### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = RUNX2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "RUNX2" "runt-related transcription factor 2" "6" "p21" "unknown" "NG_008020.1" "UD_132118380459" "" "http://www.LOVD.nl/RUNX2" "" "1" "10472" "860" "600211" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/RUNX2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-08-25 12:21:53" "00006" "2025-11-13 13:04:16" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024159" "RUNX2" "transcript variant 1" "001" "NM_001024630.3" "" "NP_001019801.3" "" "" "" "-210" "5343" "1566" "45296054" "45518819" "00006" "2016-08-25 12:20:41" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01253" "CCD" "dysplasia, cleidocranial (CCD)" "AD" "119600" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01437" "MDMHB" "dysplasia, metaphyseal, with maxillary hypoplasia and brachydactyly (MDMHB)" "AD" "156510" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "RUNX2" "01253" "RUNX2" "01437" ## Individuals ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00079877" "" "" "" "1" "" "01741" "" "" "" "" "Germany" "" "0" "" "" "" "" "00117409" "" "" "" "1" "" "01914" "" "" "" "" "Argentina" "" "0" "" "" "Latin American" "?" "00132208" "" "" "" "1" "" "01741" "" "" "" "" "Germany" "" "0" "" "" "" "" "00163991" "" "" "" "1" "" "01741" "" "" "" "" "" "" "0" "" "" "" "" "00219179" "" "" "" "1" "" "01807" "" "" "?" "" "" "" "0" "" "" "" "" "00229652" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00294123" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00359447" "" "" "" "1" "" "01709" "" "" "" "" "(Brazil)" "" "0" "" "" "" "" "00359448" "" "" "" "1" "" "01709" "" "" "" "" "(Brazil)" "" "0" "" "" "" "" "00359453" "" "" "" "1" "" "01709" "" "" "" "" "(Brazil)" "" "0" "" "" "" "" "00455332" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00469301" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 12 "{{individualid}}" "{{diseaseid}}" "00079877" "01253" "00117409" "01253" "00132208" "01253" "00163991" "01253" "00219179" "00198" "00229652" "00198" "00294123" "00198" "00359447" "01253" "00359448" "01253" "00359453" "01253" "00455332" "00198" "00469301" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01253, 01437 ## Count = 9 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000059595" "01253" "00079877" "01741" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000092644" "01253" "00117409" "01914" "Isolated (sporadic)" "" "cleidocranial dysplasia" "" "" "" "" "" "" "" "" "" "" "" "0000167727" "00198" "00219179" "01807" "Unknown" "" "HP:0002652 (Skeletal dysplasia)" "" "" "" "" "" "" "" "" "" "" "" "0000172877" "00198" "00229652" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Short stature (HP:0004322)" "" "" "" "" "" "" "" "" "" "" "" "0000254688" "01253" "00359447" "01709" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cleidocranial dysplasia" "" "0000254689" "01253" "00359448" "01709" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cleidocranial dysplasia" "" "0000254694" "01253" "00359453" "01709" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cleidocranial dysplasia" "" "0000343908" "00198" "00455332" "03544" "Isolated (sporadic)" "" "HP:0006660, HP:0004322, HP:0000164, HP:0011069, HP:0002007, HP:0000670, HP:0002650, HP:0005773, HP:0005736, HP:0000316, HP:0000248, HP:0001591" "" "" "" "" "" "" "" "" "CLCD" "cleidocranial dysostosis" "" "0000354454" "00198" "00469301" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the skeletal system" "" ## Screenings ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000079959" "00079877" "1" "01741" "01741" "2016-08-25 11:04:33" "" "" "SEQ" "DNA" "" "" "0000117874" "00117409" "1" "01914" "01914" "2017-07-15 19:06:54" "" "" "SEQ" "DNA" "" "" "0000133045" "00132208" "1" "01741" "01741" "2017-10-24 12:19:32" "" "" "SEQ" "DNA" "" "" "0000164857" "00163991" "1" "01741" "01741" "2018-05-03 14:57:45" "" "" "SEQ" "DNA" "" "" "0000220252" "00219179" "1" "01807" "01807" "2019-02-07 14:50:14" "" "" "SEQ" "DNA" "" "" "0000230745" "00229652" "1" "01807" "01807" "2019-04-08 10:01:32" "" "" "SEQ" "DNA" "" "" "0000295291" "00294123" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000360677" "00359447" "1" "01709" "00006" "2021-03-22 12:01:49" "" "" "SEQ" "DNA" "" "" "0000360678" "00359448" "1" "01709" "00006" "2021-03-22 12:01:49" "" "" "SEQ" "DNA" "" "" "0000360683" "00359453" "1" "01709" "00006" "2021-03-22 12:01:49" "" "" "SEQ" "DNA" "" "" "0000456946" "00455332" "1" "03544" "03544" "2024-10-07 11:46:39" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000470969" "00469301" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 4 "{{screeningid}}" "{{geneid}}" "0000079959" "RUNX2" "0000117874" "RUNX2" "0000133045" "RUNX2" "0000164857" "RUNX2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 65 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000128835" "0" "50" "6" "45480019" "45480019" "subst" "0" "01741" "RUNX2_000001" "g.45480019A>G" "" "" "" "NM_004348.3:c.854A>G (Tyr285Cys)" "" "Germline" "" "" "0" "" "" "g.45512282A>G" "" "VUS" "" "0000193822" "1" "90" "6" "45390671" "45390671" "subst" "0" "01914" "RUNX2_000002" "g.45390671A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.45422934A>G" "" "pathogenic" "" "0000222243" "0" "90" "6" "45514740" "45514740" "del" "0" "01741" "RUNX2_000003" "g.45514740del" "" "" "" "1264delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.45547003del" "" "pathogenic" "" "0000252430" "0" "70" "6" "45390617" "45390617" "subst" "0" "02326" "RUNX2_000006" "g.45390617A>G" "" "" "" "RUNX2(NM_001024630.4):c.346A>G (p.T116A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45422880A>G" "" "likely pathogenic" "" "0000301523" "0" "30" "6" "45480190" "45480190" "subst" "0.0989675" "02326" "RUNX2_000009" "g.45480190G>A" "" "" "" "RUNX2(NM_001024630.4):c.1021+46G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45512453G>A" "" "likely benign" "" "0000301524" "0" "10" "6" "45513036" "45513036" "subst" "0.00141358" "02326" "RUNX2_000010" "g.45513036T>C" "" "" "" "RUNX2(NM_001024630.4):c.1087+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45545299T>C" "" "benign" "" "0000301525" "0" "10" "6" "45390511" "45390511" "subst" "0" "02326" "RUNX2_000005" "g.45390511G>A" "" "" "" "RUNX2(NM_001024630.4):c.240G>A (p.A80=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45422774G>A" "" "benign" "" "0000301526" "0" "10" "6" "45390514" "45390531" "del" "0" "02326" "RUNX2_000004" "g.45390514_45390531del" "" "" "" "RUNX2(NM_001015051.3):c.216_233del (p.(Ala84_Ala89del)), RUNX2(NM_001024630.4):c.243_260delGGCGGCTGCGGCGGCGGC (p.A84_A89del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45422777_45422794del" "" "benign" "" "0000301527" "0" "90" "6" "45390639" "45390639" "subst" "0" "02326" "RUNX2_000007" "g.45390639G>A" "" "" "" "RUNX2(NM_001024630.4):c.368G>A (p.C123Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45422902G>A" "" "pathogenic" "" "0000301528" "0" "90" "6" "45405777" "45405777" "subst" "0" "02326" "RUNX2_000008" "g.45405777G>A" "" "" "" "RUNX2(NM_001024630.4):c.674G>A (p.R225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45438040G>A" "" "pathogenic" "" "0000314231" "0" "50" "6" "45296618" "45296618" "subst" "0" "02326" "SUPT3H_000001" "g.45296618T>C" "" "" "" "SUPT3H(NM_181356.3):c.-51-5914A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45328881T>C" "" "VUS" "" "0000368469" "0" "90" "6" "45399599" "45399757" "del" "0" "01741" "RUNX2_000012" "g.(45390695_45399599)_(45399757_45405683)del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "" "0000455205" "0" "90" "6" "45514684" "45514684" "dup" "0" "01807" "RUNX2_000013" "g.45514684dup" "" "" "" "1208dupC" "" "Unknown" "" "" "0" "" "" "g.45546947dup" "" "pathogenic" "" "0000472363" "0" "50" "6" "45514833" "45514833" "subst" "0" "01807" "RUNX2_000014" "g.45514833T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.45547096T>C" "" "VUS" "" "0000528978" "0" "30" "6" "45390445" "45390477" "del" "0" "01804" "SUPT3H_000002" "g.45390445_45390477del" "" "" "" "RUNX2(NM_001015051.3):c.163_195del (p.(Gln61_Gln71del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45422708_45422740del" "" "likely benign" "" "0000528979" "0" "30" "6" "45390514" "45390531" "del" "0" "01804" "RUNX2_000004" "g.45390514_45390531del" "" "" "" "RUNX2(NM_001015051.3):c.216_233del (p.(Ala84_Ala89del)), RUNX2(NM_001024630.4):c.243_260delGGCGGCTGCGGCGGCGGC (p.A84_A89del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45422777_45422794del" "" "likely benign" "" "0000528981" "0" "10" "6" "45390733" "45390733" "subst" "0.102238" "02326" "SUPT3H_000004" "g.45390733G>C" "" "" "" "RUNX2(NM_001024630.4):c.423+39G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45422996G>C" "" "benign" "" "0000528982" "0" "90" "6" "45405728" "45405728" "subst" "0" "02327" "SUPT3H_000005" "g.45405728C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45437991C>T" "" "pathogenic" "" "0000528983" "0" "70" "6" "45514563" "45514563" "subst" "0" "02327" "SUPT3H_000006" "g.45514563G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45546826G>A" "" "likely pathogenic" "" "0000528984" "0" "50" "6" "45514937" "45514937" "subst" "0" "01943" "SUPT3H_000007" "g.45514937G>T" "" "" "" "RUNX2(NM_001024630.3):c.1461G>T (p.L487F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45547200G>T" "" "VUS" "" "0000528985" "0" "30" "6" "45515007" "45515007" "subst" "0.00781091" "01804" "SUPT3H_000008" "g.45515007G>A" "" "" "" "RUNX2(NM_001015051.3):c.1465G>A (p.(Gly489Ser)), RUNX2(NM_001024630.4):c.1531G>A (p.G511S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45547270G>A" "" "likely benign" "" "0000621714" "0" "50" "6" "45459856" "45459856" "subst" "0" "02325" "SUPT3H_000009" "g.45459856G>A" "" "" "" "RUNX2(NM_001024630.4):c.859+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45492119G>A" "" "VUS" "" "0000651980" "1" "30" "6" "45515007" "45515007" "subst" "0.00781091" "03575" "SUPT3H_000008" "g.45515007G>A" "8/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "8 heterozygous, no homozygous; {DB:CLININrs11498198}" "Germline" "" "rs11498198" "0" "" "" "g.45547270G>A" "" "likely benign" "" "0000677791" "0" "30" "6" "45390463" "45390465" "del" "0" "02330" "SUPT3H_000010" "g.45390463_45390465del" "" "" "" "RUNX2(NM_001024630.3):c.192_194delGCA (p.Q71del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720962" "0" "90" "6" "45405776" "45405776" "subst" "0" "01943" "SUPT3H_000011" "g.45405776C>T" "" "" "" "RUNX2(NM_001024630.3):c.673C>T (p.R225W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000760751" "0" "50" "6" "45405759" "45405759" "subst" "0" "01709" "RUNX2_000016" "g.45405759T>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000760752" "0" "50" "6" "45459739" "45459739" "del" "0" "01709" "RUNX2_000017" "g.45459739del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.45492002del" "" "pathogenic (dominant)" "ACMG" "0000760757" "0" "50" "6" "45399682" "45399682" "subst" "0" "01709" "RUNX2_000015" "g.45399682G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000802621" "0" "90" "6" "45405777" "45405777" "subst" "0" "02327" "RUNX2_000008" "g.45405777G>A" "" "" "" "RUNX2(NM_001024630.4):c.674G>A (p.R225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000802622" "0" "70" "6" "45459851" "45459851" "subst" "0" "02327" "SUPT3H_000012" "g.45459851G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000860363" "0" "90" "6" "45405790" "45405790" "subst" "0" "01804" "SUPT3H_000013" "g.45405790T>A" "" "" "" "RUNX2(NM_001024630.3):c.685+2T>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860364" "0" "30" "6" "45480055" "45480055" "subst" "8.94033E-5" "02325" "SUPT3H_000014" "g.45480055C>T" "" "" "" "RUNX2(NM_001024630.4):c.932C>T (p.T311M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860365" "0" "90" "6" "45514647" "45514647" "subst" "0" "01943" "SUPT3H_000015" "g.45514647C>T" "" "" "" "RUNX2(NM_001024630.3):c.1171C>T (p.R391*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000887271" "0" "50" "6" "45390430" "45390441" "del" "0" "01804" "SUPT3H_000016" "g.45390430_45390441del" "" "" "" "RUNX2(NM_001015051.3):c.144_155del (p.(Gln68_Gln71del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887272" "0" "90" "6" "45399754" "45399754" "subst" "0" "02327" "SUPT3H_000017" "g.45399754G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000887273" "0" "30" "6" "45405675" "45405675" "subst" "0.000121891" "02325" "SUPT3H_000018" "g.45405675T>C" "" "" "" "RUNX2(NM_001024630.4):c.581-9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887274" "0" "90" "6" "45405762" "45405762" "subst" "0" "02325" "SUPT3H_000019" "g.45405762C>T" "" "" "" "RUNX2(NM_001024630.4):c.659C>T (p.T220I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000920219" "0" "90" "6" "45399744" "45399744" "subst" "0" "03779" "RUNX2_000018" "g.45399744C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000924520" "0" "30" "6" "45390464" "45390484" "del" "0" "02325" "SUPT3H_000020" "g.45390464_45390484del" "" "" "" "RUNX2(NM_001024630.4):c.193_213delCAACAGCAGCAGCAGCAGCAG (p.Q65_Q71del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924521" "0" "90" "6" "45390590" "45390591" "del" "0" "02329" "SUPT3H_000021" "g.45390590_45390591del" "" "" "" "RUNX2(NM_001369405.1):c.277_278delGC (p.A93Rfs*53)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924522" "0" "30" "6" "45515007" "45515007" "subst" "0.00781091" "02325" "SUPT3H_000008" "g.45515007G>A" "" "" "" "RUNX2(NM_001015051.3):c.1465G>A (p.(Gly489Ser)), RUNX2(NM_001024630.4):c.1531G>A (p.G511S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929199" "0" "90" "6" "45399736" "45399736" "subst" "0" "02327" "SUPT3H_000022" "g.45399736T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000953999" "0" "50" "6" "45514735" "45514735" "subst" "0" "03779" "RUNX2_000019" "g.45514735C>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000964161" "0" "90" "6" "45399612" "45399612" "subst" "4.06085E-6" "02327" "SUPT3H_000023" "g.45399612G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977268" "0" "30" "6" "45390460" "45390465" "dup" "0" "01804" "SUPT3H_000024" "g.45390460_45390465dup" "" "" "" "RUNX2(NM_001024630.4):c.189_194dup (p.(Gln70_Gln71dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977269" "0" "50" "6" "45390514" "45390519" "dup" "0" "01804" "SUPT3H_000025" "g.45390514_45390519dup" "" "" "" "RUNX2(NM_001024630.4):c.243_248dup (p.(Ala88_Ala89dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977270" "0" "50" "6" "45390520" "45390531" "dup" "0" "01804" "SUPT3H_000026" "g.45390520_45390531dup" "" "" "" "RUNX2(NM_001024630.4):c.249_260dup (p.(Ala86_Ala89dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977271" "0" "50" "6" "45514663" "45514663" "subst" "0" "01804" "SUPT3H_000027" "g.45514663C>A" "" "" "" "RUNX2(NM_001024630.4):c.1187C>A (p.(Ala396Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000986973" "0" "50" "6" "45514735" "45514735" "subst" "0" "03779" "RUNX2_000019" "g.45514735C>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000995794" "0" "30" "6" "45390442" "45390442" "subst" "0" "01804" "SUPT3H_000028" "g.45390442G>T" "" "" "" "RUNX2(NM_001024630.3):c.171G>T (p.(Gln57His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995795" "0" "30" "6" "45390443" "45390443" "subst" "0" "01804" "SUPT3H_000029" "g.45390443C>G" "" "" "" "RUNX2(NM_001024630.3):c.172C>G (p.(Gln58Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995796" "0" "30" "6" "45512996" "45512996" "subst" "0" "01804" "SUPT3H_000030" "g.45512996C>T" "" "" "" "RUNX2(NM_001024630.3):c.1064C>T (p.(Thr355Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995797" "0" "50" "6" "45514903" "45514903" "subst" "8.15089E-6" "01804" "SUPT3H_000031" "g.45514903C>T" "" "" "" "RUNX2(NM_001024630.3):c.1427C>T (p.(Thr476Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995798" "0" "50" "6" "45514947" "45514947" "subst" "0" "01804" "SUPT3H_000032" "g.45514947A>G" "" "" "" "RUNX2(NM_001024630.3):c.1471A>G (p.(Asn491Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001011375" "0" "70" "6" "45399612" "45399612" "subst" "0" "03544" "RUNX2_000020" "g.45399612G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.45431875G>T" "{CV:3362884}" "pathogenic" "ACMG" "0001035806" "0" "30" "6" "45390445" "45390456" "dup" "0" "02325" "SUPT3H_000033" "g.45390445_45390456dup" "" "" "" "RUNX2(NM_001024630.4):c.174_185dupACAGCAGCAGCA (p.Q68_Q71dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035807" "0" "30" "6" "45390464" "45390484" "dup" "0" "01804" "SUPT3H_000034" "g.45390464_45390484dup" "" "" "" "RUNX2(NM_001024630.4):c.193_213dup (p.(Gln65_Gln71dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035808" "0" "50" "6" "45514650" "45514650" "subst" "0" "01804" "SUPT3H_000035" "g.45514650A>T" "" "" "" "RUNX2(NM_001024630.4):c.1174A>T (p.(Met392Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046066" "0" "30" "6" "45480010" "45480010" "subst" "0.000166642" "02325" "SUPT3H_000036" "g.45480010C>T" "" "" "" "RUNX2(NM_001024630.4):c.887C>T (p.P296L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001052377" "0" "50" "6" "45390332" "45390332" "subst" "0" "01804" "SUPT3H_000037" "g.45390332C>A" "" "" "" "RUNX2(NM_001024630.4):c.61C>A (p.(Pro21Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052378" "0" "50" "6" "45399699" "45399699" "subst" "0.000117792" "01804" "SUPT3H_000038" "g.45399699A>G" "" "" "" "RUNX2(NM_001024630.4):c.523A>G (p.(Met175Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052379" "0" "30" "6" "45459791" "45459791" "subst" "2.03107E-5" "01804" "SUPT3H_000039" "g.45459791C>T" "" "" "" "RUNX2(NM_001024630.4):c.799C>T (p.(Arg267Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001052380" "0" "50" "6" "45480000" "45480000" "subst" "0" "01804" "SUPT3H_000040" "g.45480000T>C" "" "" "" "RUNX2(NM_001024630.4):c.877T>C (p.(Ser293Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052381" "0" "50" "6" "45480125" "45480125" "subst" "0" "01804" "SUPT3H_000041" "g.45480125T>A" "" "" "" "RUNX2(NM_001024630.4):c.1002T>A (p.(Asp334Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059091" "0" "90" "6" "45399753" "45399753" "subst" "0" "00006" "chr6_008336" "g.45399753C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.45432016C>T" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes RUNX2 ## Count = 65 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000128835" "00024159" "50" "896" "0" "896" "0" "c.896A>G" "r.(?)" "p.(Tyr299Cys)" "7" "0000193822" "00024159" "90" "400" "0" "400" "0" "c.400A>G" "r.(?)" "p.(Lys134Glu)" "3" "0000222243" "00024159" "90" "1264" "0" "1264" "0" "c.1264del" "r.(?)" "p.(Leu422Cysfs*62)" "" "0000252430" "00024159" "70" "346" "0" "346" "0" "c.346A>G" "r.(?)" "p.(Thr116Ala)" "" "0000301523" "00024159" "30" "1021" "46" "1021" "46" "c.1021+46G>A" "r.(=)" "p.(=)" "" "0000301524" "00024159" "10" "1087" "17" "1087" "17" "c.1087+17T>C" "r.(=)" "p.(=)" "" "0000301525" "00024159" "10" "240" "0" "240" "0" "c.240G>A" "r.(?)" "p.(Ala80=)" "" "0000301526" "00024159" "10" "243" "0" "260" "0" "c.243_260del" "r.(?)" "p.(Ala84_Ala89del)" "" "0000301527" "00024159" "90" "368" "0" "368" "0" "c.368G>A" "r.(?)" "p.(Cys123Tyr)" "" "0000301528" "00024159" "90" "674" "0" "674" "0" "c.674G>A" "r.(?)" "p.(Arg225Gln)" "" "0000314231" "00024159" "50" "58" "97" "58" "97" "c.58+97T>C" "r.(=)" "p.(=)" "" "0000368469" "00024159" "90" "424" "-1" "580" "1" "c.(423+1_424-1)_(580+1_581-1)del" "r.?" "p.?" "3i_4i" "0000455205" "00024159" "90" "1208" "0" "1208" "0" "c.1208dup" "r.(?)" "p.(Val404Serfs*86)" "" "0000472363" "00024159" "50" "1357" "0" "1357" "0" "c.1357T>C" "r.(?)" "p.(Ser453Pro)" "" "0000528978" "00024159" "30" "174" "0" "206" "0" "c.174_206del" "r.(?)" "p.(Gln61_Gln71del)" "" "0000528979" "00024159" "30" "243" "0" "260" "0" "c.243_260del" "r.(?)" "p.(Ala84_Ala89del)" "" "0000528981" "00024159" "10" "423" "39" "423" "39" "c.423+39G>C" "r.(=)" "p.(=)" "" "0000528982" "00024159" "90" "625" "0" "625" "0" "c.625C>T" "r.(?)" "p.(Gln209Ter)" "" "0000528983" "00024159" "70" "1088" "-1" "1088" "-1" "c.1088-1G>A" "r.spl?" "p.?" "" "0000528984" "00024159" "50" "1461" "0" "1461" "0" "c.1461G>T" "r.(?)" "p.(Leu487Phe)" "" "0000528985" "00024159" "30" "1531" "0" "1531" "0" "c.1531G>A" "r.(?)" "p.(Gly511Ser)" "" "0000621714" "00024159" "50" "859" "5" "859" "5" "c.859+5G>A" "r.spl?" "p.?" "" "0000651980" "00024159" "30" "1531" "0" "1531" "0" "c.1531G>A" "r.(?)" "p.(Gly511Ser)" "" "0000677791" "00024159" "30" "192" "0" "194" "0" "c.192_194del" "r.(?)" "p.(Gln71del)" "" "0000720962" "00024159" "90" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Arg225Trp)" "" "0000760751" "00024159" "50" "656" "0" "656" "0" "c.656T>A" "r.(?)" "p.(Val219Asp)" "" "0000760752" "00024159" "50" "747" "0" "747" "0" "c.747del" "r.(?)" "p.(Arg251Alafs*7)" "" "0000760757" "00024159" "50" "506" "0" "506" "0" "c.506G>C" "r.(?)" "p.(Arg169Pro)" "" "0000802621" "00024159" "90" "674" "0" "674" "0" "c.674G>A" "r.(?)" "p.(Arg225Gln)" "" "0000802622" "00024159" "70" "859" "0" "859" "0" "c.859G>A" "r.(?)" "p.(Asp287Asn)" "" "0000860363" "00024159" "90" "685" "2" "685" "2" "c.685+2T>A" "r.spl?" "p.?" "" "0000860364" "00024159" "30" "932" "0" "932" "0" "c.932C>T" "r.(?)" "p.(Thr311Met)" "" "0000860365" "00024159" "90" "1171" "0" "1171" "0" "c.1171C>T" "r.(?)" "p.(Arg391*)" "" "0000887271" "00024159" "50" "159" "0" "170" "0" "c.159_170del" "r.(?)" "p.(Gln68_Gln71del)" "" "0000887272" "00024159" "90" "578" "0" "578" "0" "c.578G>A" "r.(?)" "p.(Arg193Gln)" "" "0000887273" "00024159" "30" "581" "-9" "581" "-9" "c.581-9T>C" "r.(=)" "p.(=)" "" "0000887274" "00024159" "90" "659" "0" "659" "0" "c.659C>T" "r.(?)" "p.(Thr220Ile)" "" "0000920219" "00024159" "90" "568" "0" "568" "0" "c.568C>T" "r.(?)" "p.(Arg190Trp)" "" "0000924520" "00024159" "30" "193" "0" "213" "0" "c.193_213del" "r.(?)" "p.(Gln65_Gln71del)" "" "0000924521" "00024159" "90" "319" "0" "320" "0" "c.319_320del" "r.(?)" "p.(Ala107Argfs*53)" "" "0000924522" "00024159" "30" "1531" "0" "1531" "0" "c.1531G>A" "r.(?)" "p.(Gly511Ser)" "" "0000929199" "00024159" "90" "560" "0" "560" "0" "c.560T>C" "r.(?)" "p.(Phe187Ser)" "" "0000953999" "00024159" "50" "1259" "0" "1259" "0" "c.1259C>T" "r.(?)" "p.(Thr420Ile)" "" "0000964161" "00024159" "90" "436" "0" "436" "0" "c.436G>A" "r.(?)" "p.(Gly146Arg)" "" "0000977268" "00024159" "30" "189" "0" "194" "0" "c.189_194dup" "r.(?)" "p.(Gln70_Gln71dup)" "" "0000977269" "00024159" "50" "243" "0" "248" "0" "c.243_248dup" "r.(?)" "p.(Ala88_Ala89dup)" "" "0000977270" "00024159" "50" "249" "0" "260" "0" "c.249_260dup" "r.(?)" "p.(Ala86_Ala89dup)" "" "0000977271" "00024159" "50" "1187" "0" "1187" "0" "c.1187C>A" "r.(?)" "p.(Ala396Asp)" "" "0000986973" "00024159" "50" "1259" "0" "1259" "0" "c.1259C>T" "r.(?)" "p.(Thr420Ile)" "" "0000995794" "00024159" "30" "171" "0" "171" "0" "c.171G>T" "r.(?)" "p.(Gln57His)" "" "0000995795" "00024159" "30" "172" "0" "172" "0" "c.172C>G" "r.(?)" "p.(Gln58Glu)" "" "0000995796" "00024159" "30" "1064" "0" "1064" "0" "c.1064C>T" "r.(?)" "p.(Thr355Ile)" "" "0000995797" "00024159" "50" "1427" "0" "1427" "0" "c.1427C>T" "r.(?)" "p.(Thr476Ile)" "" "0000995798" "00024159" "50" "1471" "0" "1471" "0" "c.1471A>G" "r.(?)" "p.(Asn491Asp)" "" "0001011375" "00024159" "70" "436" "0" "436" "0" "c.436G>T" "r.(?)" "p.(Gly146*)" "4" "0001035806" "00024159" "30" "174" "0" "185" "0" "c.174_185dup" "r.(?)" "p.(Gln68_Gln71dup)" "" "0001035807" "00024159" "30" "193" "0" "213" "0" "c.193_213dup" "r.(?)" "p.(Gln65_Gln71dup)" "" "0001035808" "00024159" "50" "1174" "0" "1174" "0" "c.1174A>T" "r.(?)" "p.(Met392Leu)" "" "0001046066" "00024159" "30" "887" "0" "887" "0" "c.887C>T" "r.(?)" "p.(Pro296Leu)" "" "0001052377" "00024159" "50" "61" "0" "61" "0" "c.61C>A" "r.(?)" "p.(Pro21Thr)" "" "0001052378" "00024159" "50" "523" "0" "523" "0" "c.523A>G" "r.(?)" "p.(Met175Val)" "" "0001052379" "00024159" "30" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Trp)" "" "0001052380" "00024159" "50" "877" "0" "877" "0" "c.877T>C" "r.(?)" "p.(Ser293Pro)" "" "0001052381" "00024159" "50" "1002" "0" "1002" "0" "c.1002T>A" "r.(?)" "p.(Asp334Glu)" "" "0001059091" "00024159" "90" "577" "0" "577" "0" "c.577C>T" "r.(?)" "p.(Arg193Ter)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 12 "{{screeningid}}" "{{variantid}}" "0000079959" "0000128835" "0000117874" "0000193822" "0000133045" "0000222243" "0000164857" "0000368469" "0000220252" "0000455205" "0000230745" "0000472363" "0000295291" "0000651980" "0000360677" "0000760751" "0000360678" "0000760752" "0000360683" "0000760757" "0000456946" "0001011375" "0000470969" "0001059091"