### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = RS1)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"RS1"	"retinoschisin 1"	"X"	"p22.2-p22.1"	"no"	"LRG_702"	"UD_132084561048"	""	"https://www.dmd.nl/rs/index.html"	"Retina International RS1 mutation database <http://www.retina-international.org/files/sci-news/xlrsmut.htm>"	"1"	"10457"	"6247"	"300839"	"1"	"1"	"1"	"1"	"This database was initiated through the efforts of the <a href=\"http://www.dmd.nl/rs/consortium.html\">Retinoschisis Consortium</a>.<br><font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>"	""	"g"	"https://databases.lovd.nl/shared/refseq/RS1_codingDNA.html"	"1"	""	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>"	"-1"	""	"-1"	"00000"	"1998-02-05 00:00:00"	"00006"	"2020-04-29 11:25:12"	"00000"	"2025-11-01 13:22:20"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000905"	"RS1"	"retinoschisin 1"	"001"	"NM_000330.3"	""	"NP_000321.1"	""	""	""	"-35"	"2991"	"675"	"18657808"	"18690223"	"00000"	"2012-09-13 12:58:22"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 11
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00187"	"MRX;IDX"	"mental retardation, X-linked (MRX, intellectual disability (IDX))"	""	""	""	"X-linked"	""	"00006"	"2013-09-05 15:56:47"	"00006"	"2018-12-18 09:23:21"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00254"	"RTD"	"dysgenesis, renal tubular (RTD)"	"AR"	"267430"	""	""	""	"00006"	"2013-10-20 21:21:05"	"00006"	"2021-12-10 21:51:32"
"00308"	"HAG"	"anemia, hemolytic, due to G6PD deficiency (HAG, incl favism)"	"XLD"	"300908"	""	""	"X-linked dominant"	"00006"	"2014-01-24 11:32:05"	"00006"	"2021-12-10 21:51:32"
"00318"	"cancer, breast"	"cancer, breast"	""	""	""	""	""	"00006"	"2014-02-02 14:42:53"	"00006"	"2019-08-28 08:24:47"
"00381"	"RD"	"dystrophy, retinal (RD)"	""	""	""	""	""	"00006"	"2014-05-09 11:59:52"	"00006"	"2015-12-07 07:11:25"
"01157"	"CHTE"	"Hypothyroidism, central, testicular enlargement (CHTE)"	"XLR"	"300888"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"02262"	"RS1"	"retinoschisis, type 1, X-linked"	"XLR"	"312700"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2024-12-19 09:25:40"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"04215"	"STGD"	"Stargardt disease (STGD)"	""	""	""	""	""	"00006"	"2015-02-27 20:01:12"	""	""
"04249"	"macular dystrophy"	"dystrophy, macular"	""	""	""	""	""	"00006"	"2015-05-04 22:10:58"	"00006"	"2024-02-15 21:18:39"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}"	"{{diseaseid}}"
"RS1"	"02262"


## Individuals ## Do not remove or alter this header ##
## Count = 2179
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000047"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00000058"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000085"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000102"	""	""	""	"1"	""	"00004"	"{PMID:Almomani 2011:21102627}"	""	""	""	""	""	""	""	""	""	""
"00000208"	""	""	""	"1"	""	"00037"	"{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}"	""	"M"	"no"	"Netherlands"	""	"0"	""	""	""	""
"00000209"	""	""	""	"1"	""	"00037"	"{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}"	""	"M"	"no"	"Netherlands"	""	"0"	""	""	""	""
"00004010"	""	""	""	"1"	""	"00155"	"{PMID:Gibrouval 2012:22095942}"	""	""	"?"	"France"	""	""	""	""	""	""
"00004374"	""	""	""	"1"	""	"00591"	"{PMID:Hirono 1994:8193373}"	""	"?"	"?"	"Japan"	""	""	""	""	""	""
"00009921"	""	""	""	"1"	""	"00590"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009922"	""	""	""	"1"	""	"00589"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009923"	""	""	""	"1"	""	"00590"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009924"	""	""	""	"1"	""	"00579"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009933"	""	""	""	"1"	""	"00589"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009934"	""	""	""	"1"	""	"00589"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009935"	""	""	""	"1"	""	"00589"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009936"	""	""	""	"1"	""	"00581"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009937"	""	""	""	"1"	""	"00579"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009940"	""	""	""	"1"	""	"00584"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009941"	""	""	""	"1"	""	"00584"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009949"	""	""	""	"1"	""	"00590"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009955"	""	""	""	"1"	""	"00588"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009960"	""	""	""	"1"	""	"00590"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009961"	""	""	""	"1"	""	"00584"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00009962"	""	""	""	"1"	""	"00579"	""	""	""	"?"	"Netherlands"	""	""	""	""	""	""
"00087256"	""	""	""	"1"	""	"00006"	""	""	"?"	""	""	""	"0"	""	""	""	""
"00087257"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087258"	""	""	""	"4"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"4 affecteds"	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087259"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087260"	""	""	""	"14"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}"	"14 affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087261"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087262"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087263"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087264"	""	""	""	"14"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}, {PMID:Eksandh 2005:16272055}"	"14 affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087265"	""	""	""	"17"	""	"00006"	"{PMID:Huopaniemi 2000:11013441}"	"multi-generation family, 17 affected males"	"M"	"no"	"Denmark"	""	"0"	""	""	""	"FamRS305"
"00087266"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087267"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087268"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087269"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}, {PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"?;Pat2"
"00087270"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat1"
"00087271"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087272"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087273"	""	""	""	"2"	""	"00006"	"{PMID:Huopaniemi 2000:11013441}"	"family, 2 affected sibs"	"M"	"no"	"Denmark"	""	"0"	""	""	""	"FamRS315"
"00087274"	""	""	""	"1"	""	"00006"	"{PMID:Yu 2001:11295123}"	""	"?"	""	"China"	""	"0"	""	""	""	""
"00087275"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087276"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087277"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087278"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087279"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087280"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087281"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087282"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087283"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087284"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087285"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087286"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087287"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087288"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087289"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087290"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087291"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087292"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087293"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087294"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087295"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087296"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087297"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087298"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087299"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087300"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087301"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087302"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087303"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087304"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087305"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087306"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087307"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087308"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087309"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	"19% of Finnish RS mutations"	"M"	""	"Finland"	""	"0"	""	""	""	""
"00087310"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Finland"	""	"0"	""	""	""	""
"00087311"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087312"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087313"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087314"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087315"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087316"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087317"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087318"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087319"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087320"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Scotland"	""
"00087321"	""	""	""	"2"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}"	"2 affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087322"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087323"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087324"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087325"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087326"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087327"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087328"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087329"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087330"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087331"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087332"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087333"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087334"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087335"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Austria"	""	"0"	""	""	""	""
"00087336"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087337"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087338"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087339"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087340"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087341"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087342"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087343"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087344"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087345"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087346"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087347"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087348"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087349"	""	""	""	"1"	""	"00006"	"{PMID:Rodriguez 1998:9699564}"	""	"?"	""	""	""	"0"	""	""	""	""
"00087350"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4, 5:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087351"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087352"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087353"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087354"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087355"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087356"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087357"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087358"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087359"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087360"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Switzerland"	""	"0"	""	""	""	""
"00087361"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087362"	""	""	""	"1"	""	"00006"	"{PMID:Yu 2001:11295123}"	""	"?"	""	"China"	""	"0"	""	""	""	""
"00087363"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087364"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087365"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087366"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087367"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087368"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087369"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087370"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087371"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087372"	""	""	""	"1"	""	"00006"	"{PMID:Yu 2001:11295123}"	""	"?"	""	"China"	""	"0"	""	""	""	""
"00087373"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087374"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087375"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087376"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	"70% of Finnish RS mutations"	"M"	""	"Finland"	""	"0"	""	""	""	""
"00087377"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1, 2:9618178}"	""	"?"	""	"Italy"	""	"0"	""	""	""	""
"00087378"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087379"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087380"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087381"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087382"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087383"	""	""	""	"1"	""	"00006"	"{PMID:Hotta:11225572}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087384"	""	""	""	"1"	""	"00006"	"{PMID:Hotta:11225572}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087385"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087386"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087387"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087388"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087389"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087390"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087391"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087392"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087393"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087394"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087395"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087396"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087397"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087398"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087399"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087400"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087401"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087402"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087403"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087404"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087405"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 2:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087406"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087407"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087408"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 4:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087409"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087410"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087411"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087412"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087413"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087414"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087415"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087416"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087417"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087418"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087419"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087420"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087421"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 4:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087422"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	"6% of Finnish RS mutations"	"M"	""	"Finland"	""	"0"	""	""	""	""
"00087423"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087424"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087425"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087426"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Italy"	""	"0"	""	""	""	""
"00087427"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087428"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087429"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087430"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087431"	""	""	""	"3"	""	"00006"	"{PMID:Shastry 1999:10079181}, {PMID:Shastry 2010:21472264}"	"2 affected brothers and affected great-grandfather"	"?"	""	"United States"	""	"0"	""	""	""	"Fam2;Fam2PatI1/IV1/IV2"
"00087432"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"Belgium"	""	"0"	""	""	""	""
"00087433"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087434"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087435"	""	""	""	"1"	""	"00006"	"{PMID:Taketani:10589241}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087436"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	""	""	"0"	""	""	""	""
"00087437"	""	""	""	"4"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"4 affecteds"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087438"	""	""	""	"3"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Saldana 2007:17304551}"	"affected brother 17304551.52 and daugther 17304551.F"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087439"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087440"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087441"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087442"	""	""	""	"4"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	"4 affecteds"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087443"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087444"	""	""	""	"2"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087445"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087446"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087447"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087448"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"France"	""	"0"	""	""	""	""
"00087449"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"United States"	""	"0"	""	""	""	""
"00087450"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087451"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1, 2:9618178}"	""	"?"	""	"Italy"	""	"0"	""	""	""	""
"00087452"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Italy"	""	"0"	""	""	""	""
"00087453"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087454"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087455"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Israel"	""	"0"	""	""	""	""
"00087456"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087457"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087458"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087459"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087460"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087461"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087462"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087463"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087464"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087465"	""	""	""	"4"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"4 affecteds"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087466"	""	""	""	"2"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087467"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087468"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00087469"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087470"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087471"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087472"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087473"	""	""	""	"1"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087474"	""	""	""	"1"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087475"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087476"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087477"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087478"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087479"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087480"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087481"	""	""	""	"1"	""	"00006"	"{PMID:Park:10636429}"	""	"?"	""	""	""	"0"	""	""	""	""
"00087482"	""	""	""	"3"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"United States"	""	"0"	""	""	""	""
"00087483"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087484"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087485"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087486"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087487"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087488"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087489"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087490"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087491"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Italy"	""	"0"	""	""	""	""
"00087492"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Denmark"	""	"0"	""	""	""	""
"00087493"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087494"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087495"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087496"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087497"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087498"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087499"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087500"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087501"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Austria"	""	"0"	""	""	""	""
"00087502"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Austria"	""	"0"	""	""	""	""
"00087503"	""	""	""	"1"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087504"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087505"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087506"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087507"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087508"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087509"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087510"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087511"	""	""	""	"5"	""	"00006"	"{PMID:Shastry 1999:10079181}"	"4 affected brothers and affected grandfather"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087512"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087513"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087514"	""	""	""	"1"	""	"00221"	"{PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087515"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087516"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087517"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087518"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087519"	""	""	""	"2"	""	"00006"	"{PMID:Inoue 2000:10636421}"	"2 brothers"	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087520"	""	""	""	"1"	""	"00006"	"{PMID:Hotta:11225572}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087521"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087522"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087523"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087524"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087525"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"Belgium"	""	"0"	""	""	""	""
"00087526"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087527"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087528"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087529"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087530"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087531"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	""	"?"	""	"Finland"	""	"0"	""	""	""	""
"00087532"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087533"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig:10636740}"	""	"?"	""	"Greece"	""	"0"	""	""	""	""
"00087534"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087535"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087536"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087537"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Scotland"	""
"00087538"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087539"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087540"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087541"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087542"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087543"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087544"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 3:9618178}, {PMID:Sieving:10458173}"	"several patients"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087545"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087546"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Spain"	""	"0"	""	""	""	""
"00087547"	""	""	""	"1"	""	"00006"	"Ayuso ICHG2001 P1487;{PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087548"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	""	""	"0"	""	""	""	""
"00087549"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087550"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087551"	""	""	""	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087552"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087553"	""	""	""	"1"	""	"00006"	"{PMID:Sauer 1997:9326935}"	""	""	""	"Germany"	""	"0"	""	""	""	""
"00087554"	""	""	""	"1"	""	"00006"	"{PMID:Rodriguez 1998:9699564}"	""	"?"	""	""	""	"0"	""	""	""	""
"00087555"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087556"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087557"	""	""	""	"1"	""	"00006"	"{PMID:Hotta 1998:9760195}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087558"	""	""	""	"1"	""	"00006"	"Ayuso ICHG2001 P1487;{PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087559"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087560"	""	""	""	"1"	""	"00006"	"{PMID:Mashima 1999:10220153}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087561"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	""	"?"	""	"Sweden"	""	"0"	""	""	""	""
"00087562"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	""	"?"	""	"Finland"	""	"0"	""	""	""	""
"00087563"	""	""	""	"1"	""	"00006"	"{PMID:Huopaniemi 1999:10234514}"	""	"?"	""	"Finland"	""	"0"	""	""	""	""
"00087564"	""	""	""	"29"	""	"00006"	"{PMID:Mendoza-Lodono 1999:10415464}, {PMID:Rodriguez 2005:15655444}"	"large family with 29 affecteds, incl. 3 females (15655444.F)"	"?"	""	"Colombia"	""	"0"	""	""	""	""
"00087565"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087566"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087567"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087568"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087569"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087570"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 1:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00087571"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087572"	""	""	""	"1"	""	"00006"	"{PMID:Gehrig 1999:10450864}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087573"	""	""	""	"1"	""	"00006"	"Duval (1999) Hum.Mut. 13:259 (MPR #39)"	""	"?"	""	"France"	""	"0"	""	""	""	""
"00087574"	""	""	""	"1"	""	"00006"	"{PMID:Nakamura 2001:11594966}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087575"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:10454824}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat5"
"00087576"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087577"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087578"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087579"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087580"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087581"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"South Africa"	""	"0"	""	""	""	""
"00087582"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087583"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087584"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087585"	""	""	""	"2"	""	"00006"	"{PMID:Weinberg 2001:11709029}"	"affected boy and grandfather"	"M"	""	"China"	""	"0"	""	""	""	""
"00087586"	""	""	""	"1"	""	"00006"	"{PMID:Hiriyanna 1999:10533068}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087587"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087588"	""	""	""	"1"	""	"00006"	"{PMID:Inoue 2000:10636421}"	""	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087589"	""	""	""	"2"	""	"00006"	"{PMID:Inoue 2000:10636421}"	"2 affected brothers"	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087590"	""	""	""	"1"	""	"00006"	"{PMID:Hiraoka 2000:10679210}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00087591"	""	""	""	"1"	""	"00006"	"{PMID:Yu 2001:11295123}"	""	"?"	""	"China"	""	"0"	""	""	""	""
"00087592"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087593"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087594"	""	""	""	"1"	""	"00006"	"Ayuso ICHG2001 P1487;Riveiro-Alvarez ESHG2008 P05.213"	""	"?"	""	"Spain"	""	"0"	""	""	""	""
"00087595"	""	""	""	"1"	""	"00006"	"{PMID:Tsai 2000:11058916}"	""	"?"	""	"Taiwan"	""	"0"	""	""	""	""
"00087596"	""	""	""	"1"	""	"00006"	"{PMID:Nakamura 2001:11594966}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087597"	""	""	""	"1"	""	"00006"	"{PMID:Nakamura 2001:11594966}"	""	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087598"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087599"	""	""	""	"1"	""	"00006"	"{PMID:Stanga 2001:11217940}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087600"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat10"
"00087601"	""	""	""	"1"	""	"00006"	"DB: Gal"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00087602"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087603"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087604"	""	""	""	"1"	""	"00221"	""	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087605"	""	""	""	"1"	""	"00006"	"{PMID:Eksandh 2005:16272055}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087606"	""	""	""	"1"	""	"00006"	"{PMID:Eksandh 2005:16272055}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087607"	""	""	""	"1"	""	"00006"	"{PMID:Eksandh 2005:16272055}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087608"	""	""	""	"2"	""	"00006"	"{PMID:Teixeira 2005:16167295}"	"2 affected brothers"	"M"	""	"Portugal"	""	"0"	""	""	""	""
"00087609"	""	""	""	"2"	""	"00006"	"{PMID:Kawano 2005:15944839}"	"2 affected brothers"	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087610"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	"mother carrier"	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087611"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087612"	""	""	""	"2"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087613"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087614"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087615"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087616"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087617"	""	""	""	"2"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087618"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087619"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087620"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087621"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087622"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087623"	""	""	""	"2"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087624"	""	""	""	"1"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087625"	""	""	""	"1"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087626"	""	""	""	"1"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087627"	""	""	""	"2"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087628"	""	""	""	"1"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087629"	""	""	""	"1"	""	"00006"	"{PMID:Pimenides 2005:15937075}"	"several patients"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087630"	""	""	""	"2"	""	"00006"	"{PMID:Hayashi 2004:15531314}"	"affected boy and grandfather"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087631"	""	""	""	"1"	""	"00006"	"{PMID:Hayashi 2004:15531314}"	"mother carrier"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087632"	""	""	""	"3"	""	"00006"	"{PMID:Hayashi 2004:15531314}"	"three affecteds"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087633"	""	""	""	"1"	""	"00006"	"{PMID:Chan 2004:15281981}"	"mother carrier"	"M"	""	"China"	""	"0"	""	""	""	""
"00087634"	""	""	""	"1"	""	"00006"	"{PMID:Chan 2004:15281981}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087635"	""	""	""	"2"	""	"00006"	"{PMID:Shinoda 2004:14986011}"	"two affected brothers"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087636"	""	""	""	"3"	""	"00006"	"{PMID:Tantri 2003:12967815}"	"three affecteds, large intrafamilial variability"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087637"	""	""	""	"4"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"four affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087638"	""	""	""	"2"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"two affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087639"	""	""	""	"3"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"three affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087640"	""	""	""	"2"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"two affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087641"	""	""	""	"1"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	""	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087642"	""	""	""	"2"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"two affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087643"	""	""	""	"3"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	"three affecteds"	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087644"	""	""	""	"1"	""	"00006"	"{PMID:Simonelli 2003:12928282}"	""	"M"	""	"Italy"	""	"0"	""	""	""	""
"00087645"	""	""	""	"3"	""	"00006"	"{PMID:Sato 2003:12920343}"	"three affecteds"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087646"	""	""	""	"2"	""	"00006"	"{PMID:Sato 2003:12920343}"	"two affecteds; girl (45,X) and affected grandfather"	"F"	""	"Japan"	""	"0"	""	""	""	""
"00087647"	""	""	""	"1"	""	"00006"	"{PMID:Sato 2003:12920343}"	"mother carrier"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087648"	""	""	""	"3"	""	"00006"	"{PMID:Tanimoto 2002:12457918}"	"three affecteds"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087649"	""	""	""	"2"	""	"00006"	"{PMID:Inoue 2002:12383832}"	"two affected brothers"	"?"	""	"Japan"	""	"0"	""	""	""	""
"00087650"	""	""	""	"2"	""	"00006"	"{PMID:Inoue 2002:12383832}"	"affected grandfather and son"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087651"	""	""	""	"1"	""	"00006"	"{PMID:Eksandh 2000:10922205}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087652"	""	""	""	"2"	""	"00006"	"{PMID:Eksandh 2000:10922205}"	"two affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087653"	""	""	""	"3"	""	"00006"	"{PMID:Eksandh 2000:10922205}"	"three affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087654"	""	""	""	"5"	""	"00006"	"{PMID:Eksandh 2000:10922205}"	"five affecteds"	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087655"	""	""	""	"1"	""	"00006"	"{PMID:Eksandh 2000:10922205}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087656"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	"mother carrier"	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087657"	""	""	""	"1"	""	"00006"	"{PMID:Hewitt 2005:15932525}"	""	"M"	""	"Australia"	""	"0"	""	""	""	""
"00087658"	""	""	""	"2"	""	"00156"	"{PMID:Lesch 2008:18728755}, {PMID:Lesch 2008:19093009}"	"4-generation family, 2 affecteds, 2 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam2"
"00087659"	""	""	""	"4"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"4-generation family, 4 affecteds, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam1"
"00087660"	""	""	""	"2"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"3-generation family, 2 affecteds, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam3"
"00087661"	""	""	""	"1"	""	"00220"	"{PMID:Jin 2007:17295148}"	"mother carrier, unaffected younger brother"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087662"	""	""	""	"1"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"2-generation family, 1 affected"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam7"
"00087663"	""	""	""	"1"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"2-generation family, carrier mother/sister"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam4"
"00087664"	""	""	""	"1"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"2-generation family, 1 affected, carrier mother"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam9"
"00087665"	""	""	""	"5"	""	"00156"	""	"three affecteds, 2 carrier females"	"M"	""	"Hungary"	""	"0"	""	""	""	""
"00087666"	""	""	""	"4"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"3-generation family, 4 affected, 5 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam12"
"00087667"	""	""	""	"1"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"3-generation family, 1 affected, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam10"
"00087668"	""	""	""	"1"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam8"
"00087669"	""	""	""	"3"	""	"00156"	"{PMID:Lesch 2008:19093009}"	"4-generation family, 3 affected males, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam13"
"00087670"	""	""	""	"6"	""	"00006"	"{PMID:Dodds 2006:16900931}"	"2 affected males and 4 carriers"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087671"	""	""	""	"4"	""	"00006"	"{PMID:Dodds 2006:1690093}"	"four affecteds"	"M"	""	"United States"	""	"0"	""	""	"white"	""
"00087672"	""	""	""	"1"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	""	"M"	""	"India"	""	"0"	""	""	""	""
"00087673"	""	""	""	"6"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 3 affecteds, 3 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087674"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087675"	""	""	""	"3"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"3-generation family, 1 affected, 2 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087676"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087677"	""	""	"00087438"	"1"	""	"00221"	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Saldana 2007:17304551}"	"brother of 17304551.5"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00087678"	""	""	""	"3"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"3-generation family, 1 affected, 2 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087679"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	""
"00087680"	""	""	""	"1"	""	"00006"	"{PMID:Iannaccone 2006:16884758}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087681"	""	""	""	"1"	""	"00006"	"{PMID:Iannaccone 2006:16884758}"	"protein not secreted"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087682"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087683"	""	""	""	"8"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 4 affecteds, 4 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087684"	""	""	""	"1"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	""	"M"	""	"India"	""	"0"	""	""	""	""
"00087685"	""	""	""	"1"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	""	"M"	""	"India"	""	"0"	""	""	""	""
"00087686"	""	""	""	"1"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	""	"M"	""	"India"	""	"0"	""	""	""	""
"00087687"	""	""	""	"8"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 4 affecteds, 4 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087688"	""	""	""	"7"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 2 affecteds, 5 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087689"	""	""	"00087564"	"3"	""	"00006"	"{PMID:Rodriguez 2005:15655444}"	"3 affected females (relatives of 15655444.M)"	"F"	"yes"	"Colombia"	""	"0"	""	""	""	"FamPatV1/2/3"
"00087690"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087691"	""	""	""	"3"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"3-generation family, 2 affected, 1 carrier"	"M"	""	"China"	""	"0"	""	""	""	""
"00087692"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"United States"	""	"0"	""	""	""	""
"00087693"	""	""	""	"7"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 2 affecteds, 5 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087694"	""	""	""	"5"	""	"00006"	"{PMID:Kim 2006:17031297}"	"five affecteds (4 brothers and uncle)"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087695"	""	""	""	"1"	""	"00006"	"{PMID:Tsang 2007:17296904}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087696"	""	""	""	"15"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 4 affecteds, 11 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087697"	""	""	""	"4"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"3-generation family, 1 affected, 3 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087698"	""	""	""	"11"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"4-generation family, 6 affecteds, 5 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087699"	""	""	""	"3"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"affected grandfather, carrier mother"	"M"	""	"China"	""	"0"	""	""	""	""
"00087700"	""	""	""	"1"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"mother index patient"	"F"	""	"China"	""	"0"	""	""	""	""
"00087701"	""	""	""	"1"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	""	"M"	""	"India"	""	"0"	""	""	""	""
"00087702"	""	""	""	"2"	""	"00006"	"{PMID:Suganthalakshmi 2007:17515881}"	"mother carrier"	"M"	""	"India"	""	"0"	""	""	""	""
"00087703"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087704"	""	""	""	"1"	""	"00156"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087705"	""	""	"00087800"	"4"	""	"00006"	"{PMID:Ali 2003:14516833}, {PMID:Saleheen 2008:18982040}"	"4 affected females"	"F"	"yes"	"Pakistan"	""	"0"	""	""	""	"?;FamPatIV2/3/4/5"
"00087706"	""	""	""	"3"	""	"00006"	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"3 carriers, 2 male,1 female"	"?"	""	"China"	""	"0"	""	""	""	""
"00087707"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087708"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087709"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087710"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087711"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087712"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087713"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"carrier mother"	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087714"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"carrier mother"	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087715"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087716"	""	""	""	"1"	""	"00221"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087717"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087718"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087719"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087720"	""	""	""	"1"	""	"00006"	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087721"	""	""	""	"3"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"carrier mother/sister"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087722"	""	""	""	"8"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"3-generation family, 2 affecteds, 6 carriers"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087723"	""	""	""	"3"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"carrier mother/aunt"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087724"	""	""	""	"3"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"affected brother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087725"	""	""	""	"3"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"twin brother, carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087726"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087727"	""	""	""	"2"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087728"	""	""	""	"2"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087729"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro 2005:16521245}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087730"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro 2005:16521245}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087731"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087732"	""	""	""	"2"	""	"00006"	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087733"	""	""	""	"2"	""	"00006"	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087734"	""	""	""	"2"	""	"00006"	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087735"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087736"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087737"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro-Alvarez 2007:17879437}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087738"	""	""	""	"5"	""	"00006"	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"3-generation family, 3 affecteds, 2 carriers"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087739"	""	""	""	"5"	""	"00006"	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"carrier mother/sister, 3 affected brothers"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087740"	""	""	""	"5"	""	"00006"	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"3-generation family, 2 affecteds, 3 carriers"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087741"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2008:18465145}, {PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087742"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2008:20960647}, {PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087743"	""	""	""	"3"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213"	"affected twin brother, carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087744"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087745"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2008:18465145}, {PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087746"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	"found in healthy male"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087747"	""	""	""	"2"	""	"00006"	"{PMID:Riveiro 2005:16521244}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087748"	""	""	""	"1"	""	"00006"	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087749"	""	""	""	"1"	""	"00222"	""	""	"M"	""	"Hungary"	""	"0"	""	""	""	""
"00087750"	""	""	""	"1"	""	"00006"	"{PMID:Tarpey 2009:19377476}"	""	"M"	""	""	""	"0"	""	""	"?"	""
"00087751"	""	""	""	"1"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"affected uncle of 17631851-Pat5"	"M"	""	"India"	""	"0"	""	""	""	""
"00087752"	""	""	""	"1"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"affected uncle of 17631851-Pat5"	"M"	""	"India"	""	"0"	""	""	""	""
"00087753"	""	""	""	"1"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"brother of 17631851-Pat3"	"M"	""	"India"	""	"0"	""	""	""	""
"00087754"	""	""	""	"1"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"brother of 17631851-Pat2"	"M"	""	"India"	""	"0"	""	""	""	""
"00087755"	""	""	""	"1"	""	"00006"	"{PMID:Zeng 2007:17852193}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087756"	""	""	""	"1"	""	"00006"	"{PMID:Zeng 2007:17852193}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087757"	""	""	""	"1"	""	"00006"	"{PMID:Zeng 2007:17852193}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087758"	""	""	""	"1"	""	"00006"	"{PMID:Zeng 2007:17852193}"	""	"M"	""	"China"	""	"0"	""	""	""	""
"00087759"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087760"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087761"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087762"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087763"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087764"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087765"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087766"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087767"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087768"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087769"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087770"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087771"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087772"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087773"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087774"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087775"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087776"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087777"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087778"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087779"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087780"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087781"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087782"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087783"	""	""	""	"1"	""	"00006"	"{PMID:Renner 2008:17987333}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00087784"	""	""	""	"1"	""	"00006"	"{PMID:Lamey 2010:20238027}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Australia"	""	"0"	""	""	""	"Fam1"
"00087785"	""	""	""	"1"	""	"00006"	"{PMID:Lamey 2010:20238027}"	"3-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Australia"	""	"0"	""	""	""	"Fam3"
"00087786"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	"sibling of 18541843-Pat3"	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087787"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	""	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087788"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	"sibling of 18541843-Pat1"	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087789"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	""	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087790"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	""	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087791"	""	""	""	"1"	""	"00006"	"{PMID:Gerth 2008:18541843}"	""	"M"	""	"Canada"	""	"0"	""	""	""	""
"00087792"	""	""	""	"1"	""	"00006"	"{PMID:Lledo 2008:18549702}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087793"	""	""	""	"1"	""	"00006"	"{PMID:Lledo 2008:18549702}"	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087794"	""	""	""	"1"	""	"00006"	"{PMID:Kjellstrom 2010:20569020}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087795"	""	""	""	"1"	""	"00006"	"{PMID:Kjellstrom 2010:20569020}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087796"	""	""	""	"1"	""	"00006"	"{PMID:Kjellstrom 2010:20569020}"	""	"M"	""	"Sweden"	""	"0"	""	""	""	""
"00087797"	""	""	""	"2"	""	"00006"	"{PMID:Lamey 2010:20238027}"	"2-generation family, 1 affected"	"M"	""	"Australia"	""	"0"	""	""	""	"Fam4"
"00087798"	""	""	""	"3"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"affected uncle, brother (younger)"	"M"	""	"India"	""	"0"	""	""	""	""
"00087799"	""	""	""	"1"	""	"00006"	"{PMID:Riveiro-Alvarez 2009:19324861}"	"carrier mother"	"M"	""	"Spain"	""	"0"	""	""	""	""
"00087800"	""	""	""	"9"	""	"00006"	"{PMID:Ali 2003:14516833}, {PMID:Saleheen 2008:18982040}"	"4-generation family, 5 affected males, 4, affected females, 6 unaffected carriers"	"F;M"	"yes"	"Pakistan"	""	"0"	""	""	""	"?;family"
"00087801"	""	""	""	"11"	""	"00006"	"{PMID:Xu 2010:20806044}"	"5-generation family, 7 affecteds, 4 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087802"	""	""	""	"12"	""	"00006"	"{PMID:Vijayasarathy 2009:19474399}"	"7-generation family, 12 affecteds"	"?"	""	"United States"	""	"0"	""	""	"Hispanic"	""
"00087803"	""	""	""	"17"	""	"00006"	"{PMID:Zeng 2007:17852193}"	"3-generation family, 9 affecteds, 8 carriers"	"M"	""	"China"	""	"0"	""	""	""	""
"00087804"	""	""	""	"2"	""	"00006"	"{PMID:Tuvdendorj 2002:12055472}"	"carrier mother"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087805"	""	""	""	"2"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"carrier mother"	"M"	""	"India"	""	"0"	""	""	""	""
"00087806"	""	""	""	"2"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"carrier mother"	"M"	""	"India"	""	"0"	""	""	""	""
"00087807"	""	""	""	"2"	""	"00006"	"{PMID:Kim 2009:19393523}"	"carrier mother"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087808"	""	""	""	"2"	""	"00006"	"{PMID:Kim 2009:19393523}"	"carrier mother"	"M"	""	"United States"	""	"0"	""	""	""	""
"00087809"	""	""	""	"2"	""	"00006"	"{PMID:Tuvdendorj 2002:12055472}"	"carrier mother"	"M"	""	"Japan"	""	"0"	""	""	""	""
"00087810"	""	""	""	"3"	""	"00006"	"{PMID:Shukla 2007:17631851}"	"affected brother, carrier mother"	"M"	""	"India"	""	"0"	""	""	""	""
"00087811"	""	""	""	"3"	""	"00006"	"{PMID:Atchaneeyasakul 2010:20151283}"	"5-generation family, 3 affecteds"	"M"	""	"Thailand"	""	"0"	""	""	""	""
"00087812"	""	""	""	"4"	""	"00006"	"{PMID:Koh 2006:16768192}"	"affected maternal uncle, carrier mother/sister"	"M"	""	"Korea"	""	"0"	""	""	""	""
"00087813"	""	""	""	"1"	""	"00006"	"{PMID:Lesch 2008:19093009}"	"3-generation family, 1 affected, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam11"
"00087814"	""	""	""	"5"	""	"00006"	"{PMID:Atchaneeyasakul 2010:20151283}"	"4-generation family, 5 affecteds"	"M"	""	"Thailand"	""	"0"	""	""	""	""
"00087815"	""	""	""	"5"	""	"00006"	"{PMID:Lesch 2008:19093009}"	"3-generation family, 2 affecteds, 3 carriers"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam5"
"00087816"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Austria"	""	"0"	""	""	""	""
"00087818"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00088054"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"India"	""	"0"	""	""	""	""
"00088055"	""	""	""	"5"	""	"00238"	""	"1 family, 5 affected"	"M"	"no"	"India"	""	"0"	""	""	""	""
"00088056"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"India"	""	"0"	""	""	""	""
"00088057"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"India"	""	"0"	""	""	""	""
"00088058"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"Mauritius"	""	"0"	""	""	""	""
"00088059"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"India"	""	"0"	""	""	""	""
"00088060"	""	""	""	"1"	""	"00238"	""	""	"M"	"no"	"India"	""	"0"	""	""	""	""
"00132118"	""	""	""	"1"	""	"00006"	"Kucinskas, ASHG2017, P1110"	""	""	""	"Lithuania"	""	"0"	""	""	""	"Pat1"
"00132119"	""	""	""	"1"	""	"00006"	"Kucinskas, ASHG2017, P1110"	""	""	""	"Lithuania"	""	"0"	""	""	""	"Pat2"
"00132120"	""	""	""	"1"	""	"00006"	"Kucinskas, ASHG2017, P1110"	""	""	""	"Lithuania"	""	"0"	""	""	""	"Pat3"
"00207356"	""	""	""	"1"	""	"00006"	"contact me for details"	"family history of X linked retinoschisis, carrier mother"	"M"	"no"	"United States"	""	"0"	""	""	""	"private email"
"00207597"	""	""	""	"4"	""	"01244"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00209026"	""	""	""	"1"	""	"00006"	"{PMID:Lionel 2018:28771251}"	""	"M"	""	"Canada"	""	"0"	""	""	""	"28771251-Pat44"
"00308561"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308562"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308563"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308564"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308565"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308566"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308567"	""	""	""	"2"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"2 patients with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308568"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00309413"	""	""	""	"2"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"2 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309414"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309415"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309416"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309417"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309418"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309419"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309420"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00328500"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"14021804"
"00333754"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"946"
"00333755"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"947"
"00333756"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"948"
"00333757"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"949"
"00333758"	""	""	""	"4"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 4 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"950"
"00333759"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"951"
"00333760"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"952"
"00333761"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"953"
"00333762"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"954"
"00333763"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"955"
"00333764"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"956"
"00333765"	""	""	""	"3"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 3 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"957"
"00333766"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"958"
"00335321"	""	""	""	"1"	""	"02485"	"{PMID:Bravo-Gil 2017:28157192}"	"patient"	"F"	""	"Spain"	""	"0"	""	""	""	"Pat65"
"00335449"	""	""	""	"5"	""	"00006"	"{PMID:Todorova 2017:28147405}"	"2-generation consanguineous family, 4 acrriers/1 male patient"	""	"yes"	"Switzerland"	""	"0"	""	""	""	"Fam5"
"00335992"	""	""	""	"1"	""	"00000"	"{PMID:Sergouniotis 2016:27628848}"	"analysis 486 cases"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00335993"	""	""	""	"1"	""	"00000"	"{PMID:Sergouniotis 2016:27628848}"	"analysis 486 cases"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00358745"	""	""	""	"1"	""	"00000"	"{PMID:Carrigan 2016:27624628}"	""	""	""	"Ireland"	""	"0"	""	""	""	""
"00359373"	""	""	""	"1"	""	"00000"	"{PMID:Bravo-Gil 2016:27032803}"	"see paper"	""	""	"Spain"	""	"0"	""	""	""	"512"
"00373846"	""	""	""	"1"	""	"00000"	"{PMID:Zhao 2015:25472526}"	"simplex case"	""	""	"Northern Ireland"	""	"0"	""	""	""	"Rp349B"
"00373940"	""	""	""	"1"	""	"00000"	"{PMID:Consugar 2015:25412400}"	""	""	""	"United States"	""	"0"	""	""	""	"OGI-289-627"
"00376319"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	"12 patients in 9 families"	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00376320"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	"5 patients in 5 families"	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00376321"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	"2 patients in patients in 1 family"	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00376322"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	""	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00379562"	""	""	""	"1"	""	"00000"	"{PMID:O\'Sullivan-2012:22581970}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00379785"	""	""	""	"1"	""	"01807"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00379792"	""	""	""	"1"	""	"03508"	""	""	"M"	""	"Korea, South (Republic)"	""	""	""	""	""	"IR_GS_0150"
"00383456"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00383457"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00383458"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00383459"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00384253"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13189"
"00384254"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13191"
"00384311"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13604"
"00384318"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13651"
"00384337"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13749"
"00384339"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13761"
"00384342"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13784"
"00384348"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"13846"
"00384365"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14003"
"00384395"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14178"
"00384416"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14396"
"00384448"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14612"
"00384457"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14655"
"00384479"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14809"
"00384489"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14865"
"00384490"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2019:31106028}"	""	"M"	""	"China"	""	"0"	""	""	""	"14880"
"00386731"	""	""	""	"1"	""	"00000"	"{PMID:Zampaglione 2020:32037395}"	""	"?"	""	""	""	"0"	""	""	""	"OGI2869_004454"
"00386797"	""	""	""	"1"	""	"00000"	"{PMID:Zampaglione 2020:32037395}"	""	"?"	""	""	""	"0"	""	""	""	"OGI2953_004538"
"00388037"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2016:27788217}"	""	"M"	""	"United States"	""	"0"	""	""	""	"9"
"00388195"	""	""	""	"1"	""	"00006"	"{PMID:Lingao 2016:26894784}"	""	"M"	""	""	""	"0"	""	""	""	"Pat5"
"00388727"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 6, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"11"
"00388756"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 18, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"40"
"00388758"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 22, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"42"
"00388765"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 26, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"49"
"00388766"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 26, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"50"
"00388779"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 32, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"63"
"00388784"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 33, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"68"
"00388787"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 35, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"71"
"00388788"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 36, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"72"
"00388790"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 37, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"74"
"00388886"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 67, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"170"
"00388887"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 67, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"171"
"00388898"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 69, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"182"
"00388903"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 70, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"187"
"00388905"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 71, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"189"
"00388910"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 72, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"194"
"00388919"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 73, retinoschisis, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"203"
"00388962"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 84, unclassified / mixed, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"246"
"00388963"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 84, unclassified / mixed, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"247"
"00390760"	""	""	""	"1"	""	"00000"	"{PMID:Booij-2011:20801516}"	""	""	""	""	""	"0"	""	""	""	""
"00390796"	""	""	""	"1"	""	"00000"	"{PMID:Booij-2011:20801516}"	""	""	""	""	""	"0"	""	""	""	""
"00390859"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390916"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390984"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390991"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390993"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390997"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00391384"	""	""	""	"1"	""	"00000"	"{PMID:Méjécase 2020:3278337"	""	"?"	""	"United Arab Emirates"	""	"0"	""	""	""	"52"
"00391385"	""	""	""	"1"	""	"00000"	"{PMID:Méjécase 2020:3278337"	""	"?"	""	"United Arab Emirates"	""	"0"	""	""	""	"53"
"00391503"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"1"
"00391504"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"Maori"	"2"
"00391505"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"3"
"00391508"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"4"
"00391509"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"5"
"00391510"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"6"
"00391511"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"Middle Eastern"	"7"
"00391512"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"8"
"00391513"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"9"
"00391514"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"10"
"00391515"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"white"	"11"
"00391516"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	""	""	"New Zealand"	""	"0"	""	""	"Indian"	"12"
"00393448"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393470"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393471"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393475"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393476"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393517"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393549"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393609"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393730"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393745"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393812"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393837"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393866"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00393888"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00394797"	""	""	""	"1"	""	"00000"	"{PMID:Kim 2021:33946315}"	""	"?"	""	"Korea, South (Republic)"	""	"0"	""	""	""	"6-6"
"00395926"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:43360855}"	""	"?"	""	"Taiwan"	""	"0"	""	""	""	"F087"
"00395927"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:43360855}"	""	"?"	""	"Taiwan"	""	"0"	""	""	""	"F210"
"00395952"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:43360855}"	""	"?"	""	"Taiwan"	""	"0"	""	""	""	"F215"
"00395985"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"1"
"00395986"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"2"
"00395987"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"3"
"00395988"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"4"
"00395989"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"5"
"00395990"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"6"
"00395991"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"7"
"00395992"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"8"
"00395993"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"9"
"00395994"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"10"
"00395995"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"11"
"00395996"	""	""	""	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"12"
"00395997"	""	""	""	"2"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	"3-generation family, 2 affcted (uncle/boy)"	"M"	""	"United States"	""	"0"	""	""	"China"	"FamPatII2"
"00395998"	""	""	"00395997"	"1"	""	"00000"	"{PMID:Vijayasarathy 2010:20809529}"	"boy"	"M"	""	"United States"	""	"1"	""	""	"china"	"FamPatIII4"
"00396002"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family A, individual II-1"	"M"	""	"China"	""	"0"	""	""	""	"II-1"
"00396003"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family B, individual II-1"	"M"	""	"China"	""	"0"	""	""	""	"II-1"
"00396004"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family C, individual III-1"	"M"	""	"China"	""	"0"	""	""	""	"III-1"
"00396005"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family C, individual II-2"	"M"	""	"China"	""	"0"	""	""	""	"II-2"
"00396006"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family D, individual IV-1"	"M"	""	"China"	""	"0"	""	""	""	"IV-1"
"00396007"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family D, individual II-1"	"M"	""	"China"	""	"0"	""	""	""	"II-1"
"00396008"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family E, individual III-1"	"M"	""	"China"	""	"0"	""	""	""	"III-1"
"00396009"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2011:21701876}"	"Family F, individual III-1"	"M"	""	"China"	""	"0"	""	""	""	"III-1"
"00396010"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat3"
"00396011"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat4"
"00396012"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat6"
"00396013"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat7"
"00396014"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat8"
"00396015"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat9"
"00396016"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat11"
"00396017"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat12"
"00396018"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat13"
"00396019"	""	""	""	"1"	""	"00006"	"{PMID:Shinoda 2000:11035549}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"Pat14"
"00396020"	""	""	""	"1"	""	"00000"	"{PMID:Armanda-Maresca 2011:21836411}"	""	"?"	""	"Spain"	""	"0"	""	""	""	"F119"
"00396021"	""	""	""	"1"	""	"00000"	"{PMID:Duncan 2011:22110067}"	""	"?"	""	"United States"	""	"0"	""	""	""	"1"
"00396022"	""	""	""	"1"	""	"00000"	"{PMID:Duncan 2011:22110067}"	""	"?"	""	"United States"	""	"0"	""	""	""	"2"
"00396034"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT042"
"00396035"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT335"
"00396036"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT221"
"00396037"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT232"
"00396038"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT653"
"00396039"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"MD015"
"00396040"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"RP006"
"00396041"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"MD030"
"00396042"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT212"
"00396043"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT417"
"00396044"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT848"
"00396045"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT911"
"00396046"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT219"
"00396047"	""	""	""	"1"	""	"00000"	"{PMID:Yi 2012:22245991}"	""	"M"	""	"China"	""	"0"	""	""	""	"QT758"
"00396048"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"1"
"00396049"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"2"
"00396050"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"3"
"00396051"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"4"
"00396052"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"5"
"00396053"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"6"
"00396054"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"7"
"00396055"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"8"
"00396056"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"9"
"00396057"	""	""	""	"1"	""	"00000"	"{PMID:Skorczyk 2012:23288992}"	""	"M"	""	"Poland"	""	"0"	""	""	""	"10"
"00396062"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"1"
"00396063"	""	""	""	"7"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"7 patients, ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"2"
"00396064"	""	""	""	"2"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"2 patients, ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"3"
"00396065"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"4"
"00396066"	""	""	""	"2"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"2 patients, ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"5"
"00396067"	""	""	""	"2"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"2 patients, ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"6"
"00396068"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"7"
"00396069"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"8"
"00396070"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"9"
"00396071"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"10"
"00396072"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"11"
"00396073"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"12"
"00396074"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"13"
"00396075"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"14"
"00396076"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"15"
"00396077"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"16"
"00396078"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"17"
"00396079"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"18"
"00396080"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"19"
"00396081"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"20"
"00396082"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"21"
"00396083"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"22"
"00396084"	""	""	""	"1"	""	"00000"	"{PMID:Sergeev 2013:23847049}"	"patient ID ascribed consecutively (no ID in the paper)"	"M"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"23"
"00396085"	""	""	""	"1"	""	"00000"	"{PMID:Chu 2013:23568735}"	"Family 1, proband (only from abstract)"	"M"	""	"China"	""	"0"	""	""	""	"1"
"00396086"	""	""	""	"1"	""	"00000"	"{PMID:Chu 2013:23568735}"	"Family 2, proband (only from abstract)"	"M"	""	"China"	""	"0"	""	""	""	"2"
"00396087"	""	""	""	"1"	""	"00000"	"{PMID:D�Souza:24227916}"	"Patient #645"	"M"	""	"(United States)"	""	"0"	""	""	""	"645"
"00396088"	""	""	""	"1"	""	"00000"	"{PMID:D�Souza:24227916}"	"Patient #22"	"M"	""	"(United States)"	""	"0"	""	""	""	"22"
"00396089"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113001"
"00396090"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113010"
"00396091"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113020"
"00396092"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113030"
"00396093"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113040"
"00396094"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113050"
"00396095"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113060"
"00396096"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113070"
"00396097"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113080"
"00396098"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113090"
"00396099"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113100"
"00396100"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113110"
"00396101"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113120"
"00396102"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113140"
"00396103"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113150"
"00396104"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2014:24505212}"	""	"M"	""	"China"	""	"0"	""	""	""	"113160"
"00396105"	""	""	""	"1"	""	"00000"	"{PMID:Lai 2015:24529551}"	"Single Taiwanese family: proband\'s maternal uncle 1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-7"
"00396106"	""	""	""	"1"	""	"00000"	"{PMID:Lai 2015:24529551}"	"Single Taiwanese family: proband\'s maternal uncle 2"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-8"
"00396107"	""	""	""	"1"	""	"00000"	"{PMID:Lai 2015:24529551}"	"Single Taiwanese family: proband\'s maternal aunt\'s son"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-2"
"00396108"	""	""	""	"1"	""	"00000"	"{PMID:Lai 2015:24529551}"	"Single Taiwanese family: proband"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-3"
"00396109"	""	""	""	"1"	""	"00000"	"{PMID:Lai 2015:24529551}"	"Single Taiwanese family: proband\'s brother"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-4"
"00396111"	""	""	""	"7"	""	"00000"	"{PMID:Gliem 2014:25054456}"	"4-generation family, 6 affected males, 1 affected female, 7 unaffected carrier females"	"F"	""	"(Germany)"	""	"0"	""	""	"Turkish"	"FamPatII2"
"00396112"	""	""	"00396111"	"1"	""	"00000"	"{PMID:Gliem 2014:25054456}"	"proband (son)"	"M"	""	"(Germany)"	""	"0"	""	""	"Turkish"	"FamPatIII4"
"00396113"	""	""	"00396111"	"1"	""	"00000"	"{PMID:Gliem 2014:25054456}"	"brother"	"M"	""	"(Germany)"	""	"0"	""	""	"Turkish"	"FamPatIII5"
"00396114"	""	""	"00396111"	"1"	""	"00000"	"{PMID:Gliem 2014:25054456}"	"proband\'s brother\'s son"	"M"	""	"(Germany)"	""	"0"	""	""	"Turkish"	"FamPatIV3"
"00396115"	""	""	"00396111"	"1"	""	"00000"	"{PMID:Gliem 2014:25054456}"	"proband\'s brother\'s son"	"M"	""	"(Germany)"	""	"0"	""	""	"Turkish"	"FamPatIV4"
"00396116"	""	""	""	"1"	""	"00000"	"{PMID:Huang 2014:25168411}"	"Single Chinese family: proband"	"M"	""	"China"	""	"0"	""	""	""	"III.1"
"00396117"	""	""	""	"1"	""	"00000"	"{PMID:Huang 2014:25168411}"	"Single Chinese family: proband\'s brother"	"M"	""	"China"	""	"0"	""	""	""	"III.2"
"00396118"	""	""	""	"1"	""	"00000"	"{PMID:Ulinska 2014:25799783}"	"Single Polish family: proband"	"M"	""	"Poland"	""	"0"	""	""	""	""
"00396119"	""	""	""	"1"	""	"00000"	"{PMID:Ulinska 2014:25799783}"	"Single Polish family: proband�s sister 3\'s son 1"	"M"	""	"Poland"	""	"0"	""	""	""	""
"00396120"	""	""	""	"1"	""	"00000"	"{PMID:Ulinska 2014:25799783}"	"Single Polish family: proband�s sister 3\'s son 2"	"M"	""	"Poland"	""	"0"	""	""	""	""
"00396121"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"101"
"00396122"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"102"
"00396123"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"103"
"00396124"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"104"
"00396125"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	"brother of 106"	"M"	""	"(United States)"	""	"0"	""	""	""	"105"
"00396126"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	"brother of 105"	"M"	""	"(United States)"	""	"0"	""	""	""	"106"
"00396127"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"107"
"00396128"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"108"
"00396129"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"109"
"00396130"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"110"
"00396131"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2001:11738458}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"111"
"00396133"	""	""	""	"1"	""	"00000"	"{PMID:Akeo 2015:26356828}"	"proband"	"M"	""	"Japan"	""	"0"	""	""	""	"1"
"00396134"	""	""	""	"1"	""	"00000"	"{PMID:Akeo 2015:26356828}"	"proband\'s brother"	"M"	""	"Japan"	""	"0"	""	""	""	"2"
"00396135"	""	""	""	"1"	""	"00000"	"{PMID:Vazquez-Alfageme 2016:26791414}"	"proband"	"M"	""	"Spain"	""	"0"	""	""	""	"1"
"00396136"	""	""	""	"1"	""	"00000"	"{PMID:Xiao 2016:26823236}"	"proband"	"M"	""	"China"	""	"0"	""	""	""	"IV-3"
"00396137"	""	""	""	"1"	""	"00000"	"{PMID:Xiao 2016:26823236}"	"proband\'s brother"	"M"	""	"China"	""	"0"	""	""	""	"IV-4"
"00396138"	""	""	""	"1"	""	"00000"	"{PMID:Xiao 2016:26823236}"	"proband\'s maternal cousin"	"M"	""	"China"	""	"0"	""	""	""	"IV-1"
"00396139"	""	""	""	"1"	""	"00000"	"{PMID:Xiao 2016:26823236}"	"proband\'s mother\'s paternal cousin"	"M"	""	"China"	""	"0"	""	""	""	"III-2"
"00396140"	""	""	""	"1"	""	"00000"	"{PMID:Xiao 2016:26823236}"	"proband\'s maternal grandfather"	"M"	""	"China"	""	"0"	""	""	""	"II-4"
"00396141"	""	""	""	"1"	""	"00000"	"{PMID:Sadaka 2016:27246168}"	"proband"	"M"	""	"United States"	""	"0"	""	"extensive retinectomy and silicone oil tamponade; dorzolamide 2 % twice per day"	"African-American"	"IV-3"
"00396142"	""	""	""	"1"	""	"00000"	"{PMID:Galantuomo 2016:27932860}"	"proband"	"M"	""	"Italy"	""	"0"	""	"375 mg acetazolamide daily for 3 months; then  2% dorzolamide collyrium"	""	"IV-2"
"00396143"	""	""	""	"1"	""	"00000"	"{PMID:Galantuomo 2016:27932860}"	"proband\'s brother"	"M"	""	"Italy"	""	"0"	""	"375 mg acetazolamide daily for 3 months; no further treatment"	""	"IV-3"
"00396144"	""	""	""	"1"	""	"00000"	"{PMID:Nicoletti 2017:27997221}"	"proband"	"M"	""	"Italy"	""	"0"	""	""	""	"III-3"
"00396145"	""	""	""	"1"	""	"00000"	"{PMID:Nicoletti 2017:27997221}"	"proband\'s brother 1"	"M"	""	"Italy"	""	"0"	""	""	""	"III-4"
"00396146"	""	""	""	"1"	""	"00000"	"{PMID:Nicoletti 2017:27997221}"	"proband\'s brother 2"	"M"	""	"Italy"	""	"0"	""	""	""	"III-6"
"00396147"	""	""	""	"1"	""	"00000"	"{PMID:Nicoletti 2017:27997221}"	"proband\'s maternal cousin"	"M"	""	"Italy"	""	"0"	""	""	""	"III-7"
"00396148"	""	""	""	"1"	""	"00000"	"{PMID:Murro 2017:28235399}"	"monozygotic twin of Twin B"	"M"	""	""	""	"0"	""	""	""	"Twin-A"
"00396149"	""	""	""	"1"	""	"00000"	"{PMID:Murro 2017:28235399}"	"monozygotic twin of Twin A"	"M"	""	""	""	"0"	""	""	""	"Twin-B"
"00396150"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"1"
"00396151"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"2"
"00396152"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"3"
"00396153"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"4"
"00396154"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"5"
"00396155"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"6"
"00396156"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"7"
"00396157"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"8"
"00396158"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"9"
"00396159"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"10"
"00396160"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"11"
"00396161"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"12"
"00396162"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"14"
"00396163"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"15"
"00396164"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"16"
"00396165"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"17"
"00396166"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"18"
"00396167"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"19"
"00396168"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"20"
"00396169"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"21"
"00396170"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"22"
"00396171"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"23"
"00396172"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"24"
"00396173"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"25"
"00396174"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"26"
"00396175"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"27"
"00396176"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"28"
"00396177"	""	""	""	"1"	""	"00000"	"{PMID:Hu 2017:28272453}"	""	"M"	""	""	""	"0"	""	""	""	"29"
"00396345"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"1"
"00396346"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"2"
"00396347"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"3"
"00396348"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"4"
"00396349"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"5"
"00396350"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"6"
"00396351"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"7"
"00396352"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"8"
"00396353"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"9"
"00396354"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"10"
"00396355"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"11"
"00396356"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"12"
"00396357"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"13"
"00396358"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"14"
"00396359"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"15"
"00396360"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"16"
"00396361"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"17"
"00396362"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"18"
"00396363"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"19"
"00396364"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"20"
"00396365"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"21"
"00396366"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"22"
"00396367"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"23"
"00396368"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"24"
"00396369"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"25"
"00396370"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"26"
"00396371"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"27"
"00396372"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"28"
"00396373"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"29"
"00396374"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"30"
"00396375"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"31"
"00396376"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"32"
"00396377"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"33"
"00396378"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"34"
"00396379"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"35"
"00396380"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"36"
"00396381"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"37"
"00396382"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"38"
"00396383"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"39"
"00396384"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"40"
"00396385"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"41"
"00396386"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"42"
"00396387"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"43"
"00396388"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"44"
"00396389"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"45"
"00396390"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"46"
"00396391"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"47"
"00396392"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"48"
"00396393"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"49"
"00396394"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"50"
"00396395"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"51"
"00396396"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"52"
"00396397"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"53"
"00396398"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"54"
"00396399"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"55"
"00396400"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"56"
"00396401"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"57"
"00396402"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"58"
"00396403"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"59"
"00396404"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"60"
"00396405"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"61"
"00396406"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"62"
"00396407"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2017:28348004}"	"no patient numbers in paper, consecutive numbers given"	"M"	""	""	""	"0"	""	""	""	"63"
"00396421"	""	""	""	"1"	""	"00006"	"{PMID:Ellingford 2016:26872967}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"09001814"
"00396431"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family A, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396432"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family B, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396433"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family C, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396434"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family D, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396435"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family E, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396436"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family F, patient I-2"	"M"	""	"Taiwan"	""	"0"	""	""	""	"I-2"
"00396437"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family F, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396438"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family G, patient I-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"I-1"
"00396439"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family G, patient III-2"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-2"
"00396440"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family G, patient III-3"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-3"
"00396441"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family G, patient  III-6"	"M"	""	"Taiwan"	""	"0"	""	""	""	"III-6"
"00396442"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family H, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396443"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family I, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396444"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family J, patient II-2"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-2"
"00396445"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family J, patient II-5"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-5"
"00396446"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family K, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396447"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family L, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396448"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family M, patient II-3"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-3"
"00396449"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family M, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396450"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family N, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396451"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family O, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396452"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family P, patient II-1"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-1"
"00396453"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:25999676}"	"Family P, patient II-2"	"M"	""	"Taiwan"	""	"0"	""	""	""	"II-2"
"00396466"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2017:28574807}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"101"
"00396489"	""	""	""	"1"	""	"00000"	"{PMID:Dockery 2017:29099798}"	"no patient numbers in the paper, consecutive numbers given"	"?"	""	"Ireland"	""	"0"	""	""	""	"22"
"00396490"	""	""	""	"1"	""	"00000"	"{PMID:Dockery 2017:29099798}"	"no patient numbers in the paper, consecutive numbers given"	"?"	""	"Ireland"	""	"0"	""	""	""	"23"
"00396656"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4975, patient CIC08760"	"M"	""	"France"	""	"0"	""	""	""	"CIC08760"
"00396657"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F1466, patient CIC03438"	"M"	""	"France"	""	"0"	""	""	""	"CIC03438"
"00396658"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F275, patient CIC00400"	"M"	""	"France"	""	"0"	""	""	""	"CIC00400"
"00396659"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F1949, patient CIC04141"	"M"	""	"France"	""	"0"	""	""	""	"CIC04141"
"00396660"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient Subject_KA"	"M"	""	"France"	""	"0"	""	""	""	"Subject_KA"
"00396661"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3741, patient CIC07454"	"M"	""	"France"	""	"0"	""	""	""	"CIC07454"
"00396662"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3741, patient CIC06716"	"M"	""	"France"	""	"0"	""	""	""	"CIC06716"
"00396663"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3741, patient CIC07873"	"M"	""	"France"	""	"0"	""	""	""	"CIC07873"
"00396664"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F94, patient CIC00121"	"M"	""	"France"	""	"0"	""	""	""	"CIC00121"
"00396665"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4060, patient CIC07365"	"M"	""	"France"	""	"0"	""	""	""	"CIC07365"
"00396666"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4717, patient CIC08376"	"M"	""	"France"	""	"0"	""	""	""	"CIC08376"
"00396667"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F511, patient CIC00789"	"M"	""	"France"	""	"0"	""	""	""	"CIC00789"
"00396668"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F5222, patient CIC09138"	"M"	""	"France"	""	"0"	""	""	""	"CIC09138"
"00396669"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient CIC05162"	"M"	""	"France"	""	"0"	""	""	""	"CIC05162"
"00396670"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient CIC05163"	"M"	""	"France"	""	"0"	""	""	""	"CIC05163"
"00396671"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F442, patient CIC00650"	"M"	""	"France"	""	"0"	""	""	""	"CIC00650"
"00396672"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F442, patient CIC04991"	"M"	""	"France"	""	"0"	""	""	""	"CIC04991"
"00396673"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4111, patient CIC07437"	"M"	""	"France"	""	"0"	""	""	""	"CIC07437"
"00396674"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4111, patient CIC08483"	"M"	""	"France"	""	"0"	""	""	""	"CIC08483"
"00396675"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4111, patient CIC07437\'s_cousin_1"	"M"	""	"France"	""	"0"	""	""	""	"CIC07437\'s_cousin_1"
"00396676"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4111, patient CIC07437\'s_cousin_2"	"M"	""	"France"	""	"0"	""	""	""	"CIC07437\'s_cousin_2"
"00396677"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F442, patient CIC04991"	"M"	""	"France"	""	"0"	""	""	""	"CIC04991"
"00396678"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2699, patient CIC05323"	"M"	""	"France"	""	"0"	""	""	""	"CIC05323"
"00396679"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2699, patient CIC05323\'s_brother"	"M"	""	"France"	""	"0"	""	""	""	"CIC05323\'s_brother"
"00396680"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3725, patient CIC06826"	"M"	""	"France"	""	"0"	""	""	""	"CIC06826"
"00396681"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3725, patient CIC06827"	"M"	""	"France"	""	"0"	""	""	""	"CIC06827"
"00396682"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3175, patient CIC06042"	"M"	""	"France"	""	"0"	""	""	""	"CIC06042"
"00396683"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient CIC09774"	"M"	""	"France"	""	"0"	""	""	""	"CIC09774"
"00396684"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F816, patient CIC01352"	"M"	""	"France"	""	"0"	""	""	""	"CIC01352"
"00396685"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F68, patient CIC00091"	"M"	""	"France"	""	"0"	""	""	""	"CIC00091"
"00396686"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F5227, patient CIC09147"	"M"	""	"France"	""	"0"	""	""	""	"CIC09147"
"00396687"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4870, patient CIC08603"	"M"	""	"France"	""	"0"	""	""	""	"CIC08603"
"00396688"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2068, patient CIC04314"	"M"	""	"France"	""	"0"	""	""	""	"CIC04314"
"00396689"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient Subject_VT"	"M"	""	"France"	""	"0"	""	""	""	"Subject_VT"
"00396690"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3448, patient CIC06469"	"M"	""	"France"	""	"0"	""	""	""	"CIC06469"
"00396691"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F5277, patient CIC09214"	"M"	""	"France"	""	"0"	""	""	""	"CIC09214"
"00396692"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2628, patient CIC05647"	"M"	""	"France"	""	"0"	""	""	""	"CIC05647"
"00396693"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2628, patient CIC05191"	"M"	""	"France"	""	"0"	""	""	""	"CIC05191"
"00396694"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F5283, patient CIC09220"	"M"	""	"France"	""	"0"	""	""	""	"CIC09220"
"00396695"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F1761, patient CIC03863"	"M"	""	"France"	""	"0"	""	""	""	"CIC03863"
"00396696"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F1761, patient CIC03864"	"M"	""	"France"	""	"0"	""	""	""	"CIC03864"
"00396697"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3451, patient Subject_ML"	"M"	""	"France"	""	"0"	""	""	""	"Subject_ML"
"00396698"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3451, patient CIC06475"	"M"	""	"France"	""	"0"	""	""	""	"CIC06475"
"00396699"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F5727, patient CIC10049"	"M"	""	"France"	""	"0"	""	""	""	"CIC10049"
"00396700"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F152, patient CIC00209"	"M"	""	"France"	""	"0"	""	""	""	"CIC00209"
"00396701"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F152, patient CIC00209\'s_cousin"	"M"	""	"France"	""	"0"	""	""	""	"CIC00209\'s_cousin"
"00396702"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2868, patient CIC05596"	"M"	""	"France"	""	"0"	""	""	""	"CIC05596"
"00396703"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F2200, patient CIC04516"	"M"	""	"France"	""	"0"	""	""	""	"CIC04516"
"00396704"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F3852, patient CIC07009"	"M"	""	"France"	""	"0"	""	""	""	"CIC07009"
"00396705"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F1919, patient CIC04102"	"M"	""	"France"	""	"0"	""	""	""	"CIC04102"
"00396706"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family F4873, patient CIC08607"	"M"	""	"France"	""	"0"	""	""	""	"CIC08607"
"00396707"	""	""	""	"1"	""	"00000"	"{PMID:Ores 2018:29739629}"	"Family unknown, patient subject_BA"	"M"	""	"France"	""	"0"	""	""	""	"subject_BA"
"00396725"	""	""	""	"1"	""	"00000"	"{PMID:Piermarocchi 2017:28811895}"	""	"M"	""	"Italy"	""	"0"	""	""	""	"101"
"00396727"	""	""	""	"1"	""	"00000"	"{PMID:Abalem 2018:29902095}"	""	"M"	""	"United States"	""	"0"	""	"Dorzolamide 1%"	""	"Pat1"
"00396728"	""	""	""	"1"	""	"00000"	"{PMID:Abalem 2018:29902095}"	""	"M"	""	"United States"	""	"0"	""	"Acetozolamide 250mg"	""	"Pat2"
"00396729"	""	""	""	"1"	""	"00000"	"{PMID:Abalem 2018:29902095}"	""	"M"	""	"United States"	""	"0"	""	"Dorzolamide 1%"	""	"Pat3"
"00396730"	""	""	""	"2"	""	"00000"	"{PMID:Lee 2019:30215241}"	"proband, brother of 2"	"M"	""	"United States"	""	"0"	""	""	""	"FamPatII1"
"00396731"	""	""	"00396730"	"1"	""	"00000"	"{PMID:Lee 2019:30215241}"	"brother"	"M"	""	"United States"	""	"0"	""	""	""	"FamPatII2"
"00396732"	""	""	""	"14"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"5-generation family, 14 affected (14M), proband"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII1"
"00396733"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 1 of proband"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII2"
"00396734"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 2 of proband"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII3"
"00396735"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 3 of proband"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII4"
"00396736"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 4 of proband"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII5"
"00396737"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"proband\'s maternal cousin 1"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII6"
"00396738"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"proband\'s maternal cousin 2"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatII7"
"00396739"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 1 of proband\'s grandson (son 1 of daughter)"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatIV3"
"00396740"	""	""	"00396732"	"1"	""	"00000"	"{PMID:Stephenson 2018:30419843}"	"brother 1 of proband\'s grandson (son 2 of daughter)"	"M"	""	"Ireland"	""	"0"	""	""	""	"FamPatIV4"
"00396741"	""	""	""	"1"	""	"00000"	"{PMID:Strupaite 2018:30450322}"	""	"M"	""	"Ireland"	""	"0"	""	""	""	"II:1"
"00396742"	""	""	""	"1"	""	"00000"	"{PMID:Strupaite 2018:30450322}"	""	"M"	""	"Ireland"	""	"0"	""	""	""	"II:2"
"00396743"	""	""	""	"1"	""	"00000"	"{PMID:Strupaite 2018:30450322}"	""	"M"	""	"Ireland"	""	"0"	""	""	""	"II:3"
"00396744"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-304"
"00396745"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-316"
"00396746"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-020"
"00396747"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-013"
"00396748"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-004"
"00396749"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-006"
"00396750"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-013"
"00396751"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-311"
"00396752"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-325"
"00396753"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-326"
"00396754"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-310"
"00396755"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-319"
"00396756"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-321"
"00396757"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-014"
"00396758"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-007"
"00396759"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-002"
"00396760"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-022"
"00396761"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-005"
"00396762"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-314"
"00396763"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-011"
"00396764"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-012"
"00396765"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-014"
"00396766"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-018"
"00396767"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-003*"
"00396768"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-004*"
"00396769"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-312"
"00396770"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-318"
"00396771"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-011"
"00396772"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-015"
"00396773"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-009"
"00396774"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-002"
"00396775"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-003"
"00396776"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-309"
"00396777"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-306"
"00396778"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-010"
"00396779"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-017"
"00396780"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-016"
"00396781"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-324"
"00396782"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-315�"
"00396783"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-320"
"00396784"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-322�"
"00396785"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-015"
"00396786"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-001"
"00396787"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-001"
"00396788"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-007�"
"00396789"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-008�"
"00396790"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-018�"
"00396791"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-019�"
"00396792"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-303"
"00396793"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-301"
"00396794"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-017"
"00396795"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-002"
"00396796"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-021"
"00396797"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-008"
"00396798"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"KEC-010"
"00396799"	""	""	""	"1"	""	"00000"	"{PMID:Pennesi 2018:30551202}"	""	"M"	""	"United States"	""	"0"	""	""	""	"RFS-323"
"00396801"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F1, patient P1"	"M"	""	"India"	""	"0"	""	""	""	"P1"
"00396802"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F2, patient P2"	"M"	""	"India"	""	"0"	""	""	""	"P2"
"00396803"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F3, patient P3"	"M"	""	"India"	""	"0"	""	""	""	"P3"
"00396804"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F3, patient P4"	"M"	""	"India"	""	"0"	""	""	""	"P4"
"00396805"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F4, patient P5"	"M"	""	"India"	""	"0"	""	""	""	"P5"
"00396806"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F5, patient P6"	"M"	""	"India"	""	"0"	""	""	""	"P6"
"00396807"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F6, patient P7"	"M"	""	"India"	""	"0"	""	""	""	"P7"
"00396808"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F7, patient P8"	"M"	""	"India"	""	"0"	""	""	""	"P8"
"00396809"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F8, patient P9"	"M"	""	"India"	""	"0"	""	""	""	"P9"
"00396810"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F8, patient P10"	"M"	""	"India"	""	"0"	""	""	""	"P10"
"00396811"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F9, patient P11"	"M"	""	"India"	""	"0"	""	""	""	"P11"
"00396812"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F10, patient P12"	"M"	""	"India"	""	"0"	""	""	""	"P12"
"00396813"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F11, patient P13"	"M"	""	"India"	""	"0"	""	""	""	"P13"
"00396814"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F12, patient P14"	"M"	""	"India"	""	"0"	""	""	""	"P14"
"00396815"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F12, patient P15"	"M"	""	"India"	""	"0"	""	""	""	"P15"
"00396816"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F13, patient P16"	"M"	""	"India"	""	"0"	""	""	""	"P16"
"00396817"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F14, patient P17"	"M"	""	"India"	""	"0"	""	""	""	"P17"
"00396818"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F15, patient P18"	"M"	""	"India"	""	"0"	""	""	""	"P18"
"00396819"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F16, patient P19"	"M"	""	"India"	""	"0"	""	""	""	"P19"
"00396820"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F17, patient P20"	"M"	""	"India"	""	"0"	""	""	""	"P20"
"00396821"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F18, patient P21"	"M"	""	"India"	""	"0"	""	""	""	"P21"
"00396822"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F19, patient P22"	"M"	""	"India"	""	"0"	""	""	""	"P22"
"00396823"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F20, patient P23"	"M"	""	"India"	""	"0"	""	""	""	"P23"
"00396824"	""	""	""	"1"	""	"00000"	"{PMID:Sudha 2018:29851975}"	"Family F20, patient P24"	"M"	""	"India"	""	"0"	""	""	""	"P24"
"00396861"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 1, patient KS0001, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"KS0001"
"00396862"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 2, patient F111, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"F111"
"00396863"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 3, patient J0968, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0968"
"00396864"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 4, patient RS30-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS30-1"
"00396865"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 5, patient J0913, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0913"
"00396866"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 6, patient RS13-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS13-1"
"00396867"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 6, patient RS13-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"RS13-2"
"00396868"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 7, patient RS14-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS14-1"
"00396869"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 8, patient RS01-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS01-1"
"00396870"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 8, patient RS01-2, sibling 1"	"M"	""	"Japan"	""	"0"	""	""	""	"RS01-2"
"00396871"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 8, patient RS01-3, sibling 2"	"M"	""	"Japan"	""	"0"	""	""	""	"RS01-3"
"00396872"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 9, patient RS11-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS11-1"
"00396873"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 9, patient RS11-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"RS11-2"
"00396874"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 10, patient J0381, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0381"
"00396875"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 11, patient J0673, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0673"
"00396876"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 12, patient J1033, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J1033"
"00396877"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 13, patient J1062, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J1062"
"00396878"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 14, patient RS04-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS04-1"
"00396879"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 14, patient RS04-1, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"RS04-1"
"00396880"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 15, patient KINKI-113, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"KINKI-113"
"00396881"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 16, patient NMSCHH011-01, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"NMSCHH011-01"
"00396882"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 16, patient NMSCHH011-02, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"NMSCHH011-02"
"00396883"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 17, patient RS12-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS12-1"
"00396884"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 18, patient J0256, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0256"
"00396885"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 19, patient J1224, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J1224"
"00396886"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 20, patient Teik1051, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"Teik1051"
"00396887"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 21, patient Teik1103, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"Teik1103"
"00396888"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 22, patient KINKI-107-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"KINKI-107-1"
"00396889"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 22, patient KINKI-107-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"KINKI-107-2"
"00396890"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 23, patient RS21-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS21-1"
"00396891"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 24, patient RS16-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS16-1"
"00396892"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 25, patient RS17-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS17-1"
"00396893"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 26, patient RS31-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS31-1"
"00396894"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 26, patient RS31-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"RS31-2"
"00396895"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 27, patient Teik1153, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"Teik1153"
"00396896"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 28, patient J1330, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J1330"
"00396897"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 29, patient RS23-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS23-1"
"00396898"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 29, patient RS23-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"RS23-2"
"00396899"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 30, patient RS08-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS08-1"
"00396900"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 31, patient MIYA003-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"MIYA003-1"
"00396901"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 31, patient MIYA003-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"MIYA003-2"
"00396902"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 32, patient RS18-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS18-1"
"00396903"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 33, patient J0690, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0690"
"00396904"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 34, patient J0852, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0852"
"00396905"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 35, patient MIE52, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"MIE52"
"00396906"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 36, patient J0892, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0892"
"00396907"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 37, patient NHO1025, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"NHO1025"
"00396908"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 38, patient RS25-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS25-1"
"00396909"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 39, patient RS26-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS26-1"
"00396910"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 40, patient RS27-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS27-1"
"00396911"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 41, patient J1461, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J1461"
"00396912"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 42, patient KIN, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"KIN"
"00396913"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 43, patient RS07-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS07-1"
"00396914"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 44, patient MIE49, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"MIE49"
"00396915"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 45, patient RS32-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS32-1"
"00396916"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 46, patient RS10-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS10-1"
"00396917"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 47, patient RS19-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS19-1"
"00396918"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 48, patient RS15-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS15-1"
"00396919"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 49, patient NTMC218, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"NTMC218"
"00396920"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 50, patient RS29-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS29-1"
"00396921"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 51, patient J0903, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0903"
"00396922"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 52, patient J0371, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0371"
"00396923"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 53, patient J0640, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"J0640"
"00396924"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 54, patient RS06-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS06-1"
"00396925"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 55, patient RS05-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"RS05-1"
"00396926"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 56, patient MIYA020-1, proband"	"M"	""	"Japan"	""	"0"	""	""	""	"MIYA020-1"
"00396927"	""	""	""	"1"	""	"00000"	"{PMID:Kondo 2019:30652005}"	"Family 56, patient MIYA020-2, sibling"	"M"	""	"Japan"	""	"0"	""	""	""	"MIYA020-2"
"00397004"	""	""	""	"1"	""	"00000"	"{PMID:Selvan 2018:31238476}"	"proband"	"M"	""	"India"	""	"0"	""	""	""	"1"
"00397045"	""	""	""	"1"	""	"00000"	"{PMID:Smith 2020:32124668}"	"proband 1"	"M"	""	"United States"	""	"0"	""	""	"Guatemalan"	"1"
"00397046"	""	""	""	"1"	""	"00000"	"{PMID:Smith 2020:32124668}"	"proband 1\'s uncle"	"M"	""	"United States"	""	"0"	""	""	"Guatemalan"	"1"
"00397047"	""	""	""	"1"	""	"00000"	"{PMID:Smith 2020:32124668}"	"proband 2"	"M"	""	"United States"	""	"0"	""	""	"Guatemalan"	"1"
"00397048"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"1"
"00397049"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"2"
"00397050"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"3"
"00397051"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"4"
"00397052"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"5"
"00397053"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"6"
"00397054"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"7"
"00397055"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"8"
"00397056"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"9"
"00397057"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"10"
"00397058"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"11"
"00397059"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"12"
"00397060"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"13"
"00397061"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"14"
"00397062"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"15"
"00397063"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"16"
"00397064"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"17"
"00397065"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"18"
"00397066"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"19"
"00397067"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"20"
"00397068"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"21"
"00397069"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"22"
"00397070"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"23"
"00397071"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"24"
"00397072"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"25"
"00397073"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"26"
"00397074"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"27"
"00397075"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"28"
"00397076"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"29"
"00397077"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"30"
"00397078"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"31"
"00397079"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"32"
"00397080"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"33"
"00397081"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"34"
"00397082"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"35"
"00397083"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"36"
"00397084"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"37"
"00397085"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"38"
"00397086"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"39"
"00397087"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"40"
"00397088"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"41"
"00397089"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"42"
"00397090"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"43"
"00397091"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"44"
"00397092"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"45"
"00397093"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"46"
"00397094"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"47"
"00397095"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"48"
"00397096"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"49"
"00397097"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"50"
"00397098"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"51"
"00397099"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"52"
"00397100"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"53"
"00397101"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"54"
"00397102"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"55"
"00397103"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"56"
"00397104"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"57"
"00397105"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"58"
"00397106"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"59"
"00397107"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"60"
"00397108"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"61"
"00397109"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"62"
"00397110"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"63"
"00397111"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"64"
"00397112"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"65"
"00397113"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"66"
"00397114"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"67"
"00397115"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"68"
"00397116"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"69"
"00397117"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"70"
"00397118"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"71"
"00397119"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"72"
"00397120"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"73"
"00397121"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"74"
"00397122"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"75"
"00397123"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"76"
"00397124"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"77"
"00397125"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"78"
"00397126"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"79"
"00397127"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"80"
"00397128"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"81"
"00397129"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"82"
"00397130"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"83"
"00397131"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"84"
"00397132"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"85"
"00397133"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"86"
"00397134"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"87"
"00397135"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"88"
"00397136"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"89"
"00397137"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"90"
"00397138"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2020:32300273}"	"no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)"	"M"	""	"China"	""	"0"	""	""	""	"91"
"00408447"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 38"
"00408448"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 39"
"00408449"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 40"
"00408450"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 41"
"00408451"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 42"
"00408452"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 43"
"00408453"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 44"
"00408454"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 45"
"00408455"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"38-46 (12 patients in 9 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 46"
"00408456"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"47-51 (5 patients in 5 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 47"
"00408457"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"47-51 (5 patients in 5 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 48"
"00408458"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"47-51 (5 patients in 5 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 49"
"00408459"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"47-51 (5 patients in 5 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 50"
"00408460"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"47-51 (5 patients in 5 families)"	"?"	""	"Finland"	""	"0"	""	""	""	"Family 51"
"00408461"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"Family 52, invidivual a"	"?"	""	"Finland"	""	"0"	""	""	""	"52a"
"00408462"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	"Family 52, invidivual b"	"?"	""	"Finland"	""	"0"	""	""	""	"52b"
"00408463"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	""	"?"	""	"Finland"	""	"0"	""	""	""	"53"
"00411582"	""	""	""	"1"	""	"01741"	""	""	""	""	""	""	""	""	""	""	""
"00414485"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2018:30076350}"	""	"M"	""	"China"	""	"0"	""	""	""	"WHP152"
"00420446"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:33608557}"	""	""	""	"Taiwan"	""	"0"	""	""	""	"F087"
"00420521"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:33608557}"	""	""	""	"Taiwan"	""	"0"	""	""	""	"F210"
"00420525"	""	""	""	"1"	""	"00000"	"{PMID:Chen 2021:33608557}"	""	""	""	"Taiwan"	""	"0"	""	""	""	"F215"
"00426951"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 55, individual 64"	"M"	""	""	""	"0"	""	""	""	"55_64"
"00426952"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 55, individual 65"	"M"	""	""	""	"0"	""	""	""	"55_65"
"00426953"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 55, individual 66"	"M"	""	""	""	"0"	""	""	""	"55_66"
"00436599"	""	""	""	"1"	""	"04552"	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	"M"	"no"	"Mexico"	""	"0"	""	"NONE"	"Hispanic"	"2467881"
"00436600"	""	""	""	"1"	""	"04552"	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	"M"	"no"	"Mexico"	""	"0"	""	"NONE"	"Hispanic"	"2471473"
"00436601"	""	""	""	"1"	""	"04552"	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	"M"	"no"	"Mexico"	""	"0"	""	"NONE"	"Hispanic"	"3844330"
"00443697"	""	""	""	"1"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"1 patient (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443698"	""	""	""	"3"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"3 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443699"	""	""	""	"4"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"4 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443700"	""	""	""	"3"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"3 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443701"	""	""	""	"1"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"1 patient (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443702"	""	""	""	"1"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"1 patient (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443703"	""	""	""	"3"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"3 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443704"	""	""	""	"4"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"4 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443705"	""	""	""	"3"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"3 patients (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443706"	""	""	""	"1"	""	"00006"	"{PMID:Sergeev 2013:23847049}"	"1 patient (no ID in the paper)"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443849"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 4:9618178}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	""
"00443850"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Netherlands"	""	"0"	""	""	""	""
"00443851"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443852"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443853"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443854"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443855"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443856"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group W:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00443857"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group W:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00443858"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00443859"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 3:9618178}"	""	"?"	""	"United States"	""	"0"	""	""	""	""
"00443860"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00443861"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00443862"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group 6:9618178}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00443863"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998, group W:9618178}"	""	"?"	""	"(Germany)"	""	"0"	""	""	""	""
"00443864"	""	""	""	"1"	""	"00006"	"{PMID:RS-consortium 1998:9618178}"	""	"?"	""	"Germany"	""	"0"	""	""	""	""
"00447244"	""	""	""	"3"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 3 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-74"
"00447245"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-76"
"00447246"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-77"
"00447247"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-79"
"00447248"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-81"
"00447249"	""	""	""	"3"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 3 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-83"
"00447250"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-84"
"00447251"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-85"
"00447252"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-86"
"00447253"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-88"
"00447254"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-90"
"00447433"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"USHII-348"
"00447580"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 2 affected"	"M"	""	"Germany"	""	"0"	""	""	""	"SCHI-89"
"00451009"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"067173"
"00451010"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"070798"
"00451011"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"071523"
"00458573"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat1"
"00458574"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat2"
"00458575"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat3"
"00458576"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat4"
"00458577"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Latino"	"Pat5"
"00458578"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat6"
"00458579"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Africa-N"	"Pat7"
"00458580"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat8"
"00458581"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Africa-N"	"Pat9"
"00458582"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat10"
"00458583"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat11"
"00458584"	""	""	""	"2"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"family, patient and affected cousin (11y)"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat12"
"00458585"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat13"
"00458586"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Latino"	"Pat14"
"00458587"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat15"
"00458588"	""	""	""	"1"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, no family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat16"
"00458589"	""	""	""	"2"	""	"00006"	"{PMID:D\'Anna Mardero 2024:39648411}"	"patient, family history"	"M"	""	"Spain"	""	"0"	""	""	"Europe"	"Pat17"
"00458590"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat1"
"00458591"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat2"
"00458592"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat3"
"00458593"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat4"
"00458594"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat5"
"00458595"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat6"
"00458596"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat7A"
"00458597"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat7B"
"00458598"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat7C"
"00458599"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat8"
"00458600"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam9"
"00458601"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9A"
"00458602"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9B"
"00458603"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9C"
"00458604"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9D"
"00458605"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9E"
"00458606"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat9F"
"00458607"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat10"
"00458608"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat11"
"00458609"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat12"
"00458610"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat13"
"00458611"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat14"
"00458612"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat15"
"00458613"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat16"
"00458614"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat17"
"00458615"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam18"
"00458616"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat18A"
"00458617"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat18B"
"00458618"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat18C"
"00458619"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam19"
"00458620"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam20-1"
"00458621"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam20-2"
"00458622"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat20"
"00458623"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat21"
"00458624"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat22"
"00458625"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat23"
"00458626"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat24"
"00458627"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat25A"
"00458628"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat25B"
"00458629"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat25C"
"00458630"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat25D"
"00458631"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat25E"
"00458632"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat26A"
"00458633"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat26B"
"00458634"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat27"
"00458635"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat28"
"00458636"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam29"
"00458637"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat29A"
"00458638"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat29B"
"00458639"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat29C"
"00458640"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat29D"
"00458641"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat29E"
"00458642"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam30"
"00458643"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30A"
"00458644"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30B"
"00458645"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30C"
"00458646"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30D"
"00458647"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30E"
"00458648"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30F"
"00458649"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat30G"
"00458650"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat31"
"00458651"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam32"
"00458652"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat32B"
"00458653"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam33-1"
"00458654"	""	""	""	"2"	""	"00006"	"{PMID:Lee 2025:39293640}"	"family, 2 affected"	"M"	""	"Korea"	""	"0"	""	""	""	"Fam33-2"
"00458655"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat33A"
"00458656"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat33B"
"00458657"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat34"
"00458658"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat35A"
"00458659"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat35B"
"00458660"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat35C"
"00458661"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat35D"
"00458662"	""	""	""	"1"	""	"00006"	"{PMID:Lee 2025:39293640}"	"patient"	"M"	""	"Korea"	""	"0"	""	""	""	"Pat36"
"00458663"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat1"
"00458664"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"yes"	"India"	""	"0"	""	""	""	"Pat2"
"00458665"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat3"
"00458666"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat4"
"00458667"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat9"
"00458668"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat11"
"00458669"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat13"
"00458670"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"yes"	"India"	""	"0"	""	""	""	"Pat14"
"00458671"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat18"
"00458672"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat20"
"00458673"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"no"	"India"	""	"0"	""	""	""	"Pat21"
"00458674"	""	""	""	"1"	""	"00006"	"{PMID:Chowdury 2024:38317323}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	"yes"	"India"	""	"0"	""	""	""	"Pat22"
"00458675"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-01"
"00458676"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-02"
"00458677"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-03"
"00458678"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-04"
"00458679"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-05"
"00458680"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-06"
"00458681"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-07"
"00458682"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-08"
"00458683"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-09"
"00458684"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-10"
"00458685"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-11"
"00458686"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-12"
"00458687"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-13"
"00458688"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-14"
"00458689"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-15"
"00458690"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-16"
"00458691"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-17"
"00458692"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-18"
"00458693"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-19"
"00458694"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-20"
"00458695"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-21"
"00458696"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-22"
"00458697"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-23"
"00458698"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-24"
"00458699"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-25"
"00458700"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-26"
"00458701"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-27"
"00458702"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-28"
"00458703"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-29"
"00458704"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-30"
"00458705"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-31"
"00458706"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-32"
"00458707"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-33"
"00458708"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-34"
"00458709"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-35"
"00458710"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-36"
"00458711"	""	""	""	"1"	""	"00006"	"{PMID:Wei 2024:38324300}"	"patient"	"M"	""	"China"	""	"0"	""	""	""	"SRF-37"
"00458712"	""	""	""	"1"	""	"00006"	"{PMID:Azevedo 2024:38172268}"	""	"M"	""	"Brazil"	""	"0"	""	""	""	"patient"
"00458714"	""	""	""	"101"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"101 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var1"
"00458715"	""	""	""	"38"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"38 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var2"
"00458716"	""	""	""	"11"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"11 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var3"
"00458717"	""	""	""	"7"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"7 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var4"
"00458718"	""	""	""	"7"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"7 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var5"
"00458719"	""	""	""	"7"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"7 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var6"
"00458720"	""	""	""	"6"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"6 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var7"
"00458721"	""	""	""	"6"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"6 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var8"
"00458722"	""	""	""	"6"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"6 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var9"
"00458723"	""	""	""	"4"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"4 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var10"
"00458724"	""	""	""	"4"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"4 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var11"
"00458725"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var12"
"00458726"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var13"
"00458727"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var14"
"00458728"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var15"
"00458729"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var16"
"00458730"	""	""	""	"3"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"3 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var17"
"00458731"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var18"
"00458732"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var19"
"00458733"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var20"
"00458734"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var21"
"00458735"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var22"
"00458736"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var23"
"00458737"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var24"
"00458738"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var25"
"00458739"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var26"
"00458740"	""	""	""	"2"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"2 patients"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var27"
"00458741"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var28"
"00458742"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var29"
"00458743"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var30"
"00458744"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var31"
"00458745"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var32"
"00458746"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var33"
"00458747"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var34"
"00458748"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var35"
"00458749"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var36"
"00458750"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var37"
"00458751"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var38"
"00458752"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var39"
"00458753"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var40"
"00458754"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var41"
"00458755"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var42"
"00458756"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var43"
"00458757"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var44"
"00458758"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var45"
"00458759"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var46"
"00458760"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var47"
"00458761"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var48"
"00458762"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var49"
"00458763"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var50"
"00458764"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var51"
"00458765"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var52"
"00458766"	""	""	""	"1"	""	"00006"	"{PMID:Hahn 2022:34624300}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var53"
"00458767"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458768"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458769"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458770"	""	""	""	"2"	""	"00006"	"{PMID:Wey 2023:38020097}"	"family, 2 affected"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458771"	""	""	""	"2"	""	"00006"	"{PMID:Wey 2023:38020097}"	"family, 2 affected"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458772"	""	""	""	"2"	""	"00006"	"{PMID:Wey 2023:38020097}"	"family, 2 affected"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458773"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458774"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458775"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458776"	""	""	""	"2"	""	"00006"	"{PMID:Wey 2023:38020097}"	"family, 2 affected"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458777"	""	""	""	"2"	""	"00006"	"{PMID:Wey 2023:38020097}"	"family, 2 affected"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458778"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"United States"	""	"0"	""	""	""	""
"00458779"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	""
"00458780"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	""
"00458781"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var15"
"00458782"	""	""	""	"1"	""	"00006"	"{PMID:Wey 2023:38020097}"	"patient"	"M"	""	"(Belgium);(Netherlands)"	""	"0"	""	""	""	"Var16"
"00458783"	""	""	""	"3"	""	"00006"	"{PMID:Waibel 2022:Waibel}"	"family, 3 affected, unaffected carrier females"	"M"	""	"Germany"	""	"0"	""	""	""	"family"
"00458784"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam1Pat1"
"00458785"	""	""	"00458784"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam1Pat2"
"00458786"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam2Pat3"
"00458787"	""	""	"00458786"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam2Pat4"
"00458788"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam3Pat5"
"00458789"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam4Pat6"
"00458790"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam5Pat7"
"00458791"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam6Pat8"
"00458792"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam7Pat9"
"00458793"	""	""	"00458792"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam7Pat10"
"00458794"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam8Pat11"
"00458795"	""	""	"00458794"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam8Pat12"
"00458796"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam9Pat13"
"00458797"	""	""	"00458796"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam9Pat14"
"00458798"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam10Pat15"
"00458799"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam11Pat16"
"00458800"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam12Pat17"
"00458801"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam13Pat18"
"00458802"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam14Pat19"
"00458803"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam15Pat20"
"00458804"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam16Pat21"
"00458805"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam17Pat22"
"00458806"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam18Pat23"
"00458807"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam19Pat24"
"00458808"	""	""	""	"2"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"patient"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam20Pat25"
"00458809"	""	""	"00458808"	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"family, 2 affected"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam20Pat26"
"00458810"	""	""	""	"1"	""	"00006"	"{PMID:Fortunato 2023:36377647}"	"relative"	"M"	""	"Italy"	""	"0"	""	""	""	"Fam21Pat27"
"00458811"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat1"
"00458812"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat2"
"00458813"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat3"
"00458814"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat4"
"00458815"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat5"
"00458816"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat6"
"00458817"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat7"
"00458818"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat8"
"00458819"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat9"
"00458820"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat10"
"00458821"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat11"
"00458822"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat12"
"00458823"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat13"
"00458824"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat14"
"00458825"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat15"
"00458826"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat16"
"00458827"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat17"
"00458828"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat18"
"00458829"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat19"
"00458830"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat20"
"00458831"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat21"
"00458832"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat22"
"00458833"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat23"
"00458834"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat24"
"00458835"	""	""	""	"1"	""	"00006"	"{PMID:Cetin 2022:34865595}"	"patient"	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat25"
"00458838"	""	""	""	"2"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"3-generation family, 2 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam1PatIII1"
"00458839"	""	""	"00458838"	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"cousin"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam1PatIII2"
"00458840"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam2PatII1"
"00458841"	""	""	""	"2"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"3-generation family, 2 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam3PatIII2"
"00458842"	""	""	"00458841"	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"uncle"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam3PatII4"
"00458843"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam4PatII1"
"00458844"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam5PatII1"
"00458845"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam6PatII1"
"00458846"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam7PatII1"
"00458847"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam8PatII1"
"00458848"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam9PatII1"
"00458849"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam10PatII1"
"00458850"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam11PatII1"
"00458851"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam12PatII1"
"00458852"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam13PatII1"
"00458853"	""	""	""	"3"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"4-generation family, 3 affected (3M)"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam14PatIII3"
"00458854"	""	""	"00458853"	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"cousin"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam14PatIII6"
"00458855"	""	""	"00458853"	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"relative"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam14PatIV1"
"00458856"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam15PatII1"
"00458857"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam16PatII1"
"00458858"	""	""	""	"1"	""	"00006"	"{PMID:Kousal 2021:34828422}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Fam17PatII1"
"00458859"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458860"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458861"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458862"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458863"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458864"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458865"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458866"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458867"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458868"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458869"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458870"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458871"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458872"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458873"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458874"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458875"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458876"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458877"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458878"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458879"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 2 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458880"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458881"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458882"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458883"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458884"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458885"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458886"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458887"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458888"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458889"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458890"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458891"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458892"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458893"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458894"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458895"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458896"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458897"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458898"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458899"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458900"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458901"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, several affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458902"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, several affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458903"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, several affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458904"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, several affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458905"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458906"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458907"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458908"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458909"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458910"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458911"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458912"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458913"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458914"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458915"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458916"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458917"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458918"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458919"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458920"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458921"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458922"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458923"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458924"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458925"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458926"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458927"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458928"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458929"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458930"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458931"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458932"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458933"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458934"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458935"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458936"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458937"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458938"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458939"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458940"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458941"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458942"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458943"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458944"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458945"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458946"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458947"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458948"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458949"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458950"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458951"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458952"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458953"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458954"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458955"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458956"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458957"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458958"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458959"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458960"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458961"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458962"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458963"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458964"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458965"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458966"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458967"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458968"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458969"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458970"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458971"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458972"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458973"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458974"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458975"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458976"	""	""	""	"1"	""	"00006"	"{PMID:Georgiou 2022:34822951}"	"patient"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00458977"	""	""	""	"2"	""	"00006"	"{PMID:Chatterjee 2023:37317958}"	"2-generation family, 2 affected brothers, unaffected carrier mother"	"M"	""	"India"	""	"0"	""	""	""	"FamAPatII1"
"00458978"	""	""	"00458977"	"1"	""	"00006"	"{PMID:Chatterjee 2023:37317958}"	"brother"	"M"	""	"India"	""	"0"	""	""	""	"FamAPatII2"
"00458979"	""	""	""	"1"	""	"00006"	"{PMID:Chatterjee 2023:37317958}"	"3-generation family, 1 affected, unaffected carrier mother"	"M"	""	"India"	""	"0"	""	""	""	"FamBPatII1"
"00458980"	""	""	""	"4"	""	"00006"	"{PMID:Carta 2023:36314434}"	"4-generation family, 4 affected (4M), 5 unaffected carrier females"	"M"	""	"Italy"	""	"0"	""	""	""	"family"
"00458981"	""	""	""	"2"	""	"00006"	"{PMID:Kirkby 2023:37372373}"	"2-generation family, 1 affected girl and father"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"family"
"00458982"	""	""	"00087438"	"1"	""	"00006"	"{PMID:Saldana 2007:17304551}"	"affected daughter"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"patient"
"00458984"	""	""	""	"1"	""	"00006"	"PMID:Lesch 2008:19093009}"	"3-generation family, 2 affected, 3 unaffected carrier females"	"M"	""	"Hungary"	""	"0"	""	""	""	"Fam6"
"00458985"	""	""	""	"6"	""	"00006"	"{PMID:Staffieri 2015:25894957}"	"4-generation family, 4 affected males, 2 affected females, 6 unaffected carrier females"	"M"	""	"Australia"	""	"0"	""	""	"Europe-E;white"	"FamPat1"
"00458986"	""	""	"00458985"	"1"	""	"00006"	"{PMID:Staffieri 2015:25894957}"	"nephew"	"M"	""	"Australia"	""	"0"	""	""	"Europe-E;white"	"FamPat12"
"00458987"	""	""	"00458985"	"1"	""	"00006"	"{PMID:Staffieri 2015:25894957}"	"daughter"	"F"	""	"Australia"	""	"0"	""	""	"Europe-E;white"	"FamPat3"
"00458988"	""	""	"00458985"	"1"	""	"00006"	"{PMID:Staffieri 2015:25894957}"	"daughter"	"F"	""	"Australia"	""	"0"	""	""	"Europe-E;white"	"FamPat4"
"00458990"	""	""	"00458989"	"1"	""	"00006"	"{PMID:Khan 2019:30608181}"	"younger brother"	"M"	""	"United Arab Emirates"	""	"0"	""	""	""	"FamPatII3"
"00458991"	""	""	"00458989"	"1"	""	"00006"	"{PMID:Khan 2019:30608181}"	"older sister"	"F"	""	"United Arab Emirates"	""	"0"	""	""	""	"FamPatII1"
"00458992"	""	""	""	"1"	""	"00006"	"{PMID:Li 2023:37069516}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"patient"
"00458993"	""	""	""	"1"	""	"00006"	"{PMID:Tondelli 2022:36695495}"	""	"M"	""	"Brazil"	""	"0"	""	""	""	"patient"
"00458994"	""	""	""	"1"	""	"00006"	"{PMID:Pineda-Garrido 2022:36341910}"	"adopted"	"F"	""	"China"	""	"0"	""	""	""	"patient"
"00458999"	""	""	""	"1"	""	"00006"	"{PMID:Jimenez 2022:36362148}"	""	"M"	""	"United States"	""	"0"	""	""	""	"Pat5"
"00459000"	""	""	""	"1"	""	"00006"	"{PMID:Jimenez 2022:36362148}, {PMID:Wen 2023:36811936}"	""	"M"	""	"United States"	""	"0"	""	""	""	"Pat6;MEP_372"
"00459016"	""	""	""	"3"	""	"00006"	"{PMID:Wang 2022:36212125}"	"3-generation family, 3 affected (uncle/twin brothers), 2 carrier females"	"M"	""	"China"	""	"0"	""	""	""	"family"
"00459017"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var1.1"
"00459018"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var1.2"
"00459019"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var1.3"
"00459020"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var2.1"
"00459021"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var2.2"
"00459022"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var3.1"
"00459023"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var3.2"
"00459024"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var3.3"
"00459025"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var3.4"
"00459026"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var4"
"00459027"	""	""	""	"5"	""	"00006"	"{PMID:Bender 2022:35456481}"	"5-generation family, 5 affected, 9 unaffected carrier females"	"M"	""	""	""	"0"	""	""	""	"Var6-FamK175"
"00459028"	""	""	""	"2"	""	"00006"	"{PMID:Bender 2022:35456481}"	"3-generation family, 2 affected, 2 unaffected carrier females"	"M"	""	""	""	"0"	""	""	""	"Var6-FamK205"
"00459029"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var7"
"00459030"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var8"
"00459031"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var9.1"
"00459032"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var9.2"
"00459033"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var10"
"00459034"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var11.1"
"00459035"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var11.2"
"00459036"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var12"
"00459037"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var13.1"
"00459038"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var13.2"
"00459039"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var14"
"00459040"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var15.1"
"00459041"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var15.2"
"00459042"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var16"
"00459043"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var17"
"00459044"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var18"
"00459045"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var19"
"00459046"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var20"
"00459047"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var21"
"00459048"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.1"
"00459049"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.2"
"00459050"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.3"
"00459051"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.4"
"00459052"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.5"
"00459053"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.6"
"00459054"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.7"
"00459055"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.8"
"00459056"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.9"
"00459057"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.10"
"00459058"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.11"
"00459059"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.12"
"00459060"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.13"
"00459061"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.14"
"00459062"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.15"
"00459063"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.16"
"00459064"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var22.17"
"00459065"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var23.1"
"00459066"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var23.2"
"00459067"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var23.3"
"00459068"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var23.4"
"00459069"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.1"
"00459070"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.2"
"00459071"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.3"
"00459072"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.4"
"00459073"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.5"
"00459074"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.6"
"00459075"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.7"
"00459076"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.8"
"00459077"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.9"
"00459078"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.10"
"00459079"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.11"
"00459080"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.12"
"00459081"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.13"
"00459082"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.14"
"00459083"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.15"
"00459084"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.16"
"00459085"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.17"
"00459086"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.18"
"00459087"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.19"
"00459088"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.20"
"00459089"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.21"
"00459090"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.22"
"00459091"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.23"
"00459092"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.24"
"00459093"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.25"
"00459094"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.26"
"00459095"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.27"
"00459096"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.28"
"00459097"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.29"
"00459098"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.30"
"00459099"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var24.31"
"00459100"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var25.1"
"00459101"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var25.2"
"00459102"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var26"
"00459103"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var27.1"
"00459104"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var27.2"
"00459105"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var27.3"
"00459106"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var28"
"00459107"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var29"
"00459108"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var30"
"00459109"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var31.1"
"00459110"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var31.2"
"00459111"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var32.1"
"00459112"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var32.2"
"00459113"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var32.3"
"00459114"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var32.4"
"00459115"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var32.5"
"00459116"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var33"
"00459117"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var34.1"
"00459118"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var34.2"
"00459119"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.1"
"00459120"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.2"
"00459121"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.3"
"00459122"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.4"
"00459123"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.5"
"00459124"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.6"
"00459125"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var35.7"
"00459126"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.1"
"00459127"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.2"
"00459128"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.3"
"00459129"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.4"
"00459130"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.5"
"00459131"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.6"
"00459132"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.7"
"00459133"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.8"
"00459134"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.9"
"00459135"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.10"
"00459136"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.11"
"00459137"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.12"
"00459138"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.13"
"00459139"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.14"
"00459140"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.15"
"00459141"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.16"
"00459142"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.17"
"00459143"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.18"
"00459144"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.19"
"00459145"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var36.20"
"00459146"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var37"
"00459147"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var38"
"00459148"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.1"
"00459149"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.2"
"00459150"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.3"
"00459151"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.4"
"00459152"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.5"
"00459153"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.6"
"00459154"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.7"
"00459155"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.8"
"00459156"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.9"
"00459157"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.10"
"00459158"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.11"
"00459159"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.12"
"00459160"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.13"
"00459161"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.14"
"00459162"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var39.15"
"00459163"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.1"
"00459164"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.2"
"00459165"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.3"
"00459166"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.4"
"00459167"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.5"
"00459168"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.6"
"00459169"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.7"
"00459170"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.8"
"00459171"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.9"
"00459172"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.10"
"00459173"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.11"
"00459174"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.12"
"00459175"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.13"
"00459176"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.14"
"00459177"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var40.15"
"00459178"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var41"
"00459179"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var42"
"00459180"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var43"
"00459181"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var44.1"
"00459182"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var44.2"
"00459183"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var44.3"
"00459184"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var44.4"
"00459185"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var45"
"00459186"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var46"
"00459187"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var47.1"
"00459188"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var47.2"
"00459189"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var48"
"00459190"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var49"
"00459191"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var50"
"00459192"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var51.1"
"00459193"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var51.2"
"00459194"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var52"
"00459195"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var53.1"
"00459196"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var53.2"
"00459197"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var53.3"
"00459198"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var54.1"
"00459199"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var54.2"
"00459200"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var54.3"
"00459201"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var54.4"
"00459202"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var55.1"
"00459203"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var55.2"
"00459204"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var56"
"00459205"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var57.1"
"00459206"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var57.2"
"00459207"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var57.3"
"00459208"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var58"
"00459209"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var59.1"
"00459210"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var59.2"
"00459211"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var59.3"
"00459212"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var60.1"
"00459213"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var60.2"
"00459214"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var60.3"
"00459215"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var60.4"
"00459216"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var60.5"
"00459217"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.1"
"00459218"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.2"
"00459219"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.3"
"00459220"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.4"
"00459221"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.5"
"00459222"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var61.6"
"00459223"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var62.1"
"00459224"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var62.2"
"00459225"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var63"
"00459226"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var64.1"
"00459227"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var64.2"
"00459228"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var65"
"00459229"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var66"
"00459230"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var67"
"00459231"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var68"
"00459232"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var69"
"00459233"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var70"
"00459234"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var71.1"
"00459235"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var71.2"
"00459236"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var71.3"
"00459237"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var72"
"00459238"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.1"
"00459239"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.2"
"00459240"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.3"
"00459241"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.4"
"00459242"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.5"
"00459243"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.6"
"00459244"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var73.7"
"00459245"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var74"
"00459246"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var75"
"00459247"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var76"
"00459248"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var77"
"00459249"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.1"
"00459250"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.2"
"00459251"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.3"
"00459252"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.4"
"00459253"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.5"
"00459254"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.6"
"00459255"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.7"
"00459256"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.8"
"00459257"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.9"
"00459258"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var78.10"
"00459259"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var79"
"00459260"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var80"
"00459261"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var81"
"00459262"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var82.1"
"00459263"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var82.2"
"00459264"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var82.3"
"00459265"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var83.1"
"00459266"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var83.2"
"00459267"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var83.3"
"00459268"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var84.1"
"00459269"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var84.2"
"00459270"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var84.3"
"00459271"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var84.4"
"00459272"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var85"
"00459273"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var86"
"00459274"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var87.1"
"00459275"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var87.2"
"00459276"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var87.3"
"00459277"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var87.4"
"00459278"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var87.5"
"00459279"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.1"
"00459280"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.2"
"00459281"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.3"
"00459282"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.4"
"00459283"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.5"
"00459284"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.6"
"00459285"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.7"
"00459286"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.8"
"00459287"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.9"
"00459288"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.10"
"00459289"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.11"
"00459290"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.12"
"00459291"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.13"
"00459292"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var88.14"
"00459293"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var89.1"
"00459294"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var89.2"
"00459295"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var89.3"
"00459296"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.1"
"00459297"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.2"
"00459298"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.3"
"00459299"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.4"
"00459300"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.5"
"00459301"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.6"
"00459302"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var90.7"
"00459303"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var91.1"
"00459304"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var91.2"
"00459305"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var92.1"
"00459306"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var92.2"
"00459307"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var92.3"
"00459308"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var92.4"
"00459309"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var93"
"00459310"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var94"
"00459311"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var95"
"00459312"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var96"
"00459313"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var97"
"00459314"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var98.1"
"00459315"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var98.2"
"00459316"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var98.3"
"00459317"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var98.4"
"00459318"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var98.5"
"00459319"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var99.1"
"00459320"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var99.2"
"00459321"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var99.3"
"00459322"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var100.1"
"00459323"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var100.2"
"00459324"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var101"
"00459325"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var102"
"00459326"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var103"
"00459327"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var104.1"
"00459328"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var104.2"
"00459329"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var104.3"
"00459330"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.1"
"00459331"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.2"
"00459332"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.3"
"00459333"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.4"
"00459334"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.5"
"00459335"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.6"
"00459336"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.7"
"00459337"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.8"
"00459338"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.9"
"00459339"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.10"
"00459340"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.11"
"00459341"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.12"
"00459342"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.13"
"00459343"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.14"
"00459344"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var105.15"
"00459345"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var106.1"
"00459346"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var106.2"
"00459347"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var106.3"
"00459348"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var106.4"
"00459349"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var107"
"00459350"	""	""	""	"1"	""	"00006"	"{PMID:Bender 2022:35456481}"	"proband"	"M"	""	""	""	"0"	""	""	""	"Var108"
"00459351"	""	""	""	"2"	""	"00006"	"{PMID:Luo 2022:35446970}"	"family, several affected males/unaffected carrier females"	"M"	""	"China"	""	"0"	""	""	""	"family"
"00459353"	""	""	""	"4"	""	"00006"	"{PMID:Chen 2021:34675999}"	"3-generation family, 4 affected (grandfather/4 boys), 4 unaffected carrier females"	"M"	""	"China"	""	"0"	""	""	""	"FamPatIII6"
"00459354"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459355"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459356"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459357"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459358"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459359"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459360"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459361"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459362"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459363"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459364"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459365"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459366"	""	""	""	"1"	""	"00006"	"{PMID:Thorsteinsson 2021:33851411}"	"patient"	"M"	""	"Iceland"	""	"0"	""	""	""	""
"00459371"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam1"
"00459372"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam2"
"00459373"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam8"
"00459374"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam6"
"00459375"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam7"
"00459376"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam9"
"00459377"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam10"
"00459378"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam11"
"00459379"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam12"
"00459380"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam19"
"00459381"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam14"
"00459382"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam15"
"00459383"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam16"
"00459384"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam27"
"00459385"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam17"
"00459386"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam20"
"00459387"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam21"
"00459388"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam22"
"00459389"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"2-generation family, 1 affected, unaffected non-carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam24"
"00459390"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam28"
"00459391"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam29"
"00459392"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam18"
"00459393"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam30"
"00459394"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam26"
"00459395"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam3"
"00459396"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam4"
"00459397"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam5"
"00459398"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam25"
"00459399"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam13"
"00459400"	""	""	""	"1"	""	"00006"	"{PMID:Gao 2021:33124204}"	"family, unaffected carrier mother"	"M"	""	"China"	""	"0"	""	""	""	"Fam23"
"00459404"	""	""	""	"2"	""	"00006"	"{PMID:Hiraoka 2001:11281412}, {PMID:Shastry 2010:21472264}"	"5-generation family, 2 affected (grandfather/grandson), unaffected carrier mother"	"M"	""	"United States"	""	"0"	""	""	""	"Fam1PatII4/IV1"
"00459405"	""	""	""	"3"	""	"00006"	"{PMID:Shastry 2010:21472264}"	"4-generation family, 3 affected (2 brothers/great-grandfsther, unaffected carrier mother"	"M"	""	"United States"	""	"0"	""	""	""	"Fam2PatI1/IV1/IV2"
"00459425"	""	""	""	"1"	""	"00006"	"{PMID:Lamey 2010:20238027}"	"2-generation family, 1 affected"	"M"	""	"Australia"	""	"0"	""	""	""	"Fam2"
"00459543"	""	""	""	"1"	""	"00006"	"{PMID:Pradhan 2009:19788668}"	"2-generation family, 1 affected, unaffected carrier mother"	"M"	""	"New Zealand"	""	"0"	""	""	""	"Pat1"
"00461084"	""	""	""	"1"	""	"00006"	"{PMID:Midgley 2024:39676705}"	""	"M"	""	"South Africa"	""	"0"	""	""	"Africa-indigenous"	"Pat19"
"00461090"	""	""	""	"1"	""	"00006"	"{PMID:Midgley 2024:39676705}"	""	"M"	""	"South Africa"	""	"0"	""	""	"white"	"Pat25"
"00461099"	""	""	""	"1"	""	"00006"	"{PMID:Midgley 2024:39676705}"	""	"M"	""	"South Africa"	""	"0"	""	""	"white"	"Pat34"
"00461134"	""	""	""	"1"	""	"00006"	"{PMID:Midgley 2024:39676705}"	""	"M"	""	"South Africa"	""	"0"	""	""	"Africa-indigenous"	"Pat69"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 2168
"{{individualid}}"	"{{diseaseid}}"
"00000208"	"01157"
"00000209"	"01157"
"00004010"	"00254"
"00004374"	"00308"
"00009921"	"00318"
"00009922"	"00318"
"00009923"	"00318"
"00009924"	"00318"
"00009933"	"00318"
"00009934"	"00318"
"00009935"	"00318"
"00009936"	"00318"
"00009937"	"00318"
"00009940"	"00318"
"00009941"	"00318"
"00009949"	"00318"
"00009955"	"00318"
"00009960"	"00318"
"00009961"	"00318"
"00009962"	"00318"
"00087257"	"02262"
"00087258"	"02262"
"00087259"	"02262"
"00087260"	"02262"
"00087261"	"02262"
"00087262"	"02262"
"00087263"	"02262"
"00087264"	"02262"
"00087265"	"02262"
"00087266"	"02262"
"00087267"	"02262"
"00087268"	"02262"
"00087269"	"02262"
"00087270"	"02262"
"00087271"	"02262"
"00087272"	"02262"
"00087273"	"02262"
"00087274"	"02262"
"00087275"	"02262"
"00087276"	"02262"
"00087277"	"02262"
"00087278"	"02262"
"00087279"	"02262"
"00087280"	"02262"
"00087281"	"02262"
"00087282"	"02262"
"00087283"	"02262"
"00087284"	"02262"
"00087285"	"02262"
"00087286"	"02262"
"00087287"	"02262"
"00087288"	"02262"
"00087289"	"02262"
"00087290"	"02262"
"00087291"	"02262"
"00087292"	"02262"
"00087293"	"02262"
"00087294"	"02262"
"00087295"	"02262"
"00087296"	"02262"
"00087297"	"02262"
"00087298"	"02262"
"00087299"	"02262"
"00087300"	"02262"
"00087301"	"02262"
"00087302"	"02262"
"00087303"	"02262"
"00087304"	"02262"
"00087305"	"02262"
"00087306"	"02262"
"00087307"	"02262"
"00087308"	"02262"
"00087309"	"02262"
"00087310"	"02262"
"00087311"	"02262"
"00087312"	"02262"
"00087313"	"02262"
"00087314"	"02262"
"00087315"	"02262"
"00087316"	"02262"
"00087317"	"02262"
"00087318"	"02262"
"00087319"	"02262"
"00087320"	"02262"
"00087321"	"02262"
"00087322"	"02262"
"00087323"	"02262"
"00087324"	"02262"
"00087325"	"02262"
"00087326"	"02262"
"00087327"	"02262"
"00087328"	"02262"
"00087329"	"02262"
"00087330"	"02262"
"00087331"	"02262"
"00087332"	"02262"
"00087333"	"02262"
"00087334"	"02262"
"00087335"	"02262"
"00087336"	"02262"
"00087337"	"02262"
"00087338"	"02262"
"00087339"	"02262"
"00087340"	"02262"
"00087341"	"02262"
"00087342"	"02262"
"00087343"	"02262"
"00087344"	"02262"
"00087345"	"02262"
"00087346"	"02262"
"00087347"	"02262"
"00087348"	"02262"
"00087349"	"02262"
"00087350"	"02262"
"00087351"	"02262"
"00087352"	"02262"
"00087353"	"02262"
"00087354"	"02262"
"00087355"	"02262"
"00087356"	"02262"
"00087357"	"02262"
"00087358"	"02262"
"00087359"	"02262"
"00087360"	"02262"
"00087361"	"02262"
"00087362"	"02262"
"00087363"	"02262"
"00087364"	"02262"
"00087365"	"02262"
"00087366"	"02262"
"00087367"	"02262"
"00087368"	"02262"
"00087369"	"02262"
"00087370"	"02262"
"00087371"	"02262"
"00087372"	"02262"
"00087373"	"02262"
"00087374"	"02262"
"00087375"	"02262"
"00087376"	"02262"
"00087377"	"02262"
"00087378"	"02262"
"00087379"	"02262"
"00087380"	"02262"
"00087381"	"02262"
"00087382"	"02262"
"00087383"	"02262"
"00087384"	"02262"
"00087385"	"02262"
"00087386"	"02262"
"00087387"	"02262"
"00087388"	"02262"
"00087389"	"02262"
"00087390"	"02262"
"00087391"	"02262"
"00087392"	"02262"
"00087393"	"02262"
"00087394"	"02262"
"00087395"	"02262"
"00087396"	"02262"
"00087397"	"02262"
"00087398"	"02262"
"00087399"	"02262"
"00087400"	"02262"
"00087401"	"02262"
"00087402"	"02262"
"00087403"	"02262"
"00087404"	"02262"
"00087405"	"02262"
"00087406"	"02262"
"00087407"	"02262"
"00087408"	"02262"
"00087409"	"02262"
"00087410"	"02262"
"00087411"	"02262"
"00087412"	"02262"
"00087413"	"02262"
"00087414"	"02262"
"00087415"	"02262"
"00087416"	"02262"
"00087417"	"02262"
"00087418"	"02262"
"00087419"	"02262"
"00087420"	"02262"
"00087421"	"02262"
"00087422"	"02262"
"00087423"	"02262"
"00087424"	"02262"
"00087425"	"02262"
"00087426"	"02262"
"00087427"	"02262"
"00087428"	"02262"
"00087429"	"02262"
"00087430"	"02262"
"00087431"	"02262"
"00087432"	"02262"
"00087433"	"02262"
"00087434"	"02262"
"00087435"	"02262"
"00087436"	"02262"
"00087437"	"02262"
"00087438"	"02262"
"00087439"	"02262"
"00087440"	"02262"
"00087441"	"02262"
"00087442"	"02262"
"00087443"	"02262"
"00087444"	"02262"
"00087445"	"02262"
"00087446"	"02262"
"00087447"	"02262"
"00087450"	"02262"
"00087451"	"02262"
"00087452"	"02262"
"00087453"	"02262"
"00087454"	"02262"
"00087455"	"02262"
"00087456"	"02262"
"00087457"	"02262"
"00087458"	"02262"
"00087459"	"02262"
"00087460"	"02262"
"00087461"	"02262"
"00087462"	"02262"
"00087463"	"02262"
"00087464"	"02262"
"00087465"	"02262"
"00087466"	"02262"
"00087467"	"02262"
"00087468"	"02262"
"00087469"	"02262"
"00087470"	"02262"
"00087471"	"02262"
"00087472"	"02262"
"00087473"	"02262"
"00087474"	"02262"
"00087475"	"02262"
"00087476"	"02262"
"00087477"	"02262"
"00087478"	"02262"
"00087479"	"02262"
"00087480"	"02262"
"00087481"	"02262"
"00087483"	"02262"
"00087484"	"02262"
"00087485"	"02262"
"00087486"	"02262"
"00087487"	"02262"
"00087488"	"02262"
"00087489"	"02262"
"00087490"	"02262"
"00087491"	"02262"
"00087493"	"02262"
"00087494"	"02262"
"00087495"	"02262"
"00087496"	"02262"
"00087497"	"02262"
"00087498"	"02262"
"00087499"	"02262"
"00087500"	"02262"
"00087501"	"02262"
"00087502"	"02262"
"00087503"	"02262"
"00087504"	"02262"
"00087505"	"02262"
"00087506"	"02262"
"00087507"	"02262"
"00087508"	"02262"
"00087509"	"02262"
"00087510"	"02262"
"00087511"	"02262"
"00087512"	"02262"
"00087513"	"02262"
"00087514"	"02262"
"00087515"	"02262"
"00087516"	"02262"
"00087517"	"02262"
"00087518"	"02262"
"00087519"	"02262"
"00087520"	"02262"
"00087521"	"02262"
"00087522"	"02262"
"00087523"	"02262"
"00087524"	"02262"
"00087525"	"02262"
"00087526"	"02262"
"00087527"	"02262"
"00087528"	"02262"
"00087529"	"02262"
"00087530"	"00198"
"00087531"	"02262"
"00087532"	"02262"
"00087533"	"02262"
"00087534"	"02262"
"00087535"	"02262"
"00087536"	"02262"
"00087537"	"02262"
"00087538"	"02262"
"00087539"	"02262"
"00087540"	"02262"
"00087541"	"02262"
"00087542"	"02262"
"00087543"	"02262"
"00087544"	"02262"
"00087545"	"02262"
"00087546"	"02262"
"00087547"	"02262"
"00087548"	"02262"
"00087549"	"02262"
"00087550"	"02262"
"00087551"	"02262"
"00087552"	"02262"
"00087553"	"04214"
"00087554"	"02262"
"00087555"	"02262"
"00087556"	"02262"
"00087557"	"02262"
"00087558"	"02262"
"00087559"	"02262"
"00087560"	"02262"
"00087561"	"02262"
"00087562"	"02262"
"00087563"	"02262"
"00087564"	"02262"
"00087565"	"02262"
"00087566"	"02262"
"00087567"	"02262"
"00087568"	"02262"
"00087569"	"02262"
"00087570"	"02262"
"00087571"	"02262"
"00087572"	"02262"
"00087573"	"02262"
"00087574"	"02262"
"00087575"	"02262"
"00087576"	"02262"
"00087577"	"02262"
"00087578"	"02262"
"00087579"	"02262"
"00087580"	"02262"
"00087581"	"02262"
"00087582"	"02262"
"00087583"	"02262"
"00087584"	"02262"
"00087585"	"02262"
"00087586"	"02262"
"00087587"	"02262"
"00087588"	"02262"
"00087589"	"02262"
"00087590"	"02262"
"00087591"	"02262"
"00087592"	"02262"
"00087593"	"02262"
"00087594"	"02262"
"00087595"	"02262"
"00087596"	"02262"
"00087597"	"02262"
"00087598"	"02262"
"00087599"	"04249"
"00087600"	"02262"
"00087601"	"02262"
"00087602"	"02262"
"00087603"	"02262"
"00087604"	"02262"
"00087605"	"02262"
"00087606"	"02262"
"00087607"	"02262"
"00087608"	"02262"
"00087609"	"02262"
"00087610"	"02262"
"00087611"	"02262"
"00087612"	"02262"
"00087613"	"02262"
"00087614"	"02262"
"00087615"	"02262"
"00087616"	"02262"
"00087617"	"02262"
"00087618"	"02262"
"00087619"	"02262"
"00087620"	"02262"
"00087621"	"02262"
"00087622"	"02262"
"00087623"	"02262"
"00087624"	"02262"
"00087625"	"02262"
"00087626"	"02262"
"00087627"	"02262"
"00087628"	"02262"
"00087629"	"02262"
"00087630"	"02262"
"00087631"	"02262"
"00087632"	"02262"
"00087633"	"02262"
"00087634"	"02262"
"00087635"	"02262"
"00087636"	"02262"
"00087637"	"02262"
"00087638"	"02262"
"00087639"	"02262"
"00087640"	"02262"
"00087641"	"02262"
"00087642"	"02262"
"00087643"	"02262"
"00087644"	"02262"
"00087645"	"02262"
"00087646"	"02262"
"00087647"	"02262"
"00087648"	"02262"
"00087649"	"02262"
"00087650"	"02262"
"00087651"	"02262"
"00087652"	"02262"
"00087653"	"02262"
"00087654"	"02262"
"00087655"	"02262"
"00087656"	"02262"
"00087657"	"02262"
"00087658"	"02262"
"00087659"	"02262"
"00087660"	"02262"
"00087661"	"02262"
"00087662"	"02262"
"00087663"	"02262"
"00087664"	"02262"
"00087665"	"02262"
"00087666"	"02262"
"00087667"	"02262"
"00087668"	"02262"
"00087669"	"02262"
"00087670"	"02262"
"00087671"	"02262"
"00087672"	"02262"
"00087673"	"02262"
"00087674"	"02262"
"00087675"	"02262"
"00087676"	"02262"
"00087677"	"02262"
"00087678"	"02262"
"00087679"	"02262"
"00087680"	"02262"
"00087681"	"02262"
"00087682"	"02262"
"00087683"	"02262"
"00087684"	"02262"
"00087685"	"02262"
"00087686"	"02262"
"00087687"	"02262"
"00087688"	"02262"
"00087689"	"02262"
"00087690"	"02262"
"00087691"	"02262"
"00087692"	"02262"
"00087693"	"02262"
"00087694"	"02262"
"00087695"	"02262"
"00087696"	"02262"
"00087697"	"02262"
"00087698"	"02262"
"00087699"	"02262"
"00087701"	"02262"
"00087702"	"02262"
"00087703"	"02262"
"00087704"	"02262"
"00087705"	"02262"
"00087707"	"02262"
"00087708"	"02262"
"00087709"	"02262"
"00087710"	"02262"
"00087711"	"02262"
"00087712"	"02262"
"00087713"	"02262"
"00087714"	"02262"
"00087715"	"02262"
"00087716"	"02262"
"00087717"	"02262"
"00087718"	"02262"
"00087719"	"02262"
"00087720"	"02262"
"00087721"	"02262"
"00087722"	"02262"
"00087723"	"02262"
"00087724"	"02262"
"00087725"	"02262"
"00087726"	"02262"
"00087727"	"02262"
"00087728"	"02262"
"00087729"	"02262"
"00087730"	"02262"
"00087731"	"02262"
"00087732"	"02262"
"00087733"	"02262"
"00087734"	"02262"
"00087735"	"02262"
"00087736"	"02262"
"00087737"	"02262"
"00087738"	"02262"
"00087739"	"02262"
"00087740"	"02262"
"00087741"	"02262"
"00087742"	"02262"
"00087743"	"02262"
"00087744"	"02262"
"00087745"	"02262"
"00087746"	"00198"
"00087747"	"02262"
"00087748"	"02262"
"00087749"	"00198"
"00087750"	"00187"
"00087751"	"02262"
"00087752"	"02262"
"00087753"	"02262"
"00087754"	"02262"
"00087755"	"02262"
"00087756"	"02262"
"00087757"	"02262"
"00087758"	"02262"
"00087759"	"02262"
"00087760"	"02262"
"00087761"	"02262"
"00087762"	"02262"
"00087763"	"02262"
"00087764"	"02262"
"00087765"	"02262"
"00087766"	"02262"
"00087767"	"02262"
"00087768"	"02262"
"00087769"	"02262"
"00087770"	"02262"
"00087771"	"02262"
"00087772"	"02262"
"00087773"	"02262"
"00087774"	"02262"
"00087775"	"02262"
"00087776"	"02262"
"00087777"	"02262"
"00087778"	"02262"
"00087779"	"02262"
"00087780"	"02262"
"00087781"	"02262"
"00087782"	"02262"
"00087783"	"02262"
"00087784"	"02262"
"00087785"	"02262"
"00087786"	"02262"
"00087787"	"02262"
"00087788"	"02262"
"00087789"	"02262"
"00087790"	"02262"
"00087791"	"02262"
"00087792"	"02262"
"00087793"	"02262"
"00087794"	"02262"
"00087795"	"02262"
"00087796"	"02262"
"00087797"	"02262"
"00087798"	"02262"
"00087799"	"02262"
"00087800"	"02262"
"00087801"	"02262"
"00087802"	"02262"
"00087803"	"02262"
"00087804"	"02262"
"00087805"	"02262"
"00087806"	"02262"
"00087807"	"02262"
"00087808"	"02262"
"00087809"	"02262"
"00087810"	"02262"
"00087811"	"02262"
"00087812"	"02262"
"00087813"	"02262"
"00087814"	"02262"
"00087815"	"02262"
"00087816"	"02262"
"00087818"	"02262"
"00088054"	"02262"
"00088055"	"02262"
"00088056"	"02262"
"00088057"	"02262"
"00088058"	"02262"
"00088059"	"02262"
"00088060"	"02262"
"00132118"	"02262"
"00132119"	"02262"
"00132120"	"02262"
"00207356"	"02262"
"00207597"	"02262"
"00209026"	"02262"
"00308561"	"04214"
"00308562"	"04214"
"00308563"	"04214"
"00308564"	"04214"
"00308565"	"04214"
"00308566"	"04214"
"00308567"	"04214"
"00308568"	"04214"
"00309413"	"04214"
"00309414"	"04214"
"00309415"	"04214"
"00309416"	"04214"
"00309417"	"04214"
"00309418"	"04214"
"00309419"	"04214"
"00309420"	"04214"
"00328500"	"04214"
"00333754"	"04214"
"00333755"	"04214"
"00333756"	"04214"
"00333757"	"04214"
"00333758"	"04214"
"00333759"	"04214"
"00333760"	"04214"
"00333761"	"04214"
"00333762"	"04214"
"00333763"	"04214"
"00333764"	"04214"
"00333765"	"04214"
"00333766"	"04214"
"00335321"	"04214"
"00335449"	"04214"
"00335992"	"04214"
"00335993"	"04214"
"00358745"	"04214"
"00359373"	"04214"
"00373846"	"04214"
"00373940"	"04214"
"00376319"	"04214"
"00376320"	"04214"
"00376321"	"04214"
"00376322"	"04214"
"00379562"	"04214"
"00379785"	"00198"
"00379792"	"02262"
"00383456"	"04214"
"00383457"	"04214"
"00383458"	"04214"
"00383459"	"04214"
"00384253"	"04214"
"00384254"	"04214"
"00384311"	"04214"
"00384318"	"04214"
"00384337"	"04214"
"00384339"	"04214"
"00384342"	"04214"
"00384348"	"04214"
"00384365"	"04214"
"00384395"	"04214"
"00384416"	"04214"
"00384448"	"04214"
"00384457"	"04214"
"00384479"	"04214"
"00384489"	"04214"
"00384490"	"04214"
"00386731"	"04214"
"00386797"	"04214"
"00388037"	"04214"
"00388195"	"04214"
"00388727"	"04214"
"00388756"	"04214"
"00388758"	"04214"
"00388765"	"04214"
"00388766"	"04214"
"00388779"	"04214"
"00388784"	"04214"
"00388787"	"04214"
"00388788"	"04214"
"00388790"	"04214"
"00388886"	"04214"
"00388887"	"04214"
"00388898"	"04214"
"00388903"	"04214"
"00388905"	"04214"
"00388910"	"04214"
"00388919"	"04214"
"00388962"	"04214"
"00388963"	"04214"
"00390760"	"04214"
"00390796"	"04214"
"00390859"	"04214"
"00390916"	"04214"
"00390984"	"04214"
"00390991"	"04214"
"00390993"	"04214"
"00390997"	"04214"
"00391384"	"04214"
"00391385"	"04214"
"00391503"	"04214"
"00391504"	"04214"
"00391505"	"04214"
"00391508"	"04214"
"00391509"	"04214"
"00391510"	"04214"
"00391511"	"04214"
"00391512"	"04214"
"00391513"	"04214"
"00391514"	"04214"
"00391515"	"04214"
"00391516"	"04214"
"00393448"	"04214"
"00393470"	"04214"
"00393471"	"04214"
"00393475"	"04214"
"00393476"	"04214"
"00393517"	"04214"
"00393549"	"04214"
"00393609"	"04214"
"00393730"	"04214"
"00393745"	"04214"
"00393812"	"04214"
"00393837"	"04214"
"00393866"	"04214"
"00393888"	"04214"
"00394797"	"04214"
"00395926"	"04214"
"00395927"	"04214"
"00395952"	"04214"
"00395985"	"04214"
"00395986"	"04214"
"00395987"	"04214"
"00395988"	"04214"
"00395989"	"04214"
"00395990"	"04214"
"00395991"	"04214"
"00395992"	"04214"
"00395993"	"04214"
"00395994"	"04214"
"00395995"	"04214"
"00395996"	"04214"
"00395997"	"04214"
"00395998"	"04215"
"00396002"	"04214"
"00396003"	"04214"
"00396004"	"04214"
"00396005"	"04214"
"00396006"	"04214"
"00396007"	"04214"
"00396008"	"04214"
"00396009"	"04214"
"00396010"	"02262"
"00396011"	"02262"
"00396012"	"02262"
"00396013"	"02262"
"00396014"	"02262"
"00396015"	"02262"
"00396016"	"02262"
"00396017"	"02262"
"00396018"	"02262"
"00396019"	"02262"
"00396020"	"04214"
"00396021"	"04214"
"00396022"	"04214"
"00396034"	"04214"
"00396035"	"04214"
"00396036"	"04214"
"00396037"	"04214"
"00396038"	"04214"
"00396039"	"04214"
"00396040"	"04214"
"00396041"	"04214"
"00396042"	"04214"
"00396043"	"04214"
"00396044"	"04214"
"00396045"	"04214"
"00396046"	"04214"
"00396047"	"04214"
"00396048"	"04214"
"00396049"	"04214"
"00396050"	"04214"
"00396051"	"04214"
"00396052"	"04214"
"00396053"	"04214"
"00396054"	"04214"
"00396055"	"04214"
"00396056"	"04214"
"00396057"	"04214"
"00396062"	"04214"
"00396063"	"04214"
"00396064"	"04214"
"00396065"	"04214"
"00396066"	"04214"
"00396067"	"04214"
"00396068"	"04214"
"00396069"	"04214"
"00396070"	"04214"
"00396071"	"04214"
"00396072"	"04214"
"00396073"	"04214"
"00396074"	"04214"
"00396075"	"04214"
"00396076"	"04214"
"00396077"	"04214"
"00396078"	"04214"
"00396079"	"04214"
"00396080"	"04214"
"00396081"	"04214"
"00396082"	"04214"
"00396083"	"04214"
"00396084"	"04214"
"00396085"	"04214"
"00396086"	"04214"
"00396087"	"04214"
"00396088"	"04214"
"00396089"	"04214"
"00396090"	"04214"
"00396091"	"04214"
"00396092"	"04214"
"00396093"	"04214"
"00396094"	"04214"
"00396095"	"04214"
"00396096"	"04214"
"00396097"	"04214"
"00396098"	"04214"
"00396099"	"04214"
"00396100"	"04214"
"00396101"	"04214"
"00396102"	"04214"
"00396103"	"04214"
"00396104"	"04214"
"00396105"	"04214"
"00396106"	"04214"
"00396107"	"04214"
"00396108"	"04214"
"00396109"	"04214"
"00396111"	"04214"
"00396112"	"04214"
"00396113"	"04214"
"00396114"	"04214"
"00396115"	"04214"
"00396116"	"04214"
"00396117"	"04214"
"00396118"	"04214"
"00396119"	"04214"
"00396120"	"04214"
"00396121"	"04214"
"00396122"	"04214"
"00396123"	"04214"
"00396124"	"04214"
"00396125"	"04214"
"00396126"	"04214"
"00396127"	"04214"
"00396128"	"04214"
"00396129"	"04214"
"00396130"	"04214"
"00396131"	"04214"
"00396133"	"04214"
"00396134"	"04214"
"00396135"	"04214"
"00396136"	"04214"
"00396137"	"04214"
"00396138"	"04214"
"00396139"	"04214"
"00396140"	"04214"
"00396141"	"04214"
"00396142"	"04214"
"00396143"	"04214"
"00396144"	"04214"
"00396145"	"04214"
"00396146"	"04214"
"00396147"	"04214"
"00396148"	"04214"
"00396149"	"04214"
"00396150"	"04214"
"00396151"	"04214"
"00396152"	"04214"
"00396153"	"04214"
"00396154"	"04214"
"00396155"	"04214"
"00396156"	"04214"
"00396157"	"04214"
"00396158"	"04214"
"00396159"	"04214"
"00396160"	"04214"
"00396161"	"04214"
"00396162"	"04214"
"00396163"	"04214"
"00396164"	"04214"
"00396165"	"04214"
"00396166"	"04214"
"00396167"	"04214"
"00396168"	"04214"
"00396169"	"04214"
"00396170"	"04214"
"00396171"	"04214"
"00396172"	"04214"
"00396173"	"04214"
"00396174"	"04214"
"00396175"	"04214"
"00396176"	"04214"
"00396177"	"04214"
"00396345"	"04214"
"00396346"	"04214"
"00396347"	"04214"
"00396348"	"04214"
"00396349"	"04214"
"00396350"	"04214"
"00396351"	"04214"
"00396352"	"04214"
"00396353"	"04214"
"00396354"	"04214"
"00396355"	"04214"
"00396356"	"04214"
"00396357"	"04214"
"00396358"	"04214"
"00396359"	"04214"
"00396360"	"04214"
"00396361"	"04214"
"00396362"	"04214"
"00396363"	"04214"
"00396364"	"04214"
"00396365"	"04214"
"00396366"	"04214"
"00396367"	"04214"
"00396368"	"04214"
"00396369"	"04214"
"00396370"	"04214"
"00396371"	"04214"
"00396372"	"04214"
"00396373"	"04214"
"00396374"	"04214"
"00396375"	"04214"
"00396376"	"04214"
"00396377"	"04214"
"00396378"	"04214"
"00396379"	"04214"
"00396380"	"04214"
"00396381"	"04214"
"00396382"	"04214"
"00396383"	"04214"
"00396384"	"04214"
"00396385"	"04214"
"00396386"	"04214"
"00396387"	"04214"
"00396388"	"04214"
"00396389"	"04214"
"00396390"	"04214"
"00396391"	"04214"
"00396392"	"04214"
"00396393"	"04214"
"00396394"	"04214"
"00396395"	"04214"
"00396396"	"04214"
"00396397"	"04214"
"00396398"	"04214"
"00396399"	"04214"
"00396400"	"04214"
"00396401"	"04214"
"00396402"	"04214"
"00396403"	"04214"
"00396404"	"04214"
"00396405"	"04214"
"00396406"	"04214"
"00396407"	"04214"
"00396421"	"04214"
"00396431"	"04214"
"00396432"	"04214"
"00396433"	"04214"
"00396434"	"04214"
"00396435"	"04214"
"00396436"	"04214"
"00396437"	"04214"
"00396438"	"04214"
"00396439"	"04214"
"00396440"	"04214"
"00396441"	"04214"
"00396442"	"04214"
"00396443"	"04214"
"00396444"	"04214"
"00396445"	"04214"
"00396446"	"04214"
"00396447"	"04214"
"00396448"	"04214"
"00396449"	"04214"
"00396450"	"04214"
"00396451"	"04214"
"00396452"	"04214"
"00396453"	"04214"
"00396466"	"04214"
"00396489"	"04214"
"00396490"	"04214"
"00396656"	"04214"
"00396657"	"04214"
"00396658"	"04214"
"00396659"	"04214"
"00396660"	"04214"
"00396661"	"04214"
"00396662"	"04214"
"00396663"	"04214"
"00396664"	"04214"
"00396665"	"04214"
"00396666"	"04214"
"00396667"	"04214"
"00396668"	"04214"
"00396669"	"04214"
"00396670"	"04214"
"00396671"	"04214"
"00396672"	"04214"
"00396673"	"04214"
"00396674"	"04214"
"00396675"	"04214"
"00396676"	"04214"
"00396677"	"04214"
"00396678"	"04214"
"00396679"	"04214"
"00396680"	"04214"
"00396681"	"04214"
"00396682"	"04214"
"00396683"	"04214"
"00396684"	"04214"
"00396685"	"04214"
"00396686"	"04214"
"00396687"	"04214"
"00396688"	"04214"
"00396689"	"04214"
"00396690"	"04214"
"00396691"	"04214"
"00396692"	"04214"
"00396693"	"04214"
"00396694"	"04214"
"00396695"	"04214"
"00396696"	"04214"
"00396697"	"04214"
"00396698"	"04214"
"00396699"	"04214"
"00396700"	"04214"
"00396701"	"04214"
"00396702"	"04214"
"00396703"	"04214"
"00396704"	"04214"
"00396705"	"04214"
"00396706"	"04214"
"00396707"	"04214"
"00396725"	"04214"
"00396727"	"04214"
"00396728"	"04214"
"00396729"	"04214"
"00396730"	"04214"
"00396731"	"04214"
"00396732"	"04214"
"00396733"	"04214"
"00396734"	"04214"
"00396735"	"04214"
"00396736"	"04214"
"00396737"	"04214"
"00396738"	"04214"
"00396739"	"04214"
"00396740"	"04214"
"00396741"	"04214"
"00396742"	"04214"
"00396743"	"04214"
"00396744"	"04214"
"00396745"	"04214"
"00396746"	"04214"
"00396747"	"04214"
"00396748"	"04214"
"00396749"	"04214"
"00396750"	"04214"
"00396751"	"04214"
"00396752"	"04214"
"00396753"	"04214"
"00396754"	"04214"
"00396755"	"04214"
"00396756"	"04214"
"00396757"	"04214"
"00396758"	"04214"
"00396759"	"04214"
"00396760"	"04214"
"00396761"	"04214"
"00396762"	"04214"
"00396763"	"04214"
"00396764"	"04214"
"00396765"	"04214"
"00396766"	"04214"
"00396767"	"04214"
"00396768"	"04214"
"00396769"	"04214"
"00396770"	"04214"
"00396771"	"04214"
"00396772"	"04214"
"00396773"	"04214"
"00396774"	"04214"
"00396775"	"04214"
"00396776"	"04214"
"00396777"	"04214"
"00396778"	"04214"
"00396779"	"04214"
"00396780"	"04214"
"00396781"	"04214"
"00396782"	"04214"
"00396783"	"04214"
"00396784"	"04214"
"00396785"	"04214"
"00396786"	"04214"
"00396787"	"04214"
"00396788"	"04214"
"00396789"	"04214"
"00396790"	"04214"
"00396791"	"04214"
"00396792"	"04214"
"00396793"	"04214"
"00396794"	"04214"
"00396795"	"04214"
"00396796"	"04214"
"00396797"	"04214"
"00396798"	"04214"
"00396799"	"04214"
"00396801"	"04214"
"00396802"	"04214"
"00396803"	"04214"
"00396804"	"04214"
"00396805"	"04214"
"00396806"	"04214"
"00396807"	"04214"
"00396808"	"04214"
"00396809"	"04214"
"00396810"	"04214"
"00396811"	"04214"
"00396812"	"04214"
"00396813"	"04214"
"00396814"	"04214"
"00396815"	"04214"
"00396816"	"04214"
"00396817"	"04214"
"00396818"	"04214"
"00396819"	"04214"
"00396820"	"04214"
"00396821"	"04214"
"00396822"	"04214"
"00396823"	"04214"
"00396824"	"04214"
"00396861"	"04214"
"00396862"	"04214"
"00396863"	"04214"
"00396864"	"04214"
"00396865"	"04214"
"00396866"	"04214"
"00396867"	"04214"
"00396868"	"04214"
"00396869"	"04214"
"00396870"	"04214"
"00396871"	"04214"
"00396872"	"04214"
"00396873"	"04214"
"00396874"	"04214"
"00396875"	"04214"
"00396876"	"04214"
"00396877"	"04214"
"00396878"	"04214"
"00396879"	"04214"
"00396880"	"04214"
"00396881"	"04214"
"00396882"	"04214"
"00396883"	"04214"
"00396884"	"04214"
"00396885"	"04214"
"00396886"	"04214"
"00396887"	"04214"
"00396888"	"04214"
"00396889"	"04214"
"00396890"	"04214"
"00396891"	"04214"
"00396892"	"04214"
"00396893"	"04214"
"00396894"	"04214"
"00396895"	"04214"
"00396896"	"04214"
"00396897"	"04214"
"00396898"	"04214"
"00396899"	"04214"
"00396900"	"04214"
"00396901"	"04214"
"00396902"	"04214"
"00396903"	"04214"
"00396904"	"04214"
"00396905"	"04214"
"00396906"	"04214"
"00396907"	"04214"
"00396908"	"04214"
"00396909"	"04214"
"00396910"	"04214"
"00396911"	"04214"
"00396912"	"04214"
"00396913"	"04214"
"00396914"	"04214"
"00396915"	"04214"
"00396916"	"04214"
"00396917"	"04214"
"00396918"	"04214"
"00396919"	"04214"
"00396920"	"04214"
"00396921"	"04214"
"00396922"	"04214"
"00396923"	"04214"
"00396924"	"04214"
"00396925"	"04214"
"00396926"	"04214"
"00396927"	"04214"
"00397004"	"04214"
"00397045"	"04214"
"00397046"	"04214"
"00397047"	"04214"
"00397048"	"04214"
"00397049"	"04214"
"00397050"	"04214"
"00397051"	"04214"
"00397052"	"04214"
"00397053"	"04214"
"00397054"	"04214"
"00397055"	"04214"
"00397056"	"04214"
"00397057"	"04214"
"00397058"	"04214"
"00397059"	"04214"
"00397060"	"04214"
"00397061"	"04214"
"00397062"	"04214"
"00397063"	"04214"
"00397064"	"04214"
"00397065"	"04214"
"00397066"	"04214"
"00397067"	"04214"
"00397068"	"04214"
"00397069"	"04214"
"00397070"	"04214"
"00397071"	"04214"
"00397072"	"04214"
"00397073"	"04214"
"00397074"	"04214"
"00397075"	"04214"
"00397076"	"04214"
"00397077"	"04214"
"00397078"	"04214"
"00397079"	"04214"
"00397080"	"04214"
"00397081"	"04214"
"00397082"	"04214"
"00397083"	"04214"
"00397084"	"04214"
"00397085"	"04214"
"00397086"	"04214"
"00397087"	"04214"
"00397088"	"04214"
"00397089"	"04214"
"00397090"	"04214"
"00397091"	"04214"
"00397092"	"04214"
"00397093"	"04214"
"00397094"	"04214"
"00397095"	"04214"
"00397096"	"04214"
"00397097"	"04214"
"00397098"	"04214"
"00397099"	"04214"
"00397100"	"04214"
"00397101"	"04214"
"00397102"	"04214"
"00397103"	"04214"
"00397104"	"04214"
"00397105"	"04214"
"00397106"	"04214"
"00397107"	"04214"
"00397108"	"04214"
"00397109"	"04214"
"00397110"	"04214"
"00397111"	"04214"
"00397112"	"04214"
"00397113"	"04214"
"00397114"	"04214"
"00397115"	"04214"
"00397116"	"04214"
"00397117"	"04214"
"00397118"	"04214"
"00397119"	"04214"
"00397120"	"04214"
"00397121"	"04214"
"00397122"	"04214"
"00397123"	"04214"
"00397124"	"04214"
"00397125"	"04214"
"00397126"	"04214"
"00397127"	"04214"
"00397128"	"04214"
"00397129"	"04214"
"00397130"	"04214"
"00397131"	"04214"
"00397132"	"04214"
"00397133"	"04214"
"00397134"	"04214"
"00397135"	"04214"
"00397136"	"04214"
"00397137"	"04214"
"00397138"	"04214"
"00408447"	"04214"
"00408448"	"04214"
"00408449"	"04214"
"00408450"	"04214"
"00408451"	"04214"
"00408452"	"04214"
"00408453"	"04214"
"00408454"	"04214"
"00408455"	"04214"
"00408456"	"04214"
"00408457"	"04214"
"00408458"	"04214"
"00408459"	"04214"
"00408460"	"04214"
"00408461"	"04214"
"00408462"	"04214"
"00408463"	"04214"
"00411582"	"02262"
"00414485"	"00198"
"00420446"	"04214"
"00420521"	"04214"
"00420525"	"04214"
"00426951"	"04214"
"00426952"	"04214"
"00426953"	"04214"
"00436599"	"02262"
"00436600"	"02262"
"00436601"	"02262"
"00443697"	"04214"
"00443698"	"04214"
"00443699"	"04214"
"00443700"	"04214"
"00443701"	"04214"
"00443702"	"04214"
"00443703"	"04214"
"00443704"	"04214"
"00443705"	"04214"
"00443706"	"04214"
"00443849"	"02262"
"00443850"	"02262"
"00443851"	"02262"
"00443852"	"02262"
"00443853"	"02262"
"00443854"	"02262"
"00443855"	"02262"
"00443856"	"02262"
"00443857"	"02262"
"00443858"	"02262"
"00443859"	"02262"
"00443860"	"02262"
"00443861"	"02262"
"00443862"	"02262"
"00443863"	"02262"
"00443864"	"02262"
"00447244"	"00198"
"00447245"	"00198"
"00447246"	"00198"
"00447247"	"00198"
"00447248"	"00198"
"00447249"	"00198"
"00447250"	"00198"
"00447251"	"00198"
"00447252"	"00198"
"00447253"	"00198"
"00447254"	"00198"
"00447433"	"00198"
"00447580"	"00198"
"00451009"	"04249"
"00451010"	"04249"
"00451011"	"04249"
"00458573"	"02262"
"00458574"	"02262"
"00458575"	"02262"
"00458576"	"02262"
"00458577"	"02262"
"00458578"	"02262"
"00458579"	"02262"
"00458580"	"02262"
"00458581"	"02262"
"00458582"	"02262"
"00458583"	"02262"
"00458584"	"02262"
"00458585"	"02262"
"00458586"	"02262"
"00458587"	"02262"
"00458588"	"02262"
"00458589"	"02262"
"00458590"	"02262"
"00458591"	"02262"
"00458592"	"02262"
"00458593"	"02262"
"00458594"	"02262"
"00458595"	"02262"
"00458596"	"02262"
"00458597"	"02262"
"00458598"	"02262"
"00458599"	"02262"
"00458600"	"02262"
"00458601"	"02262"
"00458602"	"02262"
"00458603"	"02262"
"00458604"	"02262"
"00458605"	"02262"
"00458606"	"02262"
"00458607"	"02262"
"00458608"	"02262"
"00458609"	"02262"
"00458610"	"02262"
"00458611"	"02262"
"00458612"	"02262"
"00458613"	"02262"
"00458614"	"02262"
"00458615"	"02262"
"00458616"	"02262"
"00458617"	"02262"
"00458618"	"02262"
"00458619"	"02262"
"00458620"	"02262"
"00458621"	"02262"
"00458622"	"02262"
"00458623"	"02262"
"00458624"	"02262"
"00458625"	"02262"
"00458626"	"02262"
"00458627"	"02262"
"00458628"	"02262"
"00458629"	"02262"
"00458630"	"02262"
"00458631"	"02262"
"00458632"	"02262"
"00458633"	"02262"
"00458634"	"02262"
"00458635"	"02262"
"00458636"	"02262"
"00458637"	"02262"
"00458638"	"02262"
"00458639"	"02262"
"00458640"	"02262"
"00458641"	"02262"
"00458642"	"02262"
"00458643"	"02262"
"00458644"	"02262"
"00458645"	"02262"
"00458646"	"02262"
"00458647"	"02262"
"00458648"	"02262"
"00458649"	"02262"
"00458650"	"02262"
"00458651"	"02262"
"00458652"	"02262"
"00458653"	"02262"
"00458654"	"02262"
"00458655"	"02262"
"00458656"	"02262"
"00458657"	"02262"
"00458658"	"02262"
"00458659"	"02262"
"00458660"	"02262"
"00458661"	"02262"
"00458662"	"02262"
"00458663"	"02262"
"00458664"	"02262"
"00458665"	"02262"
"00458666"	"02262"
"00458667"	"02262"
"00458668"	"02262"
"00458669"	"02262"
"00458670"	"02262"
"00458671"	"02262"
"00458672"	"02262"
"00458673"	"02262"
"00458674"	"02262"
"00458675"	"02262"
"00458676"	"02262"
"00458677"	"02262"
"00458678"	"02262"
"00458679"	"02262"
"00458680"	"02262"
"00458681"	"02262"
"00458682"	"02262"
"00458683"	"02262"
"00458684"	"02262"
"00458685"	"02262"
"00458686"	"02262"
"00458687"	"02262"
"00458688"	"02262"
"00458689"	"02262"
"00458690"	"02262"
"00458691"	"02262"
"00458692"	"02262"
"00458693"	"02262"
"00458694"	"02262"
"00458695"	"02262"
"00458696"	"02262"
"00458697"	"02262"
"00458698"	"02262"
"00458699"	"02262"
"00458700"	"02262"
"00458701"	"02262"
"00458702"	"02262"
"00458703"	"02262"
"00458704"	"02262"
"00458705"	"02262"
"00458706"	"02262"
"00458707"	"02262"
"00458708"	"02262"
"00458709"	"02262"
"00458710"	"02262"
"00458711"	"02262"
"00458712"	"02262"
"00458714"	"02262"
"00458715"	"02262"
"00458716"	"02262"
"00458717"	"02262"
"00458718"	"02262"
"00458719"	"02262"
"00458720"	"02262"
"00458721"	"02262"
"00458722"	"02262"
"00458723"	"02262"
"00458724"	"02262"
"00458725"	"02262"
"00458726"	"02262"
"00458727"	"02262"
"00458728"	"02262"
"00458729"	"02262"
"00458730"	"02262"
"00458731"	"02262"
"00458732"	"02262"
"00458733"	"02262"
"00458734"	"02262"
"00458735"	"02262"
"00458736"	"02262"
"00458737"	"02262"
"00458738"	"02262"
"00458739"	"02262"
"00458740"	"02262"
"00458741"	"02262"
"00458742"	"02262"
"00458743"	"02262"
"00458744"	"02262"
"00458745"	"02262"
"00458746"	"02262"
"00458747"	"02262"
"00458748"	"02262"
"00458749"	"02262"
"00458750"	"02262"
"00458751"	"02262"
"00458752"	"02262"
"00458753"	"02262"
"00458754"	"02262"
"00458755"	"02262"
"00458756"	"02262"
"00458757"	"02262"
"00458758"	"02262"
"00458759"	"02262"
"00458760"	"02262"
"00458761"	"02262"
"00458762"	"02262"
"00458763"	"02262"
"00458764"	"02262"
"00458765"	"02262"
"00458766"	"02262"
"00458767"	"02262"
"00458768"	"02262"
"00458769"	"02262"
"00458770"	"02262"
"00458771"	"02262"
"00458772"	"02262"
"00458773"	"02262"
"00458774"	"02262"
"00458775"	"02262"
"00458776"	"02262"
"00458777"	"02262"
"00458778"	"02262"
"00458779"	"02262"
"00458780"	"02262"
"00458781"	"02262"
"00458782"	"02262"
"00458783"	"02262"
"00458784"	"02262"
"00458785"	"02262"
"00458786"	"02262"
"00458787"	"02262"
"00458788"	"02262"
"00458789"	"02262"
"00458790"	"02262"
"00458791"	"02262"
"00458792"	"02262"
"00458793"	"02262"
"00458794"	"02262"
"00458795"	"02262"
"00458796"	"02262"
"00458797"	"02262"
"00458798"	"02262"
"00458799"	"02262"
"00458800"	"02262"
"00458801"	"02262"
"00458802"	"02262"
"00458803"	"02262"
"00458804"	"02262"
"00458805"	"02262"
"00458806"	"02262"
"00458807"	"02262"
"00458808"	"02262"
"00458809"	"02262"
"00458810"	"02262"
"00458811"	"02262"
"00458812"	"02262"
"00458813"	"02262"
"00458814"	"02262"
"00458815"	"02262"
"00458816"	"02262"
"00458817"	"02262"
"00458818"	"02262"
"00458819"	"02262"
"00458820"	"02262"
"00458821"	"02262"
"00458822"	"02262"
"00458823"	"02262"
"00458824"	"02262"
"00458825"	"02262"
"00458826"	"02262"
"00458827"	"02262"
"00458828"	"02262"
"00458829"	"02262"
"00458830"	"02262"
"00458831"	"02262"
"00458832"	"02262"
"00458833"	"02262"
"00458834"	"02262"
"00458835"	"02262"
"00458838"	"02262"
"00458839"	"02262"
"00458840"	"02262"
"00458841"	"02262"
"00458842"	"02262"
"00458843"	"02262"
"00458844"	"02262"
"00458845"	"02262"
"00458846"	"02262"
"00458847"	"02262"
"00458848"	"02262"
"00458849"	"02262"
"00458850"	"02262"
"00458851"	"02262"
"00458852"	"02262"
"00458853"	"02262"
"00458854"	"02262"
"00458855"	"02262"
"00458856"	"02262"
"00458857"	"02262"
"00458858"	"02262"
"00458859"	"02262"
"00458860"	"02262"
"00458861"	"02262"
"00458862"	"02262"
"00458863"	"02262"
"00458864"	"02262"
"00458865"	"02262"
"00458866"	"02262"
"00458867"	"02262"
"00458868"	"02262"
"00458869"	"02262"
"00458870"	"02262"
"00458871"	"02262"
"00458872"	"02262"
"00458873"	"02262"
"00458874"	"02262"
"00458875"	"02262"
"00458876"	"02262"
"00458877"	"02262"
"00458878"	"02262"
"00458879"	"02262"
"00458880"	"02262"
"00458881"	"02262"
"00458882"	"02262"
"00458883"	"02262"
"00458884"	"02262"
"00458885"	"02262"
"00458886"	"02262"
"00458887"	"02262"
"00458888"	"02262"
"00458889"	"02262"
"00458890"	"02262"
"00458891"	"02262"
"00458892"	"02262"
"00458893"	"02262"
"00458894"	"02262"
"00458895"	"02262"
"00458896"	"02262"
"00458897"	"02262"
"00458898"	"02262"
"00458899"	"02262"
"00458900"	"02262"
"00458901"	"02262"
"00458902"	"02262"
"00458903"	"02262"
"00458904"	"02262"
"00458905"	"02262"
"00458906"	"02262"
"00458907"	"02262"
"00458908"	"02262"
"00458909"	"02262"
"00458910"	"02262"
"00458911"	"02262"
"00458912"	"02262"
"00458913"	"02262"
"00458914"	"02262"
"00458915"	"02262"
"00458916"	"02262"
"00458917"	"02262"
"00458918"	"02262"
"00458919"	"02262"
"00458920"	"02262"
"00458921"	"02262"
"00458922"	"02262"
"00458923"	"02262"
"00458924"	"02262"
"00458925"	"02262"
"00458926"	"02262"
"00458927"	"02262"
"00458928"	"02262"
"00458929"	"02262"
"00458930"	"02262"
"00458931"	"02262"
"00458932"	"02262"
"00458933"	"02262"
"00458934"	"02262"
"00458935"	"02262"
"00458936"	"02262"
"00458937"	"02262"
"00458938"	"02262"
"00458939"	"02262"
"00458940"	"02262"
"00458941"	"02262"
"00458942"	"02262"
"00458943"	"02262"
"00458944"	"02262"
"00458945"	"02262"
"00458946"	"02262"
"00458947"	"02262"
"00458948"	"02262"
"00458949"	"02262"
"00458950"	"02262"
"00458951"	"02262"
"00458952"	"02262"
"00458953"	"02262"
"00458954"	"02262"
"00458955"	"02262"
"00458956"	"02262"
"00458957"	"02262"
"00458958"	"02262"
"00458959"	"02262"
"00458960"	"02262"
"00458961"	"02262"
"00458962"	"02262"
"00458963"	"02262"
"00458964"	"02262"
"00458965"	"02262"
"00458966"	"02262"
"00458967"	"02262"
"00458968"	"02262"
"00458969"	"02262"
"00458970"	"02262"
"00458971"	"02262"
"00458972"	"02262"
"00458973"	"02262"
"00458974"	"02262"
"00458975"	"02262"
"00458976"	"02262"
"00458977"	"02262"
"00458978"	"02262"
"00458979"	"02262"
"00458980"	"02262"
"00458981"	"02262"
"00458982"	"02262"
"00458984"	"02262"
"00458985"	"02262"
"00458986"	"02262"
"00458987"	"02262"
"00458988"	"02262"
"00458990"	"02262"
"00458991"	"02262"
"00458992"	"02262"
"00458993"	"02262"
"00458994"	"02262"
"00458999"	"04214"
"00459000"	"04214"
"00459016"	"02262"
"00459017"	"02262"
"00459018"	"02262"
"00459019"	"02262"
"00459020"	"02262"
"00459021"	"02262"
"00459022"	"02262"
"00459023"	"02262"
"00459024"	"02262"
"00459025"	"02262"
"00459026"	"02262"
"00459027"	"02262"
"00459028"	"02262"
"00459029"	"02262"
"00459030"	"02262"
"00459031"	"02262"
"00459032"	"02262"
"00459033"	"02262"
"00459034"	"02262"
"00459035"	"02262"
"00459036"	"02262"
"00459037"	"02262"
"00459038"	"02262"
"00459039"	"02262"
"00459040"	"02262"
"00459041"	"02262"
"00459042"	"02262"
"00459043"	"02262"
"00459044"	"02262"
"00459045"	"02262"
"00459046"	"02262"
"00459047"	"02262"
"00459048"	"02262"
"00459049"	"02262"
"00459050"	"02262"
"00459051"	"02262"
"00459052"	"02262"
"00459053"	"02262"
"00459054"	"02262"
"00459055"	"02262"
"00459056"	"02262"
"00459057"	"02262"
"00459058"	"02262"
"00459059"	"02262"
"00459060"	"02262"
"00459061"	"02262"
"00459062"	"02262"
"00459063"	"02262"
"00459064"	"02262"
"00459065"	"02262"
"00459066"	"02262"
"00459067"	"02262"
"00459068"	"02262"
"00459069"	"02262"
"00459070"	"02262"
"00459071"	"02262"
"00459072"	"02262"
"00459073"	"02262"
"00459074"	"02262"
"00459075"	"02262"
"00459076"	"02262"
"00459077"	"02262"
"00459078"	"02262"
"00459079"	"02262"
"00459080"	"02262"
"00459081"	"02262"
"00459082"	"02262"
"00459083"	"02262"
"00459084"	"02262"
"00459085"	"02262"
"00459086"	"02262"
"00459087"	"02262"
"00459088"	"02262"
"00459089"	"02262"
"00459090"	"02262"
"00459091"	"02262"
"00459092"	"02262"
"00459093"	"02262"
"00459094"	"02262"
"00459095"	"02262"
"00459096"	"02262"
"00459097"	"02262"
"00459098"	"02262"
"00459099"	"02262"
"00459100"	"02262"
"00459101"	"02262"
"00459102"	"02262"
"00459103"	"02262"
"00459104"	"02262"
"00459105"	"02262"
"00459106"	"02262"
"00459107"	"02262"
"00459108"	"02262"
"00459109"	"02262"
"00459110"	"02262"
"00459111"	"02262"
"00459112"	"02262"
"00459113"	"02262"
"00459114"	"02262"
"00459115"	"02262"
"00459116"	"02262"
"00459117"	"02262"
"00459118"	"02262"
"00459119"	"02262"
"00459120"	"02262"
"00459121"	"02262"
"00459122"	"02262"
"00459123"	"02262"
"00459124"	"02262"
"00459125"	"02262"
"00459126"	"02262"
"00459127"	"02262"
"00459128"	"02262"
"00459129"	"02262"
"00459130"	"02262"
"00459131"	"02262"
"00459132"	"02262"
"00459133"	"02262"
"00459134"	"02262"
"00459135"	"02262"
"00459136"	"02262"
"00459137"	"02262"
"00459138"	"02262"
"00459139"	"02262"
"00459140"	"02262"
"00459141"	"02262"
"00459142"	"02262"
"00459143"	"02262"
"00459144"	"02262"
"00459145"	"02262"
"00459146"	"02262"
"00459147"	"02262"
"00459148"	"02262"
"00459149"	"02262"
"00459150"	"02262"
"00459151"	"02262"
"00459152"	"02262"
"00459153"	"02262"
"00459154"	"02262"
"00459155"	"02262"
"00459156"	"02262"
"00459157"	"02262"
"00459158"	"02262"
"00459159"	"02262"
"00459160"	"02262"
"00459161"	"02262"
"00459162"	"02262"
"00459163"	"02262"
"00459164"	"02262"
"00459165"	"02262"
"00459166"	"02262"
"00459167"	"02262"
"00459168"	"02262"
"00459169"	"02262"
"00459170"	"02262"
"00459171"	"02262"
"00459172"	"02262"
"00459173"	"02262"
"00459174"	"02262"
"00459175"	"02262"
"00459176"	"02262"
"00459177"	"02262"
"00459178"	"02262"
"00459179"	"02262"
"00459180"	"02262"
"00459181"	"02262"
"00459182"	"02262"
"00459183"	"02262"
"00459184"	"02262"
"00459185"	"02262"
"00459186"	"02262"
"00459187"	"02262"
"00459188"	"02262"
"00459189"	"02262"
"00459190"	"02262"
"00459191"	"02262"
"00459192"	"02262"
"00459193"	"02262"
"00459194"	"02262"
"00459195"	"02262"
"00459196"	"02262"
"00459197"	"02262"
"00459198"	"02262"
"00459199"	"02262"
"00459200"	"02262"
"00459201"	"02262"
"00459202"	"02262"
"00459203"	"02262"
"00459204"	"02262"
"00459205"	"02262"
"00459206"	"02262"
"00459207"	"02262"
"00459208"	"02262"
"00459209"	"02262"
"00459210"	"02262"
"00459211"	"02262"
"00459212"	"02262"
"00459213"	"02262"
"00459214"	"02262"
"00459215"	"02262"
"00459216"	"02262"
"00459217"	"02262"
"00459218"	"02262"
"00459219"	"02262"
"00459220"	"02262"
"00459221"	"02262"
"00459222"	"02262"
"00459223"	"02262"
"00459224"	"02262"
"00459225"	"02262"
"00459226"	"02262"
"00459227"	"02262"
"00459228"	"02262"
"00459229"	"02262"
"00459230"	"02262"
"00459231"	"02262"
"00459232"	"02262"
"00459233"	"02262"
"00459234"	"02262"
"00459235"	"02262"
"00459236"	"02262"
"00459237"	"02262"
"00459238"	"02262"
"00459239"	"02262"
"00459240"	"02262"
"00459241"	"02262"
"00459242"	"02262"
"00459243"	"02262"
"00459244"	"02262"
"00459245"	"02262"
"00459246"	"02262"
"00459247"	"02262"
"00459248"	"02262"
"00459249"	"02262"
"00459250"	"02262"
"00459251"	"02262"
"00459252"	"02262"
"00459253"	"02262"
"00459254"	"02262"
"00459255"	"02262"
"00459256"	"02262"
"00459257"	"02262"
"00459258"	"02262"
"00459259"	"02262"
"00459260"	"02262"
"00459261"	"02262"
"00459262"	"02262"
"00459263"	"02262"
"00459264"	"02262"
"00459265"	"02262"
"00459266"	"02262"
"00459267"	"02262"
"00459268"	"02262"
"00459269"	"02262"
"00459270"	"02262"
"00459271"	"02262"
"00459272"	"02262"
"00459273"	"02262"
"00459274"	"02262"
"00459275"	"02262"
"00459276"	"02262"
"00459277"	"02262"
"00459278"	"02262"
"00459279"	"02262"
"00459280"	"02262"
"00459281"	"02262"
"00459282"	"02262"
"00459283"	"02262"
"00459284"	"02262"
"00459285"	"02262"
"00459286"	"02262"
"00459287"	"02262"
"00459288"	"02262"
"00459289"	"02262"
"00459290"	"02262"
"00459291"	"02262"
"00459292"	"02262"
"00459293"	"02262"
"00459294"	"02262"
"00459295"	"02262"
"00459296"	"02262"
"00459297"	"02262"
"00459298"	"02262"
"00459299"	"02262"
"00459300"	"02262"
"00459301"	"02262"
"00459302"	"02262"
"00459303"	"02262"
"00459304"	"02262"
"00459305"	"02262"
"00459306"	"02262"
"00459307"	"02262"
"00459308"	"02262"
"00459309"	"02262"
"00459310"	"02262"
"00459311"	"02262"
"00459312"	"02262"
"00459313"	"02262"
"00459314"	"02262"
"00459315"	"02262"
"00459316"	"02262"
"00459317"	"02262"
"00459318"	"02262"
"00459319"	"02262"
"00459320"	"02262"
"00459321"	"02262"
"00459322"	"02262"
"00459323"	"02262"
"00459324"	"02262"
"00459325"	"02262"
"00459326"	"02262"
"00459327"	"02262"
"00459328"	"02262"
"00459329"	"02262"
"00459330"	"02262"
"00459331"	"02262"
"00459332"	"02262"
"00459333"	"02262"
"00459334"	"02262"
"00459335"	"02262"
"00459336"	"02262"
"00459337"	"02262"
"00459338"	"02262"
"00459339"	"02262"
"00459340"	"02262"
"00459341"	"02262"
"00459342"	"02262"
"00459343"	"02262"
"00459344"	"02262"
"00459345"	"02262"
"00459346"	"02262"
"00459347"	"02262"
"00459348"	"02262"
"00459349"	"02262"
"00459350"	"02262"
"00459351"	"02262"
"00459353"	"02262"
"00459354"	"02262"
"00459355"	"02262"
"00459356"	"02262"
"00459357"	"02262"
"00459358"	"02262"
"00459359"	"02262"
"00459360"	"02262"
"00459361"	"02262"
"00459362"	"02262"
"00459363"	"02262"
"00459364"	"02262"
"00459365"	"02262"
"00459366"	"02262"
"00459371"	"02262"
"00459372"	"02262"
"00459373"	"02262"
"00459374"	"02262"
"00459375"	"02262"
"00459376"	"02262"
"00459377"	"02262"
"00459378"	"02262"
"00459379"	"02262"
"00459380"	"02262"
"00459381"	"02262"
"00459382"	"02262"
"00459383"	"02262"
"00459384"	"02262"
"00459385"	"02262"
"00459386"	"02262"
"00459387"	"02262"
"00459388"	"02262"
"00459389"	"02262"
"00459390"	"02262"
"00459391"	"02262"
"00459392"	"02262"
"00459393"	"02262"
"00459394"	"02262"
"00459395"	"02262"
"00459396"	"02262"
"00459397"	"02262"
"00459398"	"02262"
"00459399"	"02262"
"00459400"	"02262"
"00459404"	"02262"
"00459405"	"02262"
"00459425"	"02262"
"00459543"	"00381"
"00461084"	"04214"
"00461090"	"04214"
"00461099"	"04214"
"00461134"	"04214"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00187, 00198, 00254, 00308, 00318, 00381, 01157, 02262, 04214, 04215, 04249
## Count = 1818
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Birth/Gestational_age_wk}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000002805"	"00254"	"00004010"	"00155"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000003091"	"00308"	"00004374"	"00591"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008623"	"00318"	"00009921"	"00590"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008624"	"00318"	"00009922"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008625"	"00318"	"00009923"	"00590"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008626"	"00318"	"00009924"	"00579"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008635"	"00318"	"00009933"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008636"	"00318"	"00009934"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008637"	"00318"	"00009935"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008638"	"00318"	"00009936"	"00581"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008639"	"00318"	"00009937"	"00579"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008642"	"00318"	"00009940"	"00584"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008643"	"00318"	"00009941"	"00584"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008651"	"00318"	"00009949"	"00590"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008657"	"00318"	"00009955"	"00588"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008662"	"00318"	"00009960"	"00590"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008663"	"00318"	"00009961"	"00584"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000008664"	"00318"	"00009962"	"00579"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000038983"	"01157"	"00000208"	"00006"	"Familial, X-linked recessive"	""	"central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)"	""	""	"3w"	""	""	""	""	""	""	""	""	""
"0000038984"	"01157"	"00000209"	"00006"	"Familial, X-linked recessive"	""	"central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)"	""	""	"07y04m"	""	""	""	""	""	""	""	""	""
"0000066794"	"02262"	"00087257"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066795"	"02262"	"00087258"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066796"	"02262"	"00087259"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066797"	"02262"	"00087260"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066798"	"02262"	"00087261"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066799"	"02262"	"00087262"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066800"	"02262"	"00087263"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066801"	"02262"	"00087264"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066802"	"02262"	"00087265"	"00006"	"Familial, X-linked recessive"	""	"mild-moderate, typical X-linked juvenile\r\nretinoschisis, majority patients history of visual impairment appearing in early infancy;  one patient had congenital nystagmus; visual acuity primarily 0.9-0.2, little-no deterioration through-\r\nout life"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000066803"	"02262"	"00087266"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066804"	"02262"	"00087267"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066805"	"02262"	"00087268"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066806"	"02262"	"00087269"	"00006"	"Familial"	"28y"	"see paper; ..."	"06y"	""	""	""	""	""	""	""	""	"rs1"	"retinoschisis"	""
"0000066807"	"02262"	"00087270"	"00006"	"Familial"	"25y"	"see paper; ..."	"02y"	""	""	""	""	""	""	""	""	"rs1"	"retinoschisis"	""
"0000066808"	"02262"	"00087271"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066809"	"02262"	"00087272"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066810"	"02262"	"00087273"	"00006"	"Familial, X-linked recessive"	""	"typical X-linked juvenile retinoschisis; one patient had undergone asphyxia during neonatal age, suffers from mild hemiplegia,  epilepsy, scar in one hemispheres"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000066811"	"02262"	"00087274"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066812"	"02262"	"00087275"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066813"	"02262"	"00087276"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066814"	"02262"	"00087277"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066815"	"02262"	"00087278"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066816"	"02262"	"00087279"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066817"	"02262"	"00087280"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066818"	"02262"	"00087281"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066819"	"02262"	"00087282"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066820"	"02262"	"00087283"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066821"	"02262"	"00087284"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066822"	"02262"	"00087285"	"00221"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066823"	"02262"	"00087286"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066824"	"02262"	"00087287"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066825"	"02262"	"00087288"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066826"	"02262"	"00087289"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066827"	"02262"	"00087290"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066828"	"02262"	"00087291"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066829"	"02262"	"00087292"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066830"	"02262"	"00087293"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066831"	"02262"	"00087294"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066832"	"02262"	"00087295"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066833"	"02262"	"00087296"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066834"	"02262"	"00087297"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066835"	"02262"	"00087298"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066836"	"02262"	"00087299"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066837"	"02262"	"00087300"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066838"	"02262"	"00087301"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066839"	"02262"	"00087302"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066840"	"02262"	"00087303"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066841"	"02262"	"00087304"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066842"	"02262"	"00087305"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066843"	"02262"	"00087306"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066844"	"02262"	"00087307"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066845"	"02262"	"00087308"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066846"	"02262"	"00087309"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066847"	"02262"	"00087310"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066848"	"02262"	"00087311"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066849"	"02262"	"00087312"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066850"	"02262"	"00087313"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066851"	"02262"	"00087314"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066852"	"02262"	"00087315"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066853"	"02262"	"00087316"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066854"	"02262"	"00087317"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066855"	"02262"	"00087318"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066856"	"02262"	"00087319"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066857"	"02262"	"00087320"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066858"	"02262"	"00087321"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066859"	"02262"	"00087322"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066860"	"02262"	"00087323"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066861"	"02262"	"00087324"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066862"	"02262"	"00087325"	"00221"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066863"	"02262"	"00087326"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066864"	"02262"	"00087327"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066865"	"02262"	"00087328"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066866"	"02262"	"00087329"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066867"	"02262"	"00087330"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066868"	"02262"	"00087331"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066869"	"02262"	"00087332"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066870"	"02262"	"00087333"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066871"	"02262"	"00087334"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066872"	"02262"	"00087335"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066873"	"02262"	"00087336"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066874"	"02262"	"00087337"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066875"	"02262"	"00087338"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066876"	"02262"	"00087339"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066877"	"02262"	"00087340"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066878"	"02262"	"00087341"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066879"	"02262"	"00087342"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066880"	"02262"	"00087343"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066881"	"02262"	"00087344"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066882"	"02262"	"00087345"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066883"	"02262"	"00087346"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066884"	"02262"	"00087347"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066885"	"02262"	"00087348"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066886"	"02262"	"00087349"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066887"	"02262"	"00087350"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066888"	"02262"	"00087351"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066889"	"02262"	"00087352"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066890"	"02262"	"00087353"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066891"	"02262"	"00087354"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066892"	"02262"	"00087355"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066893"	"02262"	"00087356"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066894"	"02262"	"00087357"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066895"	"02262"	"00087358"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066896"	"02262"	"00087359"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066897"	"02262"	"00087360"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066898"	"02262"	"00087361"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066899"	"02262"	"00087362"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066900"	"02262"	"00087363"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066901"	"02262"	"00087364"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066902"	"02262"	"00087365"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066903"	"02262"	"00087366"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066904"	"02262"	"00087367"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066905"	"02262"	"00087368"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066906"	"02262"	"00087369"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066907"	"02262"	"00087370"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066908"	"02262"	"00087371"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066909"	"02262"	"00087372"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066910"	"02262"	"00087373"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066911"	"02262"	"00087374"	"00006"	"Familial"	""	""	"36y"	""	""	""	""	""	""	""	""	""	""	""
"0000066912"	"02262"	"00087375"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066913"	"02262"	"00087376"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066914"	"02262"	"00087377"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066915"	"02262"	"00087378"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066916"	"02262"	"00087379"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066917"	"02262"	"00087380"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066918"	"02262"	"00087381"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066919"	"02262"	"00087382"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066920"	"02262"	"00087383"	"00006"	"Familial"	""	"Rs with retinal white flecks"	""	""	""	""	""	""	""	""	""	""	""	""
"0000066921"	"02262"	"00087384"	"00006"	"Isolated (sporadic)"	""	"Rs with retinal white flecks"	""	""	""	""	""	""	""	""	""	""	""	""
"0000066922"	"02262"	"00087385"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066923"	"02262"	"00087386"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066924"	"02262"	"00087387"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066925"	"02262"	"00087388"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066926"	"02262"	"00087389"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066927"	"02262"	"00087390"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066928"	"02262"	"00087391"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066929"	"02262"	"00087392"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066930"	"02262"	"00087393"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066931"	"02262"	"00087394"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066932"	"02262"	"00087395"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066933"	"02262"	"00087396"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066934"	"02262"	"00087397"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066935"	"02262"	"00087398"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066936"	"02262"	"00087399"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066937"	"02262"	"00087400"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066938"	"02262"	"00087401"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066939"	"02262"	"00087402"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066940"	"02262"	"00087403"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066941"	"02262"	"00087404"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066942"	"02262"	"00087405"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066943"	"02262"	"00087406"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066944"	"02262"	"00087407"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066945"	"02262"	"00087408"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066946"	"02262"	"00087409"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066947"	"02262"	"00087410"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066948"	"02262"	"00087411"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066949"	"02262"	"00087412"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066950"	"02262"	"00087413"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066951"	"02262"	"00087414"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066952"	"02262"	"00087415"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066953"	"02262"	"00087416"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066954"	"02262"	"00087417"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066955"	"02262"	"00087418"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066956"	"02262"	"00087419"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066957"	"02262"	"00087420"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066958"	"02262"	"00087421"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066959"	"02262"	"00087422"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066960"	"02262"	"00087423"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066961"	"02262"	"00087424"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066962"	"02262"	"00087425"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066963"	"02262"	"00087426"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066964"	"02262"	"00087427"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066965"	"02262"	"00087428"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066966"	"02262"	"00087429"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066967"	"02262"	"00087430"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066968"	"02262"	"00087431"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066969"	"02262"	"00087432"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066970"	"02262"	"00087433"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066971"	"02262"	"00087434"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066972"	"02262"	"00087435"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066973"	"02262"	"00087436"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066974"	"02262"	"00087437"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066975"	"02262"	"00087438"	"00221"	"Familial, X-linked recessive"	""	"see paper; ..., poor vision; left divergent squint, advanced myopia, previous retinal detachment with markedly atrophic retinal pigment epithelium; right inferotemporal peripheral retinoschisis, early foveal schisis"	""	""	""	""	""	""	""	""	""	"RS1"	"poor vision"	""
"0000066976"	"02262"	"00087439"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066977"	"02262"	"00087440"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066978"	"02262"	"00087441"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066979"	"02262"	"00087442"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066980"	"02262"	"00087443"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066981"	"02262"	"00087444"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066982"	"02262"	"00087445"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066983"	"02262"	"00087446"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066984"	"02262"	"00087447"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066985"	"02262"	"00087450"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066986"	"02262"	"00087451"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066987"	"02262"	"00087452"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066988"	"02262"	"00087453"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066989"	"02262"	"00087454"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066990"	"02262"	"00087455"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066991"	"02262"	"00087456"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066992"	"02262"	"00087457"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066993"	"02262"	"00087458"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066994"	"02262"	"00087459"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066995"	"02262"	"00087460"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066996"	"02262"	"00087461"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066997"	"02262"	"00087462"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066998"	"02262"	"00087463"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000066999"	"02262"	"00087464"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067000"	"02262"	"00087465"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067001"	"02262"	"00087466"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067002"	"02262"	"00087467"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067003"	"02262"	"00087468"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067004"	"02262"	"00087469"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067005"	"02262"	"00087470"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067006"	"02262"	"00087471"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067007"	"02262"	"00087472"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067008"	"02262"	"00087473"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067009"	"02262"	"00087474"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067010"	"02262"	"00087475"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067011"	"02262"	"00087476"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067012"	"02262"	"00087477"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067013"	"02262"	"00087478"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067014"	"02262"	"00087479"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067015"	"02262"	"00087480"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067016"	"02262"	"00087481"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067017"	"02262"	"00087483"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067018"	"02262"	"00087484"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067019"	"02262"	"00087485"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067020"	"02262"	"00087486"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067021"	"02262"	"00087487"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067022"	"02262"	"00087488"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067023"	"02262"	"00087489"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067024"	"02262"	"00087490"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067025"	"02262"	"00087491"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067026"	"02262"	"00087493"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067027"	"02262"	"00087494"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067028"	"02262"	"00087495"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067029"	"02262"	"00087496"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067030"	"02262"	"00087497"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067031"	"02262"	"00087498"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067032"	"02262"	"00087499"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067033"	"02262"	"00087500"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067034"	"02262"	"00087501"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067035"	"02262"	"00087502"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067036"	"02262"	"00087503"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067037"	"02262"	"00087504"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067038"	"02262"	"00087505"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067039"	"02262"	"00087506"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067040"	"02262"	"00087507"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067041"	"02262"	"00087508"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067042"	"02262"	"00087509"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067043"	"02262"	"00087510"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067044"	"02262"	"00087511"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067045"	"02262"	"00087512"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067046"	"02262"	"00087513"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067047"	"02262"	"00087514"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067048"	"02262"	"00087515"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067049"	"02262"	"00087516"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067050"	"02262"	"00087517"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067051"	"02262"	"00087518"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067052"	"02262"	"00087519"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067053"	"02262"	"00087520"	"00006"	"Familial"	""	"Rs with retinal white flecks"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067054"	"02262"	"00087521"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067055"	"02262"	"00087522"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067056"	"02262"	"00087523"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067057"	"02262"	"00087524"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067058"	"02262"	"00087525"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067059"	"02262"	"00087526"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067060"	"02262"	"00087527"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067061"	"02262"	"00087528"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067062"	"02262"	"00087529"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067063"	"00198"	"00087530"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067064"	"02262"	"00087531"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067065"	"02262"	"00087532"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067066"	"02262"	"00087533"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067067"	"02262"	"00087534"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067068"	"02262"	"00087535"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067069"	"02262"	"00087536"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067070"	"02262"	"00087537"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067071"	"02262"	"00087538"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067072"	"02262"	"00087539"	"00006"	"Familial"	""	""	"5y"	""	""	""	""	""	""	""	""	""	""	""
"0000067073"	"02262"	"00087540"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067074"	"02262"	"00087541"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067075"	"02262"	"00087542"	"00221"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067076"	"02262"	"00087543"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067077"	"02262"	"00087544"	"00006"	"Unknown"	""	"Young patient with preserved b-wave"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067078"	"02262"	"00087545"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067079"	"02262"	"00087546"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067080"	"02262"	"00087547"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067081"	"02262"	"00087548"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067082"	"02262"	"00087549"	"00006"	"Familial"	""	"Mild"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067083"	"02262"	"00087550"	"00006"	"Familial"	""	"Mild"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067084"	"02262"	"00087551"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067085"	"02262"	"00087552"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067086"	"04214"	"00087553"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000067087"	"02262"	"00087554"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067088"	"02262"	"00087555"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067089"	"02262"	"00087556"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067090"	"02262"	"00087557"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067091"	"02262"	"00087558"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067092"	"02262"	"00087559"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067093"	"02262"	"00087560"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067094"	"02262"	"00087561"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067095"	"02262"	"00087562"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067096"	"02262"	"00087563"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067097"	"02262"	"00087564"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067098"	"02262"	"00087565"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067099"	"02262"	"00087566"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067100"	"02262"	"00087567"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067101"	"02262"	"00087568"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067102"	"02262"	"00087569"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067103"	"02262"	"00087570"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067104"	"02262"	"00087571"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067105"	"02262"	"00087572"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067106"	"02262"	"00087573"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067107"	"02262"	"00087574"	"00006"	"Isolated (sporadic)"	""	"Rs-like foveal cyst"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067108"	"02262"	"00087575"	"00006"	"Unknown"	"10y"	"see paper; ..."	"01y"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000067109"	"02262"	"00087576"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067110"	"02262"	"00087577"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067111"	"02262"	"00087578"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067112"	"02262"	"00087579"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067113"	"02262"	"00087580"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067114"	"02262"	"00087581"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067115"	"02262"	"00087582"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067116"	"02262"	"00087583"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067117"	"02262"	"00087584"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067118"	"02262"	"00087585"	"00006"	"Familial"	""	"Grandfather bietti crystalline retinopathy"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067119"	"02262"	"00087586"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067120"	"02262"	"00087587"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067121"	"02262"	"00087588"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067122"	"02262"	"00087589"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067123"	"02262"	"00087590"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067124"	"02262"	"00087591"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067125"	"02262"	"00087592"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067126"	"02262"	"00087593"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067127"	"02262"	"00087594"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067128"	"02262"	"00087595"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067129"	"02262"	"00087596"	"00006"	"Isolated (sporadic)"	""	"Bulls-eye maculopathy (negative erg)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067130"	"02262"	"00087597"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067131"	"02262"	"00087598"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067132"	"04249"	"00087599"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067133"	"02262"	"00087600"	"00006"	"Unknown"	"20y"	"see paper; ..."	"05y"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000067134"	"02262"	"00087601"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067135"	"02262"	"00087602"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067136"	"02262"	"00087603"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067137"	"02262"	"00087604"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067138"	"02262"	"00087605"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067139"	"02262"	"00087606"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067140"	"02262"	"00087607"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067141"	"02262"	"00087608"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067142"	"02262"	"00087609"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067143"	"02262"	"00087610"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067144"	"02262"	"00087611"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067145"	"02262"	"00087612"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067146"	"02262"	"00087613"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067147"	"02262"	"00087614"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067148"	"02262"	"00087615"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067149"	"02262"	"00087616"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067150"	"02262"	"00087617"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067151"	"02262"	"00087618"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067152"	"02262"	"00087619"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067153"	"02262"	"00087620"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067154"	"02262"	"00087621"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067155"	"02262"	"00087622"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067156"	"02262"	"00087623"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067157"	"02262"	"00087624"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067158"	"02262"	"00087625"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067159"	"02262"	"00087626"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067160"	"02262"	"00087627"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067161"	"02262"	"00087628"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067162"	"02262"	"00087629"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067163"	"02262"	"00087630"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067164"	"02262"	"00087631"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067165"	"02262"	"00087632"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067166"	"02262"	"00087633"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067167"	"02262"	"00087634"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067168"	"02262"	"00087635"	"00006"	"Familial"	""	"Age at onset 4y and 5y"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067169"	"02262"	"00087636"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067170"	"02262"	"00087637"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067171"	"02262"	"00087638"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067172"	"02262"	"00087639"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067173"	"02262"	"00087640"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067174"	"02262"	"00087641"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067175"	"02262"	"00087642"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067176"	"02262"	"00087643"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067177"	"02262"	"00087644"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067178"	"02262"	"00087645"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067179"	"02262"	"00087646"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., 10y-foveal schisis"	""	""	""	""	""	""	""	""	""	"RS1;Turner"	""	""
"0000067180"	"02262"	"00087647"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067181"	"02262"	"00087648"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067182"	"02262"	"00087649"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067183"	"02262"	"00087650"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067184"	"02262"	"00087651"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067185"	"02262"	"00087652"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067186"	"02262"	"00087653"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067187"	"02262"	"00087654"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067188"	"02262"	"00087655"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067189"	"02262"	"00087656"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067190"	"02262"	"00087657"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067191"	"02262"	"00087658"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067192"	"02262"	"00087659"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067193"	"02262"	"00087660"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067194"	"02262"	"00087661"	"00220"	"Familial"	""	"Oct bilateral typical foveal schisis."	""	""	""	""	""	""	""	""	""	""	""	""
"0000067195"	"02262"	"00087662"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067196"	"02262"	"00087663"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067197"	"02262"	"00087664"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067198"	"02262"	"00087665"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067199"	"02262"	"00087666"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067200"	"02262"	"00087667"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067201"	"02262"	"00087668"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067202"	"02262"	"00087669"	"00156"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067203"	"02262"	"00087670"	"00006"	"Familial"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067204"	"02262"	"00087671"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067205"	"02262"	"00087672"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067206"	"02262"	"00087673"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067207"	"02262"	"00087674"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067208"	"02262"	"00087675"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067209"	"02262"	"00087676"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067210"	"02262"	"00087677"	"00221"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067211"	"02262"	"00087678"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067212"	"02262"	"00087679"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067213"	"02262"	"00087680"	"00006"	"Unknown"	""	"Remarkably mild, prominent and asymmetric tapetal-like retinal sheen, more details see paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067214"	"02262"	"00087681"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067215"	"02262"	"00087682"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067216"	"02262"	"00087683"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067217"	"02262"	"00087684"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067218"	"02262"	"00087685"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067219"	"02262"	"00087686"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067220"	"02262"	"00087687"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067221"	"02262"	"00087688"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067222"	"02262"	"00087689"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000067223"	"02262"	"00087690"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067224"	"02262"	"00087691"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067225"	"02262"	"00087692"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067226"	"02262"	"00087693"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067227"	"02262"	"00087694"	"00006"	"Unknown"	""	"See paper, 18y follow-up"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067228"	"02262"	"00087695"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067229"	"02262"	"00087696"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067230"	"02262"	"00087697"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067231"	"02262"	"00087698"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067232"	"02262"	"00087699"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067233"	"02262"	"00087701"	"00006"	"Unknown"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067234"	"02262"	"00087702"	"00006"	"Familial"	""	"See paper"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067235"	"02262"	"00087703"	"00006"	"Unknown"	""	""	"3y"	""	""	""	""	""	""	""	""	""	""	""
"0000067236"	"02262"	"00087704"	"00156"	"Unknown"	""	""	"3y"	""	""	""	""	""	""	""	""	""	""	""
"0000067237"	"02262"	"00087705"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067238"	"02262"	"00087707"	"00006"	"Unknown"	""	""	"6y"	""	""	""	""	""	""	""	""	""	""	""
"0000067239"	"02262"	"00087708"	"00006"	"Unknown"	""	""	"6y"	""	""	""	""	""	""	""	""	""	""	""
"0000067240"	"02262"	"00087709"	"00006"	"Unknown"	""	""	"6y"	""	""	""	""	""	""	""	""	""	""	""
"0000067241"	"02262"	"00087710"	"00006"	"Unknown"	""	""	"8m"	""	""	""	""	""	""	""	""	""	""	""
"0000067242"	"02262"	"00087711"	"00006"	"Unknown"	""	""	"1y"	""	""	""	""	""	""	""	""	""	""	""
"0000067243"	"02262"	"00087712"	"00006"	"Familial"	""	""	"5y"	""	""	""	""	""	""	""	""	""	""	""
"0000067244"	"02262"	"00087713"	"00006"	"Unknown"	""	""	"3m"	""	""	""	""	""	""	""	""	""	""	""
"0000067245"	"02262"	"00087714"	"00006"	"Unknown"	""	""	"6y"	""	""	""	""	""	""	""	""	""	""	""
"0000067246"	"02262"	"00087715"	"00006"	"Unknown"	""	""	"4y"	""	""	""	""	""	""	""	""	""	""	""
"0000067247"	"02262"	"00087716"	"00221"	"Unknown"	""	""	"14y"	""	""	""	""	""	""	""	""	""	""	""
"0000067248"	"02262"	"00087717"	"00006"	"Unknown"	""	""	"6y"	""	""	""	""	""	""	""	""	""	""	""
"0000067249"	"02262"	"00087718"	"00006"	"Unknown"	""	""	"3y"	""	""	""	""	""	""	""	""	""	""	""
"0000067250"	"02262"	"00087719"	"00006"	"Unknown"	""	""	"3y"	""	""	""	""	""	""	""	""	""	""	""
"0000067251"	"02262"	"00087720"	"00006"	"Unknown"	""	""	"5y"	""	""	""	""	""	""	""	""	""	""	""
"0000067252"	"02262"	"00087721"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067253"	"02262"	"00087722"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067254"	"02262"	"00087723"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067255"	"02262"	"00087724"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067256"	"02262"	"00087725"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067257"	"02262"	"00087726"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067258"	"02262"	"00087727"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067259"	"02262"	"00087728"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067260"	"02262"	"00087729"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067261"	"02262"	"00087730"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067262"	"02262"	"00087731"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067263"	"02262"	"00087732"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067264"	"02262"	"00087733"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067265"	"02262"	"00087734"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067266"	"02262"	"00087735"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067267"	"02262"	"00087736"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067268"	"02262"	"00087737"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067269"	"02262"	"00087738"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067270"	"02262"	"00087739"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067271"	"02262"	"00087740"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067272"	"02262"	"00087741"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067273"	"02262"	"00087742"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067274"	"02262"	"00087743"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067275"	"02262"	"00087744"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067276"	"02262"	"00087745"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067277"	"00198"	"00087746"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067278"	"02262"	"00087747"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067279"	"02262"	"00087748"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067280"	"00198"	"00087749"	"00222"	"Familial"	""	"Typical foveal retinoschisis"	""	""	""	""	""	""	""	""	""	""	""	""
"0000067281"	"00187"	"00087750"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067282"	"02262"	"00087751"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067283"	"02262"	"00087752"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067284"	"02262"	"00087753"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067285"	"02262"	"00087754"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067286"	"02262"	"00087755"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067287"	"02262"	"00087756"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067288"	"02262"	"00087757"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067289"	"02262"	"00087758"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067290"	"02262"	"00087759"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067291"	"02262"	"00087760"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067292"	"02262"	"00087761"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067293"	"02262"	"00087762"	"00006"	"Unknown"	""	""	"44y"	""	""	""	""	""	""	""	""	""	""	""
"0000067294"	"02262"	"00087763"	"00006"	"Unknown"	""	""	"5y"	""	""	""	""	""	""	""	""	""	""	""
"0000067295"	"02262"	"00087764"	"00006"	"Unknown"	""	""	"7y"	""	""	""	""	""	""	""	""	""	""	""
"0000067296"	"02262"	"00087765"	"00006"	"Unknown"	""	""	"26y"	""	""	""	""	""	""	""	""	""	""	""
"0000067297"	"02262"	"00087766"	"00006"	"Unknown"	""	""	"7y"	""	""	""	""	""	""	""	""	""	""	""
"0000067298"	"02262"	"00087767"	"00006"	"Unknown"	""	""	"12y"	""	""	""	""	""	""	""	""	""	""	""
"0000067299"	"02262"	"00087768"	"00006"	"Unknown"	""	""	"7y"	""	""	""	""	""	""	""	""	""	""	""
"0000067300"	"02262"	"00087769"	"00006"	"Unknown"	""	""	"6m"	""	""	""	""	""	""	""	""	""	""	""
"0000067301"	"02262"	"00087770"	"00006"	"Unknown"	""	""	"13y"	""	""	""	""	""	""	""	""	""	""	""
"0000067302"	"02262"	"00087771"	"00006"	"Unknown"	""	""	"41y"	""	""	""	""	""	""	""	""	""	""	""
"0000067303"	"02262"	"00087772"	"00006"	"Unknown"	""	""	"40y"	""	""	""	""	""	""	""	""	""	""	""
"0000067304"	"02262"	"00087773"	"00006"	"Unknown"	""	""	"18y"	""	""	""	""	""	""	""	""	""	""	""
"0000067305"	"02262"	"00087774"	"00006"	"Unknown"	""	""	"53y"	""	""	""	""	""	""	""	""	""	""	""
"0000067306"	"02262"	"00087775"	"00006"	"Unknown"	""	""	"8y"	""	""	""	""	""	""	""	""	""	""	""
"0000067307"	"02262"	"00087776"	"00006"	"Unknown"	""	""	"53y"	""	""	""	""	""	""	""	""	""	""	""
"0000067308"	"02262"	"00087777"	"00006"	"Unknown"	""	""	"7y"	""	""	""	""	""	""	""	""	""	""	""
"0000067309"	"02262"	"00087778"	"00006"	"Unknown"	""	""	"42y"	""	""	""	""	""	""	""	""	""	""	""
"0000067310"	"02262"	"00087779"	"00006"	"Unknown"	""	""	"20y"	""	""	""	""	""	""	""	""	""	""	""
"0000067311"	"02262"	"00087780"	"00006"	"Unknown"	""	""	"34y"	""	""	""	""	""	""	""	""	""	""	""
"0000067312"	"02262"	"00087781"	"00006"	"Unknown"	""	""	"25y"	""	""	""	""	""	""	""	""	""	""	""
"0000067313"	"02262"	"00087782"	"00006"	"Unknown"	""	""	"17y"	""	""	""	""	""	""	""	""	""	""	""
"0000067314"	"02262"	"00087783"	"00006"	"Unknown"	""	""	"14y"	""	""	""	""	""	""	""	""	""	""	""
"0000067315"	"02262"	"00087784"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067316"	"02262"	"00087785"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000067317"	"02262"	"00087786"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067318"	"02262"	"00087787"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067319"	"02262"	"00087788"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067320"	"02262"	"00087789"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067321"	"02262"	"00087790"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067322"	"02262"	"00087791"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067323"	"02262"	"00087792"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067324"	"02262"	"00087793"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067325"	"02262"	"00087794"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067326"	"02262"	"00087795"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067327"	"02262"	"00087796"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067328"	"02262"	"00087797"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067329"	"02262"	"00087798"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067330"	"02262"	"00087799"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067331"	"02262"	"00087800"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067332"	"02262"	"00087801"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067333"	"02262"	"00087802"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067334"	"02262"	"00087803"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067335"	"02262"	"00087804"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067336"	"02262"	"00087805"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067337"	"02262"	"00087806"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067338"	"02262"	"00087807"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067339"	"02262"	"00087808"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067340"	"02262"	"00087809"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067341"	"02262"	"00087810"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067342"	"02262"	"00087811"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067343"	"02262"	"00087812"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067344"	"02262"	"00087813"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067345"	"02262"	"00087814"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067346"	"02262"	"00087815"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067347"	"02262"	"00087816"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067349"	"02262"	"00087818"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000067561"	"02262"	"00088054"	"00238"	"Isolated (sporadic)"	""	"Predominantly peripheral schisis"	"4y"	""	"4y"	""	""	""	""	""	""	""	""	""
"0000067562"	"02262"	"00088055"	"00238"	"Familial, X-linked"	""	"Macular schisis"	"0d"	""	"7y"	""	""	""	""	""	""	""	""	""
"0000067563"	"02262"	"00088056"	"00238"	"Isolated (sporadic)"	""	"Macular schisis, peripheral schisis"	"0d"	""	"7.5y"	""	""	""	""	""	""	""	""	""
"0000067564"	"02262"	"00088057"	"00238"	"Isolated (sporadic)"	""	"Macular schisis"	"11y"	""	"21y"	""	""	""	""	""	""	""	""	""
"0000067565"	"02262"	"00088058"	"00238"	"Isolated (sporadic)"	""	"Macular schisis"	"5y"	""	"5y"	""	""	""	""	""	""	""	""	""
"0000067566"	"02262"	"00088059"	"00238"	"Isolated (sporadic)"	""	"Macular schisis, peripheral schisis"	"4y"	""	"14y"	""	""	""	""	""	""	""	""	""
"0000067567"	"02262"	"00088060"	"00238"	"Isolated (sporadic)"	""	"Central/peripheral schisis"	"7y"	""	"9y"	""	""	""	""	""	""	""	""	""
"0000104311"	"02262"	"00132118"	"00006"	"Familial, X-linked recessive"	"09y"	"infantile; reading difficulties, never had full vision; 0.4/0.4 BCVA R/L (LogMAR)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000104312"	"02262"	"00132119"	"00006"	"Familial, X-linked recessive"	"12y"	"infantile; reading difficulties, tiredness eyes, text shimmering, never had full vision;0.2/0.3 BCVA R/L (LogMAR)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000104313"	"02262"	"00132120"	"00006"	"Familial, X-linked recessive"	"17y"	"infantile; near vision difficulties, never had full vision; 0.2/0.5 BCVA R/L (LogMAR)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000155408"	"02262"	"00207597"	"01244"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000157632"	"02262"	"00209026"	"00006"	"Familial, X-linked"	""	"Retinoschesis and optic atrophya"	""	""	""	""	""	""	""	""	""	"RS-1"	"retinoschisis"	""
"0000233989"	"04214"	"00308561"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233990"	"04214"	"00308562"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233991"	"04214"	"00308563"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233992"	"04214"	"00308564"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233993"	"04214"	"00308565"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233994"	"04214"	"00308566"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233995"	"04214"	"00308567"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233996"	"04214"	"00308568"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000234733"	"04214"	"00309413"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234734"	"04214"	"00309414"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234735"	"04214"	"00309415"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234736"	"04214"	"00309416"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234737"	"04214"	"00309417"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234738"	"04214"	"00309418"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234739"	"04214"	"00309419"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000234740"	"04214"	"00309420"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000246726"	"04214"	"00328500"	"00000"	"Familial, X-linked"	"2y"	"retinoschisis (HP:0030502)"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000251938"	"04214"	"00333754"	"00000"	"Familial, X-linked"	"26y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251939"	"04214"	"00333755"	"00000"	"Familial, X-linked"	"11y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251940"	"04214"	"00333756"	"00000"	"Familial, X-linked"	"33y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251941"	"04214"	"00333757"	"00000"	"Familial, X-linked"	"21y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251942"	"04214"	"00333758"	"00000"	"Familial, X-linked"	"16y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251943"	"04214"	"00333759"	"00000"	"Familial, X-linked"	"14y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251944"	"04214"	"00333760"	"00000"	"Familial, X-linked"	"32y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251945"	"04214"	"00333761"	"00000"	"Familial, X-linked"	"56y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251946"	"04214"	"00333762"	"00000"	"Familial, X-linked"	"16y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251947"	"04214"	"00333763"	"00000"	"Familial, X-linked"	"6y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251948"	"04214"	"00333764"	"00000"	"Familial, X-linked"	"11y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251949"	"04214"	"00333765"	"00000"	"Familial, X-linked"	"19y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000251950"	"04214"	"00333766"	"00000"	"Familial, X-linked"	"10y"	"clinical category IIIB1"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, juvenile, X-linked"	""
"0000253036"	"04214"	"00335321"	"02485"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000253394"	"04214"	"00335449"	"00006"	"Familial, X-linked"	""	"blurry optic disc with tortuous vessels"	""	""	""	""	""	""	""	""	""	""	""	""
"0000253907"	"04214"	"00335992"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000253908"	"04214"	"00335993"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000253960"	"04214"	"00358745"	"00000"	"Familial, X-linked"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000254644"	"04214"	"00359373"	"00000"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000269055"	"04214"	"00373846"	"00000"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000269149"	"04214"	"00373940"	"00000"	"Familial, X-linked"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"juvenile retinoschisis"	""
"0000271527"	"04214"	"00376319"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"Familial-X linked renitis pigmentosa XLRS"	""
"0000271528"	"04214"	"00376320"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"Familial-X linked renitis pigmentosa XLRS"	""
"0000271529"	"04214"	"00376321"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"Familial-X linked renitis pigmentosa XLRS"	""
"0000271530"	"04214"	"00376322"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"Familial-X linked renitis pigmentosa XLRS"	""
"0000273640"	"00198"	"00379785"	"01807"	"Unknown"	""	"Exudative vitreoretinopathy (HP:0030490); Retinoschisis (HP:0030502)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000273647"	"02262"	"00379792"	"03508"	"Familial, autosomal recessive"	""	"HP:0001141,\tHP:0001123,\tHP:0030502"	""	""	""	""	""	""	""	""	""	""	"retinoschisis, type 1, X-linked (RS-1)"	""
"0000277241"	"04214"	"00383456"	"00000"	"Familial, X-linked recessive"	""	""	"0y"	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000277242"	"04214"	"00383457"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000277243"	"04214"	"00383458"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000277244"	"04214"	"00383459"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278038"	"04214"	"00384253"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278039"	"04214"	"00384254"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278096"	"04214"	"00384311"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278103"	"04214"	"00384318"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278122"	"04214"	"00384337"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal detachment"	""
"0000278124"	"04214"	"00384339"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal detachment"	""
"0000278127"	"04214"	"00384342"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"family exudative vitreoretinopathy?"	""
"0000278133"	"04214"	"00384348"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"family exudative vitreoretinopathyou?"	""
"0000278150"	"04214"	"00384365"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278180"	"04214"	"00384395"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278201"	"04214"	"00384416"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278233"	"04214"	"00384448"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278242"	"04214"	"00384457"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000278264"	"04214"	"00384479"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000278274"	"04214"	"00384489"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000278275"	"04214"	"00384490"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"family exudative vitreoretinopathy? +retinal detachment"	""
"0000280531"	"04214"	"00386731"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000280597"	"04214"	"00386797"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000281631"	"04214"	"00388037"	"00000"	"Familial, X-linked"	""	"Tractional retinal detachment, vitreous hemorrhage, retinal dragging, peripheral avascular retinas"	"13y"	""	""	""	""	""	""	""	""	""	"Familial exudative vitreoretinopathy (FEVR)"	""
"0000281632"	"04214"	"00388037"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Bardet-Biedl syndrome (BBS)"	""
"0000281788"	"04214"	"00388195"	"00006"	"Familial, X-linked"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000282268"	"04214"	"00388727"	"00000"	"Familial, X-linked"	"34y"	"age at genetic diagnosis mentioned"	""	""	"32y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282297"	"04214"	"00388756"	"00000"	"Familial, X-linked"	"54y"	"age at genetic diagnosis mentioned"	""	""	"51y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282299"	"04214"	"00388758"	"00000"	"Familial, X-linked"	"13y"	"age at genetic diagnosis mentioned"	""	""	"6y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282306"	"04214"	"00388765"	"00000"	"Familial, X-linked"	"21y"	"age at genetic diagnosis mentioned"	""	""	"17y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282307"	"04214"	"00388766"	"00000"	"Familial, X-linked"	"11y"	"age at genetic diagnosis mentioned"	""	""	"8y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282320"	"04214"	"00388779"	"00000"	"Familial, X-linked"	"12y"	"age at genetic diagnosis mentioned"	""	""	"10y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282325"	"04214"	"00388784"	"00000"	"Familial, X-linked"	"30y"	"age at genetic diagnosis mentioned"	""	""	"26y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282328"	"04214"	"00388787"	"00000"	"Familial, X-linked"	"55y"	"age at genetic diagnosis mentioned"	""	""	"53y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282329"	"04214"	"00388788"	"00000"	"Familial, X-linked"	"9y"	"age at genetic diagnosis mentioned"	""	""	"7y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282331"	"04214"	"00388790"	"00000"	"Familial, X-linked"	"7y"	"age at genetic diagnosis mentioned"	""	""	"6y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282427"	"04214"	"00388886"	"00000"	"Familial, X-linked"	"53y"	"age at genetic diagnosis mentioned"	""	""	"51y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282428"	"04214"	"00388887"	"00000"	"Familial, X-linked"	"49y"	"age at genetic diagnosis mentioned"	""	""	"47y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282439"	"04214"	"00388898"	"00000"	"Familial, X-linked"	"63y"	"age at genetic diagnosis mentioned"	""	""	"61y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282444"	"04214"	"00388903"	"00000"	"Familial, X-linked"	"69y"	"age at genetic diagnosis mentioned"	""	""	"67y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282446"	"04214"	"00388905"	"00000"	"Familial, X-linked"	"33y"	"age at genetic diagnosis mentioned"	""	""	"32y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282451"	"04214"	"00388910"	"00000"	"Familial, X-linked"	"30y"	"age at genetic diagnosis mentioned"	""	""	"30y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282460"	"04214"	"00388919"	"00000"	"Familial, X-linked"	"17y"	"age at genetic diagnosis mentioned"	""	""	"16y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000282503"	"04214"	"00388962"	"00000"	"Familial, X-linked dominant"	"59y"	"age at genetic diagnosis mentioned"	""	""	"54y"	""	""	""	""	""	""	"unclassified / mixed"	""	""
"0000282504"	"04214"	"00388963"	"00000"	"Familial, X-linked dominant"	"28y"	"age at genetic diagnosis mentioned"	""	""	"22y"	""	""	""	""	""	""	"unclassified / mixed"	""	""
"0000284248"	"04214"	"00390760"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284284"	"04214"	"00390796"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284347"	"04214"	"00390859"	"00000"	"Familial, X-linked"	"21y-25y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284404"	"04214"	"00390916"	"00000"	"Familial, X-linked"	"41y-45y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284472"	"04214"	"00390984"	"00000"	"Familial, X-linked"	"11y-15y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284479"	"04214"	"00390991"	"00000"	"Familial, X-linked"	"26y-30y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284481"	"04214"	"00390993"	"00000"	"Familial, X-linked"	"36y-40y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284485"	"04214"	"00390997"	"00000"	"Familial, X-linked"	"41y-45y"	""	""	""	""	""	""	""	""	""	""	""	"X-linked retinoschisis (XLRS)"	""
"0000284824"	"04214"	"00391384"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis  (312700)"	"Retinoschisis  (312700)"	""
"0000284825"	"04214"	"00391385"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis (312700)"	"Retinoschisis (312700)"	""
"0000284839"	"04214"	"00391503"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284840"	"04214"	"00391504"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284841"	"04214"	"00391505"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284844"	"04214"	"00391508"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284845"	"04214"	"00391509"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284846"	"04214"	"00391510"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284847"	"04214"	"00391511"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284848"	"04214"	"00391512"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284849"	"04214"	"00391513"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284850"	"04214"	"00391514"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284851"	"04214"	"00391515"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000284852"	"04214"	"00391516"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000286654"	"04214"	"00393448"	"00000"	"Isolated (sporadic)"	"9y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286676"	"04214"	"00393470"	"00000"	"Isolated (sporadic)"	"24y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286677"	"04214"	"00393471"	"00000"	"Isolated (sporadic)"	"24y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286681"	"04214"	"00393475"	"00000"	"Familial, X-linked"	"10y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286682"	"04214"	"00393476"	"00000"	"Isolated (sporadic)"	"26y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286723"	"04214"	"00393517"	"00000"	"Familial, X-linked"	"8y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286755"	"04214"	"00393549"	"00000"	"Familial, X-linked"	"20y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286815"	"04214"	"00393609"	"00000"	"Familial, X-linked"	"5y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286936"	"04214"	"00393730"	"00000"	"Familial, X-linked"	"14y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000286951"	"04214"	"00393745"	"00000"	"Familial, X-linked"	"10y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000287018"	"04214"	"00393812"	"00000"	"Familial, X-linked"	"5y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000287043"	"04214"	"00393837"	"00000"	"Familial, X-linked"	"32y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000287072"	"04214"	"00393866"	"00000"	"Familial, X-linked"	"18y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000287094"	"04214"	"00393888"	"00000"	"Isolated (sporadic)"	"4y"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""
"0000287997"	"04214"	"00394797"	"00000"	"Familial, X-linked"	""	"diffuse atrophy in the right eye and sectoral retinal degeneration in the left eye had"	""	""	""	""	""	""	""	""	""	"inherited retinal disease"	""	""
"0000289088"	"04214"	"00395926"	"00000"	"Unknown"	"19y7m"	""	"2y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289089"	"04214"	"00395927"	"00000"	"Unknown"	"3y7m"	""	"2y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289114"	"04214"	"00395952"	"00000"	"Unknown"	"8y11m"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289147"	"04214"	"00395985"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289148"	"04214"	"00395986"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289149"	"04214"	"00395987"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289150"	"04214"	"00395988"	"00000"	"Familial, X-linked recessive"	""	"see paper; ..., visual acuity 20/80 OD/20/70 OS, refraction +6.50 sph OU, parafoveal cysts, no peripheral involvement; bilateral reduced scotopic ERG b-wave amplitude, electronegative ERG waveform"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000289151"	"04214"	"00395989"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289152"	"04214"	"00395990"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289153"	"04214"	"00395991"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289154"	"04214"	"00395992"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289155"	"04214"	"00395993"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289156"	"04214"	"00395994"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289157"	"04214"	"00395995"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289158"	"04214"	"00395996"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289159"	"04214"	"00395997"	"00000"	"Familial, X-linked recessive"	"45y"	"see paper; ..., bilateral acuity loss; atrophic macular thinning, abnormal retinal pigment epithelium pigmentation, atrophic retinal changes macular area right eye/periphery left eye, large bullous peripheral schisis"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000289160"	"04215"	"00395998"	"00000"	"Familial, X-linked recessive"	"13y"	"see papers; ..., atrophic macular thinning, classical foveal schisis; extensive central foveal cysts, no peripheral schisis; ERG b-wave amplitude normal, b/a-wave ratio subnormal"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000289165"	"04214"	"00396002"	"00000"	"Familial, X-linked recessive"	"44y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis, fundoscopy: foveal atrophy both eyes, best corrected visual acuity: 20/200 both eyes"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289166"	"04214"	"00396003"	"00000"	"Familial, X-linked recessive"	"8y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal schisis both eyes, best corrected visual acuity: 20/60 right eye; 20/50 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289167"	"04214"	"00396004"	"00000"	"Familial, X-linked recessive"	"10y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal schisis both eyes, best corrected visual acuity: 20/25 both eyes"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289168"	"04214"	"00396005"	"00000"	"Familial, X-linked recessive"	"34y"	"Electroretinography: nonrecordable, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: hand movement right eye; 20/300 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289169"	"04214"	"00396006"	"00000"	"Familial, X-linked recessive"	"8y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/250 right eye; 20/100 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289170"	"04214"	"00396007"	"00000"	"Familial, X-linked recessive"	"45y"	"Electroretinography: nonrecordable, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/300 right eye; 20/100 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289171"	"04214"	"00396008"	"00000"	"Familial, X-linked recessive"	"6y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/400 right eye; 20/100 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289172"	"04214"	"00396009"	"00000"	"Familial, X-linked recessive"	"2y"	"Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/25right eye; 20/200 left eye"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289173"	"02262"	"00396010"	"00006"	"Unknown"	"25y"	"see paper; ..."	"5y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289174"	"02262"	"00396011"	"00006"	"Unknown"	"13y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289175"	"02262"	"00396012"	"00006"	"Unknown"	"17y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289176"	"02262"	"00396013"	"00006"	"Unknown"	"9y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289177"	"02262"	"00396014"	"00006"	"Unknown"	"16y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289178"	"02262"	"00396015"	"00006"	"Unknown"	"41y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289179"	"02262"	"00396016"	"00006"	"Unknown"	"22y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289180"	"02262"	"00396017"	"00006"	"Unknown"	"32y"	"see paper; ..."	"8m"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289181"	"02262"	"00396018"	"00006"	"Unknown"	"22y"	"see paper; ..."	"4y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289182"	"02262"	"00396019"	"00006"	"Unknown"	"18y"	"see paper; ..."	"6y"	""	""	""	""	""	""	""	""	"RS1"	"retinischisis"	""
"0000289183"	"04214"	"00396020"	"00000"	"Familial, X-linked recessive"	""	"schisis elevation involving the macula with the inferior schisis touching the lens, ERG showed b-wave amplitude reduction"	""	""	"3m"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289184"	"04214"	"00396021"	"00000"	"Familial, X-linked recessive"	"14y"	"best corrected visual acuity: right eye 20/50, left eye 20/32-2, kinetic perimetry: constriction to 40deg nasally right eye, 50deg left eye to V4e targ"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289185"	"04214"	"00396022"	"00000"	"Familial, X-linked recessive"	"29y"	"best corrected visual acuity: right eye 20/50-1, left eye 20/63, kinetic perimetry: Full to V4e and I4e right eye, constricted to 40deg nasally to V4e target"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289196"	"04214"	"00396034"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289197"	"04214"	"00396035"	"00000"	"Familial, X-linked recessive"	"11y"	"best-corrected visual acuity right/left eye: 0.4/0.2, macular retinoschisis, peripheral retinoschisis, optical coherence tomography: retinoschisis"	"6y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289198"	"04214"	"00396036"	"00000"	"Familial, X-linked recessive"	"19y"	"best-corrected visual acuity right/left eye: 0.1/0.2, macular retinoschisis, peripheral pigmental disorder"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289199"	"04214"	"00396037"	"00000"	"Familial, X-linked recessive"	"18y"	"best-corrected visual acuity right/left eye: 0.4/0.2, macular retinoschisis, peripheral retinal degeneration"	"8y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289200"	"04214"	"00396038"	"00000"	"Familial, X-linked recessive"	"5y"	"best-corrected visual acuity right/left eye: 0.3/0.7, macular retinoschisis, peripheral retinoschisis, retinal hole, electroretinography: ratio of b wave amplitude to a wave amplitude reduced"	"3y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289201"	"04214"	"00396039"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity right/left eye: 0.2/0.3, pigmental disorder, blunted foveal reflex,"	"7y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289202"	"04214"	"00396040"	"00000"	"Familial, X-linked recessive"	"5y"	"best-corrected visual acuity right/left eye: finger counting/0.03, pigmental disorder, blunted foveal reflex, blunted foveal reflex, electroretinography: ratio of b wave amplitude to a wave amplitude reduced"	"4y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289203"	"04214"	"00396041"	"00000"	"Familial, X-linked recessive"	"6y"	"best-corrected visual acuity right/left eye: 0.3/finger counting, macular retinoschisis, peripheral retinoschisis, strabismus, electroretinography: ratio of b wave amplitude to a wave amplitude reduced"	"5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289204"	"04214"	"00396042"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289205"	"04214"	"00396043"	"00000"	"Familial, X-linked recessive"	"12y"	"best-corrected visual acuity right/left eye: 0.3/0.03, no macular changes, peripheral retinoschisis, retinal hole"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289206"	"04214"	"00396044"	"00000"	"Familial, X-linked recessive"	"21y"	"best-corrected visual acuity right/left eye: 0.6/0.4, macular retinoschisis, No, electroretinography: ratio of b wave amplitude to a wave amplitude reduced"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289207"	"04214"	"00396045"	"00000"	"Familial, X-linked recessive"	"22y"	"best-corrected visual acuity right/left eye: 0.2/0.4, macular retinoschisis, peripheral retinoschisis, strabismus"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289208"	"04214"	"00396046"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289209"	"04214"	"00396047"	"00000"	"Familial, X-linked recessive"	"9y"	"best-corrected visual acuity right/left eye: 0.4/0.3, macular retinoschisis, peripheral retinoschisis, optical coherence tomography: retinoschisis"	"6y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289210"	"04214"	"00396048"	"00000"	"Familial, X-linked recessive"	"1y"	"best corrected visual acuity right/left eye: 0.1/0.2, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: not available, retinoschisis of lower retina quadrants"	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289211"	"04214"	"00396049"	"00000"	"Familial, X-linked recessive"	"2y"	"best corrected visual acuity right/left eye: 0.8/0.2, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, myopic astigmatism, peripheral retinoschisis"	""	""	""	"vitreous hemorrhage"	""	""	""	""	""	"retinoschisis"	""	""
"0000289212"	"04214"	"00396050"	"00000"	"Familial, X-linked recessive"	"1y"	"best corrected visual acuity right/left eye: 0.1/0.3, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased"	""	""	""	"strabismus, reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289213"	"04214"	"00396051"	"00000"	"Familial, X-linked recessive"	"7y"	"best corrected visual acuity right/left eye: 0.4/0.4, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289214"	"04214"	"00396052"	"00000"	"Familial, X-linked recessive"	"10y"	"best corrected visual acuity right/left eye: 0.3/0.4, no macular reflex, pigment deposits, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, vitreal floaters"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289215"	"04214"	"00396053"	"00000"	"Familial, X-linked recessive"	"7y"	"best corrected visual acuity right/left eye: 0.8/0.2, pigment deposits, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, hyperopic astigmatism"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289216"	"04214"	"00396054"	"00000"	"Familial, X-linked recessive"	"3y"	"best corrected visual acuity right/left eye: 0.1/0.1, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: not available, initial disgnosis: cystoid macular edema"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289217"	"04214"	"00396055"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 0.5/0.6, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, initial disgnosis: CME; central scotoma"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289218"	"04214"	"00396056"	"00000"	"Familial, X-linked recessive"	"11y"	"best corrected visual acuity right/left eye: 1.0/0.6, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: nonspecific (hemorrhage), vitreoretinal proliferation, floaters"	""	""	""	"vitreous hemorrhage"	""	""	""	""	""	"retinoschisis"	""	""
"0000289219"	"04214"	"00396057"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 0.4/0.1, no macular reflex, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, retinoschisis of lower retina quadrants"	""	""	""	"reduced visual acuity"	""	""	""	""	""	"retinoschisis"	""	""
"0000289224"	"04214"	"00396062"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289225"	"04214"	"00396063"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289226"	"04214"	"00396064"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289227"	"04214"	"00396065"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289228"	"04214"	"00396066"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289229"	"04214"	"00396067"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289230"	"04214"	"00396068"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289231"	"04214"	"00396069"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289232"	"04214"	"00396070"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289233"	"04214"	"00396071"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289234"	"04214"	"00396072"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289235"	"04214"	"00396073"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289236"	"04214"	"00396074"	"00000"	"Familial, X-linked recessive"	"13y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289237"	"04214"	"00396075"	"00000"	"Familial, X-linked recessive"	"13y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289238"	"04214"	"00396076"	"00000"	"Familial, X-linked recessive"	"18y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289239"	"04214"	"00396077"	"00000"	"Familial, X-linked recessive"	"25y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289240"	"04214"	"00396078"	"00000"	"Familial, X-linked recessive"	"35y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289241"	"04214"	"00396079"	"00000"	"Familial, X-linked recessive"	"38y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289242"	"04214"	"00396080"	"00000"	"Familial, X-linked recessive"	"43y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289243"	"04214"	"00396081"	"00000"	"Familial, X-linked recessive"	"43y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289244"	"04214"	"00396082"	"00000"	"Familial, X-linked recessive"	"49y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289245"	"04214"	"00396083"	"00000"	"Familial, X-linked recessive"	"55y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289246"	"04214"	"00396084"	"00000"	"Familial, X-linked recessive"	"57y"	""	""	""	""	"strabismus"	""	""	""	""	""	"retinoschisis"	""	""
"0000289247"	"04214"	"00396085"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289248"	"04214"	"00396086"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289249"	"04214"	"00396087"	"00000"	"Isolated (sporadic)"	"7y"	"best-corrected visual acuity right/left eye: 20/800, 20/50, central visual field defect right eye, foveal/macular cystic changes both eyes, no macular atrophy, peripheral visual field defect inferonasally in both eyes, peripheral flat schisis superiorly and inferotemporally more in then left than in right eye, no retinal detachment,"	"7y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289250"	"04214"	"00396088"	"00000"	"Isolated (sporadic)"	"21y"	"best-corrected visual acuity right/left eye: 20/50+1, 20/40�1, central visual field defect both eyes, foveal/macular cystic changes both eyes, no macular atrophy, no peripheral visual field defect, peripheral flat schisis superiorly and inferotemporally more in then left than in right eye, no retinal detachment, electropretinography right/left eye a wave=240, b wave=318(?V)/ a wave=240, b wave=318(?V)"	"5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289251"	"04214"	"00396089"	"00000"	"Familial, X-linked recessive"	"15y"	"best corrected visual acuity right/left eye: 0.1/0.1, both eyes: macular retinoschisis, both eyes: peripheral retinoschisis"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289252"	"04214"	"00396090"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 0.4/0.5, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"4y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289253"	"04214"	"00396091"	"00000"	"Familial, X-linked recessive"	"24y"	"best corrected visual acuity right/left eye: 0.1/0.05, both eyes: macular retinoschisis, right eye: peripheral retinoschisis, left eye: unknown, cataract (both eyes), exotropia and  retinal detachment (left eye)"	"8y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289254"	"04214"	"00396092"	"00000"	"Familial, X-linked recessive"	"8y"	"best corrected visual acuity right/left eye: 0.25/0.3, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"8y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289255"	"04214"	"00396093"	"00000"	"Familial, X-linked recessive"	"8y"	"best corrected visual acuity right/left eye: 0.4/0.4, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis, electroretinography: reduced photopic and 30Hz responses"	"6y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289256"	"04214"	"00396094"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 0.5/0.02, both eyes: peripheral retinoschisis"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289257"	"04214"	"00396095"	"00000"	"Familial, X-linked recessive"	"5y"	"best corrected visual acuity right/left eye: 0.2/0.1, both eyes: macular retinoschisis, both eyes: peripheral retinoschisis"	"5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289258"	"04214"	"00396096"	"00000"	"Familial, X-linked recessive"	"5y"	"best corrected visual acuity right/left eye: 0.2/0.1, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"3y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289259"	"04214"	"00396097"	"00000"	"Familial, X-linked recessive"	"34y"	"best corrected visual acuity right/left eye: 0.2/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289260"	"04214"	"00396098"	"00000"	"Familial, X-linked recessive"	"5y"	"best corrected visual acuity right/left eye: 0.4/hand movement, both eyes: macular retinoschisis, right eye: no peripheral retinoschisis, left eye: unknown,  retinal detachment (left eye)"	"5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289261"	"04214"	"00396099"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 0.05/1,left eye: peripheral retinoschisis, right eye: unknown, exotropia and vitreous hemorrhage (right eye), electroretinography: b-wave reduced"	"6y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289262"	"04214"	"00396100"	"00000"	"Familial, X-linked recessive"	"41y"	"best corrected visual acuity right/left eye: 0.3/0.15, both eyes:macular atrophy, both eyes: no peripheral retinoschisis"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289263"	"04214"	"00396101"	"00000"	"Familial, X-linked recessive"	"9y"	"best corrected visual acuity right/left eye: 0.1/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"8y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289264"	"04214"	"00396102"	"00000"	"Familial, X-linked recessive"	"7y"	"best corrected visual acuity right/left eye: 0.3/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289265"	"04214"	"00396103"	"00000"	"Familial, X-linked recessive"	"4y"	"best corrected visual acuity right/left eye: 0.02/0.4, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis"	"4y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289266"	"04214"	"00396104"	"00000"	"Familial, X-linked recessive"	"27y"	"best corrected visual acuity right/left eye: 0.06/0.06, both eyes: macular retinoschisis, large activity, both eyes: no peripheral retinoschisis and nystagmus, electroretinography: b-wave reduced"	"<5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289267"	"04214"	"00396105"	"00000"	"Familial, X-linked recessive"	"39y"	"best-corrected visual acuity right/left eye:  0.2/0.2, cartwheel-like appearance and RPE pigmentation abnormalities in both eyes; RPE atrophy of the fovea in both eyes, macular schisis, dysfunction of cone cells, rod cells, and phototransduction"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289268"	"04214"	"00396106"	"00000"	"Familial, X-linked recessive"	"37y"	"best-corrected visual acuity right/left eye:  0.2/0.3, cartwheel-like appearance and RPE pigmentation abnormalities in both eyes, macular schisis, dysfunction of cone cells and phototransduction"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289269"	"04214"	"00396107"	"00000"	"Familial, X-linked recessive"	"13y"	"best-corrected visual acuity right/left eye:  0.2/0.2, cartwheel-like appearance and RPE pigmentation abnormalities in both eyes; RPE atrophy of the fovea in right eye; inferior retinoschisis in both eyes  macular and peripheral schisis Dysfunction of cone cells, rod cells, and phototransduction"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289270"	"04214"	"00396108"	"00000"	"Familial, X-linked recessive"	"11y"	"best-corrected visual acuity right/left eye:  0.5/0.7, cartwheel-like appearance and RPE pigmentation abnormalities in both eyes, macular schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289271"	"04214"	"00396109"	"00000"	"Familial, X-linked recessive"	"9y"	"best-corrected visual acuity right/left eye:  0.3/0.2, cartwheel-like appearance and RPE pigmentation abnormalities in both eyes, macular schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289275"	"04214"	"00396111"	"00000"	"Familial, X-linked recessive"	"59y"	"best-corrected visual acuity right/left eye: hand movement/hand movement; reduced visual ability in childhood, which deteriorated further in early life, stable for at least 25 years. Seven years earlier, cryotherapy was performed elsewhere for suspected bilateral Coats disease. Funduscopy: the macular retina appeared atrophic, hyperpigmentary changes and chorioretinal scarring towards the periphery. Fundus autofluorescence: a mottled reduced signal of the central retina, a ring of increased AF at 1 to 2 disc diameters from the foveal center, and a virtually absent AF signal within areas of chorioretinal scarring. Optical coherence tomography: retinal thinning and a reduced contrast between different retinal layers"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289276"	"04214"	"00396112"	"00000"	"Familial, X-linked recessive"	"36y"	"best-corrected visual acuity right/left eye: 0.4/0.4; long-standing moderately reduced visual acuity, funduscopy: macular retinal pigment epithelium irregularities, some yellow�white spots, and a slightly wrinkled appearing reflex of the internal limiting membrane, periphery and retinal vesselsnormal. Fundus autofluorescence: increased foveal signal and a ring of increased AF at about 2 disc diameters eccentricity, macular pigment distribution was abnormal with a relatively reduced density in the foveal center; optical coherence tomography: macular thinning mainly resulting from thinning of the photoreceptor layer with loss of the two hyperreflective bands that are commonly referred to represent the external limiting membrane and the ellipsoid zone. The ring of enhanced AF correlated with the loss of these two hyperreflective bands. Electroretinography: reduced scotopic and photopic responses and a reduced a/b ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289277"	"04214"	"00396113"	"00000"	"Familial, X-linked recessive"	"45y"	"best-corrected visual acuity right/left eye: 0.05/0.05; early-onset low visual acuity with further deterioration within the last decades, Funduscopy: discreet macular spoke-wheel pattern well recognizable on fundus autofluorescence, with areas of enhanced and reduced AF signal resulting from displaced macular pigment, optical coherence tomography: splitting of retinal layers, electroretinography: reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289278"	"04214"	"00396114"	"00000"	"Familial, X-linked recessive"	"21y"	"best-corrected visual acuity right/left eye: 0.3/0.5; reduced visual acuity since childhood, marked central and peripheral schisis, central pigment mottling, and enhanced foveal fundus autofluorescence, optical coherence tomography: subtle intraretinal cavities,  electroretinography: similar to older family members (reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses)"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289279"	"04214"	"00396115"	"00000"	"Familial, X-linked recessive"	"23y"	"best-corrected visual acuity right/left eye: 0.6/0.4; reduced visual acuity since childhood, minimal central irregularities on funduscopy and fundus autofluorescence imaging; optical coherence tomography: subtle intraretinal cavities, electroretinography: similar to older family members (reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses)"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289283"	"04214"	"00396116"	"00000"	"Familial, X-linked recessive"	"7y"	"characteristic phenotype of XLRS: stellate cystic changes of the region of the retina, a splitting of the neurosensory retina, and visual deterioration, temporal retinal detachment, visual acuity had gradually decreased since 5 years old"	"5y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289284"	"04214"	"00396117"	"00000"	"Familial, X-linked recessive"	"8m"	"eyes could not follow moving objects; anemia"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289285"	"04214"	"00396118"	"00000"	"Familial, X-linked recessive"	"37y"	"Best corrected visual acuity right/left eye: 0.4/0.7, funduscopy:  retinal blurring in the macula with discrete edema, resembling the �cartwheel� sign, optical coherence tomography: intraretinal schisis cysts, electroretinography: reduced b-wave amplitude"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289286"	"04214"	"00396119"	"00000"	"Familial, X-linked recessive"	"9y"	"Best corrected visual acuity right/left eye: 0.5/0.4, optical coherence tomography: edema, electroretinography: electronegative record"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289287"	"04214"	"00396120"	"00000"	"Familial, X-linked recessive"	"6y"	"Best corrected visual acuity right/left eye: 0.5/0.5, optical coherence tomography: edema, electroretinography: electronegative record"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289288"	"04214"	"00396121"	"00000"	"Familial, X-linked recessive"	"39y"	"visual acuity: 0.3,  visual field not affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289289"	"04214"	"00396122"	"00000"	"Familial, X-linked recessive"	"43y"	"visual acuity: 0.81,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289290"	"04214"	"00396123"	"00000"	"Familial, X-linked recessive"	"42y"	"visual acuity: 0.68,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289291"	"04214"	"00396124"	"00000"	"Familial, X-linked recessive"	"14y"	"visual acuity: 0.52,  visual field not affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289292"	"04214"	"00396125"	"00000"	"Familial, X-linked recessive"	"28y"	"visual acuity: 0.49,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289293"	"04214"	"00396126"	"00000"	"Familial, X-linked recessive"	"26y"	"visual acuity: 0.46,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289294"	"04214"	"00396127"	"00000"	"Familial, X-linked recessive"	"20y"	"visual acuity: 0.43,  visual field not affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289295"	"04214"	"00396128"	"00000"	"Familial, X-linked recessive"	"31y"	"visual acuity: 0.6,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289296"	"04214"	"00396129"	"00000"	"Familial, X-linked recessive"	"11y"	"visual acuity: 0.12,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289297"	"04214"	"00396130"	"00000"	"Familial, X-linked recessive"	"32y"	"visual acuity: 0.62,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289298"	"04214"	"00396131"	"00000"	"Familial, X-linked recessive"	"20y"	"visual acuity: 0.37,  visual field affected by schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289299"	"04214"	"00396133"	"00000"	"Familial, X-linked recessive"	"42y"	"Best corrected visual acuity right/left eye: 0.15/0.3 in the. Funduscopy: bilateral spoke wheel-appearing maculopathy. Spectral-domain optical coherence tomography: foveoschisis in the left eye, adaptive optics: left eye showed spoke wheel retinal folds thinner than those in fundus photographs. Follow-up: foveal thickness in the and the number of retinal folds in the AO images were reduced, full-field electroretinography: amplitudes reduced in the fovea and also in the peripheral areas in both eyes; Goldmann visual field: central scotomas in both eyes"	""	""	"30y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289300"	"04214"	"00396134"	"00000"	"Familial, X-linked recessive"	""	"bilateral central atrophy without foveoschisis in the fundus photographs and spectral-domain optical coherence tomography images"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289301"	"04214"	"00396135"	"00000"	"Familial, X-linked recessive"	"17y"	"Funduscopy: bilateral spoke-wheel pattern in the macular area and peripheral schisis with large holes in the inferotemporal quadrant of both eyes; Mizuo-Nakamura phenomenon in the peripheral retina; Spectral Domain Optic Coherence Tomography: retinal cysts in the foveal area and extended up to the vascular arcades. Electroretinogram: negative"	"17y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289302"	"04214"	"00396136"	"00000"	"Familial, X-linked recessive"	"12y"	"best corrected visual acuity right/left eye: 20/50_ 20/40, large cyst in multilayer in both eyes by optical coherence tomography, schisis and linkage in fundus autofluorescence"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289303"	"04214"	"00396137"	"00000"	"Familial, X-linked recessive"	"5y"	"schisis in both eyes"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289304"	"04214"	"00396138"	"00000"	"Familial, X-linked recessive"	"6y"	"best corrected visual acuity right/left eye: 20/63_ 20/160, large cyst in multilayer in both eyes by optical coherence tomography, schisis"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289305"	"04214"	"00396139"	"00000"	"Familial, X-linked recessive"	"22y"	"best corrected visual acuity right/left eye: 20/25_20/20, mild cysts in inner nuclear layer in both eyes by optical coherence tomography"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289306"	"04214"	"00396140"	"00000"	"Familial, X-linked recessive"	"61y"	"best corrected visual acuity right/left eye: 20/200_20/400, retinoschisis change in right eye; macular atrophy in left eye by optical coherence tomography, pigment epithelium atrophy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289307"	"04214"	"00396141"	"00000"	"Familial, X-linked recessive"	"8m"	"very bullous anterior retinal elevations, posterior retinal corrugations, and cystic foveae that appeared to represent severe XLRS with bilateral chronic rhegmatogenous retinal detachments and macular holes"	""	""	""	"poor visual behavior"	""	""	""	""	""	"retinoschisis"	""	""
"0000289308"	"04214"	"00396142"	"00000"	"Familial, X-linked recessive"	"18y"	"decrease in visual acuity, stellate-shaped cavities in the macular region on the retinal exam, electroretinography: decrease in the b-wave amplitude; response to the treatment:  the appearance of macular thickening was limited by sustained therapy with topical CAI, avoiding the return to the pretreatment levels"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289309"	"04214"	"00396143"	"00000"	"Familial, X-linked recessive"	"20y"	"decrease in visual acuity, stellate-shaped cavities in the macular region on the retinal exam, electroretinography: decrease in the b-wave amplitude; response to the treatment: initial improvement in cystoid macular edema was not associated with visual acuity changes (during therapy with oral acetazolamide), followed by a marked rebound effect after cessation of  the therapy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289310"	"04214"	"00396144"	"00000"	"Familial, X-linked recessive"	"17y"	"last available medical records reported a best corrected visual acuity of 0.125 right eye, and 0.1 S left eye (LE) at 17 years of age"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289311"	"04214"	"00396145"	"00000"	"Familial, X-linked recessive"	""	"slight opacity of the lens (posterior cataract) was found in left eye. Fundus examination showed spoke wheel maculopathy in both eyes, with retinoschisis in the inferior and nasal sectors and posterior holes that extended almost to the inferior macular arcades only in LE (stable since 1990). Optical coherence tomography: cystic macular edema. Goldmann Visual Field: slight constriction of peripheral isopters in the superior sector of right eye and slight constriction of peripheral isopters in the superior and nasal sectors of LE. Best corrected visual acuity of 0.3 in RE and 0.2 in LE"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289312"	"04214"	"00396146"	"00000"	"Familial, X-linked recessive"	""	"exotropia of both eyes (convergent strabismus) since early infancy (5 months of age); a severe form of juvenile retinoschisis was diagnosed at 7 months of age on the basis of massive vitreous hemorrhage (situated between the retinoschisis and posterior hyaloid or in the retinoschisis itself) of the RE and retinoschisis extending from the optic papilla to the temporal periphery and just under the macula (not detached) in the LE. At 1 year, he underwent vitrectomy with silicon oil for retinal detachment in RE followed by cataract extraction at 1.5 years of age. At 2 years, he underwent a second vitrectomy due to total retinal detachment with vitreoretinal tractions in aphakia in RE. The visual acuity measurement revealed negligible light perception. The LE showed moderate vitreous hemorrhage and intraschisis hemorrhage, treated with vitrectomy followed by injection of gas into the posterior segment of the globe, innerwall retinectomy, membrane peeling, endolaser photocoagulation, perfluorocarbon liquid, and silicone oil exchange.BCVA: 0.3 in LE. At 4.5y retinal detachment and vitreoretinal proliferation of LE were diagnosed. The patient currently has neurosensory nystagmus, ectopic pupil, and many synechiae at 360 in both eyes (more severe in RE), as well as no light perception."	"5m"	""	"7m"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289313"	"04214"	"00396147"	"00000"	"Familial, X-linked recessive"	""	"typical common XLRS phenotype without complications. Best corrected visual acuity : 0.1 right eye, but only perception of light in left eye. The patient also has Daltonism, like his maternal uncle."	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289314"	"04214"	"00396148"	"00000"	"Familial, X-linked recessive"	"3m"	"funduscopy: right eye - severe schisis reaching the posterior pole and preventing visualization of the fovea, left eye the inferior schisis was complicated by an intra-retinal haemorrhage; optical coherence tomography: right eye the bullous elevated schisis prevented foveal visualization, left eye: macular schisis with intraretinal separation in different retinal layers (intraretinal cysts could be seen in the inner nuclear, outer plexiform and outer nuclear layer), extending beyond the foveal area; electroretinography: absence of the b-wave and a nearly normal a-wave"	"3m"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289315"	"04214"	"00396149"	"00000"	"Familial, X-linked recessive"	"3m"	"funduscopy: right eye - severe bullous peripheral schisis with pre-retinal and intra-retinal haemorrhages, left eye schisis from the inferior quadrant shrouding to the posterior pole; optical coherence tomography: both eyes - macular schisis with intraretinal separation in different retinal layers (intraretinal cysts could be seen in the inner nuclear, outer plexiform and outer nuclear layer), extending beyond the foveal area; electroretinography: absence of the b-wave and a nearly normal a-wave"	"3m"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289316"	"04214"	"00396150"	"00000"	"Familial, X-linked recessive"	"7y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289317"	"04214"	"00396151"	"00000"	"Isolated (sporadic)"	"10y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289318"	"04214"	"00396152"	"00000"	"Familial, X-linked recessive"	"3y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289319"	"04214"	"00396153"	"00000"	"Isolated (sporadic)"	"10y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289320"	"04214"	"00396154"	"00000"	"Familial, X-linked recessive"	"4y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289321"	"04214"	"00396155"	"00000"	"Isolated (sporadic)"	"6y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289322"	"04214"	"00396156"	"00000"	"Isolated (sporadic)"	"8y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289323"	"04214"	"00396157"	"00000"	"Familial, X-linked recessive"	"3y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289324"	"04214"	"00396158"	"00000"	"Isolated (sporadic)"	"6y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289325"	"04214"	"00396159"	"00000"	"Isolated (sporadic)"	"6y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289326"	"04214"	"00396160"	"00000"	"Isolated (sporadic)"	"5y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289327"	"04214"	"00396161"	"00000"	"Familial, X-linked recessive"	"38y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289328"	"04214"	"00396162"	"00000"	"Isolated (sporadic)"	"11y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289329"	"04214"	"00396163"	"00000"	"Isolated (sporadic)"	"3y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289330"	"04214"	"00396164"	"00000"	"Isolated (sporadic)"	"7y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289331"	"04214"	"00396165"	"00000"	"Isolated (sporadic)"	"5y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289332"	"04214"	"00396166"	"00000"	"Isolated (sporadic)"	"25y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289333"	"04214"	"00396167"	"00000"	"Isolated (sporadic)"	"11y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289334"	"04214"	"00396168"	"00000"	"Familial, X-linked recessive"	"3y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289335"	"04214"	"00396169"	"00000"	"Isolated (sporadic)"	"8y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289336"	"04214"	"00396170"	"00000"	"Familial, X-linked recessive"	"7y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289337"	"04214"	"00396171"	"00000"	"Isolated (sporadic)"	"8y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289338"	"04214"	"00396172"	"00000"	"Familial, X-linked recessive"	"10y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289339"	"04214"	"00396173"	"00000"	"Isolated (sporadic)"	"7m"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289340"	"04214"	"00396174"	"00000"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289341"	"04214"	"00396175"	"00000"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289342"	"04214"	"00396176"	"00000"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289343"	"04214"	"00396177"	"00000"	"Isolated (sporadic)"	"10y"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289507"	"04214"	"00396345"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289508"	"04214"	"00396346"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289509"	"04214"	"00396347"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289510"	"04214"	"00396348"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289511"	"04214"	"00396349"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289512"	"04214"	"00396350"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289513"	"04214"	"00396351"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289514"	"04214"	"00396352"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289515"	"04214"	"00396353"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289516"	"04214"	"00396354"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289517"	"04214"	"00396355"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289518"	"04214"	"00396356"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289519"	"04214"	"00396357"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289520"	"04214"	"00396358"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289521"	"04214"	"00396359"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289522"	"04214"	"00396360"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289523"	"04214"	"00396361"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289524"	"04214"	"00396362"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289525"	"04214"	"00396363"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289526"	"04214"	"00396364"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289527"	"04214"	"00396365"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289528"	"04214"	"00396366"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289529"	"04214"	"00396367"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289530"	"04214"	"00396368"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289531"	"04214"	"00396369"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289532"	"04214"	"00396370"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289533"	"04214"	"00396371"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289534"	"04214"	"00396372"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289535"	"04214"	"00396373"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289536"	"04214"	"00396374"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289537"	"04214"	"00396375"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289538"	"04214"	"00396376"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289539"	"04214"	"00396377"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289540"	"04214"	"00396378"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289541"	"04214"	"00396379"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289542"	"04214"	"00396380"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289543"	"04214"	"00396381"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289544"	"04214"	"00396382"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289545"	"04214"	"00396383"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289546"	"04214"	"00396384"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289547"	"04214"	"00396385"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289548"	"04214"	"00396386"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289549"	"04214"	"00396387"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289550"	"04214"	"00396388"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289551"	"04214"	"00396389"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289552"	"04214"	"00396390"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289553"	"04214"	"00396391"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289554"	"04214"	"00396392"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289555"	"04214"	"00396393"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289556"	"04214"	"00396394"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289557"	"04214"	"00396395"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289558"	"04214"	"00396396"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289559"	"04214"	"00396397"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289560"	"04214"	"00396398"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289561"	"04214"	"00396399"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289562"	"04214"	"00396400"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289563"	"04214"	"00396401"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289564"	"04214"	"00396402"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289565"	"04214"	"00396403"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289566"	"04214"	"00396404"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289567"	"04214"	"00396405"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289568"	"04214"	"00396406"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289569"	"04214"	"00396407"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289583"	"04214"	"00396421"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000289593"	"04214"	"00396431"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio:"	""	""	"58y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289594"	"04214"	"00396432"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20160; 20/ 60, macular schisis, peripheral retinoschisis, vitreous hemorrhage right eye, no retinal detachment, electroretinography scotopic max b/a ratio: >l"	""	""	"18y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289595"	"04214"	"00396433"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, right eye retinal pigment epithelium atrophy, peripheral retinoschisis right eye, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"23y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289596"	"04214"	"00396434"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): hand motion; 20/50, macular schisis, peripheral retinoschisis both eyes, vitreous hemorrhage both eyes, Surgery for severe proliferative vitreoretinopathy right eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"6y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289597"	"04214"	"00396435"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/60; 20/50, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: not tested"	""	""	"6y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289598"	"04214"	"00396436"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/ 1000; 20/1000, retinal pigment epithelium atrophy, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: >l"	""	""	"52y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289599"	"04214"	"00396437"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, peripheral retinoschisis right eye, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"42y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289600"	"04214"	"00396438"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, retinal pigment epithelium atrophy, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: not tested"	""	""	"72y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289601"	"04214"	"00396439"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/40 ; 20/40, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: >l"	""	""	"18y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289602"	"04214"	"00396440"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): light perception ; 20/60, macular schisis, peripheral retinoschisis left eye, no vitreous hemorrhage, Phthisis after surgery for severe proliferative vitreoretinopathy right eye, electroretinography scotopic max b/a ratio: <l"	""	""	"17y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289603"	"04214"	"00396441"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): no light perception ; 20/25, macular schisis left eye, no peripheral retinoschisis,  no vitreous hemorrhage, neovascular glaucoma and Coats\'-like appearance right eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"5y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289604"	"04214"	"00396442"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/400, macular schisis right eye, retinal pigment epithelium atrophy left eye, peripheral retinoschisis left eye, no vitreous hemorrhage, Subretinal fibrosis left eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"6y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289605"	"04214"	"00396443"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/1000; 20/2000, macular schisis, peripheral retinoschisis, vitreous hemorrhage, Exudation, electroretinography scotopic max b/a ratio: not tested"	""	""	"5y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289606"	"04214"	"00396444"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): not tested, macular schisis, hole left eye, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: not tested"	""	""	"5y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289607"	"04214"	"00396445"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/40 ; 20/30, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: not tested"	""	""	"10y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289608"	"04214"	"00396446"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, hole left eye, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"22y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289609"	"04214"	"00396447"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/60 ; 20/ 60, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: >l, normal"	""	""	"11y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289610"	"04214"	"00396448"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): light perception; 20/300, macular schisis, no peripheral retinoschisis, left eye, no vitreous hemorrhage, Coats\'-like appearance right eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"4y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289611"	"04214"	"00396449"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): no light perception; 20/300, macular schisis left eye, peripheral retinoschisis left eye, vitreous hemorrhage left eye, retinal detachment left eye, phthisis right eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"7y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289612"	"04214"	"00396450"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/200 ; 20/60, macular schisis, right eye retinal pigment epithelium atrophy, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"51y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289613"	"04214"	"00396451"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): 20/30 ; 20/30, macular schisis, no peripheral retinoschisis,  no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"30y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289614"	"04214"	"00396452"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): counting fingers; 201200, Macular schisis, peripheral retinoschisis, no vitreous hemorrhage, retinal detachment, electroretinography scotopic max b/a ratio: <l"	""	""	"41y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289615"	"04214"	"00396453"	"00000"	"Familial, X-linked recessive"	""	"best-corrected visual acuity (right ; left eye): counting fingers; 20/100, Macular schisis, peripheral retinoschisis, no vitreous hemorrhage, Surgery for severe proliferative vitreoretinopathy roght eye, electroretinography scotopic max b/a ratio: not tested"	""	""	"31y"	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289627"	"04214"	"00396466"	"00000"	"Familial, X-linked recessive"	""	"retinoschisis with developmental delay, sensorineural hearing loss, and reduced axial tone"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289650"	"04214"	"00396489"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""	""
"0000289651"	"04214"	"00396490"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	""	""
"0000289817"	"04214"	"00396656"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289818"	"04214"	"00396657"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289819"	"04214"	"00396658"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289820"	"04214"	"00396659"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289821"	"04214"	"00396660"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289822"	"04214"	"00396661"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289823"	"04214"	"00396662"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289824"	"04214"	"00396663"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289825"	"04214"	"00396664"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289826"	"04214"	"00396665"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289827"	"04214"	"00396666"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289828"	"04214"	"00396667"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289829"	"04214"	"00396668"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289830"	"04214"	"00396669"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289831"	"04214"	"00396670"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289832"	"04214"	"00396671"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289833"	"04214"	"00396672"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289834"	"04214"	"00396673"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289835"	"04214"	"00396674"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289836"	"04214"	"00396675"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289837"	"04214"	"00396676"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289838"	"04214"	"00396677"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289839"	"04214"	"00396678"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289840"	"04214"	"00396679"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289841"	"04214"	"00396680"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289842"	"04214"	"00396681"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289843"	"04214"	"00396682"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289844"	"04214"	"00396683"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289845"	"04214"	"00396684"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289846"	"04214"	"00396685"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289847"	"04214"	"00396686"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289848"	"04214"	"00396687"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289849"	"04214"	"00396688"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289850"	"04214"	"00396689"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289851"	"04214"	"00396690"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289852"	"04214"	"00396691"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289853"	"04214"	"00396692"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289854"	"04214"	"00396693"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289855"	"04214"	"00396694"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289856"	"04214"	"00396695"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289857"	"04214"	"00396696"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289858"	"04214"	"00396697"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289859"	"04214"	"00396698"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289860"	"04214"	"00396699"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289861"	"04214"	"00396700"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289862"	"04214"	"00396701"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289863"	"04214"	"00396702"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289864"	"04214"	"00396703"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289865"	"04214"	"00396704"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289866"	"04214"	"00396705"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: electronegative"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289867"	"04214"	"00396706"	"00000"	"Familial, X-linked recessive"	""	"electroretinography: non-electronegative dark-adapted 10.0 b/a ratio"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289868"	"04214"	"00396707"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289886"	"04214"	"00396725"	"00000"	"Familial, X-linked recessive"	"41y"	"marked reduction of best-corrected visual acuity, spectral domain optical coherence tomography: cystic degeneration primarily involving the inner nuclear layer, though some cysts were detected in the outer plexiform layer aand in the ganglion cell layer; ten-year follow-up: progressive retinal thickening and coalescence of the cysts"	"9y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289888"	"04214"	"00396727"	"00000"	"Familial, X-linked recessive"	"8y"	"Inferior peripheral retinoschisis, best corrected visual acuity right_left eye: 20/40 _20/50, intraocular pressure (mmHg) right_left eye: 17_19"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289889"	"04214"	"00396728"	"00000"	"Familial, X-linked recessive"	"14y"	"No peripheral retinoschisis, best corrected visual acuity right_left eye: 20/60 _20/60, intraocular pressure (mmHg) right_left eye: 15_14"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289890"	"04214"	"00396729"	"00000"	"Familial, X-linked recessive"	"12y"	"No peripheral retinoschisis, best corrected visual acuity right_left eye: 20/125_20/30, intraocular pressure (mmHg) right_left eye: 17_16"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289891"	"04214"	"00396730"	"00000"	"Familial, X-linked recessive"	"41y"	"best-corrected visual acuity: 0.5 in both eyes. Ophthalmoscopy: bilateral wheel-like maculopathy; spectral domain optical coherence tomography: pronounced inner retinal cysts in the foveal area, foveal schisis; electroretinography: marked reduction of the b wave"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289892"	"04214"	"00396731"	"00000"	"Familial, X-linked recessive"	""	"poor visual acuity"	""	""	""	""	""	""	""	""	""	"retinoschisis"	"cystic maculopathy"	""
"0000289893"	"04214"	"00396732"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289894"	"04214"	"00396733"	"00000"	"Familial, X-linked recessive"	"60y"	"Stage 2 (intermediate) disease, best corrected visual acuity both eyes 0.9; hypopigmented ring at the macula, surrounding an area of normal pigmentation confirmed by autofluorescence; optical coherence tomography: intraretinal cystic spaces, but lacking complete outer retinal atrophy; incidental vitreo-foveal traction"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289895"	"04214"	"00396734"	"00000"	"Familial, X-linked recessive"	"71y"	"Stage 3 (advanced) disease, best corrected visual acuity both eyes 1.0, macular atrophy  which appears as hypoautofluorescence with a hyperautofluorescent ring, corresponds to outer retinal atrophy without schitic intraretinal space on optical coherence tomography"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289896"	"04214"	"00396735"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289897"	"04214"	"00396736"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289898"	"04214"	"00396737"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289899"	"04214"	"00396738"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289900"	"04214"	"00396739"	"00000"	"Familial, X-linked recessive"	""	"bilateral Stage 1 disease"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289901"	"04214"	"00396740"	"00000"	"Familial, X-linked recessive"	""	"bilateral Stage 1 disease"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289902"	"04214"	"00396741"	"00000"	"Familial, X-linked recessive"	"09y"	"Lack of macular reflex bilaterally, spectral domain optical coherence tomography: macular schisis with large intraretinal separation mainly in the inner nuclear layer, less in the outer plexiform, outer nuclear layer and ganglion cell layer, extending beyond the foveal area and a certain amount and size of cavities formation; peripheral schisis inferiorly and nasally, with light traction, additional lamellar hole in the inner layer and obliterated vessels in the left eye; patient underwent the standard automated perimetry of 30 degrees, but it couldn\'t be evaluated correctly due to a high amount of fixation losses and errors; full-field electroretinography: typical selective decrease or absence of the b-wave as compared to the a-wave (negative ERG)"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289903"	"04214"	"00396742"	"00000"	"Familial, X-linked recessive"	"12y"	"Lack of macular reflex bilaterally, spectral domain optical coherence tomography: macular schisis with large intraretinal separation mainly in the inner nuclear layer, less in the outer plexiform, outer nuclear layer and ganglion cell layer, extending beyond the foveal area and a certain amount and size of cavities formation; demarcation lines nasally in the right eye and paramacular temporal in the left eye; patient underwent the standard automated perimetry of 30 degrees, but it couldn\'t be evaluated correctly due to a high amount of fixation losses and errors; full-field electroretinography: typical selective decrease or absence of the b-wave as compared to the a-wave (negative ERG)"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289904"	"04214"	"00396743"	"00000"	"Familial, X-linked recessive"	"17y"	"Lack of macular reflex bilaterally, spectral domain optical coherence tomography: macular schisis with large intraretinal separation mainly in the inner nuclear layer, less in the outer plexiform, outer nuclear layer and ganglion cell layer, extending beyond the foveal area and a certain amount and size of cavities formation; no changes in the peripheral retina; patient underwent the standard automated perimetry of 30 degrees, which was normal; full-field electroretinography: typical selective decrease or absence of the b-wave as compared to the a-wave (negative ERG)"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289905"	"04214"	"00396744"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289906"	"04214"	"00396745"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289907"	"04214"	"00396746"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289908"	"04214"	"00396747"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289909"	"04214"	"00396748"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289910"	"04214"	"00396749"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289911"	"04214"	"00396750"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289912"	"04214"	"00396751"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289913"	"04214"	"00396752"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289914"	"04214"	"00396753"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289915"	"04214"	"00396754"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289916"	"04214"	"00396755"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289917"	"04214"	"00396756"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289918"	"04214"	"00396757"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289919"	"04214"	"00396758"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289920"	"04214"	"00396759"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289921"	"04214"	"00396760"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289922"	"04214"	"00396761"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289923"	"04214"	"00396762"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289924"	"04214"	"00396763"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289925"	"04214"	"00396764"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289926"	"04214"	"00396765"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289927"	"04214"	"00396766"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289928"	"04214"	"00396767"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289929"	"04214"	"00396768"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289930"	"04214"	"00396769"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289931"	"04214"	"00396770"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289932"	"04214"	"00396771"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289933"	"04214"	"00396772"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289934"	"04214"	"00396773"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289935"	"04214"	"00396774"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289936"	"04214"	"00396775"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289937"	"04214"	"00396776"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289938"	"04214"	"00396777"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289939"	"04214"	"00396778"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289940"	"04214"	"00396779"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289941"	"04214"	"00396780"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289942"	"04214"	"00396781"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289943"	"04214"	"00396782"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289944"	"04214"	"00396783"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289945"	"04214"	"00396784"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289946"	"04214"	"00396785"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289947"	"04214"	"00396786"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289948"	"04214"	"00396787"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289949"	"04214"	"00396788"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289950"	"04214"	"00396789"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289951"	"04214"	"00396790"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289952"	"04214"	"00396791"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289953"	"04214"	"00396792"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289954"	"04214"	"00396793"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289955"	"04214"	"00396794"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289956"	"04214"	"00396795"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289957"	"04214"	"00396796"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289958"	"04214"	"00396797"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289959"	"04214"	"00396798"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289960"	"04214"	"00396799"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000289961"	"04214"	"00396801"	"00000"	"Familial, X-linked recessive"	"4y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: single eye, cataract"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289962"	"04214"	"00396802"	"00000"	"Familial, X-linked recessive"	"6y"	"foveal schisis/ foveal schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: not tested, vitiligo, tapetal reflex"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289963"	"04214"	"00396803"	"00000"	"Familial, X-linked recessive"	"9y"	"foveal schisis/ foveal schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes, tapetal reflex"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289964"	"04214"	"00396804"	"00000"	"Familial, X-linked recessive"	"7y"	"foveal schisis/ foveal schisis, electroretinography right/left eye: electronegative/ reduced, optical coherence tomography: both eyes, tapetal reflex"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289965"	"04214"	"00396805"	"00000"	"Familial, X-linked recessive"	"9y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: not tested/not tested, optical coherence tomography: not tested, vitreous veils, cataract"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289966"	"04214"	"00396806"	"00000"	"Familial, X-linked recessive"	"21y"	"foveal schisis/ foveal schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289967"	"04214"	"00396807"	"00000"	"Familial, X-linked recessive"	"40y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: both eyes, epilepsy"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289968"	"04214"	"00396808"	"00000"	"Familial, X-linked recessive"	"25y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: electronegative/non recordable, optical coherence tomography: single eye, cataract"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289969"	"04214"	"00396809"	"00000"	"Familial, X-linked recessive"	"45y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes, cataract"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289970"	"04214"	"00396810"	"00000"	"Familial, X-linked recessive"	"41y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: not tested/not tested, optical coherence tomography: both eyes"	""	""	""	""	"No secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289971"	"04214"	"00396811"	"00000"	"Familial, X-linked recessive"	"14y"	"foveal schisis + peripheral schisis (retinal detachment)/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: not tested/not tested, optical coherence tomography: not tested, vitreous veils"	""	""	""	""	"Very mild secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289972"	"04214"	"00396812"	"00000"	"Familial, X-linked recessive"	"9y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: not tested/not tested, optical coherence tomography: single eye"	""	""	""	""	"Very mild secretion"	""	""	""	""	"retinoschisis"	""	""
"0000289973"	"04214"	"00396813"	"00000"	"Familial, X-linked recessive"	"7y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes, tapetal reflex"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289974"	"04214"	"00396814"	"00000"	"Familial, X-linked recessive"	"27y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289975"	"04214"	"00396815"	"00000"	"Familial, X-linked recessive"	"25y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289976"	"04214"	"00396816"	"00000"	"Familial, X-linked recessive"	"11y"	"foveal schisis/foveal schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289977"	"04214"	"00396817"	"00000"	"Familial, X-linked recessive"	"12y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: both eyes"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289978"	"04214"	"00396818"	"00000"	"Familial, X-linked recessive"	"19y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: not tested/not tested, optical coherence tomography: single eye, vitreous veils, aphakia"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289979"	"04214"	"00396819"	"00000"	"Familial, X-linked recessive"	"26y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: both eyes, glaucoma"	""	""	""	""	"Secreted"	""	""	""	""	"retinoschisis"	""	""
"0000289980"	"04214"	"00396820"	"00000"	"Familial, X-linked recessive"	"8y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: single eye"	""	""	""	""	"Null expression"	""	""	""	""	"retinoschisis"	""	""
"0000289981"	"04214"	"00396821"	"00000"	"Familial, X-linked recessive"	"12y"	"foveal schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: reduced/ reduced, optical coherence tomography: not tested"	""	""	""	""	"Null expression"	""	""	""	""	"retinoschisis"	""	""
"0000289982"	"04214"	"00396822"	"00000"	"Familial, X-linked recessive"	"2y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis (retinal detachment), electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: single eye, delayed milestone, hearing loss"	""	""	""	""	"No data"	""	""	""	""	"retinoschisis"	""	""
"0000289983"	"04214"	"00396823"	"00000"	"Familial, X-linked recessive"	"11y"	"foveal schisis + peripheral schisis/ foveal schisis + peripheral schisis, electroretinography right/left eye: electronegative/electronegative, optical coherence tomography: not tested"	""	""	""	""	"No data"	""	""	""	""	"retinoschisis"	""	""
"0000289984"	"04214"	"00396824"	"00000"	"Familial, X-linked recessive"	"39y"	"foveal schisis + peripheral schisis/foveal schisis + peripheral schisis, electroretinography right/left eye: not tested/not tested, optical coherence tomography: not tested, pseudophakia"	""	""	""	""	"No data"	""	""	""	""	"retinoschisis"	""	""
"0000290019"	"04214"	"00396861"	"00000"	"Isolated (sporadic)"	"4m"	"best corrected visual acuity: 0.02/NA, refraction right/left eye:  ?0.375/+0.375, foveal retinochisis right/left eye: ?/ +, peripheral retinochisis right/left eye: +/+, electroretinography: a-amplitude (?V) 46/38.3, b/a ratio 0.61/0.66; both eyes: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290020"	"04214"	"00396862"	"00000"	"Isolated (sporadic)"	"2y"	"best corrected visual acuity: not available, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: +/+, electroretinography: a-amplitude (?V) not available, b/a ratio not available; right eye: vitreous hemorrahge"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290021"	"04214"	"00396863"	"00000"	"Isolated (sporadic)"	"36y"	"best corrected visual acuity: 0.8/0.3, refraction right/left eye:  + 0.625/?0.375, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 312.5/226, b/a ratio 0.78/0.93;"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290022"	"04214"	"00396864"	"00000"	"Isolated (sporadic)"	"8y"	"best corrected visual acuity: 0.3/0.3, refraction right/left eye:  + 4/ + 3.625, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + / +, electroretinography: a-amplitude (?V) 227/167, b/a ratio 0.91/0.95; left eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290023"	"04214"	"00396865"	"00000"	"Isolated (sporadic)"	"6y"	"best corrected visual acuity: 0.5/0.7, refraction right/left eye:  + 1.125/ + 0.75, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + / +, electroretinography: a-amplitude (?V) 267.5/not available, b/a ratio 0.56/NA"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290024"	"04214"	"00396866"	"00000"	"Familial, X-linked recessive"	"4y"	"best corrected visual acuity: 0.4/0.2, refraction right/left eye:  + 5.5/ + 2, foveal retinochisis right/left eye: +/ +, peripheral retinochisis right/left eye: + / +, electroretinography: a-amplitude (?V) 490/416, b/a ratio 1.11/0.97; left eye: vitreous hemorrahge, vitrectomy, both eyes: retinal fold"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290025"	"04214"	"00396867"	"00000"	"Familial, X-linked recessive"	"11y"	"best corrected visual acuity: 1.2/1.2, refraction right/left eye:  + 0.75/ + 0.75, foveal retinochisis right/left eye: +/ +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290026"	"04214"	"00396868"	"00000"	"Isolated (sporadic)"	"3y"	"best corrected visual acuity: 0.6/0.06, refraction right/left eye:  + 5.25/ + 6.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 345/274, b/a ratio 0.96/1.2"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290027"	"04214"	"00396869"	"00000"	"Familial, X-linked recessive"	"16y"	"best corrected visual acuity: 0.5/0.02, refraction right/left eye:  0/?7.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 467/360, b/a ratio 0.55/0.7; left eye: vitreous hemorrahge"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290028"	"04214"	"00396870"	"00000"	"Familial, X-linked recessive"	"23y"	"best corrected visual acuity: 0.5/0.5, refraction right/left eye:  + 0.5/ + 0.5, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 314/331, b/a ratio 0.3/0.25"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290029"	"04214"	"00396871"	"00000"	"Familial, X-linked recessive"	"20y"	"best corrected visual acuity: 0.4/0.4, refraction right/left eye:  ?0.25/0, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 375/374, b/a ratio 0.58/0.47"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290030"	"04214"	"00396872"	"00000"	"Familial, X-linked recessive"	"12y"	"best corrected visual acuity: 0.05/0.8, refraction right/left eye:  + 2/?0.25, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 383/403, b/a ratio 0.74/0.83; right eye: Retinal hole"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290031"	"04214"	"00396873"	"00000"	"Familial, X-linked recessive"	"7y"	"best corrected visual acuity: 0.4/0.3, refraction right/left eye:  + 0.5/?0.25, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/ +, electroretinography: a-amplitude (?V) 457/401, b/a ratio 0.9/0.76"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290032"	"04214"	"00396874"	"00000"	"Isolated (sporadic)"	"17y"	"best corrected visual acuity: 0.3/0.3, refraction right/left eye:  ?3/?2.5, foveal retinochisis right/left eye: +/ +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 129/146, b/a ratio 1.11/1.16"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290033"	"04214"	"00396875"	"00000"	"Isolated (sporadic)"	"13y"	"best corrected visual acuity: 0.8/0.7, refraction right/left eye:  ?2/?2, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 185/195, b/a ratio 0.79/0.76"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290034"	"04214"	"00396876"	"00000"	"Isolated (sporadic)"	"13y"	"best corrected visual acuity: 0.5/0.9, refraction right/left eye:  ?1/?0.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 229/252, b/a ratio 1.31/1.28"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290035"	"04214"	"00396877"	"00000"	"Isolated (sporadic)"	"32y"	"best corrected visual acuity: 0.5/0.4, refraction right/left eye:  ?2.375/ +0.875, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 119.6/134.3, b/a ratio 0.76/0.86"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290036"	"04214"	"00396878"	"00000"	"Familial, X-linked recessive"	"16y"	"best corrected visual acuity: 0.3/0.15, refraction right/left eye:  ?1.75/?2.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 362/344, b/a ratio 0.55/0.67"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290037"	"04214"	"00396879"	"00000"	"Familial, X-linked recessive"	"9y"	"best corrected visual acuity: 0.7/0.06, refraction right/left eye:  ?1.25/NA, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290038"	"04214"	"00396880"	"00000"	"Isolated (sporadic)"	"50y"	"best corrected visual acuity: 0.2/0.2, refraction right/left eye:  ?2.75/?1.625, foveal retinochisis right/left eye: N/N, peripheral retinochisis right/left eye: N/N, electroretinography: a-amplitude (?V) 370/370, b/a ratio 0.78/0.8"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290039"	"04214"	"00396881"	"00000"	"Familial, X-linked recessive"	"42y"	"best corrected visual acuity: CF/0.2, refraction right/left eye:  NA/ + 0.25, foveal retinochisis right/left eye: N/ +, peripheral retinochisis right/left eye: N/+, electroretinography: a-amplitude (?V) not available/344.5, b/a ratio NA/0.76"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290040"	"04214"	"00396882"	"00000"	"Familial, X-linked recessive"	"47y"	"best corrected visual acuity: 0.15/0.3, refraction right/left eye:  + 0.25/ + 0.75, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 308/243, b/a ratio 1.07/1.18"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290041"	"04214"	"00396883"	"00000"	"Isolated (sporadic)"	"3y"	"best corrected visual acuity: not available, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/+, electroretinography: a-amplitude (?V) ~0/~0, b/a ratio not available; left eye: retinal degeneration"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290042"	"04214"	"00396884"	"00000"	"Isolated (sporadic)"	"18y"	"best corrected visual acuity: 0.4/0.08, refraction right/left eye:  + 0.75/ + 1.5 (IOL), foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 250/168, b/a ratio 0.72/0.61; left eye: vitrectomy, IOL"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290043"	"04214"	"00396885"	"00000"	"Isolated (sporadic)"	"6y"	"best corrected visual acuity: 0.08/0.5, refraction right/left eye:  + 6/ + 6, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /-, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290044"	"04214"	"00396886"	"00000"	"Isolated (sporadic)"	"49y"	"best corrected visual acuity: 0.1/0.1, refraction right/left eye:  + 5/ + 6, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 309.5/137, b/a ratio 0.59/0.53; left eye: retinal degeneration"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290045"	"04214"	"00396887"	"00000"	"Isolated (sporadic)"	"10y"	"best corrected visual acuity: 0.03/0.6, refraction right/left eye:  + 2.75/ + 0.25, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 38.3/35.1, b/a ratio 1.25/1.12"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290046"	"04214"	"00396888"	"00000"	"Familial, X-linked recessive"	"26y"	"best corrected visual acuity: 0.4/0.3, refraction right/left eye:  + 3/ + 2.75, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 420/400, b/a ratio 0.71/0.7"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290047"	"04214"	"00396889"	"00000"	"Familial, X-linked recessive"	"25y"	"best corrected visual acuity: 0.3/0.3, refraction right/left eye:  ?0.5/?1, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 300/280, b/a ratio 1.27/1.29"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290048"	"04214"	"00396890"	"00000"	"Isolated (sporadic)"	"11y"	"best corrected visual acuity: 0.2/0.6, refraction right/left eye:  ?1.5/0.75, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 503/not available, b/a ratio 0.75/NA; right eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290049"	"04214"	"00396891"	"00000"	"Isolated (sporadic)"	"6y"	"best corrected visual acuity: 0.5/0.7, refraction right/left eye:  + 0.75/ + 1, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available/345, b/a ratio NA/0.63; both eyes: ODRL"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290050"	"04214"	"00396892"	"00000"	"Isolated (sporadic)"	"4y"	"best corrected visual acuity: 0.03/0.15, refraction right/left eye:  NA/ + 3.125, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 301/289, b/a ratio 0.83/1.06"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290051"	"04214"	"00396893"	"00000"	"Familial, X-linked recessive"	"3y"	"best corrected visual acuity: 0.4/NA, refraction right/left eye:  + 1.375/NA, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 346/349, b/a ratio 0.96/0.96; left eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290052"	"04214"	"00396894"	"00000"	"Familial, X-linked recessive"	"2y"	"best corrected visual acuity: not available, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290053"	"04214"	"00396895"	"00000"	"Isolated (sporadic)"	"45y"	"best corrected visual acuity: 0.032/0.5, refraction right/left eye:  + 6/ + 2, foveal retinochisis right/left eye: 1/ +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 146.5/304, b/a ratio 0.69/0.62"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290054"	"04214"	"00396896"	"00000"	"Isolated (sporadic)"	"5y"	"best corrected visual acuity: 0.4/0.4, refraction right/left eye:  + 9.5/ + 8, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 462/607.8, b/a ratio 0.79/0.74"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290055"	"04214"	"00396897"	"00000"	"Familial, X-linked recessive"	"1y"	"best corrected visual acuity: 0.7/0.06, refraction right/left eye:  + 6.625(IOL)/+ 5(IOL), foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 43.8/43.8, b/a ratio 0.55/0.69; left eye: vitrectomy, IOL"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290056"	"04214"	"00396898"	"00000"	"Familial, X-linked recessive"	"4y"	"best corrected visual acuity: 0.3/0.12, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290057"	"04214"	"00396899"	"00000"	"Isolated (sporadic)"	"2y"	"best corrected visual acuity: 0.2/0.3, refraction right/left eye:  + 2.25/ + 2.75, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 184/208, b/a ratio 0.87/0.77; right eye: vitreous hemorrahge, vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290058"	"04214"	"00396900"	"00000"	"Familial, X-linked recessive"	"16y"	"best corrected visual acuity: 0.7/1.2, refraction right/left eye:  ?0.5/0, foveal retinochisis right/left eye: + /+, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 377.8/302.3, b/a ratio 0.78/0.72; both eyes: retinal fold, vitrectomy, glaucoma"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290059"	"04214"	"00396901"	"00000"	"Familial, X-linked recessive"	"14y"	"best corrected visual acuity: 0.9/0.7, refraction right/left eye:  ?0.25/ + 0.75, foveal retinochisis right/left eye: + /+, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 87.8/83, b/a ratio 0.77/0.74"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290060"	"04214"	"00396902"	"00000"	"Familial, X-linked recessive"	"8y"	"best corrected visual acuity: 0.4/0.3, refraction right/left eye:  0.967567567567567, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290061"	"04214"	"00396903"	"00000"	"Familial, X-linked recessive"	"25y"	"best corrected visual acuity: 0.3/0.4, refraction right/left eye:  ?0.75/ + 0.25, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available, b/a ratio not available; both eyes: ODRL"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290062"	"04214"	"00396904"	"00000"	"Isolated (sporadic)"	"7y"	"best corrected visual acuity: 0.7/0.4, refraction right/left eye:  + 1.5/ + 1.875, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290063"	"04214"	"00396905"	"00000"	"Familial, X-linked recessive"	"53y"	"best corrected visual acuity: 0.5/0.4, refraction right/left eye:  ?0.5/0, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 270/294, b/a ratio 0.81/0.71; both eyes: macular degeration"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290064"	"04214"	"00396906"	"00000"	"Isolated (sporadic)"	"19y"	"best corrected visual acuity: 0.4/0.3, refraction right/left eye:  + 4.25/ + 4.625, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 172.1/130.6, b/a ratio 0.45/0.5"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290065"	"04214"	"00396907"	"00000"	"Isolated (sporadic)"	"54y"	"best corrected visual acuity: 0.2/0.15, refraction right/left eye:  ?3.5/?4.125, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 343.25/391.25, b/a ratio 0.9/0.93"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290066"	"04214"	"00396908"	"00000"	"Isolated (sporadic)"	"8y"	"best corrected visual acuity: 0.1/1.2, refraction right/left eye:  + 2.625/?0.125, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 283/318, b/a ratio 0.74/0.85; right eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290067"	"04214"	"00396909"	"00000"	"Isolated (sporadic)"	"3y"	"best corrected visual acuity: 0.5/0.2, refraction right/left eye:  + 1(IOL)/?1 (IOL), foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 175.5/200.8, b/a ratio 0.69/0.64; right eye: vitrectomy IOL"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290068"	"04214"	"00396910"	"00000"	"Isolated (sporadic)"	"9y"	"best corrected visual acuity: 0.3/0.3, refraction right/left eye:  ?0.25/?2.75(aphakia), foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) not available, b/a ratio not available; left eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290069"	"04214"	"00396911"	"00000"	"Isolated (sporadic)"	"38y"	"best corrected visual acuity: 0.4/0.4, refraction right/left eye:  ?6.5/?7.125, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 360.5/348.3, b/a ratio 0.78/0.68"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290070"	"04214"	"00396912"	"00000"	"Isolated (sporadic)"	"33y"	"best corrected visual acuity: 0.8/0.9, refraction right/left eye:  ?0.225/?0.25, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 290/280, b/a ratio 0.86/0.82"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290071"	"04214"	"00396913"	"00000"	"Isolated (sporadic)"	"16y"	"best corrected visual acuity: 0.1/0.09, refraction right/left eye:  + 10/ + 9, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 292/237, b/a ratio 1/0.47"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290072"	"04214"	"00396914"	"00000"	"Isolated (sporadic)"	"43y"	"best corrected visual acuity: 0.2/0.3, refraction right/left eye:  + 2/ + 1.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 290/280, b/a ratio 0.45/0.5"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290073"	"04214"	"00396915"	"00000"	"Isolated (sporadic)"	"5y"	"best corrected visual acuity: Follow/ Follow, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 257/313, b/a ratio 0.95/0.74; both eyes: vitreous hemorrahge, right eye: vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290074"	"04214"	"00396916"	"00000"	"Isolated (sporadic)"	"28y"	"best corrected visual acuity: 0.06/0.08, refraction right/left eye:  not available, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: +/+, electroretinography: a-amplitude (?V) not available, b/a ratio not available"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290075"	"04214"	"00396917"	"00000"	"Familial, X-linked recessive"	"43y"	"best corrected visual acuity: 0.2/0.05, refraction right/left eye:  + 2.5/ + 2.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 281/355, b/a ratio 1.35/0.69"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290076"	"04214"	"00396918"	"00000"	"Isolated (sporadic)"	"6y"	"best corrected visual acuity: 0.7/0.7, refraction right/left eye:  + 0.5/?0.575, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 273.5/248, b/a ratio 0.83/0.72"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290077"	"04214"	"00396919"	"00000"	"Isolated (sporadic)"	"43y"	"best corrected visual acuity: 0.1/0.1, refraction right/left eye:  + 0.25/ + 0.25, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 268/175.3, b/a ratio 0.29/0.86; both eyes: Retinal hole"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290078"	"04214"	"00396920"	"00000"	"Isolated (sporadic)"	"1y"	"best corrected visual acuity: 0.4/NLP, refraction right/left eye:  not available(aphakia), foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) not available, b/a ratio not available; left eye: proliferative vitreoretinopathy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290079"	"04214"	"00396921"	"00000"	"Isolated (sporadic)"	"52y"	"best corrected visual acuity: 0.5/0.3, refraction right/left eye:  ?1.125/?1.25, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 174.3/292, b/a ratio 0.83/0.77; both eyes: macular degeration"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290080"	"04214"	"00396922"	"00000"	"Isolated (sporadic)"	"57y"	"best corrected visual acuity: CF/0.01, refraction right/left eye:  NA/0.875, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 114/218, b/a ratio 1.25/0.67"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290081"	"04214"	"00396923"	"00000"	"Isolated (sporadic)"	"31y"	"best corrected visual acuity: 0.3/1.2, refraction right/left eye:  ?1/?0.5, foveal retinochisis right/left eye: + /?, peripheral retinochisis right/left eye: ?/?, electroretinography: a-amplitude (?V) 295/279, b/a ratio 0.93/0.99"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290082"	"04214"	"00396924"	"00000"	"Isolated (sporadic)"	"49y"	"best corrected visual acuity: 0.15/0.04, refraction right/left eye:  ?0.5/0, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 312/332, b/a ratio 0.77/0.59"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290083"	"04214"	"00396925"	"00000"	"Isolated (sporadic)"	"7y"	"best corrected visual acuity: 0.3/0.3, refraction right/left eye:  + 0.25/?0.5, foveal retinochisis right/left eye: ?/?, peripheral retinochisis right/left eye: + /+, electroretinography: a-amplitude (?V) 344/400, b/a ratio 0.69/0.71"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290084"	"04214"	"00396926"	"00000"	"Familial, X-linked recessive"	"9y"	"best corrected visual acuity: 0.4/0.5, refraction right/left eye:  ?1/?1.5, foveal retinochisis right/left eye: + / +, peripheral retinochisis right/left eye: +/+, electroretinography: a-amplitude (?V) 436/399.5, b/a ratio 0.53/0.52; left eye: retinal fold, vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290085"	"04214"	"00396927"	"00000"	"Familial, X-linked recessive"	"12y"	"best corrected visual acuity: 0.4/0.4, refraction right/left eye:  ?1.5/?1, foveal retinochisis right/left eye: + /+, peripheral retinochisis right/left eye: ?/+, electroretinography: a-amplitude (?V) 342/382.8, b/a ratio 0.55/0.52; left eye: retinal fold, vitrectomy"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290159"	"04214"	"00397004"	"00000"	"Familial, X-linked recessive"	"11y"	"Best corrected visual acuity both eyes: 6/18; Baseline intraocular pressure right/left eye: 30/32mmHg,pachymetry: 484/490µm, slit‑lamp: biomicroscopy showed shallow anterior chamber and occludable angles on gonioscopy both eyes; +90D fundus examination  cup‑disc ratio 0.7/0.8:1; spoke‑wheel appearance of macula both eyes; bilateral inferotemporal retinoschisis; macular optical coherence tomography: multilevel foveoschisis both eyes, central macular thickness right/left eye: 406/337µm; biometry was done to rule out lens‑induced angle‑closure: axial lengths right/left eye: 21.43/22 mm, lens thicknesses 3.30/3.51 mm, anterior chamber depths"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290199"	"04214"	"00397045"	"00000"	"Familial, X-linked recessive"	"12y"	"best corrected visual acuity right/left eye: 20/20 / 20/100; both eyes anterior vitreous syneresis; peripheral inferior retinoschisis was seen in both eyes; no macular retinoschisis in either eye; optical coherence tomography: no retinoschisis throughout the entire macula (a representative section through the central macula; fullfield electroretinography: no negative scotopic b-waves on bright flash, which is typical of JXLRS; no progression of his inferior retinoschisis since 2014 and no development of macular retinoschisis; amblyopia and esotropia of the left eye; strabismus surgery at age 10 years"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290200"	"04214"	"00397046"	"00000"	"Familial, X-linked recessive"	"40y"	"two retinal detachments per eye with bilateral scleral buckle placement and band keratopathy right eye status post Gunderson conjunctival flap placement; best corrected visual acuity right/left eye: hand motion / 20/25; anterior segment exam: edema of the right lid and injection of the right conjunctiva with Gunderson flap covering the right cornea; fundus exam of the left eye: peripheral laser scars; optical coherence tomography: slightly visible hyporeflective spots in the inner nuclear layer that cannot be attributed specifically to XLRS given the two retina surgeries (scleral buckle and vitrectomy on two different procedures) with no signs of foveal thinning"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290201"	"04214"	"00397047"	"00000"	"Familial, X-linked recessive"	"10y"	"decreased vision for 2 years and two episodes of vitreous hemorrhage with spontaneous resolution; Best corrected visual acuity both eyes: 20/25; peripheral inferior cystic cavities both eyes with no macular abnormalities on biomicroscopy, optical coherence tomography and fundus autofluorescence"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290202"	"04214"	"00397048"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290203"	"04214"	"00397049"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290204"	"04214"	"00397050"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290205"	"04214"	"00397051"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290206"	"04214"	"00397052"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290207"	"04214"	"00397053"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290208"	"04214"	"00397054"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290209"	"04214"	"00397055"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290210"	"04214"	"00397056"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290211"	"04214"	"00397057"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290212"	"04214"	"00397058"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290213"	"04214"	"00397059"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290214"	"04214"	"00397060"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290215"	"04214"	"00397061"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290216"	"04214"	"00397062"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290217"	"04214"	"00397063"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290218"	"04214"	"00397064"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290219"	"04214"	"00397065"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290220"	"04214"	"00397066"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290221"	"04214"	"00397067"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290222"	"04214"	"00397068"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290223"	"04214"	"00397069"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290224"	"04214"	"00397070"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290225"	"04214"	"00397071"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290226"	"04214"	"00397072"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290227"	"04214"	"00397073"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290228"	"04214"	"00397074"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290229"	"04214"	"00397075"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290230"	"04214"	"00397076"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290231"	"04214"	"00397077"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290232"	"04214"	"00397078"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290233"	"04214"	"00397079"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290234"	"04214"	"00397080"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290235"	"04214"	"00397081"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290236"	"04214"	"00397082"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290237"	"04214"	"00397083"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290238"	"04214"	"00397084"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290239"	"04214"	"00397085"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290240"	"04214"	"00397086"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290241"	"04214"	"00397087"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290242"	"04214"	"00397088"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290243"	"04214"	"00397089"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290244"	"04214"	"00397090"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290245"	"04214"	"00397091"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290246"	"04214"	"00397092"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290247"	"04214"	"00397093"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290248"	"04214"	"00397094"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290249"	"04214"	"00397095"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290250"	"04214"	"00397096"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290251"	"04214"	"00397097"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290252"	"04214"	"00397098"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290253"	"04214"	"00397099"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290254"	"04214"	"00397100"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290255"	"04214"	"00397101"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290256"	"04214"	"00397102"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290257"	"04214"	"00397103"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290258"	"04214"	"00397104"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290259"	"04214"	"00397105"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290260"	"04214"	"00397106"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290261"	"04214"	"00397107"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290262"	"04214"	"00397108"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290263"	"04214"	"00397109"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290264"	"04214"	"00397110"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290265"	"04214"	"00397111"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290266"	"04214"	"00397112"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290267"	"04214"	"00397113"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290268"	"04214"	"00397114"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290269"	"04214"	"00397115"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290270"	"04214"	"00397116"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290271"	"04214"	"00397117"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290272"	"04214"	"00397118"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290273"	"04214"	"00397119"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290274"	"04214"	"00397120"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290275"	"04214"	"00397121"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290276"	"04214"	"00397122"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290277"	"04214"	"00397123"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290278"	"04214"	"00397124"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290279"	"04214"	"00397125"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290280"	"04214"	"00397126"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290281"	"04214"	"00397127"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290282"	"04214"	"00397128"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290283"	"04214"	"00397129"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290284"	"04214"	"00397130"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290285"	"04214"	"00397131"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290286"	"04214"	"00397132"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290287"	"04214"	"00397133"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290288"	"04214"	"00397134"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290289"	"04214"	"00397135"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290290"	"04214"	"00397136"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290291"	"04214"	"00397137"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000290292"	"04214"	"00397138"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000300563"	"04214"	"00408447"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300564"	"04214"	"00408448"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300565"	"04214"	"00408449"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300566"	"04214"	"00408450"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300567"	"04214"	"00408451"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300568"	"04214"	"00408452"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300569"	"04214"	"00408453"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300570"	"04214"	"00408454"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300571"	"04214"	"00408455"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300572"	"04214"	"00408456"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300573"	"04214"	"00408457"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300574"	"04214"	"00408458"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300575"	"04214"	"00408459"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300576"	"04214"	"00408460"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300577"	"04214"	"00408461"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300578"	"04214"	"00408462"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000300579"	"04214"	"00408463"	"00000"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis 1, X-linked, juvenile"	""	""
"0000306320"	"00198"	"00414485"	"00000"	"Familial, X-linked recessive"	"3y"	""	""	""	""	""	""	""	""	""	""	"X-Linked Juvenile Retinoschisis"	""	""
"0000311694"	"04214"	"00420446"	"00000"	"Familial, X-linked"	"19y7m"	""	"2y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000311769"	"04214"	"00420521"	"00000"	"Familial, X-linked"	"3y7m"	""	"2y"	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000311773"	"04214"	"00420525"	"00000"	"Familial, X-linked"	"8y11m"	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""	""
"0000318089"	"04214"	"00426951"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	"retinoschisis"	""
"0000318090"	"04214"	"00426952"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	"Retinoschisis"	""
"0000318091"	"04214"	"00426953"	"00000"	"Familial, X-linked"	""	""	""	""	""	""	""	""	""	""	""	"Retinoschisis"	"Retinoschisis"	""
"0000326713"	"00318"	"00000102"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000326714"	"00318"	"00000102"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000326747"	"02262"	"00436599"	"04552"	"Familial, X-linked"	"18y"	"Foveoschisis HP:0012152\r\nPhotophobia HP:0000613, Reduced visual acuity HP:0007663"	"09y"	""	"22y"	""	""	""	""	""	""	"# 312700"	""	""
"0000332980"	"04214"	"00443697"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332981"	"04214"	"00443698"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332982"	"04214"	"00443699"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332983"	"04214"	"00443700"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332984"	"04214"	"00443701"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332985"	"04214"	"00443702"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332986"	"04214"	"00443703"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332987"	"04214"	"00443704"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332988"	"04214"	"00443705"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000332989"	"04214"	"00443706"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinal disease"	""
"0000333126"	"02262"	"00443849"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333127"	"02262"	"00443850"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333128"	"02262"	"00443851"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333129"	"02262"	"00443852"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333130"	"02262"	"00443853"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333131"	"02262"	"00443854"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333132"	"02262"	"00443855"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333133"	"02262"	"00443856"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333134"	"02262"	"00443857"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333135"	"02262"	"00443858"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333136"	"02262"	"00443859"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333137"	"02262"	"00443860"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333138"	"02262"	"00443861"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333139"	"02262"	"00443862"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000333140"	"02262"	"00443863"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000336443"	"00198"	"00447244"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336444"	"00198"	"00447245"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336445"	"00198"	"00447246"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336446"	"00198"	"00447247"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336447"	"00198"	"00447248"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336448"	"00198"	"00447249"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336449"	"00198"	"00447250"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336450"	"00198"	"00447251"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336451"	"00198"	"00447252"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336452"	"00198"	"00447253"	"00006"	"Familial, X-linked dominant"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336453"	"00198"	"00447254"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000336632"	"00198"	"00447433"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"Usher syndrome"	""
"0000336779"	"00198"	"00447580"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000340064"	"04249"	"00451009"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000340065"	"04249"	"00451010"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000340066"	"04249"	"00451011"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	"retinal pigment epithelium dystrophy-BEM"	""
"0000347004"	"02262"	"00458573"	"00006"	"Unknown"	"9y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,7/0,7; bilateral foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"4y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347005"	"02262"	"00458574"	"00006"	"Unknown"	"14y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,5/0,5; final visual acuity 0.8/0,5; bilateral foveal schisis; macular atrophy/no macular atrophy; bilateral peripheral schisis; bilateral vitreal veils; no retinal dystrophy"	""	""	"8y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347006"	"02262"	"00458575"	"00006"	"Unknown"	"17y"	"see paper; ..., emmetrope; no strabismus; initial visual acuity 0,1/0,1; final visual acuity 0,2/0,2; bilateral foveal schisis; no macular atrophy; no peripheral schisis; bilateral vitreal veils; no retinal dystrophy"	""	""	"11y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347007"	"02262"	"00458576"	"00006"	"Unknown"	"5y"	"see paper; ..., hyperopia; strabismus; initial visual acuity light perception = 2,7/fix and follows; final visual acuity light perception  =  2,7/0,2; no foveal schisis; no macular atrophy; peripheral schisis/no peripheral schisis; no vitreal veils; retinal dystrophy/no retinal dystrophy"	""	""	"1y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347008"	"02262"	"00458577"	"00006"	"Unknown"	"12y"	"see paper; ..., hyperopia; strabismus; initial visual acuity 1/0,5; final visual acuity 1/0,7; bilateral foveal schisis; no macular atrophy; peripheral schisis/no peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"10y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347009"	"02262"	"00458578"	"00006"	"Unknown"	"2y"	"see paper; ..., strabismus; initial visual acuity no light perception = 3/light perception = 2,7; final visual acuity no light perception  = 3/light perception  = 2,7; no foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; bilateral retinal dystrophy"	""	""	"1y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347010"	"02262"	"00458579"	"00006"	"Unknown"	"7y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,4/0,7; final visual acuity 0,7/0,8; bilateral foveal schisis; no macular atrophy; peripheral schisis/no peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347011"	"02262"	"00458580"	"00006"	"Unknown"	"15y"	"see paper; ..., no strabismus; initial visual acuity light perception = 2,7/no light perception = 3; final visual acuity light perception  = 2,7/no light perception  = 3; no foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; bilateral retinal dystrophy"	""	""	"1y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347012"	"02262"	"00458581"	"00006"	"Unknown"	"11y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,2/1,9; final visual acuity 0/1,9; foveal schisis/no foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; no retinal dystrophy/retinal dystrophy"	""	""	"1y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347013"	"02262"	"00458582"	"00006"	"Unknown"	"14y"	"see paper; ..., strabismus; initial visual acuity light perception = 2,7/no light perception = 3; final visual acuity no light perception  = 3/no light perception  = 3; no foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; bilateral retinal dystrophy"	""	""	"0.16y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347014"	"02262"	"00458583"	"00006"	"Unknown"	"6y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,3/0,3; final visual acuity 0,5/0,2; no foveal schisis; bilateral macular atrophy; bilateral peripheral schisis; bilateral vitreal veils; no retinal dystrophy"	""	""	"4y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347015"	"02262"	"00458584"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..., hyperopia; strabismus; initial visual acuity 0,4/0,4; final visual acuity 0,3/0,8; no foveal schisis; bilateral macular atrophy; bilateral peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347016"	"02262"	"00458585"	"00006"	"Unknown"	"12y"	"see paper; ..., no strabismus; initial visual acuity 0,7/0,4; final visual acuity 1/0,5; bilateral foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; retinal dystrophy/no retinal dystrophy"	""	""	"12y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347017"	"02262"	"00458586"	"00006"	"Unknown"	"0.83y"	"see paper; ..., strabismus; initial visual acuity light perception = 2,7/light perception = 2,7; final visual acuity light perception  = 2,7/FF; no foveal schisis; no macular atrophy; no peripheral schisis; no vitreal veils; bilateral retinal dystrophy"	""	""	"0.75y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347018"	"02262"	"00458587"	"00006"	"Unknown"	"18y"	"see paper; ..., myopic; no strabismus; initial visual acuity 0,4/0,5; final visual acuity 0,3/0,2; bilateral foveal schisis; no macular atrophy; no peripheral schisis/peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"8y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347019"	"02262"	"00458588"	"00006"	"Unknown"	"20y"	"see paper; ..., hyperopia; no strabismus; initial visual acuity 0,5/0,7; final visual acuity 0,5/0,7; bilateral foveal schisis; no macular atrophy; bilateral peripheral schisis; no vitreal veils; no retinal dystrophy"	""	""	"13y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347020"	"02262"	"00458589"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..., hyperopia; strabismus; initial visual acuity 1/0,7; final visual acuity 1,9/0,5; bilateral foveal schisis; no macular atrophy; bilateral peripheral schisis; bilateral vitreal veils; no retinal dystrophy"	""	""	"3y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347021"	"02262"	"00458590"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347022"	"02262"	"00458591"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347023"	"02262"	"00458592"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347024"	"02262"	"00458593"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347025"	"02262"	"00458594"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347026"	"02262"	"00458595"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347027"	"02262"	"00458596"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347028"	"02262"	"00458597"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347029"	"02262"	"00458598"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347030"	"02262"	"00458599"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347031"	"02262"	"00458600"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347032"	"02262"	"00458601"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347033"	"02262"	"00458602"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347034"	"02262"	"00458603"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347035"	"02262"	"00458604"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347036"	"02262"	"00458605"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347037"	"02262"	"00458606"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347038"	"02262"	"00458607"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347039"	"02262"	"00458608"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347040"	"02262"	"00458609"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347041"	"02262"	"00458610"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347042"	"02262"	"00458611"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347043"	"02262"	"00458612"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347044"	"02262"	"00458613"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347045"	"02262"	"00458614"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347046"	"02262"	"00458615"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347047"	"02262"	"00458616"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347048"	"02262"	"00458617"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347049"	"02262"	"00458618"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347050"	"02262"	"00458619"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347051"	"02262"	"00458620"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347052"	"02262"	"00458621"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347053"	"02262"	"00458622"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347054"	"02262"	"00458623"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347055"	"02262"	"00458624"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347056"	"02262"	"00458625"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347057"	"02262"	"00458626"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347058"	"02262"	"00458627"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347059"	"02262"	"00458628"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347060"	"02262"	"00458629"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347061"	"02262"	"00458630"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347062"	"02262"	"00458631"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347063"	"02262"	"00458632"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347064"	"02262"	"00458633"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347065"	"02262"	"00458634"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347066"	"02262"	"00458635"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347067"	"02262"	"00458636"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347068"	"02262"	"00458637"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347069"	"02262"	"00458638"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347070"	"02262"	"00458639"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347071"	"02262"	"00458640"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347072"	"02262"	"00458641"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347073"	"02262"	"00458642"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347074"	"02262"	"00458643"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347075"	"02262"	"00458644"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347076"	"02262"	"00458645"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347077"	"02262"	"00458646"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347078"	"02262"	"00458647"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347079"	"02262"	"00458648"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347080"	"02262"	"00458649"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347081"	"02262"	"00458650"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347082"	"02262"	"00458651"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347083"	"02262"	"00458652"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347084"	"02262"	"00458653"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347085"	"02262"	"00458654"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347086"	"02262"	"00458655"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347087"	"02262"	"00458656"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347088"	"02262"	"00458657"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347089"	"02262"	"00458658"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347090"	"02262"	"00458659"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347091"	"02262"	"00458660"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347092"	"02262"	"00458661"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347093"	"02262"	"00458662"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347094"	"02262"	"00458663"	"00006"	"Familial, X-linked recessive"	"14y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347095"	"02262"	"00458664"	"00006"	"Familial, X-linked recessive"	"23y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347096"	"02262"	"00458665"	"00006"	"Familial, X-linked recessive"	"30y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347097"	"02262"	"00458666"	"00006"	"Familial, X-linked recessive"	"20y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347098"	"02262"	"00458667"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347099"	"02262"	"00458668"	"00006"	"Unknown"	"34y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347100"	"02262"	"00458669"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347101"	"02262"	"00458670"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347102"	"02262"	"00458671"	"00006"	"Familial, X-linked recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347103"	"02262"	"00458672"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347104"	"02262"	"00458673"	"00006"	"Familial, X-linked recessive"	"13y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347105"	"02262"	"00458674"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347106"	"02262"	"00458675"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347107"	"02262"	"00458676"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347108"	"02262"	"00458677"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347109"	"02262"	"00458678"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347110"	"02262"	"00458679"	"00006"	"Familial, X-linked recessive"	"3y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347111"	"02262"	"00458680"	"00006"	"Familial, X-linked recessive"	"3y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347112"	"02262"	"00458681"	"00006"	"Familial, X-linked recessive"	"5y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347113"	"02262"	"00458682"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347114"	"02262"	"00458683"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347115"	"02262"	"00458684"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347116"	"02262"	"00458685"	"00006"	"Familial, X-linked recessive"	"11y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347117"	"02262"	"00458686"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347118"	"02262"	"00458687"	"00006"	"Familial, X-linked recessive"	"14y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347119"	"02262"	"00458688"	"00006"	"Familial, X-linked recessive"	"28y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347120"	"02262"	"00458689"	"00006"	"Familial, X-linked recessive"	"26y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347121"	"02262"	"00458690"	"00006"	"Familial, X-linked recessive"	"56y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347122"	"02262"	"00458691"	"00006"	"Familial, X-linked recessive"	"32y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347123"	"02262"	"00458692"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347124"	"02262"	"00458693"	"00006"	"Familial, X-linked recessive"	"2y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347125"	"02262"	"00458694"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347126"	"02262"	"00458695"	"00006"	"Familial, X-linked recessive"	"44y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347127"	"02262"	"00458696"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347128"	"02262"	"00458697"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347129"	"02262"	"00458698"	"00006"	"Familial, X-linked recessive"	"3y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347130"	"02262"	"00458699"	"00006"	"Familial, X-linked recessive"	"58y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347131"	"02262"	"00458700"	"00006"	"Familial, X-linked recessive"	"9y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347132"	"02262"	"00458701"	"00006"	"Familial, X-linked recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347133"	"02262"	"00458702"	"00006"	"Familial, X-linked recessive"	"1y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347134"	"02262"	"00458703"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347135"	"02262"	"00458704"	"00006"	"Familial, X-linked recessive"	"44y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347136"	"02262"	"00458705"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347137"	"02262"	"00458706"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347138"	"02262"	"00458707"	"00006"	"Familial, X-linked recessive"	"32y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347139"	"02262"	"00458708"	"00006"	"Familial, X-linked recessive"	"1y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347140"	"02262"	"00458709"	"00006"	"Familial, X-linked recessive"	"38y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347141"	"02262"	"00458710"	"00006"	"Familial, X-linked recessive"	"11y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347142"	"02262"	"00458711"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347143"	"02262"	"00458712"	"00006"	"Familial, X-linked recessive"	"24y"	"see paper; ..., 9y-bilateral visual loss; mild-moderate impairment visual acuity; bilateral foveal schisis, normal a-wave, reduction b-wave amplitudes in dark- and light- adapted full-field electroretinograms, abnormal oscillatory potentials; diffuse amplitude reduction in multifocal electroretinogram arrays"	"09y"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347144"	"02262"	"00458714"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347145"	"02262"	"00458715"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347146"	"02262"	"00458716"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347147"	"02262"	"00458717"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347148"	"02262"	"00458718"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347149"	"02262"	"00458719"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347150"	"02262"	"00458720"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347151"	"02262"	"00458721"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347152"	"02262"	"00458722"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347153"	"02262"	"00458723"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347154"	"02262"	"00458724"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347155"	"02262"	"00458725"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347156"	"02262"	"00458726"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347157"	"02262"	"00458727"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347158"	"02262"	"00458728"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347159"	"02262"	"00458729"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347160"	"02262"	"00458730"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347161"	"02262"	"00458731"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347162"	"02262"	"00458732"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347163"	"02262"	"00458733"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347164"	"02262"	"00458734"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347165"	"02262"	"00458735"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347166"	"02262"	"00458736"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347167"	"02262"	"00458737"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347168"	"02262"	"00458738"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347169"	"02262"	"00458739"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347170"	"02262"	"00458740"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347171"	"02262"	"00458741"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347172"	"02262"	"00458742"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347173"	"02262"	"00458743"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347174"	"02262"	"00458744"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347175"	"02262"	"00458745"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347176"	"02262"	"00458746"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347177"	"02262"	"00458747"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347178"	"02262"	"00458748"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347179"	"02262"	"00458749"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347180"	"02262"	"00458750"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347181"	"02262"	"00458751"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347182"	"02262"	"00458752"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347183"	"02262"	"00458753"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347184"	"02262"	"00458754"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347185"	"02262"	"00458755"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347186"	"02262"	"00458756"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347187"	"02262"	"00458757"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347188"	"02262"	"00458758"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347189"	"02262"	"00458759"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347190"	"02262"	"00458760"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347191"	"02262"	"00458761"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347192"	"02262"	"00458762"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347193"	"02262"	"00458763"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347194"	"02262"	"00458764"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347195"	"02262"	"00458765"	"00006"	"Familial, X-linked recessive"	""	"mild"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347196"	"02262"	"00458766"	"00006"	"Familial, X-linked recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347197"	"02262"	"00458767"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347198"	"02262"	"00458768"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347199"	"02262"	"00458769"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinal tear, no retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347200"	"02262"	"00458770"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinal tear, no retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347201"	"02262"	"00458771"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinal tear, no retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347202"	"02262"	"00458772"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347203"	"02262"	"00458773"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347204"	"02262"	"00458774"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347205"	"02262"	"00458775"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, no retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347206"	"02262"	"00458776"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, no retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347207"	"02262"	"00458777"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, no retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347208"	"02262"	"00458778"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, no retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347209"	"02262"	"00458779"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoshisis, macular schisis, no macular atrophy, no retinal tear"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347210"	"02262"	"00458780"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinl tear, retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347211"	"02262"	"00458781"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinl tear, retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347212"	"02262"	"00458782"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., peripheral retinoshisis, macular schisis, no macular atrophy, no retinal tear, no retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347213"	"02262"	"00458783"	"00006"	"Familial, autosomal recessive"	"78y"	"see paper; ..., childhood visual disturbance"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347214"	"02262"	"00458784"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347215"	"02262"	"00458785"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"3y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347216"	"02262"	"00458786"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"0y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347217"	"02262"	"00458787"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..., intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"0y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347218"	"02262"	"00458788"	"00006"	"Familial, X-linked recessive"	"14y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347219"	"02262"	"00458789"	"00006"	"Familial, X-linked recessive"	"13y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"3y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347220"	"02262"	"00458790"	"00006"	"Familial, X-linked recessive"	"10y"	"see paper; ..., intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"1y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347221"	"02262"	"00458791"	"00006"	"Familial, X-linked recessive"	"16y"	"see paper; ..., bilateral intact elipsoide zone, retinal detachment (left), vitreous hemorragies (right), bilateral peripheral schisis"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347222"	"02262"	"00458792"	"00006"	"Familial, X-linked recessive"	"9y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral flat peripheral schisis"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347223"	"02262"	"00458793"	"00006"	"Familial, X-linked recessive"	"20y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"00y-10y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347224"	"02262"	"00458794"	"00006"	"Familial, X-linked recessive"	"10y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"4y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347225"	"02262"	"00458795"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral vitreous veils"	""	""	"4y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347226"	"02262"	"00458796"	"00006"	"Familial, X-linked recessive"	"27y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"2y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347227"	"02262"	"00458797"	"00006"	"Familial, X-linked recessive"	"25y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, vitreous veils"	""	""	"18y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347228"	"02262"	"00458798"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..., disturbed elipsoide zone (left), retinal detachment (right), bilateral vitreous hemorragies, bilateral peripheral schisis"	""	""	"2y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347229"	"02262"	"00458799"	"00006"	"Familial, X-linked recessive"	"17y"	"see paper; ..., intact elipsoide zone, retinal detachment (right), vitreous hemorragies (right), peripheral schisis (left)"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347230"	"02262"	"00458800"	"00006"	"Familial, X-linked recessive"	"6y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"5y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347231"	"02262"	"00458801"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"5y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347232"	"02262"	"00458802"	"00006"	"Familial, X-linked recessive"	"29y"	"see paper; ..., disturbed elipsoide zone (right), retinal detachment (right), no vitreous hemorragies, bilateral peripheral schisis"	""	""	"3y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347233"	"02262"	"00458803"	"00006"	"Familial, X-linked recessive"	"21y"	"see paper; ..., no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"9y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347234"	"02262"	"00458804"	"00006"	"Familial, X-linked recessive"	"20y"	"see paper; ..., intact elipsoide zone, no retinal detachment, no vitreous hemorragies, peripheral schisis (right)"	""	""	"18y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347235"	"02262"	"00458805"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, no peripheral schisis"	""	""	"6y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347236"	"02262"	"00458806"	"00006"	"Familial, X-linked recessive"	"5y"	"see paper; ..., bilateral intact elipsoide zone, bilateral retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"4y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347237"	"02262"	"00458807"	"00006"	"Familial, X-linked recessive"	"9y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"8y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347238"	"02262"	"00458808"	"00006"	"Familial, X-linked recessive"	"13y"	"see paper; ..., bilateral disturbed elipsoide zone, no retinal detachment, no vitreous hemorragies, bilateral peripheral schisis"	""	""	"12y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347239"	"02262"	"00458809"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..., disturbed elipsoide zone (left), retinal detachment (left), vitreous hemorragies (left), bilateral peripheral schisis"	""	""	"3y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347240"	"02262"	"00458810"	"00006"	"Familial, X-linked recessive"	"15y"	"see paper; ..., bilateral intact elipsoide zone, no retinal detachment, vitreous hemorragies (left), bilateral peripheral schisis"	""	""	"9y"	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347241"	"02262"	"00458811"	"00006"	"Familial, X-linked recessive"	"72y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347242"	"02262"	"00458812"	"00006"	"Familial, X-linked recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347243"	"02262"	"00458813"	"00006"	"Familial, X-linked recessive"	"30y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347244"	"02262"	"00458814"	"00006"	"Familial, X-linked recessive"	"10y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347245"	"02262"	"00458815"	"00006"	"Familial, X-linked recessive"	"26y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347246"	"02262"	"00458816"	"00006"	"Familial, X-linked recessive"	"11y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347247"	"02262"	"00458817"	"00006"	"Familial, X-linked recessive"	"27y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347248"	"02262"	"00458818"	"00006"	"Familial, X-linked recessive"	"28y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347249"	"02262"	"00458819"	"00006"	"Familial, X-linked recessive"	"13y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347250"	"02262"	"00458820"	"00006"	"Familial, X-linked recessive"	"42y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347251"	"02262"	"00458821"	"00006"	"Familial, X-linked recessive"	"36y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347252"	"02262"	"00458822"	"00006"	"Familial, X-linked recessive"	"50y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347253"	"02262"	"00458823"	"00006"	"Familial, X-linked recessive"	"46y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347254"	"02262"	"00458824"	"00006"	"Familial, X-linked recessive"	"20y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347255"	"02262"	"00458825"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347256"	"02262"	"00458826"	"00006"	"Familial, X-linked recessive"	"15y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347257"	"02262"	"00458827"	"00006"	"Familial, X-linked recessive"	"24y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347258"	"02262"	"00458828"	"00006"	"Familial, X-linked recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347259"	"02262"	"00458829"	"00006"	"Familial, X-linked recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347260"	"02262"	"00458830"	"00006"	"Familial, X-linked recessive"	"22y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347261"	"02262"	"00458831"	"00006"	"Familial, X-linked recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347262"	"02262"	"00458832"	"00006"	"Familial, X-linked recessive"	"45y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347263"	"02262"	"00458833"	"00006"	"Familial, X-linked recessive"	"22y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347264"	"02262"	"00458834"	"00006"	"Familial, X-linked recessive"	"15y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347265"	"02262"	"00458835"	"00006"	"Familial, X-linked recessive"	"9y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347268"	"02262"	"00458838"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347269"	"02262"	"00458839"	"00006"	"Familial, autosomal recessive"	"5y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347270"	"02262"	"00458840"	"00006"	"Familial, autosomal recessive"	"14y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347271"	"02262"	"00458841"	"00006"	"Familial, autosomal recessive"	"3y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347272"	"02262"	"00458842"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347273"	"02262"	"00458843"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347274"	"02262"	"00458844"	"00006"	"Familial, autosomal recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347275"	"02262"	"00458845"	"00006"	"Familial, autosomal recessive"	"3y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347276"	"02262"	"00458846"	"00006"	"Familial, autosomal recessive"	"15y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347277"	"02262"	"00458847"	"00006"	"Familial, autosomal recessive"	"2.5y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347278"	"02262"	"00458848"	"00006"	"Familial, autosomal recessive"	"14y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347279"	"02262"	"00458849"	"00006"	"Isolated (sporadic)"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347280"	"02262"	"00458850"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347281"	"02262"	"00458851"	"00006"	"Familial, autosomal recessive"	"10m"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347282"	"02262"	"00458852"	"00006"	"Familial, autosomal recessive"	"7m"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347283"	"02262"	"00458853"	"00006"	"Familial, autosomal recessive"	"34y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347284"	"02262"	"00458854"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347285"	"02262"	"00458855"	"00006"	"Familial, autosomal recessive"	"4y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347286"	"02262"	"00458856"	"00006"	"Familial, autosomal recessive"	"7m"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347287"	"02262"	"00458857"	"00006"	"Familial, autosomal recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347288"	"02262"	"00458858"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347289"	"02262"	"00458859"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347290"	"02262"	"00458860"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347291"	"02262"	"00458861"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347292"	"02262"	"00458862"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347293"	"02262"	"00458863"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347294"	"02262"	"00458864"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347295"	"02262"	"00458865"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347296"	"02262"	"00458866"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347297"	"02262"	"00458867"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347298"	"02262"	"00458868"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347299"	"02262"	"00458869"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347300"	"02262"	"00458870"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347301"	"02262"	"00458871"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347302"	"02262"	"00458872"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347303"	"02262"	"00458873"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347304"	"02262"	"00458874"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347305"	"02262"	"00458875"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347306"	"02262"	"00458876"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347307"	"02262"	"00458877"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347308"	"02262"	"00458878"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347309"	"02262"	"00458879"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347310"	"02262"	"00458880"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347311"	"02262"	"00458881"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347312"	"02262"	"00458882"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347313"	"02262"	"00458883"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347314"	"02262"	"00458884"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347315"	"02262"	"00458885"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347316"	"02262"	"00458886"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347317"	"02262"	"00458887"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347318"	"02262"	"00458888"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347319"	"02262"	"00458889"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347320"	"02262"	"00458890"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347321"	"02262"	"00458891"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347322"	"02262"	"00458892"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347323"	"02262"	"00458893"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347324"	"02262"	"00458894"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347325"	"02262"	"00458895"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347326"	"02262"	"00458896"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347327"	"02262"	"00458897"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347328"	"02262"	"00458898"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347329"	"02262"	"00458899"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347330"	"02262"	"00458900"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347331"	"02262"	"00458901"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347332"	"02262"	"00458902"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347333"	"02262"	"00458903"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347334"	"02262"	"00458904"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347335"	"02262"	"00458905"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347336"	"02262"	"00458906"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347337"	"02262"	"00458907"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347338"	"02262"	"00458908"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347339"	"02262"	"00458909"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347340"	"02262"	"00458910"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347341"	"02262"	"00458911"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347342"	"02262"	"00458912"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347343"	"02262"	"00458913"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347344"	"02262"	"00458914"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347345"	"02262"	"00458915"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347346"	"02262"	"00458916"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347347"	"02262"	"00458917"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347348"	"02262"	"00458918"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347349"	"02262"	"00458919"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347350"	"02262"	"00458920"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347351"	"02262"	"00458921"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347352"	"02262"	"00458922"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347353"	"02262"	"00458923"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347354"	"02262"	"00458924"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347355"	"02262"	"00458925"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347356"	"02262"	"00458926"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347357"	"02262"	"00458927"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347358"	"02262"	"00458928"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347359"	"02262"	"00458929"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347360"	"02262"	"00458930"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347361"	"02262"	"00458931"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347362"	"02262"	"00458932"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347363"	"02262"	"00458933"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347364"	"02262"	"00458934"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347365"	"02262"	"00458935"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347366"	"02262"	"00458936"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347367"	"02262"	"00458937"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347368"	"02262"	"00458938"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347369"	"02262"	"00458939"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347370"	"02262"	"00458940"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347371"	"02262"	"00458941"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347372"	"02262"	"00458942"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347373"	"02262"	"00458943"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347374"	"02262"	"00458944"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347375"	"02262"	"00458945"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347376"	"02262"	"00458946"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347377"	"02262"	"00458947"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347378"	"02262"	"00458948"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347379"	"02262"	"00458949"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347380"	"02262"	"00458950"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347381"	"02262"	"00458951"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347382"	"02262"	"00458952"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347383"	"02262"	"00458953"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347384"	"02262"	"00458954"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347385"	"02262"	"00458955"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347386"	"02262"	"00458956"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347387"	"02262"	"00458957"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347388"	"02262"	"00458958"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347389"	"02262"	"00458959"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347390"	"02262"	"00458960"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347391"	"02262"	"00458961"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347392"	"02262"	"00458962"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347393"	"02262"	"00458963"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347394"	"02262"	"00458964"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347395"	"02262"	"00458965"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347396"	"02262"	"00458966"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347397"	"02262"	"00458967"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347398"	"02262"	"00458968"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347399"	"02262"	"00458969"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347400"	"02262"	"00458970"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347401"	"02262"	"00458971"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347402"	"02262"	"00458972"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347403"	"02262"	"00458973"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347404"	"02262"	"00458974"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347405"	"02262"	"00458975"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347406"	"02262"	"00458976"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347407"	"02262"	"00458977"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinischisis, no peripheral change, macular change, no retinal hole, nystagmus"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347408"	"02262"	"00458978"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinischisis, no peripheral change, macular change, retinal hole, nystagmus"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347409"	"02262"	"00458979"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinischisis, peripheral change, macular change, no retinal hole, nystagmus"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347410"	"02262"	"00458980"	"00006"	"Familial, X-linked recessive"	""	"see paper; .."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347411"	"02262"	"00458981"	"00006"	"Familial, X-linked recessive"	"02y"	"see paper; ..., 14d-right esotropia; 2y-bumping into objects right-hand side; no nyctalopia; thickened retinae, absent laminal structure; mild foveal hypoplasia; minute intraretinal hyporeflective cystic lesions; no foveal schisis; inferior peripheral retinoschisis (left); inferotemporal RPE atrophy (right, associated concentric rings pigment enclosing schitic-appearing area/yellow material)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347412"	"02262"	"00458982"	"00006"	"Familial, X-linked recessive"	"05y"	"see paper; ..., poor vision; RPE changes; no foveal schisis; bilateral inferotemporal peripheral retinoschisis"	""	""	""	""	""	""	""	""	""	"RS1"	"poor vision"	""
"0000347414"	"02262"	"00458984"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347415"	"02262"	"00458985"	"00006"	"Familial, X-linked recessive"	"51y"	"see paper; ..., 0–5y treated for strabismus, amblyopia; nyctalopia; no nystagmus; no hyperopia; amblyopia; no cataract; childhood intermittent floaters; photophobia; intermittent light flashes; schisis; no retinal detachment"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347416"	"02262"	"00458986"	"00006"	"Familial, X-linked recessive"	"19y"	"see paper; ..., childhood nyctalopia; no nystagmus; no hyperopia; cataract (post-vitrectomy); no floaters; no photophobia; no light flashes; 11y-retinal detachment (ball hit head)"	"06y"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347417"	"02262"	"00458987"	"00006"	"Familial, X-linked recessive"	"11y"	"see paper; ...,1d-nyctalopia, nystagmus, hyperopia; no amblyopia; no cataract; no floaters; no photophobia; intermittent light flashes; infancy schisis; no retinal detachment"	"1d"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347418"	"02262"	"00458988"	"00006"	"Familial, X-linked recessive"	"9y"	"see paper; ...,1d-nyctalopia, nystagmus, high hyperopia; no amblyopia; no cataract; no floaters; no photophobia; no light flashes; no schisis; no retinal detachment"	"1d"	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347420"	"02262"	"00458990"	"00006"	"Familial, X-linked recessive"	"06y"	"see paper; ..., decreased vision; no strabismus, no nystagmus"	""	""	""	""	""	""	""	""	""	"RS1"	"decreased vision"	""
"0000347421"	"02262"	"00458991"	"00006"	"Familial, X-linked recessive"	"16y"	"see paper; ..., decreased vision; strabismus; no nystagmus; central/peripheral retinal splitting"	""	""	""	""	""	""	""	""	""	"RS1"	"decreased vision"	""
"0000347422"	"02262"	"00458992"	"00006"	"Familial, X-linked recessive"	"39y"	"see paper; ..., retinoschisis, angle-closure glaucoma; progressive blurred vision, ocular pain(left eye)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis, angle-closure glaucoma"	""
"0000347423"	"02262"	"00458993"	"00006"	"Familial, X-linked recessive"	"14y"	"see paper; ..., Coats disease (left); 6y- difficulty\r\nseeing well"	""	""	""	""	""	""	""	""	""	"RS1"	"Coats disease"	""
"0000347424"	"02262"	"00458994"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., visual difficulties, high hypermetropia, resolved intermittent exotropia, macular radial folds, alteration pigment epithelium"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347429"	"04214"	"00458999"	"00006"	"Familial, X-linked recessive"	"01y"	"see paper; ..., vision problems low light settings"	""	""	""	""	""	""	""	""	""	"RS1"	""	""
"0000347430"	"04214"	"00459000"	"00006"	"Familial, X-linked recessive"	"43y"	"see paper; ..."	""	""	""	"11y"	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347446"	"02262"	"00459016"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347447"	"02262"	"00459351"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347449"	"02262"	"00459353"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..., retinoschisis; color vision blue-purple anomaly"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347450"	"02262"	"00459371"	"00006"	"Familial, autosomal recessive"	"34y"	"see paper; ..., BVCA (R/L) 0.15/0.1; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; primary open closure glaucoma (binocular), vitreous veils (R)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347451"	"02262"	"00459372"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., BVCA (R/L) 0.1/0.02; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer; binocular primary angle closure glaucoma, retinal pigment epithelial alteration or mottling, cataract; left retinal detachment, right vitreous veils"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347452"	"02262"	"00459373"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..., BVCA (R/L) 0.25/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/ganglion cell layer; binocular vascular abnormalities and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347453"	"02262"	"00459374"	"00006"	"Familial, autosomal recessive"	"48y"	"see paper; ..., BVCA (R/L) 0.2/0.3; macular atrophy/macular atrophy; ; binocular retinal pigment epithelial alteration or mottling, vascular abnormalities and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347454"	"02262"	"00459375"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..., BVCA (R/L) 0.1/0.06; foveo‐lamellar schisis/foveo‐lamellar schisis; schisis binocular outer nuclear layer/inner nuclear layer; morning glory (binocular)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347455"	"02262"	"00459376"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..., BVCA (R/L) 0.4/0.2; foveo‐lamellar schisis/foveo‐lamellar schisis; schisi right inner nuclear layer/ganglion cell layer, left inner nuclear layer/outer nuclear layer/ganglion cell layer; inner macular hole (L), primary open closure glaucoma (binocular)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347456"	"02262"	"00459377"	"00006"	"Familial, autosomal recessive"	"19y"	"see paper; ..., BVCA (R/L) 0.5/0.4; foveo‐lamellar schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer plexiform layer/ganglion cell layer"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347457"	"02262"	"00459378"	"00006"	"Familial, autosomal recessive"	"40y"	"see paper; ..., BVCA (R/L) 0.15/0.3; macular atrophy/foveo‐lamellar schisis; right no schisis, left inner nuclear layer/outer nuclear layer/ganglion cell layer; inner macular hole (L)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347458"	"02262"	"00459379"	"00006"	"Familial, autosomal recessive"	"15y"	"see paper; ..., BVCA (R/L) 0.3/0.25; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis right inner nuclear layer/outer plexiform layer/ganglion cell layer, left inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; binocular vitreous veils, retinal pigment epithelial alteration or mottling, vascular abnormalities and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347459"	"02262"	"00459380"	"00006"	"Familial, autosomal recessive"	"6y"	"see paper; ..., BVCA (R/L) 0.12/0.15; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/ganglion cell layer; vascular abnormalities (L)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347460"	"02262"	"00459381"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..., BVCA (R/L) 0.4/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis right inner nuclear layer/outer nuclear layer/outer plexiform layer, left inner nuclear layer/outer nuclear layer; binocular vitreous veils, vascular abnormalities and retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347461"	"02262"	"00459382"	"00006"	"Familial, autosomal recessive"	"5y"	"see paper; ..., BVCA (R/L) 0.25/0.4; foveo‐lamellar schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; left vascular abnormalities, retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347462"	"02262"	"00459383"	"00006"	"Familial, autosomal recessive"	"4y"	"see paper; ..., BVCA (R/L) 0.3/0.5; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer; right retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347463"	"02262"	"00459384"	"00006"	"Familial, autosomal recessive"	"34y"	"see paper; ..., BVCA (R/L) 0.08/0.3; macular atrophy/foveo‐lamellar schisis; right no schisis, left inner nuclear layer/outer nuclear layer; right vascular abnormalities, retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347464"	"02262"	"00459385"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..., BVCA (R/L) 0.12/0.12; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; binocular vitreous veils, vascular abnormalities, inner retinal break and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347465"	"02262"	"00459386"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..., BVCA (R/L) 0.4/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; binocular vitreous veils, vascular abnormalities, retinal pigment epithelial alteration or mottling and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347466"	"02262"	"00459387"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..., BVCA (R/L) 0.7/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; binocular vitreous veils and retinal pigment epithelial alteration or mottling; left vascular abnormalities, inner retinal break"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347467"	"02262"	"00459388"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..., BVCA (R/L) 0.15/0.2; foveo‐lamellar schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347468"	"02262"	"00459389"	"00006"	"Isolated (sporadic)"	"5y"	"see paper; ..., BVCA (R/L) 0.3/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; binocular vitreous veils, vascular abnormalities; left retinal pigment epithelial alteration or mottling, exudations; right vitreous haemorrhage"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347469"	"02262"	"00459390"	"00006"	"Familial, autosomal recessive"	"12y"	"see paper; ..., BVCA (R/L) 0.7/0.5; foveo‐lamellar schisis/foveo‐lamellar schisis plus peripheral schisis; schisis right  inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer, left inner nuclear layer/outer nuclear layer/ganglion cell layer; left retinal pigment epithelial alteration or mottling, vitreous veils"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347470"	"02262"	"00459391"	"00006"	"Familial, autosomal recessive"	"5y"	"see paper; ..., BVCA (R/L) 0.4/0.4; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer; binocular vitreous veils, vascular abnormalities, retinal pigment epithelial alteration or mottling and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347471"	"02262"	"00459392"	"00006"	"Familial, autosomal recessive"	"4y"	"see paper; ..., BVCA (R/L) 0.1/0.25; foveo‐lamellar schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer nuclear layer"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347472"	"02262"	"00459393"	"00006"	"Familial, autosomal recessive"	"5y"	"see paper; ..., BVCA (R/L) 0.25/0.3; foveo‐lamellar schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer nuclear layer"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347473"	"02262"	"00459394"	"00006"	"Familial, autosomal recessive"	"7y"	"see paper; ..., BVCA (R/L) 0.2/0.3; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/ganglion cell layer; binocular vitreous veils, vascular abnormalities, retinal pigment epithelial alteration or mottling; left retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347474"	"02262"	"00459395"	"00006"	"Familial, autosomal recessive"	"24y"	"see paper; ..., BVCA (R/L) 0.3/0.3; foveal schisis/foveal schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347475"	"02262"	"00459396"	"00006"	"Familial, autosomal recessive"	"7y"	"see paper; ..., BVCA (R/L) 0.5/0.5; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer; strabismus (binocular)"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347476"	"02262"	"00459397"	"00006"	"Familial, autosomal recessive"	"27y"	"see paper; ..., BVCA (R/L) 0.05/0.25; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis; schisis binocular inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer; right vascular abnormalities, inner retinal break and retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347477"	"02262"	"00459398"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..., BVCA (R/L) 0.05/0.15; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis binocular inner nuclear layer/outer nuclear layer; binocular vitreous veils, vascular abnormalities and inner retinal break; left retinal white flecks; right vascular abnormalities, cataract and retinal pigment epithelial alteration or mottling and exudations"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347478"	"02262"	"00459399"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..., BVCA (R/L) 0.8/0.05; foveo‐lamellar schisis plus peripheral schisis/foveo‐lamellar schisis plus peripheral schisis; schisis right inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer, left inner nuclear layer/outer nuclear layer/outer plexiform layer; left vitreous haemorrhage, retinal detachment, cataract; binocular vitreous veils, vascular abnormalities"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347479"	"02262"	"00459400"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..., BVCA (R/L) 0.3/0.03; foveo‐lamellar schisis/foveo‐lamellar schisis plus peripheral schisis; schisis right inner nuclear layer/outer nuclear layer/outer plexiform layer/ganglion cell layer, left inner nuclear layer/outer nuclear layer; left vitreous veils and retinal pigment epithelial alteration or mottling"	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347482"	"02262"	"00459404"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347483"	"02262"	"00459405"	"00006"	"Familial, X-linked recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"RS1"	"retinoschisis"	""
"0000347501"	"02262"	"00459425"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000347619"	"00381"	"00459543"	"00006"	"Familial, X-linked recessive"	"7y"	"see paper; ..., visual acuity no light perception right eye (OD), 6/18 left eye; 5y- spontaneous retinal detachment right"	""	""	""	""	""	""	""	""	""	"RS1"	"neurodevelopmental delay"	""
"0000348584"	"04214"	"00461084"	"00006"	"Familial, X-linked recessive"	""	""	"8y"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000348590"	"04214"	"00461090"	"00006"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000348599"	"04214"	"00461099"	"00006"	"Familial, X-linked recessive"	""	""	"8y"	""	""	""	""	""	""	""	""	""	"retinoschisis"	""
"0000348634"	"04214"	"00461134"	"00006"	"Familial, X-linked recessive"	""	""	"7y"	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""


## Screenings ## Do not remove or alter this header ##
## Count = 2179
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000047"	"00000047"	"1"	"00004"	""	"2012-05-11 13:18:48"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000058"	"00000058"	"1"	"00004"	""	"2012-05-11 13:18:53"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000085"	"00000085"	"1"	"00004"	""	"2012-05-11 13:19:11"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000102"	"00000102"	"1"	"00004"	""	"2012-05-11 13:19:45"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000209"	"00000208"	"1"	"00037"	"00001"	"2012-09-13 12:02:03"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000000210"	"00000209"	"1"	"00037"	"00001"	"2012-09-13 12:09:36"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000003931"	"00004010"	"1"	"00155"	"00006"	"2011-10-24 22:40:19"	""	""	"SEQ"	"DNA"	""	""
"0000004302"	"00004374"	"1"	"00591"	"00006"	"2010-12-14 23:20:59"	"00006"	"2013-03-15 09:40:07"	"SEQ"	"DNA"	""	""
"0000009835"	"00009921"	"1"	"00590"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009836"	"00009922"	"1"	"00589"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009837"	"00009923"	"1"	"00590"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009838"	"00009924"	"1"	"00579"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009847"	"00009933"	"1"	"00589"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009848"	"00009934"	"1"	"00589"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009849"	"00009935"	"1"	"00589"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009850"	"00009936"	"1"	"00581"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009851"	"00009937"	"1"	"00579"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009854"	"00009940"	"1"	"00584"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009855"	"00009941"	"1"	"00584"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009863"	"00009949"	"1"	"00590"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009869"	"00009955"	"1"	"00588"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009874"	"00009960"	"1"	"00590"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009875"	"00009961"	"1"	"00584"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000009876"	"00009962"	"1"	"00579"	"00006"	"2014-02-03 23:26:51"	""	""	"SEQ"	"DNA"	"?"	""
"0000087396"	"00087256"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087397"	"00087257"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087398"	"00087258"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087399"	"00087259"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087400"	"00087260"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087401"	"00087261"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087402"	"00087262"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087403"	"00087263"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087404"	"00087264"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR"	"DNA"	""	""
"0000087405"	"00087265"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR;Southern"	"DNA"	""	""
"0000087406"	"00087266"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000087407"	"00087267"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000087408"	"00087268"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000087409"	"00087269"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087410"	"00087270"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087411"	"00087271"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087412"	"00087272"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087413"	"00087273"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR;Southern"	"DNA"	""	""
"0000087414"	"00087274"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR;Southern"	"DNA"	""	""
"0000087415"	"00087275"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087416"	"00087276"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087417"	"00087277"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087418"	"00087278"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087419"	"00087279"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087420"	"00087280"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087421"	"00087281"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087422"	"00087282"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087423"	"00087283"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087424"	"00087284"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087425"	"00087285"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087426"	"00087286"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087427"	"00087287"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087428"	"00087288"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087429"	"00087289"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087430"	"00087290"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087431"	"00087291"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087432"	"00087292"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087433"	"00087293"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087434"	"00087294"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087435"	"00087295"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087436"	"00087296"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087437"	"00087297"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087438"	"00087298"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087439"	"00087299"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087440"	"00087300"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087441"	"00087301"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087442"	"00087302"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087443"	"00087303"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087444"	"00087304"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087445"	"00087305"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087446"	"00087306"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087447"	"00087307"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087448"	"00087308"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087449"	"00087309"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087450"	"00087310"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087451"	"00087311"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087452"	"00087312"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087453"	"00087313"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087454"	"00087314"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087455"	"00087315"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087456"	"00087316"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087457"	"00087317"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087458"	"00087318"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087459"	"00087319"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087460"	"00087320"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087461"	"00087321"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087462"	"00087322"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087463"	"00087323"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087464"	"00087324"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087465"	"00087325"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087466"	"00087326"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087467"	"00087327"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087468"	"00087328"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087469"	"00087329"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087470"	"00087330"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087471"	"00087331"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087472"	"00087332"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087473"	"00087333"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087474"	"00087334"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087475"	"00087335"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087476"	"00087336"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087477"	"00087337"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087478"	"00087338"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087479"	"00087339"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087480"	"00087340"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087481"	"00087341"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087482"	"00087342"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087483"	"00087343"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087484"	"00087344"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087485"	"00087345"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087486"	"00087346"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087487"	"00087347"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087488"	"00087348"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087489"	"00087349"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;Southern"	"DNA"	""	""
"0000087490"	"00087350"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087491"	"00087351"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087492"	"00087352"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087493"	"00087353"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087494"	"00087354"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087495"	"00087355"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087496"	"00087356"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE;Southern"	"DNA"	""	""
"0000087497"	"00087357"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;Southern"	"DNA"	""	""
"0000087498"	"00087358"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087499"	"00087359"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087500"	"00087360"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087501"	"00087361"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087502"	"00087362"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087503"	"00087363"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087504"	"00087364"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087505"	"00087365"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087506"	"00087366"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087507"	"00087367"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087508"	"00087368"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087509"	"00087369"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087510"	"00087370"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087511"	"00087371"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087512"	"00087372"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087513"	"00087373"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087514"	"00087374"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087515"	"00087375"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087516"	"00087376"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087517"	"00087377"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;DGGE"	"DNA"	""	""
"0000087518"	"00087378"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087519"	"00087379"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087520"	"00087380"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087521"	"00087381"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087522"	"00087382"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087523"	"00087383"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087524"	"00087384"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087525"	"00087385"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087526"	"00087386"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087527"	"00087387"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087528"	"00087388"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087529"	"00087389"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087530"	"00087390"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087531"	"00087391"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087532"	"00087392"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087533"	"00087393"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087534"	"00087394"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087535"	"00087395"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087536"	"00087396"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087537"	"00087397"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087538"	"00087398"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087539"	"00087399"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087540"	"00087400"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087541"	"00087401"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087542"	"00087402"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087543"	"00087403"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087544"	"00087404"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087545"	"00087405"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087546"	"00087406"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087547"	"00087407"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087548"	"00087408"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087549"	"00087409"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087550"	"00087410"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087551"	"00087411"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087552"	"00087412"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087553"	"00087413"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087554"	"00087414"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087555"	"00087415"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087556"	"00087416"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087557"	"00087417"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087558"	"00087418"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087559"	"00087419"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087560"	"00087420"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087561"	"00087421"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087562"	"00087422"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087563"	"00087423"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087564"	"00087424"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087565"	"00087425"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087566"	"00087426"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087567"	"00087427"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087568"	"00087428"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087569"	"00087429"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087570"	"00087430"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087571"	"00087431"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087572"	"00087432"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087573"	"00087433"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087574"	"00087434"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087575"	"00087435"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087576"	"00087436"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087577"	"00087437"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087578"	"00087438"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087579"	"00087439"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087580"	"00087440"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087581"	"00087441"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087582"	"00087442"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087583"	"00087443"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087584"	"00087444"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087585"	"00087445"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087586"	"00087446"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087587"	"00087447"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087588"	"00087448"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087589"	"00087449"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087590"	"00087450"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087591"	"00087451"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;DGGE"	"DNA"	""	""
"0000087592"	"00087452"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087593"	"00087453"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087594"	"00087454"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087595"	"00087455"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087596"	"00087456"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087597"	"00087457"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087598"	"00087458"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087599"	"00087459"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087600"	"00087460"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087601"	"00087461"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087602"	"00087462"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087603"	"00087463"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087604"	"00087464"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087605"	"00087465"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087606"	"00087466"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087607"	"00087467"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087608"	"00087468"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087609"	"00087469"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087610"	"00087470"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087611"	"00087471"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087612"	"00087472"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087613"	"00087473"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087614"	"00087474"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087615"	"00087475"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087616"	"00087476"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087617"	"00087477"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087618"	"00087478"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087619"	"00087479"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087620"	"00087480"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087621"	"00087481"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087622"	"00087482"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087623"	"00087483"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087624"	"00087484"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087625"	"00087485"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087626"	"00087486"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087627"	"00087487"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087628"	"00087488"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087629"	"00087489"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087630"	"00087490"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087631"	"00087491"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087632"	"00087492"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SSCA"	"DNA"	""	""
"0000087633"	"00087493"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087634"	"00087494"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087635"	"00087495"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087636"	"00087496"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087637"	"00087497"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087638"	"00087498"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087639"	"00087499"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087640"	"00087500"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087641"	"00087501"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087642"	"00087502"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087643"	"00087503"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087644"	"00087504"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087645"	"00087505"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087646"	"00087506"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087647"	"00087507"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087648"	"00087508"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087649"	"00087509"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087650"	"00087510"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087651"	"00087511"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087652"	"00087512"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087653"	"00087513"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087654"	"00087514"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087655"	"00087515"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087656"	"00087516"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087657"	"00087517"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087658"	"00087518"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087659"	"00087519"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087660"	"00087520"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087661"	"00087521"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087662"	"00087522"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087663"	"00087523"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087664"	"00087524"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087665"	"00087525"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087666"	"00087526"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087667"	"00087527"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087668"	"00087528"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087669"	"00087529"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087670"	"00087530"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087671"	"00087531"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087672"	"00087532"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087673"	"00087533"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087674"	"00087534"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087675"	"00087535"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087676"	"00087536"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087677"	"00087537"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087678"	"00087538"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087679"	"00087539"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087680"	"00087540"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087681"	"00087541"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087682"	"00087542"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087683"	"00087543"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087684"	"00087544"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087685"	"00087545"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087686"	"00087546"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087687"	"00087547"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087688"	"00087548"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087689"	"00087549"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087690"	"00087550"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087691"	"00087551"	"1"	"00221"	"00221"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087692"	"00087552"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087693"	"00087553"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SSCA"	"DNA"	""	""
"0000087694"	"00087554"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA;Southern"	"DNA"	""	""
"0000087695"	"00087555"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087696"	"00087556"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087697"	"00087557"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087698"	"00087558"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087699"	"00087559"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087700"	"00087560"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087701"	"00087561"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087702"	"00087562"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087703"	"00087563"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087704"	"00087564"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087705"	"00087565"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087706"	"00087566"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087707"	"00087567"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087708"	"00087568"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087709"	"00087569"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087710"	"00087570"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"DGGE"	"DNA"	""	""
"0000087711"	"00087571"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087712"	"00087572"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087713"	"00087573"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087714"	"00087574"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087715"	"00087575"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087716"	"00087576"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087717"	"00087577"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087718"	"00087578"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087719"	"00087579"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087720"	"00087580"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087721"	"00087581"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087722"	"00087582"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087723"	"00087583"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087724"	"00087584"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087725"	"00087585"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087726"	"00087586"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087727"	"00087587"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087728"	"00087588"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087729"	"00087589"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087730"	"00087590"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087731"	"00087591"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087732"	"00087592"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087733"	"00087593"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087734"	"00087594"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087735"	"00087595"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087736"	"00087596"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087737"	"00087597"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087738"	"00087598"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087739"	"00087599"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087740"	"00087600"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087741"	"00087601"	"1"	"00006"	"00006"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087742"	"00087602"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087743"	"00087603"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087744"	"00087604"	"1"	"00221"	"00221"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087745"	"00087605"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087746"	"00087606"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087747"	"00087607"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087748"	"00087608"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087749"	"00087609"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087750"	"00087610"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087751"	"00087611"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087752"	"00087612"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087753"	"00087613"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087754"	"00087614"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087755"	"00087615"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087756"	"00087616"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087757"	"00087617"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087758"	"00087618"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087759"	"00087619"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087760"	"00087620"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087761"	"00087621"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087762"	"00087622"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR"	"DNA"	""	""
"0000087763"	"00087623"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR"	"DNA"	""	""
"0000087764"	"00087624"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087765"	"00087625"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087766"	"00087626"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087767"	"00087627"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087768"	"00087628"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087769"	"00087629"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087770"	"00087630"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087771"	"00087631"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087772"	"00087632"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087773"	"00087633"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087774"	"00087634"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087775"	"00087635"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"PCR;SEQ"	"DNA"	""	""
"0000087776"	"00087636"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087777"	"00087637"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087778"	"00087638"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087779"	"00087639"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087780"	"00087640"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087781"	"00087641"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087782"	"00087642"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087783"	"00087643"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087784"	"00087644"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087785"	"00087645"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087786"	"00087646"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087787"	"00087647"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087788"	"00087648"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087789"	"00087649"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087790"	"00087650"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087791"	"00087651"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087792"	"00087652"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087793"	"00087653"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087794"	"00087654"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087795"	"00087655"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087796"	"00087656"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087797"	"00087657"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087798"	"00087658"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087799"	"00087659"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087800"	"00087660"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087801"	"00087661"	"1"	"00220"	"00220"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087802"	"00087662"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087803"	"00087663"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087804"	"00087664"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087805"	"00087665"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087806"	"00087666"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087807"	"00087667"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087808"	"00087668"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087809"	"00087669"	"1"	"00156"	"00156"	"2008-01-22 12:32:05"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087810"	"00087670"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087811"	"00087671"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087812"	"00087672"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087813"	"00087673"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087814"	"00087674"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087815"	"00087675"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087816"	"00087676"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087817"	"00087677"	"1"	"00221"	"00221"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087818"	"00087678"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087819"	"00087679"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087820"	"00087680"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087821"	"00087681"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087822"	"00087682"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087823"	"00087683"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087824"	"00087684"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087825"	"00087685"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087826"	"00087686"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087827"	"00087687"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087828"	"00087688"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087829"	"00087689"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087830"	"00087690"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087831"	"00087691"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087832"	"00087692"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087833"	"00087693"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087834"	"00087694"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087835"	"00087695"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087836"	"00087696"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087837"	"00087697"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087838"	"00087698"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087839"	"00087699"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087840"	"00087700"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087841"	"00087701"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087842"	"00087702"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087843"	"00087703"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087844"	"00087704"	"1"	"00156"	"00156"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087845"	"00087705"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087846"	"00087706"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087847"	"00087707"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087848"	"00087708"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087849"	"00087709"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087850"	"00087710"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087851"	"00087711"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087852"	"00087712"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087853"	"00087713"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087854"	"00087714"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087855"	"00087715"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087856"	"00087716"	"1"	"00221"	"00221"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087857"	"00087717"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087858"	"00087718"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087859"	"00087719"	"1"	"00006"	"00006"	"2008-05-18 17:47:17"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087860"	"00087720"	"1"	"00006"	"00006"	"2008-02-04 22:57:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087861"	"00087721"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087862"	"00087722"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087863"	"00087723"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087864"	"00087724"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087865"	"00087725"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087866"	"00087726"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087867"	"00087727"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087868"	"00087728"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087869"	"00087729"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087870"	"00087730"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087871"	"00087731"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087872"	"00087732"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087873"	"00087733"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087874"	"00087734"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087875"	"00087735"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087876"	"00087736"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087877"	"00087737"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087878"	"00087738"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087879"	"00087739"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087880"	"00087740"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087881"	"00087741"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087882"	"00087742"	"1"	"00006"	"00006"	"2008-06-06 12:55:13"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087883"	"00087743"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087884"	"00087744"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087885"	"00087745"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087886"	"00087746"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087887"	"00087747"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087888"	"00087748"	"1"	"00006"	"00006"	"2008-06-06 12:55:14"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087889"	"00087749"	"1"	"00222"	"00222"	"2008-09-04 21:59:44"	"00006"	"2012-05-18 13:59:34"	"SEQ"	"DNA"	""	""
"0000087890"	"00087750"	"1"	"00006"	"00006"	"2009-05-17 16:51:03"	"00006"	"2013-01-02 14:10:10"	"SEQ"	"DNA"	""	""
"0000087891"	"00087751"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087892"	"00087752"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087893"	"00087753"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087894"	"00087754"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087895"	"00087755"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087896"	"00087756"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087897"	"00087757"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087898"	"00087758"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087899"	"00087759"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087900"	"00087760"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087901"	"00087761"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087902"	"00087762"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087903"	"00087763"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087904"	"00087764"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087905"	"00087765"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087906"	"00087766"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087907"	"00087767"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087908"	"00087768"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087909"	"00087769"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087910"	"00087770"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087911"	"00087771"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087912"	"00087772"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087913"	"00087773"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087914"	"00087774"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087915"	"00087775"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087916"	"00087776"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087917"	"00087777"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087918"	"00087778"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087919"	"00087779"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087920"	"00087780"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087921"	"00087781"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087922"	"00087782"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087923"	"00087783"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087924"	"00087784"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087925"	"00087785"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087926"	"00087786"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087927"	"00087787"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087928"	"00087788"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087929"	"00087789"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087930"	"00087790"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087931"	"00087791"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087932"	"00087792"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087933"	"00087793"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087934"	"00087794"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087935"	"00087795"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087936"	"00087796"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087937"	"00087797"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087938"	"00087798"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087939"	"00087799"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087940"	"00087800"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087941"	"00087801"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087942"	"00087802"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000087943"	"00087803"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA;SEQ"	"DNA"	""	""
"0000087944"	"00087804"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087945"	"00087805"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087946"	"00087806"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087947"	"00087807"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087948"	"00087808"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087949"	"00087809"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087950"	"00087810"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087951"	"00087811"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087952"	"00087812"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087953"	"00087813"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087954"	"00087814"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087955"	"00087815"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000087956"	"00087816"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SSCA"	"DNA"	""	""
"0000087958"	"00087818"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000088194"	"00088054"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088195"	"00088055"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088196"	"00088056"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088197"	"00088057"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088198"	"00088058"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088199"	"00088059"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000088200"	"00088060"	"1"	"00238"	"00238"	"2013-01-20 15:06:08"	""	""	"?"	"DNA"	""	""
"0000132955"	"00132118"	"1"	"00006"	"00006"	"2017-10-23 20:49:25"	""	""	"SEQ"	"DNA"	""	""
"0000132956"	"00132119"	"1"	"00006"	"00006"	"2017-10-23 20:49:25"	""	""	"SEQ"	"DNA"	""	""
"0000132957"	"00132120"	"1"	"00006"	"00006"	"2017-10-23 20:49:25"	""	""	"SEQ"	"DNA"	""	""
"0000208392"	"00207356"	"1"	"00006"	"00006"	"2018-11-20 14:07:41"	""	""	"SEQ"	"DNA"	""	""
"0000208634"	"00207597"	"1"	"01244"	"01244"	"2018-11-26 13:45:55"	""	""	"SEQ-NG-I"	"DNA"	"Peripheral blood"	""
"0000210083"	"00209026"	"1"	"00006"	"00006"	"2018-12-22 15:10:51"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000309706"	"00308561"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309707"	"00308562"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309708"	"00308563"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309709"	"00308564"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309710"	"00308565"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309711"	"00308566"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309712"	"00308567"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309713"	"00308568"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000310558"	"00309413"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310559"	"00309414"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310560"	"00309415"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310561"	"00309416"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310562"	"00309417"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310563"	"00309418"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310564"	"00309419"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310565"	"00309420"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000329715"	"00328500"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000334980"	"00333754"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334981"	"00333755"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334982"	"00333756"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334983"	"00333757"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334984"	"00333758"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334985"	"00333759"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334986"	"00333760"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334987"	"00333761"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334988"	"00333762"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334989"	"00333763"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334990"	"00333764"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334991"	"00333765"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000334992"	"00333766"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000336550"	"00335321"	"1"	"02485"	"00006"	"2021-03-04 16:18:39"	""	""	"SEQ-NG"	"DNA"	""	"68-gene panel"
"0000336678"	"00335449"	"1"	"00006"	"00006"	"2021-03-05 17:02:19"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000337222"	"00335992"	"1"	"00000"	"00006"	"2021-03-10 17:05:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000337223"	"00335993"	"1"	"00000"	"00006"	"2021-03-10 17:05:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000359975"	"00358745"	"1"	"00000"	"00006"	"2021-03-11 13:59:15"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000360615"	"00359373"	"1"	"00000"	"00006"	"2021-03-19 18:50:51"	""	""	"SEQ-NG"	"DNA"	""	"64-gene panel"
"0000375078"	"00373846"	"1"	"00000"	"00006"	"2021-05-21 13:56:05"	""	""	"SEQ-NG"	"DNA"	""	"86-gene panel"
"0000375172"	"00373940"	"1"	"00000"	"00006"	"2021-05-21 15:01:30"	""	""	"SEQ-NG"	"DNA"	""	"238-gene panel"
"0000377515"	"00376319"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377516"	"00376320"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377517"	"00376321"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377518"	"00376322"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000380761"	"00379562"	"1"	"00000"	"00008"	"2021-08-06 03:44:17"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000380988"	"00379785"	"1"	"01807"	"01807"	"2021-08-09 13:50:01"	""	""	"SEQ"	"DNA"	""	""
"0000380995"	"00379792"	"1"	"03508"	"03508"	"2021-08-10 03:00:23"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000384681"	"00383456"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000384682"	"00383457"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000384683"	"00383458"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000384684"	"00383459"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000385478"	"00384253"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385479"	"00384254"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385536"	"00384311"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385543"	"00384318"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385562"	"00384337"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385564"	"00384339"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385567"	"00384342"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385573"	"00384348"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385590"	"00384365"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385620"	"00384395"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385641"	"00384416"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385673"	"00384448"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385682"	"00384457"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385704"	"00384479"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385714"	"00384489"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000385715"	"00384490"	"1"	"00000"	"03840"	"2021-09-29 13:19:55"	""	""	"SEQ-NG"	"DNA"	"blood"	"panel of 126 genes"
"0000387959"	"00386731"	"1"	"00000"	"03840"	"2021-10-26 11:33:19"	""	""	"SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000388025"	"00386797"	"1"	"00000"	"03840"	"2021-10-26 11:33:19"	""	""	"SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000389275"	"00388037"	"1"	"00000"	"00008"	"2021-11-02 00:52:48"	"00008"	"2021-11-04 08:55:19"	"SEQ-NG;arrayCGH;SEQ"	"DNA"	"blood"	""
"0000389434"	"00388195"	"1"	"00006"	"00006"	"2021-11-02 18:56:14"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000389970"	"00388727"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000389999"	"00388756"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390001"	"00388758"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390008"	"00388765"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390009"	"00388766"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390022"	"00388779"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390027"	"00388784"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390030"	"00388787"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390031"	"00388788"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390033"	"00388790"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390129"	"00388886"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390130"	"00388887"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"MLPA"	"DNA"	"blood"	"MLPA"
"0000390141"	"00388898"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390146"	"00388903"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390148"	"00388905"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390153"	"00388910"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390162"	"00388919"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390205"	"00388962"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000390206"	"00388963"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET5 targeted sequencing panel - see paper"
"0000392001"	"00390760"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"arraySEQ"	"DNA"	"Blood"	""
"0000392037"	"00390796"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"arraySEQ"	"DNA"	"Blood"	""
"0000392100"	"00390859"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392157"	"00390916"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392225"	"00390984"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392232"	"00390991"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392234"	"00390993"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392238"	"00390997"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392626"	"00391384"	"1"	"00000"	"03840"	"2021-11-15 18:02:17"	""	""	"SEQ-NG"	"DNA"	""	"retrospective case note review, targeted gene panel testing"
"0000392627"	"00391385"	"1"	"00000"	"03840"	"2021-11-15 18:02:17"	""	""	"SEQ-NG"	"DNA"	""	"retrospective case note review, targeted gene panel testing"
"0000392745"	"00391503"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392746"	"00391504"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392747"	"00391505"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392750"	"00391508"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392751"	"00391509"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392752"	"00391510"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392753"	"00391511"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392754"	"00391512"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392755"	"00391513"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392756"	"00391514"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392757"	"00391515"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392758"	"00391516"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000394696"	"00393448"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394718"	"00393470"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394719"	"00393471"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394723"	"00393475"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394724"	"00393476"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394765"	"00393517"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394797"	"00393549"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394857"	"00393609"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000394978"	"00393730"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ-NG"	"DNA"	""	"hereditary eye disease enrichment panel (HEDEP)"
"0000394993"	"00393745"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ-NG"	"DNA"	""	"hereditary eye disease enrichment panel (HEDEP)"
"0000395060"	"00393812"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000395085"	"00393837"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000395114"	"00393866"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ"	"DNA"	""	""
"0000395136"	"00393888"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ-NG;PCRq"	"DNA"	""	"hereditary eye disease enrichment panel (HEDEP); quantitative fluorescence PCR (QF-PCR)"
"0000396044"	"00394797"	"1"	"00000"	"03840"	"2021-12-02 12:05:39"	""	""	"SEQ-NG"	"DNA"	""	""
"0000397165"	"00395926"	"1"	"00000"	"03840"	"2021-12-09 13:32:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"212 inherited retinal disease-related genes"
"0000397166"	"00395927"	"1"	"00000"	"03840"	"2021-12-09 13:32:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"212 inherited retinal disease-related genes"
"0000397191"	"00395952"	"1"	"00000"	"03840"	"2021-12-09 13:32:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"212 inherited retinal disease-related genes"
"0000397224"	"00395985"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397225"	"00395986"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397226"	"00395987"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397227"	"00395988"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397228"	"00395989"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397229"	"00395990"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397230"	"00395991"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397231"	"00395992"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397232"	"00395993"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397233"	"00395994"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397234"	"00395995"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397235"	"00395996"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397236"	"00395997"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397237"	"00395998"	"1"	"00000"	"03840"	"2021-12-10 14:01:06"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397242"	"00396002"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397243"	"00396003"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397244"	"00396004"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397245"	"00396005"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397246"	"00396006"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397247"	"00396007"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397248"	"00396008"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397249"	"00396009"	"1"	"00000"	"03840"	"2021-12-10 15:30:28"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397250"	"00396010"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397251"	"00396011"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397252"	"00396012"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397253"	"00396013"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397254"	"00396014"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397255"	"00396015"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397256"	"00396016"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397257"	"00396017"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397258"	"00396018"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397259"	"00396019"	"1"	"00006"	"00006"	"2021-12-10 19:26:27"	""	""	"SEQ"	"DNA"	""	""
"0000397260"	"00396020"	"1"	"00000"	"03840"	"2021-12-10 20:34:31"	""	""	"?"	"DNA"	"?"	""
"0000397261"	"00396021"	"1"	"00000"	"03840"	"2021-12-11 09:13:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397262"	"00396022"	"1"	"00000"	"03840"	"2021-12-11 09:13:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397273"	"00396034"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397274"	"00396035"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397275"	"00396036"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397276"	"00396037"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397277"	"00396038"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397278"	"00396039"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397279"	"00396040"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397280"	"00396041"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397281"	"00396042"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397282"	"00396043"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397283"	"00396044"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397284"	"00396045"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397285"	"00396046"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397286"	"00396047"	"1"	"00000"	"03840"	"2021-12-12 11:44:27"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397287"	"00396048"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397288"	"00396049"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397289"	"00396050"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397290"	"00396051"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397291"	"00396052"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397292"	"00396053"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397293"	"00396054"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397294"	"00396055"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397295"	"00396056"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397296"	"00396057"	"1"	"00000"	"03840"	"2021-12-12 12:56:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397301"	"00396062"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397302"	"00396063"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397303"	"00396064"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397304"	"00396065"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397305"	"00396066"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397306"	"00396067"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397307"	"00396068"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397308"	"00396069"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397309"	"00396070"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397310"	"00396071"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397311"	"00396072"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397312"	"00396073"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397313"	"00396074"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397314"	"00396075"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397315"	"00396076"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397316"	"00396077"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397317"	"00396078"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397318"	"00396079"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397319"	"00396080"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397320"	"00396081"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397321"	"00396082"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397322"	"00396083"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397323"	"00396084"	"1"	"00000"	"03840"	"2021-12-13 11:34:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397324"	"00396085"	"1"	"00000"	"03840"	"2021-12-13 12:21:22"	""	""	"SEQ"	"DNA"	""	""
"0000397325"	"00396086"	"1"	"00000"	"03840"	"2021-12-13 12:21:22"	""	""	"SEQ"	"DNA"	""	""
"0000397326"	"00396087"	"1"	"00000"	"03840"	"2021-12-13 12:50:19"	""	""	"SEQ"	"DNA"	""	""
"0000397327"	"00396088"	"1"	"00000"	"03840"	"2021-12-13 12:50:19"	""	""	"SEQ"	"DNA"	""	""
"0000397328"	"00396089"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397329"	"00396090"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397330"	"00396091"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397331"	"00396092"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397332"	"00396093"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397333"	"00396094"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397334"	"00396095"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397335"	"00396096"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397336"	"00396097"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397337"	"00396098"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397338"	"00396099"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397339"	"00396100"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397340"	"00396101"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397341"	"00396102"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397342"	"00396103"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397343"	"00396104"	"1"	"00000"	"03840"	"2021-12-13 13:53:04"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397344"	"00396105"	"1"	"00000"	"03840"	"2021-12-13 14:36:35"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397345"	"00396106"	"1"	"00000"	"03840"	"2021-12-13 14:36:35"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397346"	"00396107"	"1"	"00000"	"03840"	"2021-12-13 14:36:35"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397347"	"00396108"	"1"	"00000"	"03840"	"2021-12-13 14:36:35"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397348"	"00396109"	"1"	"00000"	"03840"	"2021-12-13 14:36:35"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397350"	"00396111"	"1"	"00000"	"03840"	"2021-12-13 15:15:04"	""	""	"SEQ"	"DNA"	""	""
"0000397351"	"00396112"	"1"	"00000"	"03840"	"2021-12-13 15:15:04"	""	""	"SEQ"	"DNA"	""	""
"0000397352"	"00396113"	"1"	"00000"	"03840"	"2021-12-13 15:15:04"	""	""	"SEQ"	"DNA"	""	""
"0000397353"	"00396114"	"1"	"00000"	"03840"	"2021-12-13 15:15:04"	""	""	"SEQ"	"DNA"	""	""
"0000397354"	"00396115"	"1"	"00000"	"03840"	"2021-12-13 15:15:04"	""	""	"SEQ"	"DNA"	""	""
"0000397355"	"00396116"	"1"	"00000"	"03840"	"2021-12-13 15:30:22"	""	""	"SEQ"	"DNA"	""	""
"0000397356"	"00396117"	"1"	"00000"	"03840"	"2021-12-13 15:30:22"	""	""	"SEQ"	"DNA"	""	""
"0000397357"	"00396118"	"1"	"00000"	"03840"	"2021-12-13 16:01:08"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397358"	"00396119"	"1"	"00000"	"03840"	"2021-12-13 16:01:08"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397359"	"00396120"	"1"	"00000"	"03840"	"2021-12-13 16:01:08"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397360"	"00396121"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397361"	"00396122"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397362"	"00396123"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397363"	"00396124"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397364"	"00396125"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397365"	"00396126"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397366"	"00396127"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397367"	"00396128"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397368"	"00396129"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397369"	"00396130"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397370"	"00396131"	"1"	"00000"	"03840"	"2021-12-13 20:31:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397372"	"00396133"	"1"	"00000"	"03840"	"2021-12-14 11:36:30"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397373"	"00396134"	"1"	"00000"	"03840"	"2021-12-14 11:36:30"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397374"	"00396135"	"1"	"00000"	"03840"	"2021-12-14 11:49:57"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397375"	"00396136"	"1"	"00000"	"03840"	"2021-12-14 12:15:15"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397376"	"00396137"	"1"	"00000"	"03840"	"2021-12-14 12:15:15"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397377"	"00396138"	"1"	"00000"	"03840"	"2021-12-14 12:15:15"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397378"	"00396139"	"1"	"00000"	"03840"	"2021-12-14 12:15:15"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397379"	"00396140"	"1"	"00000"	"03840"	"2021-12-14 12:15:15"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397380"	"00396141"	"1"	"00000"	"03840"	"2021-12-14 12:26:21"	""	""	"?"	"DNA"	""	""
"0000397381"	"00396142"	"1"	"00000"	"03840"	"2021-12-14 12:44:52"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397382"	"00396143"	"1"	"00000"	"03840"	"2021-12-14 12:44:52"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397383"	"00396144"	"1"	"00000"	"03840"	"2021-12-14 13:25:42"	""	""	"MLPA"	"DNA"	"blood"	""
"0000397384"	"00396145"	"1"	"00000"	"03840"	"2021-12-14 13:25:42"	""	""	"MLPA"	"DNA"	"blood"	""
"0000397385"	"00396146"	"1"	"00000"	"03840"	"2021-12-14 13:25:42"	""	""	"MLPA"	"DNA"	"blood"	""
"0000397386"	"00396147"	"1"	"00000"	"03840"	"2021-12-14 13:25:42"	""	""	"MLPA"	"DNA"	"blood"	""
"0000397387"	"00396148"	"1"	"00000"	"03840"	"2021-12-14 13:50:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397388"	"00396149"	"1"	"00000"	"03840"	"2021-12-14 13:50:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397389"	"00396150"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397390"	"00396151"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397391"	"00396152"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397392"	"00396153"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397393"	"00396154"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397394"	"00396155"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397395"	"00396156"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397396"	"00396157"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397397"	"00396158"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397398"	"00396159"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397399"	"00396160"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397400"	"00396161"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397401"	"00396162"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397402"	"00396163"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397403"	"00396164"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397404"	"00396165"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397405"	"00396166"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397406"	"00396167"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397407"	"00396168"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397408"	"00396169"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397409"	"00396170"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397410"	"00396171"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397411"	"00396172"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397412"	"00396173"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397413"	"00396174"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397414"	"00396175"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397415"	"00396176"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397416"	"00396177"	"1"	"00000"	"03840"	"2021-12-14 14:56:56"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397586"	"00396345"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397587"	"00396346"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397588"	"00396347"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397589"	"00396348"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397590"	"00396349"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397591"	"00396350"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397592"	"00396351"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397593"	"00396352"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397594"	"00396353"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397595"	"00396354"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397596"	"00396355"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397597"	"00396356"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397598"	"00396357"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397599"	"00396358"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397600"	"00396359"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397601"	"00396360"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397602"	"00396361"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397603"	"00396362"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397604"	"00396363"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397605"	"00396364"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397606"	"00396365"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397607"	"00396366"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397608"	"00396367"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397609"	"00396368"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397610"	"00396369"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397611"	"00396370"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397612"	"00396371"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397613"	"00396372"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397614"	"00396373"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397615"	"00396374"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397616"	"00396375"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397617"	"00396376"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397618"	"00396377"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397619"	"00396378"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397620"	"00396379"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397621"	"00396380"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397622"	"00396381"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397623"	"00396382"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397624"	"00396383"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397625"	"00396384"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397626"	"00396385"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397627"	"00396386"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397628"	"00396387"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397629"	"00396388"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397630"	"00396389"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397631"	"00396390"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397632"	"00396391"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397633"	"00396392"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397634"	"00396393"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397635"	"00396394"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397636"	"00396395"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397637"	"00396396"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397638"	"00396397"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397639"	"00396398"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397640"	"00396399"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397641"	"00396400"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397642"	"00396401"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397643"	"00396402"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397644"	"00396403"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397645"	"00396404"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397646"	"00396405"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397647"	"00396406"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397648"	"00396407"	"1"	"00000"	"03840"	"2021-12-15 13:41:42"	""	""	"?"	"DNA"	""	"retrospective study"
"0000397662"	"00396421"	"1"	"00006"	"00006"	"2021-12-15 14:29:48"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WGS"
"0000397672"	"00396431"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397673"	"00396432"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397674"	"00396433"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397675"	"00396434"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397676"	"00396435"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397677"	"00396436"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397678"	"00396437"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397679"	"00396438"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397680"	"00396439"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397681"	"00396440"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397682"	"00396441"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397683"	"00396442"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397684"	"00396443"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397685"	"00396444"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397686"	"00396445"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397687"	"00396446"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397688"	"00396447"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397689"	"00396448"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397690"	"00396449"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397691"	"00396450"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397692"	"00396451"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397693"	"00396452"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397694"	"00396453"	"1"	"00000"	"03840"	"2021-12-15 15:16:20"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397706"	"00396466"	"1"	"00000"	"03840"	"2021-12-15 20:02:57"	""	""	"SEQ;arraySNP"	"DNA"	"blood"	"Sanger sequencing, whole genome SNP 6.0 array"
"0000397732"	"00396489"	"1"	"00000"	"03840"	"2021-12-16 12:35:05"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"panel of 254 genes implicated in retinopathies"
"0000397733"	"00396490"	"1"	"00000"	"03840"	"2021-12-16 12:35:05"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"panel of 254 genes implicated in retinopathies"
"0000397899"	"00396656"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397900"	"00396657"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397901"	"00396658"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397902"	"00396659"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397903"	"00396660"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397904"	"00396661"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397905"	"00396662"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397906"	"00396663"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397907"	"00396664"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397908"	"00396665"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397909"	"00396666"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397910"	"00396667"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397911"	"00396668"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397912"	"00396669"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397913"	"00396670"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397914"	"00396671"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397915"	"00396672"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397916"	"00396673"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397917"	"00396674"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397918"	"00396675"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397919"	"00396676"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397920"	"00396677"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397921"	"00396678"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397922"	"00396679"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397923"	"00396680"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397924"	"00396681"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397925"	"00396682"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397926"	"00396683"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397927"	"00396684"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397928"	"00396685"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397929"	"00396686"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397930"	"00396687"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397931"	"00396688"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397932"	"00396689"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397933"	"00396690"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397934"	"00396691"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397935"	"00396692"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397936"	"00396693"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397937"	"00396694"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397938"	"00396695"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397939"	"00396696"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397940"	"00396697"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397941"	"00396698"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397942"	"00396699"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397943"	"00396700"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397944"	"00396701"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397945"	"00396702"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397946"	"00396703"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397947"	"00396704"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397948"	"00396705"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397949"	"00396706"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397950"	"00396707"	"1"	"00000"	"03840"	"2021-12-16 14:52:25"	""	""	"SEQ"	"DNA"	"blood"	"retrospective study"
"0000397968"	"00396725"	"1"	"00000"	"03840"	"2021-12-17 09:26:52"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397969"	"00396727"	"1"	"00000"	"03840"	"2021-12-17 11:24:37"	""	""	"?"	"DNA"	""	"study of diurnal variations of foveoschisis"
"0000397970"	"00396728"	"1"	"00000"	"03840"	"2021-12-17 11:24:37"	""	""	"?"	"DNA"	""	"study of diurnal variations of foveoschisis"
"0000397971"	"00396729"	"1"	"00000"	"03840"	"2021-12-17 11:24:37"	""	""	"?"	"DNA"	""	"study of diurnal variations of foveoschisis"
"0000397972"	"00396730"	"1"	"00000"	"03840"	"2021-12-17 12:04:59"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397973"	"00396731"	"1"	"00000"	"03840"	"2021-12-17 12:04:59"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397974"	"00396732"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000397975"	"00396733"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397976"	"00396734"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397977"	"00396735"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397978"	"00396736"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397979"	"00396737"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397980"	"00396738"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397981"	"00396739"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397982"	"00396740"	"1"	"00000"	"03840"	"2021-12-17 12:32:21"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397983"	"00396741"	"1"	"00000"	"03840"	"2021-12-17 12:54:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397984"	"00396742"	"1"	"00000"	"03840"	"2021-12-17 12:54:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397985"	"00396743"	"1"	"00000"	"03840"	"2021-12-17 12:54:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000397986"	"00396744"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397987"	"00396745"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397988"	"00396746"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397989"	"00396747"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397990"	"00396748"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397991"	"00396749"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397992"	"00396750"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397993"	"00396751"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397994"	"00396752"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397995"	"00396753"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397996"	"00396754"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397997"	"00396755"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397998"	"00396756"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000397999"	"00396757"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398000"	"00396758"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398001"	"00396759"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398002"	"00396760"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398003"	"00396761"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398004"	"00396762"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398005"	"00396763"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398006"	"00396764"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398007"	"00396765"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398008"	"00396766"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398009"	"00396767"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398010"	"00396768"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398011"	"00396769"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398012"	"00396770"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398013"	"00396771"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398014"	"00396772"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398015"	"00396773"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398016"	"00396774"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398017"	"00396775"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398018"	"00396776"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398019"	"00396777"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398020"	"00396778"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398021"	"00396779"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398022"	"00396780"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398023"	"00396781"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398024"	"00396782"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398025"	"00396783"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398026"	"00396784"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398027"	"00396785"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398028"	"00396786"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398029"	"00396787"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398030"	"00396788"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398031"	"00396789"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398032"	"00396790"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398033"	"00396791"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398034"	"00396792"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398035"	"00396793"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398036"	"00396794"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398037"	"00396795"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398038"	"00396796"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398039"	"00396797"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398040"	"00396798"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398041"	"00396799"	"1"	"00000"	"03840"	"2021-12-17 14:26:04"	""	""	"?"	"DNA"	""	""
"0000398042"	"00396801"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398043"	"00396802"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398044"	"00396803"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398045"	"00396804"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398046"	"00396805"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398047"	"00396806"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398048"	"00396807"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398049"	"00396808"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398050"	"00396809"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398051"	"00396810"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398052"	"00396811"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398053"	"00396812"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398054"	"00396813"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398055"	"00396814"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398056"	"00396815"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398057"	"00396816"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398058"	"00396817"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398059"	"00396818"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398060"	"00396819"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398061"	"00396820"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398062"	"00396821"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398063"	"00396822"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398064"	"00396823"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398065"	"00396824"	"1"	"00000"	"03840"	"2021-12-17 14:48:13"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398102"	"00396861"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398103"	"00396862"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398104"	"00396863"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398105"	"00396864"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398106"	"00396865"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398107"	"00396866"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398108"	"00396867"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398109"	"00396868"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398110"	"00396869"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398111"	"00396870"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398112"	"00396871"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398113"	"00396872"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398114"	"00396873"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398115"	"00396874"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398116"	"00396875"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398117"	"00396876"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398118"	"00396877"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398119"	"00396878"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398120"	"00396879"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398121"	"00396880"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398122"	"00396881"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398123"	"00396882"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398124"	"00396883"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398125"	"00396884"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398126"	"00396885"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398127"	"00396886"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398128"	"00396887"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398129"	"00396888"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398130"	"00396889"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398131"	"00396890"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398132"	"00396891"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398133"	"00396892"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398134"	"00396893"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398135"	"00396894"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398136"	"00396895"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398137"	"00396896"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398138"	"00396897"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398139"	"00396898"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398140"	"00396899"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398141"	"00396900"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398142"	"00396901"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398143"	"00396902"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398144"	"00396903"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398145"	"00396904"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398146"	"00396905"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398147"	"00396906"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398148"	"00396907"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398149"	"00396908"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398150"	"00396909"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398151"	"00396910"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398152"	"00396911"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398153"	"00396912"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398154"	"00396913"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398155"	"00396914"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398156"	"00396915"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398157"	"00396916"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398158"	"00396917"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398159"	"00396918"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398160"	"00396919"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398161"	"00396920"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398162"	"00396921"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398163"	"00396922"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398164"	"00396923"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398165"	"00396924"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398166"	"00396925"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398167"	"00396926"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398168"	"00396927"	"1"	"00000"	"03840"	"2021-12-17 15:56:41"	""	""	"SEQ"	"DNA"	"blood"	""
"0000398245"	"00397004"	"1"	"00000"	"03840"	"2021-12-18 19:37:54"	""	""	"SEQ"	"DNA"	""	""
"0000398285"	"00397045"	"1"	"00000"	"03840"	"2021-12-19 16:05:33"	""	""	"SEQ"	"DNA"	""	""
"0000398286"	"00397046"	"1"	"00000"	"03840"	"2021-12-19 16:05:33"	""	""	"SEQ"	"DNA"	""	""
"0000398287"	"00397047"	"1"	"00000"	"03840"	"2021-12-19 16:05:33"	""	""	"SEQ"	"DNA"	""	""
"0000398288"	"00397048"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398289"	"00397049"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398290"	"00397050"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398291"	"00397051"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398292"	"00397052"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398293"	"00397053"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398294"	"00397054"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398295"	"00397055"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398296"	"00397056"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398297"	"00397057"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398298"	"00397058"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398299"	"00397059"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398300"	"00397060"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398301"	"00397061"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398302"	"00397062"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398303"	"00397063"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398304"	"00397064"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398305"	"00397065"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398306"	"00397066"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398307"	"00397067"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398308"	"00397068"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398309"	"00397069"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398310"	"00397070"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398311"	"00397071"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398312"	"00397072"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398313"	"00397073"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398314"	"00397074"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398315"	"00397075"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398316"	"00397076"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398317"	"00397077"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398318"	"00397078"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398319"	"00397079"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398320"	"00397080"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398321"	"00397081"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398322"	"00397082"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398323"	"00397083"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398324"	"00397084"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398325"	"00397085"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398326"	"00397086"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398327"	"00397087"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398328"	"00397088"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398329"	"00397089"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398330"	"00397090"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398331"	"00397091"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398332"	"00397092"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398333"	"00397093"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398334"	"00397094"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398335"	"00397095"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398336"	"00397096"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398337"	"00397097"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398338"	"00397098"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398339"	"00397099"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398340"	"00397100"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398341"	"00397101"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398342"	"00397102"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398343"	"00397103"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398344"	"00397104"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398345"	"00397105"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398346"	"00397106"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398347"	"00397107"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398348"	"00397108"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398349"	"00397109"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398350"	"00397110"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398351"	"00397111"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398352"	"00397112"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398353"	"00397113"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398354"	"00397114"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398355"	"00397115"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398356"	"00397116"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398357"	"00397117"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398358"	"00397118"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398359"	"00397119"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398360"	"00397120"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398361"	"00397121"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398362"	"00397122"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398363"	"00397123"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398364"	"00397124"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398365"	"00397125"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398366"	"00397126"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398367"	"00397127"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398368"	"00397128"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398369"	"00397129"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398370"	"00397130"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398371"	"00397131"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398372"	"00397132"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398373"	"00397133"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398374"	"00397134"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398375"	"00397135"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398376"	"00397136"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398377"	"00397137"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000398378"	"00397138"	"1"	"00000"	"03840"	"2021-12-19 19:23:13"	""	""	"SEQ;SEQ-NG"	"DNA"	"blood"	"Sanger-DNA sequencing of RS1 and targeted next-generation sequencing"
"0000409704"	"00408447"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409705"	"00408448"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409706"	"00408449"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409707"	"00408450"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409708"	"00408451"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409709"	"00408452"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409710"	"00408453"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409711"	"00408454"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409712"	"00408455"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409713"	"00408456"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409714"	"00408457"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409715"	"00408458"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409716"	"00408459"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409717"	"00408460"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409718"	"00408461"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409719"	"00408462"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409720"	"00408463"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ;MLPA"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000412853"	"00411582"	"1"	"01741"	"01741"	"2022-06-16 14:52:26"	""	""	"SEQ"	"DNA"	""	""
"0000415765"	"00414485"	"1"	"00000"	"03840"	"2022-07-28 13:16:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000421755"	"00420446"	"1"	"00000"	"03840"	"2022-11-02 10:32:06"	""	""	"SEQ-NG"	"DNA"	""	"targeted 212 IRD-related genes"
"0000421830"	"00420521"	"1"	"00000"	"03840"	"2022-11-02 10:32:06"	""	""	"SEQ-NG"	"DNA"	""	"targeted 212 IRD-related genes"
"0000421834"	"00420525"	"1"	"00000"	"03840"	"2022-11-02 10:32:06"	""	""	"SEQ-NG"	"DNA"	""	"targeted 212 IRD-related genes"
"0000428271"	"00426951"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428272"	"00426952"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428273"	"00426953"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000438085"	"00436599"	"1"	"04552"	"04552"	"2023-09-23 04:19:29"	""	""	"SEQ-NG-I"	"DNA"	"Buccal swab"	""
"0000438086"	"00436600"	"1"	"04552"	"04552"	"2023-09-23 04:35:16"	""	""	"SEQ-NG-I"	"DNA"	"Buccal swab"	""
"0000438087"	"00436601"	"1"	"04552"	"04552"	"2023-09-23 04:39:30"	""	""	"SEQ-NG-I"	"DNA"	"Buccal swab"	""
"0000445190"	"00443697"	"1"	"00006"	"00006"	"2023-11-30 22:26:26"	""	""	"SEQ"	"DNA"	""	""
"0000445191"	"00443698"	"1"	"00006"	"00006"	"2023-11-30 22:26:26"	""	""	"SEQ"	"DNA"	""	""
"0000445192"	"00443699"	"1"	"00006"	"00006"	"2023-11-30 22:26:26"	""	""	"SEQ"	"DNA"	""	""
"0000445193"	"00443700"	"1"	"00006"	"00006"	"2023-11-30 22:26:26"	""	""	"SEQ"	"DNA"	""	""
"0000445194"	"00443701"	"1"	"00006"	"00006"	"2023-11-30 22:26:26"	""	""	"SEQ"	"DNA"	""	""
"0000445195"	"00443702"	"1"	"00006"	"00006"	"2023-11-30 22:36:22"	""	""	"SEQ"	"DNA"	""	""
"0000445196"	"00443703"	"1"	"00006"	"00006"	"2023-11-30 22:36:22"	""	""	"SEQ"	"DNA"	""	""
"0000445197"	"00443704"	"1"	"00006"	"00006"	"2023-11-30 22:36:22"	""	""	"SEQ"	"DNA"	""	""
"0000445198"	"00443705"	"1"	"00006"	"00006"	"2023-11-30 22:36:22"	""	""	"SEQ"	"DNA"	""	""
"0000445199"	"00443706"	"1"	"00006"	"00006"	"2023-11-30 22:36:22"	""	""	"SEQ"	"DNA"	""	""
"0000445346"	"00443849"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445347"	"00443850"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445348"	"00443851"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445349"	"00443852"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445350"	"00443853"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445351"	"00443854"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445352"	"00443855"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445353"	"00443856"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445354"	"00443857"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445355"	"00443858"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445356"	"00443859"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445357"	"00443860"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445358"	"00443861"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445359"	"00443862"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445360"	"00443863"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000445361"	"00443864"	"1"	"00006"	"00006"	"2008-01-22 12:32:06"	"00006"	"2013-01-02 14:09:13"	"Southern"	"DNA"	""	""
"0000448821"	"00447244"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448822"	"00447245"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448823"	"00447246"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448824"	"00447247"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448825"	"00447248"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448826"	"00447249"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448827"	"00447250"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448828"	"00447251"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448829"	"00447252"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448830"	"00447253"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448831"	"00447254"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449010"	"00447433"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449157"	"00447580"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000452607"	"00451009"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452608"	"00451010"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452609"	"00451011"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000460194"	"00458573"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460195"	"00458574"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460196"	"00458575"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460197"	"00458576"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460198"	"00458577"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460199"	"00458578"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460200"	"00458579"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460201"	"00458580"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460202"	"00458581"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460203"	"00458582"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460204"	"00458583"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460205"	"00458584"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460206"	"00458585"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460207"	"00458586"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460208"	"00458587"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460209"	"00458588"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460210"	"00458589"	"1"	"00006"	"00006"	"2024-12-19 09:29:11"	""	""	"SEQ"	"DNA"	""	""
"0000460211"	"00458590"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460212"	"00458591"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460213"	"00458592"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460214"	"00458593"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460215"	"00458594"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460216"	"00458595"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460217"	"00458596"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460218"	"00458597"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460219"	"00458598"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460220"	"00458599"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460221"	"00458600"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460222"	"00458601"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460223"	"00458602"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460224"	"00458603"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460225"	"00458604"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460226"	"00458605"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460227"	"00458606"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460228"	"00458607"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460229"	"00458608"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460230"	"00458609"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460231"	"00458610"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460232"	"00458611"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460233"	"00458612"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460234"	"00458613"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460235"	"00458614"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460236"	"00458615"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460237"	"00458616"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460238"	"00458617"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460239"	"00458618"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460240"	"00458619"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460241"	"00458620"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460242"	"00458621"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460243"	"00458622"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460244"	"00458623"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460245"	"00458624"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460246"	"00458625"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460247"	"00458626"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460248"	"00458627"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460249"	"00458628"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460250"	"00458629"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460251"	"00458630"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460252"	"00458631"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460253"	"00458632"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460254"	"00458633"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460255"	"00458634"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460256"	"00458635"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460257"	"00458636"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460258"	"00458637"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460259"	"00458638"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460260"	"00458639"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460261"	"00458640"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460262"	"00458641"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460263"	"00458642"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460264"	"00458643"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460265"	"00458644"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460266"	"00458645"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460267"	"00458646"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460268"	"00458647"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460269"	"00458648"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460270"	"00458649"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460271"	"00458650"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460272"	"00458651"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460273"	"00458652"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460274"	"00458653"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460275"	"00458654"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460276"	"00458655"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460277"	"00458656"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460278"	"00458657"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460279"	"00458658"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460280"	"00458659"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460281"	"00458660"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460282"	"00458661"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460283"	"00458662"	"1"	"00006"	"00006"	"2024-12-19 19:39:04"	""	""	"SEQ"	"DNA"	""	""
"0000460284"	"00458663"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460285"	"00458664"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460286"	"00458665"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460287"	"00458666"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460288"	"00458667"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460289"	"00458668"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460290"	"00458669"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460291"	"00458670"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460292"	"00458671"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460293"	"00458672"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460294"	"00458673"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460295"	"00458674"	"1"	"00006"	"00006"	"2024-12-19 20:57:17"	""	""	"SEQ"	"DNA"	""	""
"0000460296"	"00458675"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460297"	"00458676"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460298"	"00458677"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460299"	"00458678"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460300"	"00458679"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460301"	"00458680"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460302"	"00458681"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460303"	"00458682"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460304"	"00458683"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460305"	"00458684"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460306"	"00458685"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460307"	"00458686"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460308"	"00458687"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460309"	"00458688"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460310"	"00458689"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460311"	"00458690"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460312"	"00458691"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460313"	"00458692"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460314"	"00458693"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460315"	"00458694"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460316"	"00458695"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460317"	"00458696"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460318"	"00458697"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460319"	"00458698"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460320"	"00458699"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460321"	"00458700"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460322"	"00458701"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460323"	"00458702"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460324"	"00458703"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460325"	"00458704"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460326"	"00458705"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460327"	"00458706"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460328"	"00458707"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460329"	"00458708"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460330"	"00458709"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460331"	"00458710"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460332"	"00458711"	"1"	"00006"	"00006"	"2024-12-19 21:31:25"	""	""	"SEQ"	"DNA"	""	""
"0000460333"	"00458712"	"1"	"00006"	"00006"	"2024-12-19 21:39:45"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000460335"	"00458714"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460336"	"00458715"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460337"	"00458716"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460338"	"00458717"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460339"	"00458718"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460340"	"00458719"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460341"	"00458720"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460342"	"00458721"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460343"	"00458722"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460344"	"00458723"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460345"	"00458724"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460346"	"00458725"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460347"	"00458726"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460348"	"00458727"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460349"	"00458728"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460350"	"00458729"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460351"	"00458730"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460352"	"00458731"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460353"	"00458732"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460354"	"00458733"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460355"	"00458734"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460356"	"00458735"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460357"	"00458736"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460358"	"00458737"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460359"	"00458738"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460360"	"00458739"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460361"	"00458740"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460362"	"00458741"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460363"	"00458742"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460364"	"00458743"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460365"	"00458744"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460366"	"00458745"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460367"	"00458746"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460368"	"00458747"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460369"	"00458748"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460370"	"00458749"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460371"	"00458750"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460372"	"00458751"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460373"	"00458752"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460374"	"00458753"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460375"	"00458754"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460376"	"00458755"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460377"	"00458756"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460378"	"00458757"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460379"	"00458758"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460380"	"00458759"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460381"	"00458760"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460382"	"00458761"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460383"	"00458762"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460384"	"00458763"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460385"	"00458764"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460386"	"00458765"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460387"	"00458766"	"1"	"00006"	"00006"	"2024-12-20 15:47:58"	""	""	"SEQ"	"DNA"	""	""
"0000460388"	"00458767"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460389"	"00458768"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460390"	"00458769"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460391"	"00458770"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460392"	"00458771"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460393"	"00458772"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460394"	"00458773"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460395"	"00458774"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460396"	"00458775"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460397"	"00458776"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460398"	"00458777"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460399"	"00458778"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460400"	"00458779"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460401"	"00458780"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460402"	"00458781"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460403"	"00458782"	"1"	"00006"	"00006"	"2024-12-20 16:21:00"	""	""	"SEQ"	"DNA"	""	""
"0000460404"	"00458783"	"1"	"00006"	"00006"	"2024-12-20 16:28:31"	""	""	"SEQ"	"DNA"	""	""
"0000460405"	"00458784"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460406"	"00458785"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460407"	"00458786"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460408"	"00458787"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460409"	"00458788"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460410"	"00458789"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460411"	"00458790"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460412"	"00458791"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460413"	"00458792"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"arrayCGH;SEQ"	"DNA"	""	""
"0000460414"	"00458793"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"arrayCGH;SEQ"	"DNA"	""	""
"0000460415"	"00458794"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460416"	"00458795"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460417"	"00458796"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460418"	"00458797"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460419"	"00458798"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460420"	"00458799"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460421"	"00458800"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460422"	"00458801"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460423"	"00458802"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460424"	"00458803"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460425"	"00458804"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460426"	"00458805"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460427"	"00458806"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460428"	"00458807"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460429"	"00458808"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460430"	"00458809"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460431"	"00458810"	"1"	"00006"	"00006"	"2024-12-20 17:38:17"	""	""	"SEQ"	"DNA"	""	""
"0000460432"	"00458811"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460433"	"00458812"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460434"	"00458813"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460435"	"00458814"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460436"	"00458815"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460437"	"00458816"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460438"	"00458817"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460439"	"00458818"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460440"	"00458819"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460441"	"00458820"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460442"	"00458821"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460443"	"00458822"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460444"	"00458823"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460445"	"00458824"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460446"	"00458825"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460447"	"00458826"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460448"	"00458827"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460449"	"00458828"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460450"	"00458829"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460451"	"00458830"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460452"	"00458831"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460453"	"00458832"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460454"	"00458833"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460455"	"00458834"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460456"	"00458835"	"1"	"00006"	"00006"	"2024-12-20 17:55:07"	""	""	"SEQ"	"DNA"	""	""
"0000460459"	"00458838"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460460"	"00458839"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460461"	"00458840"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460462"	"00458841"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460463"	"00458842"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460464"	"00458843"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460465"	"00458844"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460466"	"00458845"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460467"	"00458846"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460468"	"00458847"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460469"	"00458848"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460470"	"00458849"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460471"	"00458850"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460472"	"00458851"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460473"	"00458852"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460474"	"00458853"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460475"	"00458854"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460476"	"00458855"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460477"	"00458856"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460478"	"00458857"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460479"	"00458858"	"1"	"00006"	"00006"	"2024-12-22 09:51:14"	""	""	"SEQ"	"DNA"	""	""
"0000460480"	"00458859"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460481"	"00458860"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460482"	"00458861"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460483"	"00458862"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460484"	"00458863"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460485"	"00458864"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460486"	"00458865"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460487"	"00458866"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460488"	"00458867"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460489"	"00458868"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460490"	"00458869"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460491"	"00458870"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460492"	"00458871"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460493"	"00458872"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460494"	"00458873"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460495"	"00458874"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460496"	"00458875"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460497"	"00458876"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460498"	"00458877"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460499"	"00458878"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460500"	"00458879"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460501"	"00458880"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460502"	"00458881"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460503"	"00458882"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460504"	"00458883"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460505"	"00458884"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460506"	"00458885"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460507"	"00458886"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460508"	"00458887"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460509"	"00458888"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460510"	"00458889"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460511"	"00458890"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460512"	"00458891"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460513"	"00458892"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460514"	"00458893"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460515"	"00458894"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460516"	"00458895"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460517"	"00458896"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460518"	"00458897"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460519"	"00458898"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460520"	"00458899"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460521"	"00458900"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460522"	"00458901"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460523"	"00458902"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460524"	"00458903"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460525"	"00458904"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460526"	"00458905"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460527"	"00458906"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460528"	"00458907"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460529"	"00458908"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460530"	"00458909"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460531"	"00458910"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460532"	"00458911"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460533"	"00458912"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460534"	"00458913"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460535"	"00458914"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460536"	"00458915"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460537"	"00458916"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460538"	"00458917"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460539"	"00458918"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460540"	"00458919"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460541"	"00458920"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460542"	"00458921"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460543"	"00458922"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460544"	"00458923"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460545"	"00458924"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460546"	"00458925"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460547"	"00458926"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460548"	"00458927"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460549"	"00458928"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460550"	"00458929"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460551"	"00458930"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460552"	"00458931"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460553"	"00458932"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460554"	"00458933"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460555"	"00458934"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460556"	"00458935"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460557"	"00458936"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460558"	"00458937"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460559"	"00458938"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460560"	"00458939"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460561"	"00458940"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460562"	"00458941"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460563"	"00458942"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460564"	"00458943"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460565"	"00458944"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460566"	"00458945"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460567"	"00458946"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460568"	"00458947"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460569"	"00458948"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460570"	"00458949"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460571"	"00458950"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460572"	"00458951"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460573"	"00458952"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460574"	"00458953"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460575"	"00458954"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460576"	"00458955"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460577"	"00458956"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460578"	"00458957"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460579"	"00458958"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460580"	"00458959"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460581"	"00458960"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460582"	"00458961"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460583"	"00458962"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460584"	"00458963"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460585"	"00458964"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460586"	"00458965"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460587"	"00458966"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460588"	"00458967"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460589"	"00458968"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460590"	"00458969"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460591"	"00458970"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460592"	"00458971"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460593"	"00458972"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460594"	"00458973"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460595"	"00458974"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460596"	"00458975"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460597"	"00458976"	"1"	"00006"	"00006"	"2024-12-22 11:48:07"	""	""	"SEQ"	"DNA"	""	""
"0000460598"	"00458977"	"1"	"00006"	"00006"	"2024-12-22 12:10:14"	""	""	"SEQ"	"DNA"	""	""
"0000460599"	"00458978"	"1"	"00006"	"00006"	"2024-12-22 12:12:49"	""	""	"SEQ"	"DNA"	""	""
"0000460600"	"00458979"	"1"	"00006"	"00006"	"2024-12-22 12:14:20"	""	""	"SEQ"	"DNA"	""	""
"0000460601"	"00458980"	"1"	"00006"	"00006"	"2024-12-23 10:36:35"	""	""	"SEQ"	"DNA"	""	""
"0000460602"	"00458981"	"1"	"00006"	"00006"	"2024-12-23 10:43:25"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000460603"	"00458982"	"1"	"00006"	"00006"	"2024-12-23 10:56:49"	""	""	"SEQ"	"DNA"	""	""
"0000460605"	"00458984"	"1"	"00006"	"00006"	"2024-12-23 11:34:34"	""	""	"SEQ"	"DNA"	""	""
"0000460606"	"00458985"	"1"	"00006"	"00006"	"2024-12-23 12:17:47"	""	""	"SEQ"	"DNA"	""	""
"0000460607"	"00458986"	"1"	"00006"	"00006"	"2024-12-23 12:17:47"	""	""	"SEQ"	"DNA"	""	""
"0000460608"	"00458987"	"1"	"00006"	"00006"	"2024-12-23 12:17:47"	""	""	"SEQ"	"DNA"	""	""
"0000460609"	"00458988"	"1"	"00006"	"00006"	"2024-12-23 12:17:47"	""	""	"SEQ"	"DNA"	""	""
"0000460611"	"00458990"	"1"	"00006"	"00006"	"2024-12-23 12:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000460612"	"00458991"	"1"	"00006"	"00006"	"2024-12-23 12:49:25"	""	""	"SEQ"	"DNA"	""	""
"0000460613"	"00458992"	"1"	"00006"	"00006"	"2024-12-23 13:51:42"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000460614"	"00458993"	"1"	"00006"	"00006"	"2024-12-23 13:57:43"	""	""	"SEQ-NG"	"DNA"	""	"236-gene panel"
"0000460615"	"00458994"	"1"	"00006"	"00006"	"2024-12-23 14:06:53"	""	""	"SEQ"	"DNA"	""	""
"0000460620"	"00458999"	"1"	"00006"	"00006"	"2024-12-23 14:44:01"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000460621"	"00459000"	"1"	"00006"	"00006"	"2024-12-23 14:51:34"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000460637"	"00459016"	"1"	"00006"	"00006"	"2024-12-23 20:30:04"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000460638"	"00459017"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460639"	"00459018"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460640"	"00459019"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460641"	"00459020"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460642"	"00459021"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460643"	"00459022"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460644"	"00459023"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460645"	"00459024"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460646"	"00459025"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460647"	"00459026"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460648"	"00459027"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460649"	"00459028"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460650"	"00459029"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460651"	"00459030"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460652"	"00459031"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460653"	"00459032"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460654"	"00459033"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460655"	"00459034"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460656"	"00459035"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460657"	"00459036"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460658"	"00459037"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460659"	"00459038"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460660"	"00459039"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460661"	"00459040"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460662"	"00459041"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460663"	"00459042"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460664"	"00459043"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460665"	"00459044"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460666"	"00459045"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460667"	"00459046"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460668"	"00459047"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460669"	"00459048"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460670"	"00459049"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460671"	"00459050"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460672"	"00459051"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460673"	"00459052"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460674"	"00459053"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460675"	"00459054"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460676"	"00459055"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460677"	"00459056"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460678"	"00459057"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460679"	"00459058"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460680"	"00459059"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460681"	"00459060"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460682"	"00459061"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460683"	"00459062"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460684"	"00459063"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460685"	"00459064"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460686"	"00459065"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460687"	"00459066"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460688"	"00459067"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460689"	"00459068"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460690"	"00459069"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460691"	"00459070"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460692"	"00459071"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460693"	"00459072"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460694"	"00459073"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460695"	"00459074"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460696"	"00459075"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460697"	"00459076"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460698"	"00459077"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460699"	"00459078"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460700"	"00459079"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460701"	"00459080"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460702"	"00459081"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460703"	"00459082"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460704"	"00459083"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460705"	"00459084"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460706"	"00459085"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460707"	"00459086"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460708"	"00459087"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460709"	"00459088"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460710"	"00459089"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460711"	"00459090"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460712"	"00459091"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460713"	"00459092"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460714"	"00459093"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460715"	"00459094"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460716"	"00459095"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460717"	"00459096"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460718"	"00459097"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460719"	"00459098"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460720"	"00459099"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460721"	"00459100"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460722"	"00459101"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460723"	"00459102"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460724"	"00459103"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460725"	"00459104"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460726"	"00459105"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460727"	"00459106"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460728"	"00459107"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460729"	"00459108"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460730"	"00459109"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460731"	"00459110"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460732"	"00459111"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460733"	"00459112"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460734"	"00459113"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460735"	"00459114"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460736"	"00459115"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460737"	"00459116"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460738"	"00459117"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460739"	"00459118"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460740"	"00459119"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460741"	"00459120"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460742"	"00459121"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460743"	"00459122"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460744"	"00459123"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460745"	"00459124"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460746"	"00459125"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460747"	"00459126"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460748"	"00459127"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460749"	"00459128"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460750"	"00459129"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460751"	"00459130"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460752"	"00459131"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460753"	"00459132"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460754"	"00459133"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460755"	"00459134"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460756"	"00459135"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460757"	"00459136"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460758"	"00459137"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460759"	"00459138"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460760"	"00459139"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460761"	"00459140"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460762"	"00459141"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460763"	"00459142"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460764"	"00459143"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460765"	"00459144"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460766"	"00459145"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460767"	"00459146"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460768"	"00459147"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460769"	"00459148"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460770"	"00459149"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460771"	"00459150"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460772"	"00459151"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460773"	"00459152"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460774"	"00459153"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460775"	"00459154"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460776"	"00459155"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460777"	"00459156"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460778"	"00459157"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460779"	"00459158"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460780"	"00459159"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460781"	"00459160"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460782"	"00459161"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460783"	"00459162"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460784"	"00459163"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460785"	"00459164"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460786"	"00459165"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460787"	"00459166"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460788"	"00459167"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460789"	"00459168"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460790"	"00459169"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460791"	"00459170"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460792"	"00459171"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460793"	"00459172"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460794"	"00459173"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460795"	"00459174"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460796"	"00459175"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460797"	"00459176"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460798"	"00459177"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460799"	"00459178"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460800"	"00459179"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460801"	"00459180"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460802"	"00459181"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460803"	"00459182"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460804"	"00459183"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460805"	"00459184"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460806"	"00459185"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460807"	"00459186"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460808"	"00459187"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460809"	"00459188"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460810"	"00459189"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460811"	"00459190"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460812"	"00459191"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460813"	"00459192"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460814"	"00459193"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460815"	"00459194"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460816"	"00459195"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460817"	"00459196"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460818"	"00459197"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460819"	"00459198"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460820"	"00459199"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460821"	"00459200"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460822"	"00459201"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460823"	"00459202"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460824"	"00459203"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460825"	"00459204"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460826"	"00459205"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460827"	"00459206"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460828"	"00459207"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460829"	"00459208"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460830"	"00459209"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460831"	"00459210"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460832"	"00459211"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460833"	"00459212"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460834"	"00459213"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460835"	"00459214"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460836"	"00459215"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460837"	"00459216"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460838"	"00459217"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460839"	"00459218"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460840"	"00459219"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460841"	"00459220"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460842"	"00459221"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460843"	"00459222"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460844"	"00459223"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460845"	"00459224"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460846"	"00459225"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460847"	"00459226"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460848"	"00459227"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460849"	"00459228"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460850"	"00459229"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460851"	"00459230"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460852"	"00459231"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460853"	"00459232"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460854"	"00459233"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460855"	"00459234"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460856"	"00459235"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460857"	"00459236"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460858"	"00459237"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460859"	"00459238"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460860"	"00459239"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460861"	"00459240"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460862"	"00459241"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460863"	"00459242"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460864"	"00459243"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460865"	"00459244"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460866"	"00459245"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460867"	"00459246"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460868"	"00459247"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460869"	"00459248"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460870"	"00459249"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460871"	"00459250"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460872"	"00459251"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460873"	"00459252"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460874"	"00459253"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460875"	"00459254"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460876"	"00459255"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460877"	"00459256"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460878"	"00459257"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460879"	"00459258"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460880"	"00459259"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460881"	"00459260"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460882"	"00459261"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460883"	"00459262"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460884"	"00459263"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460885"	"00459264"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460886"	"00459265"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460887"	"00459266"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460888"	"00459267"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460889"	"00459268"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460890"	"00459269"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460891"	"00459270"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460892"	"00459271"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460893"	"00459272"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460894"	"00459273"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460895"	"00459274"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460896"	"00459275"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460897"	"00459276"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460898"	"00459277"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460899"	"00459278"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460900"	"00459279"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460901"	"00459280"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460902"	"00459281"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460903"	"00459282"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460904"	"00459283"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460905"	"00459284"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460906"	"00459285"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460907"	"00459286"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460908"	"00459287"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460909"	"00459288"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460910"	"00459289"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460911"	"00459290"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460912"	"00459291"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460913"	"00459292"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460914"	"00459293"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460915"	"00459294"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460916"	"00459295"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460917"	"00459296"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460918"	"00459297"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460919"	"00459298"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460920"	"00459299"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460921"	"00459300"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460922"	"00459301"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460923"	"00459302"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460924"	"00459303"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460925"	"00459304"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460926"	"00459305"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460927"	"00459306"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460928"	"00459307"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460929"	"00459308"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460930"	"00459309"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460931"	"00459310"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460932"	"00459311"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460933"	"00459312"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460934"	"00459313"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460935"	"00459314"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460936"	"00459315"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460937"	"00459316"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460938"	"00459317"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460939"	"00459318"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460940"	"00459319"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460941"	"00459320"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460942"	"00459321"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460943"	"00459322"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460944"	"00459323"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460945"	"00459324"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460946"	"00459325"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460947"	"00459326"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460948"	"00459327"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460949"	"00459328"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460950"	"00459329"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460951"	"00459330"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460952"	"00459331"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460953"	"00459332"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460954"	"00459333"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460955"	"00459334"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460956"	"00459335"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460957"	"00459336"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460958"	"00459337"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460959"	"00459338"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460960"	"00459339"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460961"	"00459340"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460962"	"00459341"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460963"	"00459342"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460964"	"00459343"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460965"	"00459344"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460966"	"00459345"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460967"	"00459346"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460968"	"00459347"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460969"	"00459348"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460970"	"00459349"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460971"	"00459350"	"1"	"00006"	"00006"	"2024-12-24 08:52:01"	""	""	"SEQ"	"DNA"	""	""
"0000460972"	"00459351"	"1"	"00006"	"00006"	"2024-12-24 09:54:59"	""	""	"SEQ"	"DNA"	""	""
"0000460974"	"00459353"	"1"	"00006"	"00006"	"2024-12-24 10:32:56"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000460975"	"00459354"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460976"	"00459355"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460977"	"00459356"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460978"	"00459357"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460979"	"00459358"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460980"	"00459359"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460981"	"00459360"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460982"	"00459361"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460983"	"00459362"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460984"	"00459363"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460985"	"00459364"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460986"	"00459365"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460987"	"00459366"	"1"	"00006"	"00006"	"2024-12-24 12:43:21"	""	""	"SEQ-NG"	"DNA"	""	""
"0000460992"	"00459371"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460993"	"00459372"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460994"	"00459373"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460995"	"00459374"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460996"	"00459375"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460997"	"00459376"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460998"	"00459377"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000460999"	"00459378"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461000"	"00459379"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461001"	"00459380"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461002"	"00459381"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461003"	"00459382"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461004"	"00459383"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461005"	"00459384"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461006"	"00459385"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461007"	"00459386"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461008"	"00459387"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461009"	"00459388"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461010"	"00459389"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461011"	"00459390"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461012"	"00459391"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461013"	"00459392"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461014"	"00459393"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461015"	"00459394"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461016"	"00459395"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461017"	"00459396"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461018"	"00459397"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461019"	"00459398"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461020"	"00459399"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461021"	"00459400"	"1"	"00006"	"00006"	"2024-12-24 15:45:13"	""	""	"SEQ"	"DNA"	""	""
"0000461025"	"00459404"	"1"	"00006"	"00006"	"2024-12-25 08:23:52"	"00006"	"2024-12-25 08:45:39"	"SEQ"	"DNA"	""	""
"0000461026"	"00459405"	"1"	"00006"	"00006"	"2024-12-25 08:28:01"	""	""	"SEQ"	"DNA"	""	""
"0000461050"	"00459425"	"1"	"00006"	"00006"	"2010-11-21 22:46:23"	"00006"	"2013-01-02 14:09:13"	"SEQ"	"DNA"	""	""
"0000461169"	"00459543"	"1"	"00006"	"00006"	"2025-01-09 16:10:04"	"00006"	"2025-01-09 16:10:30"	"SEQ"	"DNA"	""	""
"0000462716"	"00461084"	"1"	"00006"	"00006"	"2025-01-31 08:52:59"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000462722"	"00461090"	"1"	"00006"	"00006"	"2025-01-31 08:52:59"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000462731"	"00461099"	"1"	"00006"	"00006"	"2025-01-31 08:52:59"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000462766"	"00461134"	"1"	"00006"	"00006"	"2025-01-31 08:52:59"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 2197
"{{screeningid}}"	"{{geneid}}"
"0000000047"	"ATP7B"
"0000000047"	"BCKDHA"
"0000000047"	"DPYD"
"0000000047"	"ETFB"
"0000000047"	"HEXB"
"0000000047"	"IGHMBP2"
"0000000047"	"KMT2A"
"0000000047"	"MEFV"
"0000000047"	"MPL"
"0000000047"	"MYO5A"
"0000000047"	"NHLRC1"
"0000000047"	"NPC1"
"0000000047"	"NPHS1"
"0000000047"	"SERPINA1"
"0000000058"	"ALDH5A1"
"0000000058"	"ATP7B"
"0000000058"	"CFTR"
"0000000058"	"CYP21A2"
"0000000058"	"GBA"
"0000000058"	"HEXB"
"0000000058"	"IGHMBP2"
"0000000058"	"MEFV"
"0000000058"	"MYO5A"
"0000000058"	"NHLRC1"
"0000000058"	"NPHS1"
"0000000058"	"PKHD1"
"0000000058"	"PMM2"
"0000000058"	"SERPINA1"
"0000000058"	"SLC26A2"
"0000000058"	"SMPD1"
"0000000085"	"ADA"
"0000000085"	"ATP7B"
"0000000085"	"ETFB"
"0000000085"	"FGG"
"0000000085"	"FKTN"
"0000000085"	"HEXB"
"0000000085"	"IGHMBP2"
"0000000085"	"MYO5A"
"0000000085"	"NHLRC1"
"0000000085"	"PKHD1"
"0000000085"	"POLG"
"0000000085"	"SERPINA1"
"0000000085"	"SGSH"
"0000000102"	"B3GLCT"
"0000000102"	"BEST1"
"0000000102"	"MECP2"
"0000000102"	"NF1"
"0000000102"	"NSD1"
"0000000102"	"RS1"
"0000003931"	"ACE"
"0000004302"	"G6PD"
"0000009835"	"BRCA1"
"0000009835"	"BRCA2"
"0000009836"	"BRCA1"
"0000009836"	"BRCA2"
"0000009837"	"BRCA1"
"0000009837"	"BRCA2"
"0000009838"	"BRCA1"
"0000009838"	"BRCA2"
"0000009847"	"BRCA1"
"0000009847"	"BRCA2"
"0000009848"	"BRCA1"
"0000009848"	"BRCA2"
"0000009849"	"BRCA1"
"0000009849"	"BRCA2"
"0000009850"	"BRCA1"
"0000009850"	"BRCA2"
"0000009851"	"BRCA1"
"0000009851"	"BRCA2"
"0000009854"	"BRCA1"
"0000009854"	"BRCA2"
"0000009855"	"BRCA1"
"0000009855"	"BRCA2"
"0000009863"	"BRCA1"
"0000009863"	"BRCA2"
"0000009869"	"BRCA1"
"0000009869"	"BRCA2"
"0000009874"	"BRCA1"
"0000009874"	"BRCA2"
"0000009875"	"BRCA1"
"0000009875"	"BRCA2"
"0000009876"	"BRCA1"
"0000009876"	"BRCA2"
"0000087396"	"RS1"
"0000087397"	"RS1"
"0000087398"	"RS1"
"0000087399"	"RS1"
"0000087400"	"RS1"
"0000087401"	"RS1"
"0000087402"	"RS1"
"0000087403"	"RS1"
"0000087404"	"RS1"
"0000087405"	"RS1"
"0000087406"	"RS1"
"0000087407"	"RS1"
"0000087408"	"RS1"
"0000087409"	"RS1"
"0000087410"	"RS1"
"0000087411"	"RS1"
"0000087412"	"RS1"
"0000087413"	"RS1"
"0000087414"	"RS1"
"0000087415"	"RS1"
"0000087416"	"RS1"
"0000087417"	"RS1"
"0000087418"	"RS1"
"0000087419"	"RS1"
"0000087420"	"RS1"
"0000087421"	"RS1"
"0000087422"	"RS1"
"0000087423"	"RS1"
"0000087424"	"RS1"
"0000087425"	"RS1"
"0000087426"	"RS1"
"0000087427"	"RS1"
"0000087428"	"RS1"
"0000087429"	"RS1"
"0000087430"	"RS1"
"0000087431"	"RS1"
"0000087432"	"RS1"
"0000087433"	"RS1"
"0000087434"	"RS1"
"0000087435"	"RS1"
"0000087436"	"RS1"
"0000087437"	"RS1"
"0000087438"	"RS1"
"0000087439"	"RS1"
"0000087440"	"RS1"
"0000087441"	"RS1"
"0000087442"	"RS1"
"0000087443"	"RS1"
"0000087444"	"RS1"
"0000087445"	"RS1"
"0000087446"	"RS1"
"0000087447"	"RS1"
"0000087448"	"RS1"
"0000087449"	"RS1"
"0000087450"	"RS1"
"0000087451"	"RS1"
"0000087452"	"RS1"
"0000087453"	"RS1"
"0000087454"	"RS1"
"0000087455"	"RS1"
"0000087456"	"RS1"
"0000087457"	"RS1"
"0000087458"	"RS1"
"0000087459"	"RS1"
"0000087460"	"RS1"
"0000087461"	"RS1"
"0000087462"	"RS1"
"0000087463"	"RS1"
"0000087464"	"RS1"
"0000087465"	"RS1"
"0000087466"	"RS1"
"0000087467"	"RS1"
"0000087468"	"RS1"
"0000087469"	"RS1"
"0000087470"	"RS1"
"0000087471"	"RS1"
"0000087472"	"RS1"
"0000087473"	"RS1"
"0000087474"	"RS1"
"0000087475"	"RS1"
"0000087476"	"RS1"
"0000087477"	"RS1"
"0000087478"	"RS1"
"0000087479"	"RS1"
"0000087480"	"RS1"
"0000087481"	"RS1"
"0000087482"	"RS1"
"0000087483"	"RS1"
"0000087484"	"RS1"
"0000087485"	"RS1"
"0000087486"	"RS1"
"0000087487"	"RS1"
"0000087488"	"RS1"
"0000087489"	"RS1"
"0000087490"	"RS1"
"0000087491"	"RS1"
"0000087492"	"RS1"
"0000087493"	"RS1"
"0000087494"	"RS1"
"0000087495"	"RS1"
"0000087496"	"RS1"
"0000087497"	"RS1"
"0000087498"	"RS1"
"0000087499"	"RS1"
"0000087500"	"RS1"
"0000087501"	"RS1"
"0000087502"	"RS1"
"0000087503"	"RS1"
"0000087504"	"RS1"
"0000087505"	"RS1"
"0000087506"	"RS1"
"0000087507"	"RS1"
"0000087508"	"RS1"
"0000087509"	"RS1"
"0000087510"	"RS1"
"0000087511"	"RS1"
"0000087512"	"RS1"
"0000087513"	"RS1"
"0000087514"	"RS1"
"0000087515"	"RS1"
"0000087516"	"RS1"
"0000087517"	"RS1"
"0000087518"	"RS1"
"0000087519"	"RS1"
"0000087520"	"RS1"
"0000087521"	"RS1"
"0000087522"	"RS1"
"0000087523"	"RS1"
"0000087524"	"RS1"
"0000087525"	"RS1"
"0000087526"	"RS1"
"0000087527"	"RS1"
"0000087528"	"RS1"
"0000087529"	"RS1"
"0000087530"	"RS1"
"0000087531"	"RS1"
"0000087532"	"RS1"
"0000087533"	"RS1"
"0000087534"	"RS1"
"0000087535"	"RS1"
"0000087536"	"RS1"
"0000087537"	"RS1"
"0000087538"	"RS1"
"0000087539"	"RS1"
"0000087540"	"RS1"
"0000087541"	"RS1"
"0000087542"	"RS1"
"0000087543"	"RS1"
"0000087544"	"RS1"
"0000087545"	"RS1"
"0000087546"	"RS1"
"0000087547"	"RS1"
"0000087548"	"RS1"
"0000087549"	"RS1"
"0000087550"	"RS1"
"0000087551"	"RS1"
"0000087552"	"RS1"
"0000087553"	"RS1"
"0000087554"	"RS1"
"0000087555"	"RS1"
"0000087556"	"RS1"
"0000087557"	"RS1"
"0000087558"	"RS1"
"0000087559"	"RS1"
"0000087560"	"RS1"
"0000087561"	"RS1"
"0000087562"	"RS1"
"0000087563"	"RS1"
"0000087564"	"RS1"
"0000087565"	"RS1"
"0000087566"	"RS1"
"0000087567"	"RS1"
"0000087568"	"RS1"
"0000087569"	"RS1"
"0000087570"	"RS1"
"0000087571"	"RS1"
"0000087572"	"RS1"
"0000087573"	"RS1"
"0000087574"	"RS1"
"0000087575"	"RS1"
"0000087576"	"RS1"
"0000087577"	"RS1"
"0000087578"	"RS1"
"0000087579"	"RS1"
"0000087580"	"RS1"
"0000087581"	"RS1"
"0000087582"	"RS1"
"0000087583"	"RS1"
"0000087584"	"RS1"
"0000087585"	"RS1"
"0000087586"	"RS1"
"0000087587"	"RS1"
"0000087588"	"RS1"
"0000087589"	"RS1"
"0000087590"	"RS1"
"0000087591"	"RS1"
"0000087592"	"RS1"
"0000087593"	"RS1"
"0000087594"	"RS1"
"0000087595"	"RS1"
"0000087596"	"RS1"
"0000087597"	"RS1"
"0000087598"	"RS1"
"0000087599"	"RS1"
"0000087600"	"RS1"
"0000087601"	"RS1"
"0000087602"	"RS1"
"0000087603"	"RS1"
"0000087604"	"RS1"
"0000087605"	"RS1"
"0000087606"	"RS1"
"0000087607"	"RS1"
"0000087608"	"RS1"
"0000087609"	"RS1"
"0000087610"	"RS1"
"0000087611"	"RS1"
"0000087612"	"RS1"
"0000087613"	"RS1"
"0000087614"	"RS1"
"0000087615"	"RS1"
"0000087616"	"RS1"
"0000087617"	"RS1"
"0000087618"	"RS1"
"0000087619"	"RS1"
"0000087620"	"RS1"
"0000087621"	"RS1"
"0000087622"	"RS1"
"0000087623"	"RS1"
"0000087624"	"RS1"
"0000087625"	"RS1"
"0000087626"	"RS1"
"0000087627"	"RS1"
"0000087628"	"RS1"
"0000087629"	"RS1"
"0000087630"	"RS1"
"0000087631"	"RS1"
"0000087632"	"RS1"
"0000087633"	"RS1"
"0000087634"	"RS1"
"0000087635"	"RS1"
"0000087636"	"RS1"
"0000087637"	"RS1"
"0000087638"	"RS1"
"0000087639"	"RS1"
"0000087640"	"RS1"
"0000087641"	"RS1"
"0000087642"	"RS1"
"0000087643"	"RS1"
"0000087644"	"RS1"
"0000087645"	"RS1"
"0000087646"	"RS1"
"0000087647"	"RS1"
"0000087648"	"RS1"
"0000087649"	"RS1"
"0000087650"	"RS1"
"0000087651"	"RS1"
"0000087652"	"RS1"
"0000087653"	"RS1"
"0000087654"	"RS1"
"0000087655"	"RS1"
"0000087656"	"RS1"
"0000087657"	"RS1"
"0000087658"	"RS1"
"0000087659"	"RS1"
"0000087660"	"RS1"
"0000087661"	"RS1"
"0000087662"	"RS1"
"0000087663"	"RS1"
"0000087664"	"RS1"
"0000087665"	"RS1"
"0000087666"	"RS1"
"0000087667"	"RS1"
"0000087668"	"RS1"
"0000087669"	"RS1"
"0000087670"	"RS1"
"0000087671"	"RS1"
"0000087672"	"RS1"
"0000087673"	"RS1"
"0000087674"	"RS1"
"0000087675"	"RS1"
"0000087676"	"RS1"
"0000087677"	"RS1"
"0000087678"	"RS1"
"0000087679"	"RS1"
"0000087680"	"RS1"
"0000087681"	"RS1"
"0000087682"	"RS1"
"0000087683"	"RS1"
"0000087684"	"RS1"
"0000087685"	"RS1"
"0000087686"	"RS1"
"0000087687"	"RS1"
"0000087688"	"RS1"
"0000087689"	"RS1"
"0000087690"	"RS1"
"0000087691"	"RS1"
"0000087692"	"RS1"
"0000087693"	"RS1"
"0000087694"	"RS1"
"0000087695"	"RS1"
"0000087696"	"RS1"
"0000087697"	"RS1"
"0000087698"	"RS1"
"0000087699"	"RS1"
"0000087700"	"RS1"
"0000087701"	"RS1"
"0000087702"	"RS1"
"0000087703"	"RS1"
"0000087704"	"RS1"
"0000087705"	"RS1"
"0000087706"	"RS1"
"0000087707"	"RS1"
"0000087708"	"RS1"
"0000087709"	"RS1"
"0000087710"	"RS1"
"0000087711"	"RS1"
"0000087712"	"RS1"
"0000087713"	"RS1"
"0000087714"	"RS1"
"0000087715"	"RS1"
"0000087716"	"RS1"
"0000087717"	"RS1"
"0000087718"	"RS1"
"0000087719"	"RS1"
"0000087720"	"RS1"
"0000087721"	"RS1"
"0000087722"	"RS1"
"0000087723"	"RS1"
"0000087724"	"RS1"
"0000087725"	"RS1"
"0000087726"	"RS1"
"0000087727"	"RS1"
"0000087728"	"RS1"
"0000087729"	"RS1"
"0000087730"	"RS1"
"0000087731"	"RS1"
"0000087732"	"RS1"
"0000087733"	"RS1"
"0000087734"	"RS1"
"0000087735"	"RS1"
"0000087736"	"RS1"
"0000087737"	"RS1"
"0000087738"	"RS1"
"0000087739"	"RS1"
"0000087740"	"RS1"
"0000087741"	"RS1"
"0000087742"	"RS1"
"0000087743"	"RS1"
"0000087744"	"RS1"
"0000087745"	"RS1"
"0000087746"	"RS1"
"0000087747"	"RS1"
"0000087748"	"RS1"
"0000087749"	"RS1"
"0000087750"	"RS1"
"0000087751"	"RS1"
"0000087752"	"RS1"
"0000087753"	"RS1"
"0000087754"	"RS1"
"0000087755"	"RS1"
"0000087756"	"RS1"
"0000087757"	"RS1"
"0000087758"	"RS1"
"0000087759"	"RS1"
"0000087760"	"RS1"
"0000087761"	"RS1"
"0000087762"	"RS1"
"0000087763"	"RS1"
"0000087764"	"RS1"
"0000087765"	"RS1"
"0000087766"	"RS1"
"0000087767"	"RS1"
"0000087768"	"RS1"
"0000087769"	"RS1"
"0000087770"	"RS1"
"0000087771"	"RS1"
"0000087772"	"RS1"
"0000087773"	"RS1"
"0000087774"	"RS1"
"0000087775"	"RS1"
"0000087776"	"RS1"
"0000087777"	"RS1"
"0000087778"	"RS1"
"0000087779"	"RS1"
"0000087780"	"RS1"
"0000087781"	"RS1"
"0000087782"	"RS1"
"0000087783"	"RS1"
"0000087784"	"RS1"
"0000087785"	"RS1"
"0000087786"	"RS1"
"0000087787"	"RS1"
"0000087788"	"RS1"
"0000087789"	"RS1"
"0000087790"	"RS1"
"0000087791"	"RS1"
"0000087792"	"RS1"
"0000087793"	"RS1"
"0000087794"	"RS1"
"0000087795"	"RS1"
"0000087796"	"RS1"
"0000087797"	"RS1"
"0000087798"	"RS1"
"0000087799"	"RS1"
"0000087800"	"RS1"
"0000087801"	"RS1"
"0000087802"	"RS1"
"0000087803"	"RS1"
"0000087804"	"RS1"
"0000087805"	"RS1"
"0000087806"	"RS1"
"0000087807"	"RS1"
"0000087808"	"RS1"
"0000087809"	"RS1"
"0000087810"	"RS1"
"0000087811"	"RS1"
"0000087812"	"RS1"
"0000087813"	"RS1"
"0000087814"	"RS1"
"0000087815"	"RS1"
"0000087816"	"RS1"
"0000087817"	"RS1"
"0000087818"	"RS1"
"0000087819"	"RS1"
"0000087820"	"RS1"
"0000087821"	"RS1"
"0000087822"	"RS1"
"0000087823"	"RS1"
"0000087824"	"RS1"
"0000087825"	"RS1"
"0000087826"	"RS1"
"0000087827"	"RS1"
"0000087828"	"RS1"
"0000087829"	"RS1"
"0000087830"	"RS1"
"0000087831"	"RS1"
"0000087832"	"RS1"
"0000087833"	"RS1"
"0000087834"	"RS1"
"0000087835"	"RS1"
"0000087836"	"RS1"
"0000087837"	"RS1"
"0000087838"	"RS1"
"0000087839"	"RS1"
"0000087840"	"RS1"
"0000087841"	"RS1"
"0000087842"	"RS1"
"0000087843"	"RS1"
"0000087844"	"RS1"
"0000087845"	"RS1"
"0000087846"	"RS1"
"0000087847"	"RS1"
"0000087848"	"RS1"
"0000087849"	"RS1"
"0000087850"	"RS1"
"0000087851"	"RS1"
"0000087852"	"RS1"
"0000087853"	"RS1"
"0000087854"	"RS1"
"0000087855"	"RS1"
"0000087856"	"RS1"
"0000087857"	"RS1"
"0000087858"	"RS1"
"0000087859"	"RS1"
"0000087860"	"RS1"
"0000087861"	"RS1"
"0000087862"	"RS1"
"0000087863"	"RS1"
"0000087864"	"RS1"
"0000087865"	"RS1"
"0000087866"	"RS1"
"0000087867"	"RS1"
"0000087868"	"RS1"
"0000087869"	"RS1"
"0000087870"	"RS1"
"0000087871"	"RS1"
"0000087872"	"RS1"
"0000087873"	"RS1"
"0000087874"	"RS1"
"0000087875"	"RS1"
"0000087876"	"RS1"
"0000087877"	"RS1"
"0000087878"	"RS1"
"0000087879"	"RS1"
"0000087880"	"RS1"
"0000087881"	"RS1"
"0000087882"	"RS1"
"0000087883"	"RS1"
"0000087884"	"RS1"
"0000087885"	"RS1"
"0000087886"	"RS1"
"0000087887"	"RS1"
"0000087888"	"RS1"
"0000087889"	"RS1"
"0000087890"	"RS1"
"0000087891"	"RS1"
"0000087892"	"RS1"
"0000087893"	"RS1"
"0000087894"	"RS1"
"0000087895"	"RS1"
"0000087896"	"RS1"
"0000087897"	"RS1"
"0000087898"	"RS1"
"0000087899"	"RS1"
"0000087900"	"RS1"
"0000087901"	"RS1"
"0000087902"	"RS1"
"0000087903"	"RS1"
"0000087904"	"RS1"
"0000087905"	"RS1"
"0000087906"	"RS1"
"0000087907"	"RS1"
"0000087908"	"RS1"
"0000087909"	"RS1"
"0000087910"	"RS1"
"0000087911"	"RS1"
"0000087912"	"RS1"
"0000087913"	"RS1"
"0000087914"	"RS1"
"0000087915"	"RS1"
"0000087916"	"RS1"
"0000087917"	"RS1"
"0000087918"	"RS1"
"0000087919"	"RS1"
"0000087920"	"RS1"
"0000087921"	"RS1"
"0000087922"	"RS1"
"0000087923"	"RS1"
"0000087924"	"RS1"
"0000087925"	"RS1"
"0000087926"	"RS1"
"0000087927"	"RS1"
"0000087928"	"RS1"
"0000087929"	"RS1"
"0000087930"	"RS1"
"0000087931"	"RS1"
"0000087932"	"RS1"
"0000087933"	"RS1"
"0000087934"	"RS1"
"0000087935"	"RS1"
"0000087936"	"RS1"
"0000087937"	"RS1"
"0000087938"	"RS1"
"0000087939"	"RS1"
"0000087940"	"RS1"
"0000087941"	"RS1"
"0000087942"	"RS1"
"0000087943"	"RS1"
"0000087944"	"RS1"
"0000087945"	"RS1"
"0000087946"	"RS1"
"0000087947"	"RS1"
"0000087948"	"RS1"
"0000087949"	"RS1"
"0000087950"	"RS1"
"0000087951"	"RS1"
"0000087952"	"RS1"
"0000087953"	"RS1"
"0000087954"	"RS1"
"0000087955"	"RS1"
"0000087956"	"RS1"
"0000087958"	"RS1"
"0000088194"	"RS1"
"0000088195"	"RS1"
"0000088196"	"RS1"
"0000088197"	"RS1"
"0000088198"	"RS1"
"0000088199"	"RS1"
"0000088200"	"RS1"
"0000132955"	"RS1"
"0000132956"	"RS1"
"0000132957"	"RS1"
"0000208392"	"RS1"
"0000210083"	"RS1"
"0000309706"	"RS1"
"0000309707"	"RS1"
"0000309708"	"RS1"
"0000309709"	"RS1"
"0000309710"	"RS1"
"0000309711"	"RS1"
"0000309712"	"RS1"
"0000309713"	"RS1"
"0000310558"	"RS1"
"0000310559"	"RS1"
"0000310560"	"RS1"
"0000310561"	"RS1"
"0000310562"	"RS1"
"0000310563"	"RS1"
"0000310564"	"RS1"
"0000310565"	"RS1"
"0000329715"	"RS1"
"0000334980"	"RS1"
"0000334981"	"RS1"
"0000334982"	"RS1"
"0000334983"	"RS1"
"0000334984"	"RS1"
"0000334985"	"RS1"
"0000334986"	"RS1"
"0000334987"	"RS1"
"0000334988"	"RS1"
"0000334989"	"RS1"
"0000334990"	"RS1"
"0000334991"	"RS1"
"0000334992"	"RS1"
"0000336550"	"RS1"
"0000336678"	"RS1"
"0000337222"	"RS1"
"0000337223"	"RS1"
"0000359975"	"RS1"
"0000375078"	"RS1"
"0000375172"	"RS1"
"0000377515"	"RS1"
"0000377516"	"RS1"
"0000377517"	"RS1"
"0000377518"	"RS1"
"0000380761"	"RS1"
"0000384681"	"RS1"
"0000384682"	"RS1"
"0000384683"	"RS1"
"0000384684"	"RS1"
"0000385478"	"RS1"
"0000385479"	"RS1"
"0000385536"	"RS1"
"0000385543"	"RS1"
"0000385562"	"RS1"
"0000385564"	"RS1"
"0000385567"	"RS1"
"0000385573"	"RS1"
"0000385590"	"RS1"
"0000385620"	"RS1"
"0000385641"	"RS1"
"0000385673"	"RS1"
"0000385682"	"RS1"
"0000385704"	"RS1"
"0000385714"	"RS1"
"0000385715"	"RS1"
"0000387959"	"RS1"
"0000388025"	"RS1"
"0000389275"	"RS1"
"0000389970"	"RS1"
"0000389999"	"RS1"
"0000390001"	"RS1"
"0000390008"	"RS1"
"0000390009"	"RS1"
"0000390022"	"RS1"
"0000390027"	"RS1"
"0000390030"	"RS1"
"0000390031"	"RS1"
"0000390033"	"RS1"
"0000390129"	"RS1"
"0000390130"	"RS1"
"0000390141"	"RS1"
"0000390146"	"RS1"
"0000390148"	"RS1"
"0000390153"	"RS1"
"0000390162"	"RS1"
"0000390205"	"RS1"
"0000390206"	"RS1"
"0000392001"	"RS1"
"0000392037"	"RS1"
"0000392100"	"RS1"
"0000392157"	"RS1"
"0000392225"	"RS1"
"0000392232"	"RS1"
"0000392234"	"RS1"
"0000392238"	"RS1"
"0000392626"	"RS1"
"0000392627"	"RS1"
"0000392745"	"RS1"
"0000392746"	"RS1"
"0000392747"	"RS1"
"0000392750"	"RS1"
"0000392751"	"RS1"
"0000392752"	"RS1"
"0000392753"	"RS1"
"0000392754"	"RS1"
"0000392755"	"RS1"
"0000392756"	"RS1"
"0000392757"	"RS1"
"0000392758"	"RS1"
"0000394696"	"RS1"
"0000394718"	"RS1"
"0000394719"	"RS1"
"0000394723"	"RS1"
"0000394724"	"RS1"
"0000394765"	"RS1"
"0000394797"	"RS1"
"0000394857"	"RS1"
"0000394978"	"RS1"
"0000394993"	"RS1"
"0000395060"	"RS1"
"0000395085"	"RS1"
"0000395114"	"RS1"
"0000395136"	"RS1"
"0000396044"	"RS1"
"0000397165"	"RS1"
"0000397166"	"RS1"
"0000397191"	"RS1"
"0000397224"	"RS1"
"0000397225"	"RS1"
"0000397226"	"RS1"
"0000397227"	"RS1"
"0000397228"	"RS1"
"0000397229"	"RS1"
"0000397230"	"RS1"
"0000397231"	"RS1"
"0000397232"	"RS1"
"0000397233"	"RS1"
"0000397234"	"RS1"
"0000397235"	"RS1"
"0000397236"	"RS1"
"0000397237"	"RS1"
"0000397242"	"RS1"
"0000397243"	"RS1"
"0000397244"	"RS1"
"0000397245"	"RS1"
"0000397246"	"RS1"
"0000397247"	"RS1"
"0000397248"	"RS1"
"0000397249"	"RS1"
"0000397250"	"RS1"
"0000397251"	"RS1"
"0000397252"	"RS1"
"0000397253"	"RS1"
"0000397254"	"RS1"
"0000397255"	"RS1"
"0000397256"	"RS1"
"0000397257"	"RS1"
"0000397258"	"RS1"
"0000397259"	"RS1"
"0000397260"	"RS1"
"0000397261"	"RS1"
"0000397262"	"RS1"
"0000397273"	"RS1"
"0000397274"	"RS1"
"0000397275"	"RS1"
"0000397276"	"RS1"
"0000397277"	"RS1"
"0000397278"	"RS1"
"0000397279"	"RS1"
"0000397280"	"RS1"
"0000397281"	"RS1"
"0000397282"	"RS1"
"0000397283"	"RS1"
"0000397284"	"RS1"
"0000397285"	"RS1"
"0000397286"	"RS1"
"0000397287"	"RS1"
"0000397288"	"RS1"
"0000397289"	"RS1"
"0000397290"	"RS1"
"0000397291"	"RS1"
"0000397292"	"RS1"
"0000397293"	"RS1"
"0000397294"	"RS1"
"0000397295"	"RS1"
"0000397296"	"RS1"
"0000397301"	"RS1"
"0000397302"	"RS1"
"0000397303"	"RS1"
"0000397304"	"RS1"
"0000397305"	"RS1"
"0000397306"	"RS1"
"0000397307"	"RS1"
"0000397308"	"RS1"
"0000397309"	"RS1"
"0000397310"	"RS1"
"0000397311"	"RS1"
"0000397312"	"RS1"
"0000397313"	"RS1"
"0000397314"	"RS1"
"0000397315"	"RS1"
"0000397316"	"RS1"
"0000397317"	"RS1"
"0000397318"	"RS1"
"0000397319"	"RS1"
"0000397320"	"RS1"
"0000397321"	"RS1"
"0000397322"	"RS1"
"0000397323"	"RS1"
"0000397324"	"RS1"
"0000397325"	"RS1"
"0000397326"	"RS1"
"0000397327"	"RS1"
"0000397328"	"RS1"
"0000397329"	"RS1"
"0000397330"	"RS1"
"0000397331"	"RS1"
"0000397332"	"RS1"
"0000397333"	"RS1"
"0000397334"	"RS1"
"0000397335"	"RS1"
"0000397336"	"RS1"
"0000397337"	"RS1"
"0000397338"	"RS1"
"0000397339"	"RS1"
"0000397340"	"RS1"
"0000397341"	"RS1"
"0000397342"	"RS1"
"0000397343"	"RS1"
"0000397344"	"RS1"
"0000397345"	"RS1"
"0000397346"	"RS1"
"0000397347"	"RS1"
"0000397348"	"RS1"
"0000397350"	"RS1"
"0000397351"	"RS1"
"0000397352"	"RS1"
"0000397353"	"RS1"
"0000397354"	"RS1"
"0000397355"	"RS1"
"0000397356"	"RS1"
"0000397357"	"RS1"
"0000397358"	"RS1"
"0000397359"	"RS1"
"0000397360"	"RS1"
"0000397361"	"RS1"
"0000397362"	"RS1"
"0000397363"	"RS1"
"0000397364"	"RS1"
"0000397365"	"RS1"
"0000397366"	"RS1"
"0000397367"	"RS1"
"0000397368"	"RS1"
"0000397369"	"RS1"
"0000397370"	"RS1"
"0000397372"	"RS1"
"0000397373"	"RS1"
"0000397374"	"RS1"
"0000397375"	"RS1"
"0000397376"	"RS1"
"0000397377"	"RS1"
"0000397378"	"RS1"
"0000397379"	"RS1"
"0000397380"	"RS1"
"0000397381"	"RS1"
"0000397382"	"RS1"
"0000397383"	"RS1"
"0000397384"	"RS1"
"0000397385"	"RS1"
"0000397386"	"RS1"
"0000397387"	"RS1"
"0000397388"	"RS1"
"0000397389"	"RS1"
"0000397390"	"RS1"
"0000397391"	"RS1"
"0000397392"	"RS1"
"0000397393"	"RS1"
"0000397394"	"RS1"
"0000397395"	"RS1"
"0000397396"	"RS1"
"0000397397"	"RS1"
"0000397398"	"RS1"
"0000397399"	"RS1"
"0000397400"	"RS1"
"0000397401"	"RS1"
"0000397402"	"RS1"
"0000397403"	"RS1"
"0000397404"	"RS1"
"0000397405"	"RS1"
"0000397406"	"RS1"
"0000397407"	"RS1"
"0000397408"	"RS1"
"0000397409"	"RS1"
"0000397410"	"RS1"
"0000397411"	"RS1"
"0000397412"	"RS1"
"0000397413"	"RS1"
"0000397414"	"RS1"
"0000397415"	"RS1"
"0000397416"	"RS1"
"0000397586"	"RS1"
"0000397587"	"RS1"
"0000397588"	"RS1"
"0000397589"	"RS1"
"0000397590"	"RS1"
"0000397591"	"RS1"
"0000397592"	"RS1"
"0000397593"	"RS1"
"0000397594"	"RS1"
"0000397595"	"RS1"
"0000397596"	"RS1"
"0000397597"	"RS1"
"0000397598"	"RS1"
"0000397599"	"RS1"
"0000397600"	"RS1"
"0000397601"	"RS1"
"0000397602"	"RS1"
"0000397603"	"RS1"
"0000397604"	"RS1"
"0000397605"	"RS1"
"0000397606"	"RS1"
"0000397607"	"RS1"
"0000397608"	"RS1"
"0000397609"	"RS1"
"0000397610"	"RS1"
"0000397611"	"RS1"
"0000397612"	"RS1"
"0000397613"	"RS1"
"0000397614"	"RS1"
"0000397615"	"RS1"
"0000397616"	"RS1"
"0000397617"	"RS1"
"0000397618"	"RS1"
"0000397619"	"RS1"
"0000397620"	"RS1"
"0000397621"	"RS1"
"0000397622"	"RS1"
"0000397623"	"RS1"
"0000397624"	"RS1"
"0000397625"	"RS1"
"0000397626"	"RS1"
"0000397627"	"RS1"
"0000397628"	"RS1"
"0000397629"	"RS1"
"0000397630"	"RS1"
"0000397631"	"RS1"
"0000397632"	"RS1"
"0000397633"	"RS1"
"0000397634"	"RS1"
"0000397635"	"RS1"
"0000397636"	"RS1"
"0000397637"	"RS1"
"0000397638"	"RS1"
"0000397639"	"RS1"
"0000397640"	"RS1"
"0000397641"	"RS1"
"0000397642"	"RS1"
"0000397643"	"RS1"
"0000397644"	"RS1"
"0000397645"	"RS1"
"0000397646"	"RS1"
"0000397647"	"RS1"
"0000397648"	"RS1"
"0000397672"	"RS1"
"0000397673"	"RS1"
"0000397674"	"RS1"
"0000397675"	"RS1"
"0000397676"	"RS1"
"0000397677"	"RS1"
"0000397678"	"RS1"
"0000397679"	"RS1"
"0000397680"	"RS1"
"0000397681"	"RS1"
"0000397682"	"RS1"
"0000397683"	"RS1"
"0000397684"	"RS1"
"0000397685"	"RS1"
"0000397686"	"RS1"
"0000397687"	"RS1"
"0000397688"	"RS1"
"0000397689"	"RS1"
"0000397690"	"RS1"
"0000397691"	"RS1"
"0000397692"	"RS1"
"0000397693"	"RS1"
"0000397694"	"RS1"
"0000397706"	"RS1"
"0000397732"	"RS1"
"0000397733"	"RS1"
"0000397899"	"RS1"
"0000397900"	"RS1"
"0000397901"	"RS1"
"0000397902"	"RS1"
"0000397903"	"RS1"
"0000397904"	"RS1"
"0000397905"	"RS1"
"0000397906"	"RS1"
"0000397907"	"RS1"
"0000397908"	"RS1"
"0000397909"	"RS1"
"0000397910"	"RS1"
"0000397911"	"RS1"
"0000397912"	"RS1"
"0000397913"	"RS1"
"0000397914"	"RS1"
"0000397915"	"RS1"
"0000397916"	"RS1"
"0000397917"	"RS1"
"0000397918"	"RS1"
"0000397919"	"RS1"
"0000397920"	"RS1"
"0000397921"	"RS1"
"0000397922"	"RS1"
"0000397923"	"RS1"
"0000397924"	"RS1"
"0000397925"	"RS1"
"0000397926"	"RS1"
"0000397927"	"RS1"
"0000397928"	"RS1"
"0000397929"	"RS1"
"0000397930"	"RS1"
"0000397931"	"RS1"
"0000397932"	"RS1"
"0000397933"	"RS1"
"0000397934"	"RS1"
"0000397935"	"RS1"
"0000397936"	"RS1"
"0000397937"	"RS1"
"0000397938"	"RS1"
"0000397939"	"RS1"
"0000397940"	"RS1"
"0000397941"	"RS1"
"0000397942"	"RS1"
"0000397943"	"RS1"
"0000397944"	"RS1"
"0000397945"	"RS1"
"0000397946"	"RS1"
"0000397947"	"RS1"
"0000397948"	"RS1"
"0000397949"	"RS1"
"0000397950"	"RS1"
"0000397968"	"RS1"
"0000397969"	"RS1"
"0000397970"	"RS1"
"0000397971"	"RS1"
"0000397972"	"RS1"
"0000397973"	"RS1"
"0000397974"	"RS1"
"0000397975"	"RS1"
"0000397976"	"RS1"
"0000397977"	"RS1"
"0000397978"	"RS1"
"0000397979"	"RS1"
"0000397980"	"RS1"
"0000397981"	"RS1"
"0000397982"	"RS1"
"0000397983"	"RS1"
"0000397984"	"RS1"
"0000397985"	"RS1"
"0000397986"	"RS1"
"0000397987"	"RS1"
"0000397988"	"RS1"
"0000397989"	"RS1"
"0000397990"	"RS1"
"0000397991"	"RS1"
"0000397992"	"RS1"
"0000397993"	"RS1"
"0000397994"	"RS1"
"0000397995"	"RS1"
"0000397996"	"RS1"
"0000397997"	"RS1"
"0000397998"	"RS1"
"0000397999"	"RS1"
"0000398000"	"RS1"
"0000398001"	"RS1"
"0000398002"	"RS1"
"0000398003"	"RS1"
"0000398004"	"RS1"
"0000398005"	"RS1"
"0000398006"	"RS1"
"0000398007"	"RS1"
"0000398008"	"RS1"
"0000398009"	"RS1"
"0000398010"	"RS1"
"0000398011"	"RS1"
"0000398012"	"RS1"
"0000398013"	"RS1"
"0000398014"	"RS1"
"0000398015"	"RS1"
"0000398016"	"RS1"
"0000398017"	"RS1"
"0000398018"	"RS1"
"0000398019"	"RS1"
"0000398020"	"RS1"
"0000398021"	"RS1"
"0000398022"	"RS1"
"0000398023"	"RS1"
"0000398024"	"RS1"
"0000398025"	"RS1"
"0000398026"	"RS1"
"0000398027"	"RS1"
"0000398028"	"RS1"
"0000398029"	"RS1"
"0000398030"	"RS1"
"0000398031"	"RS1"
"0000398032"	"RS1"
"0000398033"	"RS1"
"0000398034"	"RS1"
"0000398035"	"RS1"
"0000398036"	"RS1"
"0000398037"	"RS1"
"0000398038"	"RS1"
"0000398039"	"RS1"
"0000398040"	"RS1"
"0000398041"	"RS1"
"0000398042"	"RS1"
"0000398043"	"RS1"
"0000398044"	"RS1"
"0000398045"	"RS1"
"0000398046"	"RS1"
"0000398047"	"RS1"
"0000398048"	"RS1"
"0000398049"	"RS1"
"0000398050"	"RS1"
"0000398051"	"RS1"
"0000398052"	"RS1"
"0000398053"	"RS1"
"0000398054"	"RS1"
"0000398055"	"RS1"
"0000398056"	"RS1"
"0000398057"	"RS1"
"0000398058"	"RS1"
"0000398059"	"RS1"
"0000398060"	"RS1"
"0000398061"	"RS1"
"0000398062"	"RS1"
"0000398063"	"RS1"
"0000398064"	"RS1"
"0000398065"	"RS1"
"0000398102"	"RS1"
"0000398103"	"RS1"
"0000398104"	"RS1"
"0000398105"	"RS1"
"0000398106"	"RS1"
"0000398107"	"RS1"
"0000398108"	"RS1"
"0000398109"	"RS1"
"0000398110"	"RS1"
"0000398111"	"RS1"
"0000398112"	"RS1"
"0000398113"	"RS1"
"0000398114"	"RS1"
"0000398115"	"RS1"
"0000398116"	"RS1"
"0000398117"	"RS1"
"0000398118"	"RS1"
"0000398119"	"RS1"
"0000398120"	"RS1"
"0000398121"	"RS1"
"0000398122"	"RS1"
"0000398123"	"RS1"
"0000398124"	"RS1"
"0000398125"	"RS1"
"0000398126"	"RS1"
"0000398127"	"RS1"
"0000398128"	"RS1"
"0000398129"	"RS1"
"0000398130"	"RS1"
"0000398131"	"RS1"
"0000398132"	"RS1"
"0000398133"	"RS1"
"0000398134"	"RS1"
"0000398135"	"RS1"
"0000398136"	"RS1"
"0000398137"	"RS1"
"0000398138"	"RS1"
"0000398139"	"RS1"
"0000398140"	"RS1"
"0000398141"	"RS1"
"0000398142"	"RS1"
"0000398143"	"RS1"
"0000398144"	"RS1"
"0000398145"	"RS1"
"0000398146"	"RS1"
"0000398147"	"RS1"
"0000398148"	"RS1"
"0000398149"	"RS1"
"0000398150"	"RS1"
"0000398151"	"RS1"
"0000398152"	"RS1"
"0000398153"	"RS1"
"0000398154"	"RS1"
"0000398155"	"RS1"
"0000398156"	"RS1"
"0000398157"	"RS1"
"0000398158"	"RS1"
"0000398159"	"RS1"
"0000398160"	"RS1"
"0000398161"	"RS1"
"0000398162"	"RS1"
"0000398163"	"RS1"
"0000398164"	"RS1"
"0000398165"	"RS1"
"0000398166"	"RS1"
"0000398167"	"RS1"
"0000398168"	"RS1"
"0000398245"	"RS1"
"0000398285"	"RS1"
"0000398286"	"RS1"
"0000398287"	"RS1"
"0000398288"	"RS1"
"0000398289"	"RS1"
"0000398290"	"RS1"
"0000398291"	"RS1"
"0000398292"	"RS1"
"0000398293"	"RS1"
"0000398294"	"RS1"
"0000398295"	"RS1"
"0000398296"	"RS1"
"0000398297"	"RS1"
"0000398298"	"RS1"
"0000398299"	"RS1"
"0000398300"	"RS1"
"0000398301"	"RS1"
"0000398302"	"RS1"
"0000398303"	"RS1"
"0000398304"	"RS1"
"0000398305"	"RS1"
"0000398306"	"RS1"
"0000398307"	"RS1"
"0000398308"	"RS1"
"0000398309"	"RS1"
"0000398310"	"RS1"
"0000398311"	"RS1"
"0000398312"	"RS1"
"0000398313"	"RS1"
"0000398314"	"RS1"
"0000398315"	"RS1"
"0000398316"	"RS1"
"0000398317"	"RS1"
"0000398318"	"RS1"
"0000398319"	"RS1"
"0000398320"	"RS1"
"0000398321"	"RS1"
"0000398322"	"RS1"
"0000398323"	"RS1"
"0000398324"	"RS1"
"0000398325"	"RS1"
"0000398326"	"RS1"
"0000398327"	"RS1"
"0000398328"	"RS1"
"0000398329"	"RS1"
"0000398330"	"RS1"
"0000398331"	"RS1"
"0000398332"	"RS1"
"0000398333"	"RS1"
"0000398334"	"RS1"
"0000398335"	"RS1"
"0000398336"	"RS1"
"0000398337"	"RS1"
"0000398338"	"RS1"
"0000398339"	"RS1"
"0000398340"	"RS1"
"0000398341"	"RS1"
"0000398342"	"RS1"
"0000398343"	"RS1"
"0000398344"	"RS1"
"0000398345"	"RS1"
"0000398346"	"RS1"
"0000398347"	"RS1"
"0000398348"	"RS1"
"0000398349"	"RS1"
"0000398350"	"RS1"
"0000398351"	"RS1"
"0000398352"	"RS1"
"0000398353"	"RS1"
"0000398354"	"RS1"
"0000398355"	"RS1"
"0000398356"	"RS1"
"0000398357"	"RS1"
"0000398358"	"RS1"
"0000398359"	"RS1"
"0000398360"	"RS1"
"0000398361"	"RS1"
"0000398362"	"RS1"
"0000398363"	"RS1"
"0000398364"	"RS1"
"0000398365"	"RS1"
"0000398366"	"RS1"
"0000398367"	"RS1"
"0000398368"	"RS1"
"0000398369"	"RS1"
"0000398370"	"RS1"
"0000398371"	"RS1"
"0000398372"	"RS1"
"0000398373"	"RS1"
"0000398374"	"RS1"
"0000398375"	"RS1"
"0000398376"	"RS1"
"0000398377"	"RS1"
"0000398378"	"RS1"
"0000409704"	"RS1"
"0000409705"	"RS1"
"0000409706"	"RS1"
"0000409707"	"RS1"
"0000409708"	"RS1"
"0000409709"	"RS1"
"0000409710"	"RS1"
"0000409711"	"RS1"
"0000409712"	"RS1"
"0000409713"	"RS1"
"0000409714"	"RS1"
"0000409715"	"RS1"
"0000409716"	"RS1"
"0000409717"	"RS1"
"0000409718"	"RS1"
"0000409719"	"RS1"
"0000409720"	"RS1"
"0000412853"	"RS1"
"0000415765"	"RS1"
"0000421755"	"RS1"
"0000421830"	"RS1"
"0000421834"	"RS1"
"0000428271"	"RS1"
"0000428272"	"RS1"
"0000428273"	"RS1"
"0000438085"	"RS1"
"0000438086"	"RS1"
"0000438087"	"RS1"
"0000445190"	"RS1"
"0000445191"	"RS1"
"0000445192"	"RS1"
"0000445193"	"RS1"
"0000445194"	"RS1"
"0000445195"	"RS1"
"0000445196"	"RS1"
"0000445197"	"RS1"
"0000445198"	"RS1"
"0000445199"	"RS1"
"0000445346"	"RS1"
"0000445347"	"RS1"
"0000445348"	"RS1"
"0000445349"	"RS1"
"0000445350"	"RS1"
"0000445351"	"RS1"
"0000445352"	"RS1"
"0000445353"	"RS1"
"0000445354"	"RS1"
"0000445355"	"RS1"
"0000445356"	"RS1"
"0000445357"	"RS1"
"0000445358"	"RS1"
"0000445359"	"RS1"
"0000445360"	"RS1"
"0000445361"	"RS1"
"0000460194"	"RS1"
"0000460195"	"RS1"
"0000460196"	"RS1"
"0000460197"	"RS1"
"0000460198"	"RS1"
"0000460199"	"RS1"
"0000460200"	"RS1"
"0000460201"	"RS1"
"0000460202"	"RS1"
"0000460203"	"RS1"
"0000460204"	"RS1"
"0000460205"	"RS1"
"0000460206"	"RS1"
"0000460207"	"RS1"
"0000460208"	"RS1"
"0000460209"	"RS1"
"0000460210"	"RS1"
"0000460211"	"RS1"
"0000460212"	"RS1"
"0000460213"	"RS1"
"0000460214"	"RS1"
"0000460215"	"RS1"
"0000460216"	"RS1"
"0000460217"	"RS1"
"0000460218"	"RS1"
"0000460219"	"RS1"
"0000460220"	"RS1"
"0000460221"	"RS1"
"0000460222"	"RS1"
"0000460223"	"RS1"
"0000460224"	"RS1"
"0000460225"	"RS1"
"0000460226"	"RS1"
"0000460227"	"RS1"
"0000460228"	"RS1"
"0000460229"	"RS1"
"0000460230"	"RS1"
"0000460231"	"RS1"
"0000460232"	"RS1"
"0000460233"	"RS1"
"0000460234"	"RS1"
"0000460235"	"RS1"
"0000460236"	"RS1"
"0000460237"	"RS1"
"0000460238"	"RS1"
"0000460239"	"RS1"
"0000460240"	"RS1"
"0000460241"	"RS1"
"0000460242"	"RS1"
"0000460243"	"RS1"
"0000460244"	"RS1"
"0000460245"	"RS1"
"0000460246"	"RS1"
"0000460247"	"RS1"
"0000460248"	"RS1"
"0000460249"	"RS1"
"0000460250"	"RS1"
"0000460251"	"RS1"
"0000460252"	"RS1"
"0000460253"	"RS1"
"0000460254"	"RS1"
"0000460255"	"RS1"
"0000460256"	"RS1"
"0000460257"	"RS1"
"0000460258"	"RS1"
"0000460259"	"RS1"
"0000460260"	"RS1"
"0000460261"	"RS1"
"0000460262"	"RS1"
"0000460263"	"RS1"
"0000460264"	"RS1"
"0000460265"	"RS1"
"0000460266"	"RS1"
"0000460267"	"RS1"
"0000460268"	"RS1"
"0000460269"	"RS1"
"0000460270"	"RS1"
"0000460271"	"RS1"
"0000460272"	"RS1"
"0000460273"	"RS1"
"0000460274"	"RS1"
"0000460275"	"RS1"
"0000460276"	"RS1"
"0000460277"	"RS1"
"0000460278"	"RS1"
"0000460279"	"RS1"
"0000460280"	"RS1"
"0000460281"	"RS1"
"0000460282"	"RS1"
"0000460283"	"RS1"
"0000460284"	"RS1"
"0000460285"	"RS1"
"0000460286"	"RS1"
"0000460287"	"RS1"
"0000460288"	"RS1"
"0000460289"	"RS1"
"0000460290"	"RS1"
"0000460291"	"RS1"
"0000460292"	"RS1"
"0000460293"	"RS1"
"0000460294"	"RS1"
"0000460295"	"RS1"
"0000460296"	"RS1"
"0000460297"	"RS1"
"0000460298"	"RS1"
"0000460299"	"RS1"
"0000460300"	"RS1"
"0000460301"	"RS1"
"0000460302"	"RS1"
"0000460303"	"RS1"
"0000460304"	"RS1"
"0000460305"	"RS1"
"0000460306"	"RS1"
"0000460307"	"RS1"
"0000460308"	"RS1"
"0000460309"	"RS1"
"0000460310"	"RS1"
"0000460311"	"RS1"
"0000460312"	"RS1"
"0000460313"	"RS1"
"0000460314"	"RS1"
"0000460315"	"RS1"
"0000460316"	"RS1"
"0000460317"	"RS1"
"0000460318"	"RS1"
"0000460319"	"RS1"
"0000460320"	"RS1"
"0000460321"	"RS1"
"0000460322"	"RS1"
"0000460323"	"RS1"
"0000460324"	"RS1"
"0000460325"	"RS1"
"0000460326"	"RS1"
"0000460327"	"RS1"
"0000460328"	"RS1"
"0000460329"	"RS1"
"0000460330"	"RS1"
"0000460331"	"RS1"
"0000460332"	"RS1"
"0000460335"	"RS1"
"0000460336"	"RS1"
"0000460337"	"RS1"
"0000460338"	"RS1"
"0000460339"	"RS1"
"0000460340"	"RS1"
"0000460341"	"RS1"
"0000460342"	"RS1"
"0000460343"	"RS1"
"0000460344"	"RS1"
"0000460345"	"RS1"
"0000460346"	"RS1"
"0000460347"	"RS1"
"0000460348"	"RS1"
"0000460349"	"RS1"
"0000460350"	"RS1"
"0000460351"	"RS1"
"0000460352"	"RS1"
"0000460353"	"RS1"
"0000460354"	"RS1"
"0000460355"	"RS1"
"0000460356"	"RS1"
"0000460357"	"RS1"
"0000460358"	"RS1"
"0000460359"	"RS1"
"0000460360"	"RS1"
"0000460361"	"RS1"
"0000460362"	"RS1"
"0000460363"	"RS1"
"0000460364"	"RS1"
"0000460365"	"RS1"
"0000460366"	"RS1"
"0000460367"	"RS1"
"0000460368"	"RS1"
"0000460369"	"RS1"
"0000460370"	"RS1"
"0000460371"	"RS1"
"0000460372"	"RS1"
"0000460373"	"RS1"
"0000460374"	"RS1"
"0000460375"	"RS1"
"0000460376"	"RS1"
"0000460377"	"RS1"
"0000460378"	"RS1"
"0000460379"	"RS1"
"0000460380"	"RS1"
"0000460381"	"RS1"
"0000460382"	"RS1"
"0000460383"	"RS1"
"0000460384"	"RS1"
"0000460385"	"RS1"
"0000460386"	"RS1"
"0000460387"	"RS1"
"0000460388"	"RS1"
"0000460389"	"RS1"
"0000460390"	"RS1"
"0000460391"	"RS1"
"0000460392"	"RS1"
"0000460393"	"RS1"
"0000460394"	"RS1"
"0000460395"	"RS1"
"0000460396"	"RS1"
"0000460397"	"RS1"
"0000460398"	"RS1"
"0000460399"	"RS1"
"0000460400"	"RS1"
"0000460401"	"RS1"
"0000460402"	"RS1"
"0000460403"	"RS1"
"0000460404"	"RS1"
"0000460405"	"RS1"
"0000460406"	"RS1"
"0000460407"	"RS1"
"0000460408"	"RS1"
"0000460409"	"RS1"
"0000460410"	"RS1"
"0000460411"	"RS1"
"0000460412"	"RS1"
"0000460413"	"RS1"
"0000460414"	"RS1"
"0000460415"	"RS1"
"0000460416"	"RS1"
"0000460417"	"RS1"
"0000460418"	"RS1"
"0000460419"	"RS1"
"0000460420"	"RS1"
"0000460421"	"RS1"
"0000460422"	"RS1"
"0000460423"	"RS1"
"0000460424"	"RS1"
"0000460425"	"RS1"
"0000460426"	"RS1"
"0000460427"	"RS1"
"0000460428"	"RS1"
"0000460429"	"RS1"
"0000460430"	"RS1"
"0000460431"	"RS1"
"0000460432"	"RS1"
"0000460433"	"RS1"
"0000460434"	"RS1"
"0000460435"	"RS1"
"0000460436"	"RS1"
"0000460437"	"RS1"
"0000460438"	"RS1"
"0000460439"	"RS1"
"0000460440"	"RS1"
"0000460441"	"RS1"
"0000460442"	"RS1"
"0000460443"	"RS1"
"0000460444"	"RS1"
"0000460445"	"RS1"
"0000460446"	"RS1"
"0000460447"	"RS1"
"0000460448"	"RS1"
"0000460449"	"RS1"
"0000460450"	"RS1"
"0000460451"	"RS1"
"0000460452"	"RS1"
"0000460453"	"RS1"
"0000460454"	"RS1"
"0000460455"	"RS1"
"0000460456"	"RS1"
"0000460459"	"RS1"
"0000460460"	"RS1"
"0000460461"	"RS1"
"0000460462"	"RS1"
"0000460463"	"RS1"
"0000460464"	"RS1"
"0000460465"	"RS1"
"0000460466"	"RS1"
"0000460467"	"RS1"
"0000460468"	"RS1"
"0000460469"	"RS1"
"0000460470"	"RS1"
"0000460471"	"RS1"
"0000460472"	"RS1"
"0000460473"	"RS1"
"0000460474"	"RS1"
"0000460475"	"RS1"
"0000460476"	"RS1"
"0000460477"	"RS1"
"0000460478"	"RS1"
"0000460479"	"RS1"
"0000460480"	"RS1"
"0000460481"	"RS1"
"0000460482"	"RS1"
"0000460483"	"RS1"
"0000460484"	"RS1"
"0000460485"	"RS1"
"0000460486"	"RS1"
"0000460487"	"RS1"
"0000460488"	"RS1"
"0000460489"	"RS1"
"0000460490"	"RS1"
"0000460491"	"RS1"
"0000460492"	"RS1"
"0000460493"	"RS1"
"0000460494"	"RS1"
"0000460495"	"RS1"
"0000460496"	"RS1"
"0000460497"	"RS1"
"0000460498"	"RS1"
"0000460499"	"RS1"
"0000460500"	"RS1"
"0000460501"	"RS1"
"0000460502"	"RS1"
"0000460503"	"RS1"
"0000460504"	"RS1"
"0000460505"	"RS1"
"0000460506"	"RS1"
"0000460507"	"RS1"
"0000460508"	"RS1"
"0000460509"	"RS1"
"0000460510"	"RS1"
"0000460511"	"RS1"
"0000460512"	"RS1"
"0000460513"	"RS1"
"0000460514"	"RS1"
"0000460515"	"RS1"
"0000460516"	"RS1"
"0000460517"	"RS1"
"0000460518"	"RS1"
"0000460519"	"RS1"
"0000460520"	"RS1"
"0000460521"	"RS1"
"0000460522"	"RS1"
"0000460523"	"RS1"
"0000460524"	"RS1"
"0000460525"	"RS1"
"0000460526"	"RS1"
"0000460527"	"RS1"
"0000460528"	"RS1"
"0000460529"	"RS1"
"0000460530"	"RS1"
"0000460531"	"RS1"
"0000460532"	"RS1"
"0000460533"	"RS1"
"0000460534"	"RS1"
"0000460535"	"RS1"
"0000460536"	"RS1"
"0000460537"	"RS1"
"0000460538"	"RS1"
"0000460539"	"RS1"
"0000460540"	"RS1"
"0000460541"	"RS1"
"0000460542"	"RS1"
"0000460543"	"RS1"
"0000460544"	"RS1"
"0000460545"	"RS1"
"0000460546"	"RS1"
"0000460547"	"RS1"
"0000460548"	"RS1"
"0000460549"	"RS1"
"0000460550"	"RS1"
"0000460551"	"RS1"
"0000460552"	"RS1"
"0000460553"	"RS1"
"0000460554"	"RS1"
"0000460555"	"RS1"
"0000460556"	"RS1"
"0000460557"	"IDS"
"0000460558"	"IDS"
"0000460559"	"IDS"
"0000460560"	"IDS"
"0000460561"	"IDS"
"0000460562"	"IDS"
"0000460563"	"IDS"
"0000460564"	"IDS"
"0000460565"	"IDS"
"0000460566"	"IDS"
"0000460567"	"IDS"
"0000460568"	"IDS"
"0000460569"	"IDS"
"0000460570"	"IDS"
"0000460571"	"IDS"
"0000460572"	"IDS"
"0000460573"	"IDS"
"0000460574"	"IDS"
"0000460575"	"IDS"
"0000460576"	"IDS"
"0000460577"	"IDS"
"0000460578"	"IDS"
"0000460579"	"IDS"
"0000460580"	"IDS"
"0000460581"	"IDS"
"0000460582"	"IDS"
"0000460583"	"IDS"
"0000460584"	"IDS"
"0000460585"	"IDS"
"0000460586"	"IDS"
"0000460587"	"IDS"
"0000460588"	"IDS"
"0000460589"	"IDS"
"0000460590"	"IDS"
"0000460591"	"IDS"
"0000460592"	"IDS"
"0000460593"	"IDS"
"0000460594"	"IDS"
"0000460595"	"IDS"
"0000460596"	"IDS"
"0000460597"	"IDS"
"0000460598"	"RS1"
"0000460599"	"RS1"
"0000460600"	"RS1"
"0000460601"	"RS1"
"0000460603"	"RS1"
"0000460605"	"RS1"
"0000460606"	"RS1"
"0000460607"	"RS1"
"0000460608"	"RS1"
"0000460609"	"RS1"
"0000460611"	"CRB1"
"0000460611"	"RS1"
"0000460612"	"CRB1"
"0000460612"	"RS1"
"0000460615"	"RS1"
"0000460620"	"RS1"
"0000460621"	"RS1"
"0000460637"	"RS1"
"0000460638"	"RS1"
"0000460639"	"RS1"
"0000460640"	"RS1"
"0000460641"	"RS1"
"0000460642"	"RS1"
"0000460643"	"RS1"
"0000460644"	"RS1"
"0000460645"	"RS1"
"0000460646"	"RS1"
"0000460647"	"RS1"
"0000460648"	"RS1"
"0000460649"	"RS1"
"0000460650"	"RS1"
"0000460651"	"RS1"
"0000460652"	"RS1"
"0000460653"	"RS1"
"0000460654"	"RS1"
"0000460655"	"RS1"
"0000460656"	"RS1"
"0000460657"	"RS1"
"0000460658"	"RS1"
"0000460659"	"RS1"
"0000460660"	"RS1"
"0000460661"	"RS1"
"0000460662"	"RS1"
"0000460663"	"RS1"
"0000460664"	"RS1"
"0000460665"	"RS1"
"0000460666"	"RS1"
"0000460667"	"RS1"
"0000460668"	"RS1"
"0000460669"	"RS1"
"0000460670"	"RS1"
"0000460671"	"RS1"
"0000460672"	"RS1"
"0000460673"	"RS1"
"0000460674"	"RS1"
"0000460675"	"RS1"
"0000460676"	"RS1"
"0000460677"	"RS1"
"0000460678"	"RS1"
"0000460679"	"RS1"
"0000460680"	"RS1"
"0000460681"	"RS1"
"0000460682"	"RS1"
"0000460683"	"RS1"
"0000460684"	"RS1"
"0000460685"	"RS1"
"0000460686"	"RS1"
"0000460687"	"RS1"
"0000460688"	"RS1"
"0000460689"	"RS1"
"0000460690"	"RS1"
"0000460691"	"RS1"
"0000460692"	"RS1"
"0000460693"	"RS1"
"0000460694"	"RS1"
"0000460695"	"RS1"
"0000460696"	"RS1"
"0000460697"	"RS1"
"0000460698"	"RS1"
"0000460699"	"RS1"
"0000460700"	"RS1"
"0000460701"	"RS1"
"0000460702"	"RS1"
"0000460703"	"RS1"
"0000460704"	"RS1"
"0000460705"	"RS1"
"0000460706"	"RS1"
"0000460707"	"RS1"
"0000460708"	"RS1"
"0000460709"	"RS1"
"0000460710"	"RS1"
"0000460711"	"RS1"
"0000460712"	"RS1"
"0000460713"	"RS1"
"0000460714"	"RS1"
"0000460715"	"RS1"
"0000460716"	"RS1"
"0000460717"	"RS1"
"0000460718"	"RS1"
"0000460719"	"RS1"
"0000460720"	"RS1"
"0000460721"	"RS1"
"0000460722"	"RS1"
"0000460723"	"RS1"
"0000460724"	"RS1"
"0000460725"	"RS1"
"0000460726"	"RS1"
"0000460727"	"RS1"
"0000460728"	"RS1"
"0000460729"	"RS1"
"0000460730"	"RS1"
"0000460731"	"RS1"
"0000460732"	"RS1"
"0000460733"	"RS1"
"0000460734"	"RS1"
"0000460735"	"RS1"
"0000460736"	"RS1"
"0000460737"	"RS1"
"0000460738"	"RS1"
"0000460739"	"RS1"
"0000460740"	"RS1"
"0000460741"	"RS1"
"0000460742"	"RS1"
"0000460743"	"RS1"
"0000460744"	"RS1"
"0000460745"	"RS1"
"0000460746"	"RS1"
"0000460747"	"RS1"
"0000460748"	"RS1"
"0000460749"	"RS1"
"0000460750"	"RS1"
"0000460751"	"RS1"
"0000460752"	"RS1"
"0000460753"	"RS1"
"0000460754"	"RS1"
"0000460755"	"RS1"
"0000460756"	"RS1"
"0000460757"	"RS1"
"0000460758"	"RS1"
"0000460759"	"RS1"
"0000460760"	"RS1"
"0000460761"	"RS1"
"0000460762"	"RS1"
"0000460763"	"RS1"
"0000460764"	"RS1"
"0000460765"	"RS1"
"0000460766"	"RS1"
"0000460767"	"RS1"
"0000460768"	"RS1"
"0000460769"	"RS1"
"0000460770"	"RS1"
"0000460771"	"RS1"
"0000460772"	"RS1"
"0000460773"	"RS1"
"0000460774"	"RS1"
"0000460775"	"RS1"
"0000460776"	"RS1"
"0000460777"	"RS1"
"0000460778"	"RS1"
"0000460779"	"RS1"
"0000460780"	"RS1"
"0000460781"	"RS1"
"0000460782"	"RS1"
"0000460783"	"RS1"
"0000460784"	"RS1"
"0000460785"	"RS1"
"0000460786"	"RS1"
"0000460787"	"RS1"
"0000460788"	"RS1"
"0000460789"	"RS1"
"0000460790"	"RS1"
"0000460791"	"RS1"
"0000460792"	"RS1"
"0000460793"	"RS1"
"0000460794"	"RS1"
"0000460795"	"RS1"
"0000460796"	"RS1"
"0000460797"	"RS1"
"0000460798"	"RS1"
"0000460799"	"RS1"
"0000460800"	"RS1"
"0000460801"	"RS1"
"0000460802"	"RS1"
"0000460803"	"RS1"
"0000460804"	"RS1"
"0000460805"	"RS1"
"0000460806"	"RS1"
"0000460807"	"RS1"
"0000460808"	"RS1"
"0000460809"	"RS1"
"0000460810"	"RS1"
"0000460811"	"RS1"
"0000460812"	"RS1"
"0000460813"	"RS1"
"0000460814"	"RS1"
"0000460815"	"RS1"
"0000460816"	"RS1"
"0000460817"	"RS1"
"0000460818"	"RS1"
"0000460819"	"RS1"
"0000460820"	"RS1"
"0000460821"	"RS1"
"0000460822"	"RS1"
"0000460823"	"RS1"
"0000460824"	"RS1"
"0000460825"	"RS1"
"0000460826"	"RS1"
"0000460827"	"RS1"
"0000460828"	"RS1"
"0000460829"	"RS1"
"0000460830"	"RS1"
"0000460831"	"RS1"
"0000460832"	"RS1"
"0000460833"	"RS1"
"0000460834"	"RS1"
"0000460835"	"RS1"
"0000460836"	"RS1"
"0000460837"	"RS1"
"0000460838"	"RS1"
"0000460839"	"RS1"
"0000460840"	"RS1"
"0000460841"	"RS1"
"0000460842"	"RS1"
"0000460843"	"RS1"
"0000460844"	"RS1"
"0000460845"	"RS1"
"0000460846"	"RS1"
"0000460847"	"RS1"
"0000460848"	"RS1"
"0000460849"	"RS1"
"0000460850"	"RS1"
"0000460851"	"RS1"
"0000460852"	"RS1"
"0000460853"	"RS1"
"0000460854"	"RS1"
"0000460855"	"RS1"
"0000460856"	"RS1"
"0000460857"	"RS1"
"0000460858"	"RS1"
"0000460859"	"RS1"
"0000460860"	"RS1"
"0000460861"	"RS1"
"0000460862"	"RS1"
"0000460863"	"RS1"
"0000460864"	"RS1"
"0000460865"	"RS1"
"0000460866"	"RS1"
"0000460867"	"RS1"
"0000460868"	"RS1"
"0000460869"	"RS1"
"0000460870"	"RS1"
"0000460871"	"RS1"
"0000460872"	"RS1"
"0000460873"	"RS1"
"0000460874"	"RS1"
"0000460875"	"RS1"
"0000460876"	"RS1"
"0000460877"	"RS1"
"0000460878"	"RS1"
"0000460879"	"RS1"
"0000460880"	"RS1"
"0000460881"	"RS1"
"0000460882"	"RS1"
"0000460883"	"RS1"
"0000460884"	"RS1"
"0000460885"	"RS1"
"0000460886"	"RS1"
"0000460887"	"RS1"
"0000460888"	"RS1"
"0000460889"	"RS1"
"0000460890"	"RS1"
"0000460891"	"RS1"
"0000460892"	"RS1"
"0000460893"	"RS1"
"0000460894"	"RS1"
"0000460895"	"RS1"
"0000460896"	"RS1"
"0000460897"	"RS1"
"0000460898"	"RS1"
"0000460899"	"RS1"
"0000460900"	"RS1"
"0000460901"	"RS1"
"0000460902"	"RS1"
"0000460903"	"RS1"
"0000460904"	"RS1"
"0000460905"	"RS1"
"0000460906"	"RS1"
"0000460907"	"RS1"
"0000460908"	"RS1"
"0000460909"	"RS1"
"0000460910"	"RS1"
"0000460911"	"RS1"
"0000460912"	"RS1"
"0000460913"	"RS1"
"0000460914"	"RS1"
"0000460915"	"RS1"
"0000460916"	"RS1"
"0000460917"	"RS1"
"0000460918"	"RS1"
"0000460919"	"RS1"
"0000460920"	"RS1"
"0000460921"	"RS1"
"0000460922"	"RS1"
"0000460923"	"RS1"
"0000460924"	"RS1"
"0000460925"	"RS1"
"0000460926"	"RS1"
"0000460927"	"RS1"
"0000460928"	"RS1"
"0000460929"	"RS1"
"0000460930"	"RS1"
"0000460931"	"RS1"
"0000460932"	"RS1"
"0000460933"	"RS1"
"0000460934"	"RS1"
"0000460935"	"RS1"
"0000460936"	"RS1"
"0000460937"	"RS1"
"0000460938"	"RS1"
"0000460939"	"RS1"
"0000460940"	"RS1"
"0000460941"	"RS1"
"0000460942"	"RS1"
"0000460943"	"RS1"
"0000460944"	"RS1"
"0000460945"	"RS1"
"0000460946"	"RS1"
"0000460947"	"RS1"
"0000460948"	"RS1"
"0000460949"	"RS1"
"0000460950"	"RS1"
"0000460951"	"RS1"
"0000460952"	"RS1"
"0000460953"	"RS1"
"0000460954"	"RS1"
"0000460955"	"RS1"
"0000460956"	"RS1"
"0000460957"	"RS1"
"0000460958"	"RS1"
"0000460959"	"RS1"
"0000460960"	"RS1"
"0000460961"	"RS1"
"0000460962"	"RS1"
"0000460963"	"RS1"
"0000460964"	"RS1"
"0000460965"	"RS1"
"0000460966"	"RS1"
"0000460967"	"RS1"
"0000460968"	"RS1"
"0000460969"	"RS1"
"0000460970"	"RS1"
"0000460971"	"RS1"
"0000460972"	"RS1"
"0000460992"	"RS1"
"0000460993"	"RS1"
"0000460994"	"RS1"
"0000460995"	"RS1"
"0000460996"	"RS1"
"0000460997"	"RS1"
"0000460998"	"RS1"
"0000460999"	"RS1"
"0000461000"	"RS1"
"0000461001"	"RS1"
"0000461002"	"RS1"
"0000461003"	"RS1"
"0000461004"	"RS1"
"0000461005"	"RS1"
"0000461006"	"RS1"
"0000461007"	"RS1"
"0000461008"	"RS1"
"0000461009"	"RS1"
"0000461010"	"RS1"
"0000461011"	"RS1"
"0000461012"	"RS1"
"0000461013"	"RS1"
"0000461014"	"RS1"
"0000461015"	"RS1"
"0000461016"	"RS1"
"0000461017"	"RS1"
"0000461018"	"RS1"
"0000461019"	"RS1"
"0000461020"	"RS1"
"0000461021"	"RS1"
"0000461025"	"NDP"
"0000461025"	"RS1"
"0000461026"	"RS1"
"0000461050"	"RS1"
"0000461169"	"RS1"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 2408
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000000301"	"0"	"50"	"13"	"52515354"	"52515354"	"subst"	"0.56922"	"00002"	"ATP7B_000001"	"g.52515354A>G"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.51941218A>G"	""	"VUS"	""
"0000000302"	"3"	"50"	"13"	"52515354"	"52515354"	"subst"	"0.56922"	"00002"	"ATP7B_000001"	"g.52515354A>G"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.51941218A>G"	""	"VUS"	""
"0000000303"	"3"	"50"	"13"	"52515354"	"52515354"	"subst"	"0.56922"	"00002"	"ATP7B_000001"	"g.52515354A>G"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.51941218A>G"	""	"VUS"	""
"0000006452"	"20"	"50"	"X"	"18671289"	"18671289"	"subst"	"0"	"00037"	"RS1_000210"	"g.18671289G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18653169G>T"	""	"VUS"	""
"0000008502"	"20"	"50"	"X"	"18671795"	"18671795"	"subst"	"0"	"00037"	"RS1_000208"	"g.18671795A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18653675A>G"	""	"VUS"	""
"0000014411"	"20"	"50"	"X"	"18675380"	"18675380"	"subst"	"0"	"00037"	"RS1_000209"	"g.18675380A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657260A>G"	""	"VUS"	""
"0000140769"	"21"	"90"	"X"	"18689879"	"18692767"	"del"	"0"	"00006"	"RS1_000198"	"g.18689879_18692767del"	""	"{PMID:Huopaniemi 2000:11013441}"	""	"[-5303_-3784del; -2579_52+258del]"	"fragment cloned"	"Germline"	"yes"	""	"0"	""	""	"g.18671759_18674647del"	""	"pathogenic (recessive)"	""
"0000140770"	"21"	"50"	"X"	"18693972"	"18695491"	"del"	"0"	"00006"	"RS1_000308"	"g.18693972_18695491del"	""	"{PMID:Huopaniemi 2000:11013441}"	""	"[-5303_-3784del;-2579_52+258del]"	"fragment cloned"	"Germline"	""	""	"0"	""	""	"g.18675852_18677371del"	""	"VUS"	""
"0000140771"	"1"	"90"	"X"	"0"	"0"	""	"0"	"00006"	"RS1_000000"	"g.="	""	""	""	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	""	""	"NA"	""
"0000140772"	"20"	"90"	"X"	"18674772"	"18690223"	"del"	"0"	"00006"	"RS1_000123"	"g.(18665453_18674772)_(18690223_?)del"	""	"{PMID:Yu 2001:11295123}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18672103_?)del"	""	"pathogenic"	""
"0000140773"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}, {PMID:Eksandh 2005:16272055}"	""	""	"deletion upto 1 kb 5\' ATG"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140774"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140775"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140776"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140777"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Mashima 1999:10220153}, {PMID:Shinoda 2000:11035549}"	""	"del ex1"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140778"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Shinoda 2000:11035549}"	""	"del ex1"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140779"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00221"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140780"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Chan 2004:15281981}"	""	""	"deletion upto 1 kb 5\' ATG\r\n"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140781"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Tsang 2007:17296904}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140782"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000140783"	"21"	"90"	"X"	"18674772"	"18779695"	"del"	"0"	"00006"	"RS1_000123"	"g.(18665453_18674772)_(18779695_18797127)del"	""	"{PMID:Huopaniemi:11013441}"	""	""	"136 kb deletion from PPEF intron 9 to RS1 intron 3 also involving CDKL5 (STK9)"	"Germline"	"yes"	""	"0"	""	""	"g.(18647333_18656652)_(18761577_18779009)del"	""	"pathogenic (recessive)"	""
"0000140792"	"20"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000093"	"g.18690188T>C"	""	"{PMID:Mashima 1999:10220153}"	"-MboII"	""	""	"Germline"	""	""	"0"	""	""	"g.18672068T>C"	""	"pathogenic"	""
"0000140793"	"20"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Kim 2006:17031297}"	"-MboII"	""	"not in 100 control chromosomes"	"Germline"	""	""	"0"	""	""	"g.18672068T>A"	""	"pathogenic"	""
"0000140794"	"21"	"90"	"X"	"18690167"	"18690167"	"del"	"0"	"00006"	"RS1_000162"	"g.18690167del"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672047del"	""	"pathogenic"	""
"0000140795"	"20"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	""	"pathogenic"	""
"0000140796"	"20"	"50"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672034A>T"	""	"VUS"	""
"0000140797"	"20"	"90"	"X"	"18690154"	"18690154"	"subst"	"0"	"00221"	"RS1_000016"	"g.18690154A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672034A>T"	""	"pathogenic"	""
"0000140798"	"1"	"90"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Wang 2002:12417531}"	""	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18672034A>T"	""	"NA"	""
"0000140799"	"20"	"90"	"X"	"18690151"	"18690151"	"subst"	"0"	"00006"	"RS1_000109"	"g.18690151A>G"	""	"{PMID:Hiriyanna 1999:10533068}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672031A>G"	""	"pathogenic"	""
"0000140800"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"+MboII"	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic"	""
"0000140801"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Mashima 1999:10220153}"	"+MboII"	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic"	""
"0000140802"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+MboII"	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic"	""
"0000140803"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000014"	"g.18690136C>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>A"	""	"pathogenic"	""
"0000140804"	"20"	"50"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000014"	"g.18690136C>A"	""	"{PMID:Lamey 2010:20238027}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>A"	""	"VUS"	""
"0000140805"	"20"	"90"	"X"	"18690135"	"18690135"	"dup"	"0"	"00006"	"RS1_000015"	"g.18690135dup"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015dup"	""	"pathogenic"	""
"0000140806"	"20"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00221"	"RS1_000128"	"g.18690135A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015A>G"	""	"pathogenic"	""
"0000140807"	"20"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00006"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Stanga 2001:11217940}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015A>G"	""	"pathogenic"	""
"0000140808"	"21"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00006"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015A>G"	""	"pathogenic"	""
"0000140809"	"20"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00006"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Tsang 2007:17296904}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015A>G"	""	"pathogenic"	""
"0000140810"	"20"	"50"	"X"	"18690132"	"18690132"	"subst"	"0"	"00006"	"RS1_000017"	"g.18690132C>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672012C>G"	""	"VUS"	""
"0000140811"	"20"	"90"	"X"	"18675819"	"18675819"	"subst"	"0"	"00006"	"RS1_000179"	"g.18675819T>C"	""	"{PMID:Gerth 2008:18541843}"	""	"IVS1-34A>G"	""	"Germline"	""	""	"0"	""	""	"g.18657699T>C"	""	"pathogenic"	""
"0000140812"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000140813"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Rodriguez 1998:09699564}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000140814"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Hewitt 2005:15932525}"	""	""	"no amplification exon 2\r\n"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000140815"	"20"	"90"	"X"	"18675777"	"18675777"	"subst"	"0"	"00006"	"RS1_000137"	"g.18675777C>A"	""	"{PMID:Hewitt 2005:15932525}"	"+DraIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18657657C>A"	""	"pathogenic"	""
"0000140816"	"20"	"90"	"X"	"18675777"	"18675777"	"subst"	"0"	"00006"	"RS1_000137"	"g.18675777C>A"	""	"{PMID:Hewitt 2005:15932525}"	"+DraIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18657657C>A"	""	"pathogenic"	""
"0000140817"	"20"	"90"	"X"	"18675770"	"18675770"	"subst"	"0"	"00006"	"RS1_000019"	"g.18675770G>T"	""	"{PMID:RS-consortium 1998, group 4, 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657650G>T"	""	"pathogenic"	""
"0000140818"	"20"	"90"	"X"	"18675762"	"18675762"	"subst"	"0"	"00006"	"RS1_000020"	"g.18675762C>A"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"+MaeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18657642C>A"	""	"pathogenic"	""
"0000140819"	"20"	"90"	"X"	"18675760"	"18675760"	"subst"	"0"	"00006"	"RS1_000142"	"g.18675760C>G"	""	"{PMID:Pimenides 2005:15937075}"	"+MaeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18657640C>G"	""	"pathogenic"	""
"0000140820"	"20"	"90"	"X"	"18675759"	"18675759"	"subst"	"0"	"00006"	"RS1_000152"	"g.18675759C>T"	""	"{PMID:Inoue 2002:12383832}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657639C>T"	""	"pathogenic"	""
"0000140821"	"21"	"90"	"X"	"18675759"	"18675759"	"subst"	"0"	"00156"	"RS1_000155"	"g.18675759C>G"	""	"{PMID:Lesch 2008:18728755}, {PMID:Lesch 2008:19093009}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18657639C>G"	""	"pathogenic"	""
"0000140822"	"20"	"90"	"X"	"18675759"	"18675759"	"subst"	"0"	"00006"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	""	"not in 108 control chromosomes"	"Germline"	""	""	"0"	""	""	"g.18657639C>A"	""	"pathogenic"	""
"0000140823"	"20"	"90"	"X"	"18675755"	"18675755"	"subst"	"0"	"00156"	"RS1_000170"	"g.18675755C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	""	"not in 108 control chromosomes"	"Germline"	""	""	"0"	""	""	"g.18657635C>T"	""	"pathogenic"	""
"0000140824"	"20"	"90"	"X"	"18674880"	"18674880"	"subst"	"0"	"00006"	"RS1_000001"	"g.18674880T>C"	""	"{PMID:Sauer 1997:9326935}"	"-PstI"	""	""	"Germline"	""	""	"0"	""	""	"g.18656760T>C"	""	"pathogenic"	""
"0000140825"	"20"	"90"	"X"	"18674880"	"18674880"	"subst"	"0"	"00221"	"RS1_000001"	"g.18674880T>C"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-PstI"	""	""	"Germline"	""	""	"0"	""	""	"g.18656760T>C"	""	"pathogenic"	""
"0000140826"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140827"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140828"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140829"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140830"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140831"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140832"	"20"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Hewitt 2005:15932525}"	""	""	"no amplification exon 3\r\n"	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic"	""
"0000140833"	"20"	"90"	"X"	"18674854"	"18674854"	"subst"	"0"	"00006"	"RS1_000138"	"g.18674854G>A"	""	"{PMID:Hewitt 2005:15932525}"	"-KpnI"	""	""	"Germline"	""	""	"0"	""	""	"g.18656734G>A"	""	"pathogenic"	""
"0000140834"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Sauer 1997:9326935}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140835"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140836"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140837"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00221"	"RS1_000002"	"g.18674837G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140838"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140839"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Eksandh 2000:10922205}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140840"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Eksandh 2000:10922205}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140841"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Kjellstrom 2010:20569020}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000140842"	"20"	"90"	"X"	"18674808"	"18674808"	"subst"	"0"	"00006"	"RS1_000135"	"g.18674808C>T"	""	"{PMID:Eksandh 2005:16272055}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18656688C>T"	""	"pathogenic"	""
"0000140843"	"20"	"90"	"X"	"18674794"	"18674797"	"dup"	"0"	"00006"	"RS1_000122"	"g.18674794_18674797dup"	""	"{PMID:Hiraoka 2000:10679210}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656674_18656677dup"	""	"pathogenic"	""
"0000140844"	"20"	"90"	"X"	"18674794"	"18674794"	"del"	"0"	"00006"	"RS1_000101"	"g.18674794del"	""	"{PMID:Gehrig 1999:10450864}"	"-BstXI +SduI"	""	""	"Germline"	""	""	"0"	""	""	"g.18656674del"	""	"pathogenic"	""
"0000140845"	"20"	"90"	"X"	"18674759"	"18674791"	"del"	"0"	"00006"	"RS1_000107"	"g.18674759_18674791del"	""	"{PMID:Shinoda 2000:10454824}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656639_18656671del"	""	"pathogenic"	""
"0000140846"	"20"	"90"	"X"	"18674782"	"18674782"	"subst"	"0"	"00006"	"RS1_000022"	"g.18674782A>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.18656662A>T"	""	"pathogenic"	""
"0000140847"	"20"	"90"	"X"	"18674782"	"18674782"	"subst"	"0"	"00006"	"RS1_000022"	"g.18674782A>T"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656662A>T"	""	"pathogenic"	""
"0000140848"	"20"	"90"	"X"	"18674782"	"18674782"	"subst"	"0"	"00006"	"RS1_000022"	"g.18674782A>T"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656662A>T"	""	"pathogenic"	""
"0000140849"	"1"	"90"	"X"	"18674782"	"18674782"	"subst"	"0"	"00006"	"RS1_000022"	"g.18674782A>T"	""	"{PMID:Wang 2002:12417531}"	""	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18656662A>T"	""	"NA"	""
"0000140850"	"20"	"90"	"X"	"18674782"	"18674782"	"subst"	"0"	"00006"	"RS1_000022"	"g.18674782A>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656662A>T"	""	"pathogenic"	""
"0000140851"	"0"	"50"	"X"	"18674738"	"18674738"	"subst"	"0.0354714"	"00006"	"RS1_000157"	"g.18674738A>G"	"0.07"	""	""	""	""	"Germline"	""	"rs6633109"	"0"	""	""	"g.18656618A>G"	""	"VUS"	""
"0000140852"	"21"	"10"	"X"	"18674738"	"18674738"	"subst"	"0.0354714"	"00006"	"RS1_000157"	"g.18674738A>G"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656618A>G"	""	"benign"	""
"0000140853"	"21"	"10"	"X"	"18674738"	"18674738"	"subst"	"0.0354714"	"00006"	"RS1_000157"	"g.18674738A>G"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656618A>G"	""	"benign"	""
"0000140854"	"20"	"50"	"X"	"18674738"	"18674738"	"subst"	"0.0354714"	"00006"	"RS1_000157"	"g.18674738A>G"	""	"{PMID:Kjellstrom 2010:20569020}"	""	"184+35C>T"	""	"Germline"	""	""	"0"	""	""	"g.18656618A>G"	""	"VUS"	""
"0000140855"	"21"	"10"	"X"	"18674644"	"18674644"	"subst"	"0"	"00006"	"RS1_000171"	"g.18674644A>C"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"184+129G>T"	""	"Germline"	""	""	"0"	""	""	"g.18656524A>C"	""	"benign"	""
"0000140856"	"21"	"10"	"X"	"18674644"	"18674644"	"subst"	"0"	"00006"	"RS1_000171"	"g.18674644A>C"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	"184+129G>T"	""	"Germline"	""	""	"0"	""	""	"g.18656524A>C"	""	"benign"	""
"0000140857"	"0"	"50"	"X"	"18665602"	"18665602"	"subst"	"0"	"00006"	"RS1_000153"	"g.18665602T>G"	"0.11"	""	""	""	""	"Germline"	""	"rs6633107"	"0"	""	""	"g.18647482T>G"	""	"VUS"	""
"0000140858"	"20"	"90"	"X"	"18665016"	"18665488"	"del"	"0"	"00006"	"RS1_000145"	"g.18665016_18665488del"	""	"{PMID:Shinoda 2004:14986011}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18646896_18647368del"	""	"pathogenic"	""
"0000140859"	"0"	"50"	"X"	"18665455"	"18665455"	"subst"	"1.67983E-5"	"00006"	"RS1_000154"	"g.18665455G>A"	"<0.01"	""	""	""	""	"Germline"	""	"rs2239810"	"0"	""	""	"g.18647335G>A"	""	"VUS"	""
"0000140860"	"20"	"90"	"X"	"18665453"	"18665453"	"subst"	"0"	"00006"	"RS1_000025"	"g.18665453C>G"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-BscI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647333C>G"	""	"pathogenic"	""
"0000140861"	"20"	"90"	"X"	"18665443"	"18665443"	"subst"	"0"	"00006"	"RS1_000394"	"g.18665443T>C"	""	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	""	"R123X in Renner"	""	"Germline"	""	""	"0"	""	""	"g.18647323T>C"	""	"pathogenic"	""
"0000140862"	"20"	"90"	"X"	"18665443"	"18665443"	"del"	"5.59622E-6"	"00006"	"RS1_000110"	"g.18665443del"	""	"{PMID:Hiriyanna 1999:10533068}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647323del"	""	"pathogenic"	""
"0000140863"	"20"	"90"	"X"	"18665442"	"18665442"	"del"	"0"	"00006"	"RS1_000119"	"g.18665442del"	""	"{PMID:Inoue 2000:10636421}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647322del"	""	"pathogenic"	""
"0000140864"	"20"	"90"	"X"	"18665431"	"18665431"	"subst"	"0"	"00006"	"RS1_000161"	"g.18665431A>G"	""	"{PMID:Tsang 2007:17296904}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647311A>G"	""	"pathogenic"	""
"0000140865"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Yu 2001:11295123}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140866"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00221"	"RS1_000028"	"g.18665429C>T"	""	""	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140867"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140868"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140869"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140870"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140871"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140872"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140873"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140874"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	""
"0000140875"	"1"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Wang 2002:12417531}"	"+DdeI"	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647309C>T"	""	"NA"	""
"0000140876"	"1"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Curat 2001:11598108}"	"+DdeI"	""	"Dd.DDR1:Gly36Ser; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647309C>T"	""	"NA"	""
"0000140877"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000111"	"g.18665429C>G"	""	"{PMID:Hiriyanna 1999:10533068}"	"+DdeI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>G"	""	"pathogenic"	""
"0000140878"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Yu 2001:11295123}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140879"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 4:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140880"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	"TaqI-"	""	""	"De novo"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140881"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140882"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Huopaniemi 1999:10234514}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140883"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1, 2:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140884"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta 1998:09760195}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140885"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta 1998:09760195}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140886"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Mashima 1999:10220153}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140887"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta 1998:09760195}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140888"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta 1998:09760195}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140889"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta:11225572}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140890"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hotta:11225572}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140891"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140892"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140893"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140894"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140895"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140896"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140897"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140898"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140899"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140900"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140901"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140902"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 1:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140903"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140904"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140905"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140906"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140907"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140908"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140909"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140910"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 5:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140911"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 2:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140912"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140913"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140914"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 4:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140915"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00221"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 6:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140916"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00221"	"RS1_000029"	"g.18665423C>T"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140917"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00221"	"RS1_000029"	"g.18665423C>T"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140918"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00221"	"RS1_000029"	"g.18665423C>T"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140919"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00221"	"RS1_000029"	"g.18665423C>T"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140920"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140921"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140922"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140923"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140924"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140925"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:RS-consortium 1998; group 3:9618178}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140926"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Simonelli 2003:12928282}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140927"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Simonelli 2003:12928282}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140928"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Eksandh 2000:10922205}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140929"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00156"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Lesch 2008:19093009}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140930"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00156"	"RS1_000029"	"g.18665423C>T"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140931"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00156"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Lesch 2008:19093009}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140932"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Tsang 2007:17296904}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140933"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140934"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140935"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140936"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140937"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140938"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140939"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140940"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Zeng 2007:17852193}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140941"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Renner 2008:17987333}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140942"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kim 2009:19393523}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140943"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Tuvdendorj 2002:12055472}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000140944"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00006"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Yu 2001:11295123}"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic"	""
"0000140945"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00221"	"RS1_000124"	"g.18665423C>G"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic"	""
"0000140946"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00221"	"RS1_000124"	"g.18665423C>G"	""	""	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic"	""
"0000140947"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00006"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic"	""
"0000140948"	"20"	"90"	"X"	"18665422"	"18665422"	"subst"	"0"	"00006"	"RS1_000131"	"g.18665422T>G"	""	"DB: Gal"	"TaqI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18647302T>G"	""	"pathogenic"	""
"0000140949"	"21"	"90"	"X"	"18665422"	"18665422"	"subst"	"0"	"00006"	"RS1_000180"	"g.18665422T>C"	""	"{PMID:Shukla 2007:17631851}"	""	""	"not in 125 normal chromosomes"	"Germline"	""	""	"0"	""	""	"g.18647302T>C"	""	"pathogenic"	""
"0000140950"	"20"	"90"	"X"	"18665421"	"18665421"	"subst"	"0"	"00006"	"RS1_000030"	"g.18665421C>G"	""	"{PMID:RS-consortium 1998; group 2:9618178}"	"-PleI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647301C>G"	""	"pathogenic"	""
"0000140951"	"20"	"90"	"X"	"18665421"	"18665421"	"subst"	"0"	"00006"	"RS1_000030"	"g.18665421C>G"	""	"{PMID:RS-consortium 1998; group 4:9618178}"	"-PleI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647301C>G"	""	"pathogenic"	""
"0000140952"	"20"	"90"	"X"	"18665420"	"18665420"	"subst"	"0"	"00006"	"RS1_000144"	"g.18665420A>G"	""	"{PMID:Hayashi 2004:15531314}"	"+MvaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647300A>G"	""	"pathogenic"	""
"0000140953"	"21"	"90"	"X"	"18665420"	"18665420"	"subst"	"0"	"00006"	"RS1_000144"	"g.18665420A>G"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"+MvaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647300A>G"	""	"pathogenic"	""
"0000140954"	"20"	"90"	"X"	"18665418"	"18665418"	"del"	"0"	"00006"	"RS1_000112"	"g.18665418del"	""	"{PMID:Hiriyanna 1999:10533068}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647298del"	""	"pathogenic"	""
"0000140955"	"20"	"90"	"X"	"18665416"	"18665416"	"subst"	"0"	"00006"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Huopaniemi 1999:10234514}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"pathogenic"	""
"0000140956"	"20"	"90"	"X"	"18665416"	"18665416"	"subst"	"0"	"00006"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"pathogenic"	""
"0000140957"	"20"	"90"	"X"	"18665416"	"18665416"	"subst"	"0"	"00006"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Hiriyanna 1999:10533068}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"pathogenic"	""
"0000140958"	"20"	"90"	"X"	"18665416"	"18665416"	"subst"	"0"	"00006"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Eksandh 2000:10922205}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"pathogenic"	""
"0000140959"	"20"	"90"	"X"	"18665400"	"18665416"	"delins"	"0"	"00006"	"RS1_000090"	"g.18665400_18665416delinsTAACCCGGTCAGGGGA"	""	"{PMID:Rodriguez 1998:09699564}"	""	"221_237delins20"	""	"Germline"	""	""	"0"	""	""	"g.18647280_18647296delinsTAACCCGGTCAGGGGA"	""	"pathogenic"	""
"0000140960"	"0"	"50"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	""	""	""	""	"Germline"	""	"rs62641252"	"0"	""	""	"g.18647294C>A"	""	"VUS"	""
"0000140961"	"20"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647294C>A"	""	"pathogenic"	""
"0000140962"	"20"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647294C>A"	""	"pathogenic"	""
"0000140963"	"20"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647294C>A"	""	"pathogenic"	""
"0000140964"	"20"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	"{PMID:Hiriyanna 1999:10533068}"	"-MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647294C>A"	""	"pathogenic"	""
"0000140965"	"20"	"90"	"X"	"18665410"	"18665410"	"subst"	"0"	"00006"	"RS1_000172"	"g.18665410A>C"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	""	""	"not in 108 control chromosomes"	"Germline"	""	""	"0"	""	""	"g.18647290A>C"	""	"pathogenic"	""
"0000140966"	"20"	"90"	"X"	"18665399"	"18665399"	"subst"	"0"	"00220"	"RS1_000158"	"g.18665399G>A"	""	"{PMID:Jin 2007:17295148}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647279G>A"	""	"pathogenic"	""
"0000140967"	"20"	"90"	"X"	"18665399"	"18665399"	"subst"	"0"	"00006"	"RS1_000158"	"g.18665399G>A"	""	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	""	""	""	"De novo"	""	""	"0"	""	""	"g.18647279G>A"	""	"pathogenic"	""
"0000140968"	"0"	"50"	"X"	"18665395"	"18665395"	"subst"	"0"	"00006"	"RS1_000146"	"g.18665395A>T"	""	""	""	""	""	"Germline"	""	"rs61750457"	"0"	""	""	"g.18647275A>T"	""	"VUS"	""
"0000140969"	"20"	"90"	"X"	"18665395"	"18665395"	"subst"	"0"	"00006"	"RS1_000146"	"g.18665395A>T"	""	"{PMID:Simonelli 2003:12928282}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647275A>T"	""	"pathogenic"	""
"0000140970"	"20"	"90"	"X"	"18665382"	"18665384"	"del"	"0"	"00006"	"RS1_000113"	"g.18665382_18665384del"	""	"{PMID:Hiriyanna 1999:10533068}"	"-NciI, +AccIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647262_18647264del"	""	"pathogenic"	""
"0000140971"	"0"	"50"	"X"	"18665375"	"18665375"	"subst"	"0"	"00006"	"RS1_000181"	"g.18665375G>A"	""	""	""	"0"	""	"Germline"	""	"rs61750459"	"0"	""	""	"g.18647255G>A"	""	"VUS"	""
"0000140972"	"0"	"50"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	""	""	""	""	"Germline"	""	"rs61752060"	"0"	""	""	"g.18647251T>C"	""	"VUS"	""
"0000140973"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140974"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Mashima 1999:10220153}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140975"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Hayashi 2004:15531314}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140976"	"21"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140977"	"21"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2009:19324861}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140978"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140979"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000140980"	"0"	"50"	"X"	"18665370"	"18665370"	"subst"	"0"	"00006"	"RS1_000034"	"g.18665370A>T"	""	""	""	""	""	"Germline"	""	"rs61752061"	"0"	""	""	"g.18647250A>T"	""	"VUS"	""
"0000140981"	"20"	"90"	"X"	"18665370"	"18665370"	"subst"	"0"	"00006"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Shastry 1999:10079181}, {PMID:Shastry 2010:21472264}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647250A>T"	""	"pathogenic"	""
"0000140982"	"20"	"50"	"X"	"18665363"	"18665363"	"subst"	"0"	"00006"	"RS1_000182"	"g.18665363A>C"	""	"{PMID:Lamey 2010:20238027}"	""	"289T>G"	""	"Germline"	""	""	"0"	""	""	"g.18647243A>C"	""	"VUS"	""
"0000140983"	"0"	"50"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	""	""	""	""	"Germline"	""	"rs61752062"	"0"	""	""	"g.18647241C>G"	""	"VUS"	""
"0000140984"	"20"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Inoue 2000:10636421}"	"+BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic"	""
"0000140985"	"20"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Hotta 1998:09760195}"	"+BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic"	""
"0000140986"	"0"	"50"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	""	""	""	""	"Germline"	""	"rs61752063"	"0"	""	""	"g.18647231A>G"	""	"VUS"	""
"0000140987"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Sauer 1997:9326935}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140988"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140989"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140990"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140991"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140992"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140993"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140994"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140995"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140996"	"20"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Eksandh 2005:16272055}"	"+AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic"	""
"0000140997"	"0"	"50"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000147"	"g.18665349C>T"	""	""	""	""	""	"Germline"	""	"rs61752064"	"0"	""	""	"g.18647229C>T"	""	"VUS"	""
"0000140998"	"20"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Sato 2003:12920343}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647229C>T"	""	"pathogenic"	""
"0000140999"	"0"	"50"	"X"	"18665344"	"18665344"	"subst"	"0"	"00006"	"RS1_000102"	"g.18665344G>T"	""	""	""	""	""	"Germline"	""	"rs61752065"	"0"	""	""	"g.18647224G>T"	""	"VUS"	""
"0000141000"	"20"	"90"	"X"	"18665344"	"18665344"	"subst"	"0"	"00006"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gehrig 1999:10450864}"	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647224G>T"	""	"pathogenic"	""
"0000141001"	"20"	"90"	"X"	"18665344"	"18665344"	"subst"	"0"	"00006"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Renner 2008:17987333}"	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647224G>T"	""	"pathogenic"	""
"0000141002"	"20"	"90"	"X"	"18665337"	"18665337"	"del"	"0"	"00006"	"RS1_000183"	"g.18665337del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"HaeIII-"	"300delG"	""	"Germline"	""	""	"0"	""	""	"g.18647217del"	""	"pathogenic"	""
"0000141003"	"20"	"90"	"X"	"18665336"	"18665336"	"subst"	"0"	"00006"	"RS1_000127"	"g.18665336C>G"	""	"{PMID:Nakamura 2001:11594966}"	"-HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647216C>G"	""	"pathogenic"	""
"0000141004"	"20"	"90"	"X"	"18665336"	"18665336"	"subst"	"0"	"00006"	"RS1_000127"	"g.18665336C>G"	""	"{PMID:Nakamura 2001:11594966}"	"-HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647216C>G"	""	"pathogenic"	""
"0000141005"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Sauer 1997:9326935}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141006"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141007"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141008"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141009"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141010"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141011"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141012"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141013"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141014"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141015"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141016"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141017"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141018"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141019"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141020"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141021"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141022"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141023"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141024"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141025"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141026"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141027"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00221"	"RS1_000004"	"g.18665333G>A"	""	""	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141028"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Hewitt 2005:15932525}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141029"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Dodds 2006:16900931}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141030"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Dodds 2006:1690093}"	"+EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141031"	"1"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Wang 2002:12417531}"	"+EcoRII"	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647213G>A"	""	"NA"	""
"0000141032"	"1"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Curat 2001:11598108}"	"+EcoRII"	""	"Dd.DDR1:Arg63Trp; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647213G>A"	""	"NA"	""
"0000141033"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Gerth 2008:18541843}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000141034"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141035"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"+AluI"	""	""	"De novo"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141036"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hotta 1998:09760195}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141037"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Taketani:10589241}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141038"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141039"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00221"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141040"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00221"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Saldana 2007:17304551}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141041"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141042"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141043"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141044"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hewitt 2005:15932525}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141045"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Simonelli 2003:12928282}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141046"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hewitt 2005:15932525}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141047"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00221"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Saldana 2007:17304551}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141048"	"11"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00221"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Saldana 2007:17304551}"	"+AluI"	""	"variants in other allele excluded (incl. deletions); Xi not informative"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141049"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141050"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Tsang 2007:17296904}"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141051"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"+AluI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141052"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141053"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000141055"	"21"	"90"	"X"	"18665328"	"18665330"	"delins"	"0"	"00006"	"RS1_000184"	"g.18665328_18665330delinsAAA"	""	"{PMID:Koh 2006:16768192}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647208_18647210delinsAAA"	""	"pathogenic"	""
"0000141056"	"20"	"90"	"X"	"18665329"	"18665329"	"subst"	"0"	"00221"	"RS1_000037"	"g.18665329A>C"	""	"{PMID:Pimenides 2005:15937075}"	"+HhaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647209A>C"	""	"pathogenic"	""
"0000141057"	"20"	"90"	"X"	"18665329"	"18665329"	"subst"	"0"	"00006"	"RS1_000037"	"g.18665329A>C"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"+HhaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647209A>C"	""	"pathogenic"	""
"0000141058"	"20"	"90"	"X"	"18665325"	"18665325"	"subst"	"0"	"00006"	"RS1_000097"	"g.18665325G>C"	""	"{PMID:Huopaniemi 1999:10234514}"	"+HinfI, +PleI"	""	""	"Germline"	""	""	"0"	""	""	"g.18647205G>C"	""	"pathogenic"	""
"0000141059"	"20"	"90"	"X"	"18665320"	"18665320"	"dup"	"0"	"00006"	"RS1_000005"	"g.18665320dup"	""	"{PMID:Sauer 1997:9326935}"	""	"315_316insA"	""	"Germline"	""	""	"0"	""	""	"g.18647200dup"	""	"pathogenic"	""
"0000141060"	"20"	"90"	"X"	"18665312"	"18665318"	"del"	"0"	"00221"	"RS1_000134"	"g.18665312_18665318del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192_18647198del"	""	"pathogenic"	""
"0000141061"	"20"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"00006"	"RS1_000103"	"g.18665314A>C"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647194A>C"	""	"pathogenic"	""
"0000141062"	"20"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"00006"	"RS1_000103"	"g.18665314A>C"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647194A>C"	""	"pathogenic"	""
"0000141063"	"20"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"00006"	"RS1_000103"	"g.18665314A>C"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647194A>C"	""	"pathogenic"	""
"0000141064"	"20"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"00006"	"RS1_000103"	"g.18665314A>C"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647194A>C"	""	"pathogenic"	""
"0000141065"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Sauer 1997:9326935}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141066"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Huopaniemi 1999:10234514}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141067"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141068"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141069"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00221"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141070"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00221"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141071"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00221"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141072"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00221"	"RS1_000006"	"g.18665312C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141073"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00221"	"RS1_000006"	"g.18665312C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141074"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000141075"	"1"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Wang 2002:12417531}"	""	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647192C>G"	""	"NA"	""
"0000141076"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>A"	""	"pathogenic"	""
"0000141077"	"20"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Tsang 2007:17296904}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>A"	""	"pathogenic"	""
"0000141078"	"20"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000095"	"g.18665311C>T"	""	"{PMID:Inoue 2000:10636421}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>T"	""	"pathogenic"	""
"0000141079"	"20"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00221"	"RS1_000133"	"g.18665311C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic"	""
"0000141080"	"20"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00221"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:Pimenides 2005:15937075}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647190C>T"	""	"pathogenic"	""
"0000141081"	"20"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00221"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647190C>T"	""	"pathogenic"	""
"0000141082"	"20"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00006"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647190C>T"	""	"pathogenic"	""
"0000141083"	"20"	"90"	"X"	"18662748"	"18662748"	"subst"	"0"	"00006"	"RS1_000185"	"g.18662748G>C"	""	"{PMID:Renner 2008:17987333}"	""	"IVS4-3C>G"	""	"Germline"	""	""	"0"	""	""	"g.18644628G>C"	""	"pathogenic"	""
"0000141084"	"20"	"90"	"X"	"18662744"	"18662746"	"del"	"0"	"00006"	"RS1_000139"	"g.18662744_18662746del"	""	"{PMID:Hewitt 2005:15932525}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644624_18644626del"	""	"pathogenic"	""
"0000141085"	"20"	"90"	"X"	"18662743"	"18662743"	"subst"	"0"	"00006"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-UbaEI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644623C>T"	""	"pathogenic"	""
"0000141086"	"20"	"90"	"X"	"18662743"	"18662743"	"subst"	"0"	"00006"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Pimenides 2005:15937075}"	"-UbaEI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644623C>T"	""	"pathogenic"	""
"0000141087"	"20"	"90"	"X"	"18662742"	"18662742"	"subst"	"0"	"00006"	"RS1_000120"	"g.18662742A>T"	""	"{PMID:Inoue 2000:10636421}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644622A>T"	""	"pathogenic"	""
"0000141088"	"1"	"10"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"00006"	"RS1_000040"	"g.18662742A>G"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644622A>G"	""	"benign"	""
"0000141089"	"1"	"10"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"00006"	"RS1_000040"	"g.18662742A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644622A>G"	""	"benign"	""
"0000141090"	"20"	"30"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"00006"	"RS1_000040"	"g.18662742A>G"	"1/208"	"{PMID:Tarpey 2009:19377476}"	"?"	""	"non-recurrent variant"	"Germline"	""	""	"0"	""	""	"g.18644622A>G"	""	"likely benign"	""
"0000141091"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>G"	""	"pathogenic"	""
"0000141092"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:Hewitt 2005:15932525}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>G"	""	"pathogenic"	""
"0000141093"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:Simonelli 2003:12928282}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>G"	""	"pathogenic"	""
"0000141094"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:Iannaccone 2006:16884758}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>G"	""	"pathogenic"	""
"0000141095"	"1"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:Curat 2001:11598108}"	"-EcoRII"	""	"Dd.DDR1:Trp73Cys; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18644616C>G"	""	"NA"	""
"0000141096"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:RS-consortium 1998, group 1, 2:9618178}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic"	""
"0000141097"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic"	""
"0000141098"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:Simonelli 2003:12928282}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic"	""
"0000141099"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:Simonelli 2003:12928282}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic"	""
"0000141100"	"20"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:Iannaccone 2006:16884758}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic"	""
"0000141101"	"20"	"90"	"X"	"18662735"	"18662735"	"subst"	"0"	"00006"	"RS1_000043"	"g.18662735G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+DrdII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644615G>A"	""	"pathogenic"	""
"0000141102"	"1"	"90"	"X"	"18662723"	"18662723"	"subst"	"0"	"00238"	"RS1_000201"	"g.18662723G>A"	""	""	"PfoI-; BfaI+"	""	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18644603G>A"	""	"pathogenic"	""
"0000141103"	"20"	"90"	"X"	"18662721"	"18662722"	"ins"	"0"	"00006"	"RS1_000044"	"g.18662721_18662722insA"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-EcoRII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644601_18644602insA"	""	"pathogenic"	""
"0000141104"	"21"	"90"	"X"	"18662718"	"18662718"	"delins"	"0"	"00006"	"RS1_000186"	"g.18662718delins18662729_18662746"	""	"{PMID:Vijayasarathy 2009:19474399}"	""	"354delCinsGGTGTGCCTGGCTCTCCA"	"no detectable protein WB; variant tested by in vitro cloning"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000141105"	"0"	"50"	"X"	"18662706"	"18662706"	"subst"	"0"	"00006"	"RS1_000187"	"g.18662706C>G"	""	""	""	""	""	"Germline"	""	"rs61752147"	"0"	""	""	"g.18644586C>G"	""	"VUS"	""
"0000141106"	"21"	"90"	"X"	"18662701"	"18662701"	"subst"	"0"	"00006"	"RS1_000188"	"g.18662701T>C"	""	"{PMID:Kim 2009:19393523}"	"TatI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18644581T>C"	""	"pathogenic"	""
"0000141107"	"1"	"90"	"X"	"18662698"	"18662698"	"subst"	"0"	"00238"	"RS1_000202"	"g.18662698A>C"	""	""	""	""	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18644578A>C"	""	"pathogenic"	""
"0000141108"	"20"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00006"	"RS1_000045"	"g.18662698_18662701del"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"-BglII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic"	""
"0000141109"	"20"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00006"	"RS1_000045"	"g.18662698_18662701del"	""	"{PMID:Hiriyanna 1999:10533068}"	"-BglII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic"	""
"0000141110"	"20"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00006"	"RS1_000045"	"g.18662698_18662701del"	""	"{PMID:Tantri 2003:12967815}"	"-BglII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic"	""
"0000141111"	"1"	"90"	"X"	"18662696"	"18662696"	"subst"	"0"	"00238"	"RS1_000199"	"g.18662696C>G"	""	""	"BglII-"	""	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18644576C>G"	""	"pathogenic"	""
"0000141112"	"21"	"90"	"X"	"18662695"	"18662695"	"subst"	"0"	"00006"	"RS1_000189"	"g.18662695T>C"	""	"{PMID:Atchaneeyasakul 2010:20151283}"	""	"378A>G"	""	"Germline"	""	""	"0"	""	""	"g.18644575T>C"	""	"pathogenic"	""
"0000141113"	"0"	"50"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	""	""	""	""	"Germline"	""	"rs61752149"	"0"	""	""	"g.18644572A>G"	""	"VUS"	""
"0000141114"	"20"	"90"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AlwI, -BglII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644572A>G"	""	"pathogenic"	""
"0000141115"	"21"	"90"	"X"	"18662640"	"18662687"	"dup"	"0"	"00238"	"RS1_000200"	"g.18662640_18662687dup"	""	""	""	"387_434dup48"	"not in 50 control samples"	"Germline"	""	""	"0"	""	""	"g.18644520_18644567dup"	""	"pathogenic"	""
"0000141116"	"20"	"90"	"X"	"18662680"	"18662681"	"del"	"0"	"00006"	"RS1_000047"	"g.18662680_18662681del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"+TspRI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644560_18644561del"	""	"pathogenic"	""
"0000141117"	"0"	"50"	"X"	"18662675"	"18662675"	"subst"	"0"	"00006"	"RS1_000136"	"g.18662675T>A"	""	""	""	""	""	"Germline"	""	"rs61752151"	"0"	""	""	"g.18644555T>A"	""	"VUS"	""
"0000141118"	"20"	"90"	"X"	"18662675"	"18662675"	"subst"	"0"	"00006"	"RS1_000136"	"g.18662675T>A"	""	"{PMID:Kawano 2005:15944839}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644555T>A"	""	"pathogenic"	""
"0000141119"	"0"	"50"	"X"	"18662668"	"18662668"	"subst"	"0"	"00006"	"RS1_000048"	"g.18662668C>A"	""	""	""	""	""	"Germline"	""	"rs61752152"	"0"	""	""	"g.18644548C>A"	""	"VUS"	""
"0000141120"	"20"	"90"	"X"	"18662668"	"18662668"	"subst"	"0"	"00006"	"RS1_000048"	"g.18662668C>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-XhoII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644548C>A"	""	"pathogenic"	""
"0000141121"	"0"	"50"	"X"	"18662665"	"18662665"	"subst"	"0"	"00006"	"RS1_000049"	"g.18662665A>G"	""	""	""	""	""	"Germline"	""	"rs61752153"	"0"	""	""	"g.18644545A>G"	""	"VUS"	""
"0000141122"	"20"	"90"	"X"	"18662665"	"18662665"	"subst"	"0"	"00006"	"RS1_000049"	"g.18662665A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-BamHI, +EcoO109I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644545A>G"	""	"pathogenic"	""
"0000141123"	"20"	"90"	"X"	"18662665"	"18662665"	"subst"	"0"	"00006"	"RS1_000049"	"g.18662665A>G"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644545A>G"	""	"pathogenic"	""
"0000141124"	"20"	"90"	"X"	"18662665"	"18662665"	"subst"	"0"	"00006"	"RS1_000049"	"g.18662665A>G"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644545A>G"	""	"pathogenic"	""
"0000141125"	"20"	"90"	"X"	"18662662"	"18662662"	"subst"	"0"	"00006"	"RS1_000173"	"g.18662662A>G"	""	"{PMID:Riveiro 2005:16521245}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644542A>G"	""	"pathogenic"	""
"0000141126"	"0"	"50"	"X"	"18662660"	"18662660"	"subst"	"0"	"00006"	"RS1_000050"	"g.18662660T>C"	""	""	""	""	""	"Germline"	""	"rs61752154"	"0"	""	""	"g.18644540T>C"	""	"VUS"	""
"0000141127"	"20"	"90"	"X"	"18662660"	"18662660"	"subst"	"0"	"00006"	"RS1_000050"	"g.18662660T>C"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-HphI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644540T>C"	""	"pathogenic"	""
"0000141128"	"20"	"90"	"X"	"18662652"	"18662661"	"del"	"0"	"00006"	"RS1_000174"	"g.18662652_18662661del"	""	"{PMID:Riveiro 2005:16521245}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644532_18644541del"	""	"pathogenic"	""
"0000141129"	"20"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"+SmaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic"	""
"0000141130"	"20"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Hewitt 2005:15932525}"	"+SmaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic"	""
"0000141131"	"20"	"50"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Lamey 2010:20238027}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"VUS"	""
"0000141132"	"0"	"50"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	""	""	""	""	"Germline"	""	"rs61752156"	"0"	""	""	"g.18644534C>T"	""	"VUS"	""
"0000141133"	"20"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-BsaJI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic"	""
"0000141134"	"20"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"-BsaJI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic"	""
"0000141135"	"20"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Hewitt 2005:15932525}"	"-BsaJI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic"	""
"0000141136"	"21"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00156"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Lesch 2008:19093009}"	"-BsaJI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic"	""
"0000141137"	"1"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Curat 2001:11598108}"	"-BsaJI"	""	"Dd.DDR1:Gly104Arg; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18644534C>T"	""	"NA"	""
"0000141138"	"0"	"50"	"X"	"18662653"	"18662653"	"subst"	"0"	"00006"	"RS1_000053"	"g.18662653C>T"	""	""	""	""	""	"Germline"	""	"rs61752157"	"0"	""	""	"g.18644533C>T"	""	"VUS"	""
"0000141139"	"20"	"90"	"X"	"18662653"	"18662653"	"subst"	"0"	"00221"	"RS1_000053"	"g.18662653C>T"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"+Eco47III"	""	""	"Germline"	""	""	"0"	""	""	"g.18644533C>T"	""	"pathogenic"	""
"0000141140"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000054"	"g.18662651G>C"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>C"	""	"pathogenic"	""
"0000141141"	"1"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000054"	"g.18662651G>C"	""	"{PMID:Wang 2002:12417531}"	"-HaeII"	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18644531G>C"	""	"NA"	""
"0000141142"	"0"	"50"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	""	""	""	""	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"VUS"	""
"0000141143"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141144"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141145"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141146"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Gehrig 1999:10450864}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141147"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141148"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141149"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141150"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141151"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141152"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141153"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00221"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141154"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141155"	"21"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00156"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Lesch 2008:19093009}"	"HaeII-"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141156"	"21"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00156"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Lesch 2008:19093009}"	"-HaeII"	""	""	"De novo"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141157"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	"-HaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141158"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141160"	"21"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Lesch 2008:19093009}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	""
"0000141161"	"20"	"90"	"X"	"18662650"	"18662651"	"ins"	"0"	"00006"	"RS1_000190"	"g.18662650_18662651insT"	""	"{PMID:Kjellstrom 2010:20569020}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530_18644531insT"	""	"pathogenic"	""
"0000141162"	"0"	"50"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	""	""	""	""	"Germline"	""	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"VUS"	""
"0000141163"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-HaeII, +Bsp1286I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141164"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-HaeII, +Bsp1286I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141165"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Park:10636429}"	"-HaeII, +Bsp1286I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141166"	"21"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00156"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Lesch 2008:19093009}"	"-HaeII, +Bsp1286I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141167"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141168"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000141169"	"1"	"10"	"X"	"18662646"	"18662646"	"subst"	"0"	"00006"	"RS1_000057"	"g.18662646A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	"found 3 times"	"Germline"	""	""	"0"	""	""	"g.18644526A>G"	""	"benign"	""
"0000141170"	"20"	"90"	"X"	"18662646"	"18662646"	"subst"	"0"	"00006"	"RS1_000114"	"g.18662646A>C"	""	"{PMID:Hiriyanna 1999:10533068}"	"-MaeIII +BsmFI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644526A>C"	""	"pathogenic"	""
"0000141171"	"20"	"90"	"X"	"18662646"	"18662646"	"subst"	"0"	"00006"	"RS1_000114"	"g.18662646A>C"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-MaeIII +BsmFI"	""	""	"De novo"	""	""	"0"	""	""	"g.18644526A>C"	""	"pathogenic"	""
"0000141172"	"20"	"90"	"X"	"18662647"	"18662648"	"del"	"0"	"00006"	"RS1_000129"	"g.18662647_18662648del"	""	"{PMID:Shinoda 2000:11035549}"	""	"424-425del"	""	"Germline"	""	""	"0"	""	""	"g.18644527_18644528del"	""	"pathogenic"	""
"0000141173"	"0"	"50"	"X"	"18662644"	"18662644"	"subst"	"0"	"00006"	"RS1_000058"	"g.18662644T>A"	""	""	""	""	""	"Germline"	""	"rs61753161"	"0"	""	""	"g.18644524T>A"	""	"VUS"	""
"0000141174"	"20"	"90"	"X"	"18662644"	"18662644"	"subst"	"0"	"00006"	"RS1_000058"	"g.18662644T>A"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-MaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18644524T>A"	""	"pathogenic"	""
"0000141175"	"21"	"90"	"X"	"18662639"	"18662639"	"subst"	"0"	"00006"	"RS1_000163"	"g.18662639C>G"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644519C>G"	""	"pathogenic"	""
"0000141176"	"0"	"50"	"X"	"18662636"	"18662636"	"subst"	"0"	"00006"	"RS1_000059"	"g.18662636C>T"	""	""	""	""	""	"Germline"	""	"rs61753162"	"0"	""	""	"g.18644516C>T"	""	"VUS"	""
"0000141177"	"20"	"90"	"X"	"18662636"	"18662636"	"subst"	"0"	"00006"	"RS1_000059"	"g.18662636C>T"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644516C>T"	""	"pathogenic"	""
"0000141178"	"20"	"90"	"X"	"18662636"	"18662636"	"subst"	"0"	"00006"	"RS1_000059"	"g.18662636C>T"	""	"{PMID:Gehrig 1999:10450864}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644516C>T"	""	"pathogenic"	""
"0000141179"	"0"	"50"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	""	""	""	""	"Germline"	""	"rs61753163"	"0"	""	""	"g.18644514C>G"	""	"VUS"	""
"0000141180"	"20"	"90"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:Hotta 1998:09760195}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644514C>G"	""	"pathogenic"	""
"0000141181"	"20"	"90"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644514C>G"	""	"pathogenic"	""
"0000141182"	"20"	"90"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644514C>G"	""	"pathogenic"	""
"0000141183"	"0"	"50"	"X"	"18662612"	"18662612"	"subst"	"0"	"00006"	"RS1_000061"	"g.18662612G>A"	""	""	""	""	""	"Germline"	""	"rs61753164"	"0"	""	""	"g.18644492G>A"	""	"VUS"	""
"0000141184"	"20"	"90"	"X"	"18662612"	"18662612"	"subst"	"0"	"00006"	"RS1_000061"	"g.18662612G>A"	""	"{PMID:Hotta 1998:09760195}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644492G>A"	""	"pathogenic"	""
"0000141185"	"20"	"90"	"X"	"18662612"	"18662612"	"subst"	"0"	"00221"	"RS1_000061"	"g.18662612G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644492G>A"	""	"pathogenic"	""
"0000141186"	"20"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"Ayuso ICHG2001 P1487;Riveiro-Alvarez ESHG2008 P05.213"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141187"	"21"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141188"	"21"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141189"	"21"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141190"	"20"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141191"	"20"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro 2005:16521243}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	"common haplotype"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141192"	"20"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic"	""
"0000141193"	"0"	"50"	"X"	"18662608"	"18662608"	"subst"	"0"	"00006"	"RS1_000062"	"g.18662608T>C"	""	""	""	""	""	"Germline"	""	"rs61753165"	"0"	""	""	"g.18644488T>C"	""	"VUS"	""
"0000141194"	"20"	"90"	"X"	"18662608"	"18662608"	"subst"	"0"	"00006"	"RS1_000062"	"g.18662608T>C"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-AfaI, +BspWI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644488T>C"	""	"pathogenic"	""
"0000141195"	"21"	"90"	"X"	"18662606"	"18662606"	"subst"	"0"	"00006"	"RS1_000164"	"g.18662606T>C"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	"466G>A"	""	"Germline"	""	""	"0"	""	""	"g.18644486T>C"	""	"pathogenic"	""
"0000141196"	"1"	"10"	"X"	"18662600"	"18662600"	"subst"	"0"	"00006"	"RS1_000063"	"g.18662600C>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644480C>T"	""	"benign"	""
"0000141197"	"21"	"90"	"X"	"18662584"	"18662584"	"del"	"0"	"00006"	"RS1_000165"	"g.18662584del"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	"488delG"	""	"Germline"	""	""	"0"	""	""	"g.18644464del"	""	"pathogenic"	""
"0000141198"	"0"	"50"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000096"	"g.18662583C>T"	""	""	""	""	""	"Germline"	""	"rs61753166"	"0"	""	""	"g.18644463C>T"	""	"VUS"	""
"0000141199"	"20"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000096"	"g.18662583C>T"	""	"{PMID:Mashima 1999:10220153}"	"-BsrI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644463C>T"	""	"pathogenic"	""
"0000141200"	"20"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000115"	"g.18662583C>A"	""	"{PMID:Hiriyanna 1999:10533068}"	"-BsrI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644463C>A"	""	"pathogenic"	""
"0000141201"	"20"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000115"	"g.18662583C>A"	""	"{PMID:Eksandh 2000:10922205}"	"-BsrI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644463C>A"	""	"pathogenic"	""
"0000141202"	"20"	"90"	"X"	"18662573"	"18662573"	"subst"	"0"	"00006"	"RS1_000126"	"g.18662573T>A"	""	"{PMID:Tsai 2000:11058916}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644453T>A"	""	"pathogenic"	""
"0000141203"	"20"	"90"	"X"	"18662571"	"18662571"	"subst"	"0"	"00006"	"RS1_000149"	"g.18662571C>G"	""	"{PMID:Sato 2003:12920343}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644451C>G"	""	"pathogenic"	""
"0000141204"	"20"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Zeng 2007:17852193}"	"MspI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic"	""
"0000141205"	"20"	"90"	"X"	"18662549"	"18662549"	"subst"	"0"	"00006"	"RS1_000148"	"g.18662549C>T"	""	"{PMID:Sato 2003:12920343}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644429C>T"	""	"pathogenic"	""
"0000141206"	"20"	"90"	"X"	"18662549"	"18662549"	"subst"	"0"	"00006"	"RS1_000064"	"g.18662549C>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-NciI, +MseI"	""	""	"Germline"	""	""	"0"	""	""	"g.18644429C>A"	""	"pathogenic"	""
"0000141207"	"20"	"90"	"X"	"18662545"	"18662545"	"subst"	"4.48619E-5"	"00006"	"RS1_000116"	"g.18662545C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"+Sse9I"	""	""	"Germline"	""	""	"0"	""	""	"g.18644425C>T"	""	"pathogenic"	""
"0000141208"	"20"	"90"	"X"	"18660278"	"18660278"	"subst"	"0"	"00006"	"RS1_000065"	"g.18660278T>C"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-BfaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642158T>C"	""	"pathogenic"	""
"0000141209"	"20"	"90"	"X"	"18660272"	"18660272"	"subst"	"0"	"00006"	"RS1_000140"	"g.18660272A>G"	""	"{PMID:Hewitt 2005:15932525}"	"+BsaI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642152A>G"	""	"pathogenic"	""
"0000141210"	"20"	"90"	"X"	"18660266"	"18660266"	"subst"	"0"	"00006"	"RS1_000066"	"g.18660266C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642146C>T"	""	"pathogenic"	""
"0000141211"	"1"	"90"	"X"	"18660266"	"18660266"	"subst"	"0"	"00006"	"RS1_000066"	"g.18660266C>T"	""	"{PMID:Curat 2001:11598108}"	""	""	"Dd.DDR1:Gly143Asp; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642146C>T"	""	"NA"	""
"0000141212"	"20"	"90"	"X"	"18660266"	"18660266"	"subst"	"0"	"00006"	"RS1_000066"	"g.18660266C>T"	""	"{PMID:Simonelli 2003:12928282}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642146C>T"	""	"pathogenic"	""
"0000141213"	"21"	"90"	"X"	"18660264"	"18660264"	"subst"	"0"	"00006"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Tuvdendorj 2002:12055472}"	"HinfI+"	""	""	"Germline"	""	""	"0"	""	""	"g.18642144T>C"	""	"pathogenic"	""
"0000141214"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141215"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Inoue 2000:10636421}"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141216"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Mashima 1999:10220153}"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141217"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141218"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141219"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-AvaII, +BsgI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141220"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Zeng 2007:17852193}"	"RsrII-"	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000141221"	"20"	"90"	"X"	"18660250"	"18660251"	"dup"	"0"	"00006"	"RS1_000117"	"g.18660250_18660251dup"	""	"{PMID:Hiriyanna 1999:10533068}"	"+BslI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642130_18642131dup"	""	"pathogenic"	""
"0000141222"	"20"	"90"	"X"	"18660245"	"18660245"	"subst"	"0"	"00006"	"RS1_000098"	"g.18660245G>T"	""	"{PMID:Huopaniemi 1999:10234514}"	"+DsaI, -StyI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642125G>T"	""	"pathogenic"	""
"0000141223"	"20"	"90"	"X"	"18660240"	"18660240"	"subst"	"0"	"00006"	"RS1_000193"	"g.18660240G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642120G>A"	""	"pathogenic"	""
"0000141224"	"20"	"90"	"X"	"18660227"	"18660227"	"del"	"0"	"00006"	"RS1_000141"	"g.18660227del"	""	"{PMID:Hewitt 2005:15932525}"	"-HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642107del"	""	"pathogenic"	""
"0000141225"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000150"	"g.18660225G>T"	""	"{PMID:Tanimoto 2002:12457918}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>T"	""	"pathogenic"	""
"0000141226"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000143"	"g.18660225G>C"	""	"{PMID:Pimenides 2005:15937075}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>C"	""	"pathogenic"	""
"0000141227"	"0"	"50"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	""	""	""	""	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"VUS"	""
"0000141228"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Sauer 1997:9326935}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141229"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Inoue 2000:10636421}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141230"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141231"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Hiriyanna 1999:10533068}, {PMID:Eksandh 2000:10922205}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141232"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141233"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141234"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141235"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141236"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141237"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141238"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00221"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141239"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141240"	"21"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00156"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Lesch 2008:19093009}"	"+AvaII, HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141241"	"21"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00156"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Lesch 2008:19093009}"	"+AvaII, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141242"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Suganthalakshmi 2007:17515881}"	"+AvaII, -HaeIII"	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141243"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141244"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic"	""
"0000141245"	"0"	"50"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000068"	"g.18660224G>C"	""	""	""	""	""	"Germline"	""	"rs61753175"	"0"	""	""	"g.18642104G>C"	""	"VUS"	""
"0000141246"	"20"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000068"	"g.18660224G>C"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"+CfoI, -HaeIII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642104G>C"	""	"pathogenic"	""
"0000141247"	"20"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00156"	"RS1_000159"	"g.18660224G>A"	""	"{PMID:Lesch 2008:19093009}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642104G>A"	""	"pathogenic"	""
"0000141248"	"20"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000159"	"g.18660224G>A"	""	"{PMID:Riveiro-Alvarez 2007:17879437}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.210"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642104G>A"	""	"pathogenic"	""
"0000141249"	"21"	"10"	"X"	"18660223"	"18660223"	"subst"	"0.000835956"	"00006"	"RS1_000166"	"g.18660223G>A"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	"Pro192Pro"	""	"Germline"	""	""	"0"	""	""	"g.18642103G>A"	""	"benign"	""
"0000141250"	"0"	"10"	"X"	"18660223"	"18660223"	"subst"	"0.000835956"	"00006"	"RS1_000166"	"g.18660223G>A"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	"Pro192Pro"	""	"Germline"	""	""	"0"	""	""	"g.18642103G>A"	""	"benign"	""
"0000141251"	"20"	"90"	"X"	"18660222"	"18660223"	"ins"	"0"	"00006"	"RS1_000194"	"g.18660222_18660223insA"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"NlaIV-;MnlI+"	""	""	"Germline"	""	""	"0"	""	""	"g.18642102_18642103insA"	""	"pathogenic"	""
"0000141252"	"20"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"Duval (1999) Hum.Mut. 13:259 (MPR #39)"	"-NlaIV"	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"pathogenic"	""
"0000141253"	"20"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Nakamura 2001:11594966}"	"-NlaIV"	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"pathogenic"	""
"0000141254"	"20"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Chan 2004:15281981}"	"-NlaIV"	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"pathogenic"	""
"0000141255"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141256"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Sauer 1997:9326935}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141257"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Gehrig 1999:10450864}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141258"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Hotta 1998:09760195}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141259"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Hotta 1998:09760195}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141260"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141261"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141262"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Pimenides 2005:15937075}"	"+AvaII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	""
"0000141263"	"1"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Curat 2001:11598108}"	"+AvaII"	""	"Dd.DDR1:Pro158Leu; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642101G>A"	""	"NA"	""
"0000141264"	"1"	"90"	"X"	"18660225"	"18660225"	"del"	"0"	"00238"	"RS1_000205"	"g.18660225del"	""	""	""	""	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18642105del"	""	"pathogenic"	""
"0000141265"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141266"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Gehrig 1999:10450864}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141267"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00221"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Pimenides 2005:15937075}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141268"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00221"	"RS1_000070"	"g.18660225dup"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141269"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141270"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Tsang 2007:17296904}"	"-BbvI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141271"	"3"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Ali 2003:14516833}, {PMID:Saleheen 2008:18982040}"	""	"588-593incC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141272"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"-BbvI"	"578_579insC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141273"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"-BbvI"	"578_579insC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141274"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Riveiro 2005:16521246}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"-BbvI"	"578_579insC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141275"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Ali 2003:14516833}, {PMID:Saleheen 2008:18982040}"	""	"588-593incC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141276"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Lesch 2008:19093009}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000141277"	"20"	"90"	"X"	"18660218"	"18660218"	"subst"	"0"	"00006"	"RS1_000195"	"g.18660218A>T"	""	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642098A>T"	""	"pathogenic"	""
"0000141278"	"20"	"90"	"X"	"18660216"	"18660216"	"subst"	"1.1217E-5"	"00006"	"RS1_000167"	"g.18660216T>C"	""	"{PMID:Suganthalakshmi 2007:17515881}"	""	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642096T>C"	""	"pathogenic"	""
"0000141279"	"1"	"90"	"X"	"18660218"	"18660220"	"dup"	"0"	"00238"	"RS1_000206"	"g.18660218_18660220dup"	""	""	""	"580_582dupATC"	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18642098_18642100dup"	""	"pathogenic"	""
"0000141280"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000175"	"g.18660210G>T"	""	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2008:18465145}, {PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>T"	""	"pathogenic"	""
"0000141281"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141282"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141283"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141284"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00221"	"RS1_000071"	"g.18660210G>A"	""	""	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141285"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141286"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Shastry 1999:10079181}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141287"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141288"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2008:20960647}, {PMID:Riveiro-Alvarez 2009:19324861}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	""
"0000141289"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00221"	"RS1_000072"	"g.18660209C>T"	""	""	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	""
"0000141290"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	""
"0000141291"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00221"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	""
"0000141292"	"21"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	""
"0000141293"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"0"	"00006"	"RS1_000121"	"g.18660209C>G"	""	"{PMID:Inoue 2000:10636421}"	"-MwoI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>G"	""	"pathogenic"	""
"0000141294"	"20"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00221"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Pimenides 2005:15937075}"	"+HphI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic"	""
"0000141295"	"20"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00221"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"+HphI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic"	""
"0000141296"	"20"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"+HphI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic"	""
"0000141297"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000196"	"g.18660201G>T"	""	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>T"	""	"pathogenic"	""
"0000141298"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Gehrig 1999:10450864}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141299"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141300"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Inoue 2000:10636421}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141301"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Hotta:11225572}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141302"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141303"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00221"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141304"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Hiriyanna 1999:10533068}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141305"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141306"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Hewitt 2005:15932525}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141307"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Pimenides 2005:15937075}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141308"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Pimenides 2005:15937075}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141309"	"21"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141310"	"11"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141311"	"1"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141312"	"1"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141313"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Gerth 2008:18541843}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141314"	"21"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Zeng 2007:17852193}"	"EciI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141315"	"21"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	""
"0000141316"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Hiriyanna 1999:10533068}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141317"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141318"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00221"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141319"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141320"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141321"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Lledo 2008:18549702}"	""	""	"pre-implantation genetic diagnosis"	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141322"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Lledo 2008:18549702}"	""	""	"pre-implantation genetic diagnosis"	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000141323"	"1"	"50"	"X"	"18660193"	"18660193"	"subst"	"0"	"00006"	"RS1_000076"	"g.18660193G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-FokI"	""	"remark"	"Germline"	""	""	"0"	""	""	"g.18642073G>A"	""	"VUS"	""
"0000141324"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Huopaniemi 1999:10234514}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141325"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141326"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Gehrig:10636740}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141327"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141328"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141329"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Teixeira 2005:16167295}"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141330"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Suganthalakshmi 2007:17515881}"	"-MspA1I"	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141331"	"1"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Curat 2001:11598108}"	"-MspA1I"	""	"Dd.DDR1:Pro168Leu; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642071G>A"	""	"NA"	""
"0000141332"	"21"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"Riveiro-Alvarez ESHG2008 P05.213"	"-MspA1I"	""	""	"De novo"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141333"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"Riveiro-Alvarez ESHG2008 P05.213"	"-MspA1I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141334"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Gerth 2008:18541843}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141335"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Gerth 2008:18541843}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	""
"0000141336"	"21"	"90"	"X"	"18660182"	"18660182"	"subst"	"0"	"00006"	"RS1_000168"	"g.18660182C>T"	""	"{PMID:Suganthalakshmi 2007:17515881}"	""	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642062C>T"	""	"pathogenic"	""
"0000141337"	"20"	"90"	"X"	"18660181"	"18660181"	"subst"	"0"	"00006"	"RS1_000078"	"g.18660181C>T"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"+AflIII, -FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642061C>T"	""	"pathogenic"	""
"0000141338"	"20"	"90"	"X"	"18660181"	"18660181"	"subst"	"0"	"00006"	"RS1_000197"	"g.18660181C>G"	""	"{PMID:Shukla 2007:17631851}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642061C>G"	""	"pathogenic"	""
"0000141339"	"20"	"90"	"X"	"18660180"	"18660180"	"subst"	"0"	"00006"	"RS1_000176"	"g.18660180G>C"	""	"Riveiro-Alvarez ESHG2008 P05.210;{PMID:Riveiro-Alvarez 2008:18465145}, {PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642060G>C"	""	"pathogenic"	""
"0000141340"	"20"	"90"	"X"	"18660178"	"18660178"	"subst"	"0"	"00006"	"RS1_000079"	"g.18660178G>C"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	"-MaeII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642058G>C"	""	"pathogenic"	""
"0000141341"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000099"	"g.18660174G>C"	""	"{PMID:Huopaniemi 1999:10234514}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>C"	""	"pathogenic"	""
"0000141342"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141343"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Eksandh 2005:16272055}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141344"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hewitt 2005:15932525}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141345"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hayashi 2004:15531314}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141346"	"21"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00156"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Lesch 2008:19093009}"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141347"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-AciI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	""
"0000141348"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Sauer 1997:9326935}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141349"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141350"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141351"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141352"	"21"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141353"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141354"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141355"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	""
"0000141356"	"21"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00222"	"RS1_000178"	"g.18660173C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>A"	""	"pathogenic"	""
"0000141357"	"20"	"90"	"X"	"18660168"	"18660168"	"subst"	"0"	"00006"	"RS1_000151"	"g.18660168C>T"	""	"{PMID:Inoue 2002:12383832}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642048C>T"	""	"pathogenic"	""
"0000141358"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998; group 5:9618178}, {PMID:Renner 2008:17987333}"	"-MspI"	""	""	"De novo"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141359"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"-MspI"	""	""	"De novo"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141360"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00221"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141361"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00221"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141362"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00221"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141363"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998; group 3:9618178}, {PMID:Sieving:10458173}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141364"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141365"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Suganthalakshmi 2007:17515881}"	"-MspI"	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141366"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Suganthalakshmi 2007:17515881}"	"-MspI"	""	"not in 100 controls"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141367"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141368"	"1"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wang 2002:12417531}"	"-MspI"	""	"expression construct in pcDNA3.1, COS-7 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642042G>A"	""	"NA"	""
"0000141369"	"1"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Curat 2001:11598108}"	""	""	"Dd.DDR1:Arg179Trp; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642042G>A"	""	"NA"	""
"0000141370"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141371"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141372"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141373"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Xu 2010:20806044}"	"MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141374"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Atchaneeyasakul 2010:20151283}"	"-MspI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000141375"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Hotta 1998:09760195}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141376"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"Ayuso ICHG2001 P1487;{PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141377"	"21"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141378"	"21"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141379"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-FokI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141380"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Renner 2008:17987333}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141381"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Gerth 2008:18541843}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000141382"	"20"	"90"	"X"	"18660161"	"18660161"	"del"	"0"	"00006"	"RS1_000100"	"g.18660161del"	""	"{PMID:Mendoza-Lodono 1999:10415464}, {PMID:Rodriguez 2005:15655444}"	"-AccI, +BslI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041del"	""	"pathogenic"	""
"0000141383"	"3"	"90"	"X"	"18660161"	"18660161"	"del"	"0"	"00006"	"RS1_000100"	"g.18660161del"	""	"{PMID:Rodriguez 2005:15655444}"	"-AccI, +BslI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642041del"	""	"pathogenic"	""
"0000141384"	"20"	"90"	"X"	"18660156"	"18660156"	"subst"	"0"	"00006"	"RS1_000105"	"g.18660156C>T"	""	"{PMID:Gehrig 1999:10450864}"	"-BstXI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642036C>T"	""	"pathogenic"	""
"0000141385"	"20"	"90"	"X"	"18660156"	"18660156"	"subst"	"0"	"00006"	"RS1_000082"	"g.18660156C>G"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	"-BstXI, +PvuII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642036C>G"	""	"pathogenic"	""
"0000141386"	"20"	"90"	"X"	"18660156"	"18660156"	"subst"	"0"	"00006"	"RS1_000082"	"g.18660156C>G"	""	"Ayuso ICHG2001 P1487;{PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	"-BstXI, +PvuII"	""	""	"Germline"	""	""	"0"	""	""	"g.18642036C>G"	""	"pathogenic"	""
"0000141387"	"1"	"90"	"X"	"18660156"	"18660156"	"subst"	"0"	"00006"	"RS1_000082"	"g.18660156C>G"	""	"{PMID:Curat 2001:11598108}"	"-BstXI, +PvuII"	""	"Dd.DDR1:Glu181Gln; expression construct in pET30, 293 cell expression"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642036C>G"	""	"NA"	""
"0000141388"	"21"	"90"	"X"	"18660155"	"18660155"	"subst"	"0"	"00006"	"RS1_000177"	"g.18660155T>A"	""	"{PMID:Riveiro 2005:16521244}, {PMID:Riveiro-Alvarez 2009:19324861};Riveiro-Alvarez ESHG2008 P05.213"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642035T>A"	""	"pathogenic"	""
"0000141389"	"20"	"90"	"X"	"18660155"	"18660155"	"subst"	"0"	"00006"	"RS1_000177"	"g.18660155T>A"	""	"{PMID:Zeng 2007:17852193}"	"AluI-"	""	""	"Germline"	""	""	"0"	""	""	"g.18642035T>A"	""	"pathogenic"	""
"0000141390"	"21"	"90"	"X"	"18660155"	"18660155"	"subst"	"0"	"00006"	"RS1_000177"	"g.18660155T>A"	""	"{PMID:Riveiro-Alvarez 2009:19324861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642035T>A"	""	"pathogenic"	""
"0000141391"	"20"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-Alu"	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic"	""
"0000141392"	"20"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Kim 2009:19390641};Kim, ASHG2007 P1124"	"-Alu"	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic"	""
"0000141393"	"20"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"Riveiro-Alvarez ESHG2008 P05.213;{PMID:Riveiro-Alvarez 2009:19324861}"	"-Alu"	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic"	""
"0000141394"	"20"	"90"	"X"	"18660144"	"18660144"	"del"	"0"	"00006"	"RS1_000087"	"g.18660144del"	""	"{PMID:RS-consortium 1998, group 1:9618178}"	"-BbvI, +MnlI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642024del"	""	"pathogenic"	""
"0000141395"	"20"	"90"	"X"	"18660144"	"18660144"	"subst"	"0"	"00006"	"RS1_000085"	"g.18660144A>G"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	"+HhaI"	""	""	"De novo"	""	""	"0"	""	""	"g.18642024A>G"	""	"pathogenic"	""
"0000141396"	"20"	"90"	"X"	"18660144"	"18660144"	"subst"	"5.60821E-6"	"00221"	"RS1_000086"	"g.18660144A>C"	""	"{PMID:RS-consortium 1998; group 6:9618178}, {PMID:Pimenides 2005:15937075}"	"+BsaHI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642024A>C"	""	"pathogenic"	""
"0000141397"	"20"	"90"	"X"	"18660120"	"18660144"	"del"	"0"	"00006"	"RS1_000084"	"g.18660120_18660144del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"655–679del"	""	"Germline"	""	""	"0"	""	""	"g.18642000_18642024del"	""	"pathogenic"	""
"0000141398"	"1"	"90"	"X"	"18660136"	"18660136"	"dup"	"0"	"00238"	"RS1_000204"	"g.18660136dup"	""	""	""	""	"not in 50 control samples"	"Unknown"	""	""	"0"	""	""	"g.18642016dup"	""	"pathogenic"	""
"0000141399"	"1"	"50"	"X"	"18660133"	"18660133"	"subst"	"0"	"00006"	"RS1_000088"	"g.18660133C>G"	""	"{PMID:Sauer 1997:9326935}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642013C>G"	""	"VUS"	""
"0000141400"	"20"	"90"	"X"	"18660132"	"18660132"	"subst"	"0"	"00006"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Weinberg 2001:11709029}"	"+Cac8I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642012A>G"	""	"pathogenic"	""
"0000141401"	"20"	"90"	"X"	"18660132"	"18660132"	"subst"	"0"	"00006"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Hiriyanna 1999:10533068}"	"+Cac8I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642012A>G"	""	"pathogenic"	""
"0000141402"	"21"	"90"	"X"	"18660132"	"18660132"	"subst"	"0"	"00006"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Li 2007:17615541}, {PMID:Ma 2008:18369700}"	"+Cac8I"	""	""	"Germline"	""	""	"0"	""	""	"g.18642012A>G"	""	"pathogenic"	""
"0000141403"	"20"	"10"	"X"	"18660121"	"18660121"	"subst"	"5.62408E-6"	"00006"	"RS1_000089"	"g.18660121G>A"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	"-SanfI"	""	""	"Germline"	""	""	"0"	""	""	"g.18642001G>A"	""	"benign"	""
"0000141404"	"0"	"50"	"X"	"18659183"	"18659183"	"subst"	"0"	"00006"	"RS1_000156"	"g.18659183C>T"	"<0.01"	""	""	""	""	"Germline"	""	"rs3810667"	"0"	""	""	"g.18641063C>T"	""	"VUS"	""
"0000222143"	"1"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"Kucinskas, ASHG2017, P1110"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000222144"	"1"	"90"	"X"	"18674864"	"18674864"	"dup"	"0"	"00006"	"RS1_000211"	"g.18674864dup"	""	"Kucinskas, ASHG2017, P1110"	""	"92_96insC"	""	"Germline"	""	""	"0"	""	""	"g.18656744dup"	""	"pathogenic"	""
"0000222145"	"1"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000212"	"g.18660200C>A"	""	"Kucinskas, ASHG2017, P1110"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>A"	""	"pathogenic"	""
"0000251144"	"0"	"10"	"X"	"18638082"	"18638082"	"subst"	"0.0313058"	"02326"	"CDKL5_000002"	"g.18638082A>C"	""	""	""	"CDKL5(NM_003159.2):c.2372A>C (p.Q791P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18619962A>C"	""	"benign"	""
"0000251671"	"0"	"10"	"X"	"18528854"	"18528854"	"subst"	"0"	"02326"	"CDKL5_000092"	"g.18528854A>G"	""	""	""	"CDKL5(NM_001037343.1):c.65-86A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18510734A>G"	""	"benign"	""
"0000251672"	"0"	"10"	"X"	"18597865"	"18597865"	"del"	"0"	"02326"	"CDKL5_000097"	"g.18597865del"	""	""	""	"CDKL5(NM_001037343.1):c.283-103delA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18579745del"	""	"benign"	""
"0000251673"	"0"	"10"	"X"	"18613320"	"18613320"	"del"	"0"	"02326"	"CDKL5_000104"	"g.18613320del"	""	""	""	"CDKL5(NM_001037343.1):c.745-148delA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18595200del"	""	"benign"	""
"0000251983"	"0"	"30"	"X"	"18616642"	"18616642"	"subst"	"3.91918E-5"	"02326"	"CDKL5_000107"	"g.18616642A>G"	""	""	""	"CDKL5(NM_003159.2):c.886A>G (p.T296A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18598522A>G"	""	"likely benign"	""
"0000252352"	"0"	"30"	"X"	"18593629"	"18593629"	"subst"	"2.81229E-5"	"02326"	"CDKL5_000132"	"g.18593629A>G"	""	""	""	"CDKL5(NM_001037343.1):c.282+19A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18575509A>G"	""	"likely benign"	""
"0000252353"	"0"	"30"	"X"	"18643383"	"18643383"	"subst"	"1.69104E-5"	"02326"	"CDKL5_000120"	"g.18643383A>G"	""	""	""	"CDKL5(NM_003159.2):c.2496+16A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18625263A>G"	""	"likely benign"	""
"0000255501"	"0"	"90"	"X"	"18622758"	"18622758"	"subst"	"0"	"01943"	"CDKL5_000116"	"g.18622758A>T"	""	""	""	"CDKL5(NM_003159.2):c.1714A>T (p.K572*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604638A>T"	""	"pathogenic"	""
"0000256167"	"0"	"50"	"X"	"18622075"	"18622075"	"subst"	"0"	"01943"	"CDKL5_000108"	"g.18622075A>G"	""	""	""	"CDKL5(NM_003159.2):c.1031A>G (p.K344R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18603955A>G"	""	"VUS"	""
"0000264494"	"0"	"90"	"X"	"18660225"	"18660225"	"del"	"0"	"02330"	"RS1_000205"	"g.18660225del"	""	""	""	"CDKL5(NM_003159.3):c.2714-3902delG, RS1(NM_000330.4):c.579delC (p.I194Sfs*43)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18642105del"	""	"pathogenic"	""
"0000264495"	"0"	"10"	"X"	"18665379"	"18665379"	"subst"	"0.00164457"	"02330"	"RS1_000215"	"g.18665379C>T"	""	""	""	"CDKL5(NM_003159.3):c.2797+1169C>T, RS1(NM_000330.4):c.258G>A (p.P86=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18647259C>T"	""	"benign"	""
"0000266614"	"0"	"30"	"X"	"18582590"	"18582590"	"subst"	"2.84714E-5"	"02325"	"CDKL5_000093"	"g.18582590C>T"	""	""	""	"CDKL5(NM_001037343.1):c.100-7C>T, CDKL5(NM_003159.3):c.100-7C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18564470C>T"	""	"likely benign"	""
"0000266615"	"0"	"90"	"X"	"18622719"	"18622719"	"subst"	"0"	"02325"	"CDKL5_000030"	"g.18622719C>T"	""	""	""	"CDKL5(NM_003159.3):c.1675C>T (p.R559*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604599C>T"	""	"pathogenic"	""
"0000266616"	"0"	"30"	"X"	"18671574"	"18671574"	"subst"	"0.00422294"	"02325"	"CDKL5_000004"	"g.18671574C>T"	""	""	""	"CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653454C>T"	""	"likely benign"	""
"0000266617"	"0"	"30"	"X"	"18671655"	"18671655"	"subst"	"0.00414692"	"02325"	"CDKL5_000005"	"g.18671655G>A"	""	""	""	"CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653535G>A"	""	"likely benign"	""
"0000266618"	"0"	"90"	"X"	"18598089"	"18598089"	"subst"	"0"	"02325"	"CDKL5_000098"	"g.18598089G>T"	""	""	""	"CDKL5(NM_003159.3):c.403+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18579969G>T"	""	"pathogenic"	""
"0000269908"	"0"	"10"	"X"	"18525050"	"18525050"	"subst"	"0"	"02326"	"CDKL5_000091"	"g.18525050T>C"	""	""	""	"CDKL5(NM_001037343.1):c.-162-5T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18506930T>C"	""	"benign"	""
"0000269909"	"0"	"30"	"X"	"18582590"	"18582590"	"subst"	"2.84714E-5"	"02326"	"CDKL5_000093"	"g.18582590C>T"	""	""	""	"CDKL5(NM_001037343.1):c.100-7C>T, CDKL5(NM_003159.3):c.100-7C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18564470C>T"	""	"likely benign"	""
"0000269910"	"0"	"10"	"X"	"18622374"	"18622374"	"subst"	"0.000173596"	"02326"	"CDKL5_000110"	"g.18622374C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604254C>T"	""	"benign"	""
"0000269911"	"0"	"30"	"X"	"18622376"	"18622376"	"subst"	"0.000515178"	"02326"	"CDKL5_000112"	"g.18622376C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1332C>T (p.R444=), CDKL5(NM_001323289.1):c.1332C>T (p.R444=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604256C>T"	""	"likely benign"	""
"0000269913"	"0"	"30"	"X"	"18622657"	"18622657"	"subst"	"5.5997E-6"	"02326"	"CDKL5_000115"	"g.18622657C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1613C>T (p.T538M), CDKL5(NM_003159.2):c.1613C>T (p.T538M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604537C>T"	""	"likely benign"	""
"0000269914"	"0"	"10"	"X"	"18646594"	"18646594"	"subst"	"0"	"02326"	"CDKL5_000121"	"g.18646594C>A"	""	""	""	"CDKL5(NM_001037343.1):c.2600C>A (p.T867N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18628474C>A"	""	"benign"	""
"0000269915"	"0"	"10"	"X"	"18664282"	"18664282"	"del"	"0"	"02326"	"RS1_000214"	"g.18664282del"	""	""	""	"CDKL5(NM_001037343.1):c.2797+72delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18646162del"	""	"benign"	""
"0000269916"	"0"	"10"	"X"	"18668587"	"18668587"	"subst"	"0"	"02326"	"RS1_000216"	"g.18668587G>A"	""	""	""	"CDKL5(NM_003159.2):c.2855G>A (p.R952Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18650467G>A"	""	"benign"	""
"0000269917"	"0"	"10"	"X"	"18671566"	"18671566"	"subst"	"0.00823338"	"02326"	"RS1_000217"	"g.18671566G>A"	""	""	""	"CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653446G>A"	""	"benign"	""
"0000269918"	"0"	"10"	"X"	"18671574"	"18671574"	"subst"	"0.00422294"	"02326"	"CDKL5_000004"	"g.18671574C>T"	""	""	""	"CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653454C>T"	""	"benign"	""
"0000269919"	"0"	"10"	"X"	"18671655"	"18671655"	"subst"	"0.00414692"	"02326"	"CDKL5_000005"	"g.18671655G>A"	""	""	""	"CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653535G>A"	""	"benign"	""
"0000269920"	"0"	"10"	"X"	"18599995"	"18599995"	"del"	"0"	"02326"	"CDKL5_000099"	"g.18599995del"	""	""	""	"CDKL5(NM_001037343.1):c.404-16delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18581875del"	""	"benign"	""
"0000269921"	"0"	"90"	"X"	"18602433"	"18602433"	"subst"	"0"	"02326"	"CDKL5_000100"	"g.18602433G>T"	""	""	""	"CDKL5(NM_001037343.1):c.514G>T (p.V172F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584313G>T"	""	"pathogenic"	""
"0000269922"	"0"	"70"	"X"	"18602452"	"18602452"	"subst"	"0"	"02326"	"CDKL5_000101"	"g.18602452G>A"	""	""	""	"CDKL5(NM_001037343.1):c.533G>A (p.R178Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584332G>A"	""	"likely pathogenic"	""
"0000269923"	"0"	"90"	"X"	"18602452"	"18602452"	"subst"	"0"	"02326"	"CDKL5_000020"	"g.18602452G>C"	""	""	""	"CDKL5(NM_001037343.1):c.533G>C (p.R178P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584332G>C"	""	"pathogenic"	""
"0000269924"	"0"	"10"	"X"	"18606055"	"18606055"	"subst"	"0.0322602"	"02326"	"CDKL5_000021"	"g.18606055C>G"	""	""	""	"CDKL5(NM_003159.2):c.555-19C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18587935C>G"	""	"benign"	""
"0000269925"	"0"	"90"	"X"	"18606106"	"18606106"	"subst"	"0"	"02326"	"CDKL5_000102"	"g.18606106C>T"	""	""	""	"CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18587986C>T"	""	"pathogenic"	""
"0000269926"	"0"	"30"	"X"	"18606122"	"18606122"	"subst"	"1.68002E-5"	"02326"	"CDKL5_000103"	"g.18606122T>C"	""	""	""	"CDKL5(NM_001037343.1):c.603T>C (p.L201=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18588002T>C"	""	"likely benign"	""
"0000269927"	"0"	"10"	"X"	"18616447"	"18616447"	"del"	"0"	"02326"	"CDKL5_000106"	"g.18616447del"	""	""	""	"CDKL5(NM_001037343.1):c.826-135delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18598327del"	""	"benign"	""
"0000273057"	"0"	"10"	"X"	"18582669"	"18582670"	"del"	"0"	"01943"	"CDKL5_000059"	"g.18582669_18582670del"	""	""	""	"CDKL5(NM_003159.2):c.145+27_145+28delAT, CDKL5(NM_003159.3):c.145+27_145+28delAT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18564549_18564550del"	""	"benign"	""
"0000273058"	"0"	"10"	"X"	"18622657"	"18622657"	"subst"	"5.5997E-6"	"01943"	"CDKL5_000115"	"g.18622657C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1613C>T (p.T538M), CDKL5(NM_003159.2):c.1613C>T (p.T538M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604537C>T"	""	"benign"	""
"0000273059"	"0"	"90"	"X"	"18626930"	"18626930"	"subst"	"0"	"01943"	"CDKL5_000118"	"g.18626930G>T"	""	""	""	"CDKL5(NM_003159.2):c.1945-1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18608810G>T"	""	"pathogenic"	""
"0000273060"	"0"	"30"	"X"	"18646607"	"18646607"	"subst"	"0"	"01943"	"CDKL5_000122"	"g.18646607C>T"	""	""	""	"CDKL5(NM_001323289.1):c.2613C>T (p.F871=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18628487C>T"	""	"likely benign"	""
"0000273061"	"0"	"10"	"X"	"18671566"	"18671566"	"subst"	"0.00823338"	"01943"	"RS1_000217"	"g.18671566G>A"	""	""	""	"CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653446G>A"	""	"benign"	""
"0000273062"	"0"	"30"	"X"	"18671655"	"18671655"	"subst"	"0.00414692"	"01943"	"CDKL5_000005"	"g.18671655G>A"	""	""	""	"CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653535G>A"	""	"likely benign"	""
"0000273063"	"0"	"10"	"X"	"18606055"	"18606055"	"subst"	"0.0322602"	"01943"	"CDKL5_000021"	"g.18606055C>G"	""	""	""	"CDKL5(NM_003159.2):c.555-19C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18587935C>G"	""	"benign"	""
"0000307382"	"0"	"10"	"X"	"18660251"	"18660251"	"subst"	"0.00194966"	"01943"	"RS1_000213"	"g.18660251G>A"	""	""	""	"CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18642131G>A"	""	"benign"	""
"0000333319"	"0"	"50"	"X"	"18593567"	"18593567"	"subst"	"5.60853E-6"	"01804"	"CDKL5_000096"	"g.18593567G>T"	""	""	""	"CDKL5(NM_001037343.1):c.239G>T (p.(Arg80Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18575447G>T"	""	"VUS"	""
"0000333320"	"0"	"50"	"X"	"18622291"	"18622292"	"del"	"0"	"01804"	"CDKL5_000109"	"g.18622291_18622292del"	""	""	""	"CDKL5(NM_003159.2):c.1245_1246del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604171_18604172del"	""	"VUS"	""
"0000333321"	"0"	"50"	"X"	"18622375"	"18622375"	"subst"	"5.60114E-6"	"01804"	"CDKL5_000111"	"g.18622375G>A"	""	""	""	"CDKL5(NM_001037343.1):c.1331G>A (p.(Arg444His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604255G>A"	""	"VUS"	""
"0000333322"	"0"	"50"	"X"	"18622383"	"18622383"	"subst"	"5.60077E-6"	"01804"	"CDKL5_000113"	"g.18622383T>C"	""	""	""	"CDKL5(NM_001037343.1):c.1339T>C (p.(Phe447Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604263T>C"	""	"VUS"	""
"0000333323"	"0"	"50"	"X"	"18622430"	"18622430"	"subst"	"1.12313E-5"	"01804"	"CDKL5_000114"	"g.18622430A>C"	""	""	""	"CDKL5(NM_001037343.1):c.1386A>C (p.(Glu462Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604310A>C"	""	"VUS"	""
"0000333326"	"0"	"50"	"X"	"18646629"	"18646630"	"del"	"0"	"01804"	"CDKL5_000058"	"g.18646629_18646630del"	""	""	""	"CDKL5(NM_001037343.1):c.2635_2636del (p.(Leu879GlufsTer30))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18628509_18628510del"	""	"VUS"	""
"0000333328"	"0"	"30"	"X"	"18690182"	"18690182"	"subst"	"0.00181198"	"01804"	"RS1_000219"	"g.18690182G>C"	""	""	""	"RS1(NM_000330.3):c.7C>G (p.(Arg3Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18672062G>C"	""	"likely benign"	""
"0000337397"	"0"	"90"	"X"	"18602474"	"18602474"	"subst"	"0"	"02327"	"CDKL5_000127"	"g.18602474G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584354G>A"	""	"pathogenic"	""
"0000342908"	"0"	"10"	"X"	"18622374"	"18622374"	"subst"	"0.000173596"	"02327"	"CDKL5_000110"	"g.18622374C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604254C>T"	""	"benign"	""
"0000343547"	"0"	"90"	"X"	"18602452"	"18602452"	"subst"	"0"	"02327"	"CDKL5_000101"	"g.18602452G>A"	""	""	""	"CDKL5(NM_001037343.1):c.533G>A (p.R178Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584332G>A"	""	"pathogenic"	""
"0000343905"	"0"	"90"	"X"	"18598074"	"18598074"	"subst"	"0"	"02327"	"CDKL5_000125"	"g.18598074A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18579954A>T"	""	"pathogenic"	""
"0000344551"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"02327"	"RS1_000222"	"g.18662656del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic"	""
"0000344974"	"0"	"10"	"X"	"18638082"	"18638082"	"subst"	"0.0313058"	"02327"	"CDKL5_000002"	"g.18638082A>C"	""	""	""	"CDKL5(NM_003159.2):c.2372A>C (p.Q791P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18619962A>C"	""	"benign"	""
"0000345645"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"02327"	"RS1_000006"	"g.18665312C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic"	""
"0000345858"	"0"	"70"	"X"	"18525275"	"18525275"	"subst"	"0"	"02327"	"CDKL5_000123"	"g.18525275G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18507155G>A"	""	"likely pathogenic"	""
"0000346259"	"0"	"50"	"X"	"18665416"	"18665416"	"subst"	"0"	"02327"	"RS1_000031"	"g.18665416C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18647296C>A"	""	"VUS"	""
"0000346351"	"0"	"10"	"X"	"18671574"	"18671574"	"subst"	"0.00422294"	"02327"	"CDKL5_000004"	"g.18671574C>T"	""	""	""	"CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653454C>T"	""	"benign"	""
"0000347264"	"0"	"50"	"X"	"18622930"	"18622930"	"subst"	"0"	"02327"	"CDKL5_000131"	"g.18622930T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604810T>C"	""	"VUS"	""
"0000348268"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"02327"	"RS1_000220"	"g.18660191G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18642071G>C"	""	"pathogenic"	""
"0000348814"	"0"	"90"	"X"	"18606106"	"18606106"	"subst"	"0"	"02327"	"CDKL5_000102"	"g.18606106C>T"	""	""	""	"CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18587986C>T"	""	"pathogenic"	""
"0000349044"	"0"	"50"	"X"	"18622486"	"18622486"	"subst"	"0"	"02327"	"CDKL5_000129"	"g.18622486C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18604366C>T"	""	"VUS"	""
"0000349239"	"0"	"10"	"X"	"18671655"	"18671655"	"subst"	"0.00414692"	"02327"	"CDKL5_000005"	"g.18671655G>A"	""	""	""	"CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18653535G>A"	""	"benign"	""
"0000350988"	"0"	"90"	"X"	"18593612"	"18593612"	"subst"	"0"	"02327"	"CDKL5_000124"	"g.18593612T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18575492T>G"	""	"pathogenic"	""
"0000350989"	"0"	"90"	"X"	"18602382"	"18602382"	"subst"	"0"	"02327"	"CDKL5_000126"	"g.18602382G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.18584262G>A"	""	"pathogenic"	""
"0000438227"	"20"	"50"	"X"	"18662681"	"18662681"	"subst"	"0"	"00006"	"RS1_000223"	"g.18662681T>C"	""	""	""	""	""	"Germline"	""	""	"1"	""	""	"g.18644561T>C"	""	"VUS"	""
"0000438556"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"01244"	"RS1_000092"	"g.18660161C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	""
"0000441252"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000224"	"g.18662650C>A"	""	"{PMID:Lionel 2018:28771251}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>A"	""	"pathogenic (recessive)"	""
"0000575131"	"0"	"30"	"X"	"18582659"	"18582659"	"subst"	"0"	"02325"	"CDKL5_000012"	"g.18582659A>G"	""	""	""	"CDKL5(NM_003159.2):c.145+17A>G, CDKL5(NM_003159.3):c.145+17A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18564539A>G"	""	"likely benign"	""
"0000575132"	"0"	"10"	"X"	"18582659"	"18582659"	"subst"	"0"	"02326"	"CDKL5_000012"	"g.18582659A>G"	""	""	""	"CDKL5(NM_003159.2):c.145+17A>G, CDKL5(NM_003159.3):c.145+17A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18564539A>G"	""	"benign"	""
"0000575136"	"0"	"30"	"X"	"18582669"	"18582670"	"dup"	"0"	"02326"	"RS1_000226"	"g.18582669_18582670dup"	""	""	""	"CDKL5(NM_001037343.1):c.145+27_145+28dupAT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18564549_18564550dup"	""	"likely benign"	""
"0000575137"	"0"	"50"	"X"	"18593522"	"18593522"	"subst"	"1.68293E-5"	"02325"	"CDKL5_000011"	"g.18593522G>A"	""	""	""	"CDKL5(NM_001323289.2):c.194G>A (p.R65Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18575402G>A"	""	"VUS"	""
"0000575138"	"0"	"90"	"X"	"18593605"	"18593605"	"subst"	"0"	"02329"	"RS1_000227"	"g.18593605G>T"	""	""	""	"CDKL5(NM_003159.3):c.277G>T (p.E93*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18575485G>T"	""	"pathogenic"	""
"0000575139"	"0"	"50"	"X"	"18600043"	"18600043"	"subst"	"0"	"02329"	"RS1_000228"	"g.18600043A>C"	""	""	""	"CDKL5(NM_003159.3):c.436A>C (p.N146H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18581923A>C"	""	"VUS"	""
"0000575140"	"0"	"30"	"X"	"18602374"	"18602374"	"subst"	"8.97067E-5"	"01943"	"RS1_000229"	"g.18602374A>G"	""	""	""	"CDKL5(NM_001323289.1):c.464-9A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18584254A>G"	""	"likely benign"	""
"0000575141"	"0"	"90"	"X"	"18602454"	"18602454"	"subst"	"0"	"02326"	"RS1_000230"	"g.18602454T>A"	""	""	""	"CDKL5(NM_001037343.1):c.535T>A (p.S179T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18584334T>A"	""	"pathogenic"	""
"0000575142"	"0"	"30"	"X"	"18622138"	"18622138"	"subst"	"1.11893E-5"	"02327"	"RS1_000231"	"g.18622138G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604018G>A"	""	"likely benign"	""
"0000575143"	"0"	"30"	"X"	"18622162"	"18622162"	"subst"	"5.595E-6"	"02326"	"RS1_000232"	"g.18622162G>C"	""	""	""	"CDKL5(NM_001037343.1):c.1118G>C (p.G373A), CDKL5(NM_003159.3):c.1118G>C (p.G373A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604042G>C"	""	"likely benign"	""
"0000575144"	"0"	"30"	"X"	"18622179"	"18622179"	"subst"	"0"	"01804"	"RS1_000233"	"g.18622179C>G"	""	""	""	"CDKL5(NM_001037343.1):c.1135C>G (p.(Leu379Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604059C>G"	""	"likely benign"	""
"0000575145"	"0"	"50"	"X"	"18622374"	"18622374"	"subst"	"0.000173596"	"01943"	"CDKL5_000110"	"g.18622374C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604254C>T"	""	"VUS"	""
"0000575146"	"0"	"30"	"X"	"18622374"	"18622374"	"subst"	"0.000173596"	"02325"	"CDKL5_000110"	"g.18622374C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604254C>T"	""	"likely benign"	""
"0000575148"	"0"	"10"	"X"	"18622663"	"18622663"	"subst"	"0"	"01943"	"RS1_000234"	"g.18622663C>G"	""	""	""	"CDKL5(NM_001323289.1):c.1619C>G (p.T540S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604543C>G"	""	"benign"	""
"0000575149"	"0"	"90"	"X"	"18622941"	"18622941"	"subst"	"0"	"02327"	"RS1_000235"	"g.18622941C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604821C>T"	""	"pathogenic"	""
"0000575150"	"0"	"30"	"X"	"18627035"	"18627035"	"subst"	"1.1257E-5"	"01943"	"RS1_000236"	"g.18627035A>G"	""	""	""	"CDKL5(NM_001323289.1):c.2046+3A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18608915A>G"	""	"likely benign"	""
"0000575151"	"0"	"30"	"X"	"18631276"	"18631276"	"subst"	"0.000151824"	"01943"	"RS1_000237"	"g.18631276A>T"	""	""	""	"CDKL5(NM_001323289.1):c.2157A>T (p.P719=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18613156A>T"	""	"likely benign"	""
"0000575152"	"0"	"50"	"X"	"18631355"	"18631355"	"subst"	"0"	"02329"	"RS1_000238"	"g.18631355G>A"	""	""	""	"CDKL5(NM_003159.3):c.2236G>A (p.G746R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18613235G>A"	""	"VUS"	""
"0000575154"	"0"	"10"	"X"	"18646756"	"18646756"	"subst"	"0"	"01943"	"RS1_000240"	"g.18646756C>T"	""	""	""	"CDKL5(NM_001323289.1):c.2762C>T (p.T921I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18628636C>T"	""	"benign"	""
"0000575155"	"0"	"30"	"X"	"18660223"	"18660223"	"subst"	"0.000835956"	"02330"	"RS1_000166"	"g.18660223G>A"	""	""	""	"CDKL5(NM_003159.3):c.2714-3904G>A, RS1(NM_000330.4):c.576C>T (p.P192=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18642103G>A"	""	"likely benign"	""
"0000575156"	"0"	"70"	"X"	"18662644"	"18662644"	"subst"	"0"	"02330"	"RS1_000058"	"g.18662644T>A"	""	""	""	"RS1(NM_000330.4):c.428A>T (p.D143V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18644524T>A"	""	"likely pathogenic"	""
"0000575157"	"0"	"70"	"X"	"18665306"	"18665306"	"subst"	"0"	"02327"	"RS1_000241"	"g.18665306C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18647186C>G"	""	"likely pathogenic"	""
"0000575158"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"02327"	"RS1_000036"	"g.18665332C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000575159"	"0"	"50"	"X"	"18668629"	"18668629"	"subst"	"5.59359E-6"	"01943"	"RS1_000242"	"g.18668629T>C"	""	""	""	"CDKL5(NM_003159.2):c.2897T>C (p.V966A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18650509T>C"	""	"VUS"	""
"0000575160"	"0"	"10"	"X"	"18671566"	"18671566"	"subst"	"0.00823338"	"01804"	"RS1_000217"	"g.18671566G>A"	""	""	""	"CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18653446G>A"	""	"benign"	""
"0000575161"	"0"	"50"	"X"	"18690134"	"18690134"	"subst"	"0"	"02327"	"RS1_000243"	"g.18690134T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18672014T>C"	""	"VUS"	""
"0000575162"	"0"	"30"	"X"	"18690145"	"18690145"	"subst"	"0"	"01804"	"RS1_000244"	"g.18690145C>T"	""	""	""	"RS1(NM_000330.3):c.44G>A (p.(Gly15Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18672025C>T"	""	"likely benign"	""
"0000619373"	"0"	"30"	"X"	"18528981"	"18528981"	"subst"	"0"	"01804"	"RS1_000245"	"g.18528981A>G"	""	""	""	"CDKL5(NM_001037343.1):c.99+7A>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18510861A>G"	""	"likely benign"	""
"0000619376"	"0"	"90"	"X"	"18622459"	"18622460"	"del"	"0"	"01943"	"RS1_000247"	"g.18622459_18622460del"	""	""	""	"CDKL5(NM_001323289.1):c.1415_1416delCA (p.T472Nfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604339_18604340del"	""	"pathogenic"	""
"0000619377"	"0"	"50"	"X"	"18668644"	"18668644"	"subst"	"0"	"01943"	"RS1_000251"	"g.18668644G>A"	""	""	""	"CDKL5(NM_003159.2):c.2912G>A (p.G971D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18650524G>A"	""	"VUS"	""
"0000624540"	"0"	"10"	"X"	"18622376"	"18622376"	"subst"	"0.000515178"	"01943"	"CDKL5_000112"	"g.18622376C>T"	""	""	""	"CDKL5(NM_001037343.1):c.1332C>T (p.R444=), CDKL5(NM_001323289.1):c.1332C>T (p.R444=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604256C>T"	""	"benign"	""
"0000624541"	"0"	"30"	"X"	"18622910"	"18622910"	"subst"	"0"	"01943"	"RS1_000248"	"g.18622910C>T"	""	""	""	"CDKL5(NM_001323289.1):c.1866C>T (p.A622=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604790C>T"	""	"likely benign"	""
"0000624542"	"0"	"30"	"X"	"18627008"	"18627008"	"subst"	"0.000515611"	"02326"	"RS1_000249"	"g.18627008C>G"	""	""	""	"CDKL5(NM_001037343.1):c.2022C>G (p.S674=), CDKL5(NM_001323289.1):c.2022C>G (p.S674=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18608888C>G"	""	"likely benign"	""
"0000624543"	"0"	"30"	"X"	"18643364"	"18643364"	"subst"	"0"	"01943"	"RS1_000250"	"g.18643364C>T"	""	""	""	"CDKL5(NM_001323289.1):c.2493C>T (p.T831=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18625244C>T"	""	"likely benign"	""
"0000624544"	"0"	"10"	"X"	"18660251"	"18660251"	"subst"	"0.00194966"	"02330"	"RS1_000213"	"g.18660251G>A"	""	""	""	"CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18642131G>A"	""	"benign"	""
"0000624545"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"01943"	"RS1_000029"	"g.18665423C>T"	""	""	""	"RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000659233"	"0"	"90"	"X"	"18622886"	"18622886"	"subst"	"0"	"02327"	"RS1_000253"	"g.18622886T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.18604766T>A"	""	"pathogenic"	""
"0000682318"	"0"	"30"	"X"	"18622046"	"18622046"	"subst"	"0.000112"	"02326"	"RS1_000254"	"g.18622046T>C"	""	""	""	"CDKL5(NM_001037343.1):c.1002T>C (p.A334=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000682319"	"0"	"30"	"X"	"18627044"	"18627044"	"del"	"0.0002147"	"02326"	"RS1_000255"	"g.18627044del"	""	""	""	"CDKL5(NM_001037343.1):c.2046+12delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000682320"	"0"	"30"	"X"	"18660251"	"18660251"	"subst"	"0.00194966"	"01804"	"RS1_000213"	"g.18660251G>A"	""	""	""	"CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000682321"	"0"	"30"	"X"	"18668599"	"18668599"	"subst"	"3.91536E-5"	"01943"	"RS1_000256"	"g.18668599G>A"	""	""	""	"CDKL5(NM_003159.2):c.2867G>A (p.R956H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000682322"	"0"	"30"	"X"	"18668711"	"18668711"	"subst"	"0"	"01943"	"RS1_000257"	"g.18668711C>T"	""	""	""	"CDKL5(NM_003159.2):c.2979C>T (p.S993=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000682323"	"0"	"50"	"X"	"18690152"	"18690152"	"subst"	"5.59268E-6"	"01943"	"RS1_000258"	"g.18690152G>A"	""	""	""	"RS1(NM_000330.3):c.37C>T (p.L13F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000684579"	"1"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00004"	"RS1_000261"	"g.18674860del"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	"c.97delT"	""	"Germline"	""	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000684580"	"1"	"70"	"X"	"18665416"	"18665416"	"subst"	"0"	"00004"	"RS1_000031"	"g.18665416C>A"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"likely pathogenic"	""
"0000684581"	"1"	"70"	"X"	"18665359"	"18665359"	"subst"	"0"	"00004"	"RS1_000260"	"g.18665359T>C"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647239T>C"	""	"likely pathogenic"	""
"0000684582"	"1"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00004"	"RS1_000055"	"g.18662651G>A"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000684583"	"1"	"70"	"X"	"18660220"	"18660220"	"dup"	"0"	"00004"	"RS1_000070"	"g.18660225dup"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	"c.579dupC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000684584"	"1"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00004"	"RS1_000074"	"g.18660201G>A"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000684585"	"1"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00004"	"RS1_000080"	"g.18660174G>A"	"2/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic"	""
"0000684586"	"1"	"70"	"X"	"18657808"	"18690223"	""	"0"	"00004"	"RS1_000000"	"g.(?_18657808)_(18690223_?)del"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	"170bp deletion Xp22.13"	""	"Germline"	""	""	"0"	""	""	"g.(?_18639688)_(18672103_?)del"	""	"likely pathogenic"	""
"0000685469"	"0"	"90"	"X"	"18660167"	"18660167"	"subst"	"0"	"00004"	"RS1_000259"	"g.18660167G>A"	"2/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685470"	"0"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00004"	"RS1_000077"	"g.18660191G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685471"	"0"	"70"	"X"	"18660221"	"18660221"	"subst"	"0"	"00004"	"RS1_000008"	"g.18660221G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685472"	"0"	"90"	"X"	"18660278"	"18660278"	"subst"	"0"	"00004"	"RS1_000065"	"g.18660278T>C"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685473"	"0"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00004"	"RS1_000055"	"g.18662651G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685474"	"0"	"70"	"X"	"18662654"	"18662654"	"subst"	"0"	"00004"	"RS1_000052"	"g.18662654C>T"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685475"	"0"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00004"	"RS1_000039"	"g.18662743C>T"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685476"	"0"	"70"	"X"	"18665311"	"18665311"	"subst"	"0"	"00004"	"RS1_000095"	"g.18665311C>T"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000693509"	"0"	"30"	"X"	"18622811"	"18622811"	"subst"	"0.000280089"	"02326"	"RS1_000262"	"g.18622811C>T"	""	""	""	"CDKL5(NM_001323289.2):c.1767C>T (p.H589=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000714072"	"20"	"70"	"X"	"18660203"	"18660211"	"dup"	"0"	"00000"	"RS1_000263"	"g.18660203_18660211dup"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642083_18642091dup"	""	"likely pathogenic"	""
"0000728731"	"0"	"30"	"X"	"18597954"	"18597954"	"subst"	"0.00011231"	"02326"	"RS1_000264"	"g.18597954T>C"	""	""	""	"CDKL5(NM_001323289.2):c.283-14T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728732"	"0"	"50"	"X"	"18622881"	"18622881"	"subst"	"0"	"01943"	"CDKL5_000117"	"g.18622881A>T"	""	""	""	"CDKL5(NM_001323289.1):c.1837A>T (p.M613L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728733"	"0"	"30"	"X"	"18643279"	"18643279"	"subst"	"1.12243E-5"	"01943"	"RS1_000265"	"g.18643279C>T"	""	""	""	"CDKL5(NM_001323289.1):c.2408C>T (p.T803M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728734"	"0"	"90"	"X"	"18646572"	"18646572"	"subst"	"0"	"02329"	"RS1_000239"	"g.18646572C>T"	""	""	""	"CDKL5(NM_003159.3):c.2578C>T (p.Q860*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000728735"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"02330"	"RS1_000029"	"g.18665423C>T"	""	""	""	"RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000728736"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"02327"	"RS1_000029"	"g.18665423C>T"	""	""	""	"RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000728737"	"0"	"30"	"X"	"18668531"	"18668531"	"subst"	"0"	"01943"	"RS1_000266"	"g.18668531A>G"	""	""	""	"CDKL5(NM_003159.2):c.2799A>G (p.G933=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728738"	"0"	"30"	"X"	"18668577"	"18668577"	"subst"	"1.11868E-5"	"01943"	"RS1_000267"	"g.18668577G>A"	""	""	""	"CDKL5(NM_003159.2):c.2845G>A (p.V949I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728739"	"0"	"30"	"X"	"18668631"	"18668631"	"subst"	"5.59356E-6"	"01943"	"RS1_000268"	"g.18668631C>G"	""	""	""	"CDKL5(NM_003159.2):c.2899C>G (p.L967V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728740"	"0"	"30"	"X"	"18671654"	"18671654"	"subst"	"2.25785E-5"	"01943"	"RS1_000269"	"g.18671654C>T"	""	""	""	"CDKL5(NM_003159.2):c.3083C>T (p.T1028M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728741"	"0"	"50"	"X"	"18674870"	"18674870"	"subst"	"1.67964E-5"	"01943"	"RS1_000270"	"g.18674870G>A"	""	""	""	"RS1(NM_000330.3):c.87C>T (p.G29=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000732987"	"0"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000732988"	"0"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000732989"	"0"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Stone 2017:28559085}"	""	"c286T>C"	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000732990"	"0"	"70"	"X"	"18675759"	"18675786"	""	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Stone 2017:28559085}"	""	"del ex2"	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000732991"	"0"	"70"	"X"	"18675759"	"18675786"	""	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Stone 2017:28559085}"	""	"del ex2, breakpoint not determined"	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000732992"	"0"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000732993"	"0"	"70"	"X"	"18674837"	"18674837"	"subst"	"0"	"00000"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"likely pathogenic"	""
"0000732994"	"0"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"likely pathogenic"	""
"0000732995"	"0"	"70"	"X"	"18690188"	"18690188"	"subst"	"0"	"00000"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672068T>A"	""	"likely pathogenic"	""
"0000732996"	"0"	"70"	"X"	"18660224"	"18660224"	"subst"	"0"	"00000"	"RS1_000271"	"g.18660224G>T"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642104G>T"	""	"likely pathogenic"	""
"0000732997"	"0"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000220"	"g.18660191G>C"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>C"	""	"likely pathogenic"	""
"0000732998"	"0"	"70"	"X"	"18662736"	"18662736"	"subst"	"0"	"00000"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"likely pathogenic"	""
"0000732999"	"0"	"70"	"X"	"18662737"	"18662737"	"subst"	"0"	"00000"	"RS1_000272"	"g.18662737C>T"	""	"{PMID:Stone 2017:28559085}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644617C>T"	""	"likely pathogenic"	""
"0000735946"	"0"	"70"	"X"	"18657808"	"18690223"	""	"0"	"02485"	"RS1_000023"	"g.(?_18657808)_(18690223_?)del"	""	"{PMID:Bravo-Gil 2017:28157192}"	""	""	"large deletion chrX (p22.2-p22.13) including OFD1 and RS1"	"Germline"	""	""	"0"	""	""	"g.(?_18639688)_(18672103_?)del"	""	"likely pathogenic"	""
"0000736166"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Todorova 2017:28147405}"	""	"599C>A"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic"	""
"0000736852"	"1"	"70"	"X"	"18662577"	"18662579"	"del"	"0"	"00000"	"RS1_000273"	"g.18662577_18662579del"	"1/486 individuals"	"{PMID:Sergouniotis 2016:27628848}"	""	""	"no genotypes reported"	"Germline"	""	""	"0"	""	""	"g.18644457_18644459del"	""	"likely pathogenic"	""
"0000736853"	"1"	"70"	"X"	"18660203"	"18660211"	"dup"	"0"	"00000"	"RS1_000263"	"g.18660203_18660211dup"	"1/486 individuals"	"{PMID:Sergouniotis 2016:27628848}"	""	""	"no genotypes reported"	"Germline"	""	""	"0"	""	""	"g.18642083_18642091dup"	""	"likely pathogenic"	""
"0000759606"	"1"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Carrigan 2016:27624628}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000760657"	"20"	"90"	"X"	"18662549"	"18662549"	"subst"	"0"	"00000"	"RS1_000275"	"g.18662549C>G"	""	"{PMID:Bravo-Gil 2016:27032803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644429C>G"	""	"pathogenic"	""
"0000786345"	"0"	"90"	"X"	"18662552"	"18662552"	"subst"	"0"	"00000"	"RS1_000276"	"g.18662552G>A"	""	"{PMID:Zhao 2015:25472526}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644432G>A"	""	"pathogenic"	""
"0000786467"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Consugar 2015:25412400}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0000789878"	"0"	"50"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"c.214G>A"	"Check also: Huopaniemi.1999"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000789879"	"0"	"50"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"c.325G>C"	""	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000789880"	"0"	"50"	"X"	"18660266"	"18660266"	"subst"	"0"	"00000"	"RS1_000277"	"g.18660266C>G"	""	"{PMID:Avela 2019:31087526}"	""	"c.533G>C"	""	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000789881"	"0"	"50"	"X"	"18690171"	"18690661"	"del"	"0"	"00000"	"RS1_000278"	"g.18690171_18690661del"	""	"{PMID:Avela 2019:31087526}"	""	"exon 1 deletion"	"Check also: Bowles 2011"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000793953"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:O\'Sullivan-2012:22581970}"	""	"c.304C>T"	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000794249"	"3"	"90"	"X"	"18662700"	"18662701"	"ins"	"0"	"01807"	"RS1_000280"	"g.18662700_18662701insCACTGGCTAC"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.18644580_18644581insCACTGGCTAC"	""	"pathogenic"	""
"0000794256"	"0"	"70"	"X"	"18665329"	"18665331"	"dup"	"0"	"03508"	"RS1_000279"	"g.18665329_18665331dup"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647209_18647211dup"	""	"VUS"	"ACMG"
"0000810204"	"0"	"30"	"X"	"18593508"	"18593508"	"subst"	"0.000729509"	"01943"	"RS1_000281"	"g.18593508G>A"	""	""	""	"CDKL5(NM_001323289.1):c.180G>A (p.E60=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810205"	"0"	"30"	"X"	"18622124"	"18622124"	"subst"	"1.11897E-5"	"01943"	"RS1_000282"	"g.18622124C>T"	""	""	""	"CDKL5(NM_001323289.1):c.1080C>T (p.L360=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810206"	"0"	"30"	"X"	"18622224"	"18622224"	"subst"	"0"	"01943"	"RS1_000283"	"g.18622224A>G"	""	""	""	"CDKL5(NM_001323289.1):c.1180A>G (p.S394G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810207"	"0"	"30"	"X"	"18622382"	"18622382"	"subst"	"0.000100811"	"01943"	"RS1_000284"	"g.18622382A>T"	""	""	""	"CDKL5(NM_001323289.1):c.1338A>T (p.S446=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810208"	"0"	"30"	"X"	"18643280"	"18643280"	"subst"	"0.000314335"	"01943"	"RS1_000285"	"g.18643280G>A"	""	""	""	"CDKL5(NM_001323289.1):c.2409G>A (p.T803=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810209"	"0"	"30"	"X"	"18643293"	"18643293"	"subst"	"5.6129E-6"	"01943"	"RS1_000286"	"g.18643293A>G"	""	""	""	"CDKL5(NM_001323289.1):c.2422A>G (p.I808V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810210"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"02327"	"RS1_000077"	"g.18660191G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000810211"	"0"	"30"	"X"	"18660283"	"18660283"	"subst"	"5.63447E-6"	"01943"	"RS1_000287"	"g.18660283A>G"	""	""	""	"RS1(NM_000330.3):c.523-7T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810212"	"0"	"50"	"X"	"18662681"	"18662681"	"subst"	"0"	"02329"	"RS1_000223"	"g.18662681T>C"	""	""	""	"RS1(NM_000330.3):c.391A>G (p.K131E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000810213"	"0"	"30"	"X"	"18664229"	"18664229"	"subst"	"6.81095E-5"	"02326"	"RS1_000288"	"g.18664229A>G"	""	""	""	"CDKL5(NM_003159.2):c.2797+19A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000810214"	"0"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"02327"	"RS1_000289"	"g.18690186C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000811442"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.304C>T  (p.Arg102Trp), Allele 2 not applicable"	"hemizygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000811443"	"0"	"70"	"X"	"18690134"	"18690134"	"subst"	"0"	"00000"	"RS1_000243"	"g.18690134T>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.52+3A>G, Allele 2 not applicable"	"hemizygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18672014T>C"	""	"likely pathogenic"	""
"0000811444"	"0"	"70"	"X"	"18690134"	"18690134"	"subst"	"0"	"00000"	"RS1_000243"	"g.18690134T>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.52+3A>G, Allele 2 not applicable"	"hemizygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18672014T>C"	""	"likely pathogenic"	""
"0000811445"	"0"	"70"	"X"	"18690134"	"18690134"	"subst"	"0"	"00000"	"RS1_000243"	"g.18690134T>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.52+3A>G, Allele 2 not applicable"	"hemizygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18672014T>C"	""	"likely pathogenic"	""
"0000812541"	"21"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Wang 2019:31106028}"	""	"c.175A>C, p.(Cys59Gly)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000812542"	"21"	"70"	"X"	"18660152"	"18660152"	"subst"	"0"	"00000"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Wang 2019:31106028}"	""	"c.647A>G, p.(Leu216Pro)"	"error in annotation: c.647A>G instead of T>C, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642032A>G"	""	"likely pathogenic"	""
"0000812614"	"21"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Wang 2019:31106028}"	""	"c.305C>T, p.(Arg102Gln)"	"error in annotation: c.305C>T instead of G>A, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000812622"	"21"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wang 2019:31106028}"	""	"c.608G>A, p.(Pro203Leu)"	"error in annotation: c.608G>A instead of C>T, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000812647"	"0"	"70"	"X"	"18690163"	"18690163"	"subst"	"0"	"00000"	"RS1_000296"	"g.18690163A>T"	""	"{PMID:Wang 2019:31106028}"	""	"c.26A>T, p.(Leu9*)"	"error in annotation: c.26A>T instead of T>A, hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18672043A>T"	""	"likely pathogenic"	""
"0000812649"	"21"	"70"	"X"	"18665450"	"18665450"	"subst"	"0"	"00000"	"RS1_000292"	"g.18665450A>G"	""	"{PMID:Wang 2019:31106028}"	""	"c.187A>G, p.(Cys63Arg)"	"error in annotation: c.187A>G instead of T>C, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647330A>G"	""	"likely pathogenic"	""
"0000812653"	"21"	"70"	"X"	"18662681"	"18662681"	"subst"	"0"	"00000"	"RS1_000290"	"g.18662681T>G"	""	"{PMID:Wang 2019:31106028}"	""	"c.391T>G, p.(Lys131Gln)"	"error in annotation: c.391T>G instead of A>C, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18644561T>G"	""	"likely pathogenic"	""
"0000812661"	"0"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Wang 2019:31106028}"	""	"c.276C>G, p.(Trp92Cys)"	"error in annotation: c.276C>G instead of G>C, hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic"	""
"0000812680"	"21"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wang 2019:31106028}"	""	"c.214C>T, p.(Glu72Lys)"	"error in annotation: c.214C>T instead of G>A, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000812714"	"3"	"70"	"X"	"18660224"	"18660224"	"subst"	"0"	"00000"	"RS1_000271"	"g.18660224G>T"	""	"{PMID:Wang 2019:31106028}"	""	"c.575G>T, p.(Pro192His)"	"error in annotation: c.575G>T instead of C>A, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642104G>T"	""	"likely pathogenic"	""
"0000812738"	"0"	"70"	"X"	"18662736"	"18662736"	"subst"	"0"	"00000"	"RS1_000041"	"g.18662736C>G"	""	"{PMID:Wang 2019:31106028}"	""	"c.336C>G, p.(Trp112Cys)"	"error in annotation: c.336C>G instead of G>C, hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18644616C>G"	""	"likely pathogenic"	""
"0000812775"	"21"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wang 2019:31106028}"	""	"c.637G>A, p.(Arg213Trp)"	"error in annotation: c.637G>A instead of C>T, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000812786"	"21"	"90"	"X"	"18674818"	"18674818"	"dup"	"0"	"00000"	"RS1_000294"	"g.18674818dup"	""	"{PMID:Wang 2019:31106028}"	""	"c.140dup, p.(Asn47Lysfs*39)"	"error in annotation: c.140dup instead of, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18656698dup"	""	"pathogenic"	""
"0000812814"	"0"	"90"	"X"	"18674853"	"18674853"	"del"	"0"	"00000"	"RS1_000295"	"g.18674853del"	""	"{PMID:Wang 2019:31106028}"	""	"c.108del, p.(Ala37Hisfs*89)"	"error in annotation: c.108del instead of, hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18656733del"	""	"pathogenic"	""
"0000812826"	"0"	"70"	"X"	"18665441"	"18665441"	"subst"	"5.59628E-6"	"00000"	"RS1_000291"	"g.18665441G>C"	""	"{PMID:Wang 2019:31106028}"	""	"c.196G>C, p.(His66Asp)"	"error in annotation: c.196G>C instead of C>G, hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18647321G>C"	""	"likely pathogenic"	""
"0000812827"	"0"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wang 2019:31106028}"	""	"c.214G>A, p.(Glu72Lys)"	"hemizygous"	"Germline"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000816117"	"0"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Zampaglione 2020:32037395}"	""	"RS1 c.286T>C, p.Trp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000816183"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00000"	"RS1_000051"	"g.18662656del"	""	"{PMID:Zampaglione 2020:32037395}"	""	"RS1 c.416del, p.Gln139ArgfsTer10"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644536del"	""	"pathogenic"	""
"0000818192"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wang 2016:27788217}"	""	"c.214G>A(p.E72K)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000818493"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Lingao 2016:26894784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	""
"0000819315"	"1"	"70"	"X"	"18662654"	"18662654"	"subst"	"0"	"00000"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.418G>A/p.G140R"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18644534C>T"	""	"likely pathogenic"	""
"0000819344"	"1"	"70"	"X"	"18674772"	"18674879"	""	"0"	"00000"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1 :Deletion exon 3"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"likely pathogenic"	""
"0000819346"	"1"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.304C>T/p.R102W"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000819353"	"1"	"70"	"X"	"18660240"	"18660240"	"subst"	"0"	"00000"	"RS1_000193"	"g.18660240G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.559C>T/p.Q187*"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18642120G>A"	""	"likely pathogenic"	""
"0000819354"	"1"	"70"	"X"	"18660240"	"18660240"	"subst"	"0"	"00000"	"RS1_000193"	"g.18660240G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.559C>T/p.Q187*"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18642120G>A"	""	"likely pathogenic"	""
"0000819367"	"1"	"70"	"X"	"18662706"	"18662706"	"subst"	"0"	"00000"	"RS1_000297"	"g.18662706C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.366G>A/p.W122*"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18644586C>T"	""	"likely pathogenic"	""
"0000819372"	"1"	"70"	"X"	"18665431"	"18665438"	"dup"	"0"	"00000"	"RS1_000299"	"g.18665431_18665438dup"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.199_206dup/p.G70Sfs*59"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647311_18647318dup"	""	"likely pathogenic"	""
"0000819375"	"1"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.305G>A/p.R102Q"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000819376"	"1"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.214G>A/p.E72K"	"solved, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000819378"	"1"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.590G>A/p.R197H"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000819474"	"1"	"70"	"X"	"18657808"	"18660277"	""	"0"	"00000"	"RS1_000011"	"g.(?_18657808)_(18660277_18662549)del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1 :Deletion exon 6"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.(?_18639688)_(18642157_18644429)del"	""	"likely pathogenic"	""
"0000819475"	"1"	"70"	"X"	"18657808"	"18660277"	""	"0"	"00000"	"RS1_000011"	"g.(?_18657808)_(18660277_18662549)del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1 :Deletion exon 6"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.(?_18639688)_(18642157_18644429)del"	""	"likely pathogenic"	""
"0000819486"	"1"	"70"	"X"	"18665453"	"18665453"	"subst"	"0"	"00000"	"RS1_000025"	"g.18665453C>G"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.185-1G>C/p.?"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647333C>G"	""	"likely pathogenic"	""
"0000819491"	"1"	"70"	"X"	"18690155"	"18690158"	"del"	"0"	"00000"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.33_36del/p.L11Ffs*114"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18672035_18672038del"	""	"likely pathogenic"	""
"0000819493"	"1"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.305G>A/p.R102Q"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000819498"	"1"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.421C>T/p.R141C"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000819507"	"1"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.214G>A/p.E72K"	"solved, hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000819550"	"1"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.421C>T/p.R141C"	"solved, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000819551"	"1"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"RS1, variant 1: c.421C>T/p.R141C"	"solved, hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000822124"	"0"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Booij-2011:20801516}"	""	"c.625C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822125"	"0"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Booij-2011:20801516}"	""	"c.214G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822227"	"1"	"70"	"X"	"18675494"	"18676498"	"del"	"0"	"00000"	"RS1_000301"	"g.18675494_18676498del"	""	"{PMID:Maggi_2021:33546218}"	""	"c.53-713_78+266del"	""	"Germline"	"yes"	""	"0"	""	""	"g.18657374_18658378del"	""	"likely pathogenic"	""
"0000822331"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Maggi_2021:33546218}"	""	"c.304C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822450"	"0"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Maggi_2021:33546218}"	""	"c.598C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822460"	"0"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Maggi_2021:33546218}"	""	"c.544C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822462"	"0"	"70"	"X"	"18674807"	"18674807"	"subst"	"0"	"00000"	"RS1_000300"	"g.18674807C>T"	""	"{PMID:Maggi_2021:33546218}"	""	"c.150G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822469"	"0"	"70"	"X"	"18665428"	"18665428"	"subst"	"0"	"00000"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Maggi_2021:33546218}"	""	"c.209G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822969"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Méjécase 2020:32783370}"	""	"RS1 c.30SG>A  p.(Arg102Gln)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000822970"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Méjécase 2020:32783370}"	""	"RS1 c.304C>T p.(Arg102Trp)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000823180"	"20"	"50"	"X"	"18675759"	"18690223"	""	"0"	"00000"	"RS1_000307"	"g.(18674879_18675759)_(18690223_?)del"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:exon1del, p.?"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.(18656759_18657639)_(18672103_?)del"	""	"VUS"	""
"0000823181"	"20"	"50"	"X"	"18675759"	"18690223"	""	"0"	"00000"	"RS1_000307"	"g.(18674879_18675759)_(18690223_?)del"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:exon1del, p.?"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.(18656759_18657639)_(18672103_?)del"	""	"VUS"	""
"0000823182"	"21"	"50"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.214G>A, p.Glu72Lys"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"VUS"	""
"0000823185"	"21"	"50"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.329G>A, p.Cys110Tyr"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"yes"	""	"0"	""	""	"g.18644623C>T"	""	"VUS"	""
"0000823186"	"20"	"50"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.329G>A, p.Cys110Tyr"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"yes"	""	"0"	""	""	"g.18644623C>T"	""	"VUS"	""
"0000823187"	"20"	"50"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.421C>T, p.Arg141Cys"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"yes"	""	"0"	""	""	"g.18644531G>A"	""	"VUS"	""
"0000823188"	"20"	"50"	"X"	"18662646"	"18662646"	"subst"	"0"	"00000"	"RS1_000114"	"g.18662646A>C"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.426T>G, p.Cys142Trp"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18644526A>C"	""	"VUS"	""
"0000823189"	"20"	"50"	"X"	"18662574"	"18662574"	"subst"	"0"	"00000"	"RS1_000302"	"g.18662574G>T"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.498C>A, p.Tyr166*"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18644454G>T"	""	"VUS"	""
"0000823190"	"20"	"50"	"X"	"18662549"	"18662549"	"subst"	"0"	"00000"	"RS1_000148"	"g.18662549C>T"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.522+1G>A, p.?"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18644429C>T"	""	"VUS"	""
"0000823191"	"20"	"50"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000143"	"g.18660225G>C"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.574C>G, p.Pro192Ala"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18642105G>C"	""	"VUS"	""
"0000823192"	"20"	"50"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.579dupC, p.Ile194Hisfsext51"	"error in annotation: c.579dup causes p.(Ile194Hisfs*70) and not p.(Ile194Hisfsext51), hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18642105dup"	""	"VUS"	""
"0000823193"	"20"	"50"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hull 2020:32856788}"	""	"RS1 nucleotide 1, protein 1:c.625C>T, p.Arg209Cys"	"hemizygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.18642054G>A"	""	"VUS"	""
"0000825676"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.590G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825710"	"20"	"70"	"X"	"18660161"	"18660161"	"subst"	"0"	"00000"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.638G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825711"	"20"	"70"	"X"	"18662737"	"18662737"	"subst"	"0"	"00000"	"RS1_000306"	"g.18662737C>G"	""	"{PMID:Liu-2020:33090715}"	""	"c.335G>C"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825717"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.599G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825718"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Liu-2020:33090715}"	""	"c.286T>C"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825782"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Liu-2020:33090715}"	""	"c.304C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825828"	"20"	"70"	"X"	"18660185"	"18660185"	"dup"	"0"	"00000"	"RS1_000304"	"g.18660185dup"	""	"{PMID:Liu-2020:33090715}"	""	"c.614dupC"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000825917"	"20"	"70"	"X"	"18660143"	"18660143"	"subst"	"0"	"00000"	"RS1_000303"	"g.18660143C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.656G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826111"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.599G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826134"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Liu-2020:33090715}"	""	"c.589C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826236"	"20"	"70"	"X"	"18665416"	"18665416"	"subst"	"0"	"00000"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Liu-2020:33090715}"	""	"c.221G>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826273"	"20"	"70"	"X"	"18662605"	"18662605"	"subst"	"0"	"00000"	"RS1_000305"	"g.18662605C>A"	""	"{PMID:Liu-2020:33090715}"	""	"c.467G>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826317"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Liu-2020:33090715}"	""	"c.637C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (maternal)"	""
"0000826351"	"20"	"70"	"X"	"18674772"	"18690223"	"del"	"0"	"00000"	"RS1_000123"	"g.(18665453_18674772)_(18690223_?)del"	""	"{PMID:Liu-2020:33090715}"	""	"E1-3del"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18672103_?)del"	""	"likely pathogenic (maternal)"	""
"0000827609"	"0"	"70"	"X"	"18675759"	"18675759"	"subst"	"0"	"00000"	"RS1_000152"	"g.18675759C>T"	""	"{PMID:Kim 2021:33946315}"	""	"RS1 c.78+1G>A, p.(?)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18657639C>T"	""	"likely pathogenic"	"ACMG"
"0000828911"	"20"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Chen 2021:43360855}"	""	"RS1 c.[276G>C];[0], V1: c.276G>C, (p.Trp92Cys)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic"	"ACMG"
"0000828912"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Chen 2021:43360855}"	""	"RS1 c.[598C>T];[0], V1: c.598C>T, (p.Arg200Cys)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	"ACMG"
"0000828937"	"20"	"90"	"X"	"18665393"	"18665394"	"del"	"0"	"00000"	"RS1_000318"	"g.18665393_18665394del"	""	"{PMID:Chen 2021:43360855}"	""	"RS1 c.[244_245del];[0], V1: c.244_245delAC, (p.Thr82LeufsTer3)"	"hemizygous"	"Unknown"	"?"	""	"0"	""	""	"g.18647273_18647274del"	""	"pathogenic"	"ACMG"
"0000829079"	"20"	"70"	"X"	"18690188"	"18690188"	"subst"	"0"	"00000"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.1A>T, p.Met1Leu"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672068T>A"	""	"likely pathogenic"	""
"0000829080"	"20"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00000"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.35T>A, p.Leu12His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic"	""
"0000829081"	"20"	"70"	"X"	"18690152"	"18690152"	"subst"	"5.59268E-6"	"00000"	"RS1_000258"	"g.18690152G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.37C>T, p.Leu13Phe"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672032G>A"	""	"likely pathogenic"	""
"0000829082"	"20"	"70"	"X"	"18690151"	"18690151"	"subst"	"0"	"00000"	"RS1_000109"	"g.18690151A>G"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.38T>C, p.Leu13Pro"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672031A>G"	""	"likely pathogenic"	""
"0000829083"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829084"	"20"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.276G>C, p.Trp92Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic"	""
"0000829085"	"20"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000317"	"g.18665349C>G"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.286G>C, p.Trp96Cys"	"error in annotation: p.Trp96Cys is caused by c.288G>C, not c.286G>C"	"Unknown"	"?"	""	"0"	""	""	"g.18647229C>G"	""	"likely pathogenic"	""
"0000829086"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829087"	"20"	"70"	"X"	"18660264"	"18660264"	"subst"	"0"	"00000"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.535A>G, p.Asn179Asp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642144T>C"	""	"likely pathogenic"	""
"0000829088"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829089"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.598C>T, p.Arg200Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000829090"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.673C>T, p.Arg213Trp"	"error in annotation: p.Arg213Trp is caused by c.637C>T, not c.673C>T"	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829091"	"20"	"70"	"X"	"18690137"	"18690137"	"subst"	"0"	"00000"	"RS1_000322"	"g.18690137C>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"RS1 c.673C>T, p.Arg213Trp"	"in vitro analysis mini-gene splicing assay shows splicing is affected"	"Germline"	"yes"	""	"0"	""	""	"g.18672017C>T"	""	"likely pathogenic (recessive)"	""
"0000829092"	"20"	"70"	"X"	"18690137"	"18690137"	"subst"	"0"	"00000"	"RS1_000322"	"g.18690137C>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	""	"in vitro analysis mini-gene splicing assay shows splicing is affected"	"Germline"	"yes"	""	"0"	""	""	"g.18672017C>T"	""	"likely pathogenic (recessive)"	""
"0000829098"	"20"	"70"	"X"	"18662736"	"18662736"	"subst"	"0"	"00000"	"RS1_000316"	"g.18662736C>T"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.336G>A, p.(Trp112Ter)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18644616C>T"	""	"likely pathogenic"	""
"0000829099"	"20"	"70"	"X"	"18662672"	"18662672"	"subst"	"0"	"00000"	"RS1_000314"	"g.18662672A>G"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.400T>C, p.(Ser134Pro)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18644552A>G"	""	"likely pathogenic"	""
"0000829100"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829101"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829102"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829103"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829104"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.599G>A, p.(Arg200His)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000829105"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Xu 2011:21701876}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	"coding DNA change extrapolated: only protein changes given in the publication"	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829106"	"20"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000093"	"g.18690188T>C"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18672068T>C"	""	"pathogenic (recessive)"	""
"0000829107"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic (recessive)"	""
"0000829108"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0000829109"	"20"	"90"	"X"	"18665375"	"18665375"	"subst"	"0"	"00006"	"RS1_000181"	"g.18665375G>A"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647255G>A"	""	"pathogenic (recessive)"	""
"0000829110"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	""
"0000829111"	"20"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000095"	"g.18665311C>T"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647191C>T"	""	"pathogenic (recessive)"	""
"0000829112"	"20"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000096"	"g.18662583C>T"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644463C>T"	""	"pathogenic (recessive)"	""
"0000829113"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0000829114"	"20"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0000829115"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Shinoda 2000:11035549}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0000829116"	"0"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Armanda-Maresca 2011:21836411}"	""	"RS1, p.Gln154Arg"	"DNA change extrapolated, only protein variant in publication"	"Unknown"	"?"	""	"0"	""	""	"g.18644491T>C"	""	"likely pathogenic"	"ACMG"
"0000829117"	"0"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000310"	"g.18660173C>G"	""	"{PMID:Duncan 2011:22110067}"	""	"c.626G>C; p.Arg209Pro"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>G"	""	"likely pathogenic"	""
"0000829118"	"0"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Duncan 2011:22110067}"	""	"c.579dupC; p.Ile194Hisfs"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829208"	"0"	"90"	"X"	"18674781"	"18674781"	"subst"	"0"	"00000"	"RS1_000320"	"g.18674781C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 176G>A, Cys59Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656661C>T"	""	"pathogenic"	""
"0000829209"	"0"	"90"	"X"	"18674781"	"18674781"	"subst"	"0"	"00000"	"RS1_000320"	"g.18674781C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 176G>A, Cys59Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656661C>T"	""	"pathogenic"	""
"0000829210"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 214G>A, Glu72Lys"	""	"Germline"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000829211"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 214G>A, Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000829212"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 214G>A, Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0000829213"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 304C>T, Arg102Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000829214"	"0"	"90"	"X"	"18662636"	"18662636"	"subst"	"0"	"00000"	"RS1_000059"	"g.18662636C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 436G>A, Glu146Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644516C>T"	""	"pathogenic"	""
"0000829215"	"0"	"90"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 531T>G, Tyr177X"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"pathogenic"	""
"0000829216"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 544C>T, Arg182Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000829217"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 544C>T, Arg182Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic"	""
"0000829218"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 599G>A, Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	""
"0000829219"	"0"	"90"	"X"	"18660192"	"18660192"	"subst"	"0"	"00000"	"RS1_000311"	"g.18660192G>C"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 607C>G, Pro203Ala"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642072G>C"	""	"pathogenic"	""
"0000829220"	"0"	"90"	"X"	"18660155"	"18660155"	"subst"	"0"	"00000"	"RS1_000177"	"g.18660155T>A"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 644A>T, Glu215Val"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642035T>A"	""	"pathogenic"	""
"0000829221"	"0"	"90"	"X"	"18660131"	"18660131"	"subst"	"0"	"00000"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Yi 2012:22245991}"	""	"RS1 668G>A, Cys223Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642011C>T"	""	"pathogenic"	""
"0000829239"	"20"	"70"	"X"	"18674781"	"18674781"	"subst"	"0"	"00000"	"RS1_000321"	"g.18674781C>G"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.176G>C (p.Cys59Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656661C>G"	""	"likely pathogenic"	""
"0000829240"	"20"	"70"	"X"	"18674781"	"18674781"	"subst"	"0"	"00000"	"RS1_000321"	"g.18674781C>G"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.176G>C (p.Cys59Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656661C>G"	""	"likely pathogenic"	""
"0000829241"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.214G>A (p.Glu72Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829242"	"20"	"70"	"X"	"18665419"	"18665419"	"subst"	"0"	"00000"	"RS1_000319"	"g.18665419G>T"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.218C>A (p.Ser73*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647299G>T"	""	"likely pathogenic"	""
"0000829243"	"20"	"70"	"X"	"18665419"	"18665419"	"subst"	"0"	"00000"	"RS1_000319"	"g.18665419G>T"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.218C>A (p.Ser73*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647299G>T"	""	"likely pathogenic"	""
"0000829244"	"20"	"70"	"X"	"18665419"	"18665419"	"subst"	"0"	"00000"	"RS1_000319"	"g.18665419G>T"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.218C>A (p.Ser73*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647299G>T"	""	"likely pathogenic"	""
"0000829245"	"20"	"70"	"X"	"18662718"	"18662719"	"del"	"0"	"00000"	"RS1_000315"	"g.18662718_18662719del"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.354_355delCA (p.Asp118Glufs*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644598_18644599del"	""	"likely pathogenic"	""
"0000829246"	"20"	"70"	"X"	"18662621"	"18662621"	"subst"	"0"	"00000"	"RS1_000313"	"g.18662621A>T"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.451T>A (p.Tyr151Asp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644501A>T"	""	"likely pathogenic"	""
"0000829247"	"20"	"70"	"X"	"18662549"	"18662549"	"subst"	"0"	"00000"	"RS1_000064"	"g.18662549C>A"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.522+1G>T"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644429C>A"	""	"likely pathogenic"	""
"0000829248"	"20"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000178"	"g.18660173C>A"	""	"{PMID:Skorczyk 2012:23288992}"	""	"RS1 c.626G>T (p.Arg209Leu)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>A"	""	"likely pathogenic"	""
"0000829273"	"20"	"70"	"X"	"18665431"	"18665431"	"subst"	"0"	"00000"	"RS1_000161"	"g.18665431A>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"L69P"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18647311A>G"	""	"likely pathogenic"	""
"0000829274"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"R102E (arginine to glutamic acid)"	"predicted severe, no RS1 secretion"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829275"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"G109R"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000829276"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"0"	"00000"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"G109W"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>A"	""	"likely pathogenic"	""
"0000829277"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"C110Y"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000829278"	"20"	"70"	"X"	"18662653"	"18662653"	"subst"	"0"	"00000"	"RS1_000053"	"g.18662653C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"G140E"	"predicted mild, reduced RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18644533C>T"	""	"likely pathogenic"	""
"0000829279"	"20"	"70"	"X"	"18662570"	"18662570"	"subst"	"0"	"00000"	"RS1_000344"	"g.18662570C>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"D168H"	"predicted mild, reduced RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18644450C>G"	""	"likely pathogenic"	""
"0000829280"	"20"	"70"	"X"	"18660245"	"18660245"	"subst"	"0"	"00000"	"RS1_000098"	"g.18660245G>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"T185K"	"predicted mild, reduced RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18642125G>T"	""	"likely pathogenic"	""
"0000829281"	"20"	"70"	"X"	"18660227"	"18660227"	"subst"	"0"	"00000"	"RS1_000336"	"g.18660227C>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"R191P"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18642107C>G"	""	"likely pathogenic"	""
"0000829282"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"R197H"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000829283"	"20"	"70"	"X"	"18660152"	"18660152"	"subst"	"0"	"00000"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"L216P"	"predicted severe, no RS1 secretion; variant extrapolated from protein change"	"Unknown"	"?"	""	"0"	""	""	"g.18642032A>G"	""	"likely pathogenic"	""
"0000829284"	"20"	"70"	"X"	"18662656"	"18662656"	"del"	"0"	"00000"	"RS1_000051"	"g.18662656del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Deletion 416delA in exon 5"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644536del"	""	"likely pathogenic"	""
"0000829285"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829286"	"20"	"70"	"X"	"18674854"	"18674854"	"subst"	"0"	"00000"	"RS1_000138"	"g.18674854G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"Substitution 103C>T, p. Gln35X"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656734G>A"	""	"likely pathogenic"	""
"0000829287"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829288"	"20"	"70"	"X"	"18674771"	"18674771"	"subst"	"0"	"00000"	"RS1_000398"	"g.18674771A>C"	""	"{PMID:Sergeev 2013:23847049}"	""	"Splice site 184+2T>G"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656651A>C"	""	"likely pathogenic"	""
"0000829289"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Sergeev 2013:23847049}"	""	"Insertion c.579insC"	"error in annotation, variant c.579insC is c.579dupC and causes p.(Ile194Hisfs*70) and not p.(His194fs*263)"	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829290"	"20"	"70"	"X"	"18690135"	"18690135"	"subst"	"0"	"00000"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Sergeev 2013:23847049}"	""	"Splice site IVS1+2T>C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672015A>G"	""	"likely pathogenic"	""
"0000829291"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829292"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829293"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Sergeev 2013:23847049}"	""	"Duplication 579dupC"	"error in annotation, variant c.579insC is c.579dupC and causes p.(Ile194Hisfs*70) and not p.(His194fs*263)"	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829294"	"20"	"70"	"X"	"18662656"	"18662656"	"del"	"0"	"00000"	"RS1_000051"	"g.18662656del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Deletion 416delA in exon 5"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644536del"	""	"likely pathogenic"	""
"0000829295"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Sergeev 2013:23847049}"	""	"Exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829296"	"20"	"70"	"X"	"18660227"	"18660227"	"del"	"0"	"00000"	"RS1_000141"	"g.18660227del"	""	"{PMID:Chu 2013:23568735}"	""	"c.573delG, p.Pro192fs"	"mutation based on abstract (article in Chinese). Error in annotation, c.573delG causes p.(Ile194SerfsTer43) and not p.(Pro192fs)"	"Germline"	"yes"	""	"0"	""	""	"g.18642107del"	""	"likely pathogenic"	""
"0000829297"	"20"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Chu 2013:23568735}"	""	"c.626G>A, p.Arg209His"	"mutation based on abstract (article in Chinese)"	"Germline"	"yes"	""	"0"	""	""	"g.18642053C>T"	""	"likely pathogenic"	""
"0000829298"	"0"	"70"	"X"	"18687473"	"18691946"	"del"	"0"	"00000"	"RS1_000324"	"g.18687473_18691946del"	""	"{PMID:D\'Souza:24227916}"	""	"c.(-35)-1723_c.51+2664del4472"	"error in annotation, exon 1 is ending on nucleotide 52"	"Unknown"	"?"	""	"0"	""	""	"g.18669353_18673826del"	""	"likely pathogenic"	""
"0000829299"	"0"	"70"	"X"	"18660706"	"18666472"	"del"	"0"	"00000"	"RS1_000323"	"g.18660706_18666472del"	""	"{PMID:D\'Souza:24227916}"	""	"c.185-1020_c.522+1844del5764  (p.E62Gfs*87)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642586_18648352del"	""	"likely pathogenic"	""
"0000829300"	"0"	"70"	"X"	"18662702"	"18662702"	"subst"	"0"	"00000"	"RS1_000367"	"g.18662702G>A"	""	"{PMID:Chen 2014:24505212}"	""	"c.370C>T, p.Q124X"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644582G>A"	""	"likely pathogenic"	""
"0000829301"	"0"	"70"	"X"	"18662742"	"18662742"	"del"	"0"	"00000"	"RS1_000370"	"g.18662742del"	""	"{PMID:Chen 2014:24505212}"	""	"c.330delT, p.C110fs+15X"	"error in annotation, variant causes a stop after 16 and not 15 amino acids"	"Germline"	"yes"	""	"0"	""	""	"g.18644622del"	""	"likely pathogenic"	""
"0000829302"	"0"	"70"	"X"	"18660218"	"18660218"	"subst"	"0"	"00000"	"RS1_000195"	"g.18660218A>T"	""	"{PMID:Chen 2014:24505212}"	""	"c.581T>A, p.I194N"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642098A>T"	""	"likely pathogenic"	""
"0000829303"	"0"	"70"	"X"	"18674859"	"18674859"	"subst"	"0"	"00000"	"RS1_000401"	"g.18674859C>T"	""	"{PMID:Chen 2014:24505212}"	""	"c.98G>A, p.W33X"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656739C>T"	""	"likely pathogenic"	""
"0000829304"	"0"	"70"	"X"	"18690136"	"18690223"	"del"	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Chen 2014:24505212}"	""	"del ex1"	""	"Germline"	"yes"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829305"	"0"	"70"	"X"	"18675755"	"18675755"	"subst"	"0"	"00000"	"RS1_000402"	"g.18675755C>A"	""	"{PMID:Chen 2014:24505212}"	""	"c.78+5G>T"	""	"Germline"	"yes"	""	"0"	""	""	"g.18657635C>A"	""	"likely pathogenic"	""
"0000829306"	"0"	"70"	"X"	"18660161"	"18660161"	"subst"	"0"	"00000"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Chen 2014:24505212}"	""	"c.638G>A, p.R213Q"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642041C>T"	""	"likely pathogenic"	""
"0000829307"	"0"	"70"	"X"	"18660221"	"18660221"	"subst"	"0"	"00000"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Chen 2014:24505212}"	""	"c.578C>T, p.P193L"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642101G>A"	""	"likely pathogenic"	""
"0000829308"	"0"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Chen 2014:24505212}"	""	"c.599G>A, p.R200H"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000829309"	"0"	"70"	"X"	"18690135"	"18690141"	"dup"	"0"	"00000"	"RS1_000404"	"g.18690135_18690141dup"	""	"{PMID:Chen 2014:24505212}"	""	"c.52+2_3insTGAAGGT"	"error in annotation, variant automapped to c.48_52+2dup"	"Germline"	"yes"	""	"0"	""	""	"g.18672015_18672021dup"	""	"likely pathogenic"	""
"0000829310"	"0"	"70"	"X"	"18662576"	"18662576"	"subst"	"0"	"00000"	"RS1_000346"	"g.18662576A>G"	""	"{PMID:Chen 2014:24505212}"	""	"c.496T>C, p.Y166H"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644456A>G"	""	"likely pathogenic"	""
"0000829311"	"0"	"70"	"X"	"18662621"	"18662621"	"subst"	"0"	"00000"	"RS1_000354"	"g.18662621A>G"	""	"{PMID:Chen 2014:24505212}"	""	"c.451T>C, p.Y151H"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644501A>G"	""	"likely pathogenic"	""
"0000829312"	"0"	"70"	"X"	"18662573"	"18662573"	"subst"	"0"	"00000"	"RS1_000345"	"g.18662573T>C"	""	"{PMID:Chen 2014:24505212}"	""	"c.499A>G, p.K167E"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644453T>C"	""	"likely pathogenic"	""
"0000829313"	"0"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Chen 2014:24505212}"	""	"c.208G>A, p.G70S"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647309C>T"	""	"likely pathogenic"	""
"0000829314"	"0"	"70"	"X"	"18662698"	"18662701"	"del"	"0"	"00000"	"RS1_000045"	"g.18662698_18662701del"	""	"{PMID:Chen 2014:24505212}"	""	"c.375_378delAGAT, p.I125fs+1X"	"error in annotation, variant causes p.(Asp126*) and not p.(Ile125fs*1)"	"Germline"	"yes"	""	"0"	""	""	"g.18644578_18644581del"	""	"likely pathogenic"	""
"0000829315"	"0"	"70"	"X"	"18662584"	"18662584"	"del"	"0"	"00000"	"RS1_000165"	"g.18662584del"	""	"{PMID:Chen 2014:24505212}"	""	"c.489delG, p.W163fsX"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644464del"	""	"likely pathogenic"	""
"0000829316"	"20"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lai 2015:24529551}"	""	"c.97delT"	"no protein change given"	"Germline"	"yes"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000829317"	"20"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lai 2015:24529551}"	""	"c.97delT"	"no protein change given"	"Germline"	"yes"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000829318"	"21"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lai 2015:24529551}"	""	"c.97delT"	"no protein change given"	"Germline"	"yes"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000829319"	"21"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lai 2015:24529551}"	""	"c.97delT"	"no protein change given"	"Germline"	"yes"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000829320"	"21"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lai 2015:24529551}"	""	"c.97delT"	"no protein change given"	"Germline"	"yes"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000829322"	"3"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00000"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gliem 2014:25054456}"	""	"c.293C>A (p.Ala98Glu)"	"homozygous female from consanguineous marriage of an affected father and a carrier mother"	"Germline"	"yes"	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic"	""
"0000829323"	"21"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00000"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gliem 2014:25054456}"	""	"c.293C>A (p.Ala98Glu)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic"	""
"0000829324"	"21"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00000"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gliem 2014:25054456}"	""	"c.293C>A (p.Ala98Glu)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic"	""
"0000829325"	"21"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00000"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gliem 2014:25054456}"	""	"c.293C>A (p.Ala98Glu)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic"	""
"0000829326"	"21"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00000"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Gliem 2014:25054456}"	""	"c.293C>A (p.Ala98Glu)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic"	""
"0000829327"	"21"	"70"	"X"	"18665430"	"18665431"	"del"	"0"	"00000"	"RS1_000390"	"g.18665430_18665431del"	""	"{PMID:Huang 2014:25168411}"	""	"c.206-207delTG in the RS1 gene (p.L69fs16X)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647310_18647311del"	""	"likely pathogenic"	""
"0000829328"	"21"	"70"	"X"	"18665430"	"18665431"	"del"	"0"	"00000"	"RS1_000390"	"g.18665430_18665431del"	""	"{PMID:Huang 2014:25168411}"	""	"c.206-207delTG in the RS1 gene (p.L69fs16X)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647310_18647311del"	""	"likely pathogenic"	""
"0000829329"	"21"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Ulinska 2014:25799783}"	""	"c.589C>T, p.Arg197Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829330"	"21"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Ulinska 2014:25799783}"	""	"c.589C>T, p.Arg197Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829331"	"21"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Ulinska 2014:25799783}"	""	"c.589C>T, p.Arg197Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829332"	"20"	"70"	"X"	"18690135"	"18690135"	"subst"	"0"	"00000"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Khan 2001:11738458}"	""	"IVS1+2 T to C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672015A>G"	""	"likely pathogenic"	""
"0000829333"	"20"	"70"	"X"	"18674775"	"18675787"	"del"	"0"	"00000"	"RS1_000000"	"g.(18674775_18675787)delN[?]"	""	"{PMID:Khan 2001:11738458}"	""	"deletion in ex2 and/or ex3"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.(18656655_18657667)delN[?]"	""	"likely pathogenic"	""
"0000829334"	"20"	"70"	"X"	"18674772"	"18674772"	"subst"	"0"	"00000"	"RS1_000399"	"g.18674772C>G"	""	"{PMID:Khan 2001:11738458}"	""	"IVS3+1G to C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656652C>G"	""	"likely pathogenic"	""
"0000829335"	"20"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000111"	"g.18665429C>G"	""	"{PMID:Khan 2001:11738458}"	""	"X4, 208 G to C (G70R)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>G"	""	"likely pathogenic"	""
"0000829336"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Khan 2001:11738458}"	""	"X4, 286 T to C (W96R)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000829337"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Khan 2001:11738458}"	""	"X4, 286 T to C (W96R)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000829338"	"20"	"70"	"X"	"18662735"	"18662735"	"subst"	"0"	"00000"	"RS1_000043"	"g.18662735G>A"	""	"{PMID:Khan 2001:11738458}"	""	"X5, 337 C to T (L113F)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644615G>A"	""	"likely pathogenic"	""
"0000829339"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Khan 2001:11738458}"	""	"X6, 579insC"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829340"	"20"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00000"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Khan 2001:11738458}"	""	"X6, 596 T to C (I199T)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642083A>G"	""	"likely pathogenic"	""
"0000829341"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Khan 2001:11738458}"	""	"X6, 608 C to T (P203L)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000829342"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Khan 2001:11738458}"	""	"X6, 637 C to T (R213W)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829344"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Akeo 2015:26356828}"	""	"RS1 c.608 C>T, (P203L)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000829345"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Akeo 2015:26356828}"	""	"RS1 c.608 C>T, (P203L)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000829346"	"20"	"70"	"X"	"18662577"	"18662609"	"del"	"0"	"00000"	"RS1_000347"	"g.18662577_18662609del"	""	"{PMID:Vazquez-Alfageme 2016:26791414}"	""	"RS1 c.467_499GGACCGATGAGCGCCTGAACTGGATTTACTACA, (RTDERLNWIYY - p.R156_Y166del)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644457_18644489del"	""	"likely pathogenic"	""
"0000829349"	"20"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"00000"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:Xiao 2016:26823236}"	""	"c.3G> A (p.M1) in the RS1 gene"	""	"Germline"	"yes"	""	"0"	""	""	"g.18672066C>T"	""	"likely pathogenic"	""
"0000829350"	"20"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"00000"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:Xiao 2016:26823236}"	""	"c.3G> A (p.M1) in the RS1 gene"	""	"Germline"	"yes"	""	"0"	""	""	"g.18672066C>T"	""	"likely pathogenic"	""
"0000829351"	"20"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"00000"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:Xiao 2016:26823236}"	""	"c.3G> A (p.M1) in the RS1 gene"	""	"Germline"	"yes"	""	"0"	""	""	"g.18672066C>T"	""	"likely pathogenic"	""
"0000829352"	"20"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"00000"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:Xiao 2016:26823236}"	""	"c.3G> A (p.M1) in the RS1 gene"	""	"Germline"	"yes"	""	"0"	""	""	"g.18672066C>T"	""	"likely pathogenic"	""
"0000829353"	"20"	"70"	"X"	"18690186"	"18690186"	"subst"	"0"	"00000"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:Xiao 2016:26823236}"	""	"c.3G> A (p.M1) in the RS1 gene"	""	"Germline"	"yes"	""	"0"	""	""	"g.18672066C>T"	""	"likely pathogenic"	""
"0000829354"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Sadaka 2016:27246168}"	""	"R197H"	"no coding DNA change given: extrapolation from protein change"	"Germline"	"yes"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000829355"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Galantuomo 2016:27932860}"	""	"c.589C>T (p.Arg197Cys)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829356"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Galantuomo 2016:27932860}"	""	"c.589C>T (p.Arg197Cys)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829357"	"20"	"70"	"X"	"18675759"	"18675786"	"del"	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Nicoletti 2017:27997221}"	""	"arr[hg19] Xp22.13 (18674960 x1, 18675273-18681809 x0, 18681810 x1) mat; c.53-?_78+?del"	"error in annotation: unsure breakpoints should be marked not as c.53-?_78+?del, but c.(52+1_53-1)_(78+1_79-1)del"	"Germline"	"yes"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000829358"	"20"	"70"	"X"	"18675759"	"18675786"	"del"	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Nicoletti 2017:27997221}"	""	"arr[hg19] Xp22.13 (18674960 x1, 18675273-18681809 x0, 18681810 x1) mat; c.53-?_78+?del"	"error in annotation: unsure breakpoints should be marked not as c.53-?_78+?del, but c.(52+1_53-1)_(78+1_79-1)del"	"Germline"	"yes"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000829359"	"20"	"70"	"X"	"18675759"	"18675786"	"del"	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Nicoletti 2017:27997221}"	""	"arr[hg19] Xp22.13 (18674960 x1, 18675273-18681809 x0, 18681810 x1) mat; c.53-?_78+?del"	"error in annotation: unsure breakpoints should be marked not as c.53-?_78+?del, but c.(52+1_53-1)_(78+1_79-1)del"	"Germline"	"yes"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000829360"	"20"	"70"	"X"	"18675759"	"18675786"	"del"	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Nicoletti 2017:27997221}"	""	"arr[hg19] Xp22.13 (18674960 x1, 18675273-18681809 x0, 18681810 x1) mat; c.53-?_78+?del"	"error in annotation: unsure breakpoints should be marked not as c.53-?_78+?del, but c.(52+1_53-1)_(78+1_79-1)del"	"Germline"	"yes"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000829361"	"20"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Murro 2017:28235399}"	""	"c.288G > A (p.Trp96Ter)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647229C>T"	""	"likely pathogenic"	""
"0000829362"	"20"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Murro 2017:28235399}"	""	"c.288G > A (p.Trp96Ter)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647229C>T"	""	"likely pathogenic"	""
"0000829363"	"21"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.305G>A p.Arg102Gln"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829364"	"21"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.421C>T p.Arg102Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000829365"	"21"	"70"	"X"	"18665366"	"18665366"	"subst"	"0"	"00000"	"RS1_000383"	"g.18665366C>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.271G>T p.Gly91Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647246C>A"	""	"likely pathogenic"	""
"0000829366"	"21"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000376"	"g.18665332C>G"	""	"{PMID:Hu 2017:28272453}"	""	"c.305G>C p.Arg102Pro"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>G"	""	"likely pathogenic"	""
"0000829367"	"21"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.214G>A p.Glu72Lys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829368"	"21"	"70"	"X"	"18665311"	"18665311"	"subst"	"0"	"00000"	"RS1_000095"	"g.18665311C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.326G>A p.Gly109Glu"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647191C>T"	""	"likely pathogenic"	""
"0000829369"	"21"	"70"	"X"	"18660110"	"18660110"	"subst"	"0"	"00000"	"RS1_000325"	"g.18660110A>G"	""	"{PMID:Hu 2017:28272453}"	""	"c.675+14C>T"	"error in annotation 675 is the last nucleotide of the last exon and the nucleotide in position *14 is T and not C; should probably be T>C"	"Germline"	"yes"	""	"0"	""	""	"g.18641990A>G"	""	"likely pathogenic"	""
"0000829370"	"21"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.626G>A p.Arg209His"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642053C>T"	""	"likely pathogenic"	""
"0000829371"	"21"	"70"	"X"	"18665443"	"18665443"	"subst"	"0"	"00000"	"RS1_000394"	"g.18665443T>C"	""	"{PMID:Hu 2017:28272453}"	""	"c.194A>G p.Tyr65Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647323T>C"	""	"likely pathogenic"	""
"0000829372"	"21"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.625C>T p.Arg209Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic"	""
"0000829373"	"21"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.626G>A p.Arg209His"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642053C>T"	""	"likely pathogenic"	""
"0000829374"	"21"	"70"	"X"	"18665356"	"18665358"	"del"	"0"	"00000"	"RS1_000379"	"g.18665356_18665358del"	""	"{PMID:Hu 2017:28272453}"	""	"c.282-284del p.95del"	"error in annotation, deleted residue not mentioned"	"Germline"	"yes"	""	"0"	""	""	"g.18647236_18647238del"	""	"likely pathogenic"	""
"0000829375"	"21"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000381"	"g.18665361C>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.276G>T p.Trp92Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647241C>A"	""	"likely pathogenic"	""
"0000829376"	"21"	"70"	"X"	"18665359"	"18665359"	"subst"	"0"	"00000"	"RS1_000260"	"g.18665359T>C"	""	"{PMID:Hu 2017:28272453}"	""	"c.278A>G p.Tyr93Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647239T>C"	""	"likely pathogenic"	""
"0000829377"	"21"	"70"	"X"	"18665421"	"18665421"	"subst"	"0"	"00000"	"RS1_000389"	"g.18665421C>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.216G>T p.Glu72Asp"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647301C>A"	""	"likely pathogenic"	""
"0000829378"	"21"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.421C>T p.Arg141Gly"	"error in annotation, p.(Arg141Gly) is caused by  c.421C>G and not c.421C>T (which causes p.(Arg141Cys), also present in databases)"	"Germline"	"yes"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000829379"	"21"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.637C>T p.Arg213Trp"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829380"	"21"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.625C>T p.Arg209Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic"	""
"0000829381"	"21"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.544C>T p.Arg182Cys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000829382"	"21"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.305G>A p.Arg102Gln"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829383"	"21"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.214G>A p.Glu72Lys"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829384"	"21"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.305G>A p.Arg102Gln"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829385"	"21"	"70"	"X"	"18665416"	"18665416"	"subst"	"0"	"00000"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.221G>T p.Gly74Val"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647296C>A"	""	"likely pathogenic"	""
"0000829386"	"21"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.589C>T p.Glu72Asp"	"error in annotation, p.(Glu72Asp) is caused by c.216G>T and not c.589C>T (which causesp.(Arg197Cys), also present in databases); probably a switch with the next patient no.26, who carries c.216G>T"	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829387"	"21"	"70"	"X"	"18665421"	"18665421"	"subst"	"0"	"00000"	"RS1_000389"	"g.18665421C>A"	""	"{PMID:Hu 2017:28272453}"	""	"c.216G>T p.Arg209Cys"	"error in annotation, p.(Arg209Cys) is caused by c.625C>T and not c.216G>T (which causes p.(Glu72Asp), erroneously written in patient 25)"	"Germline"	"yes"	""	"0"	""	""	"g.18647301C>A"	""	"likely pathogenic"	""
"0000829388"	"21"	"70"	"X"	"18660278"	"18660278"	"subst"	"0"	"00000"	"RS1_000065"	"g.18660278T>C"	""	"{PMID:Hu 2017:28272453}"	""	"c.523-2A>G"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642158T>C"	""	"likely pathogenic"	""
"0000829389"	"21"	"70"	"X"	"18662654"	"18662654"	"subst"	"0"	"00000"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Hu 2017:28272453}"	""	"c.418G>A p.Gly140Arg"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644534C>T"	""	"likely pathogenic"	""
"0000829390"	"21"	"70"	"X"	"18665419"	"18665419"	"del"	"0"	"00000"	"RS1_000387"	"g.18665419del"	""	"{PMID:Hu 2017:28272453}"	""	"c.218delC p.Ser73Ter"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647299del"	""	"likely pathogenic"	""
"0000829634"	"20"	"70"	"X"	"18690136"	"18690223"	"del"	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Fahim 2017:28348004}"	""	"del ex1"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000829635"	"20"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00000"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.35T>A, p.(Leu12His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic"	""
"0000829636"	"20"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00000"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.35T>A, p.(Leu12His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic"	""
"0000829637"	"20"	"70"	"X"	"18690135"	"18690135"	"subst"	"0"	"00000"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.52+2T>C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672015A>G"	""	"likely pathogenic"	""
"0000829638"	"20"	"70"	"X"	"18674772"	"18675786"	""	"0"	"00000"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 Deletion of exons 2 and 3"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18647333_18656652)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000829639"	"20"	"70"	"X"	"18674837"	"18674837"	"subst"	"0"	"00000"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.120C>A, p.(Cys40X)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656717G>T"	""	"likely pathogenic"	""
"0000829640"	"20"	"70"	"X"	"18665453"	"18665453"	"subst"	"0"	"00000"	"RS1_000397"	"g.18665453C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.185-1G>A, p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647333C>T"	""	"likely pathogenic"	""
"0000829641"	"20"	"70"	"X"	"18674771"	"18674771"	"subst"	"0"	"00000"	"RS1_000398"	"g.18674771A>C"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.184+2T>G, p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656651A>C"	""	"likely pathogenic"	""
"0000829642"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829643"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829644"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829645"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"0"	"00000"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.214G>C, p.(Glu72Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>G"	""	"likely pathogenic"	""
"0000829646"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"0"	"00000"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.214G>C, p.(Glu72Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>G"	""	"likely pathogenic"	""
"0000829647"	"20"	"70"	"X"	"18665398"	"18665398"	"subst"	"0"	"00000"	"RS1_000385"	"g.18665398T>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.239A>C, p.(Gln80Pro)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647278T>G"	""	"likely pathogenic"	""
"0000829648"	"20"	"70"	"X"	"18665395"	"18665395"	"subst"	"0"	"00000"	"RS1_000146"	"g.18665395A>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.242T>A, p.(Ile81Asn)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647275A>T"	""	"likely pathogenic"	""
"0000829649"	"20"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.276G>C, p.(Trp92Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic"	""
"0000829650"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829651"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829652"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829653"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829654"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829655"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829656"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829657"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829658"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829659"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829660"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.305G>A, p.(Arg102Gln)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000829661"	"20"	"70"	"X"	"18665320"	"18665320"	"subst"	"0"	"00000"	"RS1_000374"	"g.18665320T>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.317A>C, p.(Gln106Pro)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647200T>G"	""	"likely pathogenic"	""
"0000829662"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.325G>C, p.(G109R)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000829663"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"0"	"00000"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.325G>T, p.(G109W)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>A"	""	"likely pathogenic"	""
"0000829664"	"20"	"70"	"X"	"18665311"	"18665311"	"subst"	"0"	"00000"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.326G>C, p.(Gly109Ala)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647191C>G"	""	"likely pathogenic"	""
"0000829665"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.329G>A, p.(Cys110Tyr)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000829666"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.329G>A, p.(Cys110Tyr)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000829667"	"20"	"70"	"X"	"18662735"	"18662735"	"subst"	"0"	"00000"	"RS1_000043"	"g.18662735G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.337C>T, p.(Leu113Phe)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644615G>A"	""	"likely pathogenic"	""
"0000829668"	"20"	"70"	"X"	"18662694"	"18662694"	"del"	"0"	"00000"	"RS1_000365"	"g.18662694del"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.378delT, p.(Leu127Ter)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644574del"	""	"likely pathogenic"	""
"0000829669"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.421C>T, p.(R141C)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000829670"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.421C>T, p.(R141C)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000829671"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.421C>T, p.(R141C)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000829672"	"20"	"70"	"X"	"18662637"	"18662637"	"dup"	"0"	"00000"	"RS1_000357"	"g.18662637dup"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.435dupT, p.(Glu146fs)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644517dup"	""	"likely pathogenic"	""
"0000829673"	"20"	"70"	"X"	"18662576"	"18662576"	"subst"	"0"	"00000"	"RS1_000346"	"g.18662576A>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.496T>C, p.(Tyr166His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644456A>G"	""	"likely pathogenic"	""
"0000829674"	"20"	"70"	"X"	"18662564"	"18662564"	"subst"	"0"	"00000"	"RS1_000342"	"g.18662564T>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.508A>C, p.(Thr170Pro)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644444T>G"	""	"likely pathogenic"	""
"0000829675"	"20"	"70"	"X"	"18660273"	"18660273"	"subst"	"0"	"00000"	"RS1_000338"	"g.18660273A>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.526T>C, p.(Phe176Val)"	"error in annotation, c.526T>C causes p.(Phe176Leu) and not p.(Phe176Val)"	"Unknown"	"?"	""	"0"	""	""	"g.18642153A>G"	""	"likely pathogenic"	""
"0000829676"	"20"	"70"	"X"	"18660245"	"18660245"	"subst"	"0"	"00000"	"RS1_000098"	"g.18660245G>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.554C>A, p.(Thr185Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642125G>T"	""	"likely pathogenic"	""
"0000829677"	"20"	"70"	"X"	"18660245"	"18660245"	"subst"	"0"	"00000"	"RS1_000098"	"g.18660245G>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.554C>A, p.(Thr185Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642125G>T"	""	"likely pathogenic"	""
"0000829678"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.574C>T, p.(Pro192Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829679"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.574C>T, p.(Pro192Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829680"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.574C>T, p.(Pro192Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829681"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.574C>T, p.(Pro192Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829682"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.574C>T, p.(Pro192Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000829683"	"20"	"70"	"X"	"18660224"	"18660224"	"subst"	"0"	"00000"	"RS1_000159"	"g.18660224G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.575C>T, p.(Pro192Leu)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642104G>A"	""	"likely pathogenic"	""
"0000829684"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.579dupC, p.(Ile194fs)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829685"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.579dupC, p.(Ile194fs)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829686"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.579dupC, p.(Ile194fs)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000829687"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.589C>T, p.(Arg197Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000829688"	"20"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00000"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.596T>C, p.(Ile199Thr)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642083A>G"	""	"likely pathogenic"	""
"0000829689"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.598C>T, p.(Arg200Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000829690"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.598C>T, p.(Arg200Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000829691"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.598C>T, p.(Arg200Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000829692"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.598C>T, p.(Arg200Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000829693"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.599G>A, p.(Arg200His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000829694"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.608C>T, p.(P203L)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000829695"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829696"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Fahim 2017:28348004}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000829710"	"1"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Ellingford 2016:26872967}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	""
"0000829734"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829735"	"20"	"70"	"X"	"18662614"	"18662614"	"subst"	"0"	"00000"	"RS1_000352"	"g.18662614A>G"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.458T>C, p.(Val153Ala)"	""	"Germline"	"?"	""	"0"	""	""	"g.18644494A>G"	""	"likely pathogenic"	""
"0000829736"	"20"	"70"	"X"	"18662737"	"18662737"	"subst"	"0"	"00000"	"RS1_000306"	"g.18662737C>G"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.335G>C, p.(Trp112Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644617C>G"	""	"likely pathogenic"	""
"0000829737"	"20"	"70"	"X"	"18662662"	"18662745"	"del"	"0"	"00000"	"RS1_000361"	"g.18662662_18662745del"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.327_410del, p.(Cys110_Leu137del)"	""	"Germline"	"?"	""	"0"	""	""	"g.18644542_18644625del"	""	"likely pathogenic"	""
"0000829738"	"20"	"70"	"X"	"18662584"	"18662584"	"subst"	"0"	"00000"	"RS1_000349"	"g.18662584C>T"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.488G>A, p.(Trp163Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18644464C>T"	""	"likely pathogenic"	""
"0000829739"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829740"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829741"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829742"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829743"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829744"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829745"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	""	"Germline"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000829746"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Germline"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829747"	"20"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000351"	"g.18662611T>G"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.461A>C, p.(Gln154Pro)"	""	"Germline"	"?"	""	"0"	""	""	"g.18644491T>G"	""	"likely pathogenic"	""
"0000829748"	"20"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000351"	"g.18662611T>G"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.461A>C, p.(Gln154Pro)"	""	"Germline"	"?"	""	"0"	""	""	"g.18644491T>G"	""	"likely pathogenic"	""
"0000829749"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000829750"	"20"	"70"	"X"	"18662584"	"18662584"	"subst"	"0"	"00000"	"RS1_000349"	"g.18662584C>T"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.488G>A, p.(Trp163Ter)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644464C>T"	""	"likely pathogenic"	""
"0000829751"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829752"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829753"	"20"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.626G>A, p.(Arg209His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>T"	""	"likely pathogenic"	""
"0000829754"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829755"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829756"	"20"	"70"	"X"	"18660268"	"18660268"	"subst"	"0"	"00000"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Wang 2015:25999676}"	""	"RS1 c.531T>G, p.(Tyr177Ter)"	""	"Germline"	"?"	""	"0"	""	""	"g.18642148A>C"	""	"likely pathogenic"	""
"0000829772"	"21"	"70"	"X"	"18675759"	"18675759"	"subst"	"0"	"00000"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Sudha 2017:28574807}"	""	"c.78+1G>T"	""	"Germline"	"yes"	""	"0"	""	""	"g.18657639C>A"	""	"likely pathogenic"	""
"0000829800"	"20"	"70"	"X"	"18662656"	"18662656"	"del"	"0"	"00000"	"RS1_000051"	"g.18662656del"	""	"{PMID:Dockery 2017:29099798}"	""	"RS1 c.416delA, p.Gln139fs"	"only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees,"	"Germline"	"yes"	""	"0"	""	""	"g.18644536del"	""	"likely pathogenic"	""
"0000829801"	"20"	"70"	"X"	"18665310"	"18665310"	"subst"	"0"	"00000"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:Dockery 2017:29099798}"	""	"RS1 c.326+1G>A, p.?"	"only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees,"	"Germline"	"yes"	""	"0"	""	""	"g.18647190C>T"	""	"likely pathogenic"	""
"0000830082"	"20"	"70"	"X"	"18690135"	"18690135"	"subst"	"0"	"00000"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.52+2T>C, p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672015A>G"	""	"likely pathogenic"	""
"0000830083"	"20"	"70"	"X"	"18674864"	"18674864"	"dup"	"0"	"00000"	"RS1_000211"	"g.18674864dup"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.96dup, p.(Trp33Leufs*53)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656744dup"	""	"likely pathogenic"	""
"0000830084"	"20"	"70"	"X"	"18674860"	"18674860"	"del"	"0"	"00000"	"RS1_000261"	"g.18674860del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.97del, p.(Trp33Glyfs*93)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656740del"	""	"likely pathogenic"	""
"0000830085"	"20"	"70"	"X"	"18674772"	"18675786"	""	"0"	"00000"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exons 2, 3"	"deletion of exons 2, 3"	"Unknown"	"?"	""	"0"	""	""	"g.(18647333_18656652)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000830086"	"20"	"70"	"X"	"18665450"	"18665450"	"subst"	"0"	"00000"	"RS1_000395"	"g.18665450A>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.187T>A, p.(Cys63Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647330A>T"	""	"likely pathogenic"	""
"0000830087"	"20"	"70"	"X"	"18665431"	"18665431"	"subst"	"0"	"00000"	"RS1_000391"	"g.18665431A>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.206T>G, p.(Leu69Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647311A>C"	""	"likely pathogenic"	""
"0000830088"	"20"	"70"	"X"	"18665431"	"18665431"	"subst"	"0"	"00000"	"RS1_000391"	"g.18665431A>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.206T>G, p.(Leu69Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647311A>C"	""	"likely pathogenic"	""
"0000830089"	"20"	"70"	"X"	"18665431"	"18665431"	"subst"	"0"	"00000"	"RS1_000391"	"g.18665431A>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.206T>G, p.(Leu69Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647311A>C"	""	"likely pathogenic"	""
"0000830090"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830091"	"20"	"70"	"X"	"18665419"	"18665419"	"subst"	"0"	"00000"	"RS1_000319"	"g.18665419G>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.218C>A, p.(Ser73*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647299G>T"	""	"likely pathogenic"	""
"0000830092"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.214G>A, p.(Glu72Lys)"	"error in annotation, c.214G>A causes p.Glu72Lys and not p.Glu75Lys"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830093"	"20"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000382"	"g.18665361C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.276G>A, p.(Trp92*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>T"	""	"likely pathogenic"	""
"0000830094"	"20"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000382"	"g.18665361C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.276G>A, p.(Trp92*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>T"	""	"likely pathogenic"	""
"0000830095"	"20"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.288G>A, p.(Trp96*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647229C>T"	""	"likely pathogenic"	""
"0000830096"	"20"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.288G>A, p.(Trp96*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647229C>T"	""	"likely pathogenic"	""
"0000830097"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.325G>C, p.(Gly109Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000830098"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.325G>C, p.(Gly109Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000830099"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830100"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830101"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830102"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.304C>T, p.(Arg102Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830103"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.325G>C, p.(Gly109Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000830104"	"20"	"70"	"X"	"18665310"	"18665453"	""	"0"	"00000"	"RS1_000425"	"g.(18662746_18665310)_(18665453_18674772)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exon 4"	"deletion of exon 4"	"Unknown"	"?"	""	"0"	""	""	"g.(18644626_18647190)_(18647333_18656652)del"	""	"likely pathogenic"	""
"0000830105"	"20"	"70"	"X"	"18665310"	"18665453"	""	"0"	"00000"	"RS1_000425"	"g.(18662746_18665310)_(18665453_18674772)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exon 4"	"deletion of exon 4"	"Unknown"	"?"	""	"0"	""	""	"g.(18644626_18647190)_(18647333_18656652)del"	""	"likely pathogenic"	""
"0000830106"	"20"	"70"	"X"	"18665310"	"18690223"	""	"0"	"00000"	"RS1_000427"	"g.(18662746_18665310)_(18690223_?)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exons 1, 2, 3, 4"	"deletion of exons 1, 2, 3, 4"	"Unknown"	"?"	""	"0"	""	""	"g.(18644626_18647190)_(18672103_?)del"	""	"likely pathogenic"	""
"0000830107"	"20"	"70"	"X"	"18665310"	"18690223"	""	"0"	"00000"	"RS1_000427"	"g.(18662746_18665310)_(18690223_?)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exons 1, 2, 3, 4"	"deletion of exons 1, 2, 3, 4"	"Unknown"	"?"	""	"0"	""	""	"g.(18644626_18647190)_(18672103_?)del"	""	"likely pathogenic"	""
"0000830108"	"20"	"70"	"X"	"18662736"	"18662736"	"subst"	"0"	"00000"	"RS1_000316"	"g.18662736C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.336G>A, p.(Trp112*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644616C>T"	""	"likely pathogenic"	""
"0000830109"	"20"	"70"	"X"	"18662698"	"18662698"	"subst"	"0"	"00000"	"RS1_000202"	"g.18662698A>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.374T>G, p.(Ile125Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644578A>C"	""	"likely pathogenic"	""
"0000830110"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.421C>T, p.(Arg141Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000830111"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.422G>A, p.(Arg141His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830112"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.422G>A, p.(Arg141His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830113"	"20"	"70"	"X"	"18662614"	"18662614"	"del"	"0"	"00000"	"RS1_000353"	"g.18662614del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.458del, p.(Val153Glyfs*9)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644494del"	""	"likely pathogenic"	""
"0000830114"	"20"	"70"	"X"	"18662648"	"18662648"	"subst"	"0"	"00000"	"CDKL5_000164"	"g.18662648A>G"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.424C>T, p.(Cys142Arg)"	"error in annotation, p.Cys142Arg is caused by c.424T>C and not c.424C>T (variant reference (C) does not agree with reference sequence (T))"	"Unknown"	"?"	""	"0"	""	""	"g.18644528A>G"	""	"likely pathogenic"	""
"0000830115"	"20"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.461A>G, p.(Gln154Arg)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644491T>C"	""	"likely pathogenic"	""
"0000830116"	"20"	"70"	"X"	"18660264"	"18660264"	"subst"	"0"	"00000"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.535A>G, p.(Asn179Asp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642144T>C"	""	"likely pathogenic"	""
"0000830117"	"20"	"70"	"X"	"18662549"	"18675786"	"del"	"0"	"00000"	"RS1_000426"	"g.(18660277_18662549)_(18675786_18690136)del"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 deletion of exons 2, 3, 4, 5"	"deletion of exons 2, 3, 4, 5"	"Unknown"	"?"	""	"0"	""	""	"g.(18642157_18644429)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000830118"	"20"	"70"	"X"	"18660222"	"18660222"	"subst"	"0"	"00000"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.577C>T, p.(Pro193Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642102G>A"	""	"likely pathogenic"	""
"0000830119"	"20"	"70"	"X"	"18660222"	"18660222"	"subst"	"0"	"00000"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.577C>T, p.(Pro193Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642102G>A"	""	"likely pathogenic"	""
"0000830120"	"20"	"70"	"X"	"18660218"	"18660218"	"subst"	"0"	"00000"	"RS1_000334"	"g.18660218A>C"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.581T>G, p.(Ile194Ser)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642098A>C"	""	"likely pathogenic"	""
"0000830121"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.590G>A, p.(Arg197His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000830122"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.590G>A, p.(Arg197His)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000830123"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.589C>T, p.(Arg197Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000830124"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.589C>T, p.(Arg197Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000830125"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.598C>T, p.(Arg200Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000830126"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.608C>T, p.(Pro203Leu)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000830127"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.608C>T, p.(Pro203Leu)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000830128"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.608C>T, p.(Pro203Leu)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000830129"	"20"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.625C>T, p.(Arg209Cys)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic"	""
"0000830130"	"20"	"70"	"X"	"18660167"	"18660167"	"subst"	"0"	"00000"	"RS1_000329"	"g.18660167G>T"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.632C>A, p.(Ala211Asp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642047G>T"	""	"likely pathogenic"	""
"0000830131"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000830132"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000830133"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Ores 2018:29739629}"	""	"RS1 c.637C>T, p.(Arg213Trp)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000830155"	"20"	"70"	"X"	"18660164"	"18660164"	"subst"	"0"	"00000"	"RS1_000328"	"g.18660164A>T"	""	"{PMID:Piermarocchi 2017:28811895}"	""	"RS1 c.635A>T, p.(lle212Asn)"	"error in annotation, p.(lle212Asn) is caused by c.635T>A and not  c.635A>T (variant reference (A) does not agree with reference sequence (T))"	"Germline"	"yes"	""	"0"	""	""	"g.18642044A>T"	""	"likely pathogenic"	""
"0000830156"	"20"	"70"	"X"	"18660164"	"18660164"	"subst"	"0"	"00000"	"RS1_000328"	"g.18660164A>T"	""	"{PMID:Piermarocchi 2017:28811895}"	""	"RS1 c.635A>T, p.(lle212Asn)"	"error in annotation, p.(lle212Asn) is caused by c.635T>A and not  c.635A>T (variant reference (A) does not agree with reference sequence (T))"	"Germline"	"yes"	""	"0"	""	""	"g.18642044A>T"	""	"likely pathogenic"	""
"0000830157"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Abalem 2018:29902095}"	""	"c.286T>C (p.W96R)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830158"	"20"	"70"	"X"	"18675759"	"18675786"	""	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Abalem 2018:29902095}"	""	"Deletion of exon 2"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000830159"	"20"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Abalem 2018:29902095}"	""	"c. 208 G>A (p.G70S)"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>T"	""	"likely pathogenic"	""
"0000830160"	"20"	"70"	"X"	"18662710"	"18662710"	"del"	"0"	"00000"	"RS1_000368"	"g.18662710del"	""	"{PMID:Lee 2019:30215241}"	""	"c.362delA (p.Gln121ArgfsTer5)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644590del"	""	"likely pathogenic"	""
"0000830161"	"20"	"70"	"X"	"18662710"	"18662710"	"del"	"0"	"00000"	"RS1_000368"	"g.18662710del"	""	"{PMID:Lee 2019:30215241}"	""	"c.362delA (p.Gln121ArgfsTer5)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644590del"	""	"likely pathogenic"	""
"0000830162"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830163"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830164"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830165"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830166"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830167"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830168"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830169"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830170"	"20"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Stephenson 2018:30419843}"	""	"RS1 c.413C>A , p.(Thr138Asn)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	""
"0000830171"	"21"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000212"	"g.18660200C>A"	""	"{PMID:Strupaite 2018:30450322}"	""	"RS1 c.599G>T, (p.R200L)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642080C>A"	""	"pathogenic"	""
"0000830172"	"21"	"70"	"X"	"18674864"	"18674864"	"dup"	"0"	"00000"	"RS1_000211"	"g.18674864dup"	""	"{PMID:Strupaite 2018:30450322}"	""	"RS1 c.(92_97)insC, (p.W33fs)"	"error in annotation, variant automapped to c.96dup"	"Germline"	"yes"	""	"0"	""	""	"g.18656744dup"	""	"likely pathogenic"	""
"0000830173"	"21"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Strupaite 2018:30450322}"	""	"RS1 c.422G>A, (p.R141H)"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	""
"0000830194"	"20"	"70"	"X"	"18690188"	"18690188"	"subst"	"0"	"00000"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.1A>T, p.Met1Lle"	"error in annotation initiation codon mutations should be annotated p.Met1?"	"Unknown"	"?"	""	"0"	""	""	"g.18672068T>A"	""	"likely pathogenic"	""
"0000830195"	"20"	"70"	"X"	"18690188"	"18690188"	"subst"	"0"	"00000"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.1A>T, p.Met1Lle"	"error in annotation initiation codon mutations should be annotated p.Met1?"	"Unknown"	"?"	""	"0"	""	""	"g.18672068T>A"	""	"likely pathogenic"	""
"0000830196"	"20"	"70"	"X"	"18665434"	"18665434"	"subst"	"0"	"00000"	"RS1_000392"	"g.18665434G>C"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.203C>G, pPro68Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647314G>C"	""	"likely pathogenic"	""
"0000830197"	"20"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.208G>A, p.Gly70Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>T"	""	"likely pathogenic"	""
"0000830198"	"20"	"70"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.208G>A, p.Gly70Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>T"	""	"likely pathogenic"	""
"0000830199"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830200"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830201"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830202"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830203"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830204"	"20"	"70"	"X"	"18665371"	"18665371"	"subst"	"0"	"00000"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.266A>G, p.Tyr89Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647251T>C"	""	"likely pathogenic"	""
"0000830205"	"20"	"70"	"X"	"18665359"	"18665359"	"subst"	"0"	"00000"	"RS1_000380"	"g.18665359T>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.278A>C, p.Tyr93Cys"	"error in annotation: c.278A>C causes p.Tyr93Ser and not p.Tyr93Cys"	"Unknown"	"?"	""	"0"	""	""	"g.18647239T>G"	""	"likely pathogenic"	""
"0000830206"	"20"	"70"	"X"	"18665359"	"18665359"	"subst"	"0"	"00000"	"RS1_000380"	"g.18665359T>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.278A>C, p.Tyr93Cys"	"error in annotation: c.278A>C causes p.Tyr93Ser and not p.Tyr93Cys"	"Unknown"	"?"	""	"0"	""	""	"g.18647239T>G"	""	"likely pathogenic"	""
"0000830207"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830208"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830209"	"20"	"70"	"X"	"18674864"	"18674864"	"dup"	"0"	"00000"	"RS1_000211"	"g.18674864dup"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.96dupC, p.Trp33Leu*53"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656744dup"	""	"likely pathogenic"	""
"0000830210"	"20"	"70"	"X"	"18674858"	"18674858"	"subst"	"0"	"00000"	"RS1_000400"	"g.18674858C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.99G>A, p.Trp33*"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656738C>T"	""	"likely pathogenic"	""
"0000830211"	"20"	"70"	"X"	"18665417"	"18665417"	"dup"	"0"	"00000"	"RS1_000386"	"g.18665417dup"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.223dupG, p.Glu75Gly*85"	"error in annotation: c.223dupG, p.Glu75Glyfs* causes termination codon to appear after 11 and not 85 amino acids"	"Unknown"	"?"	""	"0"	""	""	"g.18647297dup"	""	"likely pathogenic"	""
"0000830212"	"20"	"70"	"X"	"18662553"	"18662553"	"del"	"0"	"00000"	"RS1_000191"	"g.18662553del"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.520delC, p.Arg174Gly"	"error in annotation: c.520delC causes p.Arg174Glyfs*63 and not p.Arg174Gly"	"Unknown"	"?"	""	"0"	""	""	"g.18644433del"	""	"likely pathogenic"	""
"0000830213"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830214"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830215"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830216"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.286T>C, p.Tryp96Arg"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830217"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830218"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830219"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830220"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.305G>A, p.Arg102Gln"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000830221"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"p.325G>C, p.Gly109Arg"	"error in annotation \"\"p.\"\" instead of \"\"c\"\""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000830222"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"p.325G>C, p.Gly109Arg"	"error in annotation \"\"p.\"\" instead of \"\"c\"\""	"Unknown"	"?"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000830223"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.329G>A, p.Cys110Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000830224"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.329G>A, p.Cys110Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000830225"	"20"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00000"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.329G>As, p.Cys110Tyr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic"	""
"0000830226"	"20"	"70"	"X"	"18660264"	"18660264"	"subst"	"0"	"00000"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.535A>G, p.Asn179Asp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642144T>C"	""	"likely pathogenic"	""
"0000830227"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000830228"	"20"	"70"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Pennesi 2018:30551202}"	""	"579DupC, p.Ile194His"	"error in annotation both in cDNA (no \"\"c.\"\" and protein change should be p.Ile194Hisfs*70 and not p.Ile194His"	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"likely pathogenic"	""
"0000830229"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Pennesi 2018:30551202}"	""	"exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000830230"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Pennesi 2018:30551202}"	""	"exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000830231"	"20"	"70"	"X"	"18690136"	"18690223"	""	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Pennesi 2018:30551202}"	""	"exon 1 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000830232"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000830233"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000830234"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000830235"	"20"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00000"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.596T>C, pIle199Thr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642083A>G"	""	"likely pathogenic"	""
"0000830236"	"20"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00000"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.596T>C, pIle199Thr"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642083A>G"	""	"likely pathogenic"	""
"0000830237"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.598C>T, p.Arg200Cys"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000830238"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.599G>A, p.Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830239"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.599G>A, p.Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830240"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.599G>A, p.Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830241"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.599G>A, p.Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830242"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.599G>A, p.Arg200His"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830243"	"20"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000310"	"g.18660173C>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.626G>C, p.Arg209Pro"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>G"	""	"likely pathogenic"	""
"0000830244"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.637C>T, p.Arg213Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000830245"	"20"	"70"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.637C>T, p.Arg213Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"likely pathogenic"	""
"0000830246"	"20"	"70"	"X"	"18675759"	"18675786"	""	"0"	"00000"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Pennesi 2018:30551202}"	""	"exon 2 deletion"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000830247"	"20"	"70"	"X"	"18690135"	"18690135"	"subst"	"0"	"00000"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.52+2T>C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672015A>G"	""	"likely pathogenic"	""
"0000830248"	"20"	"70"	"X"	"18662549"	"18662549"	"subst"	"0"	"00000"	"RS1_000148"	"g.18662549C>T"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.522+1G>A"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644429C>T"	""	"likely pathogenic"	""
"0000830249"	"20"	"70"	"X"	"18660277"	"18660277"	"subst"	"0"	"00000"	"RS1_000339"	"g.18660277C>G"	""	"{PMID:Pennesi 2018:30551202}"	""	"c.523-1G>C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642157C>G"	""	"likely pathogenic"	""
"0000830250"	"20"	"70"	"X"	"18662696"	"18662696"	"subst"	"0"	"00000"	"RS1_000199"	"g.18662696C>G"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.376G>C, D126H"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644576C>G"	""	"likely pathogenic"	""
"0000830251"	"20"	"70"	"X"	"18660218"	"18660220"	"dup"	"0"	"00000"	"RS1_000206"	"g.18660218_18660220dup"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.583_585dupATC, I195dup"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642098_18642100dup"	""	"likely pathogenic"	""
"0000830252"	"20"	"70"	"X"	"18662640"	"18662687"	"dup"	"0"	"00000"	"RS1_000200"	"g.18662640_18662687dup"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.387_434dup48, Q129_I144dup"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644520_18644567dup"	""	"likely pathogenic"	""
"0000830253"	"20"	"70"	"X"	"18662640"	"18662687"	"dup"	"0"	"00000"	"RS1_000200"	"g.18662640_18662687dup"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.387_434dup48, Q129_I144dup"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644520_18644567dup"	""	"likely pathogenic"	""
"0000830254"	"20"	"70"	"X"	"18660225"	"18660225"	"del"	"0"	"00000"	"RS1_000205"	"g.18660225del"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.579delC, I194Sfs*43"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642105del"	""	"likely pathogenic"	""
"0000830255"	"20"	"70"	"X"	"18662698"	"18662698"	"subst"	"0"	"00000"	"RS1_000202"	"g.18662698A>C"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.374T>G, I125R"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644578A>C"	""	"likely pathogenic"	""
"0000830256"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.590G>A , R197H"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000830257"	"20"	"70"	"X"	"18665351"	"18665351"	"subst"	"0"	"00000"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.286T>C, W96R"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647231A>G"	""	"likely pathogenic"	""
"0000830258"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.421C>T, R141C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000830259"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.421C>T, R141C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"likely pathogenic"	""
"0000830260"	"20"	"70"	"X"	"18660136"	"18660136"	"dup"	"0"	"00000"	"RS1_000204"	"g.18660136dup"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.663dupC, K222Qfs*42"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642016dup"	""	"likely pathogenic"	""
"0000830261"	"20"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 C.544C>T, R182C"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000830262"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.422G>A, R141H"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830263"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.422G>A, R141H"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830264"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.422G>A, R141H"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830265"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.214G>A, E72K"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830266"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.214G>A, E72K"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830267"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.214G>A, E72K"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830268"	"20"	"70"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000359"	"g.18662651G>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.421C>A, R141S"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>T"	""	"likely pathogenic"	""
"0000830269"	"20"	"70"	"X"	"18662723"	"18662723"	"subst"	"0"	"00000"	"RS1_000201"	"g.18662723G>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.349C>T, Q117*"	""	"Unknown"	"?"	""	"0"	""	""	"g.18644603G>A"	""	"likely pathogenic"	""
"0000830270"	"20"	"70"	"X"	"18665370"	"18665370"	"subst"	"0"	"00000"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.267T>A, Y89*"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647250A>T"	""	"likely pathogenic"	""
"0000830271"	"20"	"70"	"X"	"18675759"	"18675759"	"subst"	"0"	"00000"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.78+1G>T , p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18657639C>A"	""	"likely pathogenic"	""
"0000830272"	"20"	"70"	"X"	"18675759"	"18675759"	"subst"	"0"	"00000"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.78+1G>T , p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18657639C>A"	""	"likely pathogenic"	""
"0000830273"	"20"	"70"	"X"	"18675759"	"18675759"	"subst"	"0"	"00000"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Sudha 2018:29851975}"	""	"RS1 c.78+1G>T , p.?"	""	"Unknown"	"?"	""	"0"	""	""	"g.18657639C>A"	""	"likely pathogenic"	""
"0000830310"	"20"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00000"	"RS1_000407"	"g.18690154A>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.35T>C, p.Leu12Pro"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672034A>G"	""	"likely pathogenic"	""
"0000830311"	"20"	"70"	"X"	"18690151"	"18690151"	"subst"	"0"	"00000"	"RS1_000109"	"g.18690151A>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.38T>C, p.Leu13Pro"	""	"Unknown"	"?"	"rs104894935"	"0"	""	""	"g.18672031A>G"	""	"likely pathogenic"	""
"0000830312"	"20"	"70"	"X"	"18690140"	"18690140"	"subst"	"0"	"00000"	"RS1_000406"	"g.18690140C>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.49G>T, p.Glu17*"	""	"Unknown"	"?"	""	"0"	""	""	"g.18672020C>A"	""	"likely pathogenic"	""
"0000830313"	"20"	"70"	"X"	"18674772"	"18675786"	""	"0"	"00000"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 exon2-3 del"	""	"Unknown"	"?"	""	"0"	""	""	"g.(18647333_18656652)_(18657666_18672016)del"	""	"likely pathogenic"	""
"0000830314"	"20"	"70"	"X"	"18675758"	"18675758"	"subst"	"0"	"00000"	"RS1_000403"	"g.18675758A>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.78+2T>C, undetermined splicing defect"	""	"Unknown"	"?"	""	"0"	""	""	"g.18657638A>G"	""	"likely pathogenic"	""
"0000830315"	"20"	"70"	"X"	"18674772"	"18674879"	""	"0"	"00000"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 exon3 del"	""	"Germline"	"yes"	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"likely pathogenic"	""
"0000830316"	"20"	"70"	"X"	"18674772"	"18674879"	""	"0"	"00000"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 exon3 del"	""	"Germline"	"yes"	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"likely pathogenic"	""
"0000830317"	"20"	"70"	"X"	"18674859"	"18674859"	"subst"	"0"	"00000"	"RS1_000401"	"g.18674859C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.98G>A, p.Trp33*"	""	"Unknown"	"?"	""	"0"	""	""	"g.18656739C>T"	""	"likely pathogenic"	""
"0000830318"	"20"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.175T>G, p.Cys59Gly"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000830319"	"20"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.175T>G, p.Cys59Gly"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000830320"	"20"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.175T>G, p.Cys59Gly"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000830321"	"20"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.175T>G, p.Cys59Gly"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000830322"	"20"	"70"	"X"	"18674782"	"18674782"	"subst"	"0"	"00000"	"RS1_000293"	"g.18674782A>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.175T>G, p.Cys59Gly"	""	"Germline"	"yes"	""	"0"	""	""	"g.18656662A>C"	""	"likely pathogenic"	""
"0000830323"	"20"	"70"	"X"	"18665451"	"18665452"	"ins"	"0"	"00000"	"RS1_000396"	"g.18665451_18665452insA"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.185_186insT, p.Glu62Aspfs*24"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647331_18647332insA"	""	"likely pathogenic"	""
"0000830324"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830325"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830326"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830327"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Germline"	"yes"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830328"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Germline"	"yes"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830329"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Unknown"	"?"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830330"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Germline"	"yes"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830331"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.214G>A, p.Glu72Lys"	""	"Germline"	"yes"	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000830332"	"20"	"70"	"X"	"18665419"	"18665419"	"subst"	"0"	"00000"	"RS1_000388"	"g.18665419G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.218C>T, p.Ser73Leu"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647299G>A"	""	"likely pathogenic"	""
"0000830333"	"20"	"70"	"X"	"18665371"	"18665371"	"subst"	"0"	"00000"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.266A>G, p.Tyr89Cys"	""	"Unknown"	"?"	"rs61752060"	"0"	""	""	"g.18647251T>C"	""	"likely pathogenic"	""
"0000830334"	"20"	"70"	"X"	"18665371"	"18665371"	"subst"	"0"	"00000"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.266A>G, p.Tyr89Cys"	""	"Unknown"	"?"	"rs61752060"	"0"	""	""	"g.18647251T>C"	""	"likely pathogenic"	""
"0000830335"	"20"	"70"	"X"	"18665371"	"18665371"	"subst"	"0"	"00000"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.266A>G, p.Tyr89Cys"	""	"Unknown"	"?"	"rs61752060"	"0"	""	""	"g.18647251T>C"	""	"likely pathogenic"	""
"0000830336"	"20"	"70"	"X"	"18665371"	"18665371"	"subst"	"0"	"00000"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.266A>G, p.Tyr89Cys"	""	"Unknown"	"?"	"rs61752060"	"0"	""	""	"g.18647251T>C"	""	"likely pathogenic"	""
"0000830337"	"20"	"70"	"X"	"18665370"	"18665370"	"subst"	"0"	"00000"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.267T>A, p.Tyr89*"	""	"Germline"	"yes"	"rs61752061"	"0"	""	""	"g.18647250A>T"	""	"likely pathogenic"	""
"0000830338"	"20"	"70"	"X"	"18665370"	"18665370"	"subst"	"0"	"00000"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.267T>A, p.Tyr89*"	""	"Germline"	"yes"	"rs61752061"	"0"	""	""	"g.18647250A>T"	""	"likely pathogenic"	""
"0000830339"	"20"	"70"	"X"	"18665352"	"18665352"	"del"	"0"	"00000"	"RS1_000378"	"g.18665352del"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.285delG, p.Trp96Glyfs*30"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647232del"	""	"likely pathogenic"	""
"0000830340"	"20"	"70"	"X"	"18665336"	"18665336"	"subst"	"0"	"00000"	"RS1_000127"	"g.18665336C>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.301G>C, p.Ala101Pro"	""	"Unknown"	"?"	"rs61752066"	"0"	""	""	"g.18647216C>G"	""	"likely pathogenic"	""
"0000830341"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830342"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.304C>T, p.Arg102Trp"	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830343"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.304C>T, p.Arg102Trp"	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830344"	"20"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.304C>T, p.Arg102Trp"	""	"Unknown"	"?"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic"	""
"0000830345"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.305G>A, p.Arg102Gln"	""	"Unknown"	"?"	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000830346"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.305G>A, p.Arg102Gln"	""	"Germline"	"yes"	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000830347"	"20"	"70"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.305G>A, p.Arg102Gln"	""	"Germline"	"yes"	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"likely pathogenic"	""
"0000830348"	"20"	"70"	"X"	"18665311"	"18665311"	"subst"	"0"	"00000"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.326G>C, p.Gly109Ala"	""	"Unknown"	"?"	""	"0"	""	""	"g.18647191C>G"	""	"likely pathogenic"	""
"0000830349"	"20"	"70"	"X"	"18662742"	"18662742"	"subst"	"0"	"00000"	"RS1_000120"	"g.18662742A>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.330T>A, p.Cys110*"	""	"Germline"	"yes"	"rs1801161"	"0"	""	""	"g.18644622A>T"	""	"likely pathogenic"	""
"0000830350"	"20"	"70"	"X"	"18662742"	"18662742"	"subst"	"0"	"00000"	"RS1_000120"	"g.18662742A>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.330T>A, p.Cys110*"	""	"Germline"	"yes"	"rs1801161"	"0"	""	""	"g.18644622A>T"	""	"likely pathogenic"	""
"0000830351"	"20"	"70"	"X"	"18662668"	"18662668"	"subst"	"0"	"00000"	"RS1_000363"	"g.18662668C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.404G>A, p.Gly135Glu"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644548C>T"	""	"likely pathogenic"	""
"0000830352"	"20"	"70"	"X"	"18662655"	"18662655"	"subst"	"0"	"00000"	"RS1_000360"	"g.18662655C>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.417G>T, p.Gln139His"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644535C>A"	""	"likely pathogenic"	""
"0000830353"	"20"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.422G>A, p.Arg141His"	""	"Unknown"	"?"	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic"	""
"0000830354"	"20"	"70"	"X"	"18662634"	"18662634"	"subst"	"0"	"00000"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.438G>C, p.Glu146Asp"	""	"Germline"	"yes"	"rs61753163"	"0"	""	""	"g.18644514C>G"	""	"likely pathogenic"	""
"0000830355"	"20"	"70"	"X"	"18662549"	"18662549"	"subst"	"0"	"00000"	"RS1_000148"	"g.18662549C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.522+1G>A, undetermined splicing defect"	""	"Unknown"	"?"	"rs281865348"	"0"	""	""	"g.18644429C>T"	""	"likely pathogenic"	""
"0000830356"	"20"	"70"	"X"	"18660277"	"18660277"	"subst"	"0"	"00000"	"RS1_000340"	"g.18660277C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.523-1G>A, undetermined splicing defect"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642157C>T"	""	"likely pathogenic"	""
"0000830357"	"20"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.544C>T, p.Arg182Cys"	""	"Unknown"	"?"	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000830358"	"20"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.544C>T, p.Arg182Cys"	""	"Unknown"	"?"	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000830359"	"20"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.544C>T, p.Arg182Cys"	""	"Unknown"	"?"	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000830360"	"20"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00000"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.544C>T, p.Arg182Cys"	""	"Unknown"	"?"	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic"	""
"0000830361"	"20"	"70"	"X"	"18660225"	"18660225"	"subst"	"0"	"00000"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.574C>T, p.Pro192Ser"	""	"Unknown"	"?"	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"likely pathogenic"	""
"0000830362"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.589C>T, p.Arg197Cys"	""	"Unknown"	"?"	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000830363"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.589C>T, p.Arg197Cys"	""	"Unknown"	"?"	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000830364"	"20"	"70"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.589C>T, p.Arg197Cys"	""	"Unknown"	"?"	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"likely pathogenic"	""
"0000830365"	"20"	"70"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.590G>A, p.Arg197His"	""	"Unknown"	"?"	"rs281865355"	"0"	""	""	"g.18642089C>T"	""	"likely pathogenic"	""
"0000830366"	"20"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.598C>T, p.Arg200Cys"	""	"Germline"	"yes"	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000830367"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.599G>A, p.Arg200His"	""	"Unknown"	"?"	"rs281865358"	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830368"	"20"	"70"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.599G>A, p.Arg200His"	""	"Unknown"	"?"	"rs281865358"	"0"	""	""	"g.18642080C>T"	""	"likely pathogenic"	""
"0000830369"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.608C>T, p.Pro203Leu"	""	"Unknown"	"?"	"rs104894930"	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000830370"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.608C>T, p.Pro203Leu"	""	"Unknown"	"?"	"rs104894930"	"0"	""	""	"g.18642071G>A"	""	"likely pathogenic"	""
"0000830371"	"20"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.625C>T, p.Arg209Cys"	""	"Unknown"	"?"	"rs281865361"	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic"	""
"0000830372"	"20"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000330"	"g.18660174G>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.625C>A, p.Arg209Ser"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642054G>T"	""	"likely pathogenic"	""
"0000830373"	"20"	"70"	"X"	"18660161"	"18660161"	"subst"	"0"	"00000"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.638G>A, p.Arg213Gln"	""	"Unknown"	"?"	"rs281865364"	"0"	""	""	"g.18642041C>T"	""	"likely pathogenic"	""
"0000830374"	"20"	"70"	"X"	"18660142"	"18660142"	"subst"	"0"	"00000"	"RS1_000326"	"g.18660142G>C"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.657C>G, p.Cys219Trp"	""	"Unknown"	"?"	""	"0"	""	""	"g.18642022G>C"	""	"likely pathogenic"	""
"0000830375"	"20"	"70"	"X"	"18660132"	"18660132"	"subst"	"0"	"00000"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.667T>C, p.Cys223Arg"	""	"Germline"	"yes"	"rs104894929"	"0"	""	""	"g.18642012A>G"	""	"likely pathogenic"	""
"0000830376"	"20"	"70"	"X"	"18660132"	"18660132"	"subst"	"0"	"00000"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Kondo 2019:30652005}"	""	"RS1 c.667T>C, p.Cys223Arg"	""	"Germline"	"yes"	"rs104894929"	"0"	""	""	"g.18642012A>G"	""	"likely pathogenic"	""
"0000830418"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Christodoulou 2019:30923717}"	""	"c.578_579incC;p.HisfsX264"	"c.578_579insC automapped to NM_000330.4:c.579dupC"	"Germline"	"yes"	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	""
"0000830454"	"21"	"90"	"X"	"18662695"	"18662697"	"del"	"0"	"00000"	"RS1_000366"	"g.18662695_18662697del"	""	"{PMID:Selvan 2018:31238476}"	""	"c. 375_377 del AGA"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644575_18644577del"	""	"pathogenic"	""
"0000830455"	"21"	"90"	"X"	"18662695"	"18662697"	"del"	"0"	"00000"	"RS1_000366"	"g.18662695_18662697del"	""	"{PMID:Selvan 2018:31238476}"	""	"c. 375_377 del AGA"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644575_18644577del"	""	"pathogenic"	""
"0000830496"	"21"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Smith 2020:32124668}"	""	"p.Gln154Arg:c.461A>G"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644491T>C"	""	"likely pathogenic"	""
"0000830497"	"21"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00000"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Smith 2020:32124668}"	""	"p.Gln154Arg:c.461A>G"	""	"Germline"	"yes"	""	"0"	""	""	"g.18644491T>C"	""	"likely pathogenic"	""
"0000830498"	"21"	"70"	"X"	"18665386"	"18665386"	"subst"	"5.59375E-6"	"00000"	"RS1_000384"	"g.18665386G>C"	""	"{PMID:Smith 2020:32124668}"	""	"p.Ser84Cys: c.251C>G"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647266G>C"	""	"likely pathogenic"	""
"0000830499"	"20"	"90"	"X"	"18676206"	"18691680"	"del"	"0"	"00000"	"RS1_000422"	"g.18676206_18691680del"	"1/90 cases RS"	"{PMID:Chen 2020:32300273}"	""	"del ex1"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18658086_18673560del"	""	"pathogenic"	"ACMG"
"0000830500"	"20"	"90"	"X"	"18690135"	"18690141"	"dup"	"0"	"00000"	"RS1_000404"	"g.18690135_18690141dup"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.52+2_3 ins tgaaggt"	"error in annotation: c.52+2_52+3instgaaggt automapped to c.48_52+2dup; number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18672015_18672021dup"	""	"pathogenic"	"ACMG"
"0000830501"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00000"	"RS1_000405"	"g.18690136C>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.52+1g>c"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18672016C>G"	""	"pathogenic"	"ACMG"
"0000830502"	"20"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00000"	"RS1_000014"	"g.18690136C>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.52+1g>t"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18672016C>A"	""	"pathogenic"	"ACMG"
"0000830503"	"20"	"70"	"X"	"18675755"	"18675755"	"subst"	"0"	"00000"	"RS1_000402"	"g.18675755C>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.78+5G>T"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18657635C>A"	""	"likely pathogenic"	"ACMG"
"0000830504"	"20"	"90"	"X"	"18674859"	"18674859"	"subst"	"0"	"00000"	"RS1_000401"	"g.18674859C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.98G>A, p.W33X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18656739C>T"	""	"pathogenic"	"ACMG"
"0000830505"	"20"	"90"	"X"	"18674781"	"18674781"	"subst"	"0"	"00000"	"RS1_000320"	"g.18674781C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.176G>A , p. C59Y"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18656661C>T"	""	"pathogenic"	"ACMG"
"0000830506"	"20"	"90"	"X"	"18665441"	"18665441"	"subst"	"0"	"00000"	"RS1_000393"	"g.18665441G>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.196C>A, p.H66N"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647321G>T"	""	"pathogenic"	"ACMG"
"0000830507"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.208G>A , p.G70S"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	"ACMG"
"0000830508"	"20"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00000"	"RS1_000028"	"g.18665429C>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.208G>A , p.G70S"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic"	"ACMG"
"0000830509"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.214G>A , p.E72K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	"ACMG"
"0000830510"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.214G>A , p.E72K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	"ACMG"
"0000830511"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.214G>A , p.E72K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	"ACMG"
"0000830512"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.214G>A , p.E72K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	"ACMG"
"0000830513"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00000"	"RS1_000124"	"g.18665423C>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.214G>C , p.E72Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic"	"ACMG"
"0000830514"	"20"	"90"	"X"	"18665395"	"18665395"	"subst"	"0"	"00000"	"RS1_000146"	"g.18665395A>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.242T>A, p.I81N"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647275A>T"	""	"pathogenic"	"ACMG"
"0000830515"	"20"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000382"	"g.18665361C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.276G>A , p.W92X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>T"	""	"pathogenic"	"ACMG"
"0000830516"	"20"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000381"	"g.18665361C>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.276G>T , p.W92C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647241C>A"	""	"pathogenic"	"ACMG"
"0000830517"	"20"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00000"	"RS1_000317"	"g.18665349C>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.288G>C , p.W96C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647229C>G"	""	"pathogenic"	"ACMG"
"0000830518"	"20"	"90"	"X"	"18665344"	"18665345"	"del"	"0"	"00000"	"RS1_000377"	"g.18665344_18665345del"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.292_293del, p.A98Kfs*22"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647224_18647225del"	""	"pathogenic"	"ACMG"
"0000830519"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.304C>T , p.R102W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	"ACMG"
"0000830520"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00000"	"RS1_000004"	"g.18665333G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.304C>T , p.R102W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	"ACMG"
"0000830521"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.305G>A , p.R102Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	"ACMG"
"0000830522"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.305G>A , p.R102Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	"ACMG"
"0000830523"	"20"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00000"	"RS1_000036"	"g.18665332C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.305G>A , p.R102Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic"	"ACMG"
"0000830524"	"20"	"70"	"X"	"18665326"	"18665326"	"subst"	"0"	"00000"	"RS1_000375"	"g.18665326T>C"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.311A>G , p.N104S"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647206T>C"	""	"likely pathogenic"	"ACMG"
"0000830525"	"20"	"90"	"X"	"18665290"	"18665320"	"del"	"0"	"00000"	"RS1_000372"	"g.18665290_18665320del"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.317_326+21del,"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647170_18647200del"	""	"pathogenic"	"ACMG"
"0000830526"	"20"	"90"	"X"	"18665308"	"18665310"	"delins"	"0"	"00000"	"RS1_000373"	"g.18665308_18665310delinsA"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.326+1_326+3delinsT,"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18647188_18647190delinsA"	""	"pathogenic"	"ACMG"
"0000830527"	"20"	"90"	"X"	"18662747"	"18662747"	"subst"	"0"	"00000"	"RS1_000371"	"g.18662747T>C"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.327-2A>G,"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644627T>C"	""	"pathogenic"	"ACMG"
"0000830528"	"20"	"90"	"X"	"18662702"	"18662702"	"subst"	"0"	"00000"	"RS1_000367"	"g.18662702G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.370C>T, p.Q124X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644582G>A"	""	"pathogenic"	"ACMG"
"0000830529"	"20"	"90"	"X"	"18662702"	"18662702"	"subst"	"0"	"00000"	"RS1_000367"	"g.18662702G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.370C>T, p.Q124X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644582G>A"	""	"pathogenic"	"ACMG"
"0000830530"	"20"	"90"	"X"	"18662662"	"18662759"	"del"	"0"	"00000"	"RS1_000362"	"g.18662662_18662759del"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.327-14_410del,"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644542_18644639del"	""	"pathogenic"	"ACMG"
"0000830531"	"20"	"90"	"X"	"18662742"	"18662742"	"del"	"0"	"00000"	"RS1_000370"	"g.18662742del"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.330del, p.C110Wfs*16"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644622del"	""	"pathogenic"	"ACMG"
"0000830532"	"20"	"90"	"X"	"18662738"	"18662738"	"subst"	"0"	"00000"	"RS1_000369"	"g.18662738A>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.334T>C , p.W112R"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644618A>G"	""	"pathogenic"	"ACMG"
"0000830533"	"20"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00000"	"RS1_000045"	"g.18662698_18662701del"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.375_378del , p.D126X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic"	"ACMG"
"0000830534"	"20"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00000"	"RS1_000045"	"g.18662698_18662701del"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.375_378del , p.D126X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic"	"ACMG"
"0000830535"	"20"	"90"	"X"	"18662687"	"18662689"	"del"	"0"	"00000"	"RS1_000364"	"g.18662687_18662689del"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.383_385del, p.E129Ifs*139"	"error in annotation: c.383_385del automapped to c.385_387del; it does not cause frameshift p.Glu129Ilefs*139 but an in-frame deletion p.Glu129del; number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644567_18644569del"	""	"pathogenic"	"ACMG"
"0000830536"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00000"	"RS1_000055"	"g.18662651G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.421C>T , p.R141C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic"	"ACMG"
"0000830537"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.422G>A , p.R141H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	"ACMG"
"0000830538"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.422G>A , p.R141H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	"ACMG"
"0000830539"	"20"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00000"	"RS1_000056"	"g.18662650C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.422G>A , p.R141H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic"	"ACMG"
"0000830540"	"20"	"90"	"X"	"18662647"	"18662647"	"subst"	"0"	"00000"	"RS1_000358"	"g.18662647C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.425G>A , p.C142Y"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644527C>T"	""	"pathogenic"	"ACMG"
"0000830541"	"20"	"90"	"X"	"18662639"	"18662639"	"subst"	"0"	"00000"	"RS1_000163"	"g.18662639C>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.433G>C , p.D145H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644519C>G"	""	"pathogenic"	"ACMG"
"0000830542"	"20"	"90"	"X"	"18662636"	"18662636"	"subst"	"0"	"00000"	"RS1_000059"	"g.18662636C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.436G>A , p.E146K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644516C>T"	""	"pathogenic"	"ACMG"
"0000830543"	"20"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00000"	"RS1_000356"	"g.18662631C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.441G>A , p.W147X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic"	"ACMG"
"0000830544"	"20"	"70"	"X"	"18662629"	"18662629"	"subst"	"0"	"00000"	"RS1_000355"	"g.18662629A>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.443T>A, p.M148K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644509A>T"	""	"likely pathogenic"	"ACMG"
"0000830545"	"20"	"90"	"X"	"18662621"	"18662621"	"subst"	"0"	"00000"	"RS1_000354"	"g.18662621A>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.451T>C, p.Y151H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644501A>G"	""	"pathogenic"	"ACMG"
"0000830546"	"20"	"90"	"X"	"18662606"	"18662606"	"subst"	"0"	"00000"	"RS1_000164"	"g.18662606T>C"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.466A>G , p.R156G"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644486T>C"	""	"pathogenic"	"ACMG"
"0000830547"	"20"	"90"	"X"	"18662605"	"18662605"	"dup"	"0"	"00000"	"RS1_000350"	"g.18662605dup"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.467_468insG, p.T157Dfs*3"	"error in annotation: c.467_468insG automapped to c.468dup; number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644485dup"	""	"pathogenic"	"ACMG"
"0000830548"	"20"	"90"	"X"	"18662584"	"18662584"	"del"	"0"	"00000"	"RS1_000165"	"g.18662584del"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.489del, p.W163X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644464del"	""	"pathogenic"	"ACMG"
"0000830549"	"20"	"90"	"X"	"18662584"	"18662584"	"del"	"0"	"00000"	"RS1_000165"	"g.18662584del"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.489del, p.W163X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644464del"	""	"pathogenic"	"ACMG"
"0000830550"	"20"	"90"	"X"	"18662584"	"18662584"	"del"	"0"	"00000"	"RS1_000165"	"g.18662584del"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.489del, p.W163X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644464del"	""	"pathogenic"	"ACMG"
"0000830551"	"20"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00000"	"RS1_000096"	"g.18662583C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.489G>A  , p.W163X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644463C>T"	""	"pathogenic"	"ACMG"
"0000830552"	"20"	"90"	"X"	"18662579"	"18662581"	"delins"	"0"	"00000"	"RS1_000348"	"g.18662579_18662581delinsGATT"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.491_493delinsAATC , p.I164Kext 38"	"variant can be annotated as p.Ile164Lysfs*100, but there are less than 100 amino acids until the end of the protein, so it is an extension; number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644459_18644461delinsGATT"	""	"pathogenic"	"ACMG"
"0000830553"	"20"	"90"	"X"	"18662576"	"18662576"	"subst"	"0"	"00000"	"RS1_000346"	"g.18662576A>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.496T>C, p.Y166H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644456A>G"	""	"pathogenic"	"ACMG"
"0000830554"	"20"	"90"	"X"	"18662573"	"18662573"	"subst"	"0"	"00000"	"RS1_000345"	"g.18662573T>C"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.499A>G , p.K167E"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644453T>C"	""	"pathogenic"	"ACMG"
"0000830555"	"20"	"90"	"X"	"18662567"	"18662567"	"subst"	"0"	"00000"	"RS1_000343"	"g.18662567G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.505C>T , p.Q169X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644447G>A"	""	"pathogenic"	"ACMG"
"0000830556"	"20"	"90"	"X"	"18662567"	"18662567"	"subst"	"0"	"00000"	"RS1_000343"	"g.18662567G>A"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.505C>T , p.Q169X"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644447G>A"	""	"pathogenic"	"ACMG"
"0000830557"	"20"	"90"	"X"	"18662561"	"18662561"	"subst"	"0"	"00000"	"RS1_000341"	"g.18662561C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.511 G>A,  p.G171R"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18644441C>T"	""	"pathogenic"	"ACMG"
"0000830558"	"20"	"70"	"X"	"18660254"	"18660254"	"subst"	"0"	"00000"	"RS1_000337"	"g.18660254C>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.545G>T , p.R182L"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642134C>A"	""	"likely pathogenic"	"ACMG"
"0000830559"	"20"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00000"	"RS1_000159"	"g.18660224G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.575C>T , p.P192L"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642104G>A"	""	"pathogenic"	"ACMG"
"0000830560"	"20"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00000"	"RS1_000008"	"g.18660221G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.578C>T, p.P193L"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642101G>A"	""	"pathogenic"	"ACMG"
"0000830561"	"20"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00000"	"RS1_000070"	"g.18660225dup"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.579_580insC , p.X225Lext 38"	"error in annotation: c.579_580insC automapped to c.579dup and causes p.Ile194Hisfs*70 and not p.*225Leuext 38; number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642105dup"	""	"pathogenic"	"ACMG"
"0000830562"	"20"	"70"	"X"	"18660219"	"18660219"	"subst"	"0"	"00000"	"RS1_000335"	"g.18660219T>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.580A>T , p.I194F"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642099T>A"	""	"likely pathogenic"	"ACMG"
"0000830563"	"20"	"90"	"X"	"18660218"	"18660218"	"subst"	"0"	"00000"	"RS1_000195"	"g.18660218A>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.581T>A, p.I194N"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642098A>T"	""	"pathogenic"	"ACMG"
"0000830564"	"20"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00000"	"RS1_000071"	"g.18660210G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.589C>T, p.R197C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic"	"ACMG"
"0000830565"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.590G>A, p.R197H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	"ACMG"
"0000830566"	"20"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00000"	"RS1_000072"	"g.18660209C>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.590G>A, p.R197H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic"	"ACMG"
"0000830567"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.598C>T , p.R200C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	"ACMG"
"0000830568"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.598C>T , p.R200C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	"ACMG"
"0000830569"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.598C>T , p.R200C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic"	"ACMG"
"0000830570"	"20"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00000"	"RS1_000075"	"g.18660200C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.599G>A, p.R200H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic"	"ACMG"
"0000830571"	"20"	"70"	"X"	"18660192"	"18660192"	"subst"	"0"	"00000"	"RS1_000333"	"g.18660192G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.607C>T , p.P203S"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642072G>A"	""	"likely pathogenic"	"ACMG"
"0000830572"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000332"	"g.18660191G>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.608C>A , p.P203Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>T"	""	"likely pathogenic"	"ACMG"
"0000830573"	"20"	"70"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000332"	"g.18660191G>T"	"2/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.608C>A , p.P203Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>T"	""	"likely pathogenic"	"ACMG"
"0000830574"	"20"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00000"	"RS1_000077"	"g.18660191G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.608C>T , p.P203L"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic"	"ACMG"
"0000830575"	"20"	"70"	"X"	"18660176"	"18660176"	"subst"	"0"	"00000"	"RS1_000331"	"g.18660176A>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.623T>C, p.V208A"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642056A>G"	""	"likely pathogenic"	"ACMG"
"0000830576"	"20"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00000"	"RS1_000080"	"g.18660174G>A"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.625C>T, p.R209C"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic"	"ACMG"
"0000830577"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.626G>A , p.R209H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	"ACMG"
"0000830578"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.626G>A , p.R209H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	"ACMG"
"0000830579"	"20"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00000"	"RS1_000009"	"g.18660173C>T"	"3/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.626G>A , p.R209H"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic"	"ACMG"
"0000830580"	"20"	"90"	"X"	"18660168"	"18660168"	"subst"	"0"	"00000"	"RS1_000151"	"g.18660168C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.631G>A , p.A211T"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642048C>T"	""	"pathogenic"	"ACMG"
"0000830581"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.637C>T , p.R213W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	"ACMG"
"0000830582"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.637C>T , p.R213W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	"ACMG"
"0000830583"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.637C>T , p.R213W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	"ACMG"
"0000830584"	"20"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00000"	"RS1_000081"	"g.18660162G>A"	"4/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.637C>T , p.R213W"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	"ACMG"
"0000830585"	"20"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00000"	"RS1_000092"	"g.18660161C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.638G>A, p.R213Q"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic"	"ACMG"
"0000830586"	"20"	"90"	"X"	"18660147"	"18660147"	"subst"	"0"	"00000"	"RS1_000327"	"g.18660147C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.652G>A , p.E218K"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642027C>T"	""	"pathogenic"	"ACMG"
"0000830587"	"20"	"90"	"X"	"18660143"	"18660143"	"subst"	"0"	"00000"	"RS1_000303"	"g.18660143C>T"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.656G>A, p.C219Y"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642023C>T"	""	"pathogenic"	"ACMG"
"0000830588"	"20"	"90"	"X"	"18660132"	"18660132"	"subst"	"0"	"00000"	"RS1_000118"	"g.18660132A>G"	"1/90"	"{PMID:Chen 2020:32300273}"	""	"RS1 c.667T>C , p.C223R"	"number of alleles does not match number of patients (91 vs 90)"	"Unknown"	"?"	""	"0"	""	""	"g.18642012A>G"	""	"pathogenic"	"ACMG"
"0000830589"	"20"	"90"	"X"	"18659669"	"18665975"	"delins"	"0"	"00000"	"RS1_000421"	"g.18659669_18665975delinsAAAAACTCCCTAGCTCTTTGGAAATGGTAAACA"	"1/90 cases RS"	"{PMID:Chen 2020:32300273}"	""	"del ex4-6"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18641549_18647855delinsAAAAACTCCCTAGCTCTTTGGAAATGGTAAACA"	""	"pathogenic"	"ACMG"
"0000846908"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846909"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846910"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846911"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846912"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846913"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846914"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846915"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846916"	"20"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.214G>A , p.(Glu72Lys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000846917"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.325G>C , p.(Gly109Arg)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000846918"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.325G>C , p.(Gly109Arg)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000846919"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.325G>C , p.(Gly109Arg)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000846920"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.325G>C , p.(Gly109Arg)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000846921"	"20"	"70"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00000"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.325G>C , p.(Gly109Arg)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647192C>G"	""	"likely pathogenic"	""
"0000846922"	"20"	"70"	"X"	"18660266"	"18660266"	"subst"	"0"	"00000"	"RS1_000066"	"g.18660266C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.533G>C , p.(Gly178Asp)"	"error in annotation, p.(Gly178Asp) is caused by c.533G>A and not c.533G>C - this change causes p.(Gly178Ala); hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642146C>T"	""	"likely pathogenic"	""
"0000846923"	"20"	"70"	"X"	"18660266"	"18660266"	"subst"	"0"	"00000"	"RS1_000066"	"g.18660266C>T"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 c.533G>C , p.(Gly178Asp)"	"error in annotation, p.(Gly178Asp) is caused by c.533G>A and not c.533G>C - this change causes p.(Gly178Ala); hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642146C>T"	""	"likely pathogenic"	""
"0000846924"	"20"	"70"	"X"	"18690136"	"18690223"	"del"	"0"	"00000"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Avela 2019:31087526}"	""	"RS1 exon1 deletion"	""	"Germline"	"yes"	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"likely pathogenic"	""
"0000856500"	"0"	"30"	"X"	"18528968"	"18528968"	"subst"	"2.25054E-5"	"01943"	"RS1_000409"	"g.18528968A>G"	""	""	""	"CDKL5(NM_001323289.1):c.93A>G (p.R31=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856501"	"0"	"30"	"X"	"18582667"	"18582670"	"del"	"0"	"02325"	"RS1_000225"	"g.18582667_18582670del"	""	""	""	"CDKL5(NM_003159.3):c.145+25_145+28delATAT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856502"	"0"	"10"	"X"	"18582669"	"18582670"	"del"	"0"	"02325"	"CDKL5_000059"	"g.18582669_18582670del"	""	""	""	"CDKL5(NM_003159.2):c.145+27_145+28delAT, CDKL5(NM_003159.3):c.145+27_145+28delAT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000856503"	"0"	"50"	"X"	"18622936"	"18622936"	"subst"	"2.80536E-5"	"01943"	"RS1_000410"	"g.18622936T>C"	""	""	""	"CDKL5(NM_001323289.1):c.1892T>C (p.I631T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856504"	"0"	"30"	"X"	"18627008"	"18627008"	"subst"	"0.000515611"	"01943"	"RS1_000249"	"g.18627008C>G"	""	""	""	"CDKL5(NM_001037343.1):c.2022C>G (p.S674=), CDKL5(NM_001323289.1):c.2022C>G (p.S674=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856505"	"0"	"50"	"X"	"18646549"	"18646549"	"subst"	"0"	"02325"	"RS1_000412"	"g.18646549C>T"	""	""	""	"CDKL5(NM_003159.3):c.2555C>T (p.P852L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856506"	"0"	"10"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"02326"	"RS1_000040"	"g.18662742A>G"	""	""	""	"CDKL5(NM_003159.2):c.2714-1385A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000867253"	"0"	"90"	"X"	"18606106"	"18606106"	"subst"	"0"	"01804"	"CDKL5_000102"	"g.18606106C>T"	""	""	""	"CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000867254"	"0"	"30"	"X"	"18631366"	"18631366"	"subst"	"0"	"01943"	"RS1_000411"	"g.18631366C>T"	""	""	""	"CDKL5(NM_001323289.1):c.2247C>T (p.H749=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000867255"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"02327"	"RS1_000070"	"g.18660225dup"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000867256"	"0"	"50"	"X"	"18662634"	"18662634"	"subst"	"0"	"01943"	"RS1_000060"	"g.18662634C>G"	""	""	""	"RS1(NM_000330.3):c.438G>C (p.E146D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000867257"	"0"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"02327"	"RS1_000103"	"g.18665314A>C"	""	""	""	"RS1(NM_000330.4):c.323T>G (p.F108C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000870225"	"0"	"90"	"X"	"18662555"	"18662555"	"del"	"0"	"01741"	"RS1_000413"	"g.18662555del"	""	""	""	"518delA"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644435del"	""	"pathogenic"	""
"0000873657"	"0"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00000"	"RS1_000029"	"g.18665423C>T"	"252"	"{PMID:Sun 2018:30076350}"	""	"RS1(NM_000330.3):c.214G>A(p.E72K)"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic"	""
"0000896044"	"0"	"70"	"X"	"18528946"	"18528946"	"subst"	"0"	"02327"	"RS1_000414"	"g.18528946A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000896045"	"0"	"70"	"X"	"18600005"	"18600005"	"subst"	"0"	"02327"	"RS1_000415"	"g.18600005C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000896046"	"0"	"50"	"X"	"18631283"	"18631283"	"subst"	"1.12087E-5"	"02325"	"RS1_000416"	"g.18631283C>T"	""	""	""	"CDKL5(NM_003159.3):c.2164C>T (p.R722C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000896047"	"0"	"50"	"X"	"18631388"	"18631388"	"subst"	"0"	"02325"	"RS1_000417"	"g.18631388G>C"	""	""	""	"CDKL5(NM_003159.3):c.2269G>C (p.D757H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000896048"	"0"	"30"	"X"	"18671565"	"18671565"	"subst"	"0.000564159"	"01943"	"RS1_000418"	"g.18671565C>T"	""	""	""	"CDKL5(NM_003159.2):c.2994C>T (p.F998=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000896049"	"0"	"70"	"X"	"18690187"	"18690187"	"subst"	"0"	"02327"	"RS1_000419"	"g.18690187A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000896533"	"21"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00000"	"RS1_000091"	"g.18665361C>G"	"Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0"	"{PMID:Chen 2021:33608557}"	""	"RS1 c.[276G>C];[0]; p.(Trp92Cys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic"	""
"0000896640"	"21"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00000"	"RS1_000074"	"g.18660201G>A"	"Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0"	"{PMID:Chen 2021:33608557}"	""	"RS1 c.[598C>T];[0]; p.(Arg200Cys)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18642081G>A"	""	"likely pathogenic"	""
"0000896645"	"21"	"90"	"X"	"18665393"	"18665394"	"del"	"0"	"00000"	"RS1_000318"	"g.18665393_18665394del"	"Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0"	"{PMID:Chen 2021:33608557}"	""	"RS1 c.[244_245del];[0]; p.(Thr82LeufsTer3)"	"hemizygous"	"Germline"	"yes"	""	"0"	""	""	"g.18647273_18647274del"	""	"pathogenic"	""
"0000905993"	"0"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Zhu 2022:35456422}"	""	"RS1 c.413C>A, p.(Thr138Asn)"	"hemizygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	"ACMG"
"0000905994"	"0"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Zhu 2022:35456422}"	""	"RS1 c.413C>A, p.(Thr138Asn)"	"hemizygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	"ACMG"
"0000905995"	"0"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"00000"	"RS1_000274"	"g.18662659G>T"	""	"{PMID:Zhu 2022:35456422}"	""	"RS1 c.413C>A, p.(Thr138Asn)"	"hemizygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.18644539G>T"	""	"pathogenic"	"ACMG"
"0000915663"	"0"	"50"	"X"	"18606075"	"18606075"	"subst"	"0"	"02327"	"RS1_000420"	"g.18606075G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915664"	"0"	"30"	"X"	"18622162"	"18622162"	"subst"	"5.595E-6"	"02325"	"RS1_000232"	"g.18622162G>C"	""	""	""	"CDKL5(NM_001037343.1):c.1118G>C (p.G373A), CDKL5(NM_003159.3):c.1118G>C (p.G373A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915665"	"0"	"90"	"X"	"18622692"	"18622692"	"subst"	"0"	"02329"	"CDKL5_000029"	"g.18622692C>T"	""	""	""	"CDKL5(NM_001323289.2):c.1648C>T (p.R550*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000915666"	"0"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"02327"	"RS1_000074"	"g.18660201G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000915667"	"0"	"50"	"X"	"18662660"	"18662660"	"subst"	"0"	"02327"	"RS1_000050"	"g.18662660T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927307"	"0"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"02330"	"RS1_000103"	"g.18665314A>C"	""	""	""	"RS1(NM_000330.4):c.323T>G (p.F108C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000931368"	"0"	"90"	"X"	"18662659"	"18662659"	"subst"	"0"	"02327"	"RS1_000274"	"g.18662659G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000933611"	"0"	"99"	"X"	"18665429"	"18665429"	"subst"	"0"	"04552"	"RS1_000028"	"g.18665429C>T"	""	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	""	""	"Germline"	"yes"	"rs62645894"	"0"	""	""	""	"{CV:372496}"	"pathogenic (recessive)"	"ACMG"
"0000933612"	"0"	"99"	"X"	"18665429"	"18665429"	"subst"	"0"	"04552"	"RS1_000028"	"g.18665429C>T"	""	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	""	""	"Germline"	"yes"	"rs62645894"	"0"	""	""	""	"{CV:372496}"	"pathogenic"	"ACMG"
"0000933613"	"0"	"99"	"X"	"18665429"	"18665429"	"subst"	"0"	"04552"	"RS1_000028"	"g.18665429C>T"	""	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	""	""	"Germline"	"yes"	"rs62645894"	"0"	""	""	""	"{CV:372496}"	"pathogenic"	"ACMG"
"0000951727"	"0"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"02327"	"RS1_000032"	"g.18665414C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951728"	"0"	"70"	"X"	"18665421"	"18665421"	"subst"	"0"	"02327"	"RS1_000030"	"g.18665421C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000951729"	"0"	"70"	"X"	"18690187"	"18690187"	"subst"	"0"	"02327"	"RS1_000429"	"g.18690187A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000952090"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R141C"	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0000952091"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R200C"	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0000952092"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"P192S"	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0000952093"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"E72K"	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0000952094"	"20"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R141C"	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0000952095"	"20"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R200C"	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0000952096"	"20"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"P192S"	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0000952097"	"20"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Sergeev 2013:23847049}"	""	"E72K"	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0000952098"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R102W"	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0000952099"	"20"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Sergeev 2013:23847049}"	""	"R102W"	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0000952264"	"20"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:RS-consortium 1998, group 4:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic"	""
"0000952265"	"20"	"90"	"X"	"18690187"	"18690187"	"subst"	"0"	"00006"	"RS1_000419"	"g.18690187A>G"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672067A>G"	""	"pathogenic"	""
"0000952266"	"20"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	""	"pathogenic"	""
"0000952267"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000952268"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000952269"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000952270"	"20"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic"	""
"0000952271"	"20"	"90"	"X"	"18674880"	"18674880"	"subst"	"0"	"00006"	"RS1_000001"	"g.18674880T>C"	""	"{PMID:RS-consortium 1998, group W:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656760T>C"	""	"pathogenic"	""
"0000952272"	"20"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:RS-consortium 1998, group W:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic"	""
"0000952273"	"20"	"90"	"X"	"18674763"	"18674776"	"del"	"0"	"00006"	"RS1_000423"	"g.18674763_18674776del"	""	"{PMID:RS-consortium 1998, group 5:9618178}"	""	"181-184+10del"	""	"Germline"	""	""	"0"	""	""	"g.18656643_18656656del"	""	"pathogenic"	""
"0000952274"	"20"	"90"	"X"	"18674772"	"18674772"	"subst"	"0"	"00006"	"RS1_000399"	"g.18674772C>G"	""	"{PMID:RS-consortium 1998, group 3:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656652C>G"	""	"pathogenic"	""
"0000952275"	"20"	"90"	"X"	"18665310"	"18665453"	"del"	"0"	"00006"	"RS1_000425"	"g.(18662746_18665310)_(18665453_18674772)del"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	"del ex4"	""	"Germline"	""	""	"0"	""	""	"g.(18644626_18647190)_(18647333_18656652)del"	""	"pathogenic"	""
"0000952276"	"20"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:RS-consortium 1998, group 2:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic"	""
"0000952277"	"20"	"90"	"X"	"18665370"	"18665370"	"subst"	"0"	"00006"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:RS-consortium 1998, group 6:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647250A>T"	""	"pathogenic"	""
"0000952278"	"20"	"90"	"X"	"18665321"	"18665322"	"ins"	"0"	"00006"	"RS1_000428"	"g.18665321_18665322insT"	""	"{PMID:RS-consortium 1998, group W:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647201_18647202insT"	""	"pathogenic"	""
"0000952279"	"0"	"10"	"X"	"18660133"	"18660133"	"subst"	"0"	"00006"	"RS1_000088"	"g.18660133C>G"	""	"{PMID:RS-consortium 1998:9618178}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642013C>G"	""	"benign"	""
"0000958307"	"1"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PS1_MODERATE, PP3, PM2, PM5, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (dominant)"	"ACMG"
"0000958308"	"1"	"90"	"X"	"18665431"	"18665438"	"dup"	"0"	"00006"	"RS1_000299"	"g.18665431_18665438dup"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline"	""	""	"0"	""	""	"g.18647311_18647318dup"	""	"pathogenic (dominant)"	"ACMG"
"0000958309"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM1, PP2, PP5_STRONG"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (dominant)"	"ACMG"
"0000958310"	"1"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM5, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000958311"	"21"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM5, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000958312"	"1"	"90"	"X"	"18665416"	"18665416"	"subst"	"0"	"00006"	"RS1_000031"	"g.18665416C>A"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18647296C>A"	""	"pathogenic (dominant)"	"ACMG"
"0000958313"	"1"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM5, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000958314"	"1"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM5_SUPPORTING, PM1, PP2, PP5_STRONG"	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000958315"	"21"	"70"	"X"	"18662644"	"18662644"	"subst"	"0"	"00006"	"RS1_000430"	"g.18662644T>G"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM5_SUPPORTING, PM1, PP2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644524T>G"	""	"likely pathogenic (dominant)"	"ACMG"
"0000958316"	"1"	"90"	"X"	"18665431"	"18665438"	"dup"	"0"	"00006"	"RS1_000299"	"g.18665431_18665438dup"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline"	""	""	"0"	""	""	"g.18647311_18647318dup"	""	"pathogenic (dominant)"	"ACMG"
"0000958317"	"0"	"90"	"X"	"18662700"	"18662701"	"ins"	"0"	"00006"	"RS1_000280"	"g.18662700_18662701insCACTGGCTAC"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644580_18644581insCACTGGCTAC"	"{CV:1275772}"	"pathogenic (dominant)"	"ACMG"
"0000958924"	"20"	"50"	"X"	"18665398"	"18665398"	"subst"	"0"	"00006"	"RS1_000385"	"g.18665398T>G"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM1_SUPPORTING, PP2"	"Germline"	""	""	"0"	""	""	"g.18647278T>G"	""	"VUS"	"ACMG"
"0000959229"	"0"	"70"	"X"	"18665344"	"18665344"	"subst"	"0"	"00006"	"RS1_000102"	"g.18665344G>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2, PM1, PP2"	"Germline"	""	""	"0"	""	""	"g.18647224G>T"	""	"likely pathogenic (dominant)"	"ACMG"
"0000970958"	"0"	"50"	"X"	"18646513"	"18646513"	"subst"	"0"	"02329"	"RS1_000431"	"g.18646513G>A"	""	""	""	"CDKL5(NM_001323289.2):c.2519G>A (p.R840H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970961"	"0"	"30"	"X"	"18674870"	"18674870"	"subst"	"1.67964E-5"	"02327"	"RS1_000270"	"g.18674870G>A"	""	""	""	"RS1(NM_000330.3):c.87C>T (p.G29=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000971532"	"0"	"70"	"X"	"18674830"	"18674830"	"subst"	"0"	"03779"	"RS1_000432"	"g.18674830G>A"	""	""	""	""	""	"CLASSIFICATION record"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000984590"	"0"	"30"	"X"	"18668712"	"18668712"	"subst"	"5.6146E-6"	"01804"	"RS1_000433"	"g.18668712G>A"	""	""	""	"CDKL5(NM_001037343.2):c.2980G>A (p.(Gly994Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000986590"	"1"	"90"	"X"	"18662665"	"18662665"	"subst"	"0"	"04405"	"RS1_000049"	"g.18662665A>G"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644545A>G"	""	"pathogenic"	"ACMG"
"0000986591"	"1"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"04405"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	"ACMG"
"0000986592"	"1"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"04405"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic"	"ACMG"
"0001006633"	"0"	"50"	"X"	"18598093"	"18598093"	"subst"	"5.64E-6"	"01804"	"RS1_000434"	"g.18598093G>A"	""	""	""	"CDKL5(NM_001037343.1):c.403+5G>A (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001006634"	"0"	"30"	"X"	"18622765"	"18622765"	"subst"	"5.04295E-5"	"02325"	"RS1_000435"	"g.18622765C>T"	""	""	""	"CDKL5(NM_003159.3):c.1721C>T (p.P574L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001006635"	"0"	"30"	"X"	"18626961"	"18626961"	"subst"	"0"	"01804"	"RS1_000436"	"g.18626961G>A"	""	""	""	"CDKL5(NM_001037343.1):c.1975G>A (p.(Val659Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001006636"	"0"	"50"	"X"	"18646512"	"18646512"	"subst"	"0"	"01804"	"RS1_000437"	"g.18646512C>T"	""	""	""	"CDKL5(NM_001037343.1):c.2518C>T (p.(Arg840Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001006637"	"0"	"30"	"X"	"18662607"	"18662607"	"subst"	"0"	"02325"	"RS1_000438"	"g.18662607G>A"	""	""	""	"RS1(NM_000330.4):c.465C>T (p.Y155=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001016011"	"0"	"90"	"X"	"18606174"	"18606174"	"subst"	"0"	"02329"	"RS1_000439"	"g.18606174C>T"	""	""	""	"CDKL5(NM_001323289.2):c.655C>T (p.Q219*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001016012"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"02325"	"RS1_000029"	"g.18665423C>T"	""	""	""	"RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001019189"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019190"	"0"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019191"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	"579dupC"	"ACMG PVS1, PP5, PM2, PM3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019192"	"0"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP5, PM1, PM2, PM3, PP3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019193"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019194"	"0"	"90"	"X"	"18690186"	"18690186"	"subst"	"0"	"00006"	"RS1_000408"	"g.18690186C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PS1, PP4, PP5, PM2, PM3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18672066C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019195"	"0"	"70"	"X"	"18662551"	"18662551"	"subst"	"0"	"00006"	"RS1_000451"	"g.18662551C>G"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644431C>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019196"	"0"	"70"	"X"	"18690154"	"18690155"	"ins"	"0"	"00006"	"RS1_000481"	"g.18690154_18690155insTATC"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PVS1, PP4, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18672034_18672035insTATC"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019197"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019198"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019199"	"0"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP5, PM1, PM2, PM3, PP3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019200"	"0"	"90"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP5, PM1, PM2, PM3, PP3, PM5"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019201"	"0"	"70"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP4, PM1, PM2, PM4"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647303C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019202"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019203"	"0"	"70"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18642054G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019204"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019205"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:D\'Anna Mardero 2024:39648411}"	""	""	"ACMG PP3, PP4, PP5, PM1, PM2, PM3, PM5"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019208"	"0"	"90"	"X"	"18675759"	"18675759"	"subst"	"0"	"00006"	"RS1_000169"	"g.18675759C>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657639C>A"	""	"pathogenic (recessive)"	""
"0001019209"	"0"	"90"	"X"	"18674860"	"18674860"	"del"	"0"	"00006"	"RS1_000261"	"g.18674860del"	""	"{PMID:Lee 2025:39293640}"	""	"97delT"	""	"Germline"	""	""	"0"	""	""	"g.18656740del"	""	"pathogenic (recessive)"	""
"0001019210"	"0"	"90"	"X"	"18674821"	"18674831"	"del"	"0"	"00006"	"RS1_000476"	"g.18674821_18674831del"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656701_18656711del"	""	"pathogenic (recessive)"	""
"0001019211"	"0"	"90"	"X"	"18674807"	"18674807"	"subst"	"0"	"00006"	"RS1_000300"	"g.18674807C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656687C>T"	""	"pathogenic (recessive)"	""
"0001019212"	"0"	"90"	"X"	"18665449"	"18665449"	"subst"	"5.59769E-6"	"00006"	"RS1_000475"	"g.18665449C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647329C>T"	""	"pathogenic (recessive)"	""
"0001019213"	"0"	"90"	"X"	"18665310"	"18665453"	"del"	"0"	"00006"	"RS1_000425"	"g.(18662746_18665310)_(18665453_18674772)del"	""	"{PMID:Lee 2025:39293640}"	""	"del ex4"	""	"Germline"	""	""	"0"	""	""	"g.(18644626_18647190)_(18647333_18656652)del"	""	"pathogenic (recessive)"	""
"0001019214"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019215"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019216"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019217"	"0"	"90"	"X"	"18665410"	"18665410"	"subst"	"0"	"00006"	"RS1_000172"	"g.18665410A>C"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647290A>C"	""	"pathogenic (recessive)"	""
"0001019218"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019219"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019220"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019221"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019222"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019223"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019224"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	""
"0001019225"	"0"	"90"	"X"	"18665335"	"18665335"	"subst"	"0"	"00006"	"RS1_000471"	"g.18665335G>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647215G>T"	""	"pathogenic (recessive)"	""
"0001019226"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019227"	"0"	"90"	"X"	"18665329"	"18665331"	"dup"	"0"	"00006"	"RS1_000279"	"g.18665329_18665331dup"	""	"{PMID:Lee 2025:39293640}"	""	"306_308dupGCT"	""	"Germline"	""	""	"0"	""	""	"g.18647209_18647211dup"	""	"pathogenic (recessive)"	""
"0001019228"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000470"	"g.18665312C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>T"	""	"pathogenic (recessive)"	""
"0001019229"	"0"	"90"	"X"	"18665309"	"18665309"	"subst"	"0"	"00006"	"RS1_000469"	"g.18665309A>C"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647189A>C"	""	"pathogenic (recessive)"	""
"0001019230"	"0"	"90"	"X"	"18662744"	"18662744"	"subst"	"0"	"00006"	"RS1_000468"	"g.18662744A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644624A>G"	""	"pathogenic (recessive)"	""
"0001019231"	"0"	"90"	"X"	"18662741"	"18662741"	"subst"	"0"	"00006"	"RS1_000467"	"g.18662741C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644621C>T"	""	"pathogenic (recessive)"	""
"0001019232"	"0"	"90"	"X"	"18662668"	"18662668"	"subst"	"0"	"00006"	"RS1_000363"	"g.18662668C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644548C>T"	""	"pathogenic (recessive)"	""
"0001019233"	"0"	"90"	"X"	"18662662"	"18662662"	"subst"	"0"	"00006"	"RS1_000173"	"g.18662662A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644542A>G"	""	"pathogenic (recessive)"	""
"0001019234"	"0"	"90"	"X"	"18662662"	"18662662"	"subst"	"0"	"00006"	"RS1_000173"	"g.18662662A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644542A>G"	""	"pathogenic (recessive)"	""
"0001019235"	"0"	"90"	"X"	"18662662"	"18662662"	"subst"	"0"	"00006"	"RS1_000173"	"g.18662662A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644542A>G"	""	"pathogenic (recessive)"	""
"0001019236"	"0"	"90"	"X"	"18662662"	"18662662"	"subst"	"0"	"00006"	"RS1_000173"	"g.18662662A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644542A>G"	""	"pathogenic (recessive)"	""
"0001019237"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019238"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019239"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019240"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019241"	"0"	"90"	"X"	"18662646"	"18662646"	"subst"	"0"	"00006"	"RS1_000114"	"g.18662646A>C"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644526A>C"	""	"pathogenic (recessive)"	""
"0001019242"	"0"	"90"	"X"	"18662639"	"18662639"	"subst"	"0"	"00006"	"RS1_000460"	"g.18662639C>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644519C>A"	""	"pathogenic (recessive)"	""
"0001019243"	"0"	"90"	"X"	"18662573"	"18662573"	"subst"	"0"	"00006"	"RS1_000345"	"g.18662573T>C"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644453T>C"	""	"pathogenic (recessive)"	""
"0001019244"	"0"	"90"	"X"	"18662549"	"18662549"	"subst"	"0"	"00006"	"RS1_000064"	"g.18662549C>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644429C>A"	""	"pathogenic (recessive)"	""
"0001019245"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019246"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019247"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019248"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019249"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019250"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019251"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019252"	"0"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"pathogenic (recessive)"	""
"0001019253"	"0"	"90"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000446"	"g.18660221G>C"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642101G>C"	""	"pathogenic (recessive)"	""
"0001019254"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019255"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019256"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019257"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019258"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019259"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019260"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019261"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019262"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019263"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019264"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019265"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019266"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019267"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019268"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019269"	"0"	"90"	"X"	"18660182"	"18660182"	"subst"	"0"	"00006"	"RS1_000442"	"g.18660182C>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642062C>G"	""	"pathogenic (recessive)"	""
"0001019270"	"0"	"90"	"X"	"18660182"	"18660182"	"subst"	"0"	"00006"	"RS1_000442"	"g.18660182C>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642062C>G"	""	"pathogenic (recessive)"	""
"0001019271"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019272"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019273"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019274"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019275"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001019276"	"0"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic (recessive)"	""
"0001019277"	"0"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic (recessive)"	""
"0001019278"	"0"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic (recessive)"	""
"0001019279"	"0"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642032A>G"	""	"pathogenic (recessive)"	""
"0001019280"	"0"	"90"	"X"	"18660131"	"18660131"	"subst"	"0"	"00006"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Lee 2025:39293640}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642011C>T"	""	"pathogenic (recessive)"	""
"0001019281"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019282"	"21"	"90"	"X"	"18690182"	"18690182"	"subst"	"0.00181198"	"00006"	"RS1_000219"	"g.18690182G>C"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672062G>C"	""	"pathogenic (recessive)"	""
"0001019283"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019284"	"21"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019285"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019286"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019287"	"21"	"90"	"X"	"18660131"	"18660131"	"subst"	"0"	"00006"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642011C>T"	""	"pathogenic (recessive)"	""
"0001019288"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019289"	"21"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001019290"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019291"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019292"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Chowdury 2024:38317323}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019293"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019294"	"0"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000316"	"g.18662736C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>T"	""	"pathogenic (recessive)"	""
"0001019295"	"0"	"90"	"X"	"18662737"	"18662737"	"subst"	"0"	"00006"	"RS1_000272"	"g.18662737C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644617C>T"	""	"pathogenic (recessive)"	""
"0001019296"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019297"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019298"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019299"	"0"	"90"	"X"	"18660225"	"18660225"	"del"	"0"	"00006"	"RS1_000205"	"g.18660225del"	""	"{PMID:Wei 2024:38324300}"	""	"579delC"	""	"Germline"	""	""	"0"	""	""	"g.18642105del"	""	"pathogenic (recessive)"	""
"0001019300"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019301"	"0"	"90"	"X"	"18674864"	"18674864"	"del"	"0"	"00006"	"RS1_000477"	"g.18674864del"	""	"{PMID:Wei 2024:38324300}"	""	"96delC"	""	"Germline"	""	""	"0"	""	""	"g.18656744del"	""	"pathogenic (recessive)"	""
"0001019302"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Wei 2024:38324300}"	""	"del ex2"	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	""
"0001019303"	"0"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Wei 2024:38324300}"	""	"del ex3"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic (recessive)"	""
"0001019304"	"0"	"90"	"X"	"18665414"	"18665414"	"subst"	"0"	"00006"	"RS1_000032"	"g.18665414C>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647294C>A"	""	"pathogenic (recessive)"	""
"0001019305"	"0"	"90"	"X"	"18662549"	"18665453"	"del"	"0"	"00006"	"RS1_000450"	"g.(18660277_18662549)_(18665453_18674772)del"	""	"{PMID:Wei 2024:38324300}"	""	"del ex4-5"	""	"Germline"	""	""	"0"	""	""	"g.(18642157_18644429)_(18647333_18656652)del"	""	"pathogenic (recessive)"	""
"0001019306"	"0"	"90"	"X"	"18675786"	"18675786"	"subst"	"0"	"00006"	"RS1_000479"	"g.18675786C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657666C>T"	""	"pathogenic (recessive)"	""
"0001019307"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019308"	"0"	"90"	"X"	"18662621"	"18662621"	"subst"	"0"	"00006"	"RS1_000354"	"g.18662621A>G"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644501A>G"	""	"pathogenic (recessive)"	""
"0001019309"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019310"	"0"	"90"	"X"	"18665397"	"18665397"	"subst"	"0"	"00006"	"RS1_000474"	"g.18665397C>G"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647277C>G"	""	"pathogenic (recessive)"	""
"0001019311"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019312"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019313"	"0"	"90"	"X"	"18690137"	"18690137"	"subst"	"0"	"00006"	"RS1_000322"	"g.18690137C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672017C>T"	""	"pathogenic (recessive)"	""
"0001019314"	"0"	"90"	"X"	"18674772"	"18675786"	"del"	"0"	"00006"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Wei 2024:38324300}"	""	"del ex2-3"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18657666_18672016)del"	""	"pathogenic (recessive)"	""
"0001019315"	"0"	"90"	"X"	"18662560"	"18662560"	"subst"	"0"	"00006"	"RS1_000453"	"g.18662560C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644440C>T"	""	"pathogenic (recessive)"	""
"0001019316"	"0"	"90"	"X"	"18662747"	"18662747"	"subst"	"0"	"00006"	"RS1_000371"	"g.18662747T>C"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644627T>C"	""	"pathogenic (recessive)"	""
"0001019317"	"0"	"90"	"X"	"18662735"	"18662736"	"ins"	"0"	"00006"	"RS1_000464"	"g.18662735_18662736insA"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644615_18644616insA"	""	"pathogenic (recessive)"	""
"0001019318"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019319"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019320"	"0"	"90"	"X"	"18662735"	"18662736"	"ins"	"0"	"00006"	"RS1_000464"	"g.18662735_18662736insA"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644615_18644616insA"	""	"pathogenic (recessive)"	""
"0001019321"	"0"	"90"	"X"	"18662621"	"18662621"	"subst"	"0"	"00006"	"RS1_000354"	"g.18662621A>G"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644501A>G"	""	"pathogenic (recessive)"	""
"0001019322"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019323"	"0"	"90"	"X"	"18662584"	"18662584"	"del"	"0"	"00006"	"RS1_000165"	"g.18662584del"	""	"{PMID:Wei 2024:38324300}"	""	"489delG"	""	"Germline"	""	""	"0"	""	""	"g.18644464del"	""	"pathogenic (recessive)"	""
"0001019324"	"0"	"90"	"X"	"18662672"	"18662672"	"subst"	"0"	"00006"	"RS1_000314"	"g.18662672A>G"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644552A>G"	""	"pathogenic (recessive)"	""
"0001019325"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019326"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019327"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001019328"	"0"	"90"	"X"	"18665370"	"18665370"	"subst"	"0"	"00006"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647250A>T"	""	"pathogenic (recessive)"	""
"0001019329"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Wei 2024:38324300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019330"	"0"	"90"	"X"	"18662548"	"18662548"	"subst"	"0"	"00006"	"RS1_000440"	"g.18662548A>T"	""	"{PMID:Azevedo 2024:38172268}"	""	"552+2T>A"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18644428A>T"	""	"pathogenic (recessive)"	""
"0001019339"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019340"	"0"	"90"	"X"	"18674772"	"18674879"	"del"	"0"	"00006"	"RS1_000021"	"g.(18665453_18674772)_(18674879_18675759)del"	""	"{PMID:Hahn 2022:34624300}"	""	"del ex3"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18656759_18657639)del"	""	"pathogenic (recessive)"	""
"0001019341"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019342"	"0"	"90"	"X"	"18690186"	"18690186"	"subst"	"0"	"00006"	"RS1_000289"	"g.18690186C>A"	""	"{PMID:Hahn 2022:34624300}"	""	"(Met1Ile)"	""	"Germline"	""	""	"0"	""	""	"g.18672066C>A"	""	"pathogenic (recessive)"	""
"0001019343"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic (recessive)"	""
"0001019344"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019345"	"0"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic (recessive)"	""
"0001019346"	"0"	"90"	"X"	"18662668"	"18662668"	"subst"	"0"	"00006"	"RS1_000048"	"g.18662668C>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644548C>A"	""	"pathogenic (recessive)"	""
"0001019347"	"0"	"90"	"X"	"18662644"	"18662644"	"subst"	"0"	"00006"	"RS1_000058"	"g.18662644T>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644524T>A"	""	"pathogenic (recessive)"	""
"0001019348"	"0"	"90"	"X"	"18662636"	"18662636"	"subst"	"0"	"00006"	"RS1_000059"	"g.18662636C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644516C>T"	""	"pathogenic (recessive)"	""
"0001019349"	"0"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"pathogenic (recessive)"	""
"0001019350"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019351"	"0"	"90"	"X"	"18662621"	"18662621"	"subst"	"0"	"00006"	"RS1_000313"	"g.18662621A>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644501A>T"	""	"pathogenic (recessive)"	""
"0001019352"	"0"	"90"	"X"	"18662620"	"18662620"	"subst"	"0"	"00006"	"RS1_000459"	"g.18662620T>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644500T>C"	""	"pathogenic (recessive)"	""
"0001019353"	"0"	"90"	"X"	"18660233"	"18660233"	"del"	"0"	"00006"	"RS1_000221"	"g.18660233del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642113del"	""	"pathogenic (recessive)"	""
"0001019354"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic (recessive)"	""
"0001019355"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019356"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019357"	"0"	"90"	"X"	"18665314"	"18665314"	"subst"	"0"	"00006"	"RS1_000103"	"g.18665314A>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647194A>C"	""	"pathogenic (recessive)"	""
"0001019358"	"0"	"90"	"X"	"18662681"	"18662681"	"subst"	"0"	"00006"	"RS1_000223"	"g.18662681T>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644561T>C"	""	"pathogenic (recessive)"	""
"0001019359"	"0"	"90"	"X"	"18662660"	"18662660"	"subst"	"0"	"00006"	"RS1_000050"	"g.18662660T>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644540T>C"	""	"pathogenic (recessive)"	""
"0001019360"	"0"	"90"	"X"	"18662648"	"18662648"	"subst"	"0"	"00006"	"CDKL5_000164"	"g.18662648A>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644528A>G"	""	"pathogenic (recessive)"	""
"0001019361"	"0"	"90"	"X"	"18662643"	"18662644"	"ins"	"0"	"00006"	"RS1_000461"	"g.18662643_18662644insCA"	""	"{PMID:Hahn 2022:34624300}"	""	"428insTG"	""	"Germline"	""	""	"0"	""	""	"g.18644523_18644524insCA"	""	"pathogenic (recessive)"	""
"0001019362"	"0"	"90"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644514C>G"	""	"pathogenic (recessive)"	""
"0001019363"	"0"	"90"	"X"	"18662588"	"18662588"	"del"	"0"	"00006"	"RS1_000455"	"g.18662588del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644468del"	""	"pathogenic (recessive)"	""
"0001019364"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001019365"	"0"	"90"	"X"	"18660144"	"18660144"	"del"	"0"	"00006"	"RS1_000087"	"g.18660144del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642024del"	""	"pathogenic (recessive)"	""
"0001019366"	"0"	"90"	"X"	"18665366"	"18665366"	"subst"	"0"	"00006"	"RS1_000383"	"g.18665366C>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647246C>A"	""	"pathogenic (recessive)"	""
"0001019367"	"0"	"90"	"X"	"18665363"	"18665363"	"subst"	"0"	"00006"	"RS1_000473"	"g.18665363A>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647243A>T"	""	"pathogenic (recessive)"	""
"0001019368"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	""
"0001019369"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019370"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	""
"0001019371"	"0"	"90"	"X"	"18665306"	"18665306"	"subst"	"0"	"00006"	"RS1_000241"	"g.18665306C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647186C>G"	""	"pathogenic (recessive)"	""
"0001019372"	"0"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic (recessive)"	""
"0001019373"	"0"	"90"	"X"	"18662740"	"18662740"	"subst"	"0"	"00006"	"RS1_000466"	"g.18662740G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644620G>A"	""	"pathogenic (recessive)"	""
"0001019374"	"0"	"90"	"X"	"18662706"	"18662706"	"subst"	"0"	"00006"	"RS1_000297"	"g.18662706C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644586C>T"	""	"pathogenic (recessive)"	""
"0001019375"	"0"	"90"	"X"	"18662698"	"18662701"	"del"	"0"	"00006"	"RS1_000045"	"g.18662698_18662701del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644578_18644581del"	""	"pathogenic (recessive)"	""
"0001019376"	"0"	"90"	"X"	"18662639"	"18662639"	"subst"	"0"	"00006"	"RS1_000163"	"g.18662639C>G"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644519C>G"	""	"pathogenic (recessive)"	""
"0001019377"	"0"	"90"	"X"	"18662619"	"18662619"	"subst"	"0"	"00006"	"RS1_000458"	"g.18662619G>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644499G>C"	""	"pathogenic (recessive)"	""
"0001019378"	"0"	"90"	"X"	"18662613"	"18662616"	"delins"	"0"	"00006"	"RS1_000456"	"g.18662613_18662616delinsGTC"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644493_18644496delinsGTC"	""	"pathogenic (recessive)"	""
"0001019379"	"0"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000115"	"g.18662583C>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644463C>A"	""	"pathogenic (recessive)"	""
"0001019380"	"0"	"90"	"X"	"18690137"	"18690137"	"subst"	"0"	"00006"	"RS1_000322"	"g.18690137C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672017C>T"	""	"pathogenic (recessive)"	""
"0001019381"	"0"	"90"	"X"	"18662548"	"18662548"	"subst"	"0"	"00006"	"RS1_000440"	"g.18662548A>T"	""	"{PMID:Hahn 2022:34624300}"	""	"552+2T>A"	""	"Germline"	""	""	"0"	""	""	"g.18644428A>T"	""	"pathogenic (recessive)"	""
"0001019382"	"0"	"90"	"X"	"18660223"	"18660225"	"del"	"0"	"00006"	"RS1_000448"	"g.18660223_18660225del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642103_18642105del"	""	"pathogenic (recessive)"	""
"0001019383"	"0"	"90"	"X"	"18660225"	"18660225"	"del"	"0"	"00006"	"RS1_000205"	"g.18660225del"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105del"	""	"pathogenic (recessive)"	""
"0001019384"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019385"	"0"	"90"	"X"	"18660192"	"18660192"	"subst"	"0"	"00006"	"RS1_000333"	"g.18660192G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642072G>A"	""	"pathogenic (recessive)"	""
"0001019386"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000220"	"g.18660191G>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>C"	""	"pathogenic (recessive)"	""
"0001019387"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019388"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	""
"0001019389"	"0"	"90"	"X"	"18660168"	"18660168"	"subst"	"0"	"00006"	"RS1_000151"	"g.18660168C>T"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642048C>T"	""	"pathogenic (recessive)"	""
"0001019390"	"0"	"90"	"X"	"18660142"	"18660142"	"subst"	"0"	"00006"	"RS1_000326"	"g.18660142G>C"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642022G>C"	""	"pathogenic (recessive)"	""
"0001019391"	"0"	"90"	"X"	"18675753"	"18675755"	"delins"	"0"	"00006"	"RS1_000478"	"g.18675753_18675755delinsAAA"	""	"{PMID:Hahn 2022:34624300}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657633_18657635delinsAAA"	""	"pathogenic (recessive)"	""
"0001019392"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019393"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019394"	"0"	"90"	"X"	"18662743"	"18662743"	"subst"	"0"	"00006"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644623C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019395"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000470"	"g.18665312C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019396"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000470"	"g.18665312C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019397"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019398"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019399"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Wey 2023:38020097}"	""	"(I194H )"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019400"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Wey 2023:38020097}"	""	"(I194H )"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019401"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019402"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019403"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019404"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019405"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Wey 2023:38020097}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019406"	"0"	"50"	"X"	"18674772"	"18675786"	"del"	"0"	"00006"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Wey 2023:38020097}"	""	"del ex2-3"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18657666_18672016)del"	""	"VUS"	"ACMG"
"0001019407"	"0"	"50"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Wey 2023:38020097}"	""	"del ex2"	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"VUS"	"ACMG"
"0001019408"	"21"	"90"	"X"	"18662585"	"18662585"	"subst"	"0"	"00006"	"RS1_000441"	"g.18662585A>C"	""	"{PMID:Waibel 2022:Waibel}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18644465A>C"	""	"pathogenic (recessive)"	""
"0001019410"	"0"	"90"	"X"	"18665431"	"18665431"	"subst"	"0"	"00006"	"RS1_000161"	"g.18665431A>G"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647311A>G"	""	"pathogenic (recessive)"	""
"0001019411"	"0"	"90"	"X"	"18665431"	"18665431"	"subst"	"0"	"00006"	"RS1_000161"	"g.18665431A>G"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647311A>G"	""	"pathogenic (recessive)"	""
"0001019412"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752064"	"0"	""	""	"g.18647229C>T"	""	"pathogenic (recessive)"	""
"0001019413"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752064"	"0"	""	""	"g.18647229C>T"	""	"pathogenic (recessive)"	""
"0001019414"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019415"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000196"	"g.18660201G>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>T"	""	"pathogenic (recessive)"	""
"0001019416"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019417"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019418"	"0"	"90"	"X"	"18686224"	"18690186"	"del"	"0"	"00006"	"RS1_000480"	"g.(18685276_18686224)_(18690186_18690251)del"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	"arr[GRCh37] Xp22.13(18685276x1,18686224_18690186x0,18690251x1)"	"g.(18667156_18668104)_(18672066_18672131)del"	""	"pathogenic (recessive)"	""
"0001019419"	"0"	"90"	"X"	"18686224"	"18690186"	"del"	"0"	"00006"	"RS1_000480"	"g.(18685276_18686224)_(18690186_18690251)del"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	"arr[GRCh37] Xp22.13(18685276x1,18686224_18690186x0,18690251x1)"	"g.(18667156_18668104)_(18672066_18672131)del"	""	"pathogenic (recessive)"	""
"0001019420"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019421"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019422"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019423"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019424"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001019425"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019426"	"0"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000462"	"g.18662654C>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644534C>A"	""	"pathogenic (recessive)"	""
"0001019427"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019428"	"0"	"90"	"X"	"18674808"	"18674808"	"subst"	"0"	"00006"	"RS1_000135"	"g.18674808C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18656688C>T"	""	"pathogenic (recessive)"	""
"0001019429"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019430"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019431"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019432"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs281865365"	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019433"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs281865361"	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019434"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019435"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019436"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Fortunato 2023:36377647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019437"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019438"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019439"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019440"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019441"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019442"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019443"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019444"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019445"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019446"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019447"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019448"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019449"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019450"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019451"	"0"	"90"	"X"	"18660268"	"18660268"	"subst"	"0"	"00006"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642148A>C"	""	"pathogenic (recessive)"	""
"0001019452"	"0"	"90"	"X"	"18660268"	"18660268"	"subst"	"0"	"00006"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642148A>C"	""	"pathogenic (recessive)"	""
"0001019453"	"0"	"90"	"X"	"18660268"	"18660268"	"subst"	"0"	"00006"	"RS1_000312"	"g.18660268A>C"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642148A>C"	""	"pathogenic (recessive)"	""
"0001019454"	"0"	"90"	"X"	"18662614"	"18662614"	"subst"	"0"	"00006"	"RS1_000457"	"g.18662614A>C"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644494A>C"	""	"pathogenic (recessive)"	""
"0001019455"	"0"	"90"	"X"	"18662614"	"18662614"	"subst"	"0"	"00006"	"RS1_000457"	"g.18662614A>C"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644494A>C"	""	"pathogenic (recessive)"	""
"0001019456"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000443"	"g.18660200C>G"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642080C>G"	""	"pathogenic (recessive)"	""
"0001019457"	"0"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic (recessive)"	""
"0001019458"	"0"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic (recessive)"	""
"0001019459"	"0"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic (recessive)"	""
"0001019460"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019461"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Cetin 2022:34865595}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019465"	"21"	"90"	"X"	"18690170"	"18690170"	"del"	"0"	"00006"	"RS1_000482"	"g.18690170del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672050del"	""	"pathogenic (recessive)"	""
"0001019466"	"21"	"90"	"X"	"18690170"	"18690170"	"del"	"0"	"00006"	"RS1_000482"	"g.18690170del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672050del"	""	"pathogenic (recessive)"	""
"0001019467"	"0"	"90"	"X"	"18690170"	"18690170"	"del"	"0"	"00006"	"RS1_000482"	"g.18690170del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672050del"	""	"pathogenic (recessive)"	""
"0001019468"	"21"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	"{CV:000098944.7}"	"pathogenic (recessive)"	""
"0001019469"	"21"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	"{CV:000098944.7}"	"pathogenic (recessive)"	""
"0001019470"	"0"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	"{CV:000098944.7}"	"pathogenic (recessive)"	""
"0001019471"	"0"	"90"	"X"	"18665450"	"18665450"	"subst"	"0"	"00006"	"RS1_000292"	"g.18665450A>G"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647330A>G"	""	"pathogenic (recessive)"	""
"0001019472"	"0"	"90"	"X"	"18665362"	"18665362"	"subst"	"0"	"00006"	"RS1_000472"	"g.18665362C>T"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647242C>T"	""	"pathogenic (recessive)"	""
"0001019473"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	"{CV:000009896.11}"	"pathogenic (recessive)"	""
"0001019474"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	"{CV:000009896.11}"	"pathogenic (recessive)"	""
"0001019475"	"21"	"90"	"X"	"18662693"	"18662697"	"del"	"0"	"00006"	"RS1_000463"	"g.18662693_18662697del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644573_18644577del"	""	"pathogenic (recessive)"	""
"0001019476"	"0"	"90"	"X"	"18660260"	"18660260"	"subst"	"0"	"00006"	"RS1_000449"	"g.18660260G>T"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.18642140G>T"	""	"pathogenic (recessive)"	""
"0001019477"	"0"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	"{CV:000098986.3}"	"pathogenic (recessive)"	""
"0001019478"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	"{CV:000098990.4}"	"pathogenic (recessive)"	""
"0001019479"	"21"	"90"	"X"	"18660223"	"18660224"	"ins"	"0"	"00006"	"RS1_000447"	"g.18660223_18660224insA"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642103_18642104insA"	""	"pathogenic (recessive)"	""
"0001019480"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	"{CV:000099009.5}"	"pathogenic (recessive)"	""
"0001019481"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	"{CV:000099009.5}"	"pathogenic (recessive)"	""
"0001019482"	"21"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	"{CV:000099009.5}"	"pathogenic (recessive)"	""
"0001019483"	"21"	"90"	"X"	"18690155"	"18690158"	"del"	"0"	"00006"	"RS1_000012"	"g.18690155_18690158del"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672035_18672038del"	"{CV:000098944.7}"	"pathogenic (recessive)"	""
"0001019484"	"21"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	"{CV:000098959.9}"	"pathogenic (recessive)"	""
"0001019485"	"21"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Kousal 2021:34828422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	"{CV:000098986.3}"	"pathogenic (recessive)"	""
"0001019486"	"0"	"90"	"X"	"18690170"	"18690170"	"del"	"0"	"00006"	"RS1_000482"	"g.18690170del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672050del"	""	"pathogenic (recessive)"	""
"0001019487"	"21"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	"[35T>A;52+5G>C]"	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019488"	"21"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	"[35T>A;52+5G>C]"	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019489"	"21"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	"[35T>A;52+5G>C]"	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019490"	"0"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019491"	"0"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019492"	"0"	"70"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs62645879"	"0"	""	""	"g.18672034A>T"	""	"likely pathogenic (recessive)"	""
"0001019493"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000014"	"g.18690136C>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	"rs281865336"	"0"	""	""	"g.18672016C>A"	""	"pathogenic (recessive)"	""
"0001019494"	"0"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00006"	"RS1_000128"	"g.18690135A>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	"rs281865334"	"0"	""	""	"g.18672015A>G"	""	"pathogenic (recessive)"	""
"0001019495"	"0"	"70"	"X"	"18675819"	"18675819"	"subst"	"0"	"00006"	"RS1_000179"	"g.18675819T>C"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18657699T>C"	""	"likely pathogenic (recessive)"	""
"0001019496"	"0"	"70"	"X"	"18675760"	"18675760"	"subst"	"0"	"00006"	"RS1_000142"	"g.18675760C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18657640C>G"	""	"likely pathogenic (recessive)"	""
"0001019497"	"0"	"70"	"X"	"18675760"	"18675760"	"subst"	"0"	"00006"	"RS1_000142"	"g.18675760C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18657640C>G"	""	"likely pathogenic (recessive)"	""
"0001019498"	"0"	"70"	"X"	"18675760"	"18675760"	"subst"	"0"	"00006"	"RS1_000142"	"g.18675760C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18657640C>G"	""	"likely pathogenic (recessive)"	""
"0001019499"	"0"	"90"	"X"	"18674854"	"18674854"	"subst"	"0"	"00006"	"RS1_000138"	"g.18674854G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3"	"Germline"	""	""	"0"	""	""	"g.18656734G>A"	""	"pathogenic (recessive)"	""
"0001019500"	"0"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP4, BP4"	"Germline"	""	"rs62645885"	"0"	""	""	"g.18656717G>T"	""	"pathogenic (recessive)"	""
"0001019501"	"0"	"90"	"X"	"18674771"	"18674771"	"subst"	"0"	"00006"	"RS1_000398"	"g.18674771A>C"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4, PP5"	"Germline"	""	"rs1555959367"	"0"	""	""	"g.18656651A>C"	""	"pathogenic (recessive)"	""
"0001019502"	"0"	"90"	"X"	"18665453"	"18665453"	"subst"	"0"	"00006"	"RS1_000397"	"g.18665453C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	"rs281865344"	"0"	""	""	"g.18647333C>T"	""	"pathogenic (recessive)"	""
"0001019503"	"0"	"70"	"X"	"18665431"	"18665431"	"subst"	"0"	"00006"	"RS1_000161"	"g.18665431A>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647311A>G"	""	"likely pathogenic (recessive)"	""
"0001019504"	"0"	"70"	"X"	"18665428"	"18665428"	"subst"	"0"	"00006"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4"	"Germline"	""	"rs62645895"	"0"	""	""	"g.18647308C>T"	""	"likely pathogenic (recessive)"	""
"0001019505"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00006"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>G"	""	"pathogenic (recessive)"	""
"0001019506"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019507"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019508"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019509"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019510"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019511"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019512"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001019513"	"0"	"90"	"X"	"18665421"	"18665421"	"subst"	"0"	"00006"	"RS1_000030"	"g.18665421C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894932"	"0"	""	""	"g.18647301C>G"	""	"pathogenic (recessive)"	""
"0001019514"	"0"	"70"	"X"	"18665398"	"18665398"	"subst"	"0"	"00006"	"RS1_000385"	"g.18665398T>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647278T>G"	""	"likely pathogenic (recessive)"	""
"0001019515"	"0"	"70"	"X"	"18665395"	"18665395"	"subst"	"0"	"00006"	"RS1_000146"	"g.18665395A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	"rs61750457"	"0"	""	""	"g.18647275A>T"	""	"likely pathogenic (recessive)"	""
"0001019516"	"0"	"70"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752062"	"0"	""	""	"g.18647241C>G"	""	"likely pathogenic (recessive)"	""
"0001019517"	"0"	"70"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000317"	"g.18665349C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4, PP5"	"Germline"	""	""	"0"	""	""	"g.18647229C>G"	""	"likely pathogenic (recessive)"	""
"0001019518"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019519"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019520"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019521"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019522"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019523"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019524"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019525"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019526"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019527"	"0"	"70"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"likely pathogenic (recessive)"	""
"0001019528"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019529"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019530"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019531"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752068"	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019532"	"0"	"70"	"X"	"18665329"	"18665329"	"subst"	"0"	"00006"	"RS1_000037"	"g.18665329A>C"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752069"	"0"	""	""	"g.18647209A>C"	""	"likely pathogenic (recessive)"	""
"0001019533"	"0"	"70"	"X"	"18665320"	"18665320"	"subst"	"0"	"00006"	"RS1_000374"	"g.18665320T>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647200T>G"	""	"likely pathogenic (recessive)"	""
"0001019534"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894934"	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	""
"0001019535"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894934"	"0"	""	""	"g.18647192C>A"	""	"pathogenic (recessive)"	""
"0001019536"	"0"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00006"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	"rs281865346"	"0"	""	""	"g.18647190C>T"	""	"pathogenic (recessive)"	""
"0001019537"	"0"	"90"	"X"	"18665311"	"18665311"	"subst"	"0"	"00006"	"RS1_000133"	"g.18665311C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PM5, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647191C>G"	""	"pathogenic (recessive)"	""
"0001019538"	"0"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00006"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752075"	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic (recessive)"	""
"0001019539"	"0"	"70"	"X"	"18662735"	"18662736"	"delins"	"0"	"00006"	"RS1_000465"	"g.18662735_18662736delinsAA"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644615_18644616delinsAA"	""	"likely pathogenic (recessive)"	""
"0001019540"	"0"	"70"	"X"	"18662735"	"18662735"	"subst"	"0"	"00006"	"RS1_000043"	"g.18662735G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752145"	"0"	""	""	"g.18644615G>A"	""	"likely pathogenic (recessive)"	""
"0001019541"	"0"	"90"	"X"	"18662723"	"18662723"	"subst"	"0"	"00006"	"RS1_000201"	"g.18662723G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	"rs199469696"	"0"	""	""	"g.18644603G>A"	""	"pathogenic (recessive)"	""
"0001019542"	"0"	"90"	"X"	"18662694"	"18662694"	"del"	"0"	"00006"	"RS1_000365"	"g.18662694del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644574del"	""	"pathogenic (recessive)"	""
"0001019543"	"0"	"90"	"X"	"18662694"	"18662694"	"del"	"0"	"00006"	"RS1_000365"	"g.18662694del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644574del"	""	"pathogenic (recessive)"	""
"0001019544"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019545"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019546"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019547"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019548"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752158"	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001019549"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61752159"	"0"	""	""	"g.18644530C>T"	""	"pathogenic (recessive)"	""
"0001019550"	"0"	"90"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000224"	"g.18662650C>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>A"	""	"pathogenic (recessive)"	""
"0001019551"	"0"	"90"	"X"	"18662637"	"18662637"	"dup"	"0"	"00006"	"RS1_000357"	"g.18662637dup"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644517dup"	""	"pathogenic (recessive)"	""
"0001019552"	"0"	"90"	"X"	"18662634"	"18662634"	"subst"	"0"	"00006"	"RS1_000060"	"g.18662634C>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753163"	"0"	""	""	"g.18644514C>G"	""	"pathogenic (recessive)"	""
"0001019553"	"0"	"70"	"X"	"18662577"	"18662579"	"del"	"0"	"00006"	"RS1_000273"	"g.18662577_18662579del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM4, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644457_18644459del"	""	"likely pathogenic (recessive)"	""
"0001019554"	"0"	"70"	"X"	"18662576"	"18662576"	"subst"	"0"	"00006"	"RS1_000346"	"g.18662576A>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644456A>G"	""	"likely pathogenic (recessive)"	""
"0001019555"	"0"	"90"	"X"	"18662574"	"18662574"	"subst"	"0"	"00006"	"RS1_000454"	"g.18662574G>C"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644454G>C"	""	"pathogenic (recessive)"	""
"0001019556"	"0"	"70"	"X"	"18662564"	"18662564"	"subst"	"0"	"00006"	"RS1_000342"	"g.18662564T>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644444T>G"	""	"likely pathogenic (recessive)"	""
"0001019557"	"0"	"90"	"X"	"18662559"	"18662559"	"del"	"0"	"00006"	"RS1_000452"	"g.18662559del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644439del"	""	"pathogenic (recessive)"	""
"0001019558"	"0"	"70"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753171"	"0"	""	""	"g.18642135G>A"	""	"likely pathogenic (recessive)"	""
"0001019559"	"0"	"70"	"X"	"18660245"	"18660245"	"subst"	"0"	"00006"	"RS1_000098"	"g.18660245G>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642125G>T"	""	"likely pathogenic (recessive)"	""
"0001019560"	"0"	"90"	"X"	"18660219"	"18660225"	"delins"	"0"	"00006"	"RS1_000445"	"g.18660219_18660225delinsAGGGGGGT"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642099_18642105delinsAGGGGGGT"	""	"pathogenic (recessive)"	""
"0001019561"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019562"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019563"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019564"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019565"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019566"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019567"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019568"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs61753174"	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	""
"0001019569"	"0"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000159"	"g.18660224G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642104G>A"	""	"pathogenic (recessive)"	""
"0001019570"	"0"	"90"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PS1, PM1, PM2, PM5, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865351"	"0"	""	""	"g.18642102G>A"	""	"pathogenic (recessive)"	""
"0001019571"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP1, PP3, PP4, PP5"	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019572"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP1, PP3, PP4, PP5"	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019573"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP1, PP3, PP4, PP5"	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019574"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PVS1, PM2, PP1, PP3, PP4, PP5"	"Germline"	""	"rs199469697"	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019575"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019576"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019577"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865354"	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019578"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865355"	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001019579"	"0"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000444"	"g.18660203A>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>T"	""	"likely pathogenic (recessive)"	""
"0001019580"	"0"	"70"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865356"	"0"	""	""	"g.18642083A>G"	""	"likely pathogenic (recessive)"	""
"0001019581"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019582"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019583"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019584"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019585"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019586"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019587"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865357"	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	""
"0001019588"	"0"	"70"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000196"	"g.18660201G>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>T"	""	"likely pathogenic (recessive)"	""
"0001019589"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865358"	"0"	""	""	"g.18642080C>T"	""	"pathogenic (recessive)"	""
"0001019590"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs104894930"	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	""
"0001019591"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865361"	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001019592"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865365"	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019593"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865365"	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019594"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865365"	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	""
"0001019595"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865364"	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001019596"	"0"	"90"	"X"	"18660152"	"18660152"	"subst"	"0"	"00006"	"RS1_000083"	"g.18660152A>G"	""	"{PMID:Georgiou 2022:34822951}"	""	""	"ACMG PM1, PM2, PP2, PP3, PP4, PP5"	"Germline"	""	"rs281865368"	"0"	""	""	"g.18642032A>G"	""	"pathogenic (recessive)"	""
"0001019597"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Georgiou 2022:34822951}"	""	"(?_1-1)_(52+1_53-1)del"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	""
"0001019598"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Georgiou 2022:34822951}"	""	"(?_1-1)_(52+1_53-1)del"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	""
"0001019599"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Georgiou 2022:34822951}"	""	"(?_1-1)_(52+1_53-1)del"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	""
"0001019600"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Georgiou 2022:34822951}"	""	"(?_1-1)_(52+1_53-1)del"	""	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	""
"0001019601"	"0"	"90"	"X"	"18662549"	"18665453"	"del"	"0"	"00006"	"RS1_000450"	"g.(18660277_18662549)_(18665453_18674772)del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18642157_18644429)_(18647333_18656652)del"	""	"pathogenic (recessive)"	""
"0001019602"	"0"	"90"	"X"	"18674772"	"18675786"	"del"	"0"	"00006"	"RS1_000424"	"g.(18665453_18674772)_(18675786_18690136)del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	""	"Germline"	""	""	"0"	""	""	"c.(52+1_53-1)_(184+1_185-1)del"	""	"pathogenic (recessive)"	""
"0001019603"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Georgiou 2022:34822951}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	""
"0001019604"	"21"	"90"	"X"	"18665395"	"18665395"	"subst"	"0"	"00006"	"RS1_000146"	"g.18665395A>T"	""	"{PMID:Chatterjee 2023:37317958}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18647275A>T"	""	"pathogenic (recessive)"	""
"0001019605"	"21"	"90"	"X"	"18665395"	"18665395"	"subst"	"0"	"00006"	"RS1_000146"	"g.18665395A>T"	""	"{PMID:Chatterjee 2023:37317958}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18647275A>T"	""	"pathogenic (recessive)"	""
"0001019606"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Chatterjee 2023:37317958}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019608"	"21"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Carta 2023:36314434}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	""
"0001019609"	"11"	"90"	"X"	"18665371"	"18665371"	"del"	"0"	"00006"	"RS1_000483"	"g.18665371del"	""	"{PMID:Kirkby 2023:37372373}"	""	"266delA"	""	"Germline"	""	""	"0"	"skewed X-inactivation 86:14"	""	"g.18647251del"	""	"pathogenic (recessive)"	""
"0001019610"	"11"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Saldana 2007:17304551}"	"AluI+"	"R102Q"	""	"Germline"	"yes"	""	"0"	"X-inactivation analysis inconclusive"	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001019612"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Lesch 2008:19093009}"	""	"579dupC"	""	"Germline"	"yes"	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001019613"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Staffieri 2015:25894957}"	""	""	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019614"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Staffieri 2015:25894957}"	""	""	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019615"	"3"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Staffieri 2015:25894957}"	""	""	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019616"	"3"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Staffieri 2015:25894957}"	""	""	""	"Germline"	"yes"	"rs61752067"	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019620"	"3"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Khan 2019:30608181}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019621"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Khan 2019:30608181}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019622"	"21"	"90"	"X"	"18662583"	"18662583"	"subst"	"0"	"00006"	"RS1_000096"	"g.18662583C>T"	""	"{PMID:Li 2023:37069516}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644463C>T"	""	"pathogenic (recessive)"	""
"0001019623"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Tondelli 2022:36695495}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001019624"	"3"	"90"	"X"	"18660155"	"18660155"	"subst"	"0"	"00006"	"RS1_000177"	"g.18660155T>A"	""	"{PMID:Pineda-Garrido 2022:36341910}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642035T>A"	""	"pathogenic (recessive)"	""
"0001019631"	"21"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000405"	"g.18690136C>G"	""	"{PMID:Jimenez 2022:36362148}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>G"	""	"pathogenic (recessive)"	""
"0001019632"	"0"	"90"	"X"	"18675485"	"18676645"	"del"	"0"	"00006"	"RS1_000484"	"g.18675485_18676645del"	""	"{PMID:Jimenez 2022:36362148}, {PMID:Wen 2023:36811936}"	""	"(A18Pfs*108)"	""	"Germline"	""	""	"0"	""	""	"g.18657365_18658525del"	""	"pathogenic (recessive)"	""
"0001019655"	"21"	"90"	"X"	"18675786"	"18675786"	"subst"	"0"	"00006"	"RS1_000479"	"g.18675786C>T"	""	"{PMID:Wang 2022:36212125}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18657666C>T"	""	"pathogenic (recessive)"	""
"0001019657"	"0"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PVS1, PS4, PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672068T>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019658"	"0"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PVS1, PS4, PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672068T>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019659"	"0"	"90"	"X"	"18690188"	"18690188"	"subst"	"0"	"00006"	"RS1_000160"	"g.18690188T>A"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PVS1, PS4, PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672068T>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019660"	"1"	"90"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PS4, PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672034A>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019661"	"1"	"90"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18672034A>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019662"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019663"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019664"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019665"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000013"	"g.18690136C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18672016C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019666"	"0"	"90"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000014"	"g.18690136C>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18672016C>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019667"	"0"	"90"	"X"	"18675819"	"18675819"	"subst"	"0"	"00006"	"RS1_000179"	"g.18675819T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3-PM, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18657699T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019668"	"0"	"90"	"X"	"18675819"	"18675819"	"subst"	"0"	"00006"	"RS1_000179"	"g.18675819T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3-PM, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18657699T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019669"	"0"	"90"	"X"	"18675770"	"18675770"	"subst"	"0"	"00006"	"RS1_000019"	"g.18675770G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18657650G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019670"	"0"	"50"	"X"	"18675755"	"18675755"	"subst"	"0"	"00006"	"RS1_000170"	"g.18675755C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18657635C>T"	""	"VUS"	"ACMG"
"0001019671"	"0"	"90"	"X"	"18674864"	"18674864"	"dup"	"0"	"00006"	"RS1_000211"	"g.18674864dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656744dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019672"	"0"	"90"	"X"	"18674864"	"18674864"	"dup"	"0"	"00006"	"RS1_000211"	"g.18674864dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656744dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019673"	"0"	"90"	"X"	"18674860"	"18674860"	"del"	"0"	"00006"	"RS1_000261"	"g.18674860del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656740del"	""	"pathogenic (recessive)"	"ACMG"
"0001019674"	"0"	"90"	"X"	"18674858"	"18674858"	"subst"	"0"	"00006"	"RS1_000400"	"g.18674858C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656738C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019675"	"0"	"90"	"X"	"18674858"	"18674858"	"subst"	"0"	"00006"	"RS1_000400"	"g.18674858C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656738C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019676"	"0"	"90"	"X"	"18674854"	"18674854"	"subst"	"0"	"00006"	"RS1_000138"	"g.18674854G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656734G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019677"	"0"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019678"	"0"	"90"	"X"	"18674837"	"18674837"	"subst"	"0"	"00006"	"RS1_000002"	"g.18674837G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656717G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019679"	"0"	"90"	"X"	"18674794"	"18674794"	"del"	"0"	"00006"	"RS1_000101"	"g.18674794del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656674del"	""	"pathogenic (recessive)"	"ACMG"
"0001019680"	"0"	"70"	"X"	"18674781"	"18674781"	"subst"	"0"	"00006"	"RS1_000320"	"g.18674781C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	""	"0"	""	""	"g.18656661C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019681"	"0"	"70"	"X"	"18674781"	"18674781"	"subst"	"0"	"00006"	"RS1_000320"	"g.18674781C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5"	"Germline"	""	""	"0"	""	""	"g.18656661C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019682"	"0"	"70"	"X"	"18674781"	"18674781"	"subst"	"0"	"00006"	"RS1_000321"	"g.18674781C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS3, PM2, PP3, PP4, PP"	"Germline"	""	""	"0"	""	""	"g.18656661C>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019683"	"0"	"90"	"X"	"18674772"	"18674772"	"subst"	"0"	"00006"	"RS1_000399"	"g.18674772C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18656652C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019684"	"0"	"90"	"X"	"18665451"	"18665452"	"ins"	"0"	"00006"	"RS1_000396"	"g.18665451_18665452insA"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647331_18647332insA"	""	"pathogenic (recessive)"	"ACMG"
"0001019685"	"0"	"70"	"X"	"18665450"	"18665450"	"subst"	"0"	"00006"	"RS1_000292"	"g.18665450A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647330A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019686"	"0"	"50"	"X"	"18665449"	"18665449"	"subst"	"0"	"00006"	"RS1_000509"	"g.18665449C>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PP"	"Germline"	""	""	"0"	""	""	"g.18647329C>A"	""	"VUS"	"ACMG"
"0001019687"	"0"	"50"	"X"	"18665434"	"18665434"	"subst"	"0"	"00006"	"RS1_000392"	"g.18665434G>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647314G>C"	""	"VUS"	"ACMG"
"0001019688"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019689"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019690"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019691"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019692"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019693"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019694"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019695"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019696"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019697"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019698"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019699"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019700"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019701"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019702"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019703"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019704"	"0"	"90"	"X"	"18665429"	"18665429"	"subst"	"0"	"00006"	"RS1_000028"	"g.18665429C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647309C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019705"	"0"	"90"	"X"	"18665428"	"18665428"	"subst"	"0"	"00006"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647308C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019706"	"0"	"90"	"X"	"18665428"	"18665428"	"subst"	"0"	"00006"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647308C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019707"	"0"	"90"	"X"	"18665428"	"18665428"	"subst"	"0"	"00006"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647308C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019708"	"0"	"90"	"X"	"18665428"	"18665428"	"subst"	"0"	"00006"	"RS1_000298"	"g.18665428C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647308C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019709"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019710"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019711"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019712"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019713"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019714"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019715"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019716"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019717"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019718"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019719"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019720"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019721"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019722"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019723"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019724"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019725"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019726"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019727"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019728"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019729"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019730"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019731"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019732"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019733"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019734"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019735"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019736"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019737"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019738"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019739"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS2, PS4, PS3-M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019740"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00006"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019741"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"0"	"00006"	"RS1_000124"	"g.18665423C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647303C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019742"	"0"	"70"	"X"	"18665421"	"18665421"	"subst"	"0"	"00006"	"RS1_000030"	"g.18665421C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647301C>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019743"	"0"	"90"	"X"	"18665418"	"18665418"	"del"	"0"	"00006"	"RS1_000112"	"g.18665418del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647298del"	""	"pathogenic (recessive)"	"ACMG"
"0001019744"	"0"	"90"	"X"	"18665418"	"18665418"	"del"	"0"	"00006"	"RS1_000112"	"g.18665418del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647298del"	""	"pathogenic (recessive)"	"ACMG"
"0001019745"	"0"	"90"	"X"	"18665418"	"18665418"	"del"	"0"	"00006"	"RS1_000112"	"g.18665418del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647298del"	""	"pathogenic (recessive)"	"ACMG"
"0001019746"	"0"	"90"	"X"	"18665400"	"18665416"	"delins"	"0"	"00006"	"RS1_000507"	"g.18665400_18665416delinsACTCTAACCCGGTCAGGGGA"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647280_18647296delinsACTCTAACCCGGTCAGGGGA"	""	"pathogenic (recessive)"	"ACMG"
"0001019747"	"0"	"50"	"X"	"18665410"	"18665410"	"subst"	"0"	"00006"	"RS1_000508"	"g.18665410A>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647290A>T"	""	"VUS"	"ACMG"
"0001019748"	"0"	"50"	"X"	"18665390"	"18665390"	"subst"	"0"	"00006"	"RS1_000506"	"g.18665390A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647270A>G"	""	"VUS"	"ACMG"
"0001019749"	"0"	"70"	"X"	"18665382"	"18665384"	"del"	"0"	"00006"	"RS1_000113"	"g.18665382_18665384del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM4, PP4"	"Germline"	""	""	"0"	""	""	"g.18647262_18647264del"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019750"	"0"	"70"	"X"	"18665382"	"18665384"	"del"	"0"	"00006"	"RS1_000113"	"g.18665382_18665384del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM4, PP4"	"Germline"	""	""	"0"	""	""	"g.18647262_18647264del"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019751"	"0"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019752"	"0"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019753"	"0"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019754"	"0"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019755"	"0"	"90"	"X"	"18665371"	"18665371"	"subst"	"0"	"00006"	"RS1_000033"	"g.18665371T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647251T>C"	""	"pathogenic (recessive)"	"ACMG"
"0001019756"	"0"	"70"	"X"	"18665365"	"18665365"	"subst"	"0"	"00006"	"RS1_000505"	"g.18665365C>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647245C>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019757"	"0"	"90"	"X"	"18665362"	"18665362"	"subst"	"0"	"00006"	"RS1_000472"	"g.18665362C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647242C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019758"	"0"	"90"	"X"	"18665362"	"18665362"	"subst"	"0"	"00006"	"RS1_000472"	"g.18665362C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647242C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019759"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019760"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019761"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019762"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019763"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019764"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019765"	"0"	"90"	"X"	"18665361"	"18665361"	"subst"	"0"	"00006"	"RS1_000091"	"g.18665361C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647241C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019766"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019767"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019768"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"(?_1-1)_(52+1_53-1)del"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019769"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"(?_1-1)_(52+1_53-1)del"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019770"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"(?_1-1)_(52+1_53-1)del"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019771"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"(?_1-1)_(52+1_53-1)del"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019772"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019773"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019774"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019775"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019776"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019777"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019778"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019779"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019780"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019781"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019782"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019783"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019784"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019785"	"0"	"90"	"X"	"18665351"	"18665351"	"subst"	"0"	"00006"	"RS1_000003"	"g.18665351A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PS4, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647231A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019786"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000147"	"g.18665349C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647229C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019787"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000317"	"g.18665349C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PP1>S, PM2, PM5, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647229C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019788"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019789"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019790"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019791"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019792"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019793"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019794"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019795"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019796"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019797"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019798"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019799"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019800"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019801"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019802"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>M, PM2), PS2>M, PS3>M, PP3, PP4, PM1, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019803"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019804"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019805"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019806"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019807"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019808"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019809"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019810"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019811"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019812"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019813"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019814"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019815"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019816"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019817"	"0"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM5, PP1, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019818"	"0"	"70"	"X"	"18665330"	"18665331"	"ins"	"0"	"00006"	"RS1_000504"	"g.18665330_18665331insAGC"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2), PM4, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647210_18647211insAGC"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019819"	"0"	"70"	"X"	"18665329"	"18665330"	"delins"	"0"	"00006"	"RS1_000503"	"g.18665329_18665330delinsTT"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2), PP4, PP3, PM1"	"Germline"	""	""	"0"	""	""	"g.18647209_18647210delinsTT"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019820"	"0"	"90"	"X"	"18665317"	"18665318"	"ins"	"0"	"00006"	"RS1_000502"	"g.18665317_18665318insT"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647197_18647198insT"	""	"pathogenic (recessive)"	"ACMG"
"0001019821"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM1, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019822"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM1, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019823"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM1, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019824"	"0"	"90"	"X"	"18665312"	"18665312"	"subst"	"1.68157E-5"	"00006"	"RS1_000006"	"g.18665312C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2), PM1, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18647192C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019825"	"0"	"90"	"X"	"18665293"	"18665315"	"del"	"0"	"00006"	"RS1_000501"	"g.18665293_18665315del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18647173_18647195del"	""	"pathogenic (recessive)"	"ACMG"
"0001019826"	"0"	"70"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000104"	"g.18665312C>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM5, PM1"	"Germline"	""	""	"0"	""	""	"g.18647192C>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019827"	"0"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00006"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647190C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019828"	"0"	"90"	"X"	"18665310"	"18665310"	"subst"	"0"	"00006"	"RS1_000038"	"g.18665310C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18647190C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019829"	"0"	"50"	"X"	"18662751"	"18662751"	"subst"	"0"	"00006"	"RS1_000500"	"g.18662751G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP4, PP3"	"Germline"	""	""	"0"	""	""	"g.18644631G>T"	""	"VUS"	"ACMG"
"0001019830"	"0"	"50"	"X"	"18662744"	"18662744"	"subst"	"0"	"00006"	"RS1_000468"	"g.18662744A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18644624A>G"	""	"VUS"	"ACMG"
"0001019831"	"0"	"70"	"X"	"18662743"	"18662743"	"subst"	"0"	"00006"	"RS1_000039"	"g.18662743C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644623C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019832"	"0"	"10"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"00006"	"RS1_000040"	"g.18662742A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG BA1, BP4"	"Germline"	""	""	"0"	""	""	"g.18644622A>G"	""	"benign"	"ACMG"
"0001019833"	"0"	"10"	"X"	"18662742"	"18662742"	"subst"	"0.0232788"	"00006"	"RS1_000040"	"g.18662742A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG BA1, BP4"	"Germline"	""	""	"0"	""	""	"g.18644622A>G"	""	"benign"	"ACMG"
"0001019834"	"0"	"70"	"X"	"18662735"	"18662735"	"subst"	"0"	"00006"	"RS1_000043"	"g.18662735G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644615G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019835"	"0"	"90"	"X"	"18662718"	"18662718"	"delins"	"0"	"00006"	"RS1_000499"	"g.18662718delinsTGGAGAGCCAGGCACACC"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644598delinsTGGAGAGCCAGGCACACC"	""	"pathogenic (recessive)"	"ACMG"
"0001019836"	"0"	"90"	"X"	"18662718"	"18662718"	"delins"	"0"	"00006"	"RS1_000499"	"g.18662718delinsTGGAGAGCCAGGCACACC"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644598delinsTGGAGAGCCAGGCACACC"	""	"pathogenic (recessive)"	"ACMG"
"0001019837"	"0"	"90"	"X"	"18662718"	"18662718"	"delins"	"0"	"00006"	"RS1_000499"	"g.18662718delinsTGGAGAGCCAGGCACACC"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644598delinsTGGAGAGCCAGGCACACC"	""	"pathogenic (recessive)"	"ACMG"
"0001019838"	"0"	"70"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644572A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019839"	"0"	"70"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644572A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019840"	"0"	"70"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644572A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019841"	"0"	"70"	"X"	"18662692"	"18662692"	"subst"	"0"	"00006"	"RS1_000046"	"g.18662692A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644572A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019842"	"0"	"90"	"X"	"18662682"	"18662682"	"del"	"0"	"00006"	"RS1_000498"	"g.18662682del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644562del"	""	"pathogenic (recessive)"	"ACMG"
"0001019843"	"0"	"90"	"X"	"18662682"	"18662682"	"del"	"0"	"00006"	"RS1_000498"	"g.18662682del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644562del"	""	"pathogenic (recessive)"	"ACMG"
"0001019844"	"0"	"50"	"X"	"18662665"	"18662665"	"subst"	"0"	"00006"	"RS1_000049"	"g.18662665A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644545A>G"	""	"VUS"	"ACMG"
"0001019845"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic (recessive)"	"ACMG"
"0001019846"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic (recessive)"	"ACMG"
"0001019847"	"0"	"90"	"X"	"18662656"	"18662656"	"del"	"0"	"00006"	"RS1_000051"	"g.18662656del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644536del"	""	"pathogenic (recessive)"	"ACMG"
"0001019848"	"0"	"90"	"X"	"18662654"	"18662654"	"subst"	"0"	"00006"	"RS1_000052"	"g.18662654C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4,PP1-M"	"Germline"	""	""	"0"	""	""	"g.18644534C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019849"	"0"	"90"	"X"	"18662653"	"18662653"	"subst"	"0"	"00006"	"RS1_000053"	"g.18662653C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644533C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019850"	"0"	"90"	"X"	"18662653"	"18662653"	"subst"	"0"	"00006"	"RS1_000053"	"g.18662653C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644533C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019851"	"0"	"90"	"X"	"18662653"	"18662653"	"subst"	"0"	"00006"	"RS1_000053"	"g.18662653C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644533C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019852"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5-PP, PP1, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019853"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5-PP, PP1, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019854"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5-PP, PP1, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019855"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5-PP, PP1, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019856"	"0"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PM5-PP, PP1, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019857"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019858"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019859"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019860"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019861"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019862"	"0"	"70"	"X"	"18662650"	"18662650"	"subst"	"0"	"00006"	"RS1_000056"	"g.18662650C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644530C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019863"	"0"	"70"	"X"	"18662648"	"18662648"	"subst"	"0"	"00006"	"CDKL5_000164"	"g.18662648A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4, PM5-PP"	"Germline"	""	""	"0"	""	""	"g.18644528A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019864"	"0"	"70"	"X"	"18662648"	"18662648"	"subst"	"0"	"00006"	"CDKL5_000164"	"g.18662648A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4, PM5-PP"	"Germline"	""	""	"0"	""	""	"g.18644528A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019865"	"0"	"70"	"X"	"18662636"	"18662636"	"subst"	"0"	"00006"	"RS1_000059"	"g.18662636C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644516C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019866"	"0"	"90"	"X"	"18662635"	"18662635"	"del"	"0"	"00006"	"RS1_000496"	"g.18662635del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644515del"	""	"pathogenic (recessive)"	"ACMG"
"0001019867"	"0"	"90"	"X"	"18662635"	"18662635"	"del"	"0"	"00006"	"RS1_000496"	"g.18662635del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644515del"	""	"pathogenic (recessive)"	"ACMG"
"0001019868"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019869"	"0"	"50"	"X"	"18662620"	"18662620"	"subst"	"0"	"00006"	"RS1_000495"	"g.18662620T>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644500T>G"	""	"VUS"	"ACMG"
"0001019870"	"0"	"90"	"X"	"18662616"	"18662616"	"del"	"0"	"00006"	"RS1_000494"	"g.18662616del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644496del"	""	"pathogenic (recessive)"	"ACMG"
"0001019871"	"0"	"70"	"X"	"18662611"	"18662611"	"subst"	"0"	"00006"	"RS1_000125"	"g.18662611T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644491T>C"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019872"	"0"	"50"	"X"	"18662608"	"18662608"	"subst"	"0"	"00006"	"RS1_000062"	"g.18662608T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644488T>C"	""	"VUS"	"ACMG"
"0001019873"	"0"	"90"	"X"	"18662594"	"18662595"	"del"	"0"	"00006"	"RS1_000493"	"g.18662594_18662595del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644474_18644475del"	""	"pathogenic (recessive)"	"ACMG"
"0001019874"	"0"	"90"	"X"	"18662574"	"18662574"	"subst"	"0"	"00006"	"RS1_000302"	"g.18662574G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644454G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019875"	"0"	"90"	"X"	"18662574"	"18662574"	"subst"	"0"	"00006"	"RS1_000302"	"g.18662574G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644454G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019876"	"0"	"90"	"X"	"18662574"	"18662574"	"subst"	"0"	"00006"	"RS1_000302"	"g.18662574G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644454G>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019877"	"0"	"50"	"X"	"18662561"	"18662561"	"subst"	"0"	"00006"	"RS1_000341"	"g.18662561C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18644441C>T"	""	"VUS"	"ACMG"
"0001019878"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019879"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019880"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019881"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019882"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019883"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	"522+2dupT"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019884"	"0"	"90"	"X"	"18662553"	"18662553"	"del"	"0"	"00006"	"RS1_000191"	"g.18662553del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644433del"	""	"pathogenic (recessive)"	"ACMG"
"0001019885"	"0"	"90"	"X"	"18662549"	"18662549"	"subst"	"0"	"00006"	"RS1_000148"	"g.18662549C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644429C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019886"	"0"	"50"	"X"	"18662548"	"18662548"	"dup"	"0"	"00006"	"RS1_000492"	"g.18662548dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18644428dup"	""	"VUS"	"ACMG"
"0001019887"	"0"	"90"	"X"	"18660277"	"18660277"	"subst"	"0"	"00006"	"RS1_000339"	"g.18660277C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18642157C>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019888"	"0"	"70"	"X"	"18660264"	"18660264"	"subst"	"0"	"00006"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642144T>C"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019889"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019890"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019891"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019892"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019893"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019894"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019895"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019896"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019897"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019898"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM2, PS3>M, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019899"	"0"	"70"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000271"	"g.18660224G>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PM5, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642104G>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019900"	"0"	"70"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000106"	"g.18660222G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642102G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019901"	"0"	"70"	"X"	"18660221"	"18660221"	"subst"	"0"	"00006"	"RS1_000008"	"g.18660221G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642101G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019902"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019903"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019904"	"0"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4, PM1"	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	"ACMG"
"0001019905"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019906"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019907"	"0"	"90"	"X"	"18660210"	"18660210"	"subst"	"0"	"00006"	"RS1_000071"	"g.18660210G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642090G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019908"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PS3>M, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019909"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PS3>M, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019910"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PS3>M, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019911"	"0"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PS3>M, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019912"	"0"	"70"	"X"	"18660205"	"18660206"	"ins"	"0"	"00006"	"RS1_000488"	"g.18660205_18660206insGGCGGATGA"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PM4, PP4"	"Germline"	""	""	"0"	""	""	"g.18642085_18642086insGGCGGATGA"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019913"	"0"	"90"	"X"	"18660206"	"18660207"	"ins"	"0"	"00006"	"RS1_000489"	"g.18660206_18660207insGCGGGATGAGGCGGATGAA"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18642086_18642087insGCGGGATGAGGCGGATGAA"	""	"pathogenic (recessive)"	"ACMG"
"0001019914"	"0"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019915"	"0"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019916"	"0"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019917"	"0"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019918"	"0"	"90"	"X"	"18660203"	"18660203"	"subst"	"0"	"00006"	"RS1_000073"	"g.18660203A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642083A>G"	""	"pathogenic (recessive)"	"ACMG"
"0001019919"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019920"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019921"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019922"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019923"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019924"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019925"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019926"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019927"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019928"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019929"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019930"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019931"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019932"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PM6, PS3>M, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642081G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019933"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019934"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019935"	"0"	"90"	"X"	"18660200"	"18660200"	"subst"	"0"	"00006"	"RS1_000075"	"g.18660200C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642080C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019936"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019937"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019938"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019939"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019940"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019941"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019942"	"0"	"90"	"X"	"18660191"	"18660191"	"subst"	"0"	"00006"	"RS1_000077"	"g.18660191G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS2, PS4, PP1>S, PM1, PM2, PP3, PP4, PM5>P"	"Germline"	""	""	"0"	""	""	"g.18642071G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019943"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019944"	"0"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019945"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4, PM5"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019946"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4, PM5"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019947"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Bender 2022:35456481}"	""	"628delA"	"ACMG PS4, PM1, PM2, PP3, PP4, PM5"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019948"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PP3, PP4, PM5"	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019949"	"0"	"70"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000310"	"g.18660173C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642053C>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019950"	"0"	"90"	"X"	"18660171"	"18660171"	"del"	"0"	"00006"	"RS1_000487"	"g.18660171del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18642051del"	""	"pathogenic (recessive)"	"ACMG"
"0001019951"	"0"	"70"	"X"	"18660167"	"18660168"	"delins"	"0"	"00006"	"RS1_000486"	"g.18660167_18660168delinsAA"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642047_18642048delinsAA"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019952"	"0"	"70"	"X"	"18660168"	"18660168"	"subst"	"0"	"00006"	"RS1_000151"	"g.18660168C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642048C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019953"	"0"	"70"	"X"	"18660167"	"18660167"	"subst"	"0"	"00006"	"RS1_000259"	"g.18660167G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642047G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019954"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019955"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019956"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019957"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019958"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PP1>S, PM1, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642042G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001019959"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Bender 2022:35456481}"	""	"639delG"	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019960"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Bender 2022:35456481}"	""	"639delG"	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019961"	"0"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM1, PM2, PM5, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001019962"	"0"	"90"	"X"	"18660161"	"18660161"	"del"	"0"	"00006"	"RS1_000100"	"g.18660161del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18642041del"	""	"pathogenic (recessive)"	"ACMG"
"0001019963"	"0"	"90"	"X"	"18660161"	"18660161"	"del"	"0"	"00006"	"RS1_000100"	"g.18660161del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.18642041del"	""	"pathogenic (recessive)"	"ACMG"
"0001019964"	"0"	"70"	"X"	"18660144"	"18660144"	"subst"	"0"	"00006"	"RS1_000085"	"g.18660144A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM6"	"Germline"	""	""	"0"	""	""	"g.18642024A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019965"	"0"	"50"	"X"	"18660142"	"18660142"	"subst"	"0"	"00006"	"RS1_000326"	"g.18660142G>C"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM5-PP"	"Germline"	""	""	"0"	""	""	"g.18642022G>C"	""	"VUS"	"ACMG"
"0001019966"	"0"	"70"	"X"	"18660132"	"18660132"	"subst"	"0"	"00006"	"RS1_000118"	"g.18660132A>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PM2, PP3, PP4, PM5>P, PS3-M"	"Germline"	""	""	"0"	""	""	"g.18642012A>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019967"	"0"	"70"	"X"	"18660131"	"18660131"	"subst"	"0"	"00006"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642011C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019968"	"0"	"70"	"X"	"18660131"	"18660131"	"subst"	"0"	"00006"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642011C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019969"	"0"	"70"	"X"	"18660131"	"18660131"	"subst"	"0"	"00006"	"RS1_000309"	"g.18660131C>T"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PS4, PM2, PP3, PP4"	"Germline"	""	""	"0"	""	""	"g.18642011C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001019970"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019971"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019972"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019973"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019974"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019975"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019976"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019977"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019978"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019979"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019980"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019981"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex2, (53-?_78+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019982"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex1, (1-?_52+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019983"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex1, (1-?_52+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019984"	"0"	"90"	"X"	"18675759"	"18675786"	"del"	"0"	"00006"	"RS1_000018"	"g.(18674879_18675759)_(18675786_18690136)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex1, (1-?_52+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18656759_18657639)_(18657666_18672016)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019985"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex1, (1-?_52+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019986"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex4-5, (185-?_522+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019987"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Bender 2022:35456481}"	""	"del ex1-4, (1-?_326+?)del"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019988"	"0"	"90"	"X"	"18690136"	"18690223"	"del"	"0"	"00006"	"RS1_000010"	"g.(18675786_18690136)_(18690223_?)del"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PVS1, PS4, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18657666_18672016)_(18672103_?)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019989"	"0"	"90"	"X"	"18662549"	"18665453"	"del"	"0"	"00006"	"RS1_000450"	"g.(18660277_18662549)_(18665453_18674772)del"	""	"{PMID:Bender 2022:35456481}"	""	"[35T>A;52+5G>C]"	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18642157_18644429)_(18647333_18656652)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019990"	"0"	"90"	"X"	"18674772"	"18690223"	"del"	"0"	"00006"	"RS1_000123"	"g.(18665453_18674772)_(18690223_?)del"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PVS1, PM2, PP4"	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18672103_?)del"	""	"pathogenic (recessive)"	"ACMG"
"0001019991"	"1"	"50"	"X"	"18690132"	"18690132"	"subst"	"0"	"00006"	"RS1_000017"	"g.18690132C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP4, PP3, BP2"	"Germline"	""	""	"0"	""	""	"g.18672012C>G"	""	"VUS"	"ACMG"
"0001019992"	"1"	"50"	"X"	"18690132"	"18690132"	"subst"	"0"	"00006"	"RS1_000017"	"g.18690132C>G"	""	"{PMID:Bender 2022:35456481}"	""	""	"ACMG PS4, PM2, PP4, PP3, BP2"	"Germline"	""	""	"0"	""	""	"g.18672012C>G"	""	"VUS"	"ACMG"
"0001019993"	"21"	"90"	"X"	"18662614"	"18662614"	"subst"	"0"	"00006"	"RS1_000457"	"g.18662614A>C"	""	"{PMID:Luo 2022:35446970}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.18644494A>C"	""	"pathogenic (recessive)"	""
"0001019996"	"21"	"90"	"X"	"18660240"	"18660240"	"subst"	"0"	"00006"	"RS1_000193"	"g.18660240G>A"	""	"{PMID:Chen 2021:34675999}"	""	""	"ACMG PVS1, PS4, PM2"	"Germline"	"yes"	""	"0"	""	""	"g.18642120G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0001020004"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020005"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020006"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020007"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020008"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020009"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020010"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020011"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020012"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020013"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020014"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020015"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020016"	"0"	"90"	"X"	"18662631"	"18662631"	"subst"	"0"	"00006"	"RS1_000356"	"g.18662631C>T"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644511C>T"	""	"pathogenic (recessive)"	""
"0001020017"	"0"	"90"	"X"	"18690154"	"18690154"	"subst"	"0"	"00006"	"RS1_000016"	"g.18690154A>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Leu12His"	"in vitro analysis COS-7 cells shows no RS1 in cellular/secreted fractions, no cleavage signal peptide"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18672034A>T"	""	"NA"	""
"0001020018"	"0"	"90"	"X"	"18690151"	"18690151"	"subst"	"0"	"00006"	"RS1_000109"	"g.18690151A>G"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Leu13Pro"	"in vitro analysis COS-7 cells shows no RS1 in cellular/secreted fractions, no cleavage signal peptide"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18672031A>G"	""	"NA"	""
"0001020019"	"0"	"30"	"X"	"18690152"	"18690152"	"subst"	"5.59268E-6"	"00006"	"RS1_000258"	"g.18690152G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Leu13Phe"	"in vitro analysis COS-7 cells shows readily secreted RS1 in cellular fraction"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18672032G>A"	""	"NA"	""
"0001020020"	"0"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Glu72Lys"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, limited secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647303C>T"	""	"NA"	""
"0001020021"	"0"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Arg102Trp"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647213G>A"	""	"NA"	""
"0001020022"	"0"	"90"	"X"	"18660225"	"18660225"	"subst"	"0"	"00006"	"RS1_000007"	"g.18660225G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Pro192Ser"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642105G>A"	""	"NA"	""
"0001020023"	"0"	"90"	"X"	"18660264"	"18660264"	"subst"	"0"	"00006"	"RS1_000192"	"g.18660264T>C"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Asn179Asp"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642144T>C"	""	"NA"	""
"0001020024"	"0"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Arg213Trp"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642042G>A"	""	"NA"	""
"0001020025"	"0"	"90"	"X"	"18660201"	"18660201"	"subst"	"0"	"00006"	"RS1_000074"	"g.18660201G>A"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Arg200Cys"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18642081G>A"	""	"NA"	""
"0001020026"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"00006"	"RS1_000317"	"g.18665349C>G"	""	"{PMID:Vijayasarathy 2010:20809529}"	""	"Trp96Cys"	"in vitro analysis COS-7 cells produced intracellularly retained misfolded RS1 (appeared as dimers or larger aggregates, no secretion"	"In vitro (cloned)"	""	""	"0"	""	""	"g.18647229C>G"	""	"NA"	""
"0001020030"	"21"	"70"	"X"	"18660222"	"18660222"	"subst"	"0"	"00006"	"RS1_000490"	"g.18660222G>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642102G>T"	""	"likely pathogenic (recessive)"	""
"0001020031"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001020032"	"21"	"90"	"X"	"18665333"	"18665333"	"subst"	"5.59936E-6"	"00006"	"RS1_000004"	"g.18665333G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647213G>A"	""	"pathogenic (recessive)"	""
"0001020033"	"21"	"90"	"X"	"18660174"	"18660174"	"subst"	"0"	"00006"	"RS1_000080"	"g.18660174G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642054G>A"	""	"pathogenic (recessive)"	""
"0001020034"	"21"	"70"	"X"	"18660245"	"18660245"	"subst"	"5.61697E-6"	"00006"	"RS1_000491"	"g.18660245G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642125G>A"	""	"likely pathogenic (recessive)"	""
"0001020035"	"21"	"90"	"X"	"18660161"	"18660161"	"subst"	"0"	"00006"	"RS1_000092"	"g.18660161C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642041C>T"	""	"pathogenic (recessive)"	""
"0001020036"	"21"	"90"	"X"	"18665312"	"18665312"	"subst"	"0"	"00006"	"RS1_000470"	"g.18665312C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647192C>T"	""	"pathogenic (recessive)"	""
"0001020037"	"21"	"90"	"X"	"18662736"	"18662736"	"subst"	"0"	"00006"	"RS1_000042"	"g.18662736C>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644616C>A"	""	"pathogenic (recessive)"	""
"0001020038"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001020039"	"21"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647303C>T"	""	"pathogenic (recessive)"	""
"0001020040"	"21"	"70"	"X"	"18662656"	"18662656"	"subst"	"0"	"00006"	"RS1_000497"	"g.18662656T>C"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644536T>C"	""	"likely pathogenic (recessive)"	""
"0001020041"	"21"	"90"	"X"	"18660209"	"18660209"	"subst"	"5.6062E-6"	"00006"	"RS1_000072"	"g.18660209C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642089C>T"	""	"pathogenic (recessive)"	""
"0001020042"	"21"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001020043"	"21"	"90"	"X"	"18660255"	"18660255"	"subst"	"5.62066E-6"	"00006"	"RS1_000067"	"g.18660255G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642135G>A"	""	"pathogenic (recessive)"	""
"0001020044"	"21"	"90"	"X"	"18660224"	"18660224"	"subst"	"0"	"00006"	"RS1_000159"	"g.18660224G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642104G>A"	""	"pathogenic (recessive)"	""
"0001020045"	"21"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000009"	"g.18660173C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642053C>T"	""	"pathogenic (recessive)"	""
"0001020046"	"21"	"70"	"X"	"18660143"	"18660143"	"subst"	"0"	"00006"	"RS1_000303"	"g.18660143C>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642023C>T"	""	"likely pathogenic (recessive)"	""
"0001020047"	"21"	"90"	"X"	"18662651"	"18662651"	"subst"	"0"	"00006"	"RS1_000055"	"g.18662651G>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18644531G>A"	""	"pathogenic (recessive)"	""
"0001020048"	"0"	"90"	"X"	"18660173"	"18660173"	"subst"	"0"	"00006"	"RS1_000178"	"g.18660173C>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.18642053C>A"	""	"pathogenic (recessive)"	""
"0001020049"	"21"	"90"	"X"	"18665325"	"18665325"	"subst"	"0"	"00006"	"RS1_000097"	"g.18665325G>C"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647205G>C"	""	"pathogenic (recessive)"	""
"0001020050"	"21"	"90"	"X"	"18675755"	"18675755"	"subst"	"0"	"00006"	"RS1_000402"	"g.18675755C>A"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18657635C>A"	""	"pathogenic (recessive)"	""
"0001020051"	"21"	"90"	"X"	"18690135"	"18690135"	"subst"	"0"	"00006"	"RS1_000510"	"g.18690135A>T"	""	"{PMID:Gao 2021:33124204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672015A>T"	""	"pathogenic (recessive)"	""
"0001020052"	"21"	"90"	"X"	"18674860"	"18674860"	"del"	"0"	"00006"	"RS1_000261"	"g.18674860del"	""	"{PMID:Gao 2021:33124204}"	""	"97delT"	""	"Germline"	""	""	"0"	""	""	"g.18656740del"	""	"pathogenic (recessive)"	""
"0001020053"	"21"	"90"	"X"	"18674860"	"18674860"	"del"	"0"	"00006"	"RS1_000261"	"g.18674860del"	""	"{PMID:Gao 2021:33124204}"	""	"97delT"	""	"Germline"	""	""	"0"	""	""	"g.18656740del"	""	"pathogenic (recessive)"	""
"0001020054"	"21"	"90"	"X"	"18660227"	"18660227"	"del"	"0"	"00006"	"RS1_000141"	"g.18660227del"	""	"{PMID:Gao 2021:33124204}"	""	"573delG"	""	"Germline"	""	""	"0"	""	""	"g.18642107del"	""	"pathogenic (recessive)"	""
"0001020055"	"21"	"90"	"X"	"18660227"	"18660227"	"del"	"0"	"00006"	"RS1_000141"	"g.18660227del"	""	"{PMID:Gao 2021:33124204}"	""	"573delG"	""	"Germline"	""	""	"0"	""	""	"g.18642107del"	""	"pathogenic (recessive)"	""
"0001020056"	"21"	"70"	"X"	"18690175"	"18690175"	"del"	"0"	"00006"	"RS1_000511"	"g.18690175del"	""	"{PMID:Gao 2021:33124204}"	""	"14delT"	""	"Germline"	""	""	"0"	""	""	"g.18672055del"	""	"likely pathogenic (recessive)"	""
"0001020057"	"21"	"70"	"X"	"18660223"	"18660225"	"del"	"0"	"00006"	"RS1_000448"	"g.18660223_18660225del"	""	"{PMID:Gao 2021:33124204}"	""	"(Ter193del)"	""	"Germline"	""	""	"0"	""	""	"g.18642103_18642105del"	""	"likely pathogenic (recessive)"	""
"0001020058"	"21"	"90"	"X"	"18674772"	"18779695"	"del"	"0"	"00006"	"RS1_000123"	"g.(18665453_18674772)_(18779695_18797127)del"	""	"{PMID:Gao 2021:33124204}"	""	"ex1-3del"	""	"Germline"	""	""	"0"	""	""	"g.(18647333_18656652)_(18761577_18779009)del"	""	"pathogenic (recessive)"	""
"0001020059"	"21"	"90"	"X"	"18657808"	"18665453"	"del"	"0"	"00006"	"RS1_000485"	"g.(?_18657808)_(18665453_18674772)del"	""	"{PMID:Gao 2021:33124204}"	""	"ex4-6del"	""	"Germline"	""	""	"0"	""	""	"g.(?_18639688)_(18647333_18656652)del"	""	"pathogenic (recessive)"	""
"0001020065"	"21"	"90"	"X"	"18665332"	"18665332"	"subst"	"0"	"00006"	"RS1_000036"	"g.18665332C>T"	""	"{PMID:Hiraoka 2001:11281412}, {PMID:Shastry 2010:21472264}"	""	"R102Q"	""	"Germline"	"yes"	""	"0"	""	""	"g.18647212C>T"	""	"pathogenic (recessive)"	""
"0001020067"	"21"	"90"	"X"	"18665370"	"18665370"	"subst"	"0"	"00006"	"RS1_000034"	"g.18665370A>T"	""	"{PMID:Shastry 2010:21472264}"	""	"Y89X"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0001020141"	"20"	"50"	"X"	"18690136"	"18690136"	"subst"	"0"	"00006"	"RS1_000014"	"g.18690136C>A"	""	"{PMID:Lamey 2010:20238027}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18672016C>A"	""	"VUS"	""
"0001020301"	"21"	"90"	"X"	"18660225"	"18660225"	"dup"	"0"	"00006"	"RS1_000070"	"g.18660225dup"	""	"{PMID:Pradhan 2009:19788668}"	""	"Pro192 ins1 cggC"	""	"Germline"	""	""	"0"	""	""	"g.18642105dup"	""	"pathogenic (recessive)"	""
"0001022267"	"1"	"90"	"X"	"18660183"	"18660183"	"subst"	"0"	"00006"	"RS1_000512"	"g.18660183A>C"	""	"{PMID:Midgley 2024:39676705}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18642063A>C"	""	"pathogenic"	""
"0001022273"	"1"	"90"	"X"	"18660162"	"18660162"	"subst"	"0"	"00006"	"RS1_000081"	"g.18660162G>A"	""	"{PMID:Midgley 2024:39676705}"	""	""	""	"Germline"	""	"rs281865365"	"0"	""	""	"g.18642042G>A"	""	"pathogenic"	""
"0001022282"	"1"	"90"	"X"	"18665423"	"18665423"	"subst"	"1.67844E-5"	"00006"	"RS1_000029"	"g.18665423C>T"	""	"{PMID:Midgley 2024:39676705}"	""	""	""	"Germline"	""	"rs104894928"	"0"	""	""	"g.18647303C>T"	""	"pathogenic"	""
"0001022317"	"1"	"70"	"X"	"18665335"	"18665335"	"subst"	"0"	"00006"	"RS1_000513"	"g.18665335G>A"	""	"{PMID:Midgley 2024:39676705}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.18647215G>A"	""	"likely pathogenic"	""
"0001027472"	"0"	"90"	"X"	"18665349"	"18665349"	"subst"	"0"	"02327"	"RS1_000147"	"g.18665349C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001044243"	"0"	"30"	"X"	"18525284"	"18525284"	"subst"	"5.60375E-6"	"01804"	"RS1_000514"	"g.18525284A>G"	""	""	""	"CDKL5(NM_001323289.2):c.64+4A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001044244"	"0"	"30"	"X"	"18577478"	"18577478"	"subst"	"0"	"01804"	"RS1_000515"	"g.18577478G>A"	""	""	""	"CDKL5(NM_001323289.2):c.100-5119G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes RS1
## Count = 2408
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000000301"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.(?)"	"p.(=)"	"1i"
"0000000302"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.(?)"	"p.(=)"	"1i"
"0000000303"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.(?)"	"p.(=)"	"1i"
"0000006452"	"00000905"	"50"	"184"	"3484"	"184"	"3484"	"c.184+3484C>A"	"r.(=)"	"p.(=)"	"3i"
"0000008502"	"00000905"	"50"	"184"	"2978"	"184"	"2978"	"c.184+2978T>C"	"r.(=)"	"p.(=)"	"3i"
"0000014411"	"00000905"	"50"	"78"	"380"	"78"	"380"	"c.78+380T>C"	"r.(=)"	"p.(=)"	"2i"
"0000140769"	"00000905"	"90"	"-2577"	"0"	"52"	"260"	"c.-2577_52+260del"	"r.0?"	"p.0?"	"_1_1i"
"0000140770"	"00000905"	"50"	"0"	"0"	"0"	"0"	"-"	"r.?"	"p.?"	"_1"
"0000140771"	"00000905"	"90"	"0"	"0"	"0"	"0"	"c.="	"r.(=)"	"p.(=)"	"_1_6_"
"0000140772"	"00000905"	"90"	"-1"	"0"	"184"	"1"	"c.(?_-35)_(184+1_185-1)del"	"r.0?"	"p.0?"	"_1_3i"
"0000140773"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140774"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140775"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140776"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140777"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140778"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140779"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140780"	"00000905"	"90"	"1"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140781"	"00000905"	"90"	"1"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140782"	"00000905"	"90"	"1"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000140783"	"00000905"	"90"	"-1"	"0"	"184"	"1"	"c.(?_-35)_(184+1_185-1)del"	"r.0?"	"p.0?"	"_1_3i"
"0000140792"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.(?)"	"p.(Met1?)"	"1"
"0000140793"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.(Met1?)"	"1"
"0000140794"	"00000905"	"90"	"26"	"0"	"26"	"0"	"c.26del"	"r.(?)"	"p.(Leu9Cysfs*117)"	"1"
"0000140795"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11Phefs*114)"	"1"
"0000140796"	"00000905"	"50"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0000140797"	"00000905"	"90"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0000140798"	"00000905"	"90"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0000140799"	"00000905"	"90"	"38"	"0"	"38"	"0"	"c.38T>C"	"r.(?)"	"p.(Leu13Pro)"	"1"
"0000140800"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0000140801"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0000140802"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0000140803"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>T"	"r.spl"	"p.?"	"1i"
"0000140804"	"00000905"	"50"	"52"	"1"	"52"	"1"	"c.52+1G>T"	"r.spl"	"p.?"	"1i"
"0000140805"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2dup"	"r.spl?"	"p.?"	"1i"
"0000140806"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	"1i"
"0000140807"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	"1i"
"0000140808"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	"1i"
"0000140809"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	"1i"
"0000140810"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.spl?"	"p.?"	"1i"
"0000140811"	"00000905"	"90"	"53"	"-34"	"53"	"-34"	"c.53-34A>G"	"r.(?)"	"p.(=)"	"1i"
"0000140812"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000140813"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000140814"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000140815"	"00000905"	"90"	"61"	"0"	"61"	"0"	"c.61G>T"	"r.(?)"	"p.(Gly21*)"	"2"
"0000140816"	"00000905"	"90"	"61"	"0"	"61"	"0"	"c.61G>T"	"r.(?)"	"p.(Gly21*)"	"2"
"0000140817"	"00000905"	"90"	"68"	"0"	"68"	"0"	"c.68C>A"	"r.(?)"	"p.(Ser23*)"	"2"
"0000140818"	"00000905"	"90"	"76"	"0"	"76"	"0"	"c.76G>T"	"r.(?)"	"p.(Glu26*)"	"2"
"0000140819"	"00000905"	"90"	"78"	"0"	"78"	"0"	"c.78G>C"	"r.(?)"	"p.(Glu26Asp)"	"2"
"0000140820"	"00000905"	"90"	"78"	"1"	"78"	"1"	"c.78+1G>A"	"r.spl"	"p.?"	"2i"
"0000140821"	"00000905"	"90"	"78"	"1"	"78"	"1"	"c.78+1G>C"	"r.spl"	"p.?"	"2i"
"0000140822"	"00000905"	"90"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.spl"	"p.?"	"2i"
"0000140823"	"00000905"	"90"	"78"	"5"	"78"	"5"	"c.78+5G>A"	"r.spl?"	"p.?"	"2i"
"0000140824"	"00000905"	"90"	"79"	"-2"	"79"	"-2"	"c.79-2A>G"	"r.spl"	"p.?"	"2i"
"0000140825"	"00000905"	"90"	"79"	"-2"	"79"	"-2"	"c.79-2A>G"	"r.spl"	"p.?"	"2i"
"0000140826"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140827"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140828"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140829"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140830"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140831"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140832"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(Asp27Asnfs*64)"	"2i_3i"
"0000140833"	"00000905"	"90"	"103"	"0"	"103"	"0"	"c.103C>T"	"r.(?)"	"p.(Gln35*)"	"3"
"0000140834"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140835"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140836"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140837"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140838"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140839"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140840"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140841"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000140842"	"00000905"	"90"	"149"	"0"	"149"	"0"	"c.149G>A"	"r.(?)"	"p.(Trp50*)"	"3"
"0000140843"	"00000905"	"90"	"160"	"0"	"163"	"0"	"c.160_163dup"	"r.(?)"	"p.(Thr55Serfs*32)"	"3"
"0000140844"	"00000905"	"90"	"163"	"0"	"163"	"0"	"c.163del"	"r.(?)"	"p.(Thr55Profs*71)"	"3"
"0000140845"	"00000905"	"90"	"173"	"0"	"184"	"21"	"c.173_184+21del"	"r.spl"	"p.?"	"3"
"0000140846"	"00000905"	"90"	"175"	"0"	"175"	"0"	"c.175T>A"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0000140847"	"00000905"	"90"	"175"	"0"	"175"	"0"	"c.175T>A"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0000140848"	"00000905"	"90"	"175"	"0"	"175"	"0"	"c.175T>A"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0000140849"	"00000905"	"90"	"175"	"0"	"175"	"0"	"c.175T>A"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0000140850"	"00000905"	"90"	"175"	"0"	"175"	"0"	"c.175T>A"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0000140851"	"00000905"	"50"	"184"	"35"	"184"	"35"	"c.184+35T>C"	"r.(=)"	"p.(=)"	"3i"
"0000140852"	"00000905"	"10"	"184"	"35"	"184"	"35"	"c.184+35T>C"	"r.(=)"	"p.(=)"	"3i"
"0000140853"	"00000905"	"10"	"184"	"35"	"184"	"35"	"c.184+35T>C"	"r.(=)"	"p.(=)"	"3i"
"0000140854"	"00000905"	"50"	"184"	"35"	"184"	"35"	"c.184+35T>C"	"r.(=)"	"p.(=)"	"3i"
"0000140855"	"00000905"	"10"	"184"	"129"	"184"	"129"	"c.184+129T>G"	"r.(=)"	"p.(=)"	"3i"
"0000140856"	"00000905"	"10"	"184"	"129"	"184"	"129"	"c.184+129T>G"	"r.(=)"	"p.(=)"	"3i"
"0000140857"	"00000905"	"50"	"185"	"-150"	"185"	"-150"	"c.185-150A>C"	"r.(=)"	"p.(=)"	"3i"
"0000140858"	"00000905"	"90"	"185"	"-34"	"326"	"297"	"c.185-34_326+297del"	"r.(?)"	"p.(Glu62Glyfs*17)"	"3i_4i"
"0000140859"	"00000905"	"50"	"185"	"-3"	"185"	"-3"	"c.185-3C>T"	"r.spl?"	"p.?"	"3i"
"0000140860"	"00000905"	"90"	"185"	"-1"	"185"	"-1"	"c.185-1G>C"	"r.spl"	"p.?"	"3i"
"0000140861"	"00000905"	"90"	"194"	"0"	"194"	"0"	"c.194A>G"	"r.(?)"	"p.(Tyr65Cys)"	""
"0000140862"	"00000905"	"90"	"194"	"0"	"194"	"0"	"c.194del"	"r.(?)"	"p.(Tyr65Phefs*61)"	"4"
"0000140863"	"00000905"	"90"	"195"	"0"	"195"	"0"	"c.195del"	"r.(?)"	"p.(His66Thrfs*60)"	"4"
"0000140864"	"00000905"	"90"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	"4"
"0000140865"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140866"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140867"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140868"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140869"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140870"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140871"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140872"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140873"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140874"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140875"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140876"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000140877"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>C"	"r.(?)"	"p.(Gly70Arg)"	"4"
"0000140878"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140879"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140880"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140881"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140882"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140883"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140884"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140885"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140886"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140887"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140888"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140889"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140890"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140891"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140892"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140893"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140894"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140895"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140896"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140897"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140898"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140899"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140900"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140901"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140902"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140903"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140904"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140905"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140906"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140907"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140908"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140909"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140910"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140911"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140912"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140913"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140914"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140915"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140916"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140917"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140918"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140919"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140920"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140921"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140922"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140923"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140924"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140925"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140926"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140927"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140928"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140929"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140930"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140931"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140932"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140933"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140934"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140935"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140936"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140937"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140938"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140939"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140940"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140941"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140942"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140943"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000140944"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0000140945"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0000140946"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0000140947"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0000140948"	"00000905"	"90"	"215"	"0"	"215"	"0"	"c.215A>C"	"r.(?)"	"p.(Glu72Ala)"	"4"
"0000140949"	"00000905"	"90"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Glu72Gly)"	"4"
"0000140950"	"00000905"	"90"	"216"	"0"	"216"	"0"	"c.216G>C"	"r.(?)"	"p.(Glu72Asp)"	"4"
"0000140951"	"00000905"	"90"	"216"	"0"	"216"	"0"	"c.216G>C"	"r.(?)"	"p.(Glu72Asp)"	"4"
"0000140952"	"00000905"	"90"	"217"	"0"	"217"	"0"	"c.217T>C"	"r.(?)"	"p.(Ser73Pro)"	"4"
"0000140953"	"00000905"	"90"	"217"	"0"	"217"	"0"	"c.217T>C"	"r.(?)"	"p.(Ser73Pro)"	"4"
"0000140954"	"00000905"	"90"	"219"	"0"	"219"	"0"	"c.219del"	"r.(?)"	"p.(Glu75Argfs*51)"	"4"
"0000140955"	"00000905"	"90"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000140956"	"00000905"	"90"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000140957"	"00000905"	"90"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000140958"	"00000905"	"90"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000140959"	"00000905"	"90"	"221"	"0"	"237"	"0"	"c.221_237delinsTCCCCTGACCGGGTTA"	"r.(?)"	"p.(Gly74Valfs*3)"	"4"
"0000140960"	"00000905"	"50"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	"4"
"0000140961"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	"4"
"0000140962"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	"4"
"0000140963"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	"4"
"0000140964"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	"4"
"0000140965"	"00000905"	"90"	"227"	"0"	"227"	"0"	"c.227T>G"	"r.(?)"	"p.(Val76Gly)"	"4"
"0000140966"	"00000905"	"90"	"238"	"0"	"238"	"0"	"c.238C>T"	"r.(?)"	"p.(Gln80*)"	"4"
"0000140967"	"00000905"	"90"	"238"	"0"	"238"	"0"	"c.238C>T"	"r.(?)"	"p.(Gln80*)"	"4"
"0000140968"	"00000905"	"50"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	"4"
"0000140969"	"00000905"	"90"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	"4"
"0000140970"	"00000905"	"90"	"253"	"0"	"255"	"0"	"c.253_255del"	"r.(?)"	"p.(Asn85del)"	"4"
"0000140971"	"00000905"	"50"	"262"	"0"	"262"	"0"	"c.262C>T"	"r.(?)"	"p.(Gln88*)"	"4"
"0000140972"	"00000905"	"50"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140973"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140974"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140975"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140976"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140977"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140978"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140979"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000140980"	"00000905"	"50"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89*)"	"4"
"0000140981"	"00000905"	"90"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89*)"	"4"
"0000140982"	"00000905"	"50"	"274"	"0"	"274"	"0"	"c.274T>G"	"r.(?)"	"p.(Trp92Gly)"	"4"
"0000140983"	"00000905"	"50"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000140984"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000140985"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000140986"	"00000905"	"50"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140987"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140988"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140989"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140990"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140991"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140992"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140993"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140994"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140995"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140996"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000140997"	"00000905"	"50"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000140998"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000140999"	"00000905"	"50"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000141000"	"00000905"	"90"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000141001"	"00000905"	"90"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000141002"	"00000905"	"90"	"301"	"0"	"301"	"0"	"c.301del"	"r.(?)"	"p.(Ala101Profs*25)"	"4"
"0000141003"	"00000905"	"90"	"301"	"0"	"301"	"0"	"c.301G>C"	"r.(?)"	"p.(Ala101Pro)"	"4"
"0000141004"	"00000905"	"90"	"301"	"0"	"301"	"0"	"c.301G>C"	"r.(?)"	"p.(Ala101Pro)"	"4"
"0000141005"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141006"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141007"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141008"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141009"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141010"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141011"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141012"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141013"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141014"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141015"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141016"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141017"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141018"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141019"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141020"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141021"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141022"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141023"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141024"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141025"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141026"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141027"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141028"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141029"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141030"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141031"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141032"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141033"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000141034"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141035"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141036"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141037"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141038"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141039"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141040"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141041"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141042"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141043"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141044"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141045"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141046"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141047"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141048"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141049"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141050"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141051"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141052"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141053"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000141055"	"00000905"	"90"	"307"	"0"	"309"	"0"	"c.307_309delinsTTT"	"r.(?)"	"p.(Leu103Phe)"	"4"
"0000141056"	"00000905"	"90"	"308"	"0"	"308"	"0"	"c.308T>G"	"r.(?)"	"p.(Leu103Arg)"	"4"
"0000141057"	"00000905"	"90"	"308"	"0"	"308"	"0"	"c.308T>G"	"r.(?)"	"p.(Leu103Arg)"	"4"
"0000141058"	"00000905"	"90"	"312"	"0"	"312"	"0"	"c.312C>G"	"r.(?)"	"p.(Asn104Lys)"	"4"
"0000141059"	"00000905"	"90"	"318"	"0"	"318"	"0"	"c.318dup"	"r.(?)"	"p.(Gly107Argfs*14)"	"4"
"0000141060"	"00000905"	"90"	"321"	"0"	"326"	"1"	"c.321_326+1del"	"r.spl?"	"p.?"	"4"
"0000141061"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	"4"
"0000141062"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	"4"
"0000141063"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	"4"
"0000141064"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	"4"
"0000141065"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141066"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141067"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141068"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141069"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141070"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141071"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141072"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141073"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141074"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141075"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000141076"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	"4"
"0000141077"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	"4"
"0000141078"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>A"	"r.(?)"	"p.(Gly109Glu)"	"4"
"0000141079"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	"4"
"0000141080"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl?"	"p.?"	"4i"
"0000141081"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl?"	"p.?"	"4i"
"0000141082"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl?"	"p.?"	"4i"
"0000141083"	"00000905"	"90"	"327"	"-3"	"327"	"-3"	"c.327-3C>G"	"r.spl?"	"p.?"	"4i"
"0000141084"	"00000905"	"90"	"327"	"0"	"329"	"0"	"c.327_329del"	"r.(?)"	"p.(Cys110del)"	"5"
"0000141085"	"00000905"	"90"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0000141086"	"00000905"	"90"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0000141087"	"00000905"	"90"	"330"	"0"	"330"	"0"	"c.330T>A"	"r.(?)"	"p.(Cys110*)"	"5"
"0000141088"	"00000905"	"10"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(=)"	"p.(=)"	"5"
"0000141089"	"00000905"	"10"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(=)"	"p.(=)"	"5"
"0000141090"	"00000905"	"30"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(=)"	"p.(=)"	"5"
"0000141091"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141092"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141093"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141094"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141095"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141096"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141097"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141098"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141099"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141100"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000141101"	"00000905"	"90"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Leu113Phe)"	"5"
"0000141102"	"00000905"	"90"	"349"	"0"	"349"	"0"	"c.349C>T"	"r.(?)"	"p.(Gln117*)"	"5"
"0000141103"	"00000905"	"90"	"350"	"0"	"351"	"0"	"c.350_351insT"	"r.(?)"	"p.(Gln117Hisfs*4)"	"5"
"0000141104"	"00000905"	"90"	"354"	"0"	"354"	"0"	"c.354delins327-1_343"	"r.(?)"	"p.(Asp118Glufs*14)"	"5"
"0000141105"	"00000905"	"50"	"366"	"0"	"366"	"0"	"c.366G>C"	"r.(?)"	"p.(Trp122Cys)"	"5"
"0000141106"	"00000905"	"90"	"371"	"0"	"371"	"0"	"c.371A>G"	"r.(?)"	"p.(Gln124Arg)"	"5"
"0000141107"	"00000905"	"90"	"374"	"0"	"374"	"0"	"c.374T>G"	"r.(?)"	"p.(Ile125Arg)"	"5"
"0000141108"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	"5"
"0000141109"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	"5"
"0000141110"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	"5"
"0000141111"	"00000905"	"90"	"376"	"0"	"376"	"0"	"c.376G>C"	"r.(?)"	"p.(Asp126His)"	"5"
"0000141112"	"00000905"	"90"	"377"	"0"	"377"	"0"	"c.377A>G"	"r.(?)"	"p.(Asp126Gly)"	"5"
"0000141113"	"00000905"	"50"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0000141114"	"00000905"	"90"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0000141115"	"00000905"	"90"	"387"	"0"	"434"	"0"	"c.387_434dup"	"r.(?)"	"p.(Glu129_Ile144dup)"	"5"
"0000141116"	"00000905"	"90"	"392"	"0"	"393"	"0"	"c.392_393del"	"r.(?)"	"p.(Lys131Serfs*12)"	"5"
"0000141117"	"00000905"	"50"	"397"	"0"	"397"	"0"	"c.397A>T"	"r.(?)"	"p.(Ile133Phe)"	"5"
"0000141118"	"00000905"	"90"	"397"	"0"	"397"	"0"	"c.397A>T"	"r.(?)"	"p.(Ile133Phe)"	"5"
"0000141119"	"00000905"	"50"	"404"	"0"	"404"	"0"	"c.404G>T"	"r.(?)"	"p.(Gly135Val)"	"5"
"0000141120"	"00000905"	"90"	"404"	"0"	"404"	"0"	"c.404G>T"	"r.(?)"	"p.(Gly135Val)"	"5"
"0000141121"	"00000905"	"50"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0000141122"	"00000905"	"90"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0000141123"	"00000905"	"90"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0000141124"	"00000905"	"90"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0000141125"	"00000905"	"90"	"410"	"0"	"410"	"0"	"c.410T>C"	"r.(?)"	"p.(Leu137Pro)"	"5"
"0000141126"	"00000905"	"50"	"412"	"0"	"412"	"0"	"c.412A>G"	"r.(?)"	"p.(Thr138Ala)"	"5"
"0000141127"	"00000905"	"90"	"412"	"0"	"412"	"0"	"c.412A>G"	"r.(?)"	"p.(Thr138Ala)"	"5"
"0000141128"	"00000905"	"90"	"412"	"0"	"421"	"0"	"c.412_421del"	"r.(?)"	"p.(Thr138Alafs*8)"	"5"
"0000141129"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000141130"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000141131"	"00000905"	"50"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000141132"	"00000905"	"50"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141133"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141134"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141135"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141136"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141137"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000141138"	"00000905"	"50"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	"5"
"0000141139"	"00000905"	"90"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	"5"
"0000141140"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>G"	"r.(?)"	"p.(Arg141Gly)"	"5"
"0000141141"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>G"	"r.(?)"	"p.(Arg141Gly)"	"5"
"0000141142"	"00000905"	"50"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141143"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141144"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141145"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141146"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141147"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141148"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141149"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141150"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141151"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141152"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141153"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141154"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141155"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141156"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141157"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141158"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141160"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000141161"	"00000905"	"90"	"421"	"0"	"422"	"0"	"c.421_422insA"	"r.(?)"	"p.(Arg141Glnfs*3)"	"5"
"0000141162"	"00000905"	"50"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141163"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141164"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141165"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141166"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141167"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141168"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000141169"	"00000905"	"10"	"426"	"0"	"426"	"0"	"c.426T>C"	"r.(=)"	"p.(=)"	"5"
"0000141170"	"00000905"	"90"	"426"	"0"	"426"	"0"	"c.426T>G"	"r.(?)"	"p.(Cys142Trp)"	"5"
"0000141171"	"00000905"	"90"	"426"	"0"	"426"	"0"	"c.426T>G"	"r.(?)"	"p.(Cys142Trp)"	"5"
"0000141172"	"00000905"	"90"	"426"	"0"	"427"	"0"	"c.426_427del"	"r.(?)"	"p.(Cys142*)"	"5"
"0000141173"	"00000905"	"50"	"428"	"0"	"428"	"0"	"c.428A>T"	"r.(?)"	"p.(Asp143Val)"	"5"
"0000141174"	"00000905"	"90"	"428"	"0"	"428"	"0"	"c.428A>T"	"r.(?)"	"p.(Asp143Val)"	"5"
"0000141175"	"00000905"	"90"	"433"	"0"	"433"	"0"	"c.433G>C"	"r.(?)"	"p.(Asp145His)"	"5"
"0000141176"	"00000905"	"50"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0000141177"	"00000905"	"90"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0000141178"	"00000905"	"90"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0000141179"	"00000905"	"50"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0000141180"	"00000905"	"90"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0000141181"	"00000905"	"90"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0000141182"	"00000905"	"90"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0000141183"	"00000905"	"50"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Gln154*)"	"5"
"0000141184"	"00000905"	"90"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Gln154*)"	"5"
"0000141185"	"00000905"	"90"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Gln154*)"	"5"
"0000141186"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141187"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141188"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141189"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141190"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141191"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141192"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000141193"	"00000905"	"50"	"464"	"0"	"464"	"0"	"c.464A>G"	"r.(?)"	"p.(Tyr155Cys)"	"5"
"0000141194"	"00000905"	"90"	"464"	"0"	"464"	"0"	"c.464A>G"	"r.(?)"	"p.(Tyr155Cys)"	"5"
"0000141195"	"00000905"	"90"	"466"	"0"	"466"	"0"	"c.466A>G"	"r.(?)"	"p.(Arg156Gly)"	"5"
"0000141196"	"00000905"	"10"	"472"	"0"	"472"	"0"	"c.472G>A"	"r.(?)"	"p.(Asp158Asn)"	"5"
"0000141197"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163*)"	"5"
"0000141198"	"00000905"	"50"	"489"	"0"	"489"	"0"	"c.489G>A"	"r.(?)"	"p.(Trp163*)"	"5"
"0000141199"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>A"	"r.(?)"	"p.(Trp163*)"	"5"
"0000141200"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>T"	"r.(?)"	"p.(Trp163Cys)"	"5"
"0000141201"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>T"	"r.(?)"	"p.(Trp163Cys)"	"5"
"0000141202"	"00000905"	"90"	"499"	"0"	"499"	"0"	"c.499A>T"	"r.(?)"	"p.(Lys167*)"	"5"
"0000141203"	"00000905"	"90"	"501"	"0"	"501"	"0"	"c.501G>C"	"r.(?)"	"p.(Lys167Asn)"	"5"
"0000141204"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174Glyfs*63)"	"5"
"0000141205"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>A"	"r.spl?"	"p.?"	"5i"
"0000141206"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>T"	"r.spl?"	"p.?"	"5i"
"0000141207"	"00000905"	"90"	"522"	"5"	"522"	"5"	"c.522+5G>A"	"r.spl?"	"p.?"	"5i"
"0000141208"	"00000905"	"90"	"523"	"-2"	"523"	"-2"	"c.523-2A>G"	"r.spl?"	"p.?"	"5i"
"0000141209"	"00000905"	"90"	"527"	"0"	"527"	"0"	"c.527T>C"	"r.(?)"	"p.(Phe176Ser)"	"6"
"0000141210"	"00000905"	"90"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Gly178Asp)"	"6"
"0000141211"	"00000905"	"90"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Gly178Asp)"	"6"
"0000141212"	"00000905"	"90"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Gly178Asp)"	"6"
"0000141213"	"00000905"	"90"	"535"	"0"	"535"	"0"	"c.535A>G"	"r.(?)"	"p.(Asn179Asp)"	"6"
"0000141214"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141215"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141216"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141217"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141218"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141219"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141220"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000141221"	"00000905"	"90"	"548"	"0"	"549"	"0"	"c.548_549dup"	"r.(?)"	"p.(Ser184Profs*54)"	"6"
"0000141222"	"00000905"	"90"	"554"	"0"	"554"	"0"	"c.554C>A"	"r.(?)"	"p.(Thr185Lys)"	"6"
"0000141223"	"00000905"	"90"	"559"	"0"	"559"	"0"	"c.559C>T"	"r.(?)"	"p.(Gln187*)"	"6"
"0000141224"	"00000905"	"90"	"573"	"0"	"573"	"0"	"c.573del"	"r.(?)"	"p.(Ile194Serfs*43)"	"6"
"0000141225"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>A"	"r.(?)"	"p.(Pro192Thr)"	"6"
"0000141226"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>G"	"r.(?)"	"p.(Pro192Ala)"	"6"
"0000141227"	"00000905"	"50"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141228"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141229"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141230"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141231"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141232"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141233"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141234"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141235"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141236"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141237"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141238"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141239"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141240"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141241"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141242"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141243"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141244"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000141245"	"00000905"	"50"	"575"	"0"	"575"	"0"	"c.575C>G"	"r.(?)"	"p.(Pro192Arg)"	"6"
"0000141246"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>G"	"r.(?)"	"p.(Pro192Arg)"	"6"
"0000141247"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	"6"
"0000141248"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	"6"
"0000141249"	"00000905"	"10"	"576"	"0"	"576"	"0"	"c.576C>T"	"r.(=)"	"p.(=)"	"6"
"0000141250"	"00000905"	"10"	"576"	"0"	"576"	"0"	"c.576C>T"	"r.(=)"	"p.(=)"	"6"
"0000141251"	"00000905"	"90"	"576"	"0"	"577"	"0"	"c.576_577insT"	"r.(?)"	"p.(Pro193Serfs*71)"	"6"
"0000141252"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0000141253"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0000141254"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0000141255"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141256"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141257"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141258"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141259"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141260"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141261"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141262"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141263"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000141264"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579del"	"r.(?)"	"p.(Ile194Serfs*43)"	"6"
"0000141265"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141266"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141267"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141268"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141269"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141270"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141271"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141272"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141273"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141274"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141275"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141276"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000141277"	"00000905"	"90"	"581"	"0"	"581"	"0"	"c.581T>A"	"r.(?)"	"p.(Ile194Asn)"	"6"
"0000141278"	"00000905"	"90"	"583"	"0"	"583"	"0"	"c.583A>G"	"r.(?)"	"p.(Ile195Val)"	"6"
"0000141279"	"00000905"	"90"	"583"	"0"	"585"	"0"	"c.583_585dup"	"r.(?)"	"p.(Ile195dup)"	"6"
"0000141280"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>A"	"r.(?)"	"p.(Arg197Ser)"	"6"
"0000141281"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141282"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141283"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141284"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141285"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141286"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141287"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141288"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000141289"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000141290"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000141291"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000141292"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000141293"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>C"	"r.(?)"	"p.(Arg197Pro)"	"6"
"0000141294"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0000141295"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0000141296"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0000141297"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>A"	"r.(?)"	"p.(Arg200Ser)"	"6"
"0000141298"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141299"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141300"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141301"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141302"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141303"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141304"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141305"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141306"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141307"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141308"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141309"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141310"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141311"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141312"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141313"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141314"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141315"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000141316"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141317"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141318"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141319"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141320"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141321"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141322"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000141323"	"00000905"	"50"	"606"	"0"	"606"	"0"	"c.606C>T"	"r.(=)"	"p.(=)"	"6"
"0000141324"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141325"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141326"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141327"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141328"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141329"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141330"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141331"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141332"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141333"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141334"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141335"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000141336"	"00000905"	"90"	"617"	"0"	"617"	"0"	"c.617G>A"	"r.(?)"	"p.(Trp206*)"	"6"
"0000141337"	"00000905"	"90"	"618"	"0"	"618"	"0"	"c.618G>A"	"r.(?)"	"p.(Trp206*)"	"6"
"0000141338"	"00000905"	"90"	"618"	"0"	"618"	"0"	"c.618G>C"	"r.(?)"	"p.(Trp206Cys)"	"6"
"0000141339"	"00000905"	"90"	"619"	"0"	"619"	"0"	"c.619C>G"	"r.(?)"	"p.(His207Asp)"	"6"
"0000141340"	"00000905"	"90"	"621"	"0"	"621"	"0"	"c.621C>G"	"r.(?)"	"p.(His207Gln)"	"6"
"0000141341"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>G"	"r.(?)"	"p.(Arg209Gly)"	"6"
"0000141342"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141343"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141344"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141345"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141346"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141347"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000141348"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141349"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141350"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141351"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141352"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141353"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141354"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141355"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000141356"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>T"	"r.(?)"	"p.(Arg209Leu)"	"6"
"0000141357"	"00000905"	"90"	"631"	"0"	"631"	"0"	"c.631G>A"	"r.(?)"	"p.(Ala211Thr)"	"6"
"0000141358"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141359"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141360"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141361"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141362"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141363"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141364"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141365"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141366"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141367"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141368"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141369"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141370"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141371"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141372"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141373"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141374"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000141375"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141376"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141377"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141378"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141379"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141380"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141381"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000141382"	"00000905"	"90"	"639"	"0"	"639"	"0"	"c.639del"	"r.(?)"	"p.(Met214Trpfs*23)"	"6"
"0000141383"	"00000905"	"90"	"639"	"0"	"639"	"0"	"c.639del"	"r.(?)"	"p.(Met214Trpfs*23)"	"6"
"0000141384"	"00000905"	"90"	"643"	"0"	"643"	"0"	"c.643G>A"	"r.(?)"	"p.(Glu215Lys)"	"6"
"0000141385"	"00000905"	"90"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.(?)"	"p.(Glu215Gln)"	"6"
"0000141386"	"00000905"	"90"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.(?)"	"p.(Glu215Gln)"	"6"
"0000141387"	"00000905"	"90"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.(?)"	"p.(Glu215Gln)"	"6"
"0000141388"	"00000905"	"90"	"644"	"0"	"644"	"0"	"c.644A>T"	"r.(?)"	"p.(Glu215Val)"	"6"
"0000141389"	"00000905"	"90"	"644"	"0"	"644"	"0"	"c.644A>T"	"r.(?)"	"p.(Glu215Val)"	"6"
"0000141390"	"00000905"	"90"	"644"	"0"	"644"	"0"	"c.644A>T"	"r.(?)"	"p.(Glu215Val)"	"6"
"0000141391"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0000141392"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0000141393"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0000141394"	"00000905"	"90"	"655"	"0"	"655"	"0"	"c.655del"	"r.(?)"	"p.(Cys219Alafs*18)"	"6"
"0000141395"	"00000905"	"90"	"655"	"0"	"655"	"0"	"c.655T>C"	"r.(?)"	"p.(Cys219Arg)"	"6"
"0000141396"	"00000905"	"90"	"655"	"0"	"655"	"0"	"c.655T>G"	"r.(?)"	"p.(Cys219Gly)"	"6"
"0000141397"	"00000905"	"90"	"658"	"0"	"682"	"0"	"c.658_*7del"	"r.(?)"	"p.(Val220_Ala224delinsLeuSerSerAlaProAlaArgGly)"	"6"
"0000141398"	"00000905"	"90"	"663"	"0"	"663"	"0"	"c.663dup"	"r.(?)"	"p.(Lys222Glnfs*42)"	"6"
"0000141399"	"00000905"	"50"	"666"	"0"	"666"	"0"	"c.666G>C"	"r.(?)"	"p.(Lys222Asn)"	"6"
"0000141400"	"00000905"	"90"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000141401"	"00000905"	"90"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000141402"	"00000905"	"90"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000141403"	"00000905"	"10"	"678"	"0"	"678"	"0"	"c.*3C>T"	"r.(=)"	"p.(=)"	"6"
"0000141404"	"00000905"	"50"	"1616"	"0"	"1616"	"0"	"c.*941G>A"	"r.(=)"	"p.(=)"	"6"
"0000222143"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000222144"	"00000905"	"90"	"96"	"0"	"96"	"0"	"c.96dup"	"r.(?)"	"p.(Trp33Leufs*53)"	"3"
"0000222145"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>T"	"r.(?)"	"p.(Arg200Leu)"	"6"
"0000251144"	"00000905"	"10"	"22717"	"0"	"22717"	"0"	"c.*22042T>G"	"r.(=)"	"p.(=)"	""
"0000251671"	"00000905"	"10"	"131945"	"0"	"131945"	"0"	"c.*131270T>C"	"r.(=)"	"p.(=)"	""
"0000251672"	"00000905"	"10"	"62943"	"0"	"62943"	"0"	"c.*62268del"	"r.(?)"	"p.(=)"	""
"0000251673"	"00000905"	"10"	"47487"	"0"	"47487"	"0"	"c.*46812del"	"r.(?)"	"p.(=)"	""
"0000251983"	"00000905"	"30"	"44157"	"0"	"44157"	"0"	"c.*43482T>C"	"r.(=)"	"p.(=)"	""
"0000252352"	"00000905"	"30"	"67170"	"0"	"67170"	"0"	"c.*66495T>C"	"r.(=)"	"p.(=)"	""
"0000252353"	"00000905"	"30"	"17416"	"0"	"17416"	"0"	"c.*16741T>C"	"r.(=)"	"p.(=)"	""
"0000255501"	"00000905"	"90"	"38041"	"0"	"38041"	"0"	"c.*37366T>A"	"r.(=)"	"p.(=)"	""
"0000256167"	"00000905"	"50"	"38724"	"0"	"38724"	"0"	"c.*38049T>C"	"r.(=)"	"p.(=)"	""
"0000264494"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579del"	"r.(?)"	"p.(Ile194SerfsTer43)"	"6"
"0000264495"	"00000905"	"10"	"258"	"0"	"258"	"0"	"c.258G>A"	"r.(?)"	"p.(Pro86=)"	"4"
"0000266614"	"00000905"	"30"	"78209"	"0"	"78209"	"0"	"c.*77534G>A"	"r.(=)"	"p.(=)"	""
"0000266615"	"00000905"	"90"	"38080"	"0"	"38080"	"0"	"c.*37405G>A"	"r.(=)"	"p.(=)"	""
"0000266616"	"00000905"	"30"	"184"	"3199"	"184"	"3199"	"c.184+3199G>A"	"r.(=)"	"p.(=)"	"3i"
"0000266617"	"00000905"	"30"	"184"	"3118"	"184"	"3118"	"c.184+3118C>T"	"r.(=)"	"p.(=)"	"3i"
"0000266618"	"00000905"	"90"	"62710"	"0"	"62710"	"0"	"c.*62035C>A"	"r.(=)"	"p.(=)"	""
"0000269908"	"00000905"	"10"	"135749"	"0"	"135749"	"0"	"c.*135074A>G"	"r.(=)"	"p.(=)"	""
"0000269909"	"00000905"	"30"	"78209"	"0"	"78209"	"0"	"c.*77534G>A"	"r.(=)"	"p.(=)"	""
"0000269910"	"00000905"	"10"	"38425"	"0"	"38425"	"0"	"c.*37750G>A"	"r.(=)"	"p.(=)"	""
"0000269911"	"00000905"	"30"	"38423"	"0"	"38423"	"0"	"c.*37748G>A"	"r.(=)"	"p.(=)"	""
"0000269913"	"00000905"	"30"	"38142"	"0"	"38142"	"0"	"c.*37467G>A"	"r.(=)"	"p.(=)"	""
"0000269914"	"00000905"	"10"	"14205"	"0"	"14205"	"0"	"c.*13530G>T"	"r.(=)"	"p.(=)"	""
"0000269915"	"00000905"	"10"	"326"	"1038"	"326"	"1038"	"c.326+1038del"	"r.(=)"	"p.(=)"	"4i"
"0000269916"	"00000905"	"10"	"185"	"-3135"	"185"	"-3135"	"c.185-3135C>T"	"r.(=)"	"p.(=)"	"3i"
"0000269917"	"00000905"	"10"	"184"	"3207"	"184"	"3207"	"c.184+3207C>T"	"r.(=)"	"p.(=)"	"3i"
"0000269918"	"00000905"	"10"	"184"	"3199"	"184"	"3199"	"c.184+3199G>A"	"r.(=)"	"p.(=)"	"3i"
"0000269919"	"00000905"	"10"	"184"	"3118"	"184"	"3118"	"c.184+3118C>T"	"r.(=)"	"p.(=)"	"3i"
"0000269920"	"00000905"	"10"	"60813"	"0"	"60813"	"0"	"c.*60138del"	"r.(?)"	"p.(=)"	""
"0000269921"	"00000905"	"90"	"58366"	"0"	"58366"	"0"	"c.*57691C>A"	"r.(=)"	"p.(=)"	""
"0000269922"	"00000905"	"70"	"58347"	"0"	"58347"	"0"	"c.*57672C>T"	"r.(=)"	"p.(=)"	""
"0000269923"	"00000905"	"90"	"58347"	"0"	"58347"	"0"	"c.*57672C>G"	"r.(=)"	"p.(=)"	""
"0000269924"	"00000905"	"10"	"54744"	"0"	"54744"	"0"	"c.*54069G>C"	"r.(=)"	"p.(=)"	""
"0000269925"	"00000905"	"90"	"54693"	"0"	"54693"	"0"	"c.*54018G>A"	"r.(=)"	"p.(=)"	""
"0000269926"	"00000905"	"30"	"54677"	"0"	"54677"	"0"	"c.*54002A>G"	"r.(=)"	"p.(=)"	""
"0000269927"	"00000905"	"10"	"44362"	"0"	"44362"	"0"	"c.*43687del"	"r.(?)"	"p.(=)"	""
"0000273057"	"00000905"	"10"	"78151"	"0"	"78152"	"0"	"c.*77476_*77477del"	"r.(=)"	"p.(=)"	""
"0000273058"	"00000905"	"10"	"38142"	"0"	"38142"	"0"	"c.*37467G>A"	"r.(=)"	"p.(=)"	""
"0000273059"	"00000905"	"90"	"33869"	"0"	"33869"	"0"	"c.*33194C>A"	"r.(=)"	"p.(=)"	""
"0000273060"	"00000905"	"30"	"14192"	"0"	"14192"	"0"	"c.*13517G>A"	"r.(=)"	"p.(=)"	""
"0000273061"	"00000905"	"10"	"184"	"3207"	"184"	"3207"	"c.184+3207C>T"	"r.(=)"	"p.(=)"	"3i"
"0000273062"	"00000905"	"30"	"184"	"3118"	"184"	"3118"	"c.184+3118C>T"	"r.(=)"	"p.(=)"	"3i"
"0000273063"	"00000905"	"10"	"54744"	"0"	"54744"	"0"	"c.*54069G>C"	"r.(=)"	"p.(=)"	""
"0000307382"	"00000905"	"10"	"548"	"0"	"548"	"0"	"c.548C>T"	"r.(?)"	"p.(Thr183Ile)"	"6"
"0000333319"	"00000905"	"50"	"67232"	"0"	"67232"	"0"	"c.*66557C>A"	"r.(=)"	"p.(=)"	""
"0000333320"	"00000905"	"50"	"38509"	"0"	"38510"	"0"	"c.*37834_*37835del"	"r.(=)"	"p.(=)"	""
"0000333321"	"00000905"	"50"	"38424"	"0"	"38424"	"0"	"c.*37749C>T"	"r.(=)"	"p.(=)"	""
"0000333322"	"00000905"	"50"	"38416"	"0"	"38416"	"0"	"c.*37741A>G"	"r.(=)"	"p.(=)"	""
"0000333323"	"00000905"	"50"	"38369"	"0"	"38369"	"0"	"c.*37694T>G"	"r.(=)"	"p.(=)"	""
"0000333326"	"00000905"	"50"	"14169"	"0"	"14170"	"0"	"c.*13494_*13495del"	"r.(=)"	"p.(=)"	""
"0000333328"	"00000905"	"30"	"7"	"0"	"7"	"0"	"c.7C>G"	"r.(?)"	"p.(Arg3Gly)"	"1"
"0000337397"	"00000905"	"90"	"58325"	"0"	"58325"	"0"	"c.*57650C>T"	"r.(=)"	"p.(=)"	""
"0000342908"	"00000905"	"10"	"38425"	"0"	"38425"	"0"	"c.*37750G>A"	"r.(=)"	"p.(=)"	""
"0000343547"	"00000905"	"90"	"58347"	"0"	"58347"	"0"	"c.*57672C>T"	"r.(=)"	"p.(=)"	""
"0000343905"	"00000905"	"90"	"62725"	"0"	"62725"	"0"	"c.*62050T>A"	"r.(=)"	"p.(=)"	""
"0000344551"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139ArgfsTer10)"	"5"
"0000344974"	"00000905"	"10"	"22717"	"0"	"22717"	"0"	"c.*22042T>G"	"r.(=)"	"p.(=)"	""
"0000345645"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000345858"	"00000905"	"70"	"135524"	"0"	"135524"	"0"	"c.*134849C>T"	"r.(=)"	"p.(=)"	""
"0000346259"	"00000905"	"50"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000346351"	"00000905"	"10"	"184"	"3199"	"184"	"3199"	"c.184+3199G>A"	"r.(=)"	"p.(=)"	"3i"
"0000347264"	"00000905"	"50"	"37869"	"0"	"37869"	"0"	"c.*37194A>G"	"r.(=)"	"p.(=)"	""
"0000348268"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>G"	"r.(?)"	"p.(Pro203Arg)"	"6"
"0000348814"	"00000905"	"90"	"54693"	"0"	"54693"	"0"	"c.*54018G>A"	"r.(=)"	"p.(=)"	""
"0000349044"	"00000905"	"50"	"38313"	"0"	"38313"	"0"	"c.*37638G>A"	"r.(=)"	"p.(=)"	""
"0000349239"	"00000905"	"10"	"184"	"3118"	"184"	"3118"	"c.184+3118C>T"	"r.(=)"	"p.(=)"	"3i"
"0000350988"	"00000905"	"90"	"67187"	"0"	"67187"	"0"	"c.*66512A>C"	"r.(=)"	"p.(=)"	""
"0000350989"	"00000905"	"90"	"58417"	"0"	"58417"	"0"	"c.*57742C>T"	"r.(=)"	"p.(=)"	""
"0000438227"	"00000905"	"50"	"391"	"0"	"391"	"0"	"c.391A>G"	"r.(?)"	"p.(Lys131Glu)"	"5"
"0000438556"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000441252"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>T"	"r.(?)"	"p.(Arg141Leu)"	"5"
"0000575131"	"00000905"	"30"	"78140"	"0"	"78140"	"0"	"c.*77465T>C"	"r.(=)"	"p.(=)"	""
"0000575132"	"00000905"	"10"	"78140"	"0"	"78140"	"0"	"c.*77465T>C"	"r.(=)"	"p.(=)"	""
"0000575136"	"00000905"	"30"	"78151"	"0"	"78152"	"0"	"c.*77476_*77477dup"	"r.(=)"	"p.(=)"	""
"0000575137"	"00000905"	"50"	"67277"	"0"	"67277"	"0"	"c.*66602C>T"	"r.(=)"	"p.(=)"	""
"0000575138"	"00000905"	"90"	"67194"	"0"	"67194"	"0"	"c.*66519C>A"	"r.(=)"	"p.(=)"	""
"0000575139"	"00000905"	"50"	"60756"	"0"	"60756"	"0"	"c.*60081T>G"	"r.(=)"	"p.(=)"	""
"0000575140"	"00000905"	"30"	"58425"	"0"	"58425"	"0"	"c.*57750T>C"	"r.(=)"	"p.(=)"	""
"0000575141"	"00000905"	"90"	"58345"	"0"	"58345"	"0"	"c.*57670A>T"	"r.(=)"	"p.(=)"	""
"0000575142"	"00000905"	"30"	"38661"	"0"	"38661"	"0"	"c.*37986C>T"	"r.(=)"	"p.(=)"	""
"0000575143"	"00000905"	"30"	"38637"	"0"	"38637"	"0"	"c.*37962C>G"	"r.(=)"	"p.(=)"	""
"0000575144"	"00000905"	"30"	"38620"	"0"	"38620"	"0"	"c.*37945G>C"	"r.(=)"	"p.(=)"	""
"0000575145"	"00000905"	"50"	"38425"	"0"	"38425"	"0"	"c.*37750G>A"	"r.(=)"	"p.(=)"	""
"0000575146"	"00000905"	"30"	"38425"	"0"	"38425"	"0"	"c.*37750G>A"	"r.(=)"	"p.(=)"	""
"0000575148"	"00000905"	"10"	"38136"	"0"	"38136"	"0"	"c.*37461G>C"	"r.(=)"	"p.(=)"	""
"0000575149"	"00000905"	"90"	"37858"	"0"	"37858"	"0"	"c.*37183G>A"	"r.(=)"	"p.(=)"	""
"0000575150"	"00000905"	"30"	"33764"	"0"	"33764"	"0"	"c.*33089T>C"	"r.(=)"	"p.(=)"	""
"0000575151"	"00000905"	"30"	"29523"	"0"	"29523"	"0"	"c.*28848T>A"	"r.(=)"	"p.(=)"	""
"0000575152"	"00000905"	"50"	"29444"	"0"	"29444"	"0"	"c.*28769C>T"	"r.(=)"	"p.(=)"	""
"0000575154"	"00000905"	"10"	"14043"	"0"	"14043"	"0"	"c.*13368G>A"	"r.(=)"	"p.(=)"	""
"0000575155"	"00000905"	"30"	"576"	"0"	"576"	"0"	"c.576C>T"	"r.(?)"	"p.(Pro192=)"	"6"
"0000575156"	"00000905"	"70"	"428"	"0"	"428"	"0"	"c.428A>T"	"r.(?)"	"p.(Asp143Val)"	"5"
"0000575157"	"00000905"	"70"	"326"	"5"	"326"	"5"	"c.326+5G>C"	"r.spl?"	"p.?"	"4i"
"0000575158"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000575159"	"00000905"	"50"	"185"	"-3177"	"185"	"-3177"	"c.185-3177A>G"	"r.(=)"	"p.(=)"	"3i"
"0000575160"	"00000905"	"10"	"184"	"3207"	"184"	"3207"	"c.184+3207C>T"	"r.(=)"	"p.(=)"	"3i"
"0000575161"	"00000905"	"50"	"52"	"3"	"52"	"3"	"c.52+3A>G"	"r.spl?"	"p.?"	"1i"
"0000575162"	"00000905"	"30"	"44"	"0"	"44"	"0"	"c.44G>A"	"r.(?)"	"p.(Gly15Asp)"	"1"
"0000619373"	"00000905"	"30"	"131818"	"0"	"131818"	"0"	"c.*131143T>C"	"r.(=)"	"p.(=)"	""
"0000619376"	"00000905"	"90"	"38342"	"0"	"38343"	"0"	"c.*37667_*37668del"	"r.(=)"	"p.(=)"	""
"0000619377"	"00000905"	"50"	"185"	"-3192"	"185"	"-3192"	"c.185-3192C>T"	"r.(=)"	"p.(=)"	"3i"
"0000624540"	"00000905"	"10"	"38423"	"0"	"38423"	"0"	"c.*37748G>A"	"r.(=)"	"p.(=)"	""
"0000624541"	"00000905"	"30"	"37889"	"0"	"37889"	"0"	"c.*37214G>A"	"r.(=)"	"p.(=)"	""
"0000624542"	"00000905"	"30"	"33791"	"0"	"33791"	"0"	"c.*33116G>C"	"r.(=)"	"p.(=)"	""
"0000624543"	"00000905"	"30"	"17435"	"0"	"17435"	"0"	"c.*16760G>A"	"r.(=)"	"p.(=)"	""
"0000624544"	"00000905"	"10"	"548"	"0"	"548"	"0"	"c.548C>T"	"r.(?)"	"p.(Thr183Ile)"	"6"
"0000624545"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000659233"	"00000905"	"90"	"37913"	"0"	"37913"	"0"	"c.*37238A>T"	"r.(=)"	"p.(=)"	""
"0000682318"	"00000905"	"30"	"38753"	"0"	"38753"	"0"	"c.*38078A>G"	"r.(=)"	"p.(=)"	""
"0000682319"	"00000905"	"30"	"33755"	"0"	"33755"	"0"	"c.*33080del"	"r.(?)"	"p.(=)"	""
"0000682320"	"00000905"	"30"	"548"	"0"	"548"	"0"	"c.548C>T"	"r.(?)"	"p.(Thr183Ile)"	"6"
"0000682321"	"00000905"	"30"	"185"	"-3147"	"185"	"-3147"	"c.185-3147C>T"	"r.(=)"	"p.(=)"	"3i"
"0000682322"	"00000905"	"30"	"185"	"-3259"	"185"	"-3259"	"c.185-3259G>A"	"r.(=)"	"p.(=)"	"3i"
"0000682323"	"00000905"	"50"	"37"	"0"	"37"	"0"	"c.37C>T"	"r.(?)"	"p.(Leu13Phe)"	"1"
"0000684579"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	"3"
"0000684580"	"00000905"	"70"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000684581"	"00000905"	"70"	"278"	"0"	"278"	"0"	"c.278A>G"	"r.(?)"	"p.(Tyr93Cys)"	"4"
"0000684582"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000684583"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000684584"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000684585"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000684586"	"00000905"	"70"	"-35"	"0"	"2991"	"0"	"c.(?_-35)_(*2316_?)del"	"r.0"	"p.0"	"_1_6_"
"0000685469"	"00000905"	"90"	"632"	"0"	"632"	"0"	"c.632C>T"	"r.(?)"	"p.(Ala211Val)"	"6"
"0000685470"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000685471"	"00000905"	"70"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000685472"	"00000905"	"90"	"523"	"-2"	"523"	"-2"	"c.523-2A>G"	"r.spl"	"p.?"	"5i"
"0000685473"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000685474"	"00000905"	"70"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000685475"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0000685476"	"00000905"	"70"	"326"	"0"	"326"	"0"	"c.326G>A"	"r.(?)"	"p.(Gly109Glu)"	"4"
"0000693509"	"00000905"	"30"	"37988"	"0"	"37988"	"0"	"c.*37313G>A"	"r.(=)"	"p.(=)"	""
"0000714072"	"00000905"	"70"	"592"	"0"	"600"	"0"	"c.592_600dup"	"r.(?)"	"p.(Phe198_Arg200dup)"	"6"
"0000728731"	"00000905"	"30"	"62845"	"0"	"62845"	"0"	"c.*62170A>G"	"r.(=)"	"p.(=)"	""
"0000728732"	"00000905"	"50"	"37918"	"0"	"37918"	"0"	"c.*37243T>A"	"r.(=)"	"p.(=)"	""
"0000728733"	"00000905"	"30"	"17520"	"0"	"17520"	"0"	"c.*16845G>A"	"r.(=)"	"p.(=)"	""
"0000728734"	"00000905"	"90"	"14227"	"0"	"14227"	"0"	"c.*13552G>A"	"r.(=)"	"p.(=)"	""
"0000728735"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000728736"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000728737"	"00000905"	"30"	"185"	"-3079"	"185"	"-3079"	"c.185-3079T>C"	"r.(=)"	"p.(=)"	"3i"
"0000728738"	"00000905"	"30"	"185"	"-3125"	"185"	"-3125"	"c.185-3125C>T"	"r.(=)"	"p.(=)"	"3i"
"0000728739"	"00000905"	"30"	"185"	"-3179"	"185"	"-3179"	"c.185-3179G>C"	"r.(=)"	"p.(=)"	"3i"
"0000728740"	"00000905"	"30"	"184"	"3119"	"184"	"3119"	"c.184+3119G>A"	"r.(=)"	"p.(=)"	"3i"
"0000728741"	"00000905"	"50"	"87"	"0"	"87"	"0"	"c.87C>T"	"r.(?)"	"p.(Gly29=)"	"3"
"0000732987"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000732988"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000732989"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000732990"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.?"	"p.?"	"1i_2i"
"0000732991"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.?"	"p.?"	"1i_2i"
"0000732992"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000732993"	"00000905"	"70"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000732994"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000732995"	"00000905"	"70"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.(Met1?)"	"1"
"0000732996"	"00000905"	"70"	"575"	"0"	"575"	"0"	"c.575C>A"	"r.(?)"	"p.(Pro192His)"	"6"
"0000732997"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>G"	"r.(?)"	"p.(Pro203Arg)"	"6"
"0000732998"	"00000905"	"70"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000732999"	"00000905"	"70"	"335"	"0"	"335"	"0"	"c.335G>A"	"r.(?)"	"p.(Trp112*)"	"5"
"0000735946"	"00000905"	"70"	"-35"	"0"	"2991"	"0"	"c.(?_-35)_(*2316_?)del"	"r.0"	"p.0"	"_1_6_"
"0000736166"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000736852"	"00000905"	"70"	"496"	"0"	"498"	"0"	"c.496_498del"	"r.(?)"	"p.(Tyr166del)"	"5"
"0000736853"	"00000905"	"70"	"592"	"0"	"600"	"0"	"c.592_600dup"	"r.(?)"	"p.(Phe198_Arg200dup)"	"6"
"0000759606"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000760657"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>C"	"r.spl"	"p.?"	"5i"
"0000786345"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520C>T"	"r.(?)"	"p.(Arg174Trp)"	"5"
"0000786467"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000789878"	"00000905"	"50"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000789879"	"00000905"	"50"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000789880"	"00000905"	"50"	"533"	"0"	"533"	"0"	"c.533G>C"	"r.(?)"	"p.(Gly178Ala)"	"6"
"0000789881"	"00000905"	"50"	"-473"	"0"	"17"	"1"	"c.(?_-473)_(17+1_?)del"	"r.(?)"	"p.?"	"1"
"0000793953"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000794249"	"00000905"	"90"	"372"	"0"	"373"	"0"	"c.372_373insTAGCCAGTGG"	"r.(?)"	"p.(Ile125*)"	"5"
"0000794256"	"00000905"	"70"	"306"	"0"	"308"	"0"	"c.306_308dup"	"r.(?)"	"p.(Leu103dup)"	"4"
"0000810204"	"00000905"	"30"	"67291"	"0"	"67291"	"0"	"c.*66616C>T"	"r.(=)"	"p.(=)"	""
"0000810205"	"00000905"	"30"	"38675"	"0"	"38675"	"0"	"c.*38000G>A"	"r.(=)"	"p.(=)"	""
"0000810206"	"00000905"	"30"	"38575"	"0"	"38575"	"0"	"c.*37900T>C"	"r.(=)"	"p.(=)"	""
"0000810207"	"00000905"	"30"	"38417"	"0"	"38417"	"0"	"c.*37742T>A"	"r.(=)"	"p.(=)"	""
"0000810208"	"00000905"	"30"	"17519"	"0"	"17519"	"0"	"c.*16844C>T"	"r.(=)"	"p.(=)"	""
"0000810209"	"00000905"	"30"	"17506"	"0"	"17506"	"0"	"c.*16831T>C"	"r.(=)"	"p.(=)"	""
"0000810210"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000810211"	"00000905"	"30"	"523"	"-7"	"523"	"-7"	"c.523-7T>C"	"r.(=)"	"p.(=)"	"5i"
"0000810212"	"00000905"	"50"	"391"	"0"	"391"	"0"	"c.391A>G"	"r.(?)"	"p.(Lys131Glu)"	"5"
"0000810213"	"00000905"	"30"	"326"	"1082"	"326"	"1082"	"c.326+1082T>C"	"r.(=)"	"p.(=)"	"4i"
"0000810214"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>T"	"r.(?)"	"p.(Met1?)"	"1"
"0000811442"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000811443"	"00000905"	"70"	"52"	"3"	"52"	"3"	"c.52+3A>G"	"r.spl?"	"p.(?)"	"1i"
"0000811444"	"00000905"	"70"	"52"	"3"	"52"	"3"	"c.52+3A>G"	"r.spl?"	"p.(?)"	"1i"
"0000811445"	"00000905"	"70"	"52"	"3"	"52"	"3"	"c.52+3A>G"	"r.spl?"	"p.(?)"	"1i"
"0000812541"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000812542"	"00000905"	"70"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0000812614"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000812622"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000812647"	"00000905"	"70"	"26"	"0"	"26"	"0"	"c.26T>A"	"r.(?)"	"p.(Leu9*)"	"1"
"0000812649"	"00000905"	"70"	"187"	"0"	"187"	"0"	"c.187T>C"	"r.(?)"	"p.(Cys63Arg)"	"4"
"0000812653"	"00000905"	"70"	"391"	"0"	"391"	"0"	"c.391A>C"	"r.(?)"	"p.(Lys131Gln)"	"5"
"0000812661"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000812680"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000812714"	"00000905"	"70"	"575"	"0"	"575"	"0"	"c.575C>A"	"r.(?)"	"p.(Pro192His)"	"6"
"0000812738"	"00000905"	"70"	"336"	"0"	"336"	"0"	"c.336G>C"	"r.(?)"	"p.(Trp112Cys)"	"5"
"0000812775"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000812786"	"00000905"	"90"	"140"	"0"	"140"	"0"	"c.140dup"	"r.(?)"	"p.(Asn47Lysfs*39)"	"3"
"0000812814"	"00000905"	"90"	"108"	"0"	"108"	"0"	"c.108del"	"r.(?)"	"p.(Ala37Hisfs*89)"	"3"
"0000812826"	"00000905"	"70"	"196"	"0"	"196"	"0"	"c.196C>G"	"r.(?)"	"p.(His66Asp)"	"4"
"0000812827"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000816117"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000816183"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000818192"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000818493"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000819315"	"00000905"	"70"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0000819344"	"00000905"	"70"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.spl"	"p.(?)"	"2i_3i"
"0000819346"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000819353"	"00000905"	"70"	"559"	"0"	"559"	"0"	"c.559C>T"	"r.(?)"	"p.(Gln187*)"	"6"
"0000819354"	"00000905"	"70"	"559"	"0"	"559"	"0"	"c.559C>T"	"r.(?)"	"p.(Gln187*)"	"6"
"0000819367"	"00000905"	"70"	"366"	"0"	"366"	"0"	"c.366G>A"	"r.(?)"	"p.(Trp122*)"	"5"
"0000819372"	"00000905"	"70"	"199"	"0"	"206"	"0"	"c.199_206dup"	"r.(?)"	"p.(Gly70Serfs*59)"	"4"
"0000819375"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000819376"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000819378"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000819474"	"00000905"	"70"	""	"0"	""	"0"	"c.(522+1_523-1)_(*2316_?)del"	"r.spl"	"p.(?)"	"5i_6_"
"0000819475"	"00000905"	"70"	""	"0"	""	"0"	"c.(522+1_523-1)_(*2316_?)del"	"r.spl"	"p.(?)"	"5i_6_"
"0000819486"	"00000905"	"70"	"185"	"-1"	"185"	"-1"	"c.185-1G>C"	"r.spl"	"p.?"	"3i"
"0000819491"	"00000905"	"70"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11Phefs*114)"	"1"
"0000819493"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000819498"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000819507"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000819550"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000819551"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000822124"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000822125"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000822227"	"00000905"	"70"	"53"	"-713"	"78"	"266"	"c.53-713_78+266del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000822331"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000822450"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000822460"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000822462"	"00000905"	"70"	"150"	"0"	"150"	"0"	"c.150G>A"	"r.(?)"	"p.(Trp50*)"	"3"
"0000822469"	"00000905"	"70"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0000822969"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000822970"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000823180"	"00000905"	"50"	"-35"	"-1"	"78"	"0"	"c.(?_-35)_(78+1_79-1)del"	"r.0?"	"p.0?"	"_1_2i"
"0000823181"	"00000905"	"50"	"-35"	"-1"	"78"	"0"	"c.(?_-35)_(78+1_79-1)del"	"r.0?"	"p.0?"	"_1_2i"
"0000823182"	"00000905"	"50"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000823185"	"00000905"	"50"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0000823186"	"00000905"	"50"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0000823187"	"00000905"	"50"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000823188"	"00000905"	"50"	"426"	"0"	"426"	"0"	"c.426T>G"	"r.(?)"	"p.(Cys142Trp)"	"5"
"0000823189"	"00000905"	"50"	"498"	"0"	"498"	"0"	"c.498C>A"	"r.(?)"	"p.(Tyr166*)"	"5"
"0000823190"	"00000905"	"50"	"522"	"1"	"522"	"1"	"c.522+1G>A"	"r.spl"	"p.(?)"	"5i"
"0000823191"	"00000905"	"50"	"574"	"0"	"574"	"0"	"c.574C>G"	"r.(?)"	"p.(Pro192Ala)"	"6"
"0000823192"	"00000905"	"50"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000823193"	"00000905"	"50"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000825676"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000825710"	"00000905"	"70"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000825711"	"00000905"	"70"	"335"	"0"	"335"	"0"	"c.335G>C"	"r.(?)"	"p.(Trp112Ser)"	"5"
"0000825717"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000825718"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000825782"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000825828"	"00000905"	"70"	"614"	"0"	"614"	"0"	"c.614dup"	"r.(?)"	"p.?"	"6"
"0000825917"	"00000905"	"70"	"656"	"0"	"656"	"0"	"c.656G>A"	"r.(?)"	"p.(Cys219Tyr)"	"6"
"0000826111"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000826134"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000826236"	"00000905"	"70"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	"4"
"0000826273"	"00000905"	"70"	"467"	"0"	"467"	"0"	"c.467G>T"	"r.(?)"	"p.(Arg156Met)"	"5"
"0000826317"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000826351"	"00000905"	"70"	"-35"	"-1"	"184"	"1"	"c.(?_-35)_(184+1_185-1)del"	"r.0?"	"p.0?"	"_1_3i"
"0000827609"	"00000905"	"70"	"78"	"1"	"78"	"1"	"c.78+1G>A"	"r.spl"	"p.(?)"	"2i"
"0000828911"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000828912"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000828937"	"00000905"	"90"	"244"	"0"	"245"	"0"	"c.244_245del"	"r.(?)"	"p.(Thr82Leufs*3)"	"4"
"0000829079"	"00000905"	"70"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.0?"	"p.(Met1?)"	"1"
"0000829080"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0000829081"	"00000905"	"70"	"37"	"0"	"37"	"0"	"c.37C>T"	"r.(?)"	"p.(Leu13Phe)"	"1"
"0000829082"	"00000905"	"70"	"38"	"0"	"38"	"0"	"c.38T>C"	"r.(?)"	"p.(Leu13Pro)"	"1"
"0000829083"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000829084"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000829085"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>C"	"r.(?)"	"p.(Trp96Cys)"	"4"
"0000829086"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000829087"	"00000905"	"70"	"535"	"0"	"535"	"0"	"c.535A>G"	"r.(?)"	"p.(Asn179Asp)"	"6"
"0000829088"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000829089"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000829090"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829091"	"00000905"	"70"	"52"	"0"	"52"	"0"	"c.52G>A"	"r.spl"	"p.0?"	"1"
"0000829092"	"00000905"	"70"	"52"	"0"	"52"	"0"	"c.52G>A"	"r.spl"	"p.0?"	"1"
"0000829098"	"00000905"	"70"	"336"	"0"	"336"	"0"	"c.336G>A"	"r.(?)"	"p.(Trp112Ter)"	"5"
"0000829099"	"00000905"	"70"	"400"	"0"	"400"	"0"	"c.400T>C"	"r.(?)"	"p.(Ser134Pro)"	"5"
"0000829100"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829101"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829102"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829103"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829104"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000829105"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000829106"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.(?)"	"p.(Met1?)"	"1"
"0000829107"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.(?)"	"p.?"	"1i"
"0000829108"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000829109"	"00000905"	"90"	"262"	"0"	"262"	"0"	"c.262C>T"	"r.(?)"	"p.(Gln88Ter)"	"4"
"0000829110"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000829111"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>A"	"r.spl?"	"p.(Gly109Glu)"	"4"
"0000829112"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>A"	"r.(?)"	"p.(Trp163Ter)"	"5"
"0000829113"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000829114"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000829115"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000829116"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0000829117"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>C"	"r.(?)"	"p.(Arg209Pro)"	""
"0000829118"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	""
"0000829208"	"00000905"	"90"	"176"	"0"	"176"	"0"	"c.176G>A"	"r.(?)"	"p.(Cys59Tyr)"	"3"
"0000829209"	"00000905"	"90"	"176"	"0"	"176"	"0"	"c.176G>A"	"r.(?)"	"p.(Cys59Tyr)"	"3"
"0000829210"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"c.214G>A"
"0000829211"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"c.214G>A"
"0000829212"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"c.214G>A"
"0000829213"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829214"	"00000905"	"90"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"c.436G>A"
"0000829215"	"00000905"	"90"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	"c.531T>G"
"0000829216"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"c.544C>T"
"0000829217"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"c.544C>T"
"0000829218"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"c.599G>A"
"0000829219"	"00000905"	"90"	"607"	"0"	"607"	"0"	"c.607C>G"	"r.(?)"	"p.(Pro203Ala)"	"c.607C>G"
"0000829220"	"00000905"	"90"	"644"	"0"	"644"	"0"	"c.644A>T"	"r.(?)"	"p.(Glu215Val)"	""
"0000829221"	"00000905"	"90"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	"c.668G>A"
"0000829239"	"00000905"	"90"	"176"	"0"	"176"	"0"	"c.176G>C"	"r.(?)"	"p.(Cys59Ser)"	""
"0000829240"	"00000905"	"90"	"176"	"0"	"176"	"0"	"c.176G>C"	"r.(?)"	"p.(Cys59Ser)"	""
"0000829241"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829242"	"00000905"	"90"	"218"	"0"	"218"	"0"	"c.218C>A"	"r.(?)"	"p.(Ser73*)"	""
"0000829243"	"00000905"	"90"	"218"	"0"	"218"	"0"	"c.218C>A"	"r.(?)"	"p.(Ser73*)"	""
"0000829244"	"00000905"	"90"	"218"	"0"	"218"	"0"	"c.218C>A"	"r.(?)"	"p.(Ser73*)"	""
"0000829245"	"00000905"	"90"	"354"	"0"	"355"	"0"	"c.354_355del"	"r.(?)"	"p.(Asp118Glufs*2)"	""
"0000829246"	"00000905"	"90"	"451"	"0"	"451"	"0"	"c.451T>A"	"r.(?)"	"p.(Tyr151Asp)"	""
"0000829247"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>T"	"r.spl"	"p.(?)"	""
"0000829248"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>T"	"r.(?)"	"p.(Arg209Leu)"	""
"0000829273"	"00000905"	"70"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	""
"0000829274"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829275"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000829276"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	""
"0000829277"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000829278"	"00000905"	"70"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	""
"0000829279"	"00000905"	"70"	"502"	"0"	"502"	"0"	"c.502G>C"	"r.(?)"	"p.(Asp168His)"	""
"0000829280"	"00000905"	"70"	"554"	"0"	"554"	"0"	"c.554C>A"	"r.(?)"	"p.(Thr185Lys)"	""
"0000829281"	"00000905"	"70"	"572"	"0"	"572"	"0"	"c.572G>C"	"r.(?)"	"p.(Arg191Pro)"	""
"0000829282"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0000829283"	"00000905"	"70"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	""
"0000829284"	"00000905"	"70"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000829285"	"00000905"	"70"	"-36"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829286"	"00000905"	"70"	"103"	"0"	"103"	"0"	"c.103C>T"	"r.(?)"	"p.(Gln35*)"	""
"0000829287"	"00000905"	"70"	"-36"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829288"	"00000905"	"70"	"184"	"2"	"184"	"2"	"c.184+2T>G"	"r.spl"	"p.(?)"	""
"0000829289"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000829290"	"00000905"	"70"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.(?)"	""
"0000829291"	"00000905"	"70"	"-36"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829292"	"00000905"	"70"	"-36"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829293"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000829294"	"00000905"	"70"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	"5"
"0000829295"	"00000905"	"70"	"-36"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829296"	"00000905"	"70"	"573"	"0"	"573"	"0"	"c.573delG"	"r.(?)"	"p.Pro192fs"	""
"0000829297"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.Arg209His"	""
"0000829298"	"00000905"	"70"	"-1758"	"0"	"52"	"2664"	"c.-1758_52+2664del"	"r.0?"	"p.0?"	"_1_1i"
"0000829299"	"00000905"	"70"	"185"	"-1020"	"522"	"1844"	"c.185-1020_522+1844del"	"r.(?)"	"p.(Glu62Glyfs*87)"	""
"0000829300"	"00000905"	"70"	"370"	"0"	"370"	"0"	"c.370C>T"	"r.(?)"	"p.(Gln124*)"	""
"0000829301"	"00000905"	"70"	"330"	"0"	"330"	"0"	"c.330del"	"r.(?)"	"p.(Cys110Trpfs*16)"	""
"0000829302"	"00000905"	"70"	"581"	"0"	"581"	"0"	"c.581T>A"	"r.(?)"	"p.(Ile194Asn)"	""
"0000829303"	"00000905"	"70"	"98"	"0"	"98"	"0"	"c.98G>A"	"r.(?)"	"p.(Trp33*)"	""
"0000829304"	"00000905"	"70"	"0"	"0"	"0"	"0"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829305"	"00000905"	"70"	"78"	"5"	"78"	"5"	"c.78+5G>T"	"r.spl?"	"p.(?)"	""
"0000829306"	"00000905"	"70"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	""
"0000829307"	"00000905"	"70"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	""
"0000829308"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000829309"	"00000905"	"70"	"48"	"0"	"52"	"2"	"c.48_52+2dup"	"r.spl?"	"p.(?)"	""
"0000829310"	"00000905"	"70"	"496"	"0"	"496"	"0"	"c.496T>C"	"r.(?)"	"p.(Tyr166His)"	""
"0000829311"	"00000905"	"70"	"451"	"0"	"451"	"0"	"c.451T>C"	"r.(?)"	"p.(Tyr151His)"	""
"0000829312"	"00000905"	"70"	"499"	"0"	"499"	"0"	"c.499A>G"	"r.(?)"	"p.(Lys167Glu)"	""
"0000829313"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	""
"0000829314"	"00000905"	"70"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	""
"0000829315"	"00000905"	"70"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163*)"	""
"0000829316"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	""
"0000829317"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	""
"0000829318"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	""
"0000829319"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	""
"0000829320"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	""
"0000829322"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000829323"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000829324"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000829325"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000829326"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	"4"
"0000829327"	"00000905"	"70"	"206"	"0"	"207"	"0"	"c.206_207del"	"r.(?)"	"p.(Leu69Argfs*16)"	"4"
"0000829328"	"00000905"	"70"	"206"	"0"	"207"	"0"	"c.206_207del"	"r.(?)"	"p.(Leu69Argfs*16)"	"4"
"0000829329"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0000829330"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0000829331"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0000829332"	"00000905"	"70"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.(?)"	"1i"
"0000829333"	"00000905"	"70"	"53"	"0"	"184"	"0"	"c.(53_184)delN[?]"	"r.?"	"p.?"	"2_3"
"0000829334"	"00000905"	"70"	"184"	"1"	"184"	"1"	"c.184+1G>C"	"r.spl"	"p.(?)"	"3i"
"0000829335"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>C"	"r.(?)"	"p.(Gly70Arg)"	"4"
"0000829336"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000829337"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0000829338"	"00000905"	"70"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Leu113Phe)"	"5"
"0000829339"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000829340"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0000829341"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000829342"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000829344"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000829345"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000829346"	"00000905"	"70"	"467"	"0"	"499"	"0"	"c.467_499del"	"r.(?)"	"p.(Arg156_Tyr166del)"	"6"
"0000829349"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000829350"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000829351"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000829352"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000829353"	"00000905"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000829354"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0000829355"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000829356"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000829357"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.?"	"1i_2i"
"0000829358"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.?"	"1i_2i"
"0000829359"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.?"	"1i_2i"
"0000829360"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.?"	"1i_2i"
"0000829361"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000829362"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000829363"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829364"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg102Cys)"	""
"0000829365"	"00000905"	"70"	"271"	"0"	"271"	"0"	"c.271G>T"	"r.(?)"	"p.(Gly91Cys)"	""
"0000829366"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>C"	"r.(?)"	"p.(Arg102Pro)"	""
"0000829367"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829368"	"00000905"	"70"	"326"	"0"	"326"	"0"	"c.326G>A"	"r.(?)"	"p.(Gly109Glu)"	""
"0000829369"	"00000905"	"70"	"689"	"0"	"689"	"0"	"c.*14T>C"	"r.(?)"	"p.(?)"	""
"0000829370"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0000829371"	"00000905"	"70"	"194"	"0"	"194"	"0"	"c.194A>G"	"r.(?)"	"p.(Tyr65Cys)"	""
"0000829372"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0000829373"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0000829374"	"00000905"	"70"	"282"	"0"	"284"	"0"	"c.282_284del"	"r.(?)"	"p.(Ser95del)"	""
"0000829375"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>T"	"r.(?)"	"p.(Trp92Cys)"	""
"0000829376"	"00000905"	"70"	"278"	"0"	"278"	"0"	"c.278A>G"	"r.(?)"	"p.(Tyr93Cys)"	""
"0000829377"	"00000905"	"70"	"216"	"0"	"216"	"0"	"c.216G>T"	"r.(?)"	"p.(Glu72Asp)"	""
"0000829378"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>G"	"r.(?)"	"p.(Arg141Gly)"	""
"0000829379"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0000829380"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0000829381"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0000829382"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829383"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829384"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829385"	"00000905"	"70"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	""
"0000829386"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0000829387"	"00000905"	"70"	"216"	"0"	"216"	"0"	"c.216G>T"	"r.(?)"	"p.(Glu72Asp)"	""
"0000829388"	"00000905"	"70"	"523"	"-2"	"523"	"-2"	"c.523-2A>G"	"r.(?)"	"p.(?)"	""
"0000829389"	"00000905"	"70"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	""
"0000829390"	"00000905"	"70"	"218"	"0"	"218"	"0"	"c.218del"	"r.(?)"	"p.(Ser73*)"	""
"0000829634"	"00000905"	"70"	"0"	"0"	"0"	"0"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000829635"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	""
"0000829636"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	""
"0000829637"	"00000905"	"70"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	""
"0000829638"	"00000905"	"70"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.?"	"p.?"	"1i_3i"
"0000829639"	"00000905"	"70"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	""
"0000829640"	"00000905"	"70"	"185"	"-1"	"185"	"-1"	"c.185-1G>A"	"r.spl"	"p.?"	""
"0000829641"	"00000905"	"70"	"184"	"2"	"184"	"2"	"c.184+2T>G"	"r.spl"	"p.?"	""
"0000829642"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829643"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829644"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829645"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	""
"0000829646"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	""
"0000829647"	"00000905"	"70"	"239"	"0"	"239"	"0"	"c.239A>C"	"r.(?)"	"p.(Gln80Pro)"	""
"0000829648"	"00000905"	"70"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	""
"0000829649"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	""
"0000829650"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829651"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829652"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829653"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829654"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829655"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829656"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829657"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829658"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829659"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829660"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000829661"	"00000905"	"70"	"317"	"0"	"317"	"0"	"c.317A>C"	"r.(?)"	"p.(Gln106Pro)"	""
"0000829662"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000829663"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	""
"0000829664"	"00000905"	"70"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	""
"0000829665"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000829666"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000829667"	"00000905"	"70"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Leu113Phe)"	""
"0000829668"	"00000905"	"70"	"378"	"0"	"378"	"0"	"c.378del"	"r.(?)"	"p.(Leu127Ter)"	""
"0000829669"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000829670"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000829671"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000829672"	"00000905"	"70"	"435"	"0"	"435"	"0"	"c.435dup"	"r.(?)"	"p.(Glu146*)"	""
"0000829673"	"00000905"	"70"	"496"	"0"	"496"	"0"	"c.496T>C"	"r.(?)"	"p.(Tyr166His)"	""
"0000829674"	"00000905"	"70"	"508"	"0"	"508"	"0"	"c.508A>C"	"r.(?)"	"p.(Thr170Pro)"	""
"0000829675"	"00000905"	"70"	"526"	"0"	"526"	"0"	"c.526T>C"	"r.(?)"	"p.(Phe176Leu)"	""
"0000829676"	"00000905"	"70"	"554"	"0"	"554"	"0"	"c.554C>A"	"r.(?)"	"p.(Thr185Lys)"	""
"0000829677"	"00000905"	"70"	"554"	"0"	"554"	"0"	"c.554C>A"	"r.(?)"	"p.(Thr185Lys)"	""
"0000829678"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000829679"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000829680"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000829681"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000829682"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000829683"	"00000905"	"70"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	""
"0000829684"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000829685"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000829686"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000829687"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0000829688"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	""
"0000829689"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000829690"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000829691"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000829692"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000829693"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000829694"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0000829695"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0000829696"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0000829710"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829734"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829735"	"00000905"	"70"	"458"	"0"	"458"	"0"	"c.458T>C"	"r.(?)"	"p.(Val153Ala)"	""
"0000829736"	"00000905"	"70"	"335"	"0"	"335"	"0"	"c.335G>C"	"r.(?)"	"p.(Trp112Ser)"	""
"0000829737"	"00000905"	"70"	"327"	"0"	"410"	"0"	"c.327_410del"	"r.(?)"	"p.(Cys110_Leu137del)"	""
"0000829738"	"00000905"	"70"	"488"	"0"	"488"	"0"	"c.488G>A"	"r.(?)"	"p.(Trp163Ter)"	""
"0000829739"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829740"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829741"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829742"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829743"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829744"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829745"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000829746"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829747"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>C"	"r.(?)"	"p.(Gln154Pro)"	""
"0000829748"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>C"	"r.(?)"	"p.(Gln154Pro)"	""
"0000829749"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000829750"	"00000905"	"70"	"488"	"0"	"488"	"0"	"c.488G>A"	"r.(?)"	"p.(Trp163Ter)"	""
"0000829751"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829752"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829753"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0000829754"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829755"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829756"	"00000905"	"70"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	""
"0000829772"	"00000905"	"70"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.spl"	"p.(?)"	""
"0000829800"	"00000905"	"70"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139Argfs*10)"	""
"0000829801"	"00000905"	"70"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl"	"p.?"	""
"0000830082"	"00000905"	"70"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.(?)"	"1"
"0000830083"	"00000905"	"70"	"96"	"0"	"96"	"0"	"c.96dup"	"r.(?)"	"p.(Trp33Leufs*53)"	"3"
"0000830084"	"00000905"	"70"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33Glyfs*93)"	"3"
"0000830085"	"00000905"	"70"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.(?)"	"p.(?)"	"1i_3i"
"0000830086"	"00000905"	"70"	"187"	"0"	"187"	"0"	"c.187T>A"	"r.(?)"	"p.(Cys63Ser)"	"4"
"0000830087"	"00000905"	"70"	"206"	"0"	"206"	"0"	"c.206T>G"	"r.(?)"	"p.(Leu69Arg)"	"4"
"0000830088"	"00000905"	"70"	"206"	"0"	"206"	"0"	"c.206T>G"	"r.(?)"	"p.(Leu69Arg)"	"4"
"0000830089"	"00000905"	"70"	"206"	"0"	"206"	"0"	"c.206T>G"	"r.(?)"	"p.(Leu69Arg)"	"4"
"0000830090"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830091"	"00000905"	"70"	"218"	"0"	"218"	"0"	"c.218C>A"	"r.(?)"	"p.(Ser73*)"	"4"
"0000830092"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830093"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>A"	"r.(?)"	"p.(Trp92*)"	"4"
"0000830094"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>A"	"r.(?)"	"p.(Trp92*)"	"4"
"0000830095"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000830096"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	"4"
"0000830097"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000830098"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000830099"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830100"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830101"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830102"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830103"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0000830104"	"00000905"	"70"	"185"	"-1"	"326"	"1"	"c.(184+1_185-1)_(326+1_327-1)del"	"r.?"	"p.?"	"3i_4i"
"0000830105"	"00000905"	"70"	"185"	"-1"	"326"	"1"	"c.(184+1_185-1)_(326+1_327-1)del"	"r.(?)"	"p.(?)"	"3i_4i"
"0000830106"	"00000905"	"70"	"53"	"-1"	"326"	"1"	"c.(?_-35)_(326+1_327-1)del"	"r.0?"	"p.0?"	"_1_4i"
"0000830107"	"00000905"	"70"	"53"	"-1"	"326"	"1"	"c.(?_-35)_(326+1_327-1)del"	"r.0?"	"p.0?"	"_1_4i"
"0000830108"	"00000905"	"70"	"336"	"0"	"336"	"0"	"c.336G>A"	"r.(?)"	"p.(Trp112*)"	"5"
"0000830109"	"00000905"	"70"	"374"	"0"	"374"	"0"	"c.374T>G"	"r.(?)"	"p.(Ile125Arg)"	"5"
"0000830110"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000830111"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830112"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830113"	"00000905"	"70"	"458"	"0"	"458"	"0"	"c.458del"	"r.(?)"	"p.(Val153Glyfs*9)"	"5"
"0000830114"	"00000905"	"70"	"424"	"0"	"424"	"0"	"c.424T>C"	"r.(?)"	"p.(Cys142Arg)"	"5"
"0000830115"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0000830116"	"00000905"	"70"	"535"	"0"	"535"	"0"	"c.535A>G"	"r.(?)"	"p.(Asn179Asp)"	"5"
"0000830117"	"00000905"	"70"	"53"	"-1"	"522"	"1"	"c.(52+1_53-1)_(522+1_523-1)del"	"r.?"	"p.?"	"1i_5i"
"0000830118"	"00000905"	"70"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0000830119"	"00000905"	"70"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0000830120"	"00000905"	"70"	"581"	"0"	"581"	"0"	"c.581T>G"	"r.(?)"	"p.(Ile194Ser)"	"6"
"0000830121"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000830122"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000830123"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830124"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830125"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000830126"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830127"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830128"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830129"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000830130"	"00000905"	"70"	"632"	"0"	"632"	"0"	"c.632C>A"	"r.(?)"	"p.(Ala211Asp)"	"6"
"0000830131"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830132"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830133"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830155"	"00000905"	"70"	"635"	"0"	"635"	"0"	"c.635T>A"	"r.(?)"	"p.(lle212Asn)"	"6"
"0000830156"	"00000905"	"70"	"635"	"0"	"635"	"0"	"c.635T>A"	"r.(?)"	"p.(lle212Asn)"	"6"
"0000830157"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830158"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.?"	"1i_2i"
"0000830159"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	""
"0000830160"	"00000905"	"70"	"362"	"0"	"362"	"0"	"c.362del"	"r.(?)"	"p.(Gln121Argfs*5)"	""
"0000830161"	"00000905"	"70"	"362"	"0"	"362"	"0"	"c.362del"	"r.(?)"	"p.(Gln121Argfs*5)"	""
"0000830162"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830163"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830164"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830165"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830166"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830167"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830168"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830169"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830170"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	"5"
"0000830171"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>T"	"r.(?)"	"p.(Arg200Leu)"	""
"0000830172"	"00000905"	"70"	"96"	"0"	"96"	"0"	"c.96dup"	"r.(?)"	"p.(Trp33Leufs*53)"	""
"0000830173"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000830194"	"00000905"	"70"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.0?"	"p.(Met1?)"	""
"0000830195"	"00000905"	"70"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.0?"	"p.(Met1?)"	""
"0000830196"	"00000905"	"70"	"203"	"0"	"203"	"0"	"c.203C>G"	"r.(?)"	"p.(Pro68Arg)"	""
"0000830197"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	""
"0000830198"	"00000905"	"70"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	""
"0000830199"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830200"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830201"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830202"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830203"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830204"	"00000905"	"70"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	""
"0000830205"	"00000905"	"70"	"278"	"0"	"278"	"0"	"c.278A>C"	"r.(?)"	"p.(Tyr93Ser)"	""
"0000830206"	"00000905"	"70"	"278"	"0"	"278"	"0"	"c.278A>C"	"r.(?)"	"p.(Tyr93Ser)"	""
"0000830207"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830208"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830209"	"00000905"	"70"	"96"	"0"	"96"	"0"	"c.96dupC"	"r.(?)"	"p.(Trp33Leufs*53)"	""
"0000830210"	"00000905"	"70"	"99"	"0"	"99"	"0"	"c.99G>A"	"r.(?)"	"p.(Trp33*)"	""
"0000830211"	"00000905"	"70"	"223"	"0"	"223"	"0"	"c.223dupG"	"r.(?)"	"p.(Glu75Glyfs*11)"	""
"0000830212"	"00000905"	"70"	"520"	"0"	"520"	"0"	"c.520delC"	"r.(?)"	"p.(Arg174Glyfs*63)"	""
"0000830213"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830214"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830215"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830216"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830217"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000830218"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000830219"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000830220"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0000830221"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000830222"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000830223"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000830224"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000830225"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0000830226"	"00000905"	"70"	"535"	"0"	"535"	"0"	"c.535A>G"	"r.(?)"	"p.(Asn179Asp)"	""
"0000830227"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000830228"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000830229"	"00000905"	"70"	"-35"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000830230"	"00000905"	"70"	"-35"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000830231"	"00000905"	"70"	"-35"	"-1"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000830232"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000830233"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000830234"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000830235"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	""
"0000830236"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	""
"0000830237"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000830238"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000830239"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000830240"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000830241"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000830242"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	""
"0000830243"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>C"	"r.(?)"	"p.(Arg209Pro)"	""
"0000830244"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0000830245"	"00000905"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0000830246"	"00000905"	"70"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(?)"	"1i_2i"
"0000830247"	"00000905"	"70"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.(?)"	""
"0000830248"	"00000905"	"70"	"522"	"1"	"522"	"1"	"c.522+1G>A"	"r.spl"	"p.(?)"	""
"0000830249"	"00000905"	"70"	"523"	"-1"	"523"	"-1"	"c.523-1G>C"	"r.spl"	"p.(?)"	""
"0000830250"	"00000905"	"70"	"376"	"0"	"376"	"0"	"c.376G>C"	"r.(?)"	"p.(Asp126His)"	""
"0000830251"	"00000905"	"70"	"583"	"0"	"585"	"0"	"c.583_585dup"	"r.(?)"	"p.(Ile195dup)"	""
"0000830252"	"00000905"	"70"	"387"	"0"	"434"	"0"	"c.387_434dup"	"r.(?)"	"p.(Glu129_Ile144dup)"	""
"0000830253"	"00000905"	"70"	"387"	"0"	"434"	"0"	"c.387_434dup"	"r.(?)"	"p.(Glu129_Ile144dup)"	""
"0000830254"	"00000905"	"70"	"579"	"0"	"579"	"0"	"c.579del"	"r.(?)"	"p.(Ile194SerfsTer43)"	""
"0000830255"	"00000905"	"70"	"374"	"0"	"374"	"0"	"c.374T>G"	"r.(?)"	"p.(Ile125Arg)"	""
"0000830256"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0000830257"	"00000905"	"70"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	""
"0000830258"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000830259"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000830260"	"00000905"	"70"	"663"	"0"	"663"	"0"	"c.663dup"	"r.(?)"	"p.(Lys222GlnfsTer42)"	""
"0000830261"	"00000905"	"70"	"544"	"0"	"544"	"0"	"C.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0000830262"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000830263"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000830264"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000830265"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830266"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830267"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000830268"	"00000905"	"70"	"421"	"0"	"421"	"0"	"c.421C>A"	"r.(?)"	"p.(Arg141Ser)"	""
"0000830269"	"00000905"	"70"	"349"	"0"	"349"	"0"	"c.349C>T"	"r.(?)"	"p.(Gln117Ter)"	""
"0000830270"	"00000905"	"70"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89Ter)"	""
"0000830271"	"00000905"	"70"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.(?)"	"p.?"	""
"0000830272"	"00000905"	"70"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.(?)"	"p.?"	""
"0000830273"	"00000905"	"70"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.(?)"	"p.?"	""
"0000830310"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>C"	"r.(?)"	"p.(Leu12Pro)"	"1"
"0000830311"	"00000905"	"70"	"38"	"0"	"38"	"0"	"c.38T>C"	"r.(?)"	"p.(Leu13Pro)"	"1"
"0000830312"	"00000905"	"70"	"49"	"0"	"49"	"0"	"c.49G>T"	"r.(?)"	"p.(Glu17Ter)"	"1"
"0000830313"	"00000905"	"70"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.(?)"	"p.(?)"	"1i_3i"
"0000830314"	"00000905"	"70"	"78"	"2"	"78"	"2"	"c.78+2T>C"	"r.spl"	"p.(?)"	"2i"
"0000830315"	"00000905"	"70"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.(?)"	"p.(?)"	"2i_3i"
"0000830316"	"00000905"	"70"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.(?)"	"p.(?)"	"2i_3i"
"0000830317"	"00000905"	"70"	"98"	"0"	"98"	"0"	"c.98G>A"	"r.(?)"	"p.(Trp33Ter)"	"3"
"0000830318"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000830319"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000830320"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000830321"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000830322"	"00000905"	"70"	"175"	"0"	"175"	"0"	"c.175T>G"	"r.(?)"	"p.(Cys59Gly)"	"3"
"0000830323"	"00000905"	"70"	"185"	"0"	"186"	"0"	"c.185_186insT"	"r.(?)"	"p.(Glu62AspfsTer24)"	"3"
"0000830324"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830325"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830326"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830327"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830328"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830329"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830330"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830331"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830332"	"00000905"	"70"	"218"	"0"	"218"	"0"	"c.218C>T"	"r.(?)"	"p.(Ser73Leu)"	"4"
"0000830333"	"00000905"	"70"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000830334"	"00000905"	"70"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000830335"	"00000905"	"70"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000830336"	"00000905"	"70"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000830337"	"00000905"	"70"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89Ter)"	"4"
"0000830338"	"00000905"	"70"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89Ter)"	"4"
"0000830339"	"00000905"	"70"	"285"	"0"	"285"	"0"	"c.285del"	"r.(?)"	"p.(Trp96GlyfsTer30)"	"4"
"0000830340"	"00000905"	"70"	"301"	"0"	"301"	"0"	"c.301G>C"	"r.(?)"	"p.(Ala101Pro)"	"4"
"0000830341"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830342"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830343"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830344"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830345"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830346"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830347"	"00000905"	"70"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830348"	"00000905"	"70"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	"4"
"0000830349"	"00000905"	"70"	"330"	"0"	"330"	"0"	"c.330T>A"	"r.(?)"	"p.(Cys110Ter)"	"5"
"0000830350"	"00000905"	"70"	"330"	"0"	"330"	"0"	"c.330T>A"	"r.(?)"	"p.(Cys110Ter)"	"5"
"0000830351"	"00000905"	"70"	"404"	"0"	"404"	"0"	"c.404G>A"	"r.(?)"	"p.(Gly135Glu)"	"5"
"0000830352"	"00000905"	"70"	"417"	"0"	"417"	"0"	"c.417G>T"	"r.(?)"	"p.(Gln139His)"	"5"
"0000830353"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830354"	"00000905"	"70"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0000830355"	"00000905"	"70"	"522"	"1"	"522"	"1"	"c.522+1G>A"	"r.spl"	"p.(?)"	"5i"
"0000830356"	"00000905"	"70"	"523"	"-1"	"523"	"-1"	"c.523-1G>A"	"r.spl"	"p.(?)"	"5i"
"0000830357"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000830358"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000830359"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000830360"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0000830361"	"00000905"	"70"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0000830362"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830363"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830364"	"00000905"	"70"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830365"	"00000905"	"70"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000830366"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000830367"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000830368"	"00000905"	"70"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000830369"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830370"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830371"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000830372"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>A"	"r.(?)"	"p.(Arg209Ser)"	"6"
"0000830373"	"00000905"	"70"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000830374"	"00000905"	"70"	"657"	"0"	"657"	"0"	"c.657C>G"	"r.(?)"	"p.(Cys219Trp)"	"6"
"0000830375"	"00000905"	"70"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000830376"	"00000905"	"70"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000830418"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0000830454"	"00000905"	"90"	"375"	"0"	"377"	"0"	"c.375_377del"	"r.(?)"	"p.(Asp126del)"	"6"
"0000830455"	"00000905"	"90"	"375"	"0"	"377"	"0"	"c.375_377del"	"r.(?)"	"p.(Asp126del)"	"6"
"0000830496"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0000830497"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0000830498"	"00000905"	"70"	"251"	"0"	"251"	"0"	"c.251C>G"	"r.(?)"	"p.(Ser84Cys)"	""
"0000830499"	"00000905"	"90"	"-1492"	"0"	"53"	"-421"	"c.-1492_53-421del"	"r.0?"	"p.0?"	"_1_1i"
"0000830500"	"00000905"	"90"	"48"	"0"	"52"	"2"	"c.48_52+2dup"	"r.spl"	"p.0?"	"1_1i"
"0000830501"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>C"	"r.(?)"	"p.?"	"1"
"0000830502"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1g>t"	"r.(?)"	"p.?"	"1"
"0000830503"	"00000905"	"70"	"78"	"5"	"78"	"5"	"c.78+5G>T"	"r.(?)"	"p.?"	"2"
"0000830504"	"00000905"	"90"	"98"	"0"	"98"	"0"	"c.98G>A"	"r.(?)"	"p.(Trp33*)"	"3"
"0000830505"	"00000905"	"90"	"176"	"0"	"176"	"0"	"c.176G>A"	"r.(?)"	"p.(Cys59Tyr)"	"3"
"0000830506"	"00000905"	"90"	"196"	"0"	"196"	"0"	"c.196C>A"	"r.(?)"	"p.(His66Asn)"	"4"
"0000830507"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000830508"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0000830509"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830510"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830511"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830512"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0000830513"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0000830514"	"00000905"	"90"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	"4"
"0000830515"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>A"	"r.(?)"	"p.(Trp92*)"	"4"
"0000830516"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>T"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0000830517"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>C"	"r.(?)"	"p.(Trp96Cys)"	"4"
"0000830518"	"00000905"	"90"	"292"	"0"	"293"	"0"	"c.292_293del"	"r.(?)"	"p.(Ala98Lysfs*22)"	"4"
"0000830519"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830520"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000830521"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830522"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830523"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0000830524"	"00000905"	"70"	"311"	"0"	"311"	"0"	"c.311A>G"	"r.(?)"	"p.(Asn104Ser)"	"4"
"0000830525"	"00000905"	"90"	"317"	"0"	"326"	"21"	"c.317_326+21del"	"r.(?)"	"p.?"	"4"
"0000830526"	"00000905"	"90"	"326"	"1"	"326"	"3"	"c.326+1_326+3delinsT"	"r.(?)"	"p.?"	"4"
"0000830527"	"00000905"	"90"	"327"	"-2"	"327"	"-2"	"c.327-2A>G"	"r.(?)"	"p.?"	"5"
"0000830528"	"00000905"	"90"	"370"	"0"	"370"	"0"	"c.370C>T"	"r.(?)"	"p.(Gln124*)"	"5"
"0000830529"	"00000905"	"90"	"370"	"0"	"370"	"0"	"c.370C>T"	"r.(?)"	"p.(Gln124*)"	"5"
"0000830530"	"00000905"	"90"	"327"	"-14"	"410"	"0"	"c.327-14_410del"	"r.(?)"	"p.?"	"5"
"0000830531"	"00000905"	"90"	"330"	"0"	"330"	"0"	"c.330del"	"r.(?)"	"p.(Cys110Trpfs*16)"	"5"
"0000830532"	"00000905"	"90"	"334"	"0"	"334"	"0"	"c.334T>C"	"r.(?)"	"p.(Trp112Arg)"	"5"
"0000830533"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	"5"
"0000830534"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126*)"	"5"
"0000830535"	"00000905"	"90"	"385"	"0"	"387"	"0"	"c.385_387del"	"r.(?)"	"p.(Glu129del)"	"5"
"0000830536"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0000830537"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830538"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830539"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0000830540"	"00000905"	"90"	"425"	"0"	"425"	"0"	"c.425G>A"	"r.(?)"	"p.(Cys142Tyr)"	"5"
"0000830541"	"00000905"	"90"	"433"	"0"	"433"	"0"	"c.433G>C"	"r.(?)"	"p.(Asp145His)"	"5"
"0000830542"	"00000905"	"90"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0000830543"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147*)"	"5"
"0000830544"	"00000905"	"70"	"443"	"0"	"443"	"0"	"c.443T>A"	"r.(?)"	"p.(Met148Lys)"	"5"
"0000830545"	"00000905"	"90"	"451"	"0"	"451"	"0"	"c.451T>C"	"r.(?)"	"p.(Tyr151His)"	"5"
"0000830546"	"00000905"	"90"	"466"	"0"	"466"	"0"	"c.466A>G"	"r.(?)"	"p.(Arg156Gly)"	"5"
"0000830547"	"00000905"	"90"	"468"	"0"	"468"	"0"	"c.468dup"	"r.(?)"	"p.(Thr157Aspfs*3)"	"5"
"0000830548"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163*)"	"5"
"0000830549"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163*)"	"5"
"0000830550"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163*)"	"5"
"0000830551"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>A"	"r.(?)"	"p.(Trp163*)"	"5"
"0000830552"	"00000905"	"90"	"491"	"0"	"493"	"0"	"c.491_493delinsAATC"	"r.(?)"	"p.(Ile164Lysext*38)"	"5"
"0000830553"	"00000905"	"90"	"496"	"0"	"496"	"0"	"c.496T>C"	"r.(?)"	"p.(Tyr166His)"	"5"
"0000830554"	"00000905"	"90"	"499"	"0"	"499"	"0"	"c.499A>G"	"r.(?)"	"p.(Lys167Glu)"	"5"
"0000830555"	"00000905"	"90"	"505"	"0"	"505"	"0"	"c.505C>T"	"r.(?)"	"p.(Gln169*)"	"5"
"0000830556"	"00000905"	"90"	"505"	"0"	"505"	"0"	"c.505C>T"	"r.(?)"	"p.(Gln169*)"	"5"
"0000830557"	"00000905"	"90"	"511"	"0"	"511"	"0"	"c.511G>A"	"r.(?)"	"p.(Gly171Arg)"	"5"
"0000830558"	"00000905"	"70"	"545"	"0"	"545"	"0"	"c.545G>T"	"r.(?)"	"p.(Arg182Leu)"	"6"
"0000830559"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	"6"
"0000830560"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0000830561"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0000830562"	"00000905"	"70"	"580"	"0"	"580"	"0"	"c.580A>T"	"r.(?)"	"p.(Ile194Phe)"	"6"
"0000830563"	"00000905"	"90"	"581"	"0"	"581"	"0"	"c.581T>A"	"r.(?)"	"p.(Ile194Asn)"	"6"
"0000830564"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0000830565"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000830566"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0000830567"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000830568"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000830569"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0000830570"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0000830571"	"00000905"	"70"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Pro203Ser)"	"6"
"0000830572"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>A"	"r.(?)"	"p.(Pro203Gln)"	"6"
"0000830573"	"00000905"	"70"	"608"	"0"	"608"	"0"	"c.608C>A"	"r.(?)"	"p.(Pro203Gln)"	"6"
"0000830574"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0000830575"	"00000905"	"70"	"623"	"0"	"623"	"0"	"c.623T>C"	"r.(?)"	"p.(Val208Ala)"	"6"
"0000830576"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0000830577"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000830578"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000830579"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0000830580"	"00000905"	"90"	"631"	"0"	"631"	"0"	"c.631G>A"	"r.(?)"	"p.(Ala211Thr)"	"6"
"0000830581"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830582"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830583"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830584"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0000830585"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0000830586"	"00000905"	"90"	"652"	"0"	"652"	"0"	"c.652G>A"	"r.(?)"	"p.(Glu218Lys)"	"6"
"0000830587"	"00000905"	"90"	"656"	"0"	"656"	"0"	"c.656G>A"	"r.(?)"	"p.(Cys219Tyr)"	"6"
"0000830588"	"00000905"	"90"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0000830589"	"00000905"	"90"	"185"	"-523"	"1130"	"0"	"c.185-523_*455delinsTGTTTACCATTTCCAAAGAGCTAGGGAGTTTTT"	"r.?"	"p.?"	"3i_6"
"0000846908"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846909"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846910"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846911"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846912"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846913"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846914"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846915"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846916"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000846917"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000846918"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000846919"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000846920"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000846921"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	""
"0000846922"	"00000905"	"70"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Gly178Asp)"	""
"0000846923"	"00000905"	"70"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Gly178Asp)"	""
"0000846924"	"00000905"	"70"	"0"	"0"	"0"	"0"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000856500"	"00000905"	"30"	"131831"	"0"	"131831"	"0"	"c.*131156T>C"	"r.(=)"	"p.(=)"	""
"0000856501"	"00000905"	"30"	"78149"	"0"	"78152"	"0"	"c.*77474_*77477del"	"r.(=)"	"p.(=)"	""
"0000856502"	"00000905"	"10"	"78151"	"0"	"78152"	"0"	"c.*77476_*77477del"	"r.(=)"	"p.(=)"	""
"0000856503"	"00000905"	"50"	"37863"	"0"	"37863"	"0"	"c.*37188A>G"	"r.(=)"	"p.(=)"	""
"0000856504"	"00000905"	"30"	"33791"	"0"	"33791"	"0"	"c.*33116G>C"	"r.(=)"	"p.(=)"	""
"0000856505"	"00000905"	"50"	"14250"	"0"	"14250"	"0"	"c.*13575G>A"	"r.(=)"	"p.(=)"	""
"0000856506"	"00000905"	"10"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(?)"	"p.(Cys110=)"	""
"0000867253"	"00000905"	"90"	"54693"	"0"	"54693"	"0"	"c.*54018G>A"	"r.(=)"	"p.(=)"	""
"0000867254"	"00000905"	"30"	"29433"	"0"	"29433"	"0"	"c.*28758G>A"	"r.(=)"	"p.(=)"	""
"0000867255"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	""
"0000867256"	"00000905"	"50"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	""
"0000867257"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	""
"0000870225"	"00000905"	"90"	"518"	"0"	"518"	"0"	"c.518del"	"r.(?)"	"p.(Asn173Thrfs*64)"	""
"0000873657"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000896044"	"00000905"	"70"	"131853"	"0"	"131853"	"0"	"c.*131178T>C"	"r.(=)"	"p.(=)"	""
"0000896045"	"00000905"	"70"	"60794"	"0"	"60794"	"0"	"c.*60119G>C"	"r.(=)"	"p.(=)"	""
"0000896046"	"00000905"	"50"	"29516"	"0"	"29516"	"0"	"c.*28841G>A"	"r.(=)"	"p.(=)"	""
"0000896047"	"00000905"	"50"	"29411"	"0"	"29411"	"0"	"c.*28736C>G"	"r.(=)"	"p.(=)"	""
"0000896048"	"00000905"	"30"	"184"	"3208"	"184"	"3208"	"c.184+3208G>A"	"r.(=)"	"p.(=)"	""
"0000896049"	"00000905"	"70"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.(Met1?)"	""
"0000896533"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	""
"0000896640"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000896645"	"00000905"	"90"	"244"	"0"	"245"	"0"	"c.244_245delAC"	"r.(?)"	"p.(Thr82LeufsTer3)"	""
"0000905993"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	""
"0000905994"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	""
"0000905995"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	""
"0000915663"	"00000905"	"50"	"54724"	"0"	"54724"	"0"	"c.*54049C>G"	"r.(=)"	"p.(=)"	""
"0000915664"	"00000905"	"30"	"38637"	"0"	"38637"	"0"	"c.*37962C>G"	"r.(=)"	"p.(=)"	""
"0000915665"	"00000905"	"90"	"38107"	"0"	"38107"	"0"	"c.*37432G>A"	"r.(=)"	"p.(=)"	""
"0000915666"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000915667"	"00000905"	"50"	"412"	"0"	"412"	"0"	"c.412A>G"	"r.(?)"	"p.(Thr138Ala)"	""
"0000927307"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	""
"0000931368"	"00000905"	"90"	"413"	"0"	"413"	"0"	"c.413C>A"	"r.(?)"	"p.(Thr138Asn)"	""
"0000933611"	"00000905"	"99"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"1"
"0000933612"	"00000905"	"99"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"2"
"0000933613"	"00000905"	"99"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"2"
"0000951727"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75*)"	""
"0000951728"	"00000905"	"70"	"216"	"0"	"216"	"0"	"c.216G>C"	"r.(?)"	"p.(Glu72Asp)"	""
"0000951729"	"00000905"	"70"	"2"	"0"	"2"	"0"	"c.2T>A"	"r.(?)"	"p.?"	""
"0000952090"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000952091"	"00000905"	"50"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000952092"	"00000905"	"50"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000952093"	"00000905"	"50"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000952094"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0000952095"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0000952096"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0000952097"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0000952098"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000952099"	"00000905"	"50"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0000952264"	"00000905"	"90"	"-1"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000952265"	"00000905"	"90"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.(Met1?)"	"1"
"0000952266"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11Phefs*114)"	"1"
"0000952267"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000952268"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000952269"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000952270"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(?)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0000952271"	"00000905"	"90"	"79"	"-2"	"79"	"-2"	"c.79-2A>G"	"r.spl"	"p.?"	"2i"
"0000952272"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40*)"	"3"
"0000952273"	"00000905"	"90"	"183"	"0"	"184"	"12"	"c.183_184+12del"	"r.spl"	"p.?"	"3_3i"
"0000952274"	"00000905"	"90"	"184"	"1"	"184"	"1"	"c.184+1G>C"	"r.spl"	"p.?"	"3_3i"
"0000952275"	"00000905"	"90"	"185"	"-1"	"326"	"1"	"c.(184+1_185-1)_(326+1_327-1)del"	"r.?"	"p.?"	"3i_4i"
"0000952276"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0000952277"	"00000905"	"90"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89*)"	"4"
"0000952278"	"00000905"	"90"	"315"	"0"	"316"	"0"	"c.315_316insA"	"r.(?)"	"p.((Gln106Thrfs*15)"	"4"
"0000952279"	"00000905"	"10"	"666"	"0"	"666"	"0"	"c.666G>C"	"r.(?)"	"p.(Lys222Asn)"	"6"
"0000958307"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0000958308"	"00000905"	"90"	"199"	"0"	"206"	"0"	"c.199_206dup"	"r.(?)"	"p.(Gly70SerfsTer59)"	""
"0000958309"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0000958310"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0000958311"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000958312"	"00000905"	"90"	"221"	"0"	"221"	"0"	"c.221G>T"	"r.(?)"	"p.(Gly74Val)"	""
"0000958313"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0000958314"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	""
"0000958315"	"00000905"	"70"	"428"	"0"	"428"	"0"	"c.428A>C"	"r.(?)"	"p.(Asp143Ala)"	""
"0000958316"	"00000905"	"90"	"199"	"0"	"206"	"0"	"c.199_206dup"	"r.(?)"	"p.(Gly70SerfsTer59)"	""
"0000958317"	"00000905"	"90"	"372"	"0"	"373"	"0"	"c.372_373insTAGCCAGTGG"	"r.(?)"	"p.(Ile125Ter)"	""
"0000958924"	"00000905"	"50"	"239"	"0"	"239"	"0"	"c.239A>C"	"r.(?)"	"p.(Gln80Pro)"	""
"0000959229"	"00000905"	"70"	"293"	"0"	"293"	"0"	"c.293C>A"	"r.(?)"	"p.(Ala98Glu)"	""
"0000970958"	"00000905"	"50"	"14286"	"0"	"14286"	"0"	"c.*13611C>T"	"r.(=)"	"p.(=)"	""
"0000970961"	"00000905"	"30"	"87"	"0"	"87"	"0"	"c.87C>T"	"r.(?)"	"p.(Gly29=)"	""
"0000971532"	"00000905"	"70"	"127"	"0"	"127"	"0"	"c.127C>T"	"r.(?)"	"p.(Gln43Ter)"	""
"0000984590"	"00000905"	"30"	"185"	"-3260"	"185"	"-3260"	"c.185-3260C>T"	"r.(=)"	"p.(=)"	""
"0000986590"	"00000905"	"90"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0000986591"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0000986592"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001006633"	"00000905"	"50"	"62706"	"0"	"62706"	"0"	"c.*62031C>T"	"r.(=)"	"p.(=)"	""
"0001006634"	"00000905"	"30"	"38034"	"0"	"38034"	"0"	"c.*37359G>A"	"r.(=)"	"p.(=)"	""
"0001006635"	"00000905"	"30"	"33838"	"0"	"33838"	"0"	"c.*33163C>T"	"r.(=)"	"p.(=)"	""
"0001006636"	"00000905"	"50"	"14287"	"0"	"14287"	"0"	"c.*13612G>A"	"r.(=)"	"p.(=)"	""
"0001006637"	"00000905"	"30"	"465"	"0"	"465"	"0"	"c.465C>T"	"r.(?)"	"p.(=)"	""
"0001016011"	"00000905"	"90"	"54625"	"0"	"54625"	"0"	"c.*53950G>A"	"r.(=)"	"p.(=)"	""
"0001016012"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019189"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019190"	"00000905"	"70"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0001019191"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	""
"0001019192"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0001019193"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0001019194"	"00000905"	"90"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0001019195"	"00000905"	"70"	"521"	"0"	"521"	"0"	"c.521G>C"	"r.(?)"	"p.(Arg174Pro)"	""
"0001019196"	"00000905"	"70"	"34"	"0"	"35"	"0"	"c.34_35insGATA"	"r.(?)"	"p.(Leu12ArgfsTer7)"	""
"0001019197"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019198"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019199"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0001019200"	"00000905"	"90"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	""
"0001019201"	"00000905"	"70"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019202"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019203"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0001019204"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0001019205"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0001019208"	"00000905"	"90"	"78"	"1"	"78"	"1"	"c.78+1G>T"	"r.spl"	"p.?"	"2i"
"0001019209"	"00000905"	"90"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33GlyfsTer93)"	"3"
"0001019210"	"00000905"	"90"	"130"	"0"	"140"	"0"	"c.130_140del"	"r.(?)"	"p.(Gly44CysfsTer38)"	"3"
"0001019211"	"00000905"	"90"	"150"	"0"	"150"	"0"	"c.150G>A"	"r.(?)"	"p.(Trp50Ter)"	"3"
"0001019212"	"00000905"	"90"	"188"	"0"	"188"	"0"	"c.188G>A"	"r.(?)"	"p.(Cys63Tyr)"	"3"
"0001019213"	"00000905"	"90"	"185"	"-1"	"326"	"1"	"c.(184+1_185-1)_(326+1_327-1)del"	"r.(185_326del)"	"p.(Glu62GlyfsTer17)"	"4"
"0001019214"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019215"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019216"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019217"	"00000905"	"90"	"227"	"0"	"227"	"0"	"c.227T>G"	"r.(?)"	"p.(Val76Gly)"	"4"
"0001019218"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019219"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019220"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019221"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019222"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019223"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019224"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019225"	"00000905"	"90"	"302"	"0"	"302"	"0"	"c.302C>A"	"r.(?)"	"p.(Ala101Asp)"	"4"
"0001019226"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019227"	"00000905"	"90"	"306"	"0"	"308"	"0"	"c.306_308dup"	"r.(?)"	"p.(Leu103dup)"	"4"
"0001019228"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>A"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019229"	"00000905"	"90"	"326"	"2"	"326"	"2"	"c.326+2T>G"	"r.spl"	"p.?"	"4"
"0001019230"	"00000905"	"90"	"328"	"0"	"328"	"0"	"c.328T>C"	"r.(?)"	"p.(Cys110Arg)"	"4"
"0001019231"	"00000905"	"90"	"331"	"0"	"331"	"0"	"c.331G>A"	"r.(?)"	"p.(Ala111Thr)"	"5"
"0001019232"	"00000905"	"90"	"404"	"0"	"404"	"0"	"c.404G>A"	"r.(?)"	"p.(Gly135Glu)"	"5"
"0001019233"	"00000905"	"90"	"410"	"0"	"410"	"0"	"c.410T>C"	"r.(?)"	"p.(Leu137Pro)"	"5"
"0001019234"	"00000905"	"90"	"410"	"0"	"410"	"0"	"c.410T>C"	"r.(?)"	"p.(Leu137Pro)"	"5"
"0001019235"	"00000905"	"90"	"410"	"0"	"410"	"0"	"c.410T>C"	"r.(?)"	"p.(Leu137Pro)"	"5"
"0001019236"	"00000905"	"90"	"410"	"0"	"410"	"0"	"c.410T>C"	"r.(?)"	"p.(Leu137Pro)"	"5"
"0001019237"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019238"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019239"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019240"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019241"	"00000905"	"90"	"426"	"0"	"426"	"0"	"c.426T>G"	"r.(?)"	"p.(Cys142Trp)"	"5"
"0001019242"	"00000905"	"90"	"433"	"0"	"433"	"0"	"c.433G>T"	"r.(?)"	"p.(Asp145Tyr)"	"5"
"0001019243"	"00000905"	"90"	"499"	"0"	"499"	"0"	"c.499A>G"	"r.(?)"	"p.(Lys167Glu)"	"5"
"0001019244"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>T"	"r.spl"	"p.?"	"5i"
"0001019245"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019246"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019247"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019248"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019249"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019250"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019251"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019252"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0001019253"	"00000905"	"90"	"578"	"0"	"578"	"0"	"c.578C>G"	"r.(?)"	"p.(Pro193Arg)"	"6"
"0001019254"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019255"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019256"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019257"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019258"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019259"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019260"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019261"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019262"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019263"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019264"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019265"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019266"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019267"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019268"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019269"	"00000905"	"90"	"617"	"0"	"617"	"0"	"c.617G>C"	"r.(?)"	"p.(Trp206Ser)"	"6"
"0001019270"	"00000905"	"90"	"617"	"0"	"617"	"0"	"c.617G>C"	"r.(?)"	"p.(Trp206Ser)"	"6"
"0001019271"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019272"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019273"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019274"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019275"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019276"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0001019277"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0001019278"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0001019279"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0001019280"	"00000905"	"90"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	"6"
"0001019281"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019282"	"00000905"	"90"	"7"	"0"	"7"	"0"	"c.7C>G"	"r.(?)"	"p.(Arg3Gly)"	""
"0001019283"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019284"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019285"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019286"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	""
"0001019287"	"00000905"	"90"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	""
"0001019288"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019289"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	""
"0001019290"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001019291"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019292"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019293"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0001019294"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>A"	"r.(?)"	"p.(Trp112Ter)"	""
"0001019295"	"00000905"	"90"	"335"	"0"	"335"	"0"	"c.335G>A"	"r.(?)"	"p.(Trp112Ter)"	""
"0001019296"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019297"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0001019298"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001019299"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579del"	"r.(?)"	"p.(Ile194SerfsTer43)"	""
"0001019300"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019301"	"00000905"	"90"	"96"	"0"	"96"	"0"	"c.96del"	"r.(?)"	"p.(Trp33GlyfsTer93)"	""
"0001019302"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.(Ala18GlyfsTer2)"	"1i_2i"
"0001019303"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.(79_184del)"	"p.(Asp27fs)"	"2i_3i"
"0001019304"	"00000905"	"90"	"223"	"0"	"223"	"0"	"c.223G>T"	"r.(?)"	"p.(Glu75Ter)"	""
"0001019305"	"00000905"	"90"	"185"	"-1"	"522"	"1"	"c.(184+1_185-1)_(522+1_523-1)del"	"r.(185_522del)"	"p.(Glu62fs)"	"3i_5i"
"0001019306"	"00000905"	"90"	"53"	"-1"	"53"	"-1"	"c.53-1G>A"	"r.spl"	"p.?"	""
"0001019307"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019308"	"00000905"	"90"	"451"	"0"	"451"	"0"	"c.451T>C"	"r.(?)"	"p.(Tyr151His)"	""
"0001019309"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019310"	"00000905"	"90"	"240"	"0"	"240"	"0"	"c.240G>C"	"r.(?)"	"p.(Gln80His)"	""
"0001019311"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019312"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019313"	"00000905"	"90"	"52"	"0"	"52"	"0"	"c.52G>A"	"r.spl"	"p.?"	""
"0001019314"	"00000905"	"90"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.(53_184del)"	"p.(Ala18Pro61del)"	"1i_3i"
"0001019315"	"00000905"	"90"	"512"	"0"	"512"	"0"	"c.512G>A"	"r.(?)"	"p.(Gly171Glu)"	""
"0001019316"	"00000905"	"90"	"327"	"-2"	"327"	"-2"	"c.327-2A>G"	"r.spl"	"p.?"	""
"0001019317"	"00000905"	"90"	"336"	"0"	"337"	"0"	"c.336_337insT"	"r.(?)"	"p.(Leu113SerfsTer8)"	""
"0001019318"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019319"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019320"	"00000905"	"90"	"336"	"0"	"337"	"0"	"c.336_337insT"	"r.(?)"	"p.(Leu113SerfsTer8)"	""
"0001019321"	"00000905"	"90"	"451"	"0"	"451"	"0"	"c.451T>C"	"r.(?)"	"p.(Tyr151His)"	""
"0001019322"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019323"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489del"	"r.(?)"	"p.(Trp163Ter)"	""
"0001019324"	"00000905"	"90"	"400"	"0"	"400"	"0"	"c.400T>C"	"r.(?)"	"p.(Ser134Pro)"	""
"0001019325"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001019326"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0001019327"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	""
"0001019328"	"00000905"	"90"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89Ter)"	""
"0001019329"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	""
"0001019330"	"00000905"	"90"	"522"	"2"	"522"	"2"	"c.522+2T>A"	"r.spl"	"p.?"	"5i"
"0001019339"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019340"	"00000905"	"90"	"79"	"-1"	"184"	"1"	"c.(78+1_79-1)_(184+1_185-1)del"	"r.(79_184del)"	"p.(Asp27fs)"	"2i_3i"
"0001019341"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019342"	"00000905"	"90"	"3"	"0"	"3"	"0"	"c.3G>T"	"r.(?)"	"p.(Met1?)"	"1"
"0001019343"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139ArgfsTer10)"	"5"
"0001019344"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019345"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40Ter)"	"3"
"0001019346"	"00000905"	"90"	"404"	"0"	"404"	"0"	"c.404G>T"	"r.(?)"	"p.(Gly135Val)"	"5"
"0001019347"	"00000905"	"90"	"428"	"0"	"428"	"0"	"c.428A>T"	"r.(?)"	"p.(Asp143Val)"	"5"
"0001019348"	"00000905"	"90"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0001019349"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0001019350"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019351"	"00000905"	"90"	"451"	"0"	"451"	"0"	"c.451T>A"	"r.(?)"	"p.(Tyr151Asn)"	"5"
"0001019352"	"00000905"	"90"	"452"	"0"	"452"	"0"	"c.452A>G"	"r.(?)"	"p.(Tyr151Cys)"	"5"
"0001019353"	"00000905"	"90"	"566"	"0"	"566"	"0"	"c.566del"	"r.(?)"	"p.(Leu189ArgfsTer48)"	"6"
"0001019354"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0001019355"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019356"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019357"	"00000905"	"90"	"323"	"0"	"323"	"0"	"c.323T>G"	"r.(?)"	"p.(Phe108Cys)"	"4"
"0001019358"	"00000905"	"90"	"391"	"0"	"391"	"0"	"c.391A>G"	"r.(?)"	"p.(Lys131Glu)"	"5"
"0001019359"	"00000905"	"90"	"412"	"0"	"412"	"0"	"c.412A>G"	"r.(?)"	"p.(Thr138Ala)"	"5"
"0001019360"	"00000905"	"90"	"424"	"0"	"424"	"0"	"c.424T>C"	"r.(?)"	"p.(Cys142Arg)"	"5"
"0001019361"	"00000905"	"90"	"428"	"0"	"429"	"0"	"c.428_429insTG"	"r.(?)"	"p.(Ile144AlafsTer6)"	"5"
"0001019362"	"00000905"	"90"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0001019363"	"00000905"	"90"	"485"	"0"	"485"	"0"	"c.485del"	"r.(?)"	"p.(Asn162ThrfsTer75)"	"5"
"0001019364"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019365"	"00000905"	"90"	"655"	"0"	"655"	"0"	"c.655del"	"r.(?)"	"p.(Cys219AlafsTer18)"	"6"
"0001019366"	"00000905"	"90"	"271"	"0"	"271"	"0"	"c.271G>T"	"r.(?)"	"p.(Gly91Cys)"	"4"
"0001019367"	"00000905"	"90"	"274"	"0"	"274"	"0"	"c.274T>A"	"r.(?)"	"p.(Trp92Arg)"	"4"
"0001019368"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019369"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019370"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019371"	"00000905"	"90"	"326"	"5"	"326"	"5"	"c.326+5G>C"	"r.spl"	"p.?"	"4i"
"0001019372"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.spl?"	"p.(Gly109Ala)"	"4"
"0001019373"	"00000905"	"90"	"332"	"0"	"332"	"0"	"c.332C>T"	"r.(?)"	"p.(Ala111Val)"	"5"
"0001019374"	"00000905"	"90"	"366"	"0"	"366"	"0"	"c.366G>A"	"r.(?)"	"p.(Trp122Ter)"	"5"
"0001019375"	"00000905"	"90"	"375"	"0"	"378"	"0"	"c.375_378del"	"r.(?)"	"p.(Asp126Ter)"	"5"
"0001019376"	"00000905"	"90"	"433"	"0"	"433"	"0"	"c.433G>C"	"r.(?)"	"p.(Asp145His)"	"5"
"0001019377"	"00000905"	"90"	"453"	"0"	"453"	"0"	"c.453C>G"	"r.(?)"	"p.(Tyr151Ter)"	"5"
"0001019378"	"00000905"	"90"	"456"	"0"	"459"	"0"	"c.456_459delinsGAC"	"r.(?)"	"p.(Ser152ArgfsTer10)"	"5"
"0001019379"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>T"	"r.(?)"	"p.(Trp163Cys)"	"5"
"0001019380"	"00000905"	"90"	"52"	"0"	"52"	"0"	"c.52G>A"	"r.(?)"	"p.(Ala18Thr)"	"1"
"0001019381"	"00000905"	"90"	"522"	"2"	"522"	"2"	"c.522+2T>A"	"r.spl"	"p.?"	"5i"
"0001019382"	"00000905"	"90"	"577"	"0"	"579"	"0"	"c.577_579del"	"r.(?)"	"p.(Pro193del)"	"6"
"0001019383"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579del"	"r.(?)"	"p.(Ile194SerfsTer43)"	"6"
"0001019384"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019385"	"00000905"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Pro203Ser)"	"6"
"0001019386"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>G"	"r.(?)"	"p.(Pro203Arg)"	"6"
"0001019387"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019388"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0001019389"	"00000905"	"90"	"631"	"0"	"631"	"0"	"c.631G>A"	"r.(?)"	"p.(Ala211Thr)"	"6"
"0001019390"	"00000905"	"90"	"657"	"0"	"657"	"0"	"c.657C>G"	"r.(?)"	"p.(Cys219Trp)"	"6"
"0001019391"	"00000905"	"90"	"78"	"5"	"78"	"7"	"c.78+5_78+7delinsTTT"	"r.spl"	"p.?"	"2i"
"0001019392"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019393"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019394"	"00000905"	"90"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	""
"0001019395"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>A"	"r.(?)"	"p.(Gly109Arg)"	""
"0001019396"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>A"	"r.(?)"	"p.(Gly109Arg)"	""
"0001019397"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0001019398"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0001019399"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	""
"0001019400"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	""
"0001019401"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019402"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019403"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	""
"0001019404"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0001019405"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0001019406"	"00000905"	"90"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.(53_184del)"	"p.(Ala18Pro61del)"	""
"0001019407"	"00000905"	"50"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.(Ala18Glyfs*2)"	""
"0001019408"	"00000905"	"90"	"487"	"0"	"487"	"0"	"c.487T>G"	"r.(?)"	"p.(Trp163Gly)"	"5"
"0001019410"	"00000905"	"90"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	"4"
"0001019411"	"00000905"	"90"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	"4"
"0001019412"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96Ter)"	"4"
"0001019413"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96Ter)"	"4"
"0001019414"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019415"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>A"	"r.(?)"	"p.(Arg200Ser)"	"6"
"0001019416"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019417"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019418"	"00000905"	"90"	"3"	"0"	"52"	"3913"	"c.(-63_3)_(52+3913_52+4861)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019419"	"00000905"	"90"	"3"	"0"	"52"	"3913"	"c.(-63_3)_(52+3913_52+4861)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019420"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019421"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019422"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019423"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019424"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019425"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019426"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>T"	"r.(?)"	"p.(Gly140Trp)"	"5"
"0001019427"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019428"	"00000905"	"90"	"149"	"0"	"149"	"0"	"c.149G>A"	"r.(?)"	"p.(Trp50Ter)"	"3"
"0001019429"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019430"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019431"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019432"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019433"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019434"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019435"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019436"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019437"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019438"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019439"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019440"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019441"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019442"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019443"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019444"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019445"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019446"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019447"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019448"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019449"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019450"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019451"	"00000905"	"90"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	"6"
"0001019452"	"00000905"	"90"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	"6"
"0001019453"	"00000905"	"90"	"531"	"0"	"531"	"0"	"c.531T>G"	"r.(?)"	"p.(Tyr177Ter)"	"6"
"0001019454"	"00000905"	"90"	"458"	"0"	"458"	"0"	"c.458T>G"	"r.(?)"	"p.(Val153Gly)"	"5"
"0001019455"	"00000905"	"90"	"458"	"0"	"458"	"0"	"c.458T>G"	"r.(?)"	"p.(Val153Gly)"	"5"
"0001019456"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>C"	"r.(?)"	"p.(Arg200Pro)"	"6"
"0001019457"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	"4"
"0001019458"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	"4"
"0001019459"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.(?)"	"p.(Gly109Ala)"	"4"
"0001019460"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019461"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019465"	"00000905"	"90"	"20"	"0"	"20"	"0"	"c.20del"	"r.(?)"	"p.(Gly7AlafsTer119)"	""
"0001019466"	"00000905"	"90"	"20"	"0"	"20"	"0"	"c.20del"	"r.(?)"	"p.(Gly7AlafsTer119)"	""
"0001019467"	"00000905"	"90"	"20"	"0"	"20"	"0"	"c.20del"	"r.(?)"	"p.(Gly7AlafsTer119)"	""
"0001019468"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11PhefsTer114)"	""
"0001019469"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11PhefsTer114)"	""
"0001019470"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11PhefsTer114)"	""
"0001019471"	"00000905"	"90"	"187"	"0"	"187"	"0"	"c.187T>C"	"r.(?)"	"p.(Cys63Arg)"	""
"0001019472"	"00000905"	"90"	"275"	"0"	"275"	"0"	"c.275G>A"	"r.(?)"	"p.(Trp92Ter)"	""
"0001019473"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019474"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019475"	"00000905"	"90"	"375"	"0"	"379"	"0"	"c.375_379del"	"r.(?)"	"p.(Asp126GlufsTer16)"	""
"0001019476"	"00000905"	"90"	"539"	"0"	"539"	"0"	"c.539C>A"	"r.(?)"	"p.(Ser180Ter)"	""
"0001019477"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0001019478"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	""
"0001019479"	"00000905"	"90"	"575"	"0"	"576"	"0"	"c.575_576insT"	"r.(?)"	"p.(Ile194HisfsTer70)"	""
"0001019480"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019481"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019482"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001019483"	"00000905"	"90"	"33"	"0"	"36"	"0"	"c.33_36del"	"r.(?)"	"p.(Leu11PhefsTer114)"	""
"0001019484"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0001019485"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0001019486"	"00000905"	"90"	"20"	"0"	"20"	"0"	"c.20del"	"r.(?)"	"p.(Gly7AlafsTer119)"	"1"
"0001019487"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019488"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019489"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019490"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019491"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019492"	"00000905"	"70"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019493"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>T"	"r.spl"	"p.?"	"1i"
"0001019494"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>C"	"r.spl"	"p.?"	"1i"
"0001019495"	"00000905"	"70"	"53"	"-34"	"53"	"-34"	"c.53-34A>G"	"r.spl"	"p.?"	"1i"
"0001019496"	"00000905"	"70"	"78"	"0"	"78"	"0"	"c.78G>C"	"r.(?)"	"p.(Glu26Asp)"	"2"
"0001019497"	"00000905"	"70"	"78"	"0"	"78"	"0"	"c.78G>C"	"r.(?)"	"p.(Glu26Asp)"	"2"
"0001019498"	"00000905"	"70"	"78"	"0"	"78"	"0"	"c.78G>C"	"r.(?)"	"p.(Glu26Asp)"	"2"
"0001019499"	"00000905"	"90"	"103"	"0"	"103"	"0"	"c.103C>T"	"r.(?)"	"p.(Gln35Ter)"	"3"
"0001019500"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40Ter)"	"3"
"0001019501"	"00000905"	"90"	"184"	"2"	"184"	"2"	"c.184+2T>G"	"r.spl"	"p.?"	"3i"
"0001019502"	"00000905"	"90"	"185"	"-1"	"185"	"-1"	"c.185-1G>A"	"r.spl"	"p.?"	"3i"
"0001019503"	"00000905"	"70"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	"4"
"0001019504"	"00000905"	"70"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0001019505"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0001019506"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019507"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019508"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019509"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019510"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019511"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019512"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019513"	"00000905"	"90"	"216"	"0"	"216"	"0"	"c.216G>C"	"r.(?)"	"p.(Glu72Asp)"	"4"
"0001019514"	"00000905"	"70"	"239"	"0"	"239"	"0"	"c.239A>C"	"r.(?)"	"p.(Gln80Pro)"	"4"
"0001019515"	"00000905"	"70"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	"4"
"0001019516"	"00000905"	"70"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019517"	"00000905"	"70"	"288"	"0"	"288"	"0"	"c.288G>C"	"r.(?)"	"p.(Trp96Cys)"	"4"
"0001019518"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019519"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019520"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019521"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019522"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019523"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019524"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019525"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019526"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019527"	"00000905"	"70"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019528"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019529"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019530"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019531"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019532"	"00000905"	"70"	"308"	"0"	"308"	"0"	"c.308T>G"	"r.(?)"	"p.(Leu103Arg)"	"4"
"0001019533"	"00000905"	"70"	"317"	"0"	"317"	"0"	"c.317A>C"	"r.(?)"	"p.(Gln106Pro)"	"4"
"0001019534"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019535"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	"4"
"0001019536"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl"	"p.?"	"4i"
"0001019537"	"00000905"	"90"	"326"	"0"	"326"	"0"	"c.326G>C"	"r.spl?"	"p.(Gly109Ala)"	"4"
"0001019538"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0001019539"	"00000905"	"70"	"336"	"0"	"337"	"0"	"c.336_337delinsTT"	"r.(?)"	"p.(Trp112_Leu113delinsCysPhe)"	"5"
"0001019540"	"00000905"	"70"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Leu113Phe)"	"5"
"0001019541"	"00000905"	"90"	"349"	"0"	"349"	"0"	"c.349C>T"	"r.(?)"	"p.(Gln117Ter)"	"5"
"0001019542"	"00000905"	"90"	"378"	"0"	"378"	"0"	"c.378del"	"r.(?)"	"p.(Leu127Ter)"	"5"
"0001019543"	"00000905"	"90"	"378"	"0"	"378"	"0"	"c.378del"	"r.(?)"	"p.(Leu127Ter)"	"5"
"0001019544"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019545"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019546"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019547"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019548"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019549"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019550"	"00000905"	"90"	"422"	"0"	"422"	"0"	"c.422G>T"	"r.(?)"	"p.(Arg141Leu)"	"5"
"0001019551"	"00000905"	"90"	"435"	"0"	"435"	"0"	"c.435dup"	"r.(?)"	"p.(Glu146Ter)"	"5"
"0001019552"	"00000905"	"90"	"438"	"0"	"438"	"0"	"c.438G>C"	"r.(?)"	"p.(Glu146Asp)"	"5"
"0001019553"	"00000905"	"70"	"496"	"0"	"498"	"0"	"c.496_498del"	"r.(?)"	"p.(Tyr166del)"	"5"
"0001019554"	"00000905"	"70"	"496"	"0"	"496"	"0"	"c.496T>C"	"r.(?)"	"p.(Tyr166His)"	"5"
"0001019555"	"00000905"	"90"	"498"	"0"	"498"	"0"	"c.498C>G"	"r.(?)"	"p.(Tyr166Ter)"	"5"
"0001019556"	"00000905"	"70"	"508"	"0"	"508"	"0"	"c.508A>C"	"r.(?)"	"p.(Thr170Pro)"	"5"
"0001019557"	"00000905"	"90"	"515"	"0"	"515"	"0"	"c.515del"	"r.(?)"	"p.(Asn172ThrfsTer65)"	"5"
"0001019558"	"00000905"	"70"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	"6"
"0001019559"	"00000905"	"70"	"554"	"0"	"554"	"0"	"c.554C>A"	"r.(?)"	"p.(Thr185Lys)"	"6"
"0001019560"	"00000905"	"90"	"574"	"0"	"580"	"0"	"c.574_580delinsACCCCCCT"	"r.(?)"	"p.(Pro192ThrfsTer72)"	"6"
"0001019561"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019562"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019563"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019564"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019565"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019566"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019567"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019568"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019569"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	"6"
"0001019570"	"00000905"	"90"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0001019571"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019572"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019573"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019574"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019575"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019576"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019577"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019578"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019579"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>A"	"r.(?)"	"p.(Ile199Asn)"	"6"
"0001019580"	"00000905"	"70"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019581"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019582"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019583"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019584"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019585"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019586"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019587"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019588"	"00000905"	"70"	"598"	"0"	"598"	"0"	"c.598C>A"	"r.(?)"	"p.(Arg200Ser)"	"6"
"0001019589"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0001019590"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019591"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019592"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019593"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019594"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019595"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019596"	"00000905"	"90"	"647"	"0"	"647"	"0"	"c.647T>C"	"r.(?)"	"p.(Leu216Pro)"	"6"
"0001019597"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019598"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019599"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019600"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0001019601"	"00000905"	"90"	"185"	"-1"	"522"	"1"	"c.(184+1_185-1)_(522+1_523-1)del"	"r.(185_522del)"	"p.(Glu62fs)"	"3i_5i"
"0001019602"	"00000905"	"90"	"53"	"-1"	"184"	"1"	"c.(52+1_53-1)_(184+1_185-1)del"	"r.(53_184del)"	"p.(Ala18Pro61del)"	"1i_3i"
"0001019603"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0001019604"	"00000905"	"90"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	""
"0001019605"	"00000905"	"90"	"242"	"0"	"242"	"0"	"c.242T>A"	"r.(?)"	"p.(Ile81Asn)"	""
"0001019606"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001019608"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	""
"0001019609"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266del"	"r.(266del)"	"p.(Tyr89LeufsTer37)"	""
"0001019610"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019612"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194Hisfs*70)"	"6"
"0001019613"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019614"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019615"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019616"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019620"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001019621"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001019622"	"00000905"	"90"	"489"	"0"	"489"	"0"	"c.489G>A"	"r.(?)"	"p.(Trp163*)"	"5"
"0001019623"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001019624"	"00000905"	"90"	"644"	"0"	"644"	"0"	"c.644A>T"	"r.(?)"	"p.(Glu215Val)"	""
"0001019631"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>C"	"r.spl"	"p.?"	""
"0001019632"	"00000905"	"90"	"53"	"-859"	"78"	"276"	"c.53-859_78+276del"	"r.(53_78del)"	"p.(Ala18Glyfs*2)"	"1i_2i"
"0001019655"	"00000905"	"90"	"53"	"-1"	"53"	"-1"	"c.53-1G>A"	"r.spl"	"p.?"	""
"0001019657"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.(Met1?)"	"1"
"0001019658"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.(Met1?)"	"1"
"0001019659"	"00000905"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.(Met1?)"	"1"
"0001019660"	"00000905"	"90"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019661"	"00000905"	"90"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Leu12His)"	"1"
"0001019662"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0001019663"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0001019664"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0001019665"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>A"	"r.spl"	"p.?"	"1i"
"0001019666"	"00000905"	"90"	"52"	"1"	"52"	"1"	"c.52+1G>T"	"r.spl"	"p.?"	"1i"
"0001019667"	"00000905"	"90"	"53"	"-34"	"53"	"-34"	"c.53-34A>G"	"r.(53_78del)"	"p.(Ala18fs)"	"1i"
"0001019668"	"00000905"	"90"	"53"	"-34"	"53"	"-34"	"c.53-34A>G"	"r.(53_78del)"	"p.(Ala18fs)"	"1i"
"0001019669"	"00000905"	"90"	"68"	"0"	"68"	"0"	"c.68C>A"	"r.(?)"	"p.(Ser23Ter)"	"2"
"0001019670"	"00000905"	"50"	"78"	"5"	"78"	"5"	"c.78+5G>A"	"r.spl?"	"p.?"	"2i"
"0001019671"	"00000905"	"90"	"96"	"0"	"96"	"0"	"c.96dup"	"r.(?)"	"p.(Trp33LeufsTer53)"	"3"
"0001019672"	"00000905"	"90"	"96"	"0"	"96"	"0"	"c.96dup"	"r.(?)"	"p.(Trp33LeufsTer53)"	"3"
"0001019673"	"00000905"	"90"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33GlyfsTer93)"	"3"
"0001019674"	"00000905"	"90"	"99"	"0"	"99"	"0"	"c.99G>A"	"r.(?)"	"p.(Trp33Ter)"	"3"
"0001019675"	"00000905"	"90"	"99"	"0"	"99"	"0"	"c.99G>A"	"r.(?)"	"p.(Trp33Ter)"	"3"
"0001019676"	"00000905"	"90"	"103"	"0"	"103"	"0"	"c.103C>T"	"r.(?)"	"p.(Gln35Ter)"	"3"
"0001019677"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40Ter)"	"3"
"0001019678"	"00000905"	"90"	"120"	"0"	"120"	"0"	"c.120C>A"	"r.(?)"	"p.(Cys40Ter)"	"3"
"0001019679"	"00000905"	"90"	"163"	"0"	"163"	"0"	"c.163del"	"r.(?)"	"p.(Thr55ProfsTer71)"	"3"
"0001019680"	"00000905"	"70"	"176"	"0"	"176"	"0"	"c.176G>A"	"r.(?)"	"p.(Cys59Tyr)"	"3"
"0001019681"	"00000905"	"70"	"176"	"0"	"176"	"0"	"c.176G>A"	"r.(?)"	"p.(Cys59Tyr)"	"3"
"0001019682"	"00000905"	"70"	"176"	"0"	"176"	"0"	"c.176G>C"	"r.(?)"	"p.(Cys59Ser)"	"3"
"0001019683"	"00000905"	"90"	"184"	"1"	"184"	"1"	"c.184+1G>C"	"r.spl"	"p.?"	"3i"
"0001019684"	"00000905"	"90"	"185"	"0"	"186"	"0"	"c.185_186insT"	"r.(?)"	"p.(Glu62AspfsTer24)"	"4"
"0001019685"	"00000905"	"70"	"187"	"0"	"187"	"0"	"c.187T>C"	"r.(?)"	"p.(Cys63Arg)"	"4"
"0001019686"	"00000905"	"50"	"188"	"0"	"188"	"0"	"c.188G>T"	"r.(?)"	"p.(Cys63Phe)"	"4"
"0001019687"	"00000905"	"50"	"203"	"0"	"203"	"0"	"c.203C>G"	"r.(?)"	"p.(Pro68Arg)"	"4"
"0001019688"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019689"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019690"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019691"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019692"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019693"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019694"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019695"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019696"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019697"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019698"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019699"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019700"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019701"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019702"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019703"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019704"	"00000905"	"90"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Gly70Ser)"	"4"
"0001019705"	"00000905"	"90"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0001019706"	"00000905"	"90"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0001019707"	"00000905"	"90"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0001019708"	"00000905"	"90"	"209"	"0"	"209"	"0"	"c.209G>A"	"r.(?)"	"p.(Gly70Asp)"	"4"
"0001019709"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019710"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019711"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019712"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019713"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019714"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019715"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019716"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019717"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019718"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019719"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019720"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019721"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019722"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019723"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019724"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019725"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019726"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019727"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019728"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019729"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019730"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019731"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019732"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019733"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019734"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019735"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019736"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019737"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019738"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019739"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	"4"
"0001019740"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0001019741"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>C"	"r.(?)"	"p.(Glu72Gln)"	"4"
"0001019742"	"00000905"	"70"	"216"	"0"	"216"	"0"	"c.216G>C"	"r.(?)"	"p.(Glu72Asp)"	"4"
"0001019743"	"00000905"	"90"	"219"	"0"	"219"	"0"	"c.219del"	"r.(?)"	"p.(Glu75ArgfsTer51)"	"4"
"0001019744"	"00000905"	"90"	"219"	"0"	"219"	"0"	"c.219del"	"r.(?)"	"p.(Glu75ArgfsTer51)"	"4"
"0001019745"	"00000905"	"90"	"219"	"0"	"219"	"0"	"c.219del"	"r.(?)"	"p.(Glu75ArgfsTer51)"	"4"
"0001019746"	"00000905"	"90"	"221"	"0"	"237"	"0"	"c.221_237delinsTCCCCTGACCGGGTTAGAGT"	"r.(?)"	"p.(Gly74delinsValProTer)"	"4"
"0001019747"	"00000905"	"50"	"227"	"0"	"227"	"0"	"c.227T>A"	"r.(?)"	"p.(Val76Asp)"	"4"
"0001019748"	"00000905"	"50"	"247"	"0"	"247"	"0"	"c.247T>C"	"r.(?)"	"p.(Cys83Arg)"	"4"
"0001019749"	"00000905"	"70"	"253"	"0"	"255"	"0"	"c.253_255del"	"r.(?)"	"p.(Asn85del)"	"4"
"0001019750"	"00000905"	"70"	"253"	"0"	"255"	"0"	"c.253_255del"	"r.(?)"	"p.(Asn85del)"	"4"
"0001019751"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0001019752"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0001019753"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0001019754"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0001019755"	"00000905"	"90"	"266"	"0"	"266"	"0"	"c.266A>G"	"r.(?)"	"p.(Tyr89Cys)"	"4"
"0001019756"	"00000905"	"70"	"272"	"0"	"272"	"0"	"c.272G>T"	"r.(?)"	"p.(Gly91Val)"	"4"
"0001019757"	"00000905"	"90"	"275"	"0"	"275"	"0"	"c.275G>A"	"r.(?)"	"p.(Trp92Ter)"	"4"
"0001019758"	"00000905"	"90"	"275"	"0"	"275"	"0"	"c.275G>A"	"r.(?)"	"p.(Trp92Ter)"	"4"
"0001019759"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019760"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019761"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019762"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019763"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019764"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019765"	"00000905"	"90"	"276"	"0"	"276"	"0"	"c.276G>C"	"r.(?)"	"p.(Trp92Cys)"	"4"
"0001019766"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019767"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019768"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019769"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019770"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019771"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019772"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019773"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019774"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019775"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019776"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019777"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019778"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019779"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019780"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019781"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019782"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019783"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019784"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019785"	"00000905"	"90"	"286"	"0"	"286"	"0"	"c.286T>C"	"r.(?)"	"p.(Trp96Arg)"	"4"
"0001019786"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96Ter)"	"4"
"0001019787"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>C"	"r.(?)"	"p.(Trp96Cys)"	"4"
"0001019788"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019789"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019790"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019791"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019792"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019793"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019794"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019795"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019796"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019797"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019798"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019799"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019800"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019801"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019802"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	"4"
"0001019803"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019804"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019805"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019806"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019807"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019808"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019809"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019810"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019811"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019812"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019813"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019814"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019815"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019816"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019817"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	"4"
"0001019818"	"00000905"	"70"	"306"	"0"	"307"	"0"	"c.306_307insGCT"	"r.(?)"	"p.(Arg102_Leu103insAla)"	"4"
"0001019819"	"00000905"	"70"	"307"	"0"	"308"	"0"	"c.307_308delinsAA"	"r.(?)"	"p.(Leu103Asn)"	"4"
"0001019820"	"00000905"	"90"	"319"	"0"	"320"	"0"	"c.319_320insA"	"r.(?)"	"p.(Gly107GlufsTer14)"	"4"
"0001019821"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019822"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019823"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019824"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>C"	"r.(?)"	"p.(Gly109Arg)"	"4"
"0001019825"	"00000905"	"90"	"325"	"0"	"326"	"21"	"c.325_326+21del"	"r.spl"	"p.?"	"4_4i"
"0001019826"	"00000905"	"70"	"325"	"0"	"325"	"0"	"c.325G>T"	"r.(?)"	"p.(Gly109Trp)"	"4"
"0001019827"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl"	"p.?"	"4i"
"0001019828"	"00000905"	"90"	"326"	"1"	"326"	"1"	"c.326+1G>A"	"r.spl"	"p.?"	"4i"
"0001019829"	"00000905"	"50"	"327"	"-6"	"327"	"-6"	"c.327-6C>A"	"r.spl?"	"p.?"	"4i"
"0001019830"	"00000905"	"50"	"328"	"0"	"328"	"0"	"c.328T>C"	"r.(?)"	"p.(Cys110Arg)"	"5"
"0001019831"	"00000905"	"70"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Cys110Tyr)"	"5"
"0001019832"	"00000905"	"10"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(?)"	"p.(Cys110=)"	"5"
"0001019833"	"00000905"	"10"	"330"	"0"	"330"	"0"	"c.330T>C"	"r.(?)"	"p.(Cys110=)"	"5"
"0001019834"	"00000905"	"70"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Leu113Phe)"	"5"
"0001019835"	"00000905"	"90"	"354"	"0"	"354"	"0"	"c.354delCinsGGTGTGCCTGGCTCTCCA"	"r.(?)"	"p.(Asp118GlufsTer14)"	"5"
"0001019836"	"00000905"	"90"	"354"	"0"	"354"	"0"	"c.354delCinsGGTGTGCCTGGCTCTCCA"	"r.(?)"	"p.(Asp118GlufsTer14)"	"5"
"0001019837"	"00000905"	"90"	"354"	"0"	"354"	"0"	"c.354delCinsGGTGTGCCTGGCTCTCCA"	"r.(?)"	"p.(Asp118GlufsTer14)"	"5"
"0001019838"	"00000905"	"70"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0001019839"	"00000905"	"70"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0001019840"	"00000905"	"70"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0001019841"	"00000905"	"70"	"380"	"0"	"380"	"0"	"c.380T>C"	"r.(?)"	"p.(Leu127Pro)"	"5"
"0001019842"	"00000905"	"90"	"390"	"0"	"390"	"0"	"c.390del"	"r.(?)"	"p.(Val132Ter)"	"5"
"0001019843"	"00000905"	"90"	"390"	"0"	"390"	"0"	"c.390del"	"r.(?)"	"p.(Val132Ter)"	"5"
"0001019844"	"00000905"	"50"	"407"	"0"	"407"	"0"	"c.407T>C"	"r.(?)"	"p.(Ile136Thr)"	"5"
"0001019845"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139ArgfsTer10)"	"5"
"0001019846"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139ArgfsTer10)"	"5"
"0001019847"	"00000905"	"90"	"416"	"0"	"416"	"0"	"c.416del"	"r.(?)"	"p.(Gln139ArgfsTer10)"	"5"
"0001019848"	"00000905"	"90"	"418"	"0"	"418"	"0"	"c.418G>A"	"r.(?)"	"p.(Gly140Arg)"	"5"
"0001019849"	"00000905"	"90"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	"5"
"0001019850"	"00000905"	"90"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	"5"
"0001019851"	"00000905"	"90"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Gly140Glu)"	"5"
"0001019852"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019853"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019854"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019855"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019856"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	"5"
"0001019857"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019858"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019859"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019860"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019861"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019862"	"00000905"	"70"	"422"	"0"	"422"	"0"	"c.422G>A"	"r.(?)"	"p.(Arg141His)"	"5"
"0001019863"	"00000905"	"70"	"424"	"0"	"424"	"0"	"c.424T>C"	"r.(?)"	"p.(Cys142Arg)"	"5"
"0001019864"	"00000905"	"70"	"424"	"0"	"424"	"0"	"c.424T>C"	"r.(?)"	"p.(Cys142Arg)"	"5"
"0001019865"	"00000905"	"70"	"436"	"0"	"436"	"0"	"c.436G>A"	"r.(?)"	"p.(Glu146Lys)"	"5"
"0001019866"	"00000905"	"90"	"437"	"0"	"437"	"0"	"c.437del"	"r.(?)"	"p.(Glu146GlyfsTer3)"	"5"
"0001019867"	"00000905"	"90"	"437"	"0"	"437"	"0"	"c.437del"	"r.(?)"	"p.(Glu146GlyfsTer3)"	"5"
"0001019868"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	"5"
"0001019869"	"00000905"	"50"	"452"	"0"	"452"	"0"	"c.452A>C"	"r.(?)"	"p.(Tyr151Ser)"	"5"
"0001019870"	"00000905"	"90"	"456"	"0"	"456"	"0"	"c.456del"	"r.(?)"	"p.(Ser152ArgfsTer10)"	"5"
"0001019871"	"00000905"	"70"	"461"	"0"	"461"	"0"	"c.461A>G"	"r.(?)"	"p.(Gln154Arg)"	"5"
"0001019872"	"00000905"	"50"	"464"	"0"	"464"	"0"	"c.464A>G"	"r.(?)"	"p.(Tyr155Cys)"	"5"
"0001019873"	"00000905"	"90"	"479"	"0"	"480"	"0"	"c.479_480del"	"r.(?)"	"p.(Arg160ProfsTer103)"	"5"
"0001019874"	"00000905"	"90"	"498"	"0"	"498"	"0"	"c.498C>A"	"r.(?)"	"p.(Tyr166Ter)"	"5"
"0001019875"	"00000905"	"90"	"498"	"0"	"498"	"0"	"c.498C>A"	"r.(?)"	"p.(Tyr166Ter)"	"5"
"0001019876"	"00000905"	"90"	"498"	"0"	"498"	"0"	"c.498C>A"	"r.(?)"	"p.(Tyr166Ter)"	"5"
"0001019877"	"00000905"	"50"	"511"	"0"	"511"	"0"	"c.511G>A"	"r.(?)"	"p.(Gly171Arg)"	"5"
"0001019878"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019879"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019880"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019881"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019882"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019883"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019884"	"00000905"	"90"	"520"	"0"	"520"	"0"	"c.520del"	"r.(?)"	"p.(Arg174GlyfsTer63)"	"5"
"0001019885"	"00000905"	"90"	"522"	"1"	"522"	"1"	"c.522+1G>A"	"r.spl"	"p.?"	"5i"
"0001019886"	"00000905"	"50"	"522"	"2"	"522"	"2"	"c.522+2dup"	"r.spl?"	"p.?"	"5i"
"0001019887"	"00000905"	"90"	"523"	"-1"	"523"	"-1"	"c.523-1G>C"	"r.spl"	"p.?"	"5i"
"0001019888"	"00000905"	"70"	"535"	"0"	"535"	"0"	"c.535A>G"	"r.(?)"	"p.(Asn179Asp)"	"6"
"0001019889"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019890"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019891"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019892"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019893"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019894"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019895"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019896"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019897"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019898"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Pro192Ser)"	"6"
"0001019899"	"00000905"	"70"	"575"	"0"	"575"	"0"	"c.575C>A"	"r.(?)"	"p.(Pro192His)"	"6"
"0001019900"	"00000905"	"70"	"577"	"0"	"577"	"0"	"c.577C>T"	"r.(?)"	"p.(Pro193Ser)"	"6"
"0001019901"	"00000905"	"70"	"578"	"0"	"578"	"0"	"c.578C>T"	"r.(?)"	"p.(Pro193Leu)"	"6"
"0001019902"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019903"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019904"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(?)"	"p.(Ile194HisfsTer70)"	"6"
"0001019905"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019906"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019907"	"00000905"	"90"	"589"	"0"	"589"	"0"	"c.589C>T"	"r.(?)"	"p.(Arg197Cys)"	"6"
"0001019908"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019909"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019910"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019911"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	"6"
"0001019912"	"00000905"	"70"	"593"	"0"	"594"	"0"	"c.593_594insTCATCCGCC"	"r.(?)"	"p.(Phe198_Ile199insHisProPro)"	"6"
"0001019913"	"00000905"	"90"	"593"	"0"	"594"	"0"	"c.593_594insTCATCCGCCTCATCCCGCT"	"r.(?)"	"p.(Ile199HisfsTer71)"	"6"
"0001019914"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019915"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019916"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019917"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019918"	"00000905"	"90"	"596"	"0"	"596"	"0"	"c.596T>C"	"r.(?)"	"p.(Ile199Thr)"	"6"
"0001019919"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019920"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019921"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019922"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019923"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019924"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019925"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019926"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019927"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019928"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019929"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019930"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019931"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019932"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"r.(?)"	"p.(Arg200Cys)"	"6"
"0001019933"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0001019934"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0001019935"	"00000905"	"90"	"599"	"0"	"599"	"0"	"c.599G>A"	"r.(?)"	"p.(Arg200His)"	"6"
"0001019936"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019937"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019938"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019939"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019940"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019941"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019942"	"00000905"	"90"	"608"	"0"	"608"	"0"	"c.608C>T"	"r.(?)"	"p.(Pro203Leu)"	"6"
"0001019943"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019944"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	"6"
"0001019945"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0001019946"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0001019947"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0001019948"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	"6"
"0001019949"	"00000905"	"70"	"626"	"0"	"626"	"0"	"c.626G>C"	"r.(?)"	"p.(Arg209Pro)"	"6"
"0001019950"	"00000905"	"90"	"628"	"0"	"628"	"0"	"c.628del"	"r.(?)"	"p.(Ile210LeufsTer27)"	"6"
"0001019951"	"00000905"	"70"	"631"	"0"	"632"	"0"	"c.631_632delinsTT"	"r.(?)"	"p.(Ala211Phe)"	"6"
"0001019952"	"00000905"	"70"	"631"	"0"	"631"	"0"	"c.631G>A"	"r.(?)"	"p.(Ala211Thr)"	"6"
"0001019953"	"00000905"	"70"	"632"	"0"	"632"	"0"	"c.632C>T"	"r.(?)"	"p.(Ala211Val)"	"6"
"0001019954"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019955"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019956"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019957"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019958"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	"6"
"0001019959"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019960"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019961"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	"6"
"0001019962"	"00000905"	"90"	"639"	"0"	"639"	"0"	"c.639del"	"r.(?)"	"p.(Met214TrpfsTer23)"	"6"
"0001019963"	"00000905"	"90"	"639"	"0"	"639"	"0"	"c.639del"	"r.(?)"	"p.(Met214TrpfsTer23)"	"6"
"0001019964"	"00000905"	"70"	"655"	"0"	"655"	"0"	"c.655T>C"	"r.(?)"	"p.(Cys219Arg)"	"6"
"0001019965"	"00000905"	"50"	"657"	"0"	"657"	"0"	"c.657C>G"	"r.(?)"	"p.(Cys219Trp)"	"6"
"0001019966"	"00000905"	"70"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Cys223Arg)"	"6"
"0001019967"	"00000905"	"70"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	"6"
"0001019968"	"00000905"	"70"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	"6"
"0001019969"	"00000905"	"70"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Cys223Tyr)"	"6"
"0001019970"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019971"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019972"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019973"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019974"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019975"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019976"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019977"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019978"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019979"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019980"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019981"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019982"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019983"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019984"	"00000905"	"90"	"53"	"-1"	"78"	"1"	"c.(52+1_53-1)_(78+1_79-1)del"	"r.(53_78del)"	"p.?"	"1i_2i"
"0001019985"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.?"	"_1_1i"
"0001019986"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.?"	"_1_1i"
"0001019987"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.?"	"_1_1i"
"0001019988"	"00000905"	"90"	"-35"	"0"	"52"	"1"	"c.(?_-35)_(52+1_53-1)del"	"r.0?"	"p.?"	"_1_1i"
"0001019989"	"00000905"	"90"	"185"	"-1"	"522"	"1"	"c.(184+1_185-1)_(522+1_523-1)del"	"r.(185_522del)"	"p.?"	"3i_5i"
"0001019990"	"00000905"	"90"	"-35"	"0"	"326"	"1"	"c.(?_-35)_(326+1_327-1)del"	"r.0?"	"p.?"	"_1_4i"
"0001019991"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.spl?"	"p.?"	"1i"
"0001019992"	"00000905"	"50"	"52"	"5"	"52"	"5"	"c.52+5G>C"	"r.spl?"	"p.?"	"1i"
"0001019993"	"00000905"	"90"	"458"	"0"	"458"	"0"	"c.458T>G"	"r.(?)"	"p.(Val153Gly)"	""
"0001019996"	"00000905"	"90"	"559"	"0"	"559"	"0"	"c.559C>T"	"r.(?)"	"p.(Gln187*)"	""
"0001020004"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020005"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020006"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020007"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020008"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020009"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020010"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020011"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020012"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020013"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020014"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020015"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020016"	"00000905"	"90"	"441"	"0"	"441"	"0"	"c.441G>A"	"r.(?)"	"p.(Trp147Ter)"	""
"0001020017"	"00000905"	"90"	"35"	"0"	"35"	"0"	"c.35T>A"	"-"	"p.Leu12His"	""
"0001020018"	"00000905"	"90"	"38"	"0"	"38"	"0"	"c.38T>C"	"-"	"p.Leu13Pro"	""
"0001020019"	"00000905"	"30"	"37"	"0"	"37"	"0"	"c.37C>T"	"-"	"p.Leu13Phe"	""
"0001020020"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"-"	"p.Glu72Lys"	""
"0001020021"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"-"	"p.Arg102Trp"	""
"0001020022"	"00000905"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"-"	"p.Pro192Ser"	""
"0001020023"	"00000905"	"90"	"535"	"0"	"535"	"0"	"c.535A>G"	"-"	"p.Asn179Asp"	""
"0001020024"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"-"	"p.Arg213Trp"	""
"0001020025"	"00000905"	"90"	"598"	"0"	"598"	"0"	"c.598C>T"	"-"	"p.Arg200Cys"	""
"0001020026"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>C"	"-"	"p.Trp96Cys"	""
"0001020030"	"00000905"	"70"	"577"	"0"	"577"	"0"	"c.577C>A"	"r.(?)"	"p.(Pro193Thr)"	""
"0001020031"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001020032"	"00000905"	"90"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Arg102Trp)"	""
"0001020033"	"00000905"	"90"	"625"	"0"	"625"	"0"	"c.625C>T"	"r.(?)"	"p.(Arg209Cys)"	""
"0001020034"	"00000905"	"70"	"554"	"0"	"554"	"0"	"c.554C>T"	"r.(?)"	"p.(Thr185Met)"	""
"0001020035"	"00000905"	"90"	"638"	"0"	"638"	"0"	"c.638G>A"	"r.(?)"	"p.(Arg213Gln)"	""
"0001020036"	"00000905"	"90"	"325"	"0"	"325"	"0"	"c.325G>A"	"r.(?)"	"p.(Gly109Arg)"	""
"0001020037"	"00000905"	"90"	"336"	"0"	"336"	"0"	"c.336G>T"	"r.(?)"	"p.(Trp112Cys)"	""
"0001020038"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001020039"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001020040"	"00000905"	"70"	"416"	"0"	"416"	"0"	"c.416A>G"	"r.(?)"	"p.(Gln139Arg)"	""
"0001020041"	"00000905"	"90"	"590"	"0"	"590"	"0"	"c.590G>A"	"r.(?)"	"p.(Arg197His)"	""
"0001020042"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0001020043"	"00000905"	"90"	"544"	"0"	"544"	"0"	"c.544C>T"	"r.(?)"	"p.(Arg182Cys)"	""
"0001020044"	"00000905"	"90"	"575"	"0"	"575"	"0"	"c.575C>T"	"r.(?)"	"p.(Pro192Leu)"	""
"0001020045"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>A"	"r.(?)"	"p.(Arg209His)"	""
"0001020046"	"00000905"	"70"	"656"	"0"	"656"	"0"	"c.656G>A"	"r.(?)"	"p.(Cys219Tyr)"	""
"0001020047"	"00000905"	"90"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Cys)"	""
"0001020048"	"00000905"	"90"	"626"	"0"	"626"	"0"	"c.626G>T"	"r.(?)"	"p.(Arg209Leu)"	""
"0001020049"	"00000905"	"90"	"312"	"0"	"312"	"0"	"c.312C>G"	"r.(?)"	"p.(Asn104Lys)"	""
"0001020050"	"00000905"	"90"	"78"	"5"	"78"	"5"	"c.78+5G>T"	"r.spl"	"p.?"	""
"0001020051"	"00000905"	"90"	"52"	"2"	"52"	"2"	"c.52+2T>A"	"r.spl"	"p.?"	""
"0001020052"	"00000905"	"90"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33GlyfsTer93)"	""
"0001020053"	"00000905"	"90"	"97"	"0"	"97"	"0"	"c.97del"	"r.(?)"	"p.(Trp33GlyfsTer93)"	""
"0001020054"	"00000905"	"90"	"573"	"0"	"573"	"0"	"c.573del"	"r.(?)"	"p.(Ile194SerfsTer43)"	""
"0001020055"	"00000905"	"90"	"573"	"0"	"573"	"0"	"c.573del"	"r.(?)"	"p.(Ile194SerfsTer43)"	""
"0001020056"	"00000905"	"70"	"14"	"0"	"14"	"0"	"c.14del"	"r.(?)"	"p.(Ile5LysfsTer121)"	""
"0001020057"	"00000905"	"70"	"577"	"0"	"579"	"0"	"c.577_579del"	"r.(?)"	"p.(Pro193del)"	""
"0001020058"	"00000905"	"90"	"-35"	"0"	"184"	"1"	"c.(?_-35)_(184+1_185-1)del"	"r.0?"	"p.0?"	"_1_3i"
"0001020059"	"00000905"	"90"	""	"0"	""	"0"	"c.(184+1_185-1)_(*2316_?)del"	"r.?"	"p.?"	"3i_6_"
"0001020065"	"00000905"	"90"	"305"	"0"	"305"	"0"	"c.305G>A"	"r.(?)"	"p.(Arg102Gln)"	""
"0001020067"	"00000905"	"90"	"267"	"0"	"267"	"0"	"c.267T>A"	"r.(?)"	"p.(Tyr89*)"	""
"0001020141"	"00000905"	"50"	"52"	"1"	"52"	"1"	"c.52+1G>T"	"r.spl"	"p.?"	"1i"
"0001020301"	"00000905"	"90"	"579"	"0"	"579"	"0"	"c.579dup"	"r.(579dup)"	"p.(Ile194Hisfs*70)"	""
"0001022267"	"00000905"	"90"	"616"	"0"	"616"	"0"	"c.616T>G"	"r.(?)"	"p.(Trp206Gly)"	""
"0001022273"	"00000905"	"90"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Arg213Trp)"	""
"0001022282"	"00000905"	"90"	"214"	"0"	"214"	"0"	"c.214G>A"	"r.(?)"	"p.(Glu72Lys)"	""
"0001022317"	"00000905"	"70"	"302"	"0"	"302"	"0"	"c.302C>T"	"r.(?)"	"p.(Ala101Val)"	""
"0001027472"	"00000905"	"90"	"288"	"0"	"288"	"0"	"c.288G>A"	"r.(?)"	"p.(Trp96*)"	""
"0001044243"	"00000905"	"30"	"135515"	"0"	"135515"	"0"	"c.*134840T>C"	"r.(=)"	"p.(=)"	""
"0001044244"	"00000905"	"30"	"83321"	"0"	"83321"	"0"	"c.*82646C>T"	"r.(=)"	"p.(=)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 2226
"{{screeningid}}"	"{{variantid}}"
"0000000047"	"0000000301"
"0000000058"	"0000000302"
"0000000085"	"0000000303"
"0000000102"	"0000830156"
"0000000102"	"0000830418"
"0000000102"	"0000830455"
"0000000209"	"0000006452"
"0000000210"	"0000008502"
"0000000210"	"0000014411"
"0000003931"	"0000141211"
"0000004302"	"0000141048"
"0000009835"	"0000140771"
"0000009836"	"0000140849"
"0000009837"	"0000140875"
"0000009838"	"0000140876"
"0000009847"	"0000141031"
"0000009848"	"0000141032"
"0000009849"	"0000141075"
"0000009850"	"0000141095"
"0000009851"	"0000140798"
"0000009854"	"0000141137"
"0000009855"	"0000141141"
"0000009863"	"0000141263"
"0000009869"	"0000141331"
"0000009874"	"0000141368"
"0000009875"	"0000141369"
"0000009876"	"0000141387"
"0000087396"	"0000140851"
"0000087396"	"0000140857"
"0000087396"	"0000140859"
"0000087396"	"0000140960"
"0000087396"	"0000140968"
"0000087396"	"0000140971"
"0000087396"	"0000140972"
"0000087396"	"0000140980"
"0000087396"	"0000140983"
"0000087396"	"0000140986"
"0000087396"	"0000140997"
"0000087396"	"0000140999"
"0000087396"	"0000141105"
"0000087396"	"0000141113"
"0000087396"	"0000141117"
"0000087396"	"0000141119"
"0000087396"	"0000141121"
"0000087396"	"0000141126"
"0000087396"	"0000141132"
"0000087396"	"0000141138"
"0000087396"	"0000141142"
"0000087396"	"0000141162"
"0000087396"	"0000141173"
"0000087396"	"0000141176"
"0000087396"	"0000141179"
"0000087396"	"0000141183"
"0000087396"	"0000141193"
"0000087396"	"0000141198"
"0000087396"	"0000141227"
"0000087396"	"0000141245"
"0000087396"	"0000141404"
"0000087397"	"0000140824"
"0000087398"	"0000140825"
"0000087399"	"0000140834"
"0000087400"	"0000140835"
"0000087401"	"0000140836"
"0000087402"	"0000140837"
"0000087403"	"0000140838"
"0000087404"	"0000140773"
"0000087405"	"0000140769"
"0000087405"	"0000140770"
"0000087406"	"0000140774"
"0000087407"	"0000140775"
"0000087408"	"0000140776"
"0000087409"	"0000140777"
"0000087410"	"0000140778"
"0000087411"	"0000140779"
"0000087412"	"0000140792"
"0000087413"	"0000140783"
"0000087414"	"0000140772"
"0000087415"	"0000140987"
"0000087416"	"0000140988"
"0000087417"	"0000140989"
"0000087418"	"0000140990"
"0000087419"	"0000140991"
"0000087420"	"0000140992"
"0000087421"	"0000140993"
"0000087422"	"0000140994"
"0000087423"	"0000140995"
"0000087424"	"0000141005"
"0000087425"	"0000141006"
"0000087426"	"0000141007"
"0000087427"	"0000141008"
"0000087428"	"0000141009"
"0000087429"	"0000141010"
"0000087430"	"0000141011"
"0000087431"	"0000141012"
"0000087432"	"0000141013"
"0000087433"	"0000141014"
"0000087434"	"0000141015"
"0000087435"	"0000141016"
"0000087436"	"0000141017"
"0000087437"	"0000141018"
"0000087438"	"0000141019"
"0000087439"	"0000141020"
"0000087440"	"0000141021"
"0000087441"	"0000141022"
"0000087442"	"0000141023"
"0000087443"	"0000141024"
"0000087444"	"0000141025"
"0000087445"	"0000141026"
"0000087446"	"0000141027"
"0000087447"	"0000141059"
"0000087448"	"0000141065"
"0000087449"	"0000141066"
"0000087450"	"0000141067"
"0000087451"	"0000141068"
"0000087452"	"0000141069"
"0000087453"	"0000141070"
"0000087454"	"0000141071"
"0000087455"	"0000141072"
"0000087456"	"0000141073"
"0000087457"	"0000141074"
"0000087458"	"0000141228"
"0000087459"	"0000141229"
"0000087460"	"0000141230"
"0000087461"	"0000141231"
"0000087462"	"0000141232"
"0000087463"	"0000141233"
"0000087464"	"0000141234"
"0000087465"	"0000141235"
"0000087466"	"0000141236"
"0000087467"	"0000141237"
"0000087468"	"0000141238"
"0000087469"	"0000141239"
"0000087470"	"0000141255"
"0000087471"	"0000141256"
"0000087472"	"0000141257"
"0000087473"	"0000141258"
"0000087474"	"0000141259"
"0000087475"	"0000141260"
"0000087476"	"0000141261"
"0000087477"	"0000141348"
"0000087478"	"0000141349"
"0000087479"	"0000141350"
"0000087480"	"0000141351"
"0000087481"	"0000140795"
"0000087482"	"0000140800"
"0000087483"	"0000140801"
"0000087484"	"0000140802"
"0000087485"	"0000140803"
"0000087486"	"0000140805"
"0000087487"	"0000140796"
"0000087487"	"0000140810"
"0000087488"	"0000140812"
"0000087489"	"0000140813"
"0000087490"	"0000140817"
"0000087491"	"0000140818"
"0000087492"	"0000140826"
"0000087493"	"0000140827"
"0000087494"	"0000140828"
"0000087495"	"0000140829"
"0000087496"	"0000140830"
"0000087497"	"0000140831"
"0000087498"	"0000140846"
"0000087499"	"0000140847"
"0000087500"	"0000140848"
"0000087501"	"0000140860"
"0000087502"	"0000140865"
"0000087503"	"0000140866"
"0000087504"	"0000140867"
"0000087505"	"0000140868"
"0000087506"	"0000140869"
"0000087507"	"0000140870"
"0000087508"	"0000140871"
"0000087509"	"0000140872"
"0000087510"	"0000140873"
"0000087511"	"0000140874"
"0000087512"	"0000140878"
"0000087513"	"0000140879"
"0000087514"	"0000140880"
"0000087515"	"0000140881"
"0000087516"	"0000140882"
"0000087517"	"0000140883"
"0000087518"	"0000140884"
"0000087519"	"0000140885"
"0000087520"	"0000140886"
"0000087521"	"0000140887"
"0000087522"	"0000140888"
"0000087523"	"0000140889"
"0000087524"	"0000140890"
"0000087525"	"0000140891"
"0000087526"	"0000140892"
"0000087527"	"0000140893"
"0000087528"	"0000140894"
"0000087529"	"0000140895"
"0000087530"	"0000140896"
"0000087531"	"0000140897"
"0000087532"	"0000140898"
"0000087533"	"0000140899"
"0000087534"	"0000140900"
"0000087535"	"0000140901"
"0000087536"	"0000140902"
"0000087537"	"0000140903"
"0000087538"	"0000140904"
"0000087539"	"0000140905"
"0000087540"	"0000140906"
"0000087541"	"0000140907"
"0000087542"	"0000140908"
"0000087543"	"0000140909"
"0000087544"	"0000140910"
"0000087545"	"0000140911"
"0000087546"	"0000140912"
"0000087547"	"0000140913"
"0000087548"	"0000140914"
"0000087549"	"0000140915"
"0000087550"	"0000140916"
"0000087551"	"0000140917"
"0000087552"	"0000140918"
"0000087553"	"0000140919"
"0000087554"	"0000140920"
"0000087555"	"0000140921"
"0000087556"	"0000140922"
"0000087557"	"0000140923"
"0000087558"	"0000140924"
"0000087559"	"0000140925"
"0000087560"	"0000140950"
"0000087561"	"0000140951"
"0000087562"	"0000140955"
"0000087563"	"0000140956"
"0000087564"	"0000140957"
"0000087565"	"0000140961"
"0000087566"	"0000140962"
"0000087567"	"0000140963"
"0000087568"	"0000140964"
"0000087569"	"0000140973"
"0000087570"	"0000140974"
"0000087571"	"0000140981"
"0000087572"	"0000141034"
"0000087573"	"0000141035"
"0000087574"	"0000141036"
"0000087575"	"0000141037"
"0000087576"	"0000141038"
"0000087577"	"0000141039"
"0000087578"	"0000141040"
"0000087579"	"0000141041"
"0000087580"	"0000141042"
"0000087581"	"0000141043"
"0000087582"	"0000141056"
"0000087583"	"0000141057"
"0000087584"	"0000141080"
"0000087585"	"0000141081"
"0000087586"	"0000141082"
"0000087587"	"0000141085"
"0000087588"	"0000141088"
"0000087589"	"0000141089"
"0000087590"	"0000141091"
"0000087591"	"0000141096"
"0000087592"	"0000141097"
"0000087593"	"0000141101"
"0000087594"	"0000141103"
"0000087595"	"0000141108"
"0000087596"	"0000141109"
"0000087597"	"0000141114"
"0000087598"	"0000141116"
"0000087599"	"0000141120"
"0000087600"	"0000141122"
"0000087601"	"0000141127"
"0000087602"	"0000141129"
"0000087603"	"0000141133"
"0000087604"	"0000141134"
"0000087605"	"0000141139"
"0000087606"	"0000141140"
"0000087607"	"0000141143"
"0000087608"	"0000141144"
"0000087609"	"0000141145"
"0000087610"	"0000141146"
"0000087611"	"0000141147"
"0000087612"	"0000141148"
"0000087613"	"0000141149"
"0000087614"	"0000141150"
"0000087615"	"0000141151"
"0000087616"	"0000141152"
"0000087617"	"0000141153"
"0000087618"	"0000141154"
"0000087619"	"0000141163"
"0000087620"	"0000141164"
"0000087621"	"0000141165"
"0000087622"	"0000141169"
"0000087623"	"0000141174"
"0000087624"	"0000141177"
"0000087625"	"0000141178"
"0000087626"	"0000141180"
"0000087627"	"0000141181"
"0000087628"	"0000141182"
"0000087629"	"0000141184"
"0000087630"	"0000141185"
"0000087631"	"0000141194"
"0000087632"	"0000141196"
"0000087633"	"0000141206"
"0000087634"	"0000141208"
"0000087635"	"0000141210"
"0000087636"	"0000141214"
"0000087637"	"0000141215"
"0000087638"	"0000141216"
"0000087639"	"0000141217"
"0000087640"	"0000141246"
"0000087641"	"0000141265"
"0000087642"	"0000141266"
"0000087643"	"0000141267"
"0000087644"	"0000141268"
"0000087645"	"0000141269"
"0000087646"	"0000141281"
"0000087647"	"0000141282"
"0000087648"	"0000141283"
"0000087649"	"0000141284"
"0000087650"	"0000141285"
"0000087651"	"0000141286"
"0000087652"	"0000141289"
"0000087653"	"0000141290"
"0000087654"	"0000141294"
"0000087655"	"0000141295"
"0000087656"	"0000141296"
"0000087657"	"0000141298"
"0000087658"	"0000141299"
"0000087659"	"0000141300"
"0000087660"	"0000141301"
"0000087661"	"0000141302"
"0000087662"	"0000141303"
"0000087663"	"0000141304"
"0000087664"	"0000141305"
"0000087665"	"0000141316"
"0000087666"	"0000141317"
"0000087667"	"0000141318"
"0000087668"	"0000141319"
"0000087669"	"0000141320"
"0000087669"	"0000141403"
"0000087670"	"0000141323"
"0000087671"	"0000141324"
"0000087672"	"0000141325"
"0000087673"	"0000141326"
"0000087674"	"0000141327"
"0000087675"	"0000141328"
"0000087676"	"0000141337"
"0000087677"	"0000141340"
"0000087678"	"0000141342"
"0000087679"	"0000141358"
"0000087680"	"0000141359"
"0000087681"	"0000141360"
"0000087682"	"0000141361"
"0000087683"	"0000141362"
"0000087684"	"0000141363"
"0000087685"	"0000141364"
"0000087686"	"0000141385"
"0000087687"	"0000141386"
"0000087688"	"0000141391"
"0000087689"	"0000141397"
"0000087690"	"0000141395"
"0000087691"	"0000141396"
"0000087692"	"0000141394"
"0000087693"	"0000141399"
"0000087694"	"0000140959"
"0000087695"	"0000140984"
"0000087696"	"0000140985"
"0000087697"	"0000141375"
"0000087698"	"0000141376"
"0000087699"	"0000141078"
"0000087700"	"0000141199"
"0000087701"	"0000141058"
"0000087702"	"0000141222"
"0000087703"	"0000141341"
"0000087704"	"0000141382"
"0000087705"	"0000140844"
"0000087706"	"0000141000"
"0000087707"	"0000141061"
"0000087708"	"0000141062"
"0000087709"	"0000141063"
"0000087710"	"0000141064"
"0000087711"	"0000141076"
"0000087712"	"0000141384"
"0000087713"	"0000141252"
"0000087714"	"0000141253"
"0000087715"	"0000140845"
"0000087716"	"0000140799"
"0000087717"	"0000140862"
"0000087718"	"0000140877"
"0000087719"	"0000140954"
"0000087720"	"0000140970"
"0000087721"	"0000141170"
"0000087722"	"0000141200"
"0000087723"	"0000141207"
"0000087724"	"0000141221"
"0000087725"	"0000141400"
"0000087726"	"0000141401"
"0000087727"	"0000140863"
"0000087728"	"0000141087"
"0000087729"	"0000141293"
"0000087730"	"0000140843"
"0000087731"	"0000140944"
"0000087732"	"0000140945"
"0000087733"	"0000140946"
"0000087734"	"0000141186"
"0000087735"	"0000141202"
"0000087736"	"0000141003"
"0000087737"	"0000141004"
"0000087738"	"0000140806"
"0000087739"	"0000140807"
"0000087740"	"0000141172"
"0000087741"	"0000140948"
"0000087742"	"0000140797"
"0000087743"	"0000141079"
"0000087744"	"0000141060"
"0000087745"	"0000141343"
"0000087746"	"0000140996"
"0000087747"	"0000140842"
"0000087748"	"0000141329"
"0000087749"	"0000141118"
"0000087750"	"0000140815"
"0000087751"	"0000140833"
"0000087752"	"0000141084"
"0000087753"	"0000141209"
"0000087754"	"0000141224"
"0000087755"	"0000141028"
"0000087756"	"0000141044"
"0000087757"	"0000141092"
"0000087758"	"0000141135"
"0000087759"	"0000141306"
"0000087760"	"0000141344"
"0000087761"	"0000141130"
"0000087762"	"0000140832"
"0000087763"	"0000140814"
"0000087764"	"0000140819"
"0000087765"	"0000141086"
"0000087766"	"0000141226"
"0000087767"	"0000141262"
"0000087768"	"0000141307"
"0000087769"	"0000141308"
"0000087770"	"0000140952"
"0000087771"	"0000140975"
"0000087772"	"0000141345"
"0000087773"	"0000141254"
"0000087774"	"0000140780"
"0000087775"	"0000140858"
"0000087776"	"0000141110"
"0000087777"	"0000141098"
"0000087778"	"0000141099"
"0000087779"	"0000141212"
"0000087780"	"0000140926"
"0000087781"	"0000140927"
"0000087782"	"0000141093"
"0000087783"	"0000141045"
"0000087784"	"0000140969"
"0000087785"	"0000140998"
"0000087786"	"0000141205"
"0000087787"	"0000141203"
"0000087788"	"0000141225"
"0000087789"	"0000141357"
"0000087790"	"0000140820"
"0000087791"	"0000141201"
"0000087792"	"0000140839"
"0000087793"	"0000140840"
"0000087794"	"0000140928"
"0000087795"	"0000140958"
"0000087796"	"0000140816"
"0000087797"	"0000141046"
"0000087798"	"0000140821"
"0000087799"	"0000141155"
"0000087800"	"0000140929"
"0000087801"	"0000140966"
"0000087802"	"0000141247"
"0000087803"	"0000141156"
"0000087803"	"0000141240"
"0000087804"	"0000141136"
"0000087805"	"0000140930"
"0000087806"	"0000141166"
"0000087807"	"0000141346"
"0000087808"	"0000141241"
"0000087809"	"0000140931"
"0000087810"	"0000141029"
"0000087811"	"0000141030"
"0000087812"	"0000141242"
"0000087813"	"0000141352"
"0000087814"	"0000140781"
"0000087815"	"0000140808"
"0000087816"	"0000140932"
"0000087817"	"0000141047"
"0000087818"	"0000141049"
"0000087819"	"0000141050"
"0000087820"	"0000141094"
"0000087821"	"0000141100"
"0000087822"	"0000141270"
"0000087823"	"0000141309"
"0000087824"	"0000141330"
"0000087825"	"0000141365"
"0000087826"	"0000141366"
"0000087827"	"0000141377"
"0000087828"	"0000141378"
"0000087829"	"0000141383"
"0000087830"	"0000141077"
"0000087831"	"0000141402"
"0000087832"	"0000140809"
"0000087833"	"0000140953"
"0000087834"	"0000140793"
"0000087835"	"0000140864"
"0000087836"	"0000140794"
"0000087837"	"0000141175"
"0000087838"	"0000141195"
"0000087839"	"0000141197"
"0000087840"	"0000141249"
"0000087840"	"0000141310"
"0000087841"	"0000141278"
"0000087842"	"0000141336"
"0000087843"	"0000140822"
"0000087844"	"0000140823"
"0000087845"	"0000141271"
"0000087846"	"0000141250"
"0000087847"	"0000140933"
"0000087848"	"0000140934"
"0000087849"	"0000140947"
"0000087850"	"0000140965"
"0000087851"	"0000141051"
"0000087852"	"0000141171"
"0000087853"	"0000140852"
"0000087853"	"0000140855"
"0000087853"	"0000141218"
"0000087854"	"0000140853"
"0000087854"	"0000140856"
"0000087854"	"0000141219"
"0000087855"	"0000141287"
"0000087856"	"0000141291"
"0000087857"	"0000141347"
"0000087858"	"0000141367"
"0000087859"	"0000141379"
"0000087860"	"0000141392"
"0000087861"	"0000140935"
"0000087862"	"0000140936"
"0000087863"	"0000140937"
"0000087864"	"0000140938"
"0000087865"	"0000140939"
"0000087866"	"0000140967"
"0000087867"	"0000140976"
"0000087868"	"0000140977"
"0000087869"	"0000141125"
"0000087870"	"0000141128"
"0000087871"	"0000141157"
"0000087872"	"0000141187"
"0000087873"	"0000141188"
"0000087874"	"0000141189"
"0000087875"	"0000141190"
"0000087876"	"0000141191"
"0000087877"	"0000141248"
"0000087878"	"0000141272"
"0000087879"	"0000141273"
"0000087880"	"0000141274"
"0000087881"	"0000141280"
"0000087882"	"0000141288"
"0000087883"	"0000141332"
"0000087884"	"0000141333"
"0000087885"	"0000141339"
"0000087886"	"0000141353"
"0000087887"	"0000141388"
"0000087888"	"0000141393"
"0000087889"	"0000141356"
"0000087890"	"0000141090"
"0000087891"	"0000141311"
"0000087892"	"0000141312"
"0000087893"	"0000141167"
"0000087894"	"0000141168"
"0000087895"	"0000141220"
"0000087896"	"0000141389"
"0000087897"	"0000140940"
"0000087898"	"0000141204"
"0000087899"	"0000141192"
"0000087900"	"0000141277"
"0000087901"	"0000141297"
"0000087902"	"0000140861"
"0000087903"	"0000141052"
"0000087904"	"0000141053"
"0000087905"	"0000141001"
"0000087906"	"0000140978"
"0000087907"	"0000140979"
"0000087908"	"0000140941"
"0000087909"	"0000141370"
"0000087910"	"0000141371"
"0000087911"	"0000141372"
"0000087912"	"0000141083"
"0000087913"	"0000141380"
"0000087914"	"0000141223"
"0000087915"	"0000141243"
"0000087916"	"0000141244"
"0000087917"	"0000141354"
"0000087918"	"0000141158"
"0000087919"	"0000140782"
"0000087920"	"0000141355"
"0000087921"	"0000141123"
"0000087922"	"0000141124"
"0000087923"	"0000140850"
"0000087924"	"0000141131"
"0000087925"	"0000140982"
"0000087926"	"0000141334"
"0000087927"	"0000141313"
"0000087928"	"0000141335"
"0000087929"	"0000141381"
"0000087930"	"0000141033"
"0000087931"	"0000140811"
"0000087932"	"0000141321"
"0000087933"	"0000141322"
"0000087934"	"0000141161"
"0000087935"	"0000140854"
"0000087936"	"0000140841"
"0000087937"	"0000140804"
"0000087938"	"0000141338"
"0000087939"	"0000141390"
"0000087940"	"0000141275"
"0000087941"	"0000141373"
"0000087942"	"0000141104"
"0000087943"	"0000141314"
"0000087944"	"0000141213"
"0000087945"	"0000141315"
"0000087946"	"0000140949"
"0000087947"	"0000141106"
"0000087948"	"0000140942"
"0000087949"	"0000140943"
"0000087950"	"0000141292"
"0000087951"	"0000141112"
"0000087952"	"0000141055"
"0000087953"	"0000141276"
"0000087954"	"0000141374"
"0000087955"	"0000141160"
"0000087956"	"0000141251"
"0000087958"	"0000141002"
"0000088194"	"0000141111"
"0000088195"	"0000141115"
"0000088196"	"0000141102"
"0000088197"	"0000141107"
"0000088198"	"0000141279"
"0000088199"	"0000141398"
"0000088200"	"0000141264"
"0000132955"	"0000222143"
"0000132956"	"0000222144"
"0000132957"	"0000222145"
"0000208392"	"0000438227"
"0000208634"	"0000438556"
"0000210083"	"0000441252"
"0000309706"	"0000684579"
"0000309707"	"0000684580"
"0000309708"	"0000684581"
"0000309709"	"0000684582"
"0000309710"	"0000684583"
"0000309711"	"0000684584"
"0000309712"	"0000684585"
"0000309713"	"0000684586"
"0000310558"	"0000685469"
"0000310559"	"0000685470"
"0000310560"	"0000685471"
"0000310561"	"0000685472"
"0000310562"	"0000685473"
"0000310563"	"0000685474"
"0000310564"	"0000685475"
"0000310565"	"0000685476"
"0000329715"	"0000714072"
"0000334980"	"0000732987"
"0000334981"	"0000732988"
"0000334982"	"0000732989"
"0000334983"	"0000732990"
"0000334984"	"0000732991"
"0000334985"	"0000732992"
"0000334986"	"0000732993"
"0000334987"	"0000732994"
"0000334988"	"0000732995"
"0000334989"	"0000732996"
"0000334990"	"0000732997"
"0000334991"	"0000732998"
"0000334992"	"0000732999"
"0000336550"	"0000735946"
"0000336678"	"0000736166"
"0000337222"	"0000736852"
"0000337223"	"0000736853"
"0000359975"	"0000759606"
"0000360615"	"0000760657"
"0000375078"	"0000786345"
"0000375172"	"0000786467"
"0000377515"	"0000789878"
"0000377516"	"0000789879"
"0000377517"	"0000789880"
"0000377518"	"0000789881"
"0000380761"	"0000793953"
"0000380988"	"0000794249"
"0000380995"	"0000794256"
"0000384681"	"0000811442"
"0000384682"	"0000811443"
"0000384683"	"0000811444"
"0000384684"	"0000811445"
"0000385478"	"0000812541"
"0000385479"	"0000812542"
"0000385536"	"0000812614"
"0000385543"	"0000812622"
"0000385562"	"0000812647"
"0000385564"	"0000812649"
"0000385567"	"0000812653"
"0000385573"	"0000812661"
"0000385590"	"0000812680"
"0000385620"	"0000812714"
"0000385641"	"0000812738"
"0000385673"	"0000812775"
"0000385682"	"0000812786"
"0000385704"	"0000812814"
"0000385714"	"0000812826"
"0000385715"	"0000812827"
"0000387959"	"0000816117"
"0000388025"	"0000816183"
"0000389275"	"0000818192"
"0000389434"	"0000818493"
"0000389970"	"0000819315"
"0000389999"	"0000819344"
"0000390001"	"0000819346"
"0000390008"	"0000819353"
"0000390009"	"0000819354"
"0000390022"	"0000819367"
"0000390027"	"0000819372"
"0000390030"	"0000819375"
"0000390031"	"0000819376"
"0000390033"	"0000819378"
"0000390129"	"0000819474"
"0000390130"	"0000819475"
"0000390141"	"0000819486"
"0000390146"	"0000819491"
"0000390148"	"0000819493"
"0000390153"	"0000819498"
"0000390162"	"0000819507"
"0000390205"	"0000819550"
"0000390206"	"0000819551"
"0000392001"	"0000822124"
"0000392037"	"0000822125"
"0000392100"	"0000822227"
"0000392157"	"0000822331"
"0000392225"	"0000822450"
"0000392232"	"0000822460"
"0000392234"	"0000822462"
"0000392238"	"0000822469"
"0000392626"	"0000822969"
"0000392627"	"0000822970"
"0000392745"	"0000823180"
"0000392746"	"0000823181"
"0000392747"	"0000823182"
"0000392750"	"0000823185"
"0000392751"	"0000823186"
"0000392752"	"0000823187"
"0000392753"	"0000823188"
"0000392754"	"0000823189"
"0000392755"	"0000823190"
"0000392756"	"0000823191"
"0000392757"	"0000823192"
"0000392758"	"0000823193"
"0000394696"	"0000825676"
"0000394718"	"0000825710"
"0000394719"	"0000825711"
"0000394723"	"0000825717"
"0000394724"	"0000825718"
"0000394765"	"0000825782"
"0000394797"	"0000825828"
"0000394857"	"0000825917"
"0000394978"	"0000826111"
"0000394993"	"0000826134"
"0000395060"	"0000826236"
"0000395085"	"0000826273"
"0000395114"	"0000826317"
"0000395136"	"0000826351"
"0000396044"	"0000827609"
"0000397165"	"0000828911"
"0000397166"	"0000828912"
"0000397191"	"0000828937"
"0000397224"	"0000829079"
"0000397225"	"0000829080"
"0000397226"	"0000829081"
"0000397227"	"0000829082"
"0000397228"	"0000829083"
"0000397229"	"0000829084"
"0000397230"	"0000829085"
"0000397231"	"0000829086"
"0000397232"	"0000829087"
"0000397233"	"0000829088"
"0000397234"	"0000829089"
"0000397235"	"0000829090"
"0000397236"	"0000829091"
"0000397237"	"0000829092"
"0000397242"	"0000829098"
"0000397243"	"0000829099"
"0000397244"	"0000829100"
"0000397245"	"0000829101"
"0000397246"	"0000829102"
"0000397247"	"0000829103"
"0000397248"	"0000829104"
"0000397249"	"0000829105"
"0000397250"	"0000829106"
"0000397251"	"0000829107"
"0000397252"	"0000829108"
"0000397253"	"0000829109"
"0000397254"	"0000829110"
"0000397255"	"0000829111"
"0000397256"	"0000829112"
"0000397257"	"0000829113"
"0000397258"	"0000829114"
"0000397259"	"0000829115"
"0000397260"	"0000829116"
"0000397261"	"0000829117"
"0000397262"	"0000829118"
"0000397273"	"0000829208"
"0000397274"	"0000829209"
"0000397275"	"0000829210"
"0000397276"	"0000829211"
"0000397277"	"0000829212"
"0000397278"	"0000829213"
"0000397279"	"0000829214"
"0000397280"	"0000829215"
"0000397281"	"0000829216"
"0000397282"	"0000829217"
"0000397283"	"0000829218"
"0000397284"	"0000829219"
"0000397285"	"0000829220"
"0000397286"	"0000829221"
"0000397287"	"0000829239"
"0000397288"	"0000829240"
"0000397289"	"0000829241"
"0000397290"	"0000829242"
"0000397291"	"0000829243"
"0000397292"	"0000829244"
"0000397293"	"0000829245"
"0000397294"	"0000829246"
"0000397295"	"0000829247"
"0000397296"	"0000829248"
"0000397301"	"0000829273"
"0000397302"	"0000829274"
"0000397303"	"0000829275"
"0000397304"	"0000829276"
"0000397305"	"0000829277"
"0000397306"	"0000829278"
"0000397307"	"0000829279"
"0000397308"	"0000829280"
"0000397309"	"0000829281"
"0000397310"	"0000829282"
"0000397311"	"0000829283"
"0000397312"	"0000829284"
"0000397313"	"0000829285"
"0000397314"	"0000829286"
"0000397315"	"0000829287"
"0000397316"	"0000829288"
"0000397317"	"0000829289"
"0000397318"	"0000829290"
"0000397319"	"0000829291"
"0000397320"	"0000829292"
"0000397321"	"0000829293"
"0000397322"	"0000829294"
"0000397323"	"0000829295"
"0000397324"	"0000829296"
"0000397325"	"0000829297"
"0000397326"	"0000829298"
"0000397327"	"0000829299"
"0000397328"	"0000829300"
"0000397329"	"0000829301"
"0000397330"	"0000829302"
"0000397331"	"0000829303"
"0000397332"	"0000829304"
"0000397333"	"0000829305"
"0000397334"	"0000829306"
"0000397335"	"0000829307"
"0000397336"	"0000829308"
"0000397337"	"0000829309"
"0000397338"	"0000829310"
"0000397339"	"0000829311"
"0000397340"	"0000829312"
"0000397341"	"0000829313"
"0000397342"	"0000829314"
"0000397343"	"0000829315"
"0000397344"	"0000829316"
"0000397345"	"0000829317"
"0000397346"	"0000829318"
"0000397347"	"0000829319"
"0000397348"	"0000829320"
"0000397350"	"0000829322"
"0000397351"	"0000829323"
"0000397352"	"0000829324"
"0000397353"	"0000829325"
"0000397354"	"0000829326"
"0000397355"	"0000829327"
"0000397356"	"0000829328"
"0000397357"	"0000829329"
"0000397358"	"0000829330"
"0000397359"	"0000829331"
"0000397360"	"0000829332"
"0000397361"	"0000829333"
"0000397362"	"0000829334"
"0000397363"	"0000829335"
"0000397364"	"0000829336"
"0000397365"	"0000829337"
"0000397366"	"0000829338"
"0000397367"	"0000829339"
"0000397368"	"0000829340"
"0000397369"	"0000829341"
"0000397370"	"0000829342"
"0000397372"	"0000829344"
"0000397373"	"0000829345"
"0000397374"	"0000829346"
"0000397375"	"0000829349"
"0000397376"	"0000829350"
"0000397377"	"0000829351"
"0000397378"	"0000829352"
"0000397379"	"0000829353"
"0000397380"	"0000829354"
"0000397381"	"0000829355"
"0000397382"	"0000829356"
"0000397383"	"0000829357"
"0000397384"	"0000829358"
"0000397385"	"0000829359"
"0000397386"	"0000829360"
"0000397387"	"0000829361"
"0000397388"	"0000829362"
"0000397389"	"0000829363"
"0000397390"	"0000829364"
"0000397391"	"0000829365"
"0000397392"	"0000829366"
"0000397393"	"0000829367"
"0000397394"	"0000829368"
"0000397395"	"0000829369"
"0000397396"	"0000829370"
"0000397397"	"0000829371"
"0000397398"	"0000829372"
"0000397399"	"0000829373"
"0000397400"	"0000829374"
"0000397401"	"0000829375"
"0000397402"	"0000829376"
"0000397403"	"0000829377"
"0000397404"	"0000829378"
"0000397405"	"0000829379"
"0000397406"	"0000829380"
"0000397407"	"0000829381"
"0000397408"	"0000829382"
"0000397409"	"0000829383"
"0000397410"	"0000829384"
"0000397411"	"0000829385"
"0000397412"	"0000829386"
"0000397413"	"0000829387"
"0000397414"	"0000829388"
"0000397415"	"0000829389"
"0000397416"	"0000829390"
"0000397586"	"0000829634"
"0000397587"	"0000829635"
"0000397588"	"0000829636"
"0000397589"	"0000829637"
"0000397590"	"0000829638"
"0000397591"	"0000829639"
"0000397592"	"0000829640"
"0000397593"	"0000829641"
"0000397594"	"0000829642"
"0000397595"	"0000829643"
"0000397596"	"0000829644"
"0000397597"	"0000829645"
"0000397598"	"0000829646"
"0000397599"	"0000829647"
"0000397600"	"0000829648"
"0000397601"	"0000829649"
"0000397602"	"0000829650"
"0000397603"	"0000829651"
"0000397604"	"0000829652"
"0000397605"	"0000829653"
"0000397606"	"0000829654"
"0000397607"	"0000829655"
"0000397608"	"0000829656"
"0000397609"	"0000829657"
"0000397610"	"0000829658"
"0000397611"	"0000829659"
"0000397612"	"0000829660"
"0000397613"	"0000829661"
"0000397614"	"0000829662"
"0000397615"	"0000829663"
"0000397616"	"0000829664"
"0000397617"	"0000829665"
"0000397618"	"0000829666"
"0000397619"	"0000829667"
"0000397620"	"0000829668"
"0000397621"	"0000829669"
"0000397622"	"0000829670"
"0000397623"	"0000829671"
"0000397624"	"0000829672"
"0000397625"	"0000829673"
"0000397626"	"0000829674"
"0000397627"	"0000829675"
"0000397628"	"0000829676"
"0000397629"	"0000829677"
"0000397630"	"0000829678"
"0000397631"	"0000829679"
"0000397632"	"0000829680"
"0000397633"	"0000829681"
"0000397634"	"0000829682"
"0000397635"	"0000829683"
"0000397636"	"0000829684"
"0000397637"	"0000829685"
"0000397638"	"0000829686"
"0000397639"	"0000829687"
"0000397640"	"0000829688"
"0000397641"	"0000829689"
"0000397642"	"0000829690"
"0000397643"	"0000829691"
"0000397644"	"0000829692"
"0000397645"	"0000829693"
"0000397646"	"0000829694"
"0000397647"	"0000829695"
"0000397648"	"0000829696"
"0000397662"	"0000829710"
"0000397672"	"0000829734"
"0000397673"	"0000829735"
"0000397674"	"0000829736"
"0000397675"	"0000829737"
"0000397676"	"0000829738"
"0000397677"	"0000829739"
"0000397678"	"0000829740"
"0000397679"	"0000829741"
"0000397680"	"0000829742"
"0000397681"	"0000829743"
"0000397682"	"0000829744"
"0000397683"	"0000829745"
"0000397684"	"0000829746"
"0000397685"	"0000829747"
"0000397686"	"0000829748"
"0000397687"	"0000829749"
"0000397688"	"0000829750"
"0000397689"	"0000829751"
"0000397690"	"0000829752"
"0000397691"	"0000829753"
"0000397692"	"0000829754"
"0000397693"	"0000829755"
"0000397694"	"0000829756"
"0000397706"	"0000829772"
"0000397732"	"0000829800"
"0000397733"	"0000829801"
"0000397899"	"0000830082"
"0000397900"	"0000830083"
"0000397901"	"0000830084"
"0000397902"	"0000830085"
"0000397903"	"0000830086"
"0000397904"	"0000830087"
"0000397905"	"0000830088"
"0000397906"	"0000830089"
"0000397907"	"0000830090"
"0000397908"	"0000830091"
"0000397909"	"0000830092"
"0000397910"	"0000830093"
"0000397911"	"0000830094"
"0000397912"	"0000830095"
"0000397913"	"0000830096"
"0000397914"	"0000830097"
"0000397915"	"0000830098"
"0000397916"	"0000830099"
"0000397917"	"0000830100"
"0000397918"	"0000830101"
"0000397919"	"0000830102"
"0000397920"	"0000830103"
"0000397921"	"0000830104"
"0000397922"	"0000830105"
"0000397923"	"0000830106"
"0000397924"	"0000830107"
"0000397925"	"0000830108"
"0000397926"	"0000830109"
"0000397927"	"0000830110"
"0000397928"	"0000830111"
"0000397929"	"0000830112"
"0000397930"	"0000830113"
"0000397931"	"0000830114"
"0000397932"	"0000830115"
"0000397933"	"0000830116"
"0000397934"	"0000830117"
"0000397935"	"0000830118"
"0000397936"	"0000830119"
"0000397937"	"0000830120"
"0000397938"	"0000830121"
"0000397939"	"0000830122"
"0000397940"	"0000830123"
"0000397941"	"0000830124"
"0000397942"	"0000830125"
"0000397943"	"0000830126"
"0000397944"	"0000830127"
"0000397945"	"0000830128"
"0000397946"	"0000830129"
"0000397947"	"0000830130"
"0000397948"	"0000830131"
"0000397949"	"0000830132"
"0000397950"	"0000830133"
"0000397968"	"0000830155"
"0000397969"	"0000830157"
"0000397970"	"0000830158"
"0000397971"	"0000830159"
"0000397972"	"0000830160"
"0000397973"	"0000830161"
"0000397974"	"0000830162"
"0000397975"	"0000830163"
"0000397976"	"0000830164"
"0000397977"	"0000830165"
"0000397978"	"0000830166"
"0000397979"	"0000830167"
"0000397980"	"0000830168"
"0000397981"	"0000830169"
"0000397982"	"0000830170"
"0000397983"	"0000830171"
"0000397984"	"0000830172"
"0000397985"	"0000830173"
"0000397986"	"0000830194"
"0000397987"	"0000830195"
"0000397988"	"0000830196"
"0000397989"	"0000830197"
"0000397990"	"0000830198"
"0000397991"	"0000830199"
"0000397992"	"0000830200"
"0000397993"	"0000830201"
"0000397994"	"0000830202"
"0000397995"	"0000830203"
"0000397996"	"0000830204"
"0000397997"	"0000830205"
"0000397998"	"0000830206"
"0000397999"	"0000830207"
"0000398000"	"0000830208"
"0000398001"	"0000830209"
"0000398002"	"0000830210"
"0000398003"	"0000830211"
"0000398004"	"0000830212"
"0000398005"	"0000830213"
"0000398006"	"0000830214"
"0000398007"	"0000830215"
"0000398008"	"0000830216"
"0000398009"	"0000830217"
"0000398010"	"0000830218"
"0000398011"	"0000830219"
"0000398012"	"0000830220"
"0000398013"	"0000830221"
"0000398014"	"0000830222"
"0000398015"	"0000830223"
"0000398016"	"0000830224"
"0000398017"	"0000830225"
"0000398018"	"0000830226"
"0000398019"	"0000830227"
"0000398020"	"0000830228"
"0000398021"	"0000830229"
"0000398022"	"0000830230"
"0000398023"	"0000830231"
"0000398024"	"0000830232"
"0000398025"	"0000830233"
"0000398026"	"0000830234"
"0000398027"	"0000830235"
"0000398028"	"0000830236"
"0000398029"	"0000830237"
"0000398030"	"0000830238"
"0000398031"	"0000830239"
"0000398032"	"0000830240"
"0000398033"	"0000830241"
"0000398034"	"0000830242"
"0000398035"	"0000830243"
"0000398036"	"0000830244"
"0000398037"	"0000830245"
"0000398038"	"0000830246"
"0000398039"	"0000830247"
"0000398040"	"0000830248"
"0000398041"	"0000830249"
"0000398042"	"0000830250"
"0000398043"	"0000830251"
"0000398044"	"0000830252"
"0000398045"	"0000830253"
"0000398046"	"0000830254"
"0000398047"	"0000830255"
"0000398048"	"0000830256"
"0000398049"	"0000830257"
"0000398050"	"0000830258"
"0000398051"	"0000830259"
"0000398052"	"0000830260"
"0000398053"	"0000830261"
"0000398054"	"0000830262"
"0000398055"	"0000830263"
"0000398056"	"0000830264"
"0000398057"	"0000830265"
"0000398058"	"0000830266"
"0000398059"	"0000830267"
"0000398060"	"0000830268"
"0000398061"	"0000830269"
"0000398062"	"0000830270"
"0000398063"	"0000830271"
"0000398064"	"0000830272"
"0000398065"	"0000830273"
"0000398102"	"0000830310"
"0000398103"	"0000830311"
"0000398104"	"0000830312"
"0000398105"	"0000830313"
"0000398106"	"0000830314"
"0000398107"	"0000830315"
"0000398108"	"0000830316"
"0000398109"	"0000830317"
"0000398110"	"0000830318"
"0000398111"	"0000830319"
"0000398112"	"0000830320"
"0000398113"	"0000830321"
"0000398114"	"0000830322"
"0000398115"	"0000830323"
"0000398116"	"0000830324"
"0000398117"	"0000830325"
"0000398118"	"0000830326"
"0000398119"	"0000830327"
"0000398120"	"0000830328"
"0000398121"	"0000830329"
"0000398122"	"0000830330"
"0000398123"	"0000830331"
"0000398124"	"0000830332"
"0000398125"	"0000830333"
"0000398126"	"0000830334"
"0000398127"	"0000830335"
"0000398128"	"0000830336"
"0000398129"	"0000830337"
"0000398130"	"0000830338"
"0000398131"	"0000830339"
"0000398132"	"0000830340"
"0000398133"	"0000830341"
"0000398134"	"0000830342"
"0000398135"	"0000830343"
"0000398136"	"0000830344"
"0000398137"	"0000830345"
"0000398138"	"0000830346"
"0000398139"	"0000830347"
"0000398140"	"0000830348"
"0000398141"	"0000830349"
"0000398142"	"0000830350"
"0000398143"	"0000830351"
"0000398144"	"0000830352"
"0000398145"	"0000830353"
"0000398146"	"0000830354"
"0000398147"	"0000830355"
"0000398148"	"0000830356"
"0000398149"	"0000830357"
"0000398150"	"0000830358"
"0000398151"	"0000830359"
"0000398152"	"0000830360"
"0000398153"	"0000830361"
"0000398154"	"0000830362"
"0000398155"	"0000830363"
"0000398156"	"0000830364"
"0000398157"	"0000830365"
"0000398158"	"0000830366"
"0000398159"	"0000830367"
"0000398160"	"0000830368"
"0000398161"	"0000830369"
"0000398162"	"0000830370"
"0000398163"	"0000830371"
"0000398164"	"0000830372"
"0000398165"	"0000830373"
"0000398166"	"0000830374"
"0000398167"	"0000830375"
"0000398168"	"0000830376"
"0000398245"	"0000830454"
"0000398285"	"0000830496"
"0000398286"	"0000830497"
"0000398287"	"0000830498"
"0000398288"	"0000830499"
"0000398289"	"0000830500"
"0000398290"	"0000830501"
"0000398291"	"0000830502"
"0000398292"	"0000830503"
"0000398293"	"0000830504"
"0000398294"	"0000830505"
"0000398295"	"0000830506"
"0000398296"	"0000830507"
"0000398297"	"0000830508"
"0000398298"	"0000830509"
"0000398299"	"0000830510"
"0000398300"	"0000830511"
"0000398301"	"0000830512"
"0000398302"	"0000830513"
"0000398303"	"0000830514"
"0000398304"	"0000830515"
"0000398305"	"0000830516"
"0000398306"	"0000830517"
"0000398307"	"0000830518"
"0000398308"	"0000830519"
"0000398309"	"0000830520"
"0000398310"	"0000830521"
"0000398311"	"0000830522"
"0000398312"	"0000830523"
"0000398313"	"0000830524"
"0000398314"	"0000830525"
"0000398315"	"0000830526"
"0000398316"	"0000830527"
"0000398317"	"0000830528"
"0000398318"	"0000830529"
"0000398319"	"0000830530"
"0000398320"	"0000830531"
"0000398321"	"0000830532"
"0000398322"	"0000830533"
"0000398323"	"0000830534"
"0000398324"	"0000830535"
"0000398325"	"0000830536"
"0000398326"	"0000830537"
"0000398327"	"0000830538"
"0000398328"	"0000830539"
"0000398329"	"0000830540"
"0000398330"	"0000830541"
"0000398331"	"0000830542"
"0000398332"	"0000830543"
"0000398333"	"0000830544"
"0000398334"	"0000830545"
"0000398335"	"0000830546"
"0000398336"	"0000830547"
"0000398337"	"0000830548"
"0000398338"	"0000830549"
"0000398339"	"0000830550"
"0000398340"	"0000830551"
"0000398341"	"0000830552"
"0000398342"	"0000830553"
"0000398343"	"0000830554"
"0000398344"	"0000830555"
"0000398345"	"0000830556"
"0000398346"	"0000830557"
"0000398347"	"0000830558"
"0000398348"	"0000830559"
"0000398349"	"0000830560"
"0000398350"	"0000830561"
"0000398351"	"0000830562"
"0000398352"	"0000830563"
"0000398353"	"0000830564"
"0000398354"	"0000830565"
"0000398355"	"0000830566"
"0000398356"	"0000830567"
"0000398357"	"0000830568"
"0000398358"	"0000830569"
"0000398359"	"0000830570"
"0000398360"	"0000830571"
"0000398361"	"0000830572"
"0000398362"	"0000830573"
"0000398363"	"0000830574"
"0000398364"	"0000830575"
"0000398365"	"0000830576"
"0000398366"	"0000830577"
"0000398367"	"0000830578"
"0000398368"	"0000830579"
"0000398369"	"0000830580"
"0000398370"	"0000830581"
"0000398371"	"0000830582"
"0000398372"	"0000830583"
"0000398373"	"0000830584"
"0000398374"	"0000830585"
"0000398375"	"0000830586"
"0000398376"	"0000830587"
"0000398377"	"0000830588"
"0000398378"	"0000830589"
"0000409704"	"0000846908"
"0000409705"	"0000846909"
"0000409706"	"0000846910"
"0000409707"	"0000846911"
"0000409708"	"0000846912"
"0000409709"	"0000846913"
"0000409710"	"0000846914"
"0000409711"	"0000846915"
"0000409712"	"0000846916"
"0000409713"	"0000846917"
"0000409714"	"0000846918"
"0000409715"	"0000846919"
"0000409716"	"0000846920"
"0000409717"	"0000846921"
"0000409718"	"0000846922"
"0000409719"	"0000846923"
"0000409720"	"0000846924"
"0000412853"	"0000870225"
"0000415765"	"0000873657"
"0000421755"	"0000896533"
"0000421830"	"0000896640"
"0000421834"	"0000896645"
"0000428271"	"0000905993"
"0000428272"	"0000905994"
"0000428273"	"0000905995"
"0000438085"	"0000933611"
"0000438086"	"0000933612"
"0000438087"	"0000933613"
"0000445190"	"0000952090"
"0000445191"	"0000952091"
"0000445192"	"0000952092"
"0000445193"	"0000952093"
"0000445194"	"0000952099"
"0000445195"	"0000952094"
"0000445196"	"0000952095"
"0000445197"	"0000952096"
"0000445198"	"0000952097"
"0000445199"	"0000952098"
"0000445346"	"0000952264"
"0000445347"	"0000952265"
"0000445348"	"0000952266"
"0000445349"	"0000952267"
"0000445350"	"0000952268"
"0000445351"	"0000952269"
"0000445352"	"0000952270"
"0000445353"	"0000952271"
"0000445354"	"0000952272"
"0000445355"	"0000952273"
"0000445356"	"0000952274"
"0000445357"	"0000952275"
"0000445358"	"0000952276"
"0000445359"	"0000952277"
"0000445360"	"0000952278"
"0000445361"	"0000952279"
"0000448821"	"0000958307"
"0000448822"	"0000958308"
"0000448823"	"0000958309"
"0000448824"	"0000958310"
"0000448825"	"0000958311"
"0000448826"	"0000958312"
"0000448827"	"0000958313"
"0000448828"	"0000958314"
"0000448829"	"0000958315"
"0000448830"	"0000958316"
"0000448831"	"0000958317"
"0000449010"	"0000959229"
"0000449157"	"0000958924"
"0000452607"	"0000986590"
"0000452608"	"0000986591"
"0000452609"	"0000986592"
"0000460194"	"0001019189"
"0000460195"	"0001019190"
"0000460196"	"0001019191"
"0000460197"	"0001019192"
"0000460198"	"0001019193"
"0000460199"	"0001019194"
"0000460200"	"0001019195"
"0000460201"	"0001019196"
"0000460202"	"0001019197"
"0000460203"	"0001019198"
"0000460204"	"0001019199"
"0000460205"	"0001019200"
"0000460206"	"0001019201"
"0000460207"	"0001019202"
"0000460208"	"0001019203"
"0000460209"	"0001019204"
"0000460210"	"0001019205"
"0000460211"	"0001019208"
"0000460212"	"0001019209"
"0000460213"	"0001019210"
"0000460214"	"0001019211"
"0000460215"	"0001019212"
"0000460216"	"0001019213"
"0000460217"	"0001019214"
"0000460218"	"0001019215"
"0000460219"	"0001019216"
"0000460220"	"0001019217"
"0000460221"	"0001019218"
"0000460222"	"0001019219"
"0000460223"	"0001019220"
"0000460224"	"0001019221"
"0000460225"	"0001019222"
"0000460226"	"0001019223"
"0000460227"	"0001019224"
"0000460228"	"0001019225"
"0000460229"	"0001019226"
"0000460230"	"0001019227"
"0000460231"	"0001019228"
"0000460232"	"0001019229"
"0000460233"	"0001019230"
"0000460234"	"0001019231"
"0000460235"	"0001019232"
"0000460236"	"0001019233"
"0000460237"	"0001019234"
"0000460238"	"0001019235"
"0000460239"	"0001019236"
"0000460240"	"0001019237"
"0000460241"	"0001019238"
"0000460242"	"0001019239"
"0000460243"	"0001019240"
"0000460244"	"0001019241"
"0000460245"	"0001019242"
"0000460246"	"0001019243"
"0000460247"	"0001019244"
"0000460248"	"0001019245"
"0000460249"	"0001019246"
"0000460250"	"0001019247"
"0000460251"	"0001019248"
"0000460252"	"0001019249"
"0000460253"	"0001019250"
"0000460254"	"0001019251"
"0000460255"	"0001019252"
"0000460256"	"0001019253"
"0000460257"	"0001019254"
"0000460258"	"0001019255"
"0000460259"	"0001019256"
"0000460260"	"0001019257"
"0000460261"	"0001019258"
"0000460262"	"0001019259"
"0000460263"	"0001019260"
"0000460264"	"0001019261"
"0000460265"	"0001019262"
"0000460266"	"0001019263"
"0000460267"	"0001019264"
"0000460268"	"0001019265"
"0000460269"	"0001019266"
"0000460270"	"0001019267"
"0000460271"	"0001019268"
"0000460272"	"0001019269"
"0000460273"	"0001019270"
"0000460274"	"0001019271"
"0000460275"	"0001019272"
"0000460276"	"0001019273"
"0000460277"	"0001019274"
"0000460278"	"0001019275"
"0000460279"	"0001019276"
"0000460280"	"0001019277"
"0000460281"	"0001019278"
"0000460282"	"0001019279"
"0000460283"	"0001019280"
"0000460284"	"0001019281"
"0000460285"	"0001019282"
"0000460286"	"0001019283"
"0000460287"	"0001019284"
"0000460288"	"0001019285"
"0000460289"	"0001019286"
"0000460290"	"0001019287"
"0000460291"	"0001019288"
"0000460292"	"0001019289"
"0000460293"	"0001019290"
"0000460294"	"0001019291"
"0000460295"	"0001019292"
"0000460296"	"0001019293"
"0000460297"	"0001019294"
"0000460298"	"0001019295"
"0000460299"	"0001019296"
"0000460300"	"0001019297"
"0000460301"	"0001019298"
"0000460302"	"0001019299"
"0000460303"	"0001019300"
"0000460304"	"0001019301"
"0000460305"	"0001019302"
"0000460306"	"0001019303"
"0000460307"	"0001019304"
"0000460308"	"0001019305"
"0000460309"	"0001019306"
"0000460310"	"0001019307"
"0000460311"	"0001019308"
"0000460312"	"0001019309"
"0000460313"	"0001019310"
"0000460314"	"0001019311"
"0000460315"	"0001019312"
"0000460316"	"0001019313"
"0000460317"	"0001019314"
"0000460318"	"0001019315"
"0000460319"	"0001019316"
"0000460320"	"0001019317"
"0000460321"	"0001019318"
"0000460322"	"0001019319"
"0000460323"	"0001019320"
"0000460324"	"0001019321"
"0000460325"	"0001019322"
"0000460326"	"0001019323"
"0000460327"	"0001019324"
"0000460328"	"0001019325"
"0000460329"	"0001019326"
"0000460330"	"0001019327"
"0000460331"	"0001019328"
"0000460332"	"0001019329"
"0000460333"	"0001019330"
"0000460335"	"0001019339"
"0000460336"	"0001019340"
"0000460337"	"0001019341"
"0000460338"	"0001019342"
"0000460339"	"0001019343"
"0000460340"	"0001019344"
"0000460341"	"0001019345"
"0000460342"	"0001019346"
"0000460343"	"0001019347"
"0000460344"	"0001019348"
"0000460345"	"0001019349"
"0000460346"	"0001019350"
"0000460347"	"0001019351"
"0000460348"	"0001019352"
"0000460349"	"0001019353"
"0000460350"	"0001019354"
"0000460351"	"0001019355"
"0000460352"	"0001019356"
"0000460353"	"0001019357"
"0000460354"	"0001019358"
"0000460355"	"0001019359"
"0000460356"	"0001019360"
"0000460357"	"0001019361"
"0000460358"	"0001019362"
"0000460359"	"0001019363"
"0000460360"	"0001019364"
"0000460361"	"0001019365"
"0000460362"	"0001019366"
"0000460363"	"0001019367"
"0000460364"	"0001019368"
"0000460365"	"0001019369"
"0000460366"	"0001019370"
"0000460367"	"0001019371"
"0000460368"	"0001019372"
"0000460369"	"0001019373"
"0000460370"	"0001019374"
"0000460371"	"0001019375"
"0000460372"	"0001019376"
"0000460373"	"0001019377"
"0000460374"	"0001019378"
"0000460375"	"0001019379"
"0000460376"	"0001019380"
"0000460377"	"0001019381"
"0000460378"	"0001019382"
"0000460379"	"0001019383"
"0000460380"	"0001019384"
"0000460381"	"0001019385"
"0000460382"	"0001019386"
"0000460383"	"0001019387"
"0000460384"	"0001019388"
"0000460385"	"0001019389"
"0000460386"	"0001019390"
"0000460387"	"0001019391"
"0000460388"	"0001019392"
"0000460389"	"0001019393"
"0000460390"	"0001019394"
"0000460391"	"0001019395"
"0000460392"	"0001019396"
"0000460393"	"0001019397"
"0000460394"	"0001019398"
"0000460395"	"0001019399"
"0000460396"	"0001019400"
"0000460397"	"0001019401"
"0000460398"	"0001019402"
"0000460399"	"0001019403"
"0000460400"	"0001019404"
"0000460401"	"0001019405"
"0000460402"	"0001019406"
"0000460403"	"0001019407"
"0000460404"	"0001019408"
"0000460405"	"0001019410"
"0000460406"	"0001019411"
"0000460407"	"0001019412"
"0000460408"	"0001019413"
"0000460409"	"0001019414"
"0000460410"	"0001019415"
"0000460411"	"0001019416"
"0000460412"	"0001019417"
"0000460413"	"0001019418"
"0000460414"	"0001019419"
"0000460415"	"0001019420"
"0000460416"	"0001019421"
"0000460417"	"0001019422"
"0000460418"	"0001019423"
"0000460419"	"0001019424"
"0000460420"	"0001019425"
"0000460421"	"0001019426"
"0000460422"	"0001019427"
"0000460423"	"0001019428"
"0000460424"	"0001019429"
"0000460425"	"0001019430"
"0000460426"	"0001019431"
"0000460427"	"0001019432"
"0000460428"	"0001019433"
"0000460429"	"0001019434"
"0000460430"	"0001019435"
"0000460431"	"0001019436"
"0000460432"	"0001019437"
"0000460433"	"0001019438"
"0000460434"	"0001019439"
"0000460435"	"0001019440"
"0000460436"	"0001019441"
"0000460437"	"0001019442"
"0000460438"	"0001019443"
"0000460439"	"0001019444"
"0000460440"	"0001019445"
"0000460441"	"0001019446"
"0000460442"	"0001019447"
"0000460443"	"0001019448"
"0000460444"	"0001019449"
"0000460445"	"0001019450"
"0000460446"	"0001019451"
"0000460447"	"0001019452"
"0000460448"	"0001019453"
"0000460449"	"0001019454"
"0000460450"	"0001019455"
"0000460451"	"0001019456"
"0000460452"	"0001019457"
"0000460453"	"0001019458"
"0000460454"	"0001019459"
"0000460455"	"0001019460"
"0000460456"	"0001019461"
"0000460459"	"0001019465"
"0000460460"	"0001019466"
"0000460461"	"0001019467"
"0000460462"	"0001019468"
"0000460463"	"0001019469"
"0000460464"	"0001019470"
"0000460465"	"0001019471"
"0000460466"	"0001019472"
"0000460467"	"0001019473"
"0000460468"	"0001019474"
"0000460469"	"0001019475"
"0000460470"	"0001019476"
"0000460471"	"0001019477"
"0000460472"	"0001019478"
"0000460473"	"0001019479"
"0000460474"	"0001019480"
"0000460475"	"0001019481"
"0000460476"	"0001019482"
"0000460477"	"0001019483"
"0000460478"	"0001019484"
"0000460479"	"0001019485"
"0000460480"	"0001019486"
"0000460481"	"0000000301"
"0000460481"	"0001019487"
"0000460482"	"0000000302"
"0000460482"	"0001019488"
"0000460483"	"0000000303"
"0000460483"	"0001019489"
"0000460484"	"0001019490"
"0000460485"	"0001019491"
"0000460486"	"0001019492"
"0000460487"	"0001019493"
"0000460488"	"0001019494"
"0000460489"	"0001019495"
"0000460490"	"0001019496"
"0000460491"	"0001019497"
"0000460492"	"0001019498"
"0000460493"	"0001019499"
"0000460494"	"0001019500"
"0000460495"	"0001019501"
"0000460496"	"0001019502"
"0000460497"	"0001019503"
"0000460498"	"0001019504"
"0000460499"	"0001019505"
"0000460500"	"0001019506"
"0000460501"	"0001019507"
"0000460502"	"0001019508"
"0000460503"	"0001019509"
"0000460504"	"0001019510"
"0000460505"	"0001019511"
"0000460506"	"0001019512"
"0000460507"	"0001019513"
"0000460508"	"0001019514"
"0000460509"	"0001019515"
"0000460510"	"0001019516"
"0000460511"	"0001019517"
"0000460512"	"0001019518"
"0000460513"	"0001019519"
"0000460514"	"0001019520"
"0000460515"	"0001019521"
"0000460516"	"0001019522"
"0000460517"	"0001019523"
"0000460518"	"0001019524"
"0000460519"	"0001019525"
"0000460520"	"0001019526"
"0000460521"	"0001019527"
"0000460522"	"0001019528"
"0000460523"	"0001019529"
"0000460524"	"0001019530"
"0000460525"	"0001019531"
"0000460526"	"0001019532"
"0000460527"	"0001019533"
"0000460528"	"0001019534"
"0000460529"	"0001019535"
"0000460530"	"0001019536"
"0000460531"	"0001019537"
"0000460532"	"0001019538"
"0000460533"	"0001019539"
"0000460534"	"0001019540"
"0000460535"	"0001019541"
"0000460536"	"0001019542"
"0000460537"	"0001019543"
"0000460538"	"0001019544"
"0000460539"	"0001019545"
"0000460540"	"0001019546"
"0000460541"	"0001019547"
"0000460542"	"0001019548"
"0000460543"	"0001019549"
"0000460544"	"0001019550"
"0000460545"	"0001019551"
"0000460546"	"0001019552"
"0000460547"	"0001019553"
"0000460548"	"0001019554"
"0000460549"	"0001019555"
"0000460550"	"0001019556"
"0000460551"	"0001019557"
"0000460552"	"0001019558"
"0000460553"	"0001019559"
"0000460554"	"0001019560"
"0000460555"	"0001019561"
"0000460556"	"0001019562"
"0000460557"	"0001019563"
"0000460558"	"0001019564"
"0000460559"	"0001019565"
"0000460560"	"0001019566"
"0000460561"	"0001019567"
"0000460562"	"0001019568"
"0000460563"	"0001019569"
"0000460564"	"0001019570"
"0000460565"	"0001019571"
"0000460566"	"0001019572"
"0000460567"	"0001019573"
"0000460568"	"0001019574"
"0000460569"	"0001019575"
"0000460570"	"0001019576"
"0000460571"	"0001019577"
"0000460572"	"0001019578"
"0000460573"	"0001019579"
"0000460574"	"0001019580"
"0000460575"	"0001019581"
"0000460576"	"0001019582"
"0000460577"	"0001019583"
"0000460578"	"0001019584"
"0000460579"	"0001019585"
"0000460580"	"0001019586"
"0000460581"	"0001019587"
"0000460582"	"0001019588"
"0000460583"	"0001019589"
"0000460584"	"0001019590"
"0000460585"	"0001019591"
"0000460586"	"0001019592"
"0000460587"	"0001019593"
"0000460588"	"0001019594"
"0000460589"	"0001019595"
"0000460590"	"0001019596"
"0000460591"	"0001019597"
"0000460592"	"0001019598"
"0000460593"	"0001019599"
"0000460594"	"0001019600"
"0000460595"	"0001019601"
"0000460596"	"0001019602"
"0000460597"	"0001019603"
"0000460598"	"0001019604"
"0000460599"	"0001019605"
"0000460600"	"0001019606"
"0000460601"	"0001019608"
"0000460602"	"0001019609"
"0000460603"	"0001019610"
"0000460605"	"0001019612"
"0000460606"	"0001019613"
"0000460607"	"0001019614"
"0000460608"	"0001019615"
"0000460609"	"0001019616"
"0000460611"	"0001019621"
"0000460612"	"0001019620"
"0000460613"	"0001019622"
"0000460614"	"0001019623"
"0000460615"	"0001019624"
"0000460620"	"0001019631"
"0000460621"	"0001019632"
"0000460637"	"0001019655"
"0000460638"	"0001019657"
"0000460639"	"0001019658"
"0000460640"	"0001019659"
"0000460641"	"0001019660"
"0000460641"	"0001019991"
"0000460642"	"0001019661"
"0000460642"	"0001019992"
"0000460643"	"0001019662"
"0000460644"	"0001019663"
"0000460645"	"0001019664"
"0000460646"	"0001019665"
"0000460647"	"0001019666"
"0000460648"	"0001019667"
"0000460649"	"0001019668"
"0000460650"	"0001019669"
"0000460651"	"0001019670"
"0000460652"	"0001019671"
"0000460653"	"0001019672"
"0000460654"	"0001019673"
"0000460655"	"0001019674"
"0000460656"	"0001019675"
"0000460657"	"0001019676"
"0000460658"	"0001019677"
"0000460659"	"0001019678"
"0000460660"	"0001019679"
"0000460661"	"0001019680"
"0000460662"	"0001019681"
"0000460663"	"0001019682"
"0000460664"	"0001019683"
"0000460665"	"0001019684"
"0000460666"	"0001019685"
"0000460667"	"0001019686"
"0000460668"	"0001019687"
"0000460669"	"0001019688"
"0000460670"	"0001019689"
"0000460671"	"0001019690"
"0000460672"	"0001019691"
"0000460673"	"0001019692"
"0000460674"	"0001019693"
"0000460675"	"0001019694"
"0000460676"	"0001019695"
"0000460677"	"0001019696"
"0000460678"	"0001019697"
"0000460679"	"0001019698"
"0000460680"	"0001019699"
"0000460681"	"0001019700"
"0000460682"	"0001019701"
"0000460683"	"0001019702"
"0000460684"	"0001019703"
"0000460685"	"0001019704"
"0000460686"	"0001019705"
"0000460687"	"0001019706"
"0000460688"	"0001019707"
"0000460689"	"0001019708"
"0000460690"	"0001019709"
"0000460691"	"0001019710"
"0000460692"	"0001019711"
"0000460693"	"0001019712"
"0000460694"	"0001019713"
"0000460695"	"0001019714"
"0000460696"	"0001019715"
"0000460697"	"0001019716"
"0000460698"	"0001019717"
"0000460699"	"0001019718"
"0000460700"	"0001019719"
"0000460701"	"0001019720"
"0000460702"	"0001019721"
"0000460703"	"0001019722"
"0000460704"	"0001019723"
"0000460705"	"0001019724"
"0000460706"	"0001019725"
"0000460707"	"0001019726"
"0000460708"	"0001019727"
"0000460709"	"0001019728"
"0000460710"	"0001019729"
"0000460711"	"0001019730"
"0000460712"	"0001019731"
"0000460713"	"0001019732"
"0000460714"	"0001019733"
"0000460715"	"0001019734"
"0000460716"	"0001019735"
"0000460717"	"0001019736"
"0000460718"	"0001019737"
"0000460719"	"0001019738"
"0000460720"	"0001019739"
"0000460721"	"0001019740"
"0000460722"	"0001019741"
"0000460723"	"0001019742"
"0000460724"	"0001019743"
"0000460725"	"0001019744"
"0000460726"	"0001019745"
"0000460727"	"0001019746"
"0000460728"	"0001019747"
"0000460729"	"0001019748"
"0000460730"	"0001019749"
"0000460731"	"0001019750"
"0000460732"	"0001019751"
"0000460733"	"0001019752"
"0000460734"	"0001019753"
"0000460735"	"0001019754"
"0000460736"	"0001019755"
"0000460737"	"0001019756"
"0000460738"	"0001019757"
"0000460739"	"0001019758"
"0000460740"	"0001019759"
"0000460741"	"0001019760"
"0000460742"	"0001019761"
"0000460743"	"0001019762"
"0000460744"	"0001019763"
"0000460745"	"0001019764"
"0000460746"	"0001019765"
"0000460747"	"0001019766"
"0000460748"	"0001019767"
"0000460749"	"0001019768"
"0000460750"	"0001019769"
"0000460751"	"0001019770"
"0000460752"	"0001019771"
"0000460753"	"0001019772"
"0000460754"	"0001019773"
"0000460755"	"0001019774"
"0000460756"	"0001019775"
"0000460757"	"0001019776"
"0000460758"	"0001019777"
"0000460759"	"0001019778"
"0000460760"	"0001019779"
"0000460761"	"0001019780"
"0000460762"	"0001019781"
"0000460763"	"0001019782"
"0000460764"	"0001019783"
"0000460765"	"0001019784"
"0000460766"	"0001019785"
"0000460767"	"0001019786"
"0000460768"	"0001019787"
"0000460769"	"0001019788"
"0000460770"	"0001019789"
"0000460771"	"0001019790"
"0000460772"	"0001019791"
"0000460773"	"0001019792"
"0000460774"	"0001019793"
"0000460775"	"0001019794"
"0000460776"	"0001019795"
"0000460777"	"0001019796"
"0000460778"	"0001019797"
"0000460779"	"0001019798"
"0000460780"	"0001019799"
"0000460781"	"0001019800"
"0000460782"	"0001019801"
"0000460783"	"0001019802"
"0000460784"	"0001019803"
"0000460785"	"0001019804"
"0000460786"	"0001019805"
"0000460787"	"0001019806"
"0000460788"	"0001019807"
"0000460789"	"0001019808"
"0000460790"	"0001019809"
"0000460791"	"0001019810"
"0000460792"	"0001019811"
"0000460793"	"0001019812"
"0000460794"	"0001019813"
"0000460795"	"0001019814"
"0000460796"	"0001019815"
"0000460797"	"0001019816"
"0000460798"	"0001019817"
"0000460799"	"0001019818"
"0000460800"	"0001019819"
"0000460801"	"0001019820"
"0000460802"	"0001019821"
"0000460803"	"0001019822"
"0000460804"	"0001019823"
"0000460805"	"0001019824"
"0000460806"	"0001019825"
"0000460807"	"0001019826"
"0000460808"	"0001019827"
"0000460809"	"0001019828"
"0000460810"	"0001019829"
"0000460811"	"0001019830"
"0000460812"	"0001019831"
"0000460813"	"0001019832"
"0000460814"	"0001019833"
"0000460815"	"0001019834"
"0000460816"	"0001019835"
"0000460817"	"0001019836"
"0000460818"	"0001019837"
"0000460819"	"0001019838"
"0000460820"	"0001019839"
"0000460821"	"0001019840"
"0000460822"	"0001019841"
"0000460823"	"0001019842"
"0000460824"	"0001019843"
"0000460825"	"0001019844"
"0000460826"	"0001019845"
"0000460827"	"0001019846"
"0000460828"	"0001019847"
"0000460829"	"0001019848"
"0000460830"	"0001019849"
"0000460831"	"0001019850"
"0000460832"	"0001019851"
"0000460833"	"0001019852"
"0000460834"	"0001019853"
"0000460835"	"0001019854"
"0000460836"	"0001019855"
"0000460837"	"0001019856"
"0000460838"	"0001019857"
"0000460839"	"0001019858"
"0000460840"	"0001019859"
"0000460841"	"0001019860"
"0000460842"	"0001019861"
"0000460843"	"0001019862"
"0000460844"	"0001019863"
"0000460845"	"0001019864"
"0000460846"	"0001019865"
"0000460847"	"0001019866"
"0000460848"	"0001019867"
"0000460849"	"0001019868"
"0000460850"	"0001019869"
"0000460851"	"0001019870"
"0000460852"	"0001019871"
"0000460853"	"0001019872"
"0000460854"	"0001019873"
"0000460855"	"0001019874"
"0000460856"	"0001019875"
"0000460857"	"0001019876"
"0000460858"	"0001019877"
"0000460859"	"0001019878"
"0000460860"	"0001019879"
"0000460861"	"0001019880"
"0000460862"	"0001019881"
"0000460863"	"0001019882"
"0000460864"	"0001019883"
"0000460865"	"0001019884"
"0000460866"	"0001019885"
"0000460867"	"0001019886"
"0000460868"	"0001019887"
"0000460869"	"0001019888"
"0000460870"	"0001019889"
"0000460871"	"0001019890"
"0000460872"	"0001019891"
"0000460873"	"0001019892"
"0000460874"	"0001019893"
"0000460875"	"0001019894"
"0000460876"	"0001019895"
"0000460877"	"0001019896"
"0000460878"	"0001019897"
"0000460879"	"0001019898"
"0000460880"	"0001019899"
"0000460881"	"0001019900"
"0000460882"	"0001019901"
"0000460883"	"0001019902"
"0000460884"	"0001019903"
"0000460885"	"0001019904"
"0000460886"	"0001019905"
"0000460887"	"0001019906"
"0000460888"	"0001019907"
"0000460889"	"0001019908"
"0000460890"	"0001019909"
"0000460891"	"0001019910"
"0000460892"	"0001019911"
"0000460893"	"0001019912"
"0000460894"	"0001019913"
"0000460895"	"0001019914"
"0000460896"	"0001019915"
"0000460897"	"0001019916"
"0000460898"	"0001019917"
"0000460899"	"0001019918"
"0000460900"	"0001019919"
"0000460901"	"0001019920"
"0000460902"	"0001019921"
"0000460903"	"0001019922"
"0000460904"	"0001019923"
"0000460905"	"0001019924"
"0000460906"	"0001019925"
"0000460907"	"0001019926"
"0000460908"	"0001019927"
"0000460909"	"0001019928"
"0000460910"	"0001019929"
"0000460911"	"0001019930"
"0000460912"	"0001019931"
"0000460913"	"0001019932"
"0000460914"	"0001019933"
"0000460915"	"0001019934"
"0000460916"	"0001019935"
"0000460917"	"0001019936"
"0000460918"	"0001019937"
"0000460919"	"0001019938"
"0000460920"	"0001019939"
"0000460921"	"0001019940"
"0000460922"	"0001019941"
"0000460923"	"0001019942"
"0000460924"	"0001019943"
"0000460925"	"0001019944"
"0000460926"	"0001019945"
"0000460927"	"0001019946"
"0000460928"	"0001019947"
"0000460929"	"0001019948"
"0000460930"	"0001019949"
"0000460931"	"0001019950"
"0000460932"	"0001019951"
"0000460933"	"0001019952"
"0000460934"	"0001019953"
"0000460935"	"0001019954"
"0000460936"	"0001019955"
"0000460937"	"0001019956"
"0000460938"	"0001019957"
"0000460939"	"0001019958"
"0000460940"	"0001019959"
"0000460941"	"0001019960"
"0000460942"	"0001019961"
"0000460943"	"0001019962"
"0000460944"	"0001019963"
"0000460945"	"0001019964"
"0000460946"	"0001019965"
"0000460947"	"0001019966"
"0000460948"	"0001019967"
"0000460949"	"0001019968"
"0000460950"	"0001019969"
"0000460951"	"0001019970"
"0000460952"	"0001019971"
"0000460953"	"0001019972"
"0000460954"	"0001019973"
"0000460955"	"0001019974"
"0000460956"	"0001019975"
"0000460957"	"0001019976"
"0000460958"	"0001019977"
"0000460959"	"0001019978"
"0000460960"	"0001019979"
"0000460961"	"0001019980"
"0000460962"	"0001019981"
"0000460963"	"0001019982"
"0000460964"	"0001019983"
"0000460965"	"0001019984"
"0000460966"	"0001019985"
"0000460967"	"0001019986"
"0000460968"	"0001019987"
"0000460969"	"0001019988"
"0000460970"	"0001019989"
"0000460971"	"0001019990"
"0000460972"	"0001019993"
"0000460974"	"0001019996"
"0000460975"	"0001020004"
"0000460976"	"0001020005"
"0000460977"	"0001020006"
"0000460978"	"0001020007"
"0000460979"	"0001020008"
"0000460980"	"0001020009"
"0000460981"	"0001020010"
"0000460982"	"0001020011"
"0000460983"	"0001020012"
"0000460984"	"0001020013"
"0000460985"	"0001020014"
"0000460986"	"0001020015"
"0000460987"	"0001020016"
"0000460992"	"0001020030"
"0000460993"	"0001020031"
"0000460994"	"0001020032"
"0000460995"	"0001020033"
"0000460996"	"0001020034"
"0000460997"	"0001020035"
"0000460998"	"0001020036"
"0000460999"	"0001020037"
"0000461000"	"0001020038"
"0000461001"	"0001020039"
"0000461002"	"0001020040"
"0000461003"	"0001020041"
"0000461004"	"0001020042"
"0000461005"	"0001020043"
"0000461006"	"0001020044"
"0000461007"	"0001020045"
"0000461008"	"0001020046"
"0000461009"	"0001020047"
"0000461010"	"0001020048"
"0000461011"	"0001020049"
"0000461012"	"0001020050"
"0000461013"	"0001020051"
"0000461014"	"0001020052"
"0000461015"	"0001020053"
"0000461016"	"0001020054"
"0000461017"	"0001020055"
"0000461018"	"0001020056"
"0000461019"	"0001020057"
"0000461020"	"0001020058"
"0000461021"	"0001020059"
"0000461025"	"0001020065"
"0000461026"	"0001020067"
"0000461050"	"0001020141"
"0000461169"	"0001020301"
"0000462716"	"0001022267"
"0000462722"	"0001022273"
"0000462731"	"0001022282"
"0000462766"	"0001022317"