368-1)_(2710+1_2711-1)del" "r.?" "p.(Phe790Valfs*33)" ""
"0000916071" "00018070" "70" "430" "0" "430" "0" "c.430C>T" "r.(?)" "p.(Gln144*)" "3"
"0000916231" "00018070" "90" "2941" "0" "2941" "0" "c.2941C>T" "r.(?)" "p.(Arg981*)" "18"
"0000916232" "00018070" "70" "3100" "-1" "3238" "1" "c.(3099+1_3100-1)_(3238+1_3239-1)del" "r.?" "p.(Gln1034Thrfs*23)" ""
"0000916328" "00018070" "90" "2895" "1" "2895" "1" "c.2895+1G>T" "r.spl?" "p.(?)" "17i"
"0000916329" "00018070" "50" "3374" "0" "3374" "0" "c.3374T>C" "r.(?)" "p.(Leu1125Pro)" "21"
"0000916470" "00018070" "90" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "16"
"0000916496" "00018070" "90" "800" "1" "800" "1" "c.800+1G>A" "r.spl?" "p.(?)" "5i"
"0000916497" "00018070" "90" "2895" "1" "2895" "1" "c.2895+1G>T" "r.spl?" "p.(?)" "17i"
"0000916528" "00018070" "70" "1771" "0" "1772" "0" "c.1771_1772insGAAA" "r.(?)" "p.(Lys591Argfs*24)" "14"
"0000916649" "00018070" "50" "491" "-11" "491" "-11" "c.491-11T>A" "r.(=)" "p.(?)" "3i"
"0000916746" "00018070" "70" "218" "2" "218" "2" "c.218+2T>A" "r.spl?" "p.(?)" "2i"
"0000927802" "00018070" "90" "1363" "0" "1363" "0" "c.1363del" "r.(?)" "p.(Glu455Lysfs*2)" ""
"0000927803" "00018070" "90" "871" "0" "872" "0" "c.871_872ins[N[(300_400)];854_871]" "r.?" "p.(Val291Glyfs*32)" ""
"0000927805" "00018070" "90" "0" "0" "0" "0" "-" "r.?" "p.?" "_1"
"0000927806" "00018070" "90" "2710" "374" "2895" "78" "c.2710+374_2895+78del" "r.?" "p.?" "16i_17i"
"0000927807" "00018070" "90" "0" "0" "0" "0" "c.-115_218+2395{0}" "r.0?" "p.0?" "_1_3i"
"0000927808" "00018070" "90" "0" "0" "0" "0" "-" "r.?" "p.?" "_1"
"0000927809" "00018070" "90" "0" "0" "0" "0" "-" "r.?" "p.?" "_1"
"0000930269" "00018070" "70" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" ""
"0000930270" "00018070" "30" "2490" "0" "2490" "0" "c.2490C>T" "r.(?)" "p.(Thr830=)" ""
"0000930271" "00018070" "30" "5364" "0" "5364" "0" "c.*1503C>T" "r.(=)" "p.(=)" ""
"0000944541" "00018070" "70" "3238" "1118" "3339" "323" "c.3238+1118_3339+323del" "r.?" "p.(Asp1080Glyfs*8)" "19i_20i"
"0000954069" "00018070" "90" "3565" "0" "3571" "0" "c.3565_3571del" "r.(?)" "p.(Arg1189GlyfsTer7)" ""
"0000958386" "00018070" "70" "2367" "23" "2367" "23" "c.2367+23del" "r.spl?" "p.?" ""
"0000958586" "00018070" "90" "800" "1" "800" "1" "c.800+1G>A" "r.spl" "p.?" ""
"0000958666" "00018070" "70" "3340" "-1072" "3533" "-254" "c.3340-1072_3533-254del" "r.?" "p.?" ""
"0000958667" "00018070" "50" "268" "0" "268" "0" "c.268G>A" "r.(?)" "p.(Val90Ile)" ""
"0000958877" "00018070" "70" "331" "0" "331" "0" "c.331C>T" "r.(?)" "p.(Gln111Ter)" ""
"0000959317" "00018070" "50" "2215" "5" "2215" "5" "c.2215+5G>A" "r.spl?" "p.?" ""
"0000967431" "00018070" "30" "1078" "-9" "1078" "-9" "c.1078-9C>A" "r.(=)" "p.(=)" ""
"0000967432" "00018070" "30" "1434" "0" "1434" "0" "c.1434C>T" "r.(?)" "p.(=)" ""
"0000980804" "00018070" "30" "3171" "0" "3171" "0" "c.3171C>T" "r.(?)" "p.(His1057=)" ""
"0000985488" "00018070" "90" "832" "0" "832" "0" "c.832C>T" "r.(?)" "p.(Arg278Ter)" ""
"0000985496" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.(1467_1468ins1468-250_1468-133)" "p.(Glu489_Pro490insMetArgThrTer)" ""
"0000985498" "00018070" "90" "1502" "0" "1505" "0" "c.1502_1505dup" "r.(?)" "p.(Gln503ValfsTer6)" ""
"0000985499" "00018070" "90" "1525" "0" "1525" "0" "c.1525C>T" "r.(?)" "p.(Gln509Ter)" ""
"0000985500" "00018070" "90" "2895" "1" "2895" "1" "c.2895+1G>T" "r.spl" "p.?" ""
"0000985501" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985502" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985503" "00018070" "90" "930" "77" "930" "77" "c.930+77A>G" "r.spl" "p.?" ""
"0000985504" "00018070" "90" "2437" "0" "2437" "0" "c.2437del" "r.(?)" "p.(Ser813ValfsTer45)" ""
"0000985505" "00018070" "90" "3238" "1" "3238" "1" "c.3238+1G>A" "r.spl" "p.?" ""
"0000985506" "00018070" "90" "2895" "1" "2895" "1" "c.2895+1G>T" "r.spl" "p.?" ""
"0000985507" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985508" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985509" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985510" "00018070" "90" "1468" "-128" "1468" "-128" "c.1468-128T>G" "r.1467_1468ins1468-250_1468-133" "p.Glu489_Pro490insMetArgThrTer" ""
"0000985980" "00018070" "70" "587" "2" "587" "2" "c.587+2T>G" "r.spl" "p.?" ""
"0000985981" "00018070" "90" "1611" "26" "1611" "26" "c.1611+26G>A" "r.spl?" "p.?" ""
"0000986589" "00018070" "50" "1945" "0" "1945" "0" "c.1945C>A" "r.(?)" "p.(Gln649Lys)" "15"
"0000986960" "00018070" "50" "2665" "0" "2665" "0" "c.2665G>A" "r.(?)" "p.(Ala889Thr)" "17"
"0000987235" "00018070" "70" "3620" "0" "3620" "0" "c.3620T>G" "r.(?)" "p.(Leu1207Ter)" ""
"0000987276" "00018070" "90" "1615" "0" "1624" "0" "c.1615_1624del" "r.(?)" "p.(Glu539GlnfsTer2)" ""
"0000987325" "00018070" "70" "1307" "-1" "1467" "1" "c.(1306+1_1307-1)_(1467+1_1468-1)del" "r.?" "p.?" ""
"0000987336" "00018070" "70" "631" "0" "631" "0" "c.631del" "r.(?)" "p.(Ser211ValfsTer64)" ""
"0001000837" "00018070" "30" "5377" "0" "5377" "0" "c.*1516G>A" "r.(=)" "p.(=)" ""
"0001000838" "00018070" "50" "7049" "0" "7049" "0" "c.*3188C>T" "r.(=)" "p.(=)" ""
"0001022265" "00018070" "90" "2935" "0" "2935" "0" "c.2935C>T" "r.(?)" "p.(Gln979Ter)" ""
"0001039856" "00018070" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Ter)" ""
"0001039857" "00018070" "50" "2063" "0" "2063" "0" "c.2063C>T" "r.(?)" "p.(Ser688Leu)" ""
"0001054751" "00018070" "50" "116" "0" "116" "0" "c.116G>A" "r.(?)" "p.(Ser39Asn)" ""
"0001054752" "00018070" "50" "127" "0" "127" "0" "c.127C>T" "r.(?)" "p.(Arg43Trp)" ""
"0001054753" "00018070" "30" "1306" "3" "1306" "3" "c.1306+3A>G" "r.spl?" "p.?" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 608
"{{screeningid}}" "{{variantid}}"
"0000000226" "0000790503"
"0000016563" "0000036431"
"0000033224" "0000060449"
"0000033420" "0000060450"
"0000033420" "0000060451"
"0000033421" "0000060458"
"0000033421" "0000060459"
"0000033422" "0000060452"
"0000033422" "0000060453"
"0000033423" "0000060454"
"0000033423" "0000060455"
"0000033424" "0000060460"
"0000033424" "0000060461"
"0000033425" "0000060464"
"0000033425" "0000060465"
"0000033429" "0000060466"
"0000033429" "0000060467"
"0000033430" "0000060462"
"0000033430" "0000060463"
"0000033431" "0000060468"
"0000033431" "0000060469"
"0000033656" "0000060470"
"0000033656" "0000060471"
"0000033673" "0000060474"
"0000033673" "0000060475"
"0000033674" "0000060456"
"0000033674" "0000060472"
"0000033675" "0000060457"
"0000033675" "0000060473"
"0000033790" "0000060476"
"0000033791" "0000060479"
"0000033792" "0000060481"
"0000033793" "0000060482"
"0000033793" "0000060483"
"0000038287" "0000790313"
"0000038289" "0000790314"
"0000038290" "0000790315"
"0000038307" "0000790318"
"0000100522" "0000162821"
"0000105511" "0000170952"
"0000105511" "0000170953"
"0000156413" "0000358335"
"0000156414" "0000358336"
"0000156415" "0000358337"
"0000174782" "0000790656"
"0000241570" "0000487580"
"0000241571" "0000487581"
"0000270740" "0000604552"
"0000270741" "0000604553"
"0000270741" "0000604554"
"0000270742" "0000604555"
"0000270749" "0000604570"
"0000270749" "0000604571"
"0000292139" "0000648828"
"0000292140" "0000648829"
"0000292141" "0000648830"
"0000292142" "0000648831"
"0000305549" "0000669237"
"0000305550" "0000669238"
"0000309543" "0000684408"
"0000309705" "0000684578"
"0000309769" "0000684642"
"0000310553" "0000685464"
"0000310554" "0000685465"
"0000310555" "0000685466"
"0000310556" "0000685467"
"0000310557" "0000685468"
"0000326667" "0000710259"
"0000326669" "0000710261"
"0000326684" "0000710276"
"0000326701" "0000710293"
"0000329168" "0000713291"
"0000329168" "0000713701"
"0000329388" "0000713511"
"0000329543" "0000713666"
"0000329551" "0000713674"
"0000329711" "0000714068"
"0000329711" "0000714103"
"0000333420" "0000731055"
"0000333430" "0000731074"
"0000333436" "0000731011"
"0000333436" "0000731083"
"0000333437" "0000731012"
"0000333576" "0000731252"
"0000333576" "0000731277"
"0000333576" "0000731294"
"0000333577" "0000731253"
"0000333577" "0000731278"
"0000333612" "0000731314"
"0000333612" "0000731340"
"0000333613" "0000731315"
"0000333632" "0000731347"
"0000333633" "0000731348"
"0000333633" "0000731349"
"0000333695" "0000731444"
"0000333695" "0000731459"
"0000334582" "0000732476"
"0000334591" "0000732520"
"0000334652" "0000732606"
"0000334655" "0000732627"
"0000334682" "0000732662"
"0000334691" "0000732671"
"0000334691" "0000732702"
"0000334703" "0000732683"
"0000334703" "0000732692"
"0000335190" "0000733199"
"0000335191" "0000733200"
"0000335191" "0000733630"
"0000336397" "0000735672"
"0000336397" "0000735770"
"0000336468" "0000735843"
"0000336468" "0000735863"
"0000336571" "0000735996"
"0000336727" "0000736217"
"0000336727" "0000736261"
"0000336821" "0000736357"
"0000336822" "0000736358"
"0000336842" "0000736378"
"0000336843" "0000736379"
"0000336844" "0000736380"
"0000336845" "0000736381"
"0000336846" "0000736382"
"0000336847" "0000736383"
"0000336848" "0000736384"
"0000336849" "0000736385"
"0000336850" "0000736386"
"0000360146" "0000759844"
"0000360146" "0000759876"
"0000360147" "0000759845"
"0000360148" "0000759846"
"0000360149" "0000759847"
"0000360149" "0000759877"
"0000360163" "0000759890"
"0000360188" "0000759987"
"0000360191" "0000759994"
"0000360204" "0000760043"
"0000360207" "0000760055"
"0000360284" "0000760176"
"0000360297" "0000760189"
"0000360306" "0000760198"
"0000360309" "0000760201"
"0000360311" "0000760203"
"0000360329" "0000760221"
"0000360333" "0000760225"
"0000360336" "0000760228"
"0000360336" "0000760458"
"0000360564" "0000760596"
"0000363378" "0000763955"
"0000363378" "0000764020"
"0000363379" "0000763956"
"0000363379" "0000764021"
"0000363459" "0000764114"
"0000364159" "0000764921"
"0000364159" "0000764941"
"0000364701" "0000765576"
"0000364701" "0000765603"
"0000364701" "0000765604"
"0000364831" "0000765773"
"0000364862" "0000765804"
"0000364871" "0000765813"
"0000364877" "0000765819"
"0000364899" "0000765841"
"0000364940" "0000765882"
"0000364965" "0000765907"
"0000373649" "0000783797"
"0000373680" "0000783828"
"0000373680" "0000783925"
"0000373681" "0000783829"
"0000373681" "0000783926"
"0000373682" "0000783830"
"0000373682" "0000783927"
"0000373683" "0000783831"
"0000373683" "0000783928"
"0000373684" "0000783832"
"0000373684" "0000783929"
"0000373685" "0000783833"
"0000373685" "0000783930"
"0000373686" "0000783834"
"0000373686" "0000783931"
"0000373687" "0000783835"
"0000373687" "0000783932"
"0000373724" "0000783872"
"0000373724" "0000783964"
"0000374578" "0000785369"
"0000374643" "0000785456"
"0000374644" "0000785457"
"0000374699" "0000785521"
"0000375124" "0000786419"
"0000376610" "0000788385"
"0000376625" "0000788470"
"0000376638" "0000788531"
"0000376653" "0000788546"
"0000376654" "0000788547"
"0000376655" "0000788548"
"0000376656" "0000788549"
"0000376658" "0000788551"
"0000376661" "0000788554"
"0000376662" "0000788555"
"0000376664" "0000788557"
"0000376665" "0000788558"
"0000376666" "0000788559"
"0000376667" "0000788560"
"0000376669" "0000788562"
"0000376670" "0000788563"
"0000376671" "0000788564"
"0000377481" "0000789835"
"0000377481" "0000789836"
"0000377482" "0000789837"
"0000377482" "0000789838"
"0000377676" "0000790090"
"0000377677" "0000790091"
"0000377680" "0000790094"
"0000377681" "0000790095"
"0000377681" "0000790096"
"0000377682" "0000790097"
"0000377683" "0000790098"
"0000377915" "0000790319"
"0000377916" "0000790320"
"0000377917" "0000790321"
"0000377918" "0000790322"
"0000377919" "0000790323"
"0000377920" "0000790325"
"0000377926" "0000790331"
"0000377927" "0000790332"
"0000377928" "0000790333"
"0000377934" "0000790339"
"0000377935" "0000790340"
"0000377936" "0000790341"
"0000377937" "0000790342"
"0000377938" "0000790343"
"0000377959" "0000790480"
"0000377972" "0000790536"
"0000377976" "0000790558"
"0000377976" "0000790559"
"0000377995" "0000790623"
"0000378069" "0000790738"
"0000378234" "0000790929"
"0000378235" "0000790930"
"0000378236" "0000790931"
"0000378237" "0000790932"
"0000378716" "0000791602"
"0000378718" "0000791571"
"0000378719" "0000791572"
"0000378720" "0000791573"
"0000378724" "0000791577"
"0000378724" "0000791607"
"0000378725" "0000791578"
"0000378734" "0000791621"
"0000378735" "0000791588"
"0000378735" "0000791623"
"0000378736" "0000791589"
"0000378738" "0000791591"
"0000378741" "0000791594"
"0000378741" "0000927808"
"0000378742" "0000791595"
"0000378742" "0000927809"
"0000378747" "0000791635"
"0000379085" "0000792148"
"0000379085" "0000792149"
"0000379086" "0000792150"
"0000379086" "0000792151"
"0000379087" "0000792152"
"0000379087" "0000792153"
"0000379096" "0000792166"
"0000379097" "0000792167"
"0000379098" "0000792168"
"0000379114" "0000792193"
"0000379161" "0000792274"
"0000380955" "0000794202"
"0000381430" "0000794891"
"0000381532" "0000794993"
"0000382245" "0000795970"
"0000382246" "0000795971"
"0000382253" "0000795984"
"0000382253" "0000795986"
"0000382260" "0000796000"
"0000382261" "0000796002"
"0000382298" "0000796050"
"0000382298" "0000796051"
"0000382366" "0000796144"
"0000382380" "0000796166"
"0000382386" "0000796175"
"0000382386" "0000796176"
"0000382387" "0000796177"
"0000382387" "0000796178"
"0000382430" "0000796243"
"0000382430" "0000796244"
"0000382431" "0000796245"
"0000382431" "0000796246"
"0000382831" "0000796710"
"0000382842" "0000796731"
"0000382843" "0000796737"
"0000382856" "0000796765"
"0000382862" "0000796777"
"0000382863" "0000796785"
"0000382872" "0000796808"
"0000382874" "0000796814"
"0000382876" "0000796820"
"0000382878" "0000796822"
"0000383105" "0000797097"
"0000383161" "0000797184"
"0000383162" "0000797185"
"0000383162" "0000797207"
"0000383163" "0000797186"
"0000383164" "0000797187"
"0000383164" "0000797208"
"0000383816" "0000798081"
"0000384018" "0000798443"
"0000384611" "0000811356"
"0000385140" "0000812021"
"0000385174" "0000812073"
"0000385268" "0000812229"
"0000385410" "0000812456"
"0000385411" "0000812457"
"0000385412" "0000812458"
"0000385691" "0000812796"
"0000385691" "0000812797"
"0000386222" "0000813629"
"0000386222" "0000813735"
"0000386228" "0000813635"
"0000386247" "0000813654"
"0000386247" "0000813749"
"0000386256" "0000813663"
"0000386285" "0000813692"
"0000386285" "0000813768"
"0000386309" "0000813716"
"0000386309" "0000813782"
"0000386320" "0000813727"
"0000386320" "0000813788"
"0000386841" "0000814607"
"0000386841" "0000814608"
"0000387520" "0000815625"
"0000389414" "0000818458"
"0000389414" "0000818459"
"0000389415" "0000818460"
"0000389415" "0000818461"
"0000389416" "0000818462"
"0000389423" "0000818478"
"0000389423" "0000818479"
"0000389728" "0000818960"
"0000389728" "0000818961"
"0000390243" "0000819588"
"0000390344" "0000819689"
"0000390344" "0000820699"
"0000390988" "0000820333"
"0000390989" "0000820334"
"0000390989" "0000820865"
"0000390990" "0000820335"
"0000390990" "0000820866"
"0000391001" "0000820346"
"0000391001" "0000820873"
"0000391002" "0000820347"
"0000391002" "0000820874"
"0000391003" "0000820348"
"0000391077" "0000820422"
"0000391077" "0000820910"
"0000391641" "0000821391"
"0000391642" "0000821392"
"0000391642" "0000821602"
"0000391968" "0000822041"
"0000392004" "0000822123"
"0000392463" "0000822762"
"0000392464" "0000822763"
"0000392590" "0000822933"
"0000392828" "0000823263"
"0000392828" "0000823291"
"0000392941" "0000823410"
"0000392941" "0000823525"
"0000392942" "0000823411"
"0000392943" "0000823412"
"0000392944" "0000823413"
"0000392945" "0000823414"
"0000392946" "0000823415"
"0000392946" "0000823527"
"0000392947" "0000823416"
"0000392948" "0000823417"
"0000392949" "0000823418"
"0000392950" "0000823419"
"0000392951" "0000823420"
"0000392952" "0000823421"
"0000392953" "0000823422"
"0000392954" "0000823423"
"0000392954" "0000823530"
"0000392955" "0000823424"
"0000392955" "0000823532"
"0000392956" "0000823425"
"0000392957" "0000823426"
"0000394709" "0000825696"
"0000394709" "0000825697"
"0000394806" "0000825842"
"0000394806" "0000825843"
"0000394943" "0000826051"
"0000394943" "0000826052"
"0000396806" "0000828485"
"0000397095" "0000828841"
"0000397455" "0000829465"
"0000397456" "0000829448"
"0000397470" "0000829466"
"0000397715" "0000829783"
"0000398827" "0000831089"
"0000403243" "0000838404"
"0000403243" "0000838413"
"0000403244" "0000838405"
"0000403244" "0000838414"
"0000403245" "0000838406"
"0000403245" "0000838415"
"0000403246" "0000838407"
"0000403246" "0000838416"
"0000403247" "0000838408"
"0000403247" "0000838417"
"0000403248" "0000838409"
"0000403248" "0000838418"
"0000403249" "0000838410"
"0000403250" "0000838411"
"0000403250" "0000838420"
"0000403251" "0000838412"
"0000403251" "0000838421"
"0000403552" "0000838985"
"0000403552" "0000838989"
"0000403555" "0000838990"
"0000403555" "0000838991"
"0000403557" "0000838992"
"0000403557" "0000838994"
"0000403560" "0000838997"
"0000403561" "0000838998"
"0000403562" "0000838999"
"0000403563" "0000839000"
"0000403564" "0000839001"
"0000403565" "0000839002"
"0000403566" "0000839003"
"0000403567" "0000839004"
"0000403568" "0000839005"
"0000403569" "0000839019"
"0000403570" "0000839020"
"0000403571" "0000839021"
"0000403572" "0000839022"
"0000403573" "0000839023"
"0000403574" "0000839024"
"0000403575" "0000839025"
"0000403576" "0000839026"
"0000403577" "0000839027"
"0000403578" "0000839015"
"0000403579" "0000839016"
"0000403580" "0000839017"
"0000403581" "0000839018"
"0000407626" "0000844304"
"0000407648" "0000844336"
"0000407649" "0000844337"
"0000407836" "0000844632"
"0000407836" "0000844646"
"0000407837" "0000844633"
"0000409399" "0000846561"
"0000409399" "0000846565"
"0000409400" "0000846562"
"0000409401" "0000846563"
"0000409402" "0000846564"
"0000409405" "0000846569"
"0000409406" "0000846570"
"0000409407" "0000846571"
"0000409408" "0000846572"
"0000409409" "0000846573"
"0000409409" "0000846579"
"0000409410" "0000846574"
"0000409410" "0000846580"
"0000409411" "0000846575"
"0000409412" "0000846576"
"0000409413" "0000846577"
"0000409414" "0000846578"
"0000409421" "0000846588"
"0000409422" "0000846589"
"0000409423" "0000846590"
"0000409424" "0000846591"
"0000409425" "0000846592"
"0000409426" "0000846593"
"0000409427" "0000846594"
"0000409428" "0000846595"
"0000409429" "0000846596"
"0000409430" "0000846597"
"0000409431" "0000846598"
"0000409432" "0000846599"
"0000409433" "0000846600"
"0000409434" "0000846601"
"0000409435" "0000846602"
"0000409436" "0000846603"
"0000409437" "0000846605"
"0000409438" "0000846606"
"0000409439" "0000846607"
"0000409440" "0000846608"
"0000409441" "0000846609"
"0000409443" "0000846612"
"0000409445" "0000846615"
"0000409446" "0000846616"
"0000409447" "0000846617"
"0000409455" "0000846625"
"0000409456" "0000846626"
"0000409457" "0000846627"
"0000409458" "0000846628"
"0000409459" "0000846629"
"0000409460" "0000846630"
"0000409461" "0000846631"
"0000409462" "0000846632"
"0000409463" "0000846633"
"0000409464" "0000846634"
"0000409465" "0000846635"
"0000409466" "0000846636"
"0000409467" "0000846637"
"0000409468" "0000846638"
"0000409469" "0000846639"
"0000409470" "0000846640"
"0000409471" "0000846641"
"0000409472" "0000846642"
"0000409473" "0000846643"
"0000409474" "0000846644"
"0000409475" "0000846645"
"0000409476" "0000846646"
"0000409477" "0000846647"
"0000409478" "0000846648"
"0000409479" "0000846649"
"0000409480" "0000846650"
"0000409481" "0000846651"
"0000409482" "0000846652"
"0000409483" "0000846653"
"0000409484" "0000846654"
"0000409485" "0000846655"
"0000409486" "0000846656"
"0000409487" "0000846657"
"0000409488" "0000846658"
"0000409489" "0000846659"
"0000409518" "0000846697"
"0000409519" "0000846698"
"0000409520" "0000846699"
"0000409521" "0000846700"
"0000409522" "0000846701"
"0000409523" "0000846702"
"0000409524" "0000846703"
"0000409525" "0000846704"
"0000409526" "0000846705"
"0000409527" "0000846706"
"0000409528" "0000846707"
"0000409529" "0000846708"
"0000409530" "0000846709"
"0000409531" "0000846710"
"0000409533" "0000846712"
"0000409534" "0000846713"
"0000409534" "0000846715"
"0000409535" "0000846714"
"0000409538" "0000846718"
"0000409539" "0000846719"
"0000409542" "0000846722"
"0000409669" "0000846873"
"0000409669" "0000846925"
"0000409670" "0000846874"
"0000409670" "0000846926"
"0000416549" "0000874677"
"0000421832" "0000896642"
"0000428262" "0000905964"
"0000428266" "0000905983"
"0000430994" "0000915917"
"0000430994" "0000915918"
"0000431011" "0000915940"
"0000431105" "0000916071"
"0000431207" "0000916231"
"0000431207" "0000916232"
"0000431266" "0000916328"
"0000431266" "0000916329"
"0000431359" "0000916470"
"0000431376" "0000916496"
"0000431376" "0000916497"
"0000431399" "0000916528"
"0000431474" "0000916649"
"0000431541" "0000916746"
"0000436689" "0000927802"
"0000436689" "0000927803"
"0000436691" "0000927805"
"0000436692" "0000927806"
"0000436692" "0000927807"
"0000443153" "0000944541"
"0000445884" "0000954069"
"0000448778" "0000958586"
"0000448900" "0000958386"
"0000448900" "0000958666"
"0000448900" "0000958667"
"0000449110" "0000958877"
"0000449110" "0000959317"
"0000451583" "0000985488"
"0000451583" "0000985496"
"0000451585" "0000985498"
"0000451585" "0000985507"
"0000451586" "0000985499"
"0000451586" "0000985508"
"0000451587" "0000985500"
"0000451587" "0000985509"
"0000451588" "0000985501"
"0000451589" "0000985502"
"0000451590" "0000985503"
"0000451590" "0000985510"
"0000451591" "0000985504"
"0000451592" "0000985505"
"0000451593" "0000985506"
"0000452032" "0000985980"
"0000452032" "0000985981"
"0000452606" "0000986589"
"0000452606" "0000986960"
"0000452778" "0000987325"
"0000452879" "0000987336"
"0000452890" "0000987235"
"0000452931" "0000987276"
"0000462714" "0001022265"